article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
blunt abdominal trauma is a critical and deceptive situation, and it causes a variety of signs and symptoms, ranging from insignificant symptoms to severe shock, leading to higher risk of mortality because of the difficulty in diagnosing the damage to intra - peritoneal organs (1). since the mental status of patients who have undergone trauma usually is affected, physical findings are often unreliable. diagnostic peritoneal lavage (dpl), which is an invasive procedure, provides information about the presence or absence of peritoneal fluid, but it lacks specificity and does not provide information about any possible injuries to the intra - abdominal organs (2). it is essential for emergency physicians to determine who should approach a blunt abdominal trauma, and they must rely on physical examination or performing diagnostic procedures, such as fast ultrasonography, diagnostic peritoneal lavage (dpl), or computed tomography (ct) to determine which patients require any therapeutic intervention. although dpl is very sensitive in identifying hemoperitoneum and is still a useful tool to exclude hollow organ perforations that may be undetected by ct, recent advances in imaging diagnostic procedures have reduced its usage (3). contrast abdominal ct is considered the gold standard, but there are limitations, such as high cost, being time - consuming, need to transfer the patient out of the emergency department, and exposure to radiation, that make it the last choice in low - risk patients. in most of the centers, fast ultrasonography is the primary procedure for blunt abdominal trauma to determine whether intra - peritoneal free fluid is present. it can be performed rapidly and conducted in the resuscitation room in the ed. fast us has excellent sensitivity and specificity for hemoperitoneum (4, 5), but intra - abdominal injuries that require laparotomy can not be excluded in the case of negative fast reports (6). in this prospective study, we evaluated the fast scans performed by emergency residents to determine whether they were reliable compared to radiologists and abdominal ct scans. this prospective study was performed from february 2011 to january 2012 at 7 tir hospital, which is affiliated with the iran university of medical sciences (iums) in tehran, iran. during the study period, 120 patients with blunt abdominal trauma were evaluated for abdominal fluid. fast sonography was performed for all the patients by emergency residents and radiologists who were blind to the other tests. all ultrasound evaluations were performed using the fast technique during the primary survey of advanced trauma life support (atls) guidelines. third - year emergency residents, with at least eight hours in the bedside training program, including instructions and practical sessions before study, were responsible for performing the fast exams. the exams were repeated by radiology residents (pg-2) who were blind to the prior results. the sonositetm180, handheld system was used for the tests. a curvilinear probe (24 mhz) was used. positive findings included the presence of abdominal fluid in any of the abdomino - pelvic spaces. abdominal ct with iv and oral contrast as the gold standard were done for all of the patients. the results and other necessary demographic and physical exam data were recorded by the researcher. since some patients had been transferred directly to the operating room and underwent laparotomies without performing abdominal ct scans, we used a combination of laparotomy (if performed) and abdominal ct scan as our gold standards. asymptomatic patients with normal physical exams along with normal fast reports and 24 hours of ed observation also were accepted as correct fast results. ct scans were performed within four hours of the patient s arrival at the ed. sensitivity, specificity, and the positive and negative predictive values of fast were calculated by the emergency or radiology residents. this prospective study was performed from february 2011 to january 2012 at 7 tir hospital, which is affiliated with the iran university of medical sciences (iums) in tehran, iran. during the study period, 120 patients with blunt abdominal trauma were evaluated for abdominal fluid. fast sonography was performed for all the patients by emergency residents and radiologists who were blind to the other tests. all ultrasound evaluations were performed using the fast technique during the primary survey of advanced trauma life support (atls) guidelines. third - year emergency residents, with at least eight hours in the bedside training program, including instructions and practical sessions before study, were responsible for performing the fast exams. the exams were repeated by radiology residents (pg-2) who were blind to the prior results. the sonositetm180, handheld system was used for the tests. a curvilinear probe (24 mhz) was used. positive findings included the presence of abdominal fluid in any of the abdomino - pelvic spaces. abdominal ct with iv and oral contrast as the gold standard were done for all of the patients. the results and other necessary demographic and physical exam data were recorded by the researcher. since some patients had been transferred directly to the operating room and underwent laparotomies without performing abdominal ct scans, we used a combination of laparotomy (if performed) and abdominal ct scan as our gold standards. asymptomatic patients with normal physical exams along with normal fast reports and 24 hours of ed observation also were accepted as correct fast results. ct scans were performed within four hours of the patient s arrival at the ed. sensitivity, specificity, and the positive and negative predictive values of fast were calculated by the emergency or radiology residents. during the study, 120 patients with abdominal blunt trauma were evaluated ; the mean age of the patients was 33.016.6, and the gender ratio was 3/1 (m / f). most of the subjects were referred to the hospital due to motor vehicle accidents (97.5%). all of the patients underwent fast sonography by an emergency resident and a radiology resident. according to their physical exam and fast results showing abdominal free fluid, 10 patients were transferred directly to the operating room ; abdominal ct scans were performed for 81 patients (67.5%), and the other 29 patient did not need any further diagnostic studies during the 24-hour observation period (table 1). the results of fast sonography by emergency physicians showed free fluid in the abdomen or pelvic spaces in 33 patients (27.5%), but this was not proved with ct scan results in six patients ; sensitivity and specificity were 93.1 and 93.4%, respectively. for the tests performed by the radiology residents, sensitivity was a bit higher (96.5%) with a lower specificity (92.3%) (table 2). the use of fast examination instead of abdominal contrasted ct scans is increasing significantly, and its role as a single imaging modality for blunt abdominal trauma also is increasing (7). it is a critical and challenging task for emergency physicians to assess subjects with blunt abdominal trauma quickly and accurately. using fast exam for detecting abdominal free fluid is an easy and rapid approach that could be employed by an accessible, portable sonography unit during the primary survey in the first several minutes of the patient s arrival in the ed. although abdominal ct is considered the gold standard, its limitations, such as higher cost and time, the need to transfer the patient out of emergency department and exposure to radiation implies that ultrasound can safely replace it, provided that fast shows high sensitivity and specificity. although ultrasound is probably the most strongly operator - dependent of all imaging modalities (8), there are reports that fast operators with a broad range of experience can perform the task, without any impact on the results (9). surgeon - performed or non - radiologist fast technique seems to be an accurate method to evaluate the possibility of blunt abdominal trauma in stable patients in detecting free fluid (7, 1012). although it is difficult to perform in cases of excessive bowel gas, obesity, and an empty bladder (2), finding fluid in the right upper quadrant by fast resulted in a higher probability of subsequent therapeutic laparotomy (13, 14). most recent studies have reported high sensitivity and specificity for non - radiologist performed fast exam except for ollerton.s and gaarder.s studies, which suggested that further performance improvement was required and recommended that fast be performed by radiologists or by the trauma team leaders (8, 9). fast exams, were sufficient to perform the test with high accuracy (15). our results also demonstrated that emergency physicians with an eight - hour education can perform fast exams as reliably as radiologists. the use of fast examination instead of abdominal contrasted ct scan is increasing significantly, and its role as a single imaging modality for blunt abdominal trauma also is increasing. it is a critical and challenging task for the emergency physicians to rapidly and accurately assess subjects with blunt abdominal trauma. according to our findings, fast exams can be performed by emergency physicians, and they are reliable and sensitive, but, since fast ultrasounds have a high negative predictive value in patients with blunt abdominal trauma and, thus, can not reliably exclude intra - abdominal bleeding, it is recommended to keep patients with negative ultrasound results under close observation for 1224 h before discharge. | introductionintra - abdominal hemorrhage due to blunt abdominal trauma is a major cause of trauma - related mortality. therefore, any action taken for facilitating the diagnosis of intra - abdominal hemorrhage could save the lives of patients more effectively. the aim of this study was to determine the accuracy of focused assessment with sonography for trauma (fast) performed by emergency physicians.methodsin this cross - sectional study from february 2011 to january 2012 at 7th tir hospital in tehran (iran), 120 patients with abdominal blunt trauma were chosen and evaluated for abdominal fluid. fast sonography was performed for all the subjects by emergency residents and radiologists while they were blind to the other tests. abdominal cts, which is the gold standard, were done for all of the cases. spss 20.0 was used to analyze the results.resultsduring the study, 120 patients with abdominal blunt trauma were evaluated ; the mean age of the patients was 33.0 16.6 and the gender ratio was 3/1 (m / f). the results of fast sonography by emergency physicians showed free fluid in the abdomen or pelvic spaces in 33 patients (27.5%), but this was not observed by the results of ct scans of six patients ; sensitivity and specificity were 93.1 and 93.4%, respectively. as for tests performed by radiology residents, sensitivity was a bit higher (96.5%) with lower specificity (92.3%).conclusionthe results suggested that emergency physicians can use ultrasonography as a safe and reliable method in evaluating blunt abdominal trauma. |
pompe disease is an inherited rare disorder caused by mutations in the gene for the enzyme acid -glucosidase (gaa ; > 1 in 40,000 births) that affects the heart and skeletal muscles, and is often fatal. enzyme replacement therapy (ert) with recombinant human gaa (rhgaa) has been shown to decrease heart size ; maintain normal heart function ; improve muscle function, tone, and strength ; and reduce glycogen accumulation. although ert has prolonged survival in the majority of patients with infantile pompe disease, many patients have died or remained very weak despite compliance with ert. among the poor responders to ert were many cross - reacting immune material - negative (crim - negative) patients, who lack any residual gaa protein and who formed high, sustained anti - rhgaa igg antibody titers (hsats). patients with hsats demonstrated greatly increased mortality, in comparison with patients who formed no or low titer antibodies. furthermore, suppressing anti - rhgaa antibody formation with immunosuppression significantly prolonged the survival of crim - negative infants, although immunosuppression has associated risks.3, 4 a small minority of adult patients with late - onset pompe disease (lopd) also formed hsats during ert, which in some cases were associated with reduced efficacy.5, 6 multiple preclinical experiments have demonstrated the ability of gene therapy to prevent antibody formation in mice with pompe disease.7, 8, 9, 10 preventing hsats also reduced mortality from hypersensitivity that had occurred during ert in gaa - knockout (ko) mice, whereas ert was efficacious only in the setting of immune tolerance to gaa following aav vector administration. we and others demonstrated that aav - vector - mediated gene transfer consistently induced immune tolerance to gaa by expressing gaa exclusively in the liver and by activating regulatory t cells in preclinical experiments.7, 8, 9, 10, 11 the efficacy from ert in pompe disease is limited by the short half - life of gaa and the formation of antibody responses that interfere with the uptake of gaa. we hypothesized that liver - specific expression of gaa with a recombinant (r) aav8 vector expressing human gaa under the transcriptional control of a liver - specific promoter (aav2/8-lsphgaa) would suppress the antibody response, continually secrete gaa in the blood, and improve efficacy in comparison with ert. previous studies suggested that the efficacy of this raav8 vector at a low dose (2 10 vector genomes [vg ], equivalent to 8 10 vg / kg body weight) was comparable with long - term ert13, 14 with regard to biochemical correction. importantly, a higher vector dose (4 10 vg / kg) reduced glycogen in skeletal muscle by 70% more than intensive ert in gaa knockout (ko) mice.7, 14 the current study directly compares ert with aav2/8-lsphgaa, and supported a successful investigational new drug (ind) application to the food and drug administration in anticipation of a clinical trial of liver depot gene therapy in pompe disease. we hypothesized that liver depot gene therapy for pompe disease could potentially improve clinical outcomes (figure 1). therefore, we directly compared the efficacy of intensive ert with aav2/8-lsphgaa gene transfer at the established low dose. gaa - ko mice were assigned (both male and female ; figure 1a ; table 1) to receive either a weekly injection of rhgaa for intensive ert (20 mg / kg / week ; n = 10) or a single injection of aav2/8-lsphgaa for low - dose gene therapy (8 10 vg / kg ; n = 10). the primary endpoints included gaa activity and glycogen content in the tissues and anti - gaa antibody formation. in both ert- and gene - therapy - treated animals, gaa activity was significantly increased in liver following both treatments, whereas gaa activity was higher without reaching statistical significance in the heart and muscles following gene therapy (figure 1b). glycogen content was reduced by both treatments in the heart and diaphragm, demonstrating that glycogen content is a more sensitive measure of biochemical correction than gaa activity (figure 1c) as previously observed. although ert provoked anti - gaa antibody formation, there was no detectable antibody response following aav vector administration (figure 1d). gaa activity was continuously elevated in the blood of mice following a single injection of vector and was not detectable 7 days following ert (figure 1e). the left ventricle mass was reduced significantly following either ert or vector injection, demonstrating the reversal of cardiac hypertrophy (figure 1f). as expected, aav2/8-lsphgaa demonstrated slightly greater efficacy in male mice than in female mice, including higher liver gaa activity and lower diaphragm glycogen (figure s1). additionally, female mice had higher anti - gaa igg1 following ert, in comparison with male mice (figure s1). thus, gene therapy with aav2/8-lsphgaa at a dose of 8 10 vg / kg was confirmed to have similar efficacy to ert in both sexes, with the added benefit of avoiding anti - gaa immune responses. next, we evaluated the biochemical efficacy of four lower dosages of aav2/8-lsphgaa in gaa - ko mice, either alone or in combination with ert (figure 2a ; table 1). no biochemical correction was observed following administration of 6 10 vg / kg (data not shown). the highest dose (2 10 vg / kg) significantly increased gaa activity in the heart, either with or without ert (figure 2b). administration of the highest vector dose reduced glycogen content of the heart to a greater extent in male mice than in female mice (figure s2). lower vector dosages were associated with lower gaa activity in the heart and skeletal muscles that did not achieve statistical significance, in comparison with no vector administration (figure 2b). however, aav2/8-lsphgaa significantly reduced glycogen content in the heart and diaphragm of gaa - ko mice at a dose of 8 10 vg / kg (p 1) prevented the induction of a significant humoral immune response against the transgene. furthermore, intermediate transduction of 0.011 copy allowed significant formation of igg2c (figure 3h). the formation of igg2c was significantly increased in the presence of intermediate vector transduction without ert, in comparison with intermediate transduction with ert (figure 3h). the long - term effect of aav2/8-lsphgaa in combination with ert was evaluated with regard to immune tolerance induction (figure 4 ; table 1), given the experience that vector administration following the start of ert might fail to prevent anti - gaa formation. the ability of aav2/8-lsphgaa to suppress anti - gaa antibody formation following exposure to ert was evaluated by administering the vector either 5 or 25 weeks following the initiation of ert (figure 4a). initially the mice were treated with two doses of ert according to standard recommendations (20 mg / kg every other week). at week 5 mice were treated with an additional dose of ert (group [grp ] 1) or with aav2/8-lsphgaa at a highly effective dose to evaluate the antibody response to each agent. early monitoring revealed that ert (grp 1 ; figure 4b) provoked significantly higher anti - gaa formation in comparison with aav2/8-lsphgaa (grp 2 ; figure 4b), whereas the administration of only two doses of ert did not provoke anti - gaa formation (grp 3 ; figure 4b). long - term monitoring revealed that the administration of aav2/8-lsphgaa at week 5 suppressed anti - gaa formation in response to two subsequent doses of ert at weeks 17 and 19 (grp 2 ; figure 4b). however, administration of ert at weeks 17 and 19 provoked significantly elevated anti - gaa by 23 weeks in mice that had received only ert (grp 3 ; figure 4b). thus, administration of aav2/8-lsphgaa as late as week 5 following the initiation of ert was sufficient to induce long - term immune tolerance to rhgaa. we further evaluated the ability of aav2/8-lsphgaa to suppress previously formed antibody responses against ert. aav2/8-lsphgaa was administered at week 25 to suppress previously formed anti - gaa, reducing the anti - gaa igg1 to background levels by week 36 (grp 3 ; figure 4b). initially, elisa confirmed that 10 of 10 mice were positive for anti - gaa at week 23, whereas only one of nine mice were positive at week 36 following aav2/8-lsphgaa administration (grp 3 ; figure 4b). when all three groups were challenged with ert at week 31, gaa - ko mice treated with ert only formed significantly increased anti - gaa at week 36 (grp 1 ; figure 4b). gaa - ko mice that were treated with aav2/8-lsphgaa at week 5 developed increased rotarod latency in comparison with all other groups (grp 2 ; figure 4c), which demonstrated the importance of early vector treatment to improve muscle function. both vector - treated groups had improved biochemical correction after 36 weeks, in comparison with mice treated with ert alone (figures 4d and 4e). gaa activity was significantly increased in the heart, diaphragm, and soleus of gaa - ko mice following administration of aav2/8-lsphgaa, in comparison with ert - treated or untreated mice (figure 4d). vector administration significantly reduced glycogen content in multiple skeletal muscles of vector - treated mice (figure 4e), and glycogen content was again a more sensitive measure of biochemical correction than gaa activity (figure 4d) as previously demonstrated. the soleus demonstrated a greater elevation of gaa (figure 4d) and reduction in glycogen content (figure 4e) following vector administration that was observed for other skeletal muscles. this observation was consistent with improved response of type i muscles to gaa replacement, in comparison with other muscles examined that were comprised mainly of type ii myofibers. as expected, aav2/8-lsphgaa - treated mice demonstrated slightly greater efficacy in males than in females, achieving higher gaa activity and lower glycogen content (figure s4). in general the degree of biochemical correction achieved by early and late vector injection was equivalent with regard to reducing glycogen content, confirming the efficacy of suppression of anti - gaa with aav2/8-lsphgaa at either timepoint (figure 4e). circulating igg isotypes in the three groups were quantified at week 36 and ranked according to the degree of elevation (figure 5 ; table s1). as expected, ert - only mice formed the highest total igg with nine out of nine mice generating elevated total igg (grp 1 ; figure 5a) and igg1 (figure 5b). administering aav2/8-lsphgaa at week 5 reduced total igg and igg isotypes, with six out of nine mice showing detectable igg1 levels less than 0.25 g / ml (grp 2 ; figure 5b ; table s1). vector - treated mice had significantly lower igg (grp 2 and 3 ; figure 5c) and igg1 (grp 2 and 3 ; figure 5d) responses, in comparison with the ert - only grp 1. finally, aav2/8-lsphgaa at week 25 resulted in elevated total igg (grp 3 ; figure 5c) or igg1 (grp 3 ; figure 5d) in only three out of nine mice according to the ranking scale, thus indicating an efficient eradication of the immune response 11 weeks following vector administration. interestingly, following aav2/8-lsphgaa at week 25, only very low titers of igg1 were observed, along with igg2b and igg2c (grp 3 ; figure s5). igg1 was elevated to > 10 g / ml in only one of nine grp 3 mice (figure 5b), which would correspond to an elisa titer > 1:1,600 (figure s6) that would be expected to interfere with efficacy. together, these data suggest that aav - vector - mediated liver gene transfer for gaa can eradicate established immune responses to the enzyme and enhance efficacy of gaa replacement and, consequently, clinical outcome in pompe disease. this study modeled the clinical translation of a gene therapy approach aimed at preventing igg antibody formation in patients at risk for hsats and addressed important questions related to the successful filing of an ind. furthermore, liver expression of gaa treats pompe disease by the continuous secretion of gaa from the liver accompanied by receptor - mediated uptake in the heart and skeletal muscles. three experiments investigated the effectiveness of liver depot gene therapy and its interactions with ert. a single dose of aav2/8-lsphgaa was as effective as intensive, weekly ert (figure 1). this direct comparison confirmed previous experiments that suggested that gene therapy with a very low amount of aav2/8-lsphgaapa, equivalent to 8 10 vg / kg body weight, was as effective as ert,13, 14 and more precisely quantitated the reduction in glycogen content following gaa replacement than a previous comparison between ert and gene therapy. we established the med for biochemical correction with aav2/8-lsphgaa (8 10 vg / kg), which is approximately 10-fold lower than previous data suggested (figure 2).8, 9 the med for immune tolerance is 2.5-fold higher (2 10 vg / kg). as previously observed, glycogen content was a more sensitive indicator of biochemical correction than gaa activity, because glycogen content was significantly reduced in muscles where gaa activity was not significantly increased (figures 1, 2, and 3).12, 19 finally, the ability of aav2/8-lsphgaa to suppress or eradicate antibody following the start of ert was demonstrated, as well as the long - term efficacy of liver depot therapy (figure 4). these experiments modeled the effects of aav2/8-lsph - gaa administration in : (1) the naive pompe subject, prior to ert ; (2) in conjunction with ert, either at the med or slightly higher dose ; and (3) 4 months following ert initiation, in a pompe subject immunized against rhgaa. the eradication of long - term memory antibody responses to rhgaa is perhaps the most novel aspect of this study, never achieved previously with gene therapy in pompe disease. previously the administration of an aav vector to express coagulation factor viii in dogs with hemophilia a was shown to suppress inhibitory antibodies and to establish immune tolerance. subsequently, two groups showed that expression of coagulation factor ix could similarly induce immune tolerance following inhibitory antibody formation in mice with hemophilia.21, 22 similar effects have been demonstrated following aav vector administration in mice and dogs with hemophilia b using a high activity factor ix. in pompe disease raav8 vectors have been administered 23 weeks following the start of ert to suppress anti - gaa antibody formation in gaa - ko mice.9, 11 in the current study immune tolerance induction was possible as late as week 25. as shown in figure 4, when ert was administered three times by week 5 and again at week 31, gaa - ko mice formed antibodies by week 8 that were boosted to a robust hsat following the fourth injection (grp 1 ; figure 4b). mice that received two ert treatments before the intravenous injection of aav8-lsphgaa in week 5 formed no significant humoral response against gaa, even after five ert treatments over 31 weeks (grp 2 ; figure 4b). in contrast, mice that received four ert treatments in the first 20 weeks developed a strong humoral response against the transgene (grp 3 ; figure 4b). subsequently, treatment with aav8-lsphgaa at week 25 dramatically decreased the humoral response to rhgaa (grp 3 ; figure 4c). furthermore, an immune challenge with rhgaa at week 31 did not induce a humoral response following treatment with aav8-lsphgaa at week 25, reflecting a robust peripheral tolerance induced by liver gene transfer. therefore, we anticipate that aav2/8-lsphgaa could be administered to patients with pompe disease in order to prevent or suppress anti - gaa antibodies and achieve efficacious gaa replacement. a pharmacology and toxicology study with aav2/8-lsphgaapa was completed under good laboratory practice (glp), which was designed to detect early or late toxicity. in brief, intravenous administration of the aav2/8lsphgaa vector at 1.6 10 vp / kg (8-fold higher than the proposed higher dose in the proposed clinical trial described in the ind) did not cause significant short- or long - term toxicity. the vector genome was sustained in all tissues through 16 weeks post - dosing, except for in blood, with a similar tissue tropism between males and females. administration of the vector alone, or combined with the ert, was effective in producing significantly increased gaa activity and consequently decreased glycogen accumulation in multiple tissues, in comparison with administration of vehicle. the only complication demonstrated was formation of low - titer anti - gaa igg in some female mice. anti - hgaa antibody formation has been associated with anaphylactic responses to ert following the third dose in gaa - ko mice, although anaphylaxis is rare in humans undergoing ert for pompe disease. the only mortality in the current study occurred in mice treated solely with ert (table 1), consistent with the suppression of anti - gaa observed following administration of aav2/8-lsphgaapa. limitations of the current study include the lack of gaa - ko mice treated with long - term ert, either alone or following aav2/8-lsphgaapa administration. long - term ert was not attempted because of the risk for hypersensitivity and mortality,8, 9, 13 and because of the limited supply of rhgaa available to us. because of this limitation we did not demonstrate long - term immune tolerance induction to gaa following aav2/8-lsphgaapa at week 25. however, immune tolerance induction from aav2/8-lsphgaapa has been persistent in this study following vector administration at week 5 and in prior studies.7, 8, 9 we have confirmed that the sex - dependent lower efficacy of aav vector in female mice also applies to pompe disease,16, 24 as suggested by other published studies in murine models.25, 26, 27 our pharmacology and toxicology study of aav2/8-lsphgaa in gaa - ko mice further supported the hypothesis that aav vectors transduced tissues more efficiently in male mice. the biodistribution analysis revealed a significantly higher number of vector genomes in the liver and heart of vector - treated male gaa - ko mice, in comparison with female mice. furthermore, biochemical correction was greater in male mice, in comparison of female mice, demonstrated by significantly lower glycogen content in the quadriceps and diaphragm of male mice, in comparison with female mice. the current study showed greater biochemical efficacy and reduced immune responses in male mice with pompe disease. intriguingly, we demonstrated slightly higher glycogen content in the muscle of untreated male gaa - ko mice, in comparison with female mice, which correlated with lower background gaa activity in male gaa - ko mice (figure s2). these data indicated that, in gaa - ko female mice, previously observed gaa - ko and, in other mouse models, aav - mediated gene transfer appeared to be less efficacious, however, in non - human primates, this difference was not observed ; thus, sex - related differences reported in this study are less likely to be relevant in the clinic. to this end, in a recently published clinical trial of aav - mediated gene transfer, no evidence of differential transduction between male and female liver was observed. thus, available data suggest that efficacy of liver transduction in male and female pompe patients will be equivalent. importantly, our data indicate that a minimum level of liver transduction is required to control transgene immunity in pompe disease models. in translating these results to the clinic, it therefore will be important to ensure sufficient liver transduction. in our proposed clinical study we plan to administer a first dose that will be 2-fold higher than the med defined by immune tolerance induction in the current study (i.e., 4 10 vg / kg). the second cohort will receive a highly effective dose of aav2/8-lsphgaa, shown to suppress previously formed antibodies (figure 4), which is identical to the higher dose of an raav8 vector (2 10 vg / kg) administered in the hemophilia b clinical trials. this higher dose was sufficient to decrease the glycogen content of skeletal muscle by > 50%, demonstrating a high degree of biochemical efficacy (figure 4e). the selection of vector dosages that were effective in prior clinical trials further justifies the design of our proposed clinical trial. moving forward, additional improvements to the platform could be implemented, such as the use of serotypes with reported high tropism for human hepatocytes,31, 32 which seem to outperform raav8 in non - human primates and, possibly, in humans. however, raav8 vectors have performed very well in humanized mouse models, suggesting that proceeding with the clinical translation of aav2/8-lsphgaa - mediated gene therapy for pompe disease should be considered.33, 34 in conclusion, these experiments define a range of doses, starting from the med, able to prevent humoral immune responses to gaa, to a therapeutic dose of aav2/8-lsphgaa, highly effective in eradicating a previously formed anti - gaa igg response. in combination with the assessment of pharmacology and toxicology of aav2/8-lsphgaa gene transfer for pompe disease, these data support the clinical translation of liver depot gene therapy in pompe disease. the strategy of liver - targeted gene therapy is an innovative emerging therapy with no parallel among currently approved therapies. eventual marketing approval would represent a systemic, non - invasive gene therapy in pompe disease. successful clinical development would provide immunomodulatory gene therapy in pompe disease, which would induce immune tolerance to gaa and prevent hsat formation. this strategy could be useful in other lysosomal storage disorders and in hemophilia, where antibody responses to therapeutic proteins frequently complicate replacement therapy.2, 35, 36, 37, 38, 39 the aav vector was prepared as described previously and administered intravenously to gaa - ko mice with a c57bl/6 background.24, 40 ert was administered at the standard dose (20 mg / kg), injected intravenously either weekly or every other week, and diphenhydramine was injected intraperitoneally 15 min prior to the second and subsequent doses of ert to prevent anaphylaxis. age- and sex - matched gaa - ko mice were housed in groups of three to five, and mice from different groups were co - housed when possible. all animal procedures were done in accordance with duke university institutional animal care and use committee - approved guidelines. maxisorp 96-well plates (thermo fisher scientific) were coated with myozime protein in carbonate buffer at 4c overnight. a standard curve of igg isotype (sigma - aldrich) was coated to the wells in seven 2-fold dilution starting from 1 g / ml. after blocking, plasma samples diluted at 1:100 were added to plates and incubated for 1 hr at 37c. isotype - specific secondary antibodies coupled to hrp were used for detection (southern biotech). then, 3,3,5,5-tetramethylbenzidine substrate (bd biosciences) was added to the wells and color development was measured at 450 and 570 nm (for background subtraction) on an enspire plate reader (perkin elmer) after blocking the reaction with h2so4. total dna was extracted from approximately 100 mg of frozen liver tissue by using the magna pure 96 dna and viral na small volume kit (roche diagnosis) according to manufacturer s instructions. viral vector genome copy number (vgcn) measured by qpcr was normalized by the copies of titin gene measured in each sample. qpcr was performed on a lightcycler 480 (roche diagnostics) using sybrgreen mix (thermo fisher scientific) and the following specific primers and probes : gaa, forward 5-agatcccccagacagtgctg-3 and reverse 5-ttcctgctggcagtggtgctga-3 ; titin, forward 5-aaaacgagcagtgacgtgagc-3 and reverse 5-ttcagtcatgctgctagcgc-3. total rna was extracted from approximately 100 mg of frozen liver tissue by using the magna pure 96 rna extraction kit (roche diagnosis) according to the manufacturer s instructions. total rna was reverse - transcribed using random hexamers and the revertaid h minus first strand cdna synthesis kit (thermo fisher scientific). qrt - pcr was performed using sybrgreen (thermo fisher scientific) with primers specific for cd4 : forward 5-ggttcggcatgacactct-3, reverse 5-ctgactctccctcactcttatag-3 ; cd8 : forward 5-atcactctcatctgctacc-3, reverse 5-gccttcctgtctgactag-3 ; foxp3 : forward 5-aggacagaccacacttcat-3, reverse 5-gacgcacttggagcacag-3 ; ctla4 : forward 5-tatgtcattgatccagaac-3, reverse 5-ctgttgtaagaggacttc-3 ; gapdh : forward 5-catggccttccgtgttccta-3, reverse 5-gcggcacgtcagatcca-3. expression levels were normalized for the level of expression of gapdh (ct) and then to the average level measured in control group (ct). by using this method, a ct of 1 corresponds to one cycle difference in the expression levels measured by rt - pcr, and this corresponds to a two - fold difference in the rna expression. multiple comparisons were assessed with two - way anova and dunnett s multiple comparisons test or with multiple t tests using prism software (graphpad). a p value < 0.05 was considered to be statistically significant. if the technology is commercially successful in the future, the developers and duke university may benefit financially. has received research and grant support from sanofi genzyme corporation in the past, and rhgaa for these studies was supplied by sanofi genzyme. | pompe disease results from acid -glucosidase (gaa) deficiency, and enzyme replacement therapy (ert) with recombinant human (rh) gaa has clinical benefits, although its limitations include the short half - life of gaa and the formation of antibody responses. the present study compared the efficacy of ert against gene transfer with an adeno - associated viral (aav) vector containing a liver - specific promoter. gaa knockout (ko) mice were administered either a weekly injection of rhgaa (20 mg / kg) or a single injection of aav2/8-lsphgaa (8 1011 vector genomes [vg]/kg). both treatments significantly reduced glycogen content of the heart and diaphragm. although ert triggered anti - gaa antibody formation, there was no detectable antibody response following aav vector administration. the efficacy of three lower dosages of aav2/8-lsphgaa was evaluated in gaa - ko mice, either alone or in combination with ert. the minimum effective dose (med) identified was 8 1010 vg / kg to reduce glycogen content in the heart and diaphragm of gaa - ko mice. a 3-fold higher dose was required to suppress antibody responses to ert. efficacy from liver gene therapy was slightly greater in male mice than in female mice. vector dose correlated inversely with anti - gaa antibody formation, whereas higher vector doses suppressed previously formed anti - gaa antibodies as late as 25 weeks after the start of ert and achieved biochemical correction of glycogen accumulation. in conclusion, we identified the med for effective aav2/8-lsphgaa - mediated tolerogenic gene therapy in pompe disease mice. |
during recent years, treatment with statins has been suggested to cause positive effects on bone. although, discrepant results have been reported in clinical studies on effects of statins on bone mineral density (bmd) and bone turnover [15 ], several epidemiological studies have shown that treatment with statins is associated with a reduced risk of fracture [610 ]. statins may exert a bone anabolic action due to an increased osteoblastic synthesis of bone morphogenetic protein 2 (bmp-2), a growth factor that causes osteoblastic proliferation, as well as antiresorptive effects similar to nitrogen - containing bisphosphonates (amino - bp). moreover, an effect of statins on vitamin d metabolism has been suggested as an additional mechanism of action by which statins may exert pleiotropic effects. in several [1316 ] but not all [1719 ] studies, treatment with statins has been associated with an improved vitamin d status. an emerging amount of evidence suggests that an impaired vitamin d status increases the risk of different types of cancers and chronic disorders, including cardiovascular diseases [20, 21 ]. if statins improve vitamin d status this could be a plausible explanation for the findings of not only a decreased fracture risk, but also a decreased risk of malignant diseases in users of statin drugs. thus, in a randomised controlled design we studied effects of one year of simvastatin treatment on vitamin d status in a group of healthy postmenopausal women. in year 2000, we initiated a study on effects of statin treatment on bone. the design and major results of the study has previously been detailed. in brief, in a double - blinded design we randomised 82 healthy caucasian women to one year of treatment with either simvastatin 40 mg / d or placebo. in addition, all studied subjects received a daily supplement with 400 mg of elementary calcium, but no vitamin d supplementations. we recruited studied subjects, through invitations by letter, from a random sample of the general background population. we only included women who were more than 12 months postmenopause and below 76 years of age. in addition, we required studied subjects to be healthy as assessed by a standard biochemical screening program and to have osteopenia at the lumbar spine or total hip, that is, a bmd less than 1 standard deviation (sd) below the mean of peak bone mass (t - score 120 mol / l) or hepatic (plasma alanine aminotransferase > 80 u / l) function, and alcohol abuse of more than 14 units a week within the last 2 years. none of studied subjects had known hyperlipidemia prior to study start. as a safety measure, we excluded subjects with low plasma cholesterol levels (total cholesterol 80 nmol / l (table 1). as previously reported, 52 weeks of treatment with simvastatin caused, compared with placebo, a significant decrease in plasma levels of cholesterol (27%, 95% confidence interval (ci), 22% to 32%, p 80 nmol / l showed very similar results with significantly lower tg levels (1.0 0.5 mmol / l) in vitamin d replete women (p-25ohd > 80 nmol / l) than in women with vitamin d insufficiency (p-25ohd < 50 nmol / l : tg 1.3 0.5 mmol / l, p =.03). moreover, on averages, p-25ohd levels increased from 71 25 nmol / l at wintertime (baseline) to 80 25 mmol / l to 1.1 0.5 mmol / l. in a linear regression analysis, adjusted for treatment allocation, the seasonal changes in p-25ohd levels were significantly associated with the concomitant changes in plasma tg levels (= 0.150, r = 0.47, p <.01). similarly, the decrease in p-25ohd levels between week 26 and 52 (from summer- to winter - time) correlated significantly with the concomitant changes in plasma tg levels (= 0.189, r = 0.36, p <.01). in a randomised, controlled study, we found no effects on plasma 25ohd levels of one year of treatment with simvastatin 40 mg / d compared with placebo. however, our analysis showed an effect of vitamin d status on plasma levels of tg, a finding that may contribute to our understanding of the potential positive effects of vitamin d on cardiovascular health. for more than two decades, statins they act as hmg - coa reductase inhibitors, thereby reducing the endogenous cholesterol synthesis. when statins were introduced, it was a matter of concern whether inhibition of the cholesterol biosynthetic pathway may affect other metabolic processes which are dependent on intermediates from this pathway. especially, concerns have been paid to the reduced tissue concentrations of 7-dehydrocholesterol (7-dhc) in response to treatment with statins. as 7-dhc is the precursor for endogenous skin synthesis of cholecalciferol, reduced levels of 7-dhc may impair vitamin d status. however, in a study including 17 men and women on treatment with pravastatin and 14 hypercholesterolemic age and gender matched controls, vitamin d levels increased in a similar manner in both groups in response to exposure of the skin surface to type b ultraviolet (uv - b) radiation, indicating no harmful effects of pravastatin on the endogenous vitamin d synthesis. on the contrary, in several papers statin therapy has been suggested to improve vitamin d status. in a group of 83 spanish men and women with acute coronary syndrome in whom treatment with atorvastatin was initiated, vitamin d status as measured by p-25ohd levels improved. thus, during one year of observation p-25ohd levels increased from 41 19 nmol / l at baseline to 47 19 nmol / l after 12 months, which, according to the investigators, was attributable to treatment with atorvastatin. similar results have been reported by other investigators [15, 16 ], including a cross - sectional analysis showing increased p-25ohd levels in patients on treatment with statins. in contrast to these findings from observational studies, the results from our randomised controlled study showed no effect of simvastatin treatment on p-25ohd levels. although we can not exclude differential effects on vitamin d status of different types of statin drugs (e.g., atorvastatin versus simvastatin), we find it most likely that the findings from the uncontrolled studies are due to unmeasured changes in indices affecting p-25ohd levels. in general, p-25ohd levels are determined by intake from food items rich in vitamin d (especially fatty fish), use of vitamin d supplements, and sun exposure. to the best of our knowledge, none of these indices was controlled for in the hitherto published uncontrolled studies on possible effects of statins on vitamin d status. most likely, the findings from these studies are due to the coincidence of changes in life - style habits in relation to administration of statin drugs. vitamin d has, however, independently of treatment with statins, been implicated in cardiovascular health and atherogenesis. results from a randomised controlled study showed a decreased blood pressure in response to uvb exposure, and p-25ohd levels have been shown to correlate inversely with risk of atherosclerosis in several cohort studies [21, 27, 28 ]. however, other investigators have reported either no effects or even detrimental effects on plasma lipid levels in response to administration of vitamin d [2932 ]. the vitamin d receptor is expressed by both cardiac myocytes, endothelial-, and smooth vascular muscle - cells and these cells also express the 1 -hydroxylase enzyme, that is, they may locally activate vitamin d from its circulation precursor (25ohd) to its active metabolite (1,25-dihydroxyvitamin d) [33, 34 ]. several mechanisms of action have been implicated in the potential antiatherosclerotic effects of vitamin d, including a downregulation of the renin - angiotensin system, and a reduced expression of mrna and protein levels of plasminogen activator inhibitor-1 (pai-1) and thrombospondin-1 (thbs1) which are known to be involved in the development of atherosclerosis [35, 36 ]. in addition, our data points toward a further mechanism by which vitamin d may protect against cardiovascular diseases, that is, through decreased tg levels. a possible mechanism of action by which vitamin d lowers tg levels is through an increased activity of the lipoprotein lipase, which has been shown to be regulated by vitamin d in adipocytes. our data on effects of vitamin d on tg levels are limited by the cross - sectional design of the analysis and included only women. further randomised controlled studies on effects of vitamin d on plasma lipid profile are warranted, including studies in men. in conclusion, results from our randomised, controlled trial do not support an effect of statin treatment on vitamin d status as determined by measurement of plasma 25ohd levels. however, p-25ohd levels may improve the plasma lipid profile and thereby risk of cardiovascular disease. | objectives. statin drugs act as inhibitors of the 3-hydroxy-3methylglutaryl coenzyme a (hmg - coa) reductase enzyme early in the mevalonate pathway, thereby reducing the endogenous cholesterol synthesis. in recent studies, it has been suggested from epidemiological data that statins also may improve vitamin d status, as measured by increased plasma 25-hydroxyvitamin d (25ohd) levels. we now report the results from a randomised controlled trial on effects of simvastatin on plasma 25ohd levels. design and methods. we randomised 82 healthy postmenopausal women to one year of treatment with either simvastatin 40 mg / d or placebo and performed measurement at baseline and after 26 and 52 weeks of treatment. the study was completed by 77 subjects. results. compared with placebo, plasma levels of cholesterol and low - density lipoproteins decreased in response to treatment with simvastatin, but our study showed no effect of simvastatin on vitamin d status. however, plasma levels of triglycerides were inversely associated with tertiles of plasma 25ohd levels and changes in plasma triglycerides levels correlated inversely with seasonal changes in vitamin d status. conclusion. our data do not support a pharmacological effect of statins on vitamin d status, but do suggest that vitamin d may influence plasma lipid profile and thus be of importance to cardiovascular health. |
organisms of the genus kocuria (family micrococcaceae, order actinomycetales, class actinobacteria) are gram - positive coccoid bacteria often found as tetrads and irregular clusters that are catalase - positive and coagulase - negative. these bacteria are responsible for different types of infection, mostly in immunocompromised hosts with serious underlying conditions. however, the prevalence of human infections caused by kocuria species is underestimated, as commonly used phenotypic assays are known to misidentify kocuria isolates as staphylococci. accordingly, a number of presumed staphylococcal pathologies might have been caused by kocuria species, although it is plausible that a variety of presumed kocuria infections might have actually been due to coagulase - negative staphylococci (cons). here, we report a case of peritonitis caused by kocuria rosea that was initially assumed to be due to cons. the present article reviews all the cases of kocuria infections reported in the english literature and discusses important issues pertaining to the diagnosis, etiology, identification, drug resistance, epidemiology, clinical presentation and management of such infections. a 57-year - old man, a previously known case of diabetic nephropathy with end - stage renal disease undergoing continuous ambulatory peritoneal dialysis (capd) for the last four years, was admitted to a tertiary - care hospital in puducherry, with complaints of abdominal pain, pedal edema and loose stool for three days. upon initial physical examination, he was not febrile and had a normal - appearing catheter exit site. however, the peritoneal dialysate fluid was turbid. subsequently, he became febrile, and a peripheral blood examination showed a total cell count of white blood cells 8700 cells / cu mm, neutrophils 84%, lymphocytes 12% and eosinophils 4%. the hemoglobin concentration was 9.0 g / dl, and the blood urea and creatinine levels were 161 mg / dl and 8.4 mg / dl, respectively. random blood sugar was 170 mg / dl, total protein 5.9 mg / dl, serum albumin 1.8 mg / dl and globulin 4.1 mg / dl ; the c - reactive protein level was raised to 10 mg / dl. the peritoneal dialysis fluid (7 ml) inoculated into a bact - alert fa bottle showed growth within 12 h (bact - alert 240 ; biomrieux, france). we performed all culturing procedures according to the 2005 update of the international society for peritoneal dialysis recommendations and guidelines using specimens collected prior to antibiotic treatment. subcultures of the peritoneal fluid were performed using sheep blood agar, macconkey agar and chocolate agar ; the plates were incubated at 35 c for 48 h. after incubation, sheep blood agar yielded the pure luxuriant growth of pale - pink non - hemolytic colonies that were 12 mm size (figure 1a). subculture on nutrient agar yielded smooth, small, pale - cream to pale - pink colonies (figure 1b). gram staining of the culture revealed the cells to be gram - positive cocci in pairs or clusters (figure 2). the organism was preliminarily identified as kocuria based on phenotypic test results, such as positive reactions for catalase, oxidase, nitrate reduction and growth in 5% nacl and motility test negativity. subsequent additional tests, such as bacitracin susceptibility, lysozyme sensitivity at 200 g, resistance to furazolidone and lysostaphin, helped to discriminate micrococci from staphylococci. the culture (designated as pks1409) was later identified with a 97% probability as kocuria rosea using a vitek-2 system (biomrieux) of 64 tests ; the id - gpc card panel tested positive only for -glucosidase, leucine arylamidase, -galactosidase, alanine arylamidase and tyrosine arylamidase. to verify the culture results, a second sample from the peritoneal fluid the second isolate obtained from the second peritoneal dialysate fluid taken after 3 days showed a colony morphology, growth characteristics, biochemical test results and antibiogram identical to that of first isolate. however, an examination of the removed capd catheter and subsequent blood culture results showed no growth. additionally, repeat blood samples collected from the patient who was already on antibiotics showed no growth. we performed 16s rrna gene sequencing, as previously described and compared the sequence results using the basic local alignment search tool with the eztaxon database. the 16s rrna gene amplified using a polymerase chain reaction mastermix (fermentas, thermo scientific, ma, usa) with the conserved primers pkrf (5-atc ctg gct cag agc gaa cg-3) and pkrr (5-ccc tac ggc tac ctt gtt acg-3) generated a nearly complete sequence of the 16s rrna gene (1365 bp) (veriti - pcr ; applied biosystems inc., the polymerase chain reaction product was purified (hi - media, mumbai, india) and sequenced using abi technology (eurofins, bangalore, india). the basic local alignment search tool nucleotide sequence analysis revealed a high degree of homology (99.78%) with k. rosea (genbank accession number jn084143) ; and the second closest match was k. polaris, with 99.56% homology (accession number aj278868). this isolate was precisely identified and confirmed as k. rosea by a phylogenetic analysis of the 16s rrna gene sequences by eztaxon, a web - based tool used for the identification, using 16s rrna gene sequences. similar results were obtained when we constructed a neighbor - joining phylogenetic tree with the 16s rrna gene sequences of all kocuria species using mega v5.1 program (figure 3). susceptibility testing through a modified kirby - bauer disc - diffusion technique and minimum inhibitory concentration (mic) by microbroth dilution method was performed according to the clinical and laboratory standards institute guidelines for staphylococcus. the disc - diffusion method revealed that pks1409 was susceptible to ampicillin, cefotaxime, ciprofloxacin, cloxacillin, gentamicin, erythromycin, amikacin, imipenem, linezolid, teicoplanin and vancomycin, but showed intermediate resistance to ceftazidime. the mic values for co - trimoxazole (10 mg / l), tetracycline (2 mg / l) and ceftazidime (2 mg / l) were relatively high when compared to other antimicrobials, such as benzylpenicillin (0.06 mg / l), clindamycin (0.5 mg / l) and levofloxacin (0.5 mg / l). / l mic for all the other antibiotics tested, including ciprofloxacin, erythromycin, gentamicin, linezolid, rifampicin, vancomycin and quinupristin dalfopristin. the disc - diffusion results correlated well with the mic values for all the common antibiotics evaluated. biofilm production was assessed by the microtitre plate assay, and pks1409 did not produce a biofilm. biofilm production was further checked by growing the bacterium under a different set of conditions with different media, namely, brain heart infusion, nutrient and luria - bertani broth, for different incubation time intervals of 6, 12 and 24 h. american type culture collection reference strain staphylococcus epidermidis 35984 was used as a positive control. a chest x - ray of the patient was normal, and an abdominal ultrasound showed findings suggestive of chronic renal failure. the intraperitoneal administration of amikacin and cefazolin was started for the empirical treatment of capd peritonitis. in addition, intravenous injections of vancomycin (1 g) and amikacin were given for 5 days. improvement of the patient was visible after the initiation of antibiotic treatment, with fever subsiding and a decrease in the c - reactive protein level. the patient responded well to the vancomycin treatment and did not develop any other complications. the patient was symptomless after 14 days of antibiotic therapy and catheter removal and was discharged. the nearly complete sequence of the 16s rrna gene of the kocuria rosea isolate from this study has been deposited in genbank under accession number hq830206. the nearly complete sequence of the 16s rrna gene of the kocuria rosea isolate from this study has been deposited in genbank under accession number hq830206. this group was previously classified into the micrococcus genus, but was later removed based on the phylogenetic and chemotaxonomic analyses of stackebrant. kocuria is ubiquitous in nature and is frequently found as normal skin flora in humans and other mammals. only five of the 18 species in this genus are known to be opportunistic pathogens. indeed, the documented cases of kocuria infections in humans are very limited ; however, many cases might have been missed owing to their misidentification as staphylococci due to the limited biochemical tests and also due to automated identification systems. a search of the english - language research literature revealed nineteen other reports on kocuria infections (table 1). the number of cases reported has increased over the past five years, most likely due to the improved identification systems for the diagnosis of this infective agent. recovery in many of the cases of kocuria infection required catheter removal, which resolved the infection. among the members of this genus, k. kristinae, first described in 1974 (previously micrococcus kristinae), is known to cause catheter - related bacteremia and infective endocarditis. these infections are associated with different cancers, acute cholecystitis and other metabolic disorders. the recently introduced vitek-2 gp - card supplemented with an additional database allows for the identification of k. kristinae. bacteremia caused by k. kristinae in a patient suffering from ovarian cancer who had multiple febrile episodes for a prolonged period of > six months has been described (table 1). the strains yielded from all the blood and central venous catheter (cvc) cultures of this patient were indistinguishable and clonal in nature, strongly suggesting recurrent infection and the possibility of a cvc line as a port of entry. on one occasion, a three - year screening of blood cultures in the national taiwan university hospital led to the isolation of 21 kocuria isolates from five patients, with 20 being k. kristinae and responsible for either catheter - related bacteremia or infective endocarditis. subsequent random amplification of polymorphic dna genotyping of these isolates revealed that there was no nosocomial transmission. furthermore, multiple isolates from individual patients with persistent blood - stream infection (bsi) revealed identical random amplification of polymorphic dna profiles, implying that there was either incomplete treatment of an occult focus or persistent carriage of the same bacterium. k. kristinae as the cause of acute peritonitis in a patient with end - stage renal failure undergoing capd for two years has also been reported, and bacterial entry into the peritoneal cavity through touch contamination of the catheter was suspected. the continued monitoring of bacterial growth for up to 72 h without any clinical indication after the onset of acute peritonitis was proven to be beneficial, as this led to an interruption and change in the antibiotic treatment, leading to improvement in the patient 's condition. surprisingly, k. kristinae was also reported to cause severe intravascular infections in an immunocompetent host, an infection that was complicated by septic pulmonary emboli that were secondary to suppurative thrombosis. a problematic catheter - related bsi leading to such complications was striking in this case. a recent report of a female infant with a history of prolonged diarrhea showed the blood culture growth of k. kristinae, and this organism was considered responsible for bacteremia with black hairy tongue symptoms. unlike the initial empirical ceftriaxone therapy, the infant showed a dramatic response to vancomycin treatment, which completely resolved the infection and symptoms within a week. a case of k. kristinae infection was recently documented in an elderly patient affected by endocarditis who was suffering from diabetes mellitus and hypertension who additionally had minor amputation for a left forefoot ulcer. this was a rare and unusual case, whereby a central venous catheter was not involved, but the disease was associated with a diabetic foot infection. catheter removal prior to the clearance of infection was noted in many investigations, implying that the removal of the device should be considered and recommended for the treatment of k. kristinae infection. it is also evident that any repeat isolation of k. kristinae from blood cultures can no longer be ignored by either the microbiologist or clinician. a brain abscess caused by kocuria varians has been described, affecting the right occipital region, and was successfully treated with surgical excision and antimicrobial therapy. the potential source of the organism was suspected to be the hematogenous spread to brain parenchyma. the k. varians identification was based on vitek-2, which showed a relatively reduced probability level (93%) ; however, the main drawback in this case was the lack of a 16s rrna gene sequence analysis for species confirmation. cvc placement was suspected to be a possible risk factor for k. varians peritonitis relapse in patients undergoing dialysis, and the treatment of such infections might be a complicated task, as one study demonstrated that k. varians isolated from the environment was capable of producing biofilms. interestingly, one investigation used vitek-2 for the detection of a ventriculoatrial shunt infection by phenotypically variable staphylococcus epidermidis that was masquerading as polymicrobial bacteremia caused by cons and k. varians. therefore, the erroneous identification of cons as kocuria or vice - versa is possible and should be excluded with certainty only through a genome - based analysis. clearly, it is now more important than earlier to confirm whether k. varians indeed can cause different types of infection or not. k. marina and k. rhizophila have also joined the emerging spectrum of kocuria species causing human infections. cases of k. marina peritonitis in patients undergoing capd revealed that dialysis fluid from these patients becoming turbid and straw colored and an increase in white blood cell and platelet counts was noticed ; empirical therapy failed in these cases, and only catheter removal resolved the infection. the first case of k. rhizophila infection was reported in a boy with methylmalonic aciduria where the boy suffered multiple episodes of sepsis for more than two years, and the port - a - cath was shown to be the focus of infection. indeed, the port - a - cath device might have provided a favorable niche for prolonged survival of the organism and subsequent recurrence. k. rhizophila has been widely used as a quality - control strain (american type culture collection-9341) for sterility testing, and a recent case of k. rhizophila infection presented as persistent bsi associated with a damaged cvc in a girl with hirschsprung 's disease ; advanced molecular methods were used for the identification in this case. k. rosea is yet another species capable of causing human infections, and the first report of k. rosea infection describes multiple episodes of febrile neutropenia in a patient with relapsed hodgkin disease undergoing peripheral blood stem cell transplantation. although the isolate was susceptible to vancomycin, its administration did not alter the clinical picture of the infection until the catheter was removed. it was previously reported that k. rosea can cause catheter - related bacteremia and peritonitis ; however, no genotypic identification methods were employed to confirm this, thus the etiology is uncertain. only an abstract was available as the reference in two of three cases because the original publication was not in english ; thus, precise information could not be obtained. slightly more information was available for the third case : the bacteremic patient was human immunodeficiency virus positive and was successfully treated with vancomycin and catheter removal. however, the present study conclusively confirms k. rosea as an opportunistic pathogen that is able to cause peritonitis and bsi. catheter removal was one of the treatment options followed, and the possibility of a cvc line as the portal of entry was suspected. the possibility of biofilm formation on the catheter was attributed to treatment failure in one of the cases, although it was not investigated. conversely, the k. rosea isolated in our case did not produce any biofilm, and hence the hypothesis of biofilm formation appears to be premature. biofilm assays involving a large number of isolates may provide definite answers with regard to the biofilm - forming capability of k. rosea. furthermore, k. rosea strain pks1409 investigated in our study grew well and faster with enhanced pigment production when maintained at 4 c. interestingly, contrary to the earlier observations, our isolate is very close to k. polaris, a known psychrophile isolated from antarctica, as revealed by 16s rrna gene analysis. to sum up, human infections caused by only a few species of kocuria affirm the presence of certain species - specific virulence characteristics that enable these bacteria to cause infections. moreover, several new cases have expanded the clinical spectrum of disease caused by this unusual pathogen. phenotypic identification may fail to recognize all the members of kocuria species because the results of biochemical and carbon assimilation tests are shown to be heterogeneous in different species of kocuria. in reality, these organisms are often not correctly identified and are many times hastily discarded as contaminants. furthermore, accurate identification is difficult because commercially available databases do not include all the classified kocuria species. however, kocuria classification is now typically confirmed by 16s rrna gene sequencing, and one study even used matrix - assisted laser desorption / ionization time - of - flight mass spectrometry for species identification, which appears to be an efficient method. a series of 12 kocuria isolates obtained from a patient (subsequently identified as k. rhizophila by 16s rrna gene sequencing) in a study were ambiguously identified as either belonging to any one of the four different bacterial species, namely, k. varians, k. rosea, dermacoccus nishinomiyaensis and micrococcus luteus, by the vitek 2 id - gpc - card phenotypic system. the id-32 staph system also misidentified approximately four isolates in this collection as either staphylococcus auricularis or s. capitis. another study employing the vitek-2 system initially identified two k. marina isolates as k. varians and staphylococcus hominis ; upon re - examination, they were once again misidentified as k. kristinae and staphylococcus chromogenes, whereas subsequent 16s rrna gene sequencing confirmed these two isolates as k. marina. when subjected to the vitek id - gpc - card panel test, kocuria isolates are positive for only the alanine arylamidase reaction and alkalinization of l - lactate ; strain pks1409 from our case was positive for only five tests in the vitek array. such instances of only a few positive reactions observed in an array of 64 biochemical tests (vitek-2-compact ; biomrieux) with an automated system questions the validity of this identification process. previously, ben - ami. reported on the misidentification of cons as kocuria species by the vitek-2 assay and warned that a clinical specimen yielding kocuria could easily raise suspicion of cons infection. however, recent studies, including ours, correctly identified kocuria using the vitek-2 id - gpc gram - positive identification card, perhaps due to the recently introduced larger database that allows the identification of additional taxa. however, it is not clear whether the vitek-2 gp - system will reduce the number of cons falsely identified as kocuria spp., although there are claims of improvement in specificity after the addendum of new database. however, misidentification among members of the kocuria genus can not be ruled out altogether, as recent studies have reported such occurrences. nonetheless, in a recent screening of 21 kocuria isolates, only one was misidentified, suggesting that the newer vitek-2 has improved efficiency. furthermore, both micrococci and staphylococci are known to show phenotypic variability (pv) that complicates their identification. pv among isolates might be misidentified by phenotypic assays, as biochemical activities may change during growth to allow the microbes to adapt to changing environmental conditions. it has been shown that the pathogenic clinical isolates cultured from blood are more phenotypically variable than the saprophytic strains cultured from skin or mucosal surfaces. because pv is common in s. epidermidis isolates, misidentification of these isolates as kocuria by commercial systems may be frequent and widespread. more troubling is the fact that such errors are likely to occur more frequently with the highly virulent strains of staphylococcus that are known to show high pv. thus, the biochemical analysis - based misidentification of cons as kocuria and vice - versa due to pv appears to be a major problem faced by diagnostic laboratories. a summary of the reports on the misidentification of kocuria by phenotypic systems is given in table 2. despite its limitations, simple tests, such as susceptibility to bacitracin and lysozyme and resistance to nitrofurantoin / furazolidone and lysostaphin, in addition, the typical pigmentation of kocuria colonies generally becomes more distinct with age. hence, the prolonged incubation of a culture for > 48 h is recommended to appreciate the pigmentation better, which can also discriminate the organism from staphylococci. importantly, in most of the previous reports of misidentification, there was no mention of incubation time, and it can be assumed that the plates were kept only up to 24 h, thereby missing the characteristic pigmentation, which may appear some time later. we suggest that clinical laboratories worldwide prolong the incubation time to > 48 h to avoid any chance of misidentification. in particular, our observations revealed massive growth and pigment enhancement of k. rosea at refrigeration temperatures. finally, the identification of kocuria spp. by any number of phenotypic tests should be always placed under suspicion and should be confirmed explicitly by performing molecular assays. multiple episodes of sepsis, febrile neutropenia, and increased platelets, white blood cell counts and c - reactive protein levels are the common manifestations of kocuria infection. although very little is known about the epidemiology and virulence properties of kocuria, the involvement of biofilm in adhesion, colonization and subsequent infection has been suggested. surprisingly, k. rosea pks1409 characterized by us did not produce any biofilm. furthermore, there are no reports of biofilm production by kocuria in the literature, yet it has been implicated in device - related bacteremia, implying that the colonization of kocuria on a device will likely result in chronic recurrent bacteremia in a compromised host. hence, clinicians should not overlook and underestimate the isolation of kocuria from implanted devices. k. kristinae is shown to be a component of the skin and oral cavity flora and has been implicated as a common source of contamination in clinical specimens. interestingly, k. rhizophila is a predominant bacterium isolated from chicken meat treated with oxalic acid. the most likely suspected source of k. rhizophila is patient contact with contaminated meat and dust from the environment, which may result in colonization. the possibility of a cvc line as a portal of entry should also be evaluated. a recent study emphasized the adherence of bacteria to the silastic tube as a possibility for the failure of antibiotic treatment. biofilm production in any pathogen makes them more resistant and difficult to eradicate ; nonetheless, it remains unclear whether kocuria species produce biofilm. the lack of genotypic studies has greatly impacted epidemiological investigations and the understanding of the basic differences between the saprophytic and pathogenic traits of kocuria strains. indeed, an understanding of these aspects may avoid the hasty classification of kocuria as contaminating micrococci in a clinical setup. the lack of proper guidelines and breakpoints for kocuria has forced many studies, including ours, to follow the susceptibility breakpoints used for staphylococcus. as a result, the numerous reports referring to the interpretive values of staphylococcus may cause the misdiagnosis of either sensitivity or resistance. we therefore emphasize the urgent need for the formulation of specific criteria for interpreting susceptibility in kocuria species. a recent review analyzed the antibiotic resistance patterns of various kocuria species and their clinical impact. most kocuria isolates were reported to be susceptible to many of the first- and second - line drugs, with the exception of ampicillin and norfloxacin. decreased cell wall permeability and the presence of efflux pumps the recently sequenced genome of k. rhizophila has revealed the presence of many proteins that are predicted to be involved in multidrug efflux mechanisms, although their role in imparting resistance is not clear. szczerba proposed amoxicillin / clavulanate along with such drugs as ceftriaxone, cefuroxime, doxycycline and amikacin as a first - line therapy against micrococcal pathologies. in addition, it has been suggested that the treatment duration should depend on the type of infection. the infusion of antibiotics in a catheter lock or catheter removal appears to be the best option for the treatment of implant - related sepsis. as there are no evidence - based guidelines for the management of kocuria infections, previously reported successfully treated cases can only become the guiding principle for treating kocuria infections. unfortunately, the skill required and high cost involved in molecular assays may limit their use in routine practice, and consequently, kocuria species misidentification in many laboratories is likely to continue for some time. however, it is probable that the prevalence of kocuria infections in coming years may increase as genome - based identification becomes routinely available. the first indication of such a scenario becoming true has been observed through the numerous new cases of kocuria infections being reported in a short span of time. owing to misidentification over the years hence, it is suggested that physicians should not underestimate the importance of kocuria spp. when isolated from clinical samples, particularly from blood and inert medical implants. furthermore, cause for concern remains, as therapy guidelines for illnesses involving kocuria are lacking, mainly due to the absence of established criteria for evaluating the killing and/or growth inhibition of kocuria in the presence of antibiotics. although a comprehensive view of kocuria infections will have to await the documentation of many more cases, several recent reports of kocuria species as the cause of different diseases clearly reveal the expanding clinical spectrum of infections caused by kocuria. | although not previously known to cause human infections, kocuria species have now emerged as human pathogens, mostly in compromised hosts with severe underlying disease. recently, there has been an increasing incidence of different types of kocuria infections reported, most likely due to the adoption of better identification methods. here, we report a case of peritonitis caused by kocuria rosea in a diabetic nephropathy patient who was on continuous ambulatory peritoneal dialysis. sepsis and peritonitis caused by k. rosea in our case yielded two identical kocuria isolates from the peritoneal dialysate fluid within a period of three days. the infection was subsequently resolved by antibiotic treatment and catheter removal. in addition to reporting this case, we herein review the literature concerning the emergence of kocuria as a significant human pathogen. the majority of cases were device - related, acquired in the hospital or endogenous, and different kocuria species appear to share a common etiology of peritonitis. the overall disease burden associated with kocuria appears to be high, and the treatment guidelines for diseases associated with kocuria have not yet been clearly defined. |
figure s1. molecular phylogenetic analysis of 18s rdna sequences of various green algal species by maximum likelihood method. figure s2. molecular phylogenetic analysis of 28s rdna sequences (d1d2 region) of various green algal species by maximum likelihood method. nucleotide sequence alignment of the its1, 5.8s rdna and its2 regions from chlamydomonas raudensis sag 49.72 (kp981643) and chlamydomonas sp. uwo 241. nucleotide sequence alignment of genbank jn903981 and the resequenced partial 18s rdna sequence from chlamydomonas raudensis sag 49.72. uwo 241 (panels a, b and c), and chlamydomonas raudensis sag 49.72 (panels d, e and f). labels indicate cells chloroplast (c), eyespot (e), flagellum (f), pyrenoid (p) and apical vacuole (v). | the antarctic psychrophilic green alga chlamydomonas sp. uwo 241 is an emerging model for studying microbial adaptation to polar environments. however, little is known about its evolutionary history and its phylogenetic relationship with other chlamydomonadalean algae is equivocal. here, we attempt to clarify the phylogenetic position of uwo 241, specifically with respect to chlamydomonas raudensis sag 49.72. contrary to a previous report, we show that uwo 241 is a distinct species from sag 49.72. our phylogenetic analyses of nuclear and plastid dna sequences reveal that uwo 241 represents a unique lineage within the moewusinia clade (sensu nakada) of the chlamydomonadales (chlorophyceae, chlorophyta), closely affiliated to the marine species chlamydomonas parkeae sag 24.89. |
obstetric haemorrhage is the most common cause of maternal mortality in the developing world. in egypt, postpartum haemorrhage is the most frequent cause of maternal mortality, constituting 33.4% of maternal mortality. advances in the prevention and management of atonic postpartum haemorrhage include new uterotonics such as misoprostol, new administration technologies for established uterotonics, such as oxytocin in uniject, balloon compression devices, and uterine compression sutures. however, these advances do not benefit women with nonatonic aetiologies. previous estimates considered uterine atony to be responsible for the majority of postpartum haemorrhage mortality. in other studies of severe haemorrhage, nonatonic aetiologies were found to be more common than expected. the nonpneumatic antishock garment (nasg) (zoex corporation, ashland, ore, usa) is a neoprene and velcro lower - body first aid pressure device for hypovolaemic shock made up of nine horizontal segments : three per leg (ankle, calf, and thigh), one for the pelvis, and a larger segment with a small foam compression ball for the abdomen. this device reverses shock by decreasing the transmural pressure and radius of the blood vessels in the lower body, thus decreasing blood flow to the abdomen and lower body and redirecting blood to the core organs. when a woman is experiencing obstetric haemorrhage, this device can restore her consciousness, pulse, and blood pressure, and it can buy her time to receive definitive therapy. the nasg is relatively low cost at $ 170 usd per garment which can be used approximately 40 times. the nasg is uniquely applicable as a first aid device in settings where delays in management are common. it also allows complete access to the perineal area enabling vaginal procedures without unfastening the garment and has an easily opened abdominal segment enabling surgery while the rest of the garment remains closed. we have previously published the outcomes of a pilot study in egypt (n = 364), an interim analyses of a small (n = 169) study at one facility in nigeria and a larger study in egypt (n = 990). this is a subgroup analysis of the latter egypt study which examines women with obstetric haemorrhage and shock due to nonatonic aetiologies treated with standard protocol versus nonatonic aetiologies treated with standard protocol plus nasg. in this study, 434 women were recruited from the emergency admissions of two referral hospitals in egypt ; assiut university women 's health centre (13500 deliveries annually) and el galaa teaching hospital in cairo (20000 deliveries annually). both facilities receive referrals from home deliveries and lower level facilities, and both are staffed by consulting obstetricians and residents. women were eligible regardless if they began haemorrhaging outside the facility and were transferred in or began haemorrhaging in the facility. included in this analysis were women with obstetric haemorrhage and shock due to any of the following aetiologies : ectopic gestation, trophoblastic disease of pregnancy, placenta praevia, accreta or abruption, ruptured uterus, or vaginal or cervical lacerations. all women had an estimated blood loss > 1000 ml, a pulse > 100 beats per minute, or systolic blood pressure (sbp) 100, pulse 1.5 mg / dl or increased > 1.0 mg / dl above baseline, oliguria ; < 120 ml output in 4-hour intervals), and heart failure (impairment of cardiac function according to new york heart disease classification). the secondary outcomes were cumulative blood loss measured hourly after study admission with the calibrated drape and morbidity and mortality as individual variables. the indicator of the severity of the woman 's condition at study entry was mean arterial pressure (map = [2diastolic blood pressure + systolic blood pressure]/3) on study admission. women with map < 60 mmhg were considered to be in more severe shock. hospital residents and nurses were trained in the standardized protocol for management of obstetric haemorrhage and shock, blood collection and measurement, and completion of data collection forms. all data were collected by the clinicians as they cared for or immediately after caring for the patient in shock. all data collection forms were reviewed by egyptian principal investigators and quality control was conducted regularly during each study phase to resolve any disagreement or inconsistency., on, canada) to statisticians at the university of california, san francisco (ucsf) to be entered and analysed. participants ' demographic characteristics, condition on study entry, and treatment received in the two study phases were compared using t - tests (assuming unequal variances in the two phase populations) and chi - square tests of independence. relative risks (rr) and 95% confidence intervals were computed for the primary outcome, eaos, and for the secondary outcomes, mortality and severe morbidity. mean measured volume of blood loss in the drape was compared across phases with t - tests. women in the two study phases were comparable regarding demographic characteristics and duration of gestation. in the preintervention phase, there were more women with placenta praevia (p = 0.014). in the nasg phase, there were more women with vaginal or cervical lacerations (p = 0.001) (see table 1). women in the nasg phase had significantly more estimated revealed and concealed blood loss (table 1). in addition, more women in the nasg phase were in severe condition (map < 60 mmhg) upon study entry : 24.5% as compared to 15.6% in the preintervention phase. treatment variables (table 2) show significantly fewer women in the nasg phase receiving either 1500 ml crystalloid fluids or a blood transfusion in the first hour (p < 0.001). by the end of the study admission, there was no difference in the proportion of women who received a blood transfusion. mean measured blood loss was significantly lower in the nasg phase (p < 0.001). there were more eaos in the preintervention phase although the difference was not statistically significant. more women died in the nasg phase while fewer women experienced severe morbidities ; neither were statistically significant (table 3). use of the nasg did not confer any significant increase in the side effects that were investigated, in fact there was significantly less nausea and vomiting in the nasg phase (table 4). the study results agree with previous research that the nasg is useful for patients with obstetric haemorrhage of nonatonic aetiologies. the effect of nasg on the combined variable, eao, and on severe morbidity for women with nonatonic aetiologies confirms previous reports of the benefit of nasg for all obstetric haemorrhage aetiologies. this is a promising finding given the fact that women with these aetiologies will often need surgery, which in many low - resource countries may not be feasible or may be delayed due to personnel or logistic barriers. the higher mortality in the nasg phase may be because of the worse condition of women on study entry. however, this finding is based on a sample size too small to draw meaningful conclusions ; it may be due to chance. however, as the conditions of patients on study entry in the nasg phase were worse, this is unlikely. some cases of obstetric haemorrhage at the facilities may not have been enrolled, as some providers did not participate in the study, but such missed cases would have been very small in number. further, hospital level statistics for both sites showed that no mortality or severe morbidity was missed, so it is unlikely that the effectiveness of the nasg is over - estimated. the results regarding blood loss confirm the previous findings that the nasg reduces blood loss in obstetric haemorrhage. the effect on revealed blood loss reported in this study was 113 cc difference, which may not be clinically significant. however, this may partially explain the beneficial effect of the nasg on patient outcomes. on the other hand, this positive effect on the general outlook of the patients may have a negative effect on the speed of resuscitation. the fact that women in the nasg phase received less iv fluids and blood in the first hour may be explained by complacence in response to the improvement in the general conditions as a result of the device. physicians may have been in less haste to infuse fluids and give blood after seeing the beneficial effect of the nasg on the vital signs, level of consciousness, and decreased blood loss. providing inadequate resuscitation or delaying management may adversely affect outcomes for women in the nasg. the lack of statistical significance of the difference between eao during the two phases might be due to a lack of power of the subanalysis of nonatonic aetiologies. the sample size calculation was done to power the full study, which included all obstetric haemorrhage aetiologies, to detect differences in the outcomes. the power calculation conducted with epi info version 6 showed that the study would need to include 2584 women in each arm to have 80% power and 95% confidence to detect a 1.5% difference in eaos. a third explanation may be the less timely use of resuscitation received by women in the nasg phase. this question remains largely unanswered and requires a study that is powered for these aetiologies and in which treatment would begin rapidly in both phases. the nasg may be a promising first aid device in the management of obstetric haemorrhage due to nonatonic aetiologies in tertiary level facilities in low - resource settings. the promise of the nasg can only be realized along with rapid implementation of shock and haemorrhage protocols. in the absence of other advances to manage these conditions, it is worthwhile to study the effectiveness of the nasg for nonatonic aetiologies in a study powered to demonstrate significant differences in outcomes. | the study aims to determine if the nonpneumatic antishock garment (nasg), a first aid compression device, decreases severe adverse outcomes from nonatonic obstetric haemorrhage. women with nonatonic aetiologies (434), blood loss > 1000 ml, and signs of shock were eligible. women received standard care during the preintervention phase (226) and standard care plus application of the garment in the nasg phase (208). blood loss and extreme adverse outcomes (eao - mortality and severe morbidity) were measured. women who used the nasg had more estimated blood loss on admission. mean measured blood loss was 370 ml in the preintervention phase and 258 ml in the nasg phase (p < 0.0001). eao decreased with use of the garment (2.9% versus 4.4%, (or 0.65, 95% ci 0.241.76)). in conclusion, using the nasg improved maternal outcomes despite the worse condition on study entry. these findings should be tested in larger studies. |
various regional and general anaesthesia (ga) techniques have been tried and used with success for renal surgeries. ga is usually preferred by the anaesthesiologists and surgeons because of the discomfited body position during prolonged renal surgical procedures. however, this is avoided by the use of sedative agents along with regional anaesthesia (ra). ga is considered to provide superior muscle relaxation and controlled diaphragmatic motion during the surgery. recent investigations have revealed that ra can be safely used for renal surgeries including donor nephrectomy and renal transplantation as well. moreover, minimal need for blood transfusion, lower incidence of toxicity from anaesthetic agents, good post - operative pain relief and fewer post - operative complications make ra a safer option as compared to ga. its distinctive properties render it suitable for premedication, as an anaesthetic adjuvant for general and regional anaesthesia, as well as for post - operative sedation and analgesia. dexmedetomidine has been found to be a better epidural adjuvant with more stable cardio - respiratory parameters and higher sedation scores as compared with clonidine. the use of 2-adrenergic agonist agents as adjuncts to local anaesthetics in neuraxial anaesthesia improves the quality of the block, provides good intra - operative sedation and prolongs post - operative analgesia. 2-adrenergic agonists are also free of the side - effects commonly associated with the use of opioids in neuraxial anaesthesia such as pruritis, nausea and vomiting, urinary retention, respiratory depression and so on.. very little amount of the drug is excreted unchanged in the urine or faeces. keeping in view the safety profile of epidural anaesthesia and remarkable properties of dexmedetomidine as epidural adjunct, a prospective, comparative study was designed in patients undergoing elective renal surgeries under ga or epidural anaesthesia with ropivacaine and dexmedetomidine in a randomised manner. the aim of the study was to compare the surgical conditions, surgeon 's satisfaction intra - operatively and patient 's satisfaction in the post - operative period in the two groups. the secondary outcome was to compare the haemodynamic parameters and the side - effects associated with the two anaesthesia techniques. after obtaining permission from the institutional ethical committee, 100 american society of anaesthesiologists (asa) class - i and ii adult patients of either gender in the age group of 25 - 55 years undergoing renal surgeries (pyelo - lithotomy, uretero - lithotomy, and nephrectomy) were enrolled in the study [figure 1 ] exclusion criteria included patients with diabetes mellitus, uncontrolled hypertension, cardiac rhythm disturbances, obesity, severe pulmonary disease, hepatic impairment, deranged coagulation profile, cerebrovascular disorder and refusal for epidural anaesthesia. the patients were randomly assigned using sealed envelope technique into two groups of 50 patients each : group g and group e. group g patients were administered conventional ga while group e received epidural anaesthesia. consolidated standards of reporting trials flow diagram all patients received ranitidine 150 mg as premedication a night before and on the morning of surgery with a sip of water. in the operation theatre, intravenous (iv) access was secured with 18 g cannula and all patients were pre - loaded with 10 ml / kg of ringer lactate solution. standard monitoring included electrocardiogram, pulse oximetry (spo2), non - invasive blood pressure, urinary output and respiratory rate (rr). in group g, induction of anaesthesia was achieved with propofol 2 mg / kg, butorphanol 0.02 mg / kg, isoflurane, oxygen and vecuronium 0.1 mg / kg as a muscle relaxant to facilitate endotracheal intubation with appropriate sized endotracheal tube. maintenance of anaesthesia was achieved with isoflurane (1 mac), oxygen in nitrous oxide with the ratio of 40:60 and vecuronium as a muscle relaxant as and when required. isoflurane and nitrous oxide were tapered before the anticipated end of surgery and stopped during the completion of skin closure. an intravenous (iv) infusion of diclofenac sodium (75 mg) was given just before the conclusion of surgery for post - operative analgesia. the patients were extubated after adequate recovery and thereafter kept in the recovery room for 4 h and vital parameters as well as side - effects were observed for and treated as and when required. post - operative analgesia was maintained with supplemental doses of tramadol 50 mg in addition to 8 hourly doses of diclofenac sodium. in group e, with patient in a sitting position epidural space was identified with 18 g touhy needle in l2-l3 or l3-l4 intervertebral space with the loss of resistance to air technique. epidural catheter was threaded, directed cephalad and secured. after confirming negativity of test dose, 3 mg / kg of ropivacaine up to a maximum of 150 mg (20 ml of 0.75%) admixed with 1 g / kg of dexmedetomidine was injected through the catheter into the epidural space. sensory levels were checked with bilateral pin - prick method while motor blockade was assessed with modified bromage scale (0 = no block, 1 = inability to raise extended leg, 2 = inability to flex the knee and 3 = inability to flex ankle and foot). abdominal muscle relaxation was assessed by using the rectus abdominis muscle (ram) score 10, 20, and 30 min after the injection. ram score ranged from 0 to 5 ; 0, full motor activity and 5, full abdominal muscle relaxation. the ram - test was performed as follows : the patient was made to lie in the supine position with no pillow and legs extended. to test the abdominal muscle blockade, the patient was asked to come up slowly and with a curled trunk from the supine to a sitting position and the block was graded accordingly [table 1 ]. patients were turned to kidney (lateral) position after complete establishment of sensory and motor block. the post block parameters observed included : initial period of onset of analgesia (from administration of the drug to the establishment of sensory analgesia at t-10 dermatome level) ; the highest dermatomal level of sensory analgesia ; the complete establishment of motor blockade (from administration of the drug to time to achieve bromage scale iv), patient comfort during surgery, surgical conditions as assessed by the surgeon, regression of analgesic level to s1 dermatome and time to complete recovery (from the onset of motor block to mean time to return to bromage degree 1 block). the sedation level in group e was assessed using observer 's assessment of alertness scale (oaa / s). sedation scores were recorded just before the initiation of surgery and thereafter every 20 min during the surgical procedure. ram test of abdominal muscles the criteria for surgeon 's satisfaction included the surgical field bleeding, immobility of the patient, degree of muscle relaxation and the quality of post - operative analgesia in the ward. patient satisfaction criteria included any pain or discomfort during surgery and in the post - operative period. these scores were measured by the questionnaires prepared during the planning stage of the study. hypotension was defined as fall in systolic blood pressure 25% of the baseline and was treated with iv fluids and injection mephenteramine in aliquots of 3 mg. bradycardia, a decrease of heart rate 25% of the baseline was treated with 0.3 mg bolus dose of atropine. side - effects such as nausea and vomiting, headache, respiratory depression, shivering and dry mouth were noted during the post - operative period in both groups as well as in the intra - operative period in group e. at the end of the study period, all the data were compiled and subjected to statistical evaluation by a bio - statistician with statistical package for social sciences (spss) version 17 for windows. the parametric and normally distributed data in the groups were compared with anova for repeated measurements so as to identify the differences between the groups. a total of 100 patients were enrolled in the present study and were randomly divided into two groups. various demographic characteristics such as age, gender distribution, asa physical status, body mass index, duration of surgery and total anaesthesia time were comparable in both groups and no significant difference was observed [table 2 ]. the demographic variables in the group g and e the surgical conditions were excellent to fair in the majority of the patients in both groups. in few patients, 10% in group g and 4% in group e, adequate muscle relaxation was not achieved and the surgeon was not satisfied [table 3 ]. surgical satisfaction scores and overall patient 's satisfaction besides intra - operative evaluation exclusively in group e, post - operative satisfaction scores were also recorded in both groups. majority of patients were satisfied with the type of anaesthesia administered. however, the patient satisfactory scores were significantly higher in group e as compared with group g on overall statistical evaluation (p = 0.038). patient in group e had good intra - operative sedation without the addition of any iv sedation. majority of the patients in group e had a score of 3 or 4 on oaas / s. table 4 shows the various block characteristics in group e patients which however can not be compared with group g. block characteristics in group e patients fewer side - effects were observed in group e as compared with group g [table 5 ]. the incidence of headache in the post - operative period was comparable in both the groups (p = 0.64). the other side - effects such as, nausea and vomiting, respiratory depression and shivering were observed more frequently in group g patients. however, the incidence of dry mouth was much higher in group e patients (34%) as compared with group g patients (8%) which were highly significant on statistical analysis (p < 0.001). while choosing an anaesthetic technique for any surgical procedure, desirable characteristics include stable haemodynamic parameters, minimal blood loss intra - operatively, early ambulation, good post - operative analgesia and lower incidence of various side - effects such as nausea and vomiting, shivering, cough, headache, respiratory depression and so on. ga has remained the most popular technique for renal surgeries because of the discomfited body position during prolonged renal procedures. general anaesthesia carries its own risks and complications such as stress response and cardiac complications during induction of anaesthesia, airway difficulties during intubation, awareness during surgical procedures, need for supplementing analgesia in the post - operative period, additive contribution from comorbidities, difficult extubation, post - operative restlessness, over - sedation and agitation. a higher incidence of side - effects like nausea and vomiting can make ga a very unpleasant experience. in one of the studies, it was observed that epidural anaesthesia was safer than ga in patients with deranged renal functions. previous studies have compared combined spinal - epidural anaesthesia and ga for donor nephrectomies and renal transplantation. the only disadvantage with the combined approach is the haemodynamic instability and unpredictable sensory blockade levels. taking advantage of the good haemodynamic profile characteristics of ropivacaine and excellent sedative properties of dexmedetomidine, we planned our study to compare ga and epidural anaesthesia in patients undergoing various renal surgeries. the demographic profile of patients in both groups was similar which provided a very neutral ground for comparing the efficacy of two entirely different techniques. there were no statistically significant change in the heart rate, blood pressure, respiratory rate and oxygen saturation during the surgery as compared to baseline except during two stressful periods in ga, intubation and extubation. addition of dexmedetomidine to ropivacaine in the present study helped in achieving the objective of effective neuraxial anaesthesia with good operating conditions and patient comfort during the surgical procedure. previous studies comparing neuraxial and ga for donor nephrectomies did not observe any significant difference in the levels of surgeon 's satisfaction during the peri - operative period. addition of dexmedetomidine to local anaesthetics is associated with a rapid onset and establishment of action of local anaesthetics, enhanced post - operative analgesia and dose sparing of local anaesthetics. dexmedetomidine provided good intra - operative sedation and most of the patients were sleeping comfortably during the surgical procedure. majority of the patients had a score of 3 - 4 on oaas / s. the side - effect profile in both groups was strikingly different as a significant number of patients in group g suffered from pain (38%), nausea and vomiting (16%) and shivering (22%) in the post - operative period. in spite of administration of butorphanol, the incidence of shivering was surprisingly high in the group g. the lower incidence of shivering in group e patients can probably be explained on the basis of anti - shivering properties of dexmedetomidine. peri - operative administration of dexmedetomidine markedly diminishes the incidence of shivering in patients undergoing laparoscopic surgeries. though no typical headache was observed in both groups, any discomfort in the cranial region (6% in group g vs. 4% in group e) was included in the side - effect profile and was clubbed under headache. the only statistically and clinically significant side - effect observed in group e patients as compared to group g patients was a higher incidence of dry mouth (34%) during later part of intra - operative and early part of the post - operative period. drying up of secretions resulting in dry mouth is a typical side - effect of -2 agonists, which has been observed by various authors after administration of dexmedetomidine and clonidine. until date, there is no solution for this side - effect and patients were administered 5 ml of distilled water by wetting the lips so as to get relief from this discomfort. one of the remarkable properties of dexmedetomidine includes complete elimination by metabolism with hepatic extraction accounting for 70% of the metabolic pathway. renal blood flow and renal clearance has no role to play in metabolism or elimination of dexmedetomidine as literary reports confirmed no traces of unchanged dexmedetomidine in urine. these properties will provide another added advantage of dexmedetomidine to be used in ra in patients with deranged renal functions as compared with ga, but not in hepatic dysfunction. epidural anaesthesia with ropivacaine and dexmedetomidine can be safely and effectively used in patients undergoing renal surgeries as compared with conventionally used ga technique. surgical conditions and patient satisfaction scores show only marginal difference in favour of epidural anaesthesia, but sedation scores are better with epidurally administered ropivacaine and dexmedetomidine. | background and aims : neuraxial anaesthesia has become popular for the renal surgeries during the last few years. this study was aimed at comparing general anaesthesia (ga) with epidural anaesthesia in patients undergoing renal surgeries.methods:one hundred american society of anaesthesiologists (asa) physical status - i and ii adult consenting patients of both gender in the age group of 25 - 55 years undergoing renal surgeries were randomly assigned to two groups of 50 patients each : group g and group e. group g patients were administered conventional ga while group e received epidural anaesthesia (ea) with 3 mg / kg of ropivacaine and 1 g / kg of dexmedetomidine. besides cardio - respiratory parameters, surgeon 's satisfaction, patient 's satisfaction and side effects were observed. parametric data were analysed by anova while non - parametric data were compared with mann whitney u - test and wilcoxon test. value of p < 0.05 was considered statistically significant.results:the demographic profile, total anaesthesia time, surgical time and haemodynamic parameters and surgeon 's satisfaction scores were comparable in both groups. patient 's satisfaction scores were better in group e during the post - operative period. incidence of side - effects such as nausea and vomiting and shivering were higher in group g (p < 0.001) while the incidence of dry mouth was higher in group e (p < 0.001).conclusion : epidural anaesthesia with ropivacaine and dexmedetomidine can be safely and effectively used in patients undergoing renal surgeries. |
onychomycosis (om) denotes infection of nails caused by dermatophyte fungi, non - dermatophyte fungi or yeast and represents about 30% of cutaneous mycotic infections. it is the most common nail disease and accounts for approximately 50% of all onychopathies. various factors including age, trauma, sports activity, diabetes, hiv, poor peripheral circulation, occupation and climate influence the prevalence, etiology, progression and treatment outcome of om. it can be caused by dermatophytes, yeasts (candida albicans) and non - dermatophyte molds (ndm) (acremonium, aspergillus, fusarium, onychocola canadensis, scopulariopsis brevicaulis, scytalidium dimidiatum). dermatophytes are the most frequently implicated agents and out of these trichophyton rubrum and trichophyton interdigitale (formerly trichophyton mentagrophytes var interdigitale) are responsible for nearly 90% of toenail and at least 50% fingernail om. several clinical types of om have been recognized and recently a new classification has been proposed by hay. primary includes clinical variants like distal lateral subungual onychomycosis (dlso), superficial onychomycosis (so), endonyx onychomycosis (eo), proximal subungual onychomycosis (pso), mixed pattern onychomycosis (mpo) and total dystrophic (tdo). diagnosis is primarily based upon koh examination, culture and histopathological examination of nail clippings or nail biopsies. relapse of om depends on several factors, including genetic predisposition, reduced nail growth rate in elderly and underlying disease e.g., psoriasis, peripheral vascular diseases, diabetes, immunosuppression, hiv infection, and cigarette smoking. choice of treatment is based upon factors like patient 's age, infecting fungus, number and degree of nails involved, co - morbid conditions and possible drug interactions. the correct etiological diagnosis is important in deciding the best antifungal agent warranted in a particular case. this study comprised of 100 koh and culture - proven patients of dermatophyte toenail om. a clinical diagnosis of om was made on the basis of findings that included whitish or brownish yellow opacities in the nail, subungual hyperkeratosis, dystrophy and/or onycholysis. all patients underwent detailed history pertaining to age, sex, duration and progression of the disease, occupation, history of preceding trauma ; co - morbid conditions e.g., diabetes, immune suppression, etc., a thorough clinical examination including systemic examination and cutaneous examination for evidence of co - existent fungal infection in the fingernails and other body part was performed. nails were examined for number of involved nails, pattern and extent of involvement and findings were recorded in a predesigned proforma. clinical diagnosis was confirmed by positive koh wet mount and isolation of fungus on culture. site was cleaned with 70% alcohol and full thickness clippings from the discolored, dystrophic, brittle nail (as proximal as possible) were obtained. the specimen collected was examined under direct microscopy and cultured immediately or was placed in a sterile dry container in case of delay. the direct examination was carried out in koh at 30 - 40% with glycerine and followed by tube koh. g / l), gentamicin (20 mg / l) and cycloheximide (0.5 all inoculated tubes were incubated at 25c for optimal growth. in case of growth, an etiological agent was confirmed by the characteristic morphology of the colony and by studying the microscopic appearance of the fungus on lacto phenol cotton blue (lpcb) mount. the age of the study population ranged from 21 to 75 years (mean age 42.4 13.5 years), with maximum patients (40%) belonging to the 31 - 45 years age group. there was a striking male (87%) preponderance (m : f = 6.7:1). the duration of disease ranged from 3 to 240 months (mean duration 54.1 46.9 months) with 29% having disease duration of more than 5 years. demographic characteristics of 100 study patients concomitant medications included oral steroids for chronic obstructive pulmonary disease and anti - tubercular therapy for pulmonary tuberculosis in two patients each. coronary artery disease with or without hypertension was reported by six patients and five of them had diabetes, of which one had poor glycemic control. thirty - three (33%) patients had fingernail om in addition to the toenail involvement and 37 had evidence of co - existent tinea pedis of which two had extensive tinea corporis also. discoloration was the most common symptom (98%) followed by brittle nails (89%). the average number of infected toenails was 5.4 2.2 ; 28 (28%) had involvement of at least eight toenails. thirty - three (33) patients (32 patients with dlso and 1 with dlso + so) complained of pain due to paronychia. paronychial inflammation was caused by t. interdigitale, t. rubrum and t. verrucosum in 17, 14 and 2 patients, respectively. dslo was the most common morphological variant seen in 97 followed by so and pso in 3 and 2 patients, respectively. t. interdigitale was the most common fungus isolated on culture in 61 patients followed by t. rubrum (34%) and t. verrucosum (5%) [figure 2 ]. though so was caused by t. rubrum and t. verrucosum, t. interdigitale and t. rubrum were isolated in mixed pattern dlso and so in one patient each [table 2 ]. clinical variants of onychomycosis in the study patients etiological agents of onychomycosis in the study patients correlation between clinical type of onychomycosis and the causative fungi there was no significant correlation between the causative dermatophyte isolated and clinical type of om, age and sex of the patient, fingernail involvement and presence of tinea infection at other body sites. the incidence of om is on the rise because of several predisposing factors such as ageing population leading to increase in chronic health problems such as diabetes and poor peripheral circulation ; an increase in the number of immunocompromised persons because of hiv infection and immunosuppressive therapies, antibiotics, avid sports participation leading to increasing use of health clubs, communal swimming pools and occlusive footwear for exercise. the prevalence of om is known to increase with age but of late various studies from india and worldwide have shown a lower mean age of 41.35 years, 29.40 years and 34.96 years. consistent with this, the mean age of the study population was 42.4 years in our study and 40% of the patients belonged to the age group of 31 - 45 years. similar observation of predominance of patients in the younger age groups has been reported in different studies from west as well as india. the higher incidence of toenail om in younger population could be attributed to the higher exposure of occupation and sports related trauma and use of occlusive footwear. in addition, younger population is usually cosmetically conscious and therefore seeks early and frequent dermatologic consultation. the remarkable male preponderance in toenail om has been previously reported by vijaya. and has been attributed to the more pronounced outdoor activity in men resulting in higher incidence of trauma and use of occlusive footwear. the mean duration of disease was 54.1 months (approximately 4.5 years) which is significantly lower than that of 8 - 12.3 years, reported in different studies. the lower mean disease duration in our study could be because of predominance of cosmetically conscious younger population seeking early dermatologic consults for treatment. diabetes is a known risk factor for om predominantly due to its effect on microcirculation. similar association has been found in studies from france (5%) and denmark (6.7%) and new delhi, india (3.9%) on the other hand, a higher prevalence (20% and 11.8%) of diabetes in om has been reported from southern indian states. om secondary to steroid - induced immune suppression was found in three patients though hiv screening has not been routinely recommended in patients of om. an association with immunosuppression (1%) has also been reported by guibal. significant family history of om in 26% and 7% has been reported by gupta. and kaur. only one patient had family history of om and this could be explained by the high number of male migrant laborers in the study who are staying away from home. moreover, they may be unaware of the presence of this relatively asymptomatic and benign disease in other family members. most of the clinico - mycological studies have included the patients with om involving both toenails and fingernails and have taken into account om caused by dermatophytes as well as yeast and ndm. thirty - three (33%) patients in our study had coexisting om of fingernails. t. interdigitale was the most common isolate seen in 20/33 patients followed by t. rubrum (11/33) and t. verrucosum (2/33). in most of these patients, fingernail involvement followed toenail infection that could have been a source of infection. thirty - seven patients (37%) in our study had evidence of cutaneous fungal infection elsewhere in the body. t. interdigitale was the most common isolate seen in 24/37 patients followed by t. rubrum (11/37) and t. verrucosum (2/37). this aspect has not been studied in the previous studies. this was more common in patients who had extensive and long - standing disease. discoloration was the most common symptom (98%), followed by brittle nails (89%). pain was reported by 33 patients (33%) and these patients had evidence of paronychial inflammation. kaur. have reported the occurrence of discoloration in 100% of patients and pain in 17% of patients, while gupta. it has been suggested that appropriate antifungal therapy should be started without waiting for test results when dermatologists consider om as the most probable diagnosis in the presence of plantar desquamation because under such circumstances clinical diagnosis is at least as accurate as laboratory tests. studies referring to the clinico - mycological profile of patients with dermatophyte toenail om are lacking. in our study, dslo pattern was seen in 94 patients, swo in 2 and pso in 1 patient. three patients had a combination of dlso and swo ; of these two cases were due to t. interdigitale while t. rubrum was isolated from the third patient. in a study from new delhi, t. rubrum was the most common etiological fungus for dlso and the only etiological agent for pso. in this study, the most common isolated fungus was t. interdigitale (61%), followed by t. rubrum (34%) and t. verrucosum (5%). this was in contrast to the commonly reported prevalence of dermatophytic fungi in om reported in various indian studies [table 3 ] and worldwide [table 4 ]. twenty - five of the 76 patients studied (32.9%) had involvement of 8 nails. number of nails involved was 5 nails in 57.6% of patients in a study by gupta. prevalence of various dermatophytic species causing onychomycosis in different parts of india prevalence of various dermatophytic species causing onychomycosis in different parts of world previous studies from delhi published in 2008 have reported t. rubrum to be the most common etiological fungus for om. however, we found t. interdigitale to be the most commonly isolated species in our study. this indicated that there is a continuous change in the epidemiological and mycological characteristics of om in the same population as well as the geographical region. therefore, it is imperative to be aware of these changing patterns and causative fungi for making adequate strategies for prevention and treatment of this infection. onychomycosis more commonly presents in male with a predominance of patients in the younger age groups.dlso is the most common pattern and discoloration is the most common symptom of onychomycosis in our region.t. interdigitale is the most common dermatophyte, followed by t. rubrum and t. verrucosum causing onychomycosis in our region. onychomycosis more commonly presents in male with a predominance of patients in the younger age groups. dlso is the most common pattern and discoloration is the most common symptom of onychomycosis in our region. t. interdigitale is the most common dermatophyte, followed by t. rubrum and t. verrucosum causing onychomycosis in our region. | introduction : there is a constant need to define the epidemiological and mycological characteristics of onychomycosis (om) for optimal management strategies.objectives:to define the epidemiological and mycological characteristics of patients with dermatophyte toenail om in a tertiary care hospital.materials and methods : hundred consecutive patients of koh and culture - positive dermatophyte toenail om were subjected to detailed history, clinical examination and investigations.results:maximum number of patients (40%) belonged to 31 - 45 years age group and there was a male preponderance (m : f = 6.7:1). the mean duration of disease was 54 months. thirty - three patients had fingernail involvement in addition to the toenail om and 37% had co - existent cutaneous dermatophyte infection. discoloration was the most common symptom (98%). ninety - four (94%) patients had distal lateral subungual onychomycosis (dslo) while two had superficial onychomycosis (so) and only one had proximal superficial onychomycosis (pso). trichophyton interdigitale was the most common etiological agent (61%) followed by trichophyton rubrum and trichophyton verrucosum.conclusions:toenail om is more common in males. dslo was the most common clinical variant and t. interdigitale the most common etiological fungus responsible for toenail om in our region. the importance of early diagnosis and treatment is highlighted as long - standing toenail om predisposes to fingernail onychomycosis and recurrent tinea pedis. |
the cell nucleus is the most prominent compartment in the eukaryotic cell. in this compartment many essential cellular activities take place, such as genome replication, control of gene expression and transcription, processing of transcripts and dna repair. for a long time, however, the cell nucleus has been considered as a static and scarcely structured compartment. the nucleus was thought to be substantially altered only during cell division, following formation of metaphase chromosomes and partitioning of the chromosome complement into daughter cells. another common image of the nuclear compartment has been that of a contingent cellular region where nuclear components are randomly located. this static view of the cell nucleus has drastically changed in recent years mainly due to technical advances in the field of microscopy. the cell nucleus is presently considered as a highly complex and organized compartment where nuclear components tend to occupy non - random positions, leading to a precise definition of the nuclear architecture concept (see [13 ] for recent reviews). the cell nucleus is an extremely dynamic structure where many components tend to rapidly and transiently interact with each other, giving rise to a highly ordered compartment. as these properties characterize open and self - replicating chemical systems, the idea of the cell nucleus as a self - organizing entity has been proposed. the double strand of dna, a major component of chromatin, and therefore of the nuclear compartment, can udergo chemical modification in the form of cytosine methylation of cpg dinucleotides. this biochemical modification does not alter the subjacent genetic information of the dna molecule, and is considered to be an epigenetic mark in the genome. the impact of such dna epigenetic modification within the scope of nuclear function and disease has been the subject of intense investigation (see [46 ] for recent reviews). such work has clearly established that proper dna methylation in definite regions of the genome, such as gene promoters and large repetitive sequences, is essential for the precise and orchestrated regulation of gene expression. however, the role of dna methylation in maintenance of large - scale nuclear organization remains poorly understood. the aim of this review is to briefly summarize current knowledge about nuclear architecture and to discuss the potential role of epigenetic modification of dna in the morphological and functional maintenance of global organization of the nuclear compartment. nuclear architecture is the result of the morphological and functional heterogeneity generated by the positioning of different subnuclear compartments inside the nucleus. a subnuclear compartment has been defined as a macroscopic region within the nucleus that is morphologically and/or functionally distinct from its surrounding. two types of subnuclear compartments are usually considered, nuclear bodies and chromosome territories, including associated chromatin domains. nuclear bodies are distinct subnuclear regions of different sizes lacking a lipidic membrane and usually characterized by a definite protein composition. the most prominent nuclear body is the nucleolus, factory for ribosome biogenesis and site of rna pol i - dependent rdna gene transcription. there are many other nuclear bodies exclusively characterized by the presence of one or more specific proteins. of special relevance are the cajal bodies, proposed site of snrnp assembly, and pml bodies, of unknown function and the main containers of the promyelocytic protein. the existence of thousands of rna pol ii transcription factories dispersed in the nucleoplasm of mammalian cells has been also well documented [10, 11 ]. the chromatin bulk corresponding to each particular chromosome is not randomly distributed in the nuclear compartment but occupies a specific location known as chromosome territory or domain (fig. 1), a feature which constrains the whole spatial organization inside the nuclear compartment. they are thought to be permeated by nucleoplasmic channels, creating a porous entity of enlarged surface area which is accessible to different nuclear factors. large - scale chromatin domains, belonging to one or more chromosome territories, are also morphologically defined as heterochromatic, highly condensed, genomic regions or as euchromatic, less - condensed regions. localization by fluorescence in situ hybridization of two nuclear domains, the chromosome territories of the q - arm of chromosome 9 (green) and the nucleolar localization of rdna gene repeats (red), in human hct116 cells. there are numerous examples showing that the nuclear compartment is non - randomly arranged in three - dimensional spaces. polarization of chromosomes, where centromeres and telomeres occupy opposite locations in the nucleus (rabl orientation), commonly takes place in drosophila cells [13, 14 ]. several reports also indicate a precise positioning of chromosome territories and chromatin domains relative to a radial orientation in mammalian cells [1522 ]. in some cases the radial position has been correlated to the chromosome s gene density [1520 ], and in other cases to chromosome size [21, 22 ]. positioning of chromosome territories relative to other chromosome territories has been also reported, and certain chromatin domains, such as heterochromatic regions, tend to associate to the nuclear membrane and to the nucleolus. formation of the nucleolar compartment is the result of a non - random association driven by rna pol i activity of several copies of tandemly repeated rdna genes arising from different chromosomes. in the same way, cajal bodies tend to associate to u2 snrna (small nucleolar rna)gene clusters [2426 ], while pml bodies are preferentially found near active genes [27, 28 ]. positioning of nuclear compartments is not exactly the same for all the cells in any particular model. in this sense, it is thought that chromosome positioning is not heritable, but rather established de novo at early g1 in human cells [29, 30 ], although global transmission of chromosome positions through mitosis has been reported in rat cells. in addition, chromosome positioning has been shown to be tissue and cell type specific [17, 19, 32 ]. thus, non - random post - cell division positioning of nuclear compartments is viewed as a consequence of a stochastic and probabilistic process which results in fully functional organization of the nuclear compartment. it is assumed that this spatial organization should be broadly similar and equivalent for all growing cells in a cell or tissue type in order to maintain functional organization of the cell nucleus, which is the basis for a functional definition of nuclear architecture. the above observations question the importance of the nuclear architecture s role in gene positioning and function. many gene loci tend to localize inside their corresponding chromosome territories and have strong preferential positioning with respect to the nuclear centre. this positioning is not directly related to gene activity, and probably reflects the nonrandom location of the corresponding chromosome territory. in some cases, such as cd4 locus activation during t - cell differentiation, interestingly, large loops of chromatin protruding several microns from the resident chromosome territory have been described in mammalian cells (reviewed in). for example, in differentiating es cells, hox1 and hox9 genes loop from their chromosome territories upon activation, and two genes located 25 mb away on chromosome 7 closely localize to pair and share a common transcriptional site. these observations suggest that loops containing activated or transcriptionally competent genes are expelled from or moved to the external surface of chromosome territories to be near transcription factories. assuming that chromosome territories are porous entities, acquisition of a transcriptionally competent state could be achieved by free diffusion of nuclear factors. on the other hand, there are well - known examples of gene silencing after repositioning near or inside transcriptionally repressed heterochromatin domains. in the classical position effect variegation phenomenon (pev), a gene locus becomes permanently silenced after placement near a heterochromatic domain. a similar effect of transcriptional repression associated with gene repositioning close to heterochromatin blocks has been reported in many naturally occurring differentiation systems, although association with heterochromatin does not always result in gene inactivation. it is clear that heterochromatin is characterized by a compacted chromatin structure in which transcription is inhibited and that loss of heterochromatinization may result in gene activation. however, repositioning of inactivated genes into heterochromatin domains might be a consequence rather than a cause of gene inactivation, and heterochromatin might be a sink for transcription factors rather than a repository of inactivated genes. in this sense, it has been recently shown that the correlation between chromatin structure and gene activity is not as strong as previously perceived. in fact, a strong relationship was found between chromatin structure and gene density, whereas open chromatin regions were found to be enriched in gene loci, active or not, while condensed chromatin domains were associated with poor gene content. perhaps the most direct indication of the role of nuclear architecture in gene function is in disease states, which are very often characterized by altered gene expression patterns associated with aberrant nuclear morphologies, or vice versa. many cancer cell types exhibit gross alterations of the nuclear architecture in the form of spatial organization changes, chromatin and chromosome domain textures, nuclear size and shape alterations, and changes in the number and size of nucleoli (summarized in). in fact, morphological abnormalities of the nuclear compartment are used as key diagnostic features for many cancer types. other well - known examples of changes in gene expression associated with alterations in nuclear architecture are laminopathies. these severe diseases are characterized by the loss of a - type lamin function, a major structural component of the nuclear envelope. as a consequence, the nuclear envelope is distorted and the whole nuclear organization is compromised. at the level of the organism level, patients suffering from laminopatic syndromes manifest muscular dystrophy, lipodystrophy, neurodystrophy and progeroid disorders. methylation of cpg dinucleotides is characterized by the transfer of methyl groups to the c-5 position of cytosine (5mc), and is catalyzed by members of the dna methyltransferase (dnmt) protein family. to date, three families of dnmts have been identified, dnmt1, dnmt2 and dnmt3 (dnmt3a dnmt3b and dnmt3l). dnmt1, dnmt3a, and dnmt3b are essential during the development of murine knockout models [4446 ]. dnmt1, the most abundant dna methyltransferase in somatic cells, has a strong preference for hemimethylated dna, and is therefore believed to be the enzyme primarily responsible for copying and maintaining methylation patterns from the parental to the daughter strand following dna replication. dnmt3a and dnmt3b are highly expressed in embryonic and non - differentiated cells and have been proposed to be the enzymes responsible for de novo methylation. several lines of evidence, however, indicate that in addition to the cooperation between all three dnmts, they may also possess both de novo and maintenance functions in vivo [4749 ]. dnmt2 lacks the large n - terminal regulatory domain common to other eukaryotic methyltransferases and does not exhibit comparable dna methyltransferase activity, although it does seem to have some residual activity in vitro. 5mc in normal dna constitutes 0.751% of all nucleotides, where 46% of all cytosines are methylated. cpg dinucleotides are not randomly distributed throughout the genome but are enriched in regions known as cpg islands. cpg islands are usually hypomethylated and tend to embrace the 5-end region (promoter, untranslated region and exon 1) of a wide number of genes. in mammals, two waves of active demethylation of 5mc take place in early steps of embryo development, prior to the formation of a zygotic nucleus in germ cells and in preimplantation embryos. developmentally regulated re - methylation of specific cpg islands occurs at least in imprinted genes, x - chromosome - linked silenced genes in females, and in germline and tissue - specific genes. aberrant methylation of cpg islands leading to gene silencing is a common phenomenon during carcinogenesis. cytosine methylation is also observed outside cpg islands, where it is thought to play a key role in silencing parasitic dna sequences, such as transposons and retroviruses. it is well established that dna methylation is associated with transcriptionally inactive states of chromatin, but the exact mechanism by which cpg methylation is translated into transcriptionally silent chromatin is still unclear. three different hypotheses have been proposed to explain the way by which dna methylation is interpreted by nuclear factors. the first possibility is that dna methylation inhibits the binding of sequence - specific transcription factors to their binding sites. cpg methylation would result in transcription factor release from the chromatin fibre. in this context, a protein with an affinity for unmethylated cpgs has been identified that is associated with actively transcribed regions of the genome. in a second model, it is proposed that methylation may have direct consequences for nucleosome positioning, leading to the assembly of specialized nucleosomal structures on methylated dna able to repress transcription. the third possibility is that methylation results in the recruitment of nuclear factors that selectively recognize methylated dna and either impede binding of other nuclear factors or have a direct effect on repressing transcription. although there are examples that support all three possibilities, the active recruitment of methyl - cpg binding activities appears to be the most widespread mechanism of methylation - dependent repression. it was shown years ago that mecp2 represses the transcription of methylated dna through the recruitment of a histone deacetylase - containing complex [61, 62 ], establishing for the first time a connection between dna methylation and transcriptional repression. characterization of mecp2 led to the identification of a methyl - cpg - binding domain (mbd), resulting in the further characterization of additional methyl - cpg - binding proteins containing this motif, namely mbd1, mbd2, mbd3 and mbd4. moreover, it has been demonstrated that dnmts and mbds can also recruit histone deacetylases [65, 66 ] and histone methyltransferases that modify lysine 9 of histone h3 [6769 ], a hallmark of heterochromatin. these observations have established a mechanistic link between dna methylation and changes in the structural conformation of the chromatin fibre. there is an emerging view of the eukaryotic nucleus as a three - dimensional region functionally divided into large heterochromatin compartments that repress transcription, and compartments in which transcription is permitted. accumulated evidence also suggests that a large - scale three - dimensional landscape is maintained in the nucleus by large genomic repeats, such as centromeres or telomeres, and heterochromatin blocks. in a nuclear volume in which small structures and particles move and diffuse following a random pattern [1, 71 ] positional or structural modifications of these large - scale hallmarks have key roles in cellular differentiation and transformation [39, 40, 42, 43, 70, 72 ]. methylation of cpg nucleotides is associated with closed or compacted chromatin conformations and the formation of heterochromatin. dna methylation of cpg islands contained in gene promoters results in chromatin compaction and transcriptional inactivation. compacted chromatin states are also characterized by a well - defined pattern of biochemical modification of histone h3 and h4 tails. cross - talk between dna methylation and modification of histone tails has been established in plants and animals [7375 ], indicating that transition to the closed chromatin conformation is a coordinated phenomenon involving both dna and histones. however, the precise role of dna methylation in the maintenance of chromosome positioning and large - scale nuclear architecture is poorly understood. in any case for example, in germinating wheat seeds, treatment with 5-azacytidine, which results in dna hypomethylation, induces strong changes in the architecture of interphase chromosome arms. in human chromosomes, 5-azacytidine treatment results in demethylation of heterochromatic regions. it is also known that changes in nuclear architecture are closely associated with large - scale modification of the dna methylation pattern during mammalian preim - plantation development and in germ and sertoli cells from developing mouse testis. similar changes in nuclear organization associated with changes in the dna methylation pattern are found during normal development of the peach apical meristem. finally, chromosome instability and aberrant nuclear morphologies are tightly associated with dna hypomethylation of discrete nuclear regions in cancer cells [8183 ]. all these observations point out a causal relationship between dna methylation, dna methylation machinery and large - scale nuclear organization. for the most part, dense dna methylation regions in mammalian cultured cells can be spotted on discrete locations on metaphase chromosomes, such as secondary constrictions, juxtacentromeric regions and t - bands. in the interphase nuclei, densely methylated dna regions are found in discrete foci, frequently associated with the nuclear envelope and with heterochromatic regions (fig. the distribution of 5mc in discrete heterochromatic foci associated with the nuclear envelope is best observed in tissues, where the spatial and functional organization of the nuclear architecture is constrained by the three - dimensional network of cell - cell and cell - substrate interactions that are required to maintain the homeostasis of the tissue (fig. many of these densely methylated regions correspond to large repetitive regions in the genome. in humans, such repetitive regions are typically found in classical satellites 2 and 3 at juxtacentromeric regions of chromosomes 1, 9 and 16. the icf syndrome (for immunodeficiency, centromere instability and facial anomalies) is a recessive autosomal disorder involving abnormalities of genomic methylation patterns and mutations in both alleles of the dnmt3b gene. icf patients shown complete demethylation of specific repetitive sequences contained in satellites 2 and 3. this demethylation pattern is associated with decondensation of large blocks of juxtacentromeric heterochromatin, formation of multiradiate chromosome and gross alteration on the nuclear architecture in interphase nuclei. human cancer cells lacking both copies of the dnmt1 gene also show extensive and specific demethylation of satellite 2 repeats at chromosomes 1, 9 and 16. human cells lacking dnmt1 also show a specific demethylation pattern in a second type of genomic repeat, the rdna genes. these observations indicate that the dna methylation machinery, which is required to maintain a specific pattern of methylation in large regions of the genome, is also required to maintain a particular organization of the nuclear architecture. figure 2confocal images showing the distribution of 5mc in the nucleus of (a) primary mouse fibroblasts and (b) keratinocytes of the interfollicular epithelium in a whole mount of mouse tail skin. confocal images showing the distribution of 5mc in the nucleus of (a) primary mouse fibroblasts and (b) keratinocytes of the interfollicular epithelium in a whole mount of mouse tail skin. interestingly, neither human cells lacking dnmt1 nor cells lacking dnmt3b show significant alterations in the dna methylation pattern of promoter - contained cpg islands [47, 48 ]. in this scenario, an epigenetic modification of the chromatin fibre, specifically affecting large blocks of genomic repeats contained in heterochromatic regions, results in gross alterations of nuclear architecture. however, no significant changes are observed at the promoter level of regulation of gene expression. since the output of these cells is a functionally altered state, it is tempting to speculate that large alterations of nuclear architecture have a direct effect on cell function. this observation constitutes, in turn, a change in common concepts of nuclear function, in which alterations of nuclear architecture are the result, rather than the cause, of dysfunction in local gene activities. albert einstein famously said, god does not play dice. what einstein was referring to was his own rejection of a chaotic universe. the increasing scientific amount of data obtained in recent years also shows that our dna, chromosome and nuclear structure is not a random event occurring in the cell. there is a delicate superstructure of large chromatin domains, chromosomal territories and subnuclear compartments that require reliable, but, at the same time, dynamic caretakers. epigenetic marks, such as dna methylation and histone modification, are excellent candidates to assume this critical role. | abstract.the cell nucleus is a highly structured compartment where nuclear components are thought to localize in non - random positions. correct positioning of large chromatin domains may have a direct impact on the localization of other nuclear components, and can therefore influence the global functionality of the nuclear compartment. dna methylation of cytosine residues in cpg dinucleotides is a prominent epigenetic modification of the chromatin fiber. dna methylation, in conjunction with the biochemical modification pattern of histone tails, is known to lock chromatin in a close and transcriptionally inactive conformation. the relationship between dna methylation and large - scale organization of nuclear architecture, however, is poorly understood. here we briefly summarize present concepts of nuclear architecture and current data supporting a link between dna methylation and the maintenance of large - scale nuclear organization. |
community - acquired pneumonia (cap) is a widespread disease with important implications for health care systems worldwide. for industrialized countries, cap represents the leading cause of death due to infectious disease.1,2 the incidence of cap in spain ranges from 511 per 1,000 adults, rising to 2535 cases per 1,000 in elderly people over age 65.3 hospital admission is common for elderly patients3 and is associated with significant use of health care resources and costs.4 given the inherent difficulty of determining the cause of cap (an etiological diagnosis is only established in 40%60% of the cases)5 empiric antibiotic treatment is often required. the majority of patients with mild - to - moderate cap are treated in the community setting with empirical antimicrobial therapy. patients with more serious disease or who are elderly or have comorbidities may be hospitalized, and antimicrobial therapy is usually started empirically. thus, it is important that the choice of antimicrobial therapy ensures appropriate coverage of potentially drug - resistant strains based on local antimicrobial resistance pattern. ertapenem and ceftriaxone are commonly used as empiric treatment in monotherapy or in combination with macrolides if infection with atypical pathogens is suspected.6 ertapenem is a carbapenem, active against the majority of bacterial pathogens causing most routine community - acquired infections, including enterobacteriaceae and anaerobes.7 ceftriaxone is a third - generation cephalosporin with broad - spectrum activity against gram - positive and gram - negative bacteria.8 both antibiotics are potent drugs with broad - spectrum antimicrobial activity, widely used to treat elderly patients in whom pneumonia tends to follow severe courses due to their high rates of comorbidities.911 according to international guidelines on the management of cap, ertapenem and ceftriaxone were recommended for hospital ward treatment as preferred beta - lactam agents.12 the clinical efficacy of ceftriaxone and ertapenem was compared in two randomized controlled trials, where these two antibiotics showed equivalence.1316 nonetheless, these efficacy results are limited by the controlled trials conditions and may not be representative of clinical practice. furthermore, the etiologic profile of cap may differ considerably from one geographic region to another, and the microbial susceptibility to these antibiotics may have changed over the years, depending on their prescribing patterns and extensive use. the primary objective of this study was to incorporate the dynamics in microbiological susceptibilities and pathogens distribution for elderly patients in spain into the initial clinical efficacy described for ertapenem and ceftriaxone in patients with cap. the expected effectiveness obtained for ertapenem and ceftriaxone will be used to compare the cost impact in the treatment of hospitalized patients with cap in spain. initial clinical efficacies of ertapenem and ceftriaxone were extracted from the combined analysis performed by fceftriaxone, and imipenem were not found in the literature ; ortiz - ruiz of two multicenter randomized, doubleblind studies.13,14 in these two studies, the efficacy and safety of ertapenem 1 g once a day for the treatment of cap were compared with those of ceftriaxone 1 g once a day, and patients were stratified according to pneumonia severity index (psi) (3 or > 3) or age (65 or > 65 years). in the combined analysis,15 clinical cure rates were equivalent for both treatments : 92.0% (95% confidence interval [ci ] : 89.294.8) for ertapenem and 91.8% (95% ci : 88.795.0) for ceftriaxone. nonetheless, a slight difference in clinical cure rates was reported for elderly patients (age > 65 years), with 93.6% (95% ci : 89.697.7) with ertapenem and 91.3% (95% ci : 86.196.5) with ceftriaxone, but no statistically significant difference was assumed between the groups. it was assumed that patients with clinical failure to first - line treatment with ertapenem or ceftriaxone, ie, lack of clinical response at day 3 after treatment,17 are treated with another second - line treatment. according to recommendations in spanish guidelines for the empiric treatment of cap, a second - line treatment with imipenem / cilastatin 1 g three times a day was considered in our model.6 the initial clinical efficacy of imipenem / cilastatin was extracted from a randomized prospective study conducted in elderly patients with cap.18 it was assumed that failure of second - line therapy has a mortality rate of 0.9%, based on the fine criteria mix of the population19 (table 1). the data regarding pathogens distribution and their current microbiological susceptibility profile were then combined to estimate the overall susceptibility against ertapenem, ceftriaxone, and imipenem. finally, the expected effectiveness for each antibiotic was obtained by incorporating the overall susceptibility into the initial clinical efficacy (table 2). the pathogens distribution was obtained from the study of vila - corcoles,10 in which 473 patients with cap, aged 65 years, were prospectively studied between 2002 and 2005 in the region of tarragona, spain. the etiology was established in 131 (36.6%) patients, and results showed streptococcus pneumoniae as the most common pathogen of cap in elderly patients. the current microbiological susceptibility profile was obtained from the in vitro activity of ertapenem, ceftriaxone, and imipenem against the pathogens isolated from patients suffering from respiratory tract infections in spain. in the absence of locally conducted studies, in vitro susceptibility data from european multicenter trials, including spanish centers, were used.2023 there were pathogens whose susceptibility data against ertapenem, ceftriaxone, and imipenem were not found in the literature ; these pathogens (18% of the total distribution) were chlamydia pneumoniae, legionella, moraxella catarrhalis, streptococcus sanguis, streptococcus salivarius, nocardia, peptococcus, mycobacterium tuberculosis, and coxiella burnetii, all which were assumed had 0% susceptibility to ertapenem, ceftriaxone, and imipenem. a previously published decision - tree model24,25 was adapted to evaluate the expected effectiveness in the cost impact of ertapenem relative to ceftriaxone for the treatment of cap in an elderly population. a hypothetical cohort of 1,000 patients received either ceftriaxone 1 g once a day or ertapenem 1 g once a day at model entry. the time horizon for the analysis was equivalent to the treatment duration of a cap episode, including a possible second - line treatment. as the total time is shorter than 1 year, the basic scheme of the decision - tree is presented in figure 1, depicting the most relevant outcomes in the treatment of cap. a single decision node represents a choice between the two alternatives, ertapenem or ceftriaxone, for treating cap in elderly patients. when ertapenem or ceftriaxone is not efficacious, patients are treated with another (second - line) antibiotic, which again has a certain probability of success. if this second antibacterial treatment fails, the outcome can be either fatal or there will be sequelae as a result of the bacterial infection. according to menndez data,26 the mean length of hospital stay (los) for cap treatment was 9.4 days in case of clinical success, and 18.5 days in case of treatment failure. it was assumed that the patient was receiving intravenous therapy throughout the hospitalization period. in order to update these values from 2005, the variation of mean los was studied across the 20052011 period, based on diagnosis - related group (drg) data for cap in spain. the mean days of hospital stay, weighted according to the number of patients for drgs 89 and 90 (pneumonia simple and pleurisy with and without complications in patients over 17 years, respectively) had decreased 10.6% from 20052010.27 this reduction in the los was applied to menndez data,26 obtaining a mean los of 8.4 days for cap with clinical success and 16.5 days in the case of treatment failure (table 1). hospitalization cost was also obtained from the weighted drgs 89 and 9027 and was updated to 2011 values based on the consumer price index. drug costs were calculated from the recommended dose in clinical guidelines, while considering the laboratory sales price resulting from applying the commercial margins established28 on the public retail price.29 furthermore, a 7.5% deduction based on the royal decree - law 8/2010 of may 20, was applied to the laboratory sales price of ertapenem.30 the price of ceftriaxone was based on the least expensive generic medication. the psi is a validated risk stratification instrument, which can help in identifying cap patients with high risk of mortality. the psi involves calculating a score, which places a given patient into one of five risk classes. classes i, ii, and iii are at low risk for death, and may be considered for outpatient treatment, and risk classes iv and v should usually be hospitalized.19 in this study, an alternative scenario was considered using the data of clinical cure rates for patients with psi 3 and psi > 3 from the combined analysis performed by ortiz - ruiz.15 for patients with psi 3, the clinical cure rates for the ertapenem - arm and ceftriaxonearm were 92.7% (95% ci : 89.695.8) and 93.8% (95% ci : 90.597.1), respectively, while patients with psi > 3 showed clinical cure rates of 90.9% (95% ci : 83.896.2) in the ertapenem cohort and 87.1% (95% ci : 79.994.2) in the ceftriaxone cohort. to test the robustness of our evaluation, one - way sensitivity analysis was conducted to determine the key drivers of the model by modifying independently the following parameters over a range of 10% : initial clinical efficacy, expected effectiveness, los in case of clinical success and clinical failure, cost of hospitalization per day, and unit cost of ertapenem, ceftriaxone, and imipenem. for the most sensitive parameters, los during first- and second - line treatment, probabilistic sensitivity analysis provides a comprehensive assessment of the impact of second - order uncertainty by assuming simultaneous variations in all of the model parameters. in our analysis, a monte carlo simulation was performed with 1,000 iterations, and its outcomes were expressed as a cost - effectiveness plot. for the expected effectiveness and mortality, beta distributions were used. for treatment duration and los, triangular distributions (defined by the ci limits of each estimate) were conservatively chosen given the lack of data in the literature. the point estimates, ranges, and parameters for the distributions are listed in table 3. for each simulation, a random value was sampled from these distributions, and the outcomes of the model were calculated. initial clinical efficacies of ertapenem and ceftriaxone were extracted from the combined analysis performed by fceftriaxone, and imipenem were not found in the literature ; ortiz - ruiz of two multicenter randomized, doubleblind studies.13,14 in these two studies, the efficacy and safety of ertapenem 1 g once a day for the treatment of cap were compared with those of ceftriaxone 1 g once a day, and patients were stratified according to pneumonia severity index (psi) (3 or > 3) or age (65 or > 65 years). in the combined analysis,15 clinical cure rates were equivalent for both treatments : 92.0% (95% confidence interval [ci ] : 89.294.8) for ertapenem and 91.8% (95% ci : 88.795.0) for ceftriaxone. nonetheless, a slight difference in clinical cure rates was reported for elderly patients (age > 65 years), with 93.6% (95% ci : 89.697.7) with ertapenem and 91.3% (95% ci : 86.196.5) with ceftriaxone, but no statistically significant difference was assumed between the groups. it was assumed that patients with clinical failure to first - line treatment with ertapenem or ceftriaxone, ie, lack of clinical response at day 3 after treatment,17 are treated with another second - line treatment. according to recommendations in spanish guidelines for the empiric treatment of cap, a second - line treatment with imipenem / cilastatin 1 g three times a day was considered in our model.6 the initial clinical efficacy of imipenem / cilastatin was extracted from a randomized prospective study conducted in elderly patients with cap.18 it was assumed that failure of second - line therapy has a mortality rate of 0.9%, based on the fine criteria mix of the population19 (table 1). the data regarding pathogens distribution and their current microbiological susceptibility profile were then combined to estimate the overall susceptibility against ertapenem, ceftriaxone, and imipenem. finally, the expected effectiveness for each antibiotic was obtained by incorporating the overall susceptibility into the initial clinical efficacy (table 2). the pathogens distribution was obtained from the study of vila - corcoles,10 in which 473 patients with cap, aged 65 years, were prospectively studied between 2002 and 2005 in the region of tarragona, spain. the etiology was established in 131 (36.6%) patients, and results showed streptococcus pneumoniae as the most common pathogen of cap in elderly patients. the current microbiological susceptibility profile was obtained from the in vitro activity of ertapenem, ceftriaxone, and imipenem against the pathogens isolated from patients suffering from respiratory tract infections in spain. in the absence of locally conducted studies, in vitro susceptibility data from european multicenter trials, including spanish centers, were used.2023 there were pathogens whose susceptibility data against ertapenem, ceftriaxone, and imipenem were not found in the literature ; these pathogens (18% of the total distribution) were chlamydia pneumoniae, legionella, moraxella catarrhalis, streptococcus sanguis, streptococcus salivarius, nocardia, peptococcus, mycobacterium tuberculosis, and coxiella burnetii, all which were assumed had 0% susceptibility to ertapenem, ceftriaxone, and imipenem. a previously published decision - tree model24,25 was adapted to evaluate the expected effectiveness in the cost impact of ertapenem relative to ceftriaxone for the treatment of cap in an elderly population. a hypothetical cohort of 1,000 patients received either ceftriaxone 1 g once a day or ertapenem 1 g once a day at model entry. the time horizon for the analysis was equivalent to the treatment duration of a cap episode, including a possible second - line treatment. as the total time is shorter than 1 year, no discounting of costs or outcomes was applied. the basic scheme of the decision - tree is presented in figure 1, depicting the most relevant outcomes in the treatment of cap. a single decision node represents a choice between the two alternatives, ertapenem or ceftriaxone, for treating cap in elderly patients. both ertapenem and ceftriaxone can result in a successful outcome with a certain probability. when ertapenem or ceftriaxone is not efficacious, patients are treated with another (second - line) antibiotic, which again has a certain probability of success. if this second antibacterial treatment fails, the outcome can be either fatal or there will be sequelae as a result of the bacterial infection. according to menndez data,26 the mean length of hospital stay (los) for cap treatment was 9.4 days in case of clinical success, and 18.5 days in case of treatment failure. it was assumed that the patient was receiving intravenous therapy throughout the hospitalization period. in order to update these values from 2005, the variation of mean los was studied across the 20052011 period, based on diagnosis - related group (drg) data for cap in spain. the mean days of hospital stay, weighted according to the number of patients for drgs 89 and 90 (pneumonia simple and pleurisy with and without complications in patients over 17 years, respectively) had decreased 10.6% from 20052010.27 this reduction in the los was applied to menndez data,26 obtaining a mean los of 8.4 days for cap with clinical success and 16.5 days in the case of treatment failure (table 1). hospitalization cost was also obtained from the weighted drgs 89 and 9027 and was updated to 2011 values based on the consumer price index. drug costs were calculated from the recommended dose in clinical guidelines, while considering the laboratory sales price resulting from applying the commercial margins established28 on the public retail price.29 furthermore, a 7.5% deduction based on the royal decree - law 8/2010 of may 20, was applied to the laboratory sales price of ertapenem.30 the price of ceftriaxone was based on the least expensive generic medication. the psi is a validated risk stratification instrument, which can help in identifying cap patients with high risk of mortality. the psi involves calculating a score, which places a given patient into one of five risk classes. classes i, ii, and iii are at low risk for death, and may be considered for outpatient treatment, and risk classes iv and v should usually be hospitalized.19 in this study, an alternative scenario was considered using the data of clinical cure rates for patients with psi 3 and psi > 3 from the combined analysis performed by ortiz - ruiz.15 for patients with psi 3, the clinical cure rates for the ertapenem - arm and ceftriaxonearm were 92.7% (95% ci : 89.695.8) and 93.8% (95% ci : 90.597.1), respectively, while patients with psi > 3 showed clinical cure rates of 90.9% (95% ci : 83.896.2) in the ertapenem cohort and 87.1% (95% ci : 79.994.2) in the ceftriaxone cohort. one - way sensitivity analysis was conducted to determine the key drivers of the model by modifying independently the following parameters over a range of 10% : initial clinical efficacy, expected effectiveness, los in case of clinical success and clinical failure, cost of hospitalization per day, and unit cost of ertapenem, ceftriaxone, and imipenem. for the most sensitive parameters, los during first- and second - line treatment, probabilistic sensitivity analysis provides a comprehensive assessment of the impact of second - order uncertainty by assuming simultaneous variations in all of the model parameters. in our analysis, a monte carlo simulation was performed with 1,000 iterations, and its outcomes were expressed as a cost - effectiveness plot. for the expected effectiveness and mortality, beta distributions were used. for treatment duration and los, triangular distributions (defined by the ci limits of each estimate) were conservatively chosen given the lack of data in the literature. the point estimates, ranges, and parameters for the distributions are listed in table 3. for each simulation, a random value was sampled from these distributions, and the outcomes of the model were calculated. under the base - case scenario, and after considering the distribution of pathogens in an elderly population with cap and their current microbiologic susceptibility profile, the proportion of successfully treated patients with ertapenem and ceftriaxone is expected to be 71.0% and 64.8%, respectively (table 4). the higher drug cost of 426 per patient in the ertapenem - arm compared to 243 in the ceftriaxone - arm was compensated by the lower resource use cost per patient, mainly hospitalization costs (ertapenem - arm : 4,514 ; ceftriaxone - arm : 4,726). the calculated net difference in antibiotic drug and hospital costs represents a savings of 29 per patient with ertapenem relative to ceftriaxone (figure 2). under the alternative scenario, the outcomes of the model obtained for patients with psi 3 and psi > 3 are summarized in table 5. for patients with psi 3, the proportion of successfully treated patients obtained for the ertapenem - arm and ceftriaxone - arm was 70.3% and 66.5%, respectively. the total cost for the treatment of cap, including drugs and hospitalization costs, was estimated to be 4,965 in the ertapenem - arm and 4,899 in the ceftriaxone - arm, representing a savings of 66 when cap is treated with ceftriaxone relative to ertapenem in patients with psi 3. for patients with psi > 3, a greater difference in the proportion of successfully treated patients was obtained between ertapenem and ceftriaxone, with 68.3% being the proportion of successfully treated patients in the ertapenem - arm and 61.8% in the ceftriaxone - arm. the total cost of cap treatment was lower in the ertapenem - arm, 5,042 versus 5,086 in the ceftriaxone - arm, representing a savings of 44 when ertapenem is considered for the treatment of cap in patients with psi > 3. in the one - way sensitivity analysis, the parameter most impacting the results was the los. as discussed above, the mean days of hospital stay observed for drgs 89 and 90 decreased by 10.6% across the 20052011 period. the impact of this decrease, considering both equal and different rates for first- and second - line treatment, is represented in figure 3. when los decreases at the same rate for first- and second - line treatment, there were no significant differences with the base - case results (figure 3a). nonetheless, higher savings were observed for the ertapenem - arm relative to ceftriaxone when los during first - line treatment decreased to a greater extent than for second - line (figure 3b). when los was reduced at a higher rate for second - line, the difference in total costs between ertapenem and ceftriaxone was reduced as represented in figure 3c. the results obtained for the other parameters are represented for the base - case in the tornado diagram of figure 4. as can be seen in this chart, where the variables tested in the sensitivity analysis are ordered according to their (decreasing) impact on the result, the variables with the largest impact on the result are the treatment cost with ertapenem and the unit cost per day of hospitalization. nevertheless, changes in these two variables within the 10% range do not produce a change in the outcomes, resulting in a cost reduction for both variables across the whole tested range (as it also happened for all other variables in the sensitivity analysis). the results of the probabilistic analysis showed that for the base - case (> 65 years), ertapenem is a dominant strategy (less costly with additional benefits) in 59% of simulations (figure 5). in those cases where ertapenem showed additional benefits with higher costs, there is a 44% likelihood that the treatment with ertapenem offsets by at least 50% the difference in drug costs between ertapenem and ceftriaxone. in the alternative scenario, psi > 3 and psi 3, there is a 59% and 34% likelihood that ertapenem would be a dominant strategy, respectively. under the base - case scenario, and after considering the distribution of pathogens in an elderly population with cap and their current microbiologic susceptibility profile, the proportion of successfully treated patients with ertapenem and ceftriaxone is expected to be 71.0% and 64.8%, respectively (table 4). the higher drug cost of 426 per patient in the ertapenem - arm compared to 243 in the ceftriaxone - arm was compensated by the lower resource use cost per patient, mainly hospitalization costs (ertapenem - arm : 4,514 ; ceftriaxone - arm : 4,726). the calculated net difference in antibiotic drug and hospital costs represents a savings of 29 per patient with ertapenem relative to ceftriaxone (figure 2). the outcomes of the model obtained for patients with psi 3 and psi > 3 are summarized in table 5. for patients with psi 3, the proportion of successfully treated patients obtained for the ertapenem - arm and ceftriaxone - arm was 70.3% and 66.5%, respectively. the total cost for the treatment of cap, including drugs and hospitalization costs, was estimated to be 4,965 in the ertapenem - arm and 4,899 in the ceftriaxone - arm, representing a savings of 66 when cap is treated with ceftriaxone relative to ertapenem in patients with psi 3. for patients with psi > 3, a greater difference in the proportion of successfully treated patients was obtained between ertapenem and ceftriaxone, with 68.3% being the proportion of successfully treated patients in the ertapenem - arm and 61.8% in the ceftriaxone - arm. the total cost of cap treatment was lower in the ertapenem - arm, 5,042 versus 5,086 in the ceftriaxone - arm, representing a savings of 44 when ertapenem is considered for the treatment of cap in patients with psi > 3. in the one - way sensitivity analysis, the parameter most impacting the results was the los. as discussed above, the mean days of hospital stay observed for drgs 89 and 90 decreased by 10.6% across the 20052011 period. the impact of this decrease, considering both equal and different rates for first- and second - line treatment, is represented in figure 3. when los decreases at the same rate for first- and second - line treatment, there were no significant differences with the base - case results (figure 3a). nonetheless, higher savings were observed for the ertapenem - arm relative to ceftriaxone when los during first - line treatment decreased to a greater extent than for second - line (figure 3b). when los was reduced at a higher rate for second - line, the difference in total costs between ertapenem and ceftriaxone was reduced as represented in figure 3c. the results obtained for the other parameters are represented for the base - case in the tornado diagram of figure 4. as can be seen in this chart, where the variables tested in the sensitivity analysis are ordered according to their (decreasing) impact on the result, the variables with the largest impact on the result are the treatment cost with ertapenem and the unit cost per day of hospitalization. nevertheless, changes in these two variables within the 10% range do not produce a change in the outcomes, resulting in a cost reduction for both variables across the whole tested range (as it also happened for all other variables in the sensitivity analysis). the results of the probabilistic analysis showed that for the base - case (> 65 years), ertapenem is a dominant strategy (less costly with additional benefits) in 59% of simulations (figure 5). in those cases where ertapenem showed additional benefits with higher costs, there is a 44% likelihood that the treatment with ertapenem offsets by at least 50% the difference in drug costs between ertapenem and ceftriaxone. in the alternative scenario, psi > 3 and psi 3, there is a 59% and 34% likelihood that ertapenem would be a dominant strategy, respectively. to our knowledge, this is the first study aimed to explore the impact of the evolution of the microbiological profile for cap in spain, and illustrates how the modulation of the initial clinical efficacy through the current microbial susceptibility profile and the etiology described for elderly patients can be incorporated to assess the cost impact of the antimicrobial therapy. the effectiveness of this method might better predict the percentage of patients who favorably respond to the antibiotics under study and might allow for a more accurate estimate of resource consumption associated with the treatment of cap. in the base - case, a lower total cost for the treatment of cap in the ertapenem - arm is expected due to the higher proportion of successfully treated patients, making second - line treatments unnecessary and resulting in consequent savings in hospitalization costs. under the alternative scenario, in patients with psi 3, the treatment of cap with ceftriaxone leads to lower total costs compared to the treatment with ertapenem. this result is related to the lower difference in the initial efficacy between ertapenem and ceftriaxone described for those patients. in contrast, for patients with psi > 3, the treatment of cap is less costly when ertapenem is used relative to ceftriaxone. this savings confirms that acquisition costs of different antimicrobials may be less significant compared with the costs associated with therapeutic failure or adverse effects. drug acquisition costs are a primary consideration only if there are no significant differences in treatment outcomes between agents, potential for selection of resistance, and incidence of significant treatment - related adverse events. thus, a more expensive agent may be a very efficient alternative if it is associated with greater efficacy or better tolerance than a less expensive option. there are other methods described in the literature for reducing cost when treating patients with cap. these include administering appropriate empiric antibacterial therapy, based on pharmacodynamic and pharmacokinetic characteristics and providing therapy that facilitates good patient compliance, such as single daily dosing and shorter treatment courses.31 according to the one - way sensitivity analysis, los was the parameter with the most impact on the cost of cap management. under the current cost - containment policies and supported by the evidence from recent studies demonstrating that reductions of hospital stays could reduce costs without compromising patient outcomes, most hospitals are making efforts for optimizing los. in a study by capelastegui,32 the trend in duration of hospitalization for cap was assessed during 20002007, and it was observed that a 2-day decrease in los did not increase the likelihood of short - term mortality or hospital readmission. the impact of los was extensively studied in our model through different scenarios, confirming the robustness of our evaluation. the results of the probabilistic sensitivity analysis support the finding that ertapenem could be a cost - saving alternative compared to ceftriaxone. of the 1,000 simulations run in this study, ertapenem showed additional benefits at lower costs in 59% of the estimates versus ceftriaxone, both for elderly patients (> 65 years) and patients with psi > 3. in addition, in those cases where ertapenem showed additional benefits and higher costs, the difference in drug cost between ertapenem and ceftriaxone was offset by at least 50% in 44% of simulations. the results obtained in this study suggest that elderly patients with cap, who often require longer hospitalization periods than younger patients, and patients with severe pneumonia, are two segments of the population that would greatly benefit from those strategies that lead to a shorter duration of hospitalization. our results are in line with those published in a recent and important study that relates the advanced age and severity of the pneumonia with longer hospitalization periods.33 some limitations of our study must be considered. the etiology data used in this model were obtained from an epidemiology study carried out with 473 patients, aged 65, in the region of tarragona.10 more appropriate data might be obtained with a longer study, that includes patients from several regions of spain, but unfortunately, no other specific study of etiology for elderly patients was found in the literature. in our model, it is assumed that all the patients with cap are infected uniformly with the pathogens distribution, but in the clinical setting, patients are monoinfected with a specific pathogen or with several. the microbial susceptibility profile was obtained from the most recent published studies at the time of this analysis. as new evidence regarding microbial susceptibilities arise, it will be interesting to incorporate this data in the model to assess future outcomes. additionally, it should be acknowledged that although the most current microbiological evidence has been used, this may not necessarily reflect the precise situation in a given site. certainly, there can be variability across sites that would influence the results of this study, depending both on the specificities of the microbiological distribution and as a consequence of the differences in the antibiotic drug practices and their impact on the agent and strain selection. nevertheless, we believe it is very likely that there is a common microbiological background across many sites and geographies, making the broad conclusions of this study valid in a wide range of settings despite their potential differences. another limitation of the model in this study is that, due to its short time horizon, it does not account for the antimicrobial resistance rate change over time. two longer duration studies have shown that when taking the resistance rate change into account, ertapenem yields even more cost savings over time when compared to the alternatives.24,25 for patients with clinical suspicion of infection with microorganisms causing atypical pneumonias or in the feconomic insight into the effect of modulating the initial absence of a demonstrative gram strain, most hospital guidelines recommend combination therapy with a macrolide.6 in this analysis, it was assumed that combination with a macrolide would impact both strategies in a similar way. thus, only monotherapy with ertapenem or ceftriaxone was considered for cost calculations and efficacy data. adverse events were not taken into consideration due to their similar proportion in both ertapenem and ceftriaxone - arms. moreover, the adverse events that occurred were mild and not associated with extensive costs. imipenem was chosen for the second - line antibiotic treatment due to its broad spectrum activity and its recommendation in clinical guidelines.6 it is important to note that data for the initial clinical efficacy of imipenem was obtained from a study where imipenem was administered at 1.5 g per day,18 but for cost calculations, the recommended dose of 3 g per day in spanish guidelines was considered.6 the influence of imipenem cost was studied in the sensitivity analysis, and a very low impact on the base - case results was observed. for the estimation of the health care resources costs consumed during the treatment of cap, the cost of drgs was applied due to the absence of detailed cost information on cap management in spain. the recommended regimens for patients with more severe infections include amoxicillin - clavulanic acid administered intravenously, levofloxacin, moxifloxacin, piperacillin - tazobactam, meropenem, and several cephalosporins. the current study is focused on ertapenem and ceftriaxone given the availability of head - to - head data for clinical efficacy. for future analyses, it would be interesting to include other comparators and to analyze whether the results are transferable to other strategies. despite its limitations, this study provides both clinical and economic insight into the effect of modulating the initial clinical efficacy of two antibiotics according to the current microbiological susceptibility profile and the distribution of pathogens for elderly patients. the current study showed that modulating the initial clinical efficacy, the treatment of cap with ertapenem compared to ceftriaxone could lead to lower health care costs and the benefit of earlier discharge from the hospital for two segments of the spanish population : elderly patients and patients with severe pneumonia (psi > 3). further analyses with other comparators are needed to obtain more data on effectiveness and economic impact that can help to validate the model. | backgroundclinical efficacy of antibiotics may be affected by changes in the susceptibility of microorganisms to antimicrobial agents. the purpose of this study is to assess how these changes could affect the initial efficacy of ertapenem and ceftriaxone in the treatment of community - acquired pneumonia (cap) in elderly patients and the potential consequences this may have in health care costs.methodsinitial efficacy in elderly was obtained from a combined analysis of two multicenter, randomized studies. an alternative scenario was carried out using initial efficacy data according to the pneumonia severity index (psi). country - specific pathogens distribution was obtained from a national epidemiological study, and microbiological susceptibilities to first- and second - line therapies were obtained from spanish or european surveillance studies. a decision analytic model was used to compare ertapenem versus ceftriaxone for cap inpatient treatment. inputs of the model were the expected effectiveness previously estimated and resource use considering a spanish national health system perspective. outcomes include difference in proportion of successfully treated patients and difference in total costs between ertapenem and ceftriaxone. the model performed one - way and probabilistic sensitivity analyses.resultsfirst-line treatment of cap with ertapenem led to a higher proportion of successfully treated patients compared with ceftriaxone in spain. one - way sensitivity analysis showed that length of stay was the key parameter of the model. probabilistic sensitivity analysis showed that ertapenem can be a cost - saving strategy compared with ceftriaxone, with a 59% probability of being dominant (lower costs with additional health benefits) for both, elderly patients (> 65 years) and patients with psi > 3.conclusionthe incorporation of the current antimicrobial susceptibility into the initial clinical efficacy has a significant impact in outcomes and costs in cap treatment. the treatment with ertapenem compared with ceftriaxone resulted in better clinical outcomes and lower treatment costs for two segments of the spanish population : elderly patients and patients with severe pneumonia (psi > 3). |
modifications over the past 15 years have improved unicompartmental knee replacement surgery, as indicated in recent reports on the procedure [14 ]. the designers (the originators) of the oxford unicompartmental knee prosthesis (biomet, warsaw, in) reported in 1998 a 97.7% cumulative survival rate of 10 years. an independent series with a 15-year survival analysis claimed a 94% cumulative survival rate. the outcome was dependent on proper patient selection, surgical techniques and implant design, [4, 7 ] and the results have been attributed to improvements in these factors. the procedure is now performed through a short incision from the medial pole of the patella to the tibial tuberosity. using this approach, there is little damage to the extensor mechanism, the patella is not dislocated, and the suprapatellar synovial pouch remains intact. as a result, patients recover more quickly. patients achieve knee flexion, straight leg - raising, and independent stair - climbing three times faster than after total knee replacement (tkr) and twice faster than after open unicompartmental knee replacement surgery. because of the favourable published clinical results, surgeons at the martini hospital in groningen, the netherlands, began using the oxford knee prosthesis in 1998. the goal of this independent prospective study for patients 60 years of age and above was to compare and evaluate the clinical midterm results of the oxford phase-3 unicompartmental knee replacement using the minimally invasive technique in a community hospital. between december 1998 and 2003, 154 successive oxford unicompartmental knee replacements were performed in patients 60 years of age and above (table 1). of these, 132 patients underwent unilateral surgery, 10 patients underwent bilateral surgery on separate occasions, and 1 patient underwent concomitant bilateral surgery in the same or session. there were 86 women ; the average patient s age was 69.2 years (range 6093 years). table 1oxford phase-3 unicompartmental knee replacementcriteriaresultsnumber of patients132number of knees154left / right knee (%) 53.8/46.2age (mean / range, in years)69.2 (6093)gender (m / w)57 (40%)/86 (60%)bmi30.7 4.9follow - up range27 years oxford phase-3 unicompartmental knee replacement standardised anteroposterior radiographs were obtained with the patient in a weight - bearing position (standing), and lateral radiographs were obtained with the patient in a non - weight - bearing position (the patient lying horizontally). the radiographs were examined for loosening or radiolucency around the femoral and tibial components, and the anatomical axis of the limb was measured. the imaging criterion for no increased risk for loosening of the bone was a 5 mmgrade 5 subluxation the alhback radiological scoring system for estimating the severity of oa the results (preoperative, intraoperative, and follow - ups at 3 months, 6 months, and 1 year) were prospectively recorded with a historical record, procedure record, knee society score, sf-36 questionnaire (short form consisting of 36 questions), and the western ontario mcmaster (womac) score. knee society score ratings of excellent (90100 points) and good (8089 points) indicated success. table 3scoring results of the non - revised patientsscoringresultsknee society scoreknee score preoperative39.2 (sd 18.2) postoperative89.4 (sd 14.0)function preoperative55.8 (sd 14.3) postoperative77.1 (sd 24.7)total score preoperative47.6 (sd 12.3) postoperative83.4 (sd 16.8)womac scorepain preoperative50.3 (sd 18.7) postoperative78.6 (sd 21.5)stiffness preoperative51.2 (sd 22.6) postoperative71.2 (sd 20.8)function preoperative50.6 (sd 20.7) postoperative76.2 (sd 20.4)sf-36 questionnairefunction preoperative35.7 (sd 17.6) postoperative56.1 (sd 24.5)physical preoperative28.2 (sd 37.2) postoperative57.2 (sd 44.3)pain preoperative32.7 (sd 19.2) postoperative59.8 (sd 26.5)health preoperative63.7 (sd 22.2) postoperative61.4 (sd 21.7)social function preoperative52.6 (sd 17.1) postoperative64.5 (sd 17.6)emotional preoperative64.5 (sd 44.6) postoperative70.5 (sd 40.7)mental health preoperative73.7 (sd 17.9) postoperative75.1 (sd 18.8)sd standard deviation scoring results of the non - revised patients sd standard deviation preoperative weight - bearing radiographs showed that the knees had an average femorotibial alignment of 2.4 of valgus (range 83 of varus). thirty - seven knees had grade-1 ahlback osteoarthritis in the lateral compartment on the preoperative radiographs, and one had grade-2 ahlback osteoarthritis. the preoperative skyline view of the patellofemoral joint showed no bone loss with eburnation and longitudinal grooving in all the cases. all medial compartment arthroplasties were performed using the minimally invasive technique and under tourniquet control. the discharge criteria were control of immediate postoperative pain and the ability to flex the operated knee to a minimum of 90 with no lack of extension. all complications and revisions were reported, and a revision was defined as any surgical procedure resulting in removal or exchange of any of the prosthetic components. at the time of follow - up, two patients who had no known revisions were lost for the follow - up. the remaining 130 patients were available for follow - up. at the final follow - up, june 2006, revision tkr was performed in 14 knees and a prosthetic component was exchanged in three knees. table 4revisions of oxford phase-3 knee replacement surgeryincidencerevision of a component of uka3 revision of the mobile bearing1 revision of the femoral component and the bearing1 revision of the tibial component and the bearing1conversion to a tkr14reason for revision to a tka inappropriate indication1 misalignment and loosening5 infection1 progression of osteoarthritis in lateral compartment4 persisting anteromedial pain > 1 year3 revisions of oxford phase-3 knee replacement surgery one bearing was replaced because of luxation after a hyperflexion trauma. a new bearing of the same size was inserted, and no recurrence of luxation was seen at follow - up. in another case of luxation of the bearing, the femoral component, and the bearing the multiple small drill holes were not made, and there was no cement in the large drill hole. with flexion, the loose femoral component moved distally, causing luxation of the bearing. the tibial component and bearing revision was performed seven months after the primary surgery because of misalignment of this tibial component. with flexion, there was impingement of the bearing with the tibial component, causing a clicking sensation and rotation of the bearing. in one case, there was grade-2 ahlback osteoarthritis in the lateral compartment on the preoperative radiograph. this patient had no relief of preoperative pain, and the knee underwent tkr 18 months after the primary surgery. in five cases loosening of the components occurred ; misalignment of the components is probably caused by impingement of the bearing. one patient had a deep staphylococcus aureus infection, and a two - stage procedure was performed leading to a tkr. in four cases of revision, progression of osteoarthritis these patients had a mean postoperative anatomical axis, femorotibial alignment of 18.6. this overcorrection causes overloading of the lateral compartment with progression of arthritis in that compartment. no cause was found, and in both pain persisted after tkr. in the third case, the synovial biopsy showed synovitis villonodularis pigmentosa, and after the tkr this patient was pain - free. except for the two patients with persisting anteromedial pain, all patients with a conversion to tka were pain - free no special augmentations or revision prosthetic components were necessary in these procedures ; there were no bone defects that required the use of particulate autograft or allograft, and primary cruciate - retaining tka was used in the revisions. one patient had a traumatic medial tibia plateau fracture 4 weeks postoperatively, which was treated conservatively. another patient developed hemarthrosis that required extended hospitalisation ; this was resolved with conservative treatment. there was one deep infection, and no deep venous thrombosis was reported. at the time of the most recent follow - up, average flexion was 125.8 13.8, with two patients achieving < 90 flexion. the average flexion deformity / extension was 0.3 2.2. the postoperative scores of those patients who did not undergo revision (140 knees) at the latest follow - up are presented in table 3. all three womac scores improved. for the sf-36, the function, physical, and pain scores showed an improvement in the outcome ; the other scores remained approximately the same. the final follow - up radiographs showed an average anatomical axis, femorotibial alignment of 8.8 of valgus (range 422 of valgus). signs of osteoarthritis progression in the uninvolved tibiofemoral compartment on the radiograph at the last follow - up were noted in 43 knees (grade-1 ahlback osteoarthritis in 39 knees and grade-2 ahlback osteoarthritis in four knees). seventeen knees were revised, resulting in a survival rate of 89% in these 27 years of follow - up interval. the purpose of this prospective study was to evaluate midterm durability of oxford unicompartmental knee replacement surgery for patients 60 years of age and older. we acknowledge that the present study has the limitations of a midterm follow - up. however, longer follow - up for this phase - iii version with the minimally invasive technique is not possible, because the current version has been available only since 1998. besides, most technical failures occur within the first 2 years. in these 27 years of follow - up interval, 11% of unicompartmental knee arthroplasties in all patients needed revision a survival rate of 89%. these results are considerably lower compared to the designer series or the independent series. the primary need for revision surgery thirteen of the 17 revisions were probably related to human error, the remaining four are in one case a hyperflexion trauma and luxation of the bearing, one case with deep infection, and two cases with unexplained persisting anteromedial pain. misalignment of the components was the primary cause of technical failure. with the minimally invasive technique, the visual field introduction of the minimally invasive option makes the terms surgical technique and pitfalls actual again. for the remaining 113 patients (140 knees) who did not undergo revision, the knee society score, womac and sf-36 questionnaires showed an improvement in the outcome. all three scores indicated less pain and improvement in function, as confirmed by an average clinical average flexion of 126 at the latest follow - up. the knee society score total of 83.4 indicates a successful outcome. over the 7-year period of our study, eight senior surgeons performed the operation with an average of < 10 procedures a year per surgeon. the outcome should be attributed to the number of operations performed. as a result of the relatively low survival rate of this study, the number of senior surgeons performing the procedure in this hospital is now reduced to two. careful patient selection, surgeon experience, and proper instrumentation and surgical technique are important factors in mobile - bearing unicompartmental knee replacement surgery [13, 14 ]. for unicompartmental replacement surgery the surgeon should be well versed in the routine, indications, and technique of this procedure to minimise failure rates. | we present the outcome of an independent prospective series of phase-3 oxford medial mobile - bearing unicompartmental knee replacement surgery. eight surgeons performed the 154 procedures in a community - based hospital between 1998 and 2003 for patients aged 60 and above. seventeen knees were revised ; in 14 cases a total knee replacement was performed, in 3 cases a component of the unicompartmental knee prosthesis was revised, resulting in a survival rate of 89% during these 27 years follow - up interval. this study shows that mobile - bearing unicompartmental knee replacement using a minimally invasive technique is a demanding procedure. the study emphasises the importance of routine in surgical management and strict adherence to indications and operation technique used to reduce outcome failure. |
in los angeles county (~9.8 million residents), health disparities are striking among economically disadvantaged communities. obesity prevalence is highest among cities with the greatest indices of economic hardship (table 1). east compton, for example, has one of the highest rates in the county (39.9%, the city is economically ranked last out of 127 communities), while the city of san marino has one of the lowest (8.4%, economically ranked first). these marked disparities are observed by race and ethnicity as well, with obesity being more pronounced among latinos (29.4%) and african americans (29.2%) [1, 2 ]. collectively, this community snapshot paints a picture of significant health disparities in the region [3, 4 ]. in the literature, factors such as demographics, geography, culture, community resiliency, and access to affordable, healthy foods have been found to be important mediators of obesity risk [5, 6 ]. emerging evidence suggests that, to reduce this risk, interdisciplinary interventions especially in nutrition should be implemented across multiple sectors (e.g., healthcare, public health, education, transportation, and food environments) [57 ]. in applying this evidence, federal and local health authorities have begun to take notable actions ; that is, many recent federally funded obesity prevention efforts have employed an array of practice - based system and environmental (se) change strategies to improve food environments across the united states [5, 7 ]. between 2010 and 2012, for example, the centers for disease control and prevention (cdc) communities putting prevention to work (cppw) program targeted health inequalities in several underserved communities in los angeles county. through this funding, the los angeles county department of public health implemented a number of nutrition interventions in the region. these interventions included (a) modifying food services and vending practices at food venues operated by county and city governments (e.g., incorporating healthy nutrition standards through the contracting process with food vendors or suppliers) ; (b) converting corner stores or other stores in low - income neighborhoods to food outlets which offer more fresh fruits and vegetables ; and (c) utilizing outreach and health marketing to educate the public about the adverse effects of excess sugary drink consumption (table 2). as in other communities, assuring community acceptance of se modifications to the food environment requires in - depth knowledge and understanding of the key health behaviors and characteristics of targeted subpopulations. to date, few ongoing public health strategies have tailored intervention programs to address these groups ' unique needs. access to more granular, community - level health data could change this practice by helping to better inform and guide planning and program improvements in these communities. capitalizing on the results from a local health and nutrition examination survey, we contribute to this gap in public health practice by studying a population that was exposed to and may have been affected by these and other nutrition interventions implemented in urban los angeles county during 20102012. the study examined local health data including predictors of healthy eating among a subset of low - income adults who receive free / low - cost services from multipurpose, public health centers in the jurisdiction. policy and practice implications are discussed within the context of program improvement and future obesity prevention planning for the region. data from the first round of a local health and nutrition examination survey in los angeles county was collected during the first 15 months of the cppw obesity prevention program. the survey included a subset of adults residing in low - income neighborhoods (verified using residential zip codes). information collected by the survey included (a) objectively measured height and weight ; (b) objectively measured waist circumference and blood pressure ; (c) self - reported smoking status ; (d) self - reported dietary behaviors ; (e) ratings of self - efficacy in healthy eating and exercise ; and (f) sociodemographics. survey participants in the subset were recruited from five out of the 14 low - income, multipurpose public health centers operated by the los angeles county department of public health (lacdph). although services such as immunizations and treatment for sexually transmitted diseases were standard across all public health centers, not all community programming and outreach activities were the same. the five sites that were selected, for example, were located in regions with the highest economic hardship indices and the highest prevalence of adult obesity (figure 1). in addition, the clients of these sites were among the intended audiences of several local obesity prevention efforts during 20102012. figure 2 shows selected center locations in relation to the nutrition interventions that were implemented by the cppw program and other state or locally funded efforts. survey participants were recruited by trained lacdph staff in the waiting rooms of the five public health centers described above. lacdph staff utilized a set of multistage, systematic procedures to recruit and enroll eligible participants during prespecified days of the survey period. these procedures accounted for such operational factors (when feasible) as each center 's seasonal and daily clientele volume ; time of day ; types of services offered or programming provided ; and clinic flow during the days of recruitment. all data collection activities took place between february and april, 2011. to be eligible for the survey, participants had to : (1) be receiving services from the clinic during the recruitment period ; (2) be at least 18 years of age ; (3) be a resident of los angeles county ; (4) not be pregnant ; (5) speak english or spanish ; and (6) agree to complete a series of anthropometric and self - administered assessments on a specified scheduled weekend day in one of the designated health center locations. all prospective participants were asked for their names and dates of birth during eligibility screening ; this information was monitored throughout the survey period to prevent individuals from participating more than once in the survey. as an incentive to participate, each participant was given a $ 50 gift card at the completion of the survey. prior to fieldwork, all survey protocols and materials were reviewed and approved by the lacdph institutional review board. trained lacdph staff including clinical personnel (e.g., public health nurses) measured heights and weights two to three times using a stadiometer (seca 213) and a digital scale (seca 876), respectively. blood pressure (bp) measurements were measured using an automated sphygmomanometer and an appropriately sized cuff (omron hem-907xl). the final recorded height, weight, and bp measurements were the average of the repeated measurements. each survey participant completed a standardized, self - administered questionnaire which included questions on sociodemographics, tobacco use, eating behaviors, and confidence about making changes to their diet and exercise routines. the seven - page paper questionnaire (available in both english and spanish) was developed using previously validated questions from population health surveys in the literature, including the national health and nutrition examination survey (nhanes) and the los angeles county health survey. the diet questions, which asked about self - efficacy in healthy eating and exercise, were adapted from the validated self - efficacy for diet and exercise scale developed by sallis and colleagues. these questions (based on a 5-point likert ranging from i know i can to i know i can not) included how sure are you that you can (a) stick to low - fat foods when you feel depressed, bored, or tense ; (b) stick to low - fat foods when there is high fat food readily available at a party ; (c) stick to low - fat foods when dining with friends or co - workers ; (d) cut down on the amount of food you eat at each meal (to decrease portion size) ; and (e) regularly read the serving size information listed on the nutrition facts label of packaged foods you eat. the english version of the questionnaire was translated to spanish using a standardized, forward - backward language translation protocol. descriptive and univariate analyses were first performed to generate frequency distributions and standard statistics for each variable. dependent and independent variables were identified, reviewed, and converted or transformed (as needed) to align with the statistical requirements of the various analyses. to assess overweight and obesity, we converted measured height and weight to body mass index (bmi = weight [kg]/height squared [m ]) using cut - off points for overweight and obese categories as defined by the cdc guidelines : bmi 160 or dbp > 100 = stage 2 hypertension. to facilitate comparisons of eating behaviors within the subset of low - income adults, key dependent variables including fruit and vegetable consumption (e.g., 4 servings per day versus 3 servings per day) were dichotomized as proxy indicators of healthy eating. the analysis of cut - offs for the number of servings consumed was based on research evidence suggesting worse cardiovascular health outcomes for adults who consumed 3 or less servings of fruits and vegetables per day as compared to adults who consumed 3 or more fruits and/or 5 or more vegetables per day ; this is in recognition that the recommended daily intake for any individual is generally based on age, gender, and physical activity level [1517 ]. where appropriate, mantel - haenszel chi - square tests and logistic regression procedures were performed to explore the relationships between participant characteristics (e.g., age, gender, education, employment, bmi, blood pressure, and smoking status) and participant behaviors (e.g., self - reported eating behaviors and self - efficacy in various aspects of healthy eating). logistic regression analyses, adjusted for age and gender, were conducted to compare key indicators by race / ethnicity. using consumption of 4 servings of fruit and vegetable as a proxy dependent variable for healthy eating, a series of multivariable regression models, adjusting for a range of covariates that are known to affect consumption of these foods [5, 18, 19 ], were constructed. these covariates included race, age, gender, education, bmi, blood pressure, smoking, and self - efficacy ratings on reading nutrition facts labels on the back of food packages. variable inclusion in the models was guided by a logic framework based on the socioecological perspective (figure 3). variable(s) for inclusion in each of the models were also informed by the results of bivariate analyses. model 1, for example, explored the predictive associations between sociodemographics and fruit and vegetable consumption. model 2 explored the predictive associations between cardiovascular disease risk factors and fruit and vegetable consumption. and model 3 explored the predictive associations between self - efficacy in healthy eating and fruit and vegetable consumption. in all models, fit was assessed using the hosmer - lemeshow goodness - of - fit test (p > 0.05). all data analyses were carried out using the sas version 9.2 statistical software (sas institute inc., cary, north carolina). of the 1,393 prospective survey participants approached, 983 met eligibility criteria and were scheduled appointments. of these, a total of 720 were low - income adults and completed the survey for a response rate of 74% for the subset. a large proportion of participants were black (40%) or latino (34%), between the ages of 25 and 44 years (48%), and women (57%). more than one - third had a high school education or less (39%), nearly one - quarter were college graduates (22%), and over one - half were unemployed or underemployed (58%). approximately two - thirds (68%) of the participants were overweight and/or obese ; 30% were in the prehypertension range based on objectively measured blood pressure readings (table 3). although only 28% were reported to be current smokers, approximately 63% indicated exposure to second - hand smoke. in general, fruit and vegetable consumption was relatively low in the group, with only about one - fourth consuming four or more servings of fruits and/or vegetables per day (26%). in the comparison analysis (see table 4), latinos were more likely than whites to be overweight and obese (adjusted odds ratio [aor ] = 3.9, 95% confidence interval [ci ] = 2.2, 6.9). similarly, blacks were more likely than whites to be overweight and obese (aor = 2.1, 95% ci = 1.2, 3.5). latinos were generally less likely to smoke, as compared to whites (aor = 0.4, 95% ci = 0.2, 0.7). based on objectively measured blood pressures, latinos and blacks experienced a greater burden of elevated blood pressure readings than whites : 49% of latinos (aor = 1.2, 95% ci = 0.7, 2.0) and 55% of blacks (aor = 1.4, 95% ci = 0.8, 2.4) had readings in the prehypertension and hypertension ranges. in multivariable regression analyses (see table 5), being a woman and having a high self - efficacy for regularly reading nutrition facts labels were strong predictors of high fruit and vegetable consumption. in the final model, women were 1.5 times (95% ci = 1.0, 2.1) more likely than men to consume 4 + servings of fruits and vegetables per day. participants with high self - efficacy in reading nutrition facts labels were 2.4 times (95% ci = 1.7, 3.5) more likely than their counterparts (with low self - efficacy) to do the same. the hosmer and lemeshow goodness - of - fit test indicated that these models were compatible with the data presented (= 5.57, p =.70). guided by a socioecological framework, the present study conducted a series of analyses to examine key characteristics of a subpopulation disproportionately affected by overweight and obesity in los angeles county. this priority group is one of several vulnerable groups targeted by a number of nutrition - focused obesity prevention interventions in the region (table 1) [7, 8 ]. although prior efforts have relied on national and/or county surveillance databases to aid program planning [1, 2, 4, 10, 20 ], this study is among the first to collect more granular, community - level health data that are representative of the groups targeted by program interventions that sought to make changes to the food environment. these data have implications for quality improvement, especially for local health authorities and community - based organizations seeking to improve or better tailor program delivery to their intended audiences. while emerging evidence supports the use of system and environmental change strategies [5, 7, 22 ], there remains a paucity of research that has fully elucidated the interactions between these structural modifications and individual health behavior change. to achieve meaningful outcomes in community and individual health, interventions often require substantive tailoring to match the needs and the unique social, epidemiological, and ecological characteristics of the target subpopulations [21, 23 ]. oka and colleagues (2013), for instance, analyzed a community - based epidemiologic survey using multilevel modeling to better understand area - based variations in obesity. they demonstrated differences in obesity prevalence by gender and race / ethnicity at the neighborhood level and concluded that, to be effective, future interventions / programs should address these and other neighborhood - specific characteristics. in the present study, the sampled population had high prevalence of overweight and obesity ; this was accentuated for latinos and blacks. this high prevalence, however, is not uniquely different from the documented evidence in the literature for us minorities [6, 25 ]. in the literature, disparities in obesity burden, including associated conditions such as hypertension, generally clustered in vulnerable groups, frequently confounded by multiple social and environmental factors that are not solely explained by socioeconomic status. these factors have included but are not limited to racism [27, 28 ], residential segregation, and the built environment. the most striking finding in the study was that gender and self - efficacy were strong predictors of healthy eating (e.g., fruit and vegetable consumption), even after controlling for a number of confounding variables including other demographics in the sampled group. this was somewhat unexpected given that the subset of adults included in the analysis represented a source population believed to be ready for and would benefit from structural changes made to the food environment (e.g., healthy food procurement, corner store conversion, 100% healthy vending machine policy, and competitive pricing of healthy foods in food venues). however, experiential information suggests that due to perceived lower educational attainment and poor nutrition in this population, differential patterns of receptivity or readiness to capitalize on these changes were likely common. as such, after adjusting for covariates such as age, race, and education, survey participants were significantly more likely to consume fruits and vegetables than other participants when they were women and had higher self - efficacy in reading nutrition facts labels. from a practical standpoint, intervening with women who typically make food selection decisions for their entire household (nutrition gatekeepers) may be advantageous to the overall effort to reduce obesity in los angeles county, as it can concurrently model positive changes in the diet of the entire family unit and can be applied across generations [31, 32 ]. intervening with women can also indirectly target other members of the household, especially men who often eat poorly [33, 34 ]. the potentially additive effect that may result from this action could augment the structural changes (i.e., through system and environmental interventions) made to the food environment by the recent federal and local obesity prevention initiatives. similarly, improving the level of confidence in practicing healthy eating behaviors may also help accelerate the community acceptance of changes made to the food environments by these efforts. to achieve optimal interventional effects, priming at - risk groups to accept and take advantage of structural improvements may be as important as improving the food environments themselves [10, 35 ]. first, generalizability of the findings to the general population in los angeles county was not feasible, as the sampled group principally represented the region 's low - income adult population. this, however, should not be considered a study weakness, as the demographics of the group aligned closely with the intended audiences of the various federal and local obesity prevention efforts in the region. second, large confidence intervals were observed for some of the point estimates in the analyses. for most of these, the smaller sample size(s) of the referent group (i.e., whites) likely contributed to the imprecision. third, self - selection and self - reporting bias likely led survey participants to over- or underestimate their food frequency and reports of self - confidence (self - efficacy in healthy eating). fourth, the study design was cross - sectional in nature and thus was only able to describe the regional health profiles of the subpopulation at one given point in time. finally, measurement errors, including misclassifications, likely introduced additional bias to the descriptive and comparison analyses. these potential errors, however, were minimized through iterative use of well - defined, standardized measurement protocols and rigorous training of field staff responsible for data collection. despite these limitations, community - level health data on particular subpopulations in los angeles county highlight the feasibility and utility of collecting these kinds of data to address socioecological factors that drive healthy eating in urban settings. to increase desired eating behaviors, both structural (system or environmental change) and individual - level approaches (e.g., changes in knowledge, attitudes, beliefs, intentions, and self - efficacy) should be employed. developing nutrition interventions tailored to the unique characteristics of targeted subpopulations can help prepare individuals to take advantage of the structural improvements or resources that are made available to them by obesity prevention initiatives. such tailoring of structural change interventions can be synergistically augmented by culturally sensitive public education and/or community engagement that seeks to address the underlying gender norms and self - confidence mediators known to shape eating behaviors. although local health data can help facilitate community planning and acceptance of system - level and environmental changes to the food environment, area - specific health profiles and behavioral determinants of healthy eating in the targeted subpopulations are often not well - characterized prior to nutrition program implementation or for use in subsequent program improvement efforts. the present study addresses this gap in public health practice by providing actionable data that the lacdph can use to further address health disparities in the region. many of the lessons learned in los angeles county may have similar applications in other us communities. local or community health assessments represent a set of tools that is often underutilized by public health authorities. ultimately, these chronic disease surveillance and assessment tools that document more granular information about subpopulations ' health status provide the opportunity for communities to tailor multisector public health programs to intended audiences. | although us obesity prevention efforts have begun to implement a variety of system and environmental change strategies to address the underlying socioecological barriers to healthy eating, factors which can impede or facilitate community acceptance of such interventions are often poorly understood. this is due, in part, to the paucity of subpopulation health data that are available to help guide local planning and decision - making. we contribute to this gap in practice by examining area - specific health data for a population targeted by federally funded nutrition interventions in los angeles county. using data from a local health assessment that collected information on sociodemographics, self - reported health behaviors, and objectively measured height, weight, and blood pressure for a subset of low - income adults (n = 720), we compared health risks and predictors of healthy eating across at - risk groups using multivariable modeling analyses. our main findings indicate being a woman and having high self - efficacy in reading nutrition facts labels were strong predictors of healthy eating (p < 0.05). these findings suggest that intervening with women may help increase the reach of these nutrition interventions, and that improving self - efficacy in healthy eating through public education and/or by other means can help prime at - risk groups to accept and take advantage of these food environment changes. |
the republic of india is the seventh largest country in the world and is home to nearly 1.2 billion people. with 28 states and 7 union territories spread over a vast geographic area with varying economic resources and infrastructure, india is among world 's most populous democracy. trauma, natural, as well as man - made disasters are common causes of fatalities. twenty percent of emergencies are trauma - related in prehospital setting adding up to existing burden of other emergencies. the who has estimated road crashes, cardiac, as well as stroke as major causes of death by 2020. thirty percent of acutely ill patients die before reaching the hospital in india and more than 80% of injured patients do not reach the hospital within golden hour. fear of injuring the victim, fear of poor performance and liability, reluctance to perform mouth to mouth cardio - pulmonary resuscitation (cpr) for out of hospital cardiac arrest, early evacuation of a trauma victim, and stoppage of bleeding are the keys to good outcome. current status of emergency care is lot to be desired at all tier of heath care system. there is a need for specialty of emergency medicine and emergency nursing, which is still in its infancy in india. prehospital care is not up to the mark, as it acts only as a transport vehicle. in the absence of training standards, no basic emergency care training protocols and poor prehospital care leads to adverse outcomes. considering the deficiencies and affordability in resource - constraint setting, the authors created a program named all india institute of medical sciences (aiims) basic emergency care course (becc) which addresses the issue of basic emergency care skills for healthcare and nonhealthcare personals. authors studied whether this initiative improves the knowledge and skill of healthcare workers and laypersons in basic emergency care in india. it was a prospective study over a period of 3 years (13 - 12 - 2009 - 24 - 05 - 2013) conducted all over the country. this structured course was created considering the important causes of deaths in india as per national crime report bureau. the contents of the course were cpr, choking, and special scenarios such as trauma, electrocution, drowning, hypothermia, and pregnancy [appendix 1 ]. to assess the validity, we did a pilot study on police personal and found a good improvement in the knowledge about basic emergency care and cpr. all india institute of medical sciences basic emergency care course provider course schedule it has two tier, provider course of 1 day duration and instructor course. the target groups were doctors, nurses, and lay persons (police constables, central reserved police force, border security force, national cadet crop cadets, and school children) of india. the course components included lectures, mannequin practice, audio - visual, and scenario - based training along with performance testing on one - person and two - person cpr as well as infant cpr. each batch had 16 - 24 participants with an instructor to student ratio of 1 : 4 - 1:6. theoretical knowledge was evaluated by 20 pre- and post - test questions [appendix 2 ]. the automated external defibrillator (aed) used was the lifepak 500 t aed training system (medtronic physio - control, usa) with defibrillation pads. remedial was done for those who could not pass the test as well as the skills. those who scored more than 90% and had good communication skills were eligible for instructor course and termed as instructor potential (ip). ic has to teach under supervision of a faculty in english and local dialect to become a certified instructor. the subjects evaluated the quality of course on parameters of content, presentation, and usefulness on a likert scale [appendix table 1 ]. after the end of the course, the participants were certified with aiims becc provider status card with a registration number having a validity of 2 years from the date of issue. basic emergency care course questionnaire a total of 1400 participants have done becc course. out of them, initially, a code was given to the participants on the basis of their education level and profession [appendix table 2 ]. however, for analysis, the participants were assigned three codes depending upon their education level. those who had studied up to 12 class (low education), graduates, and postgraduates (higher education) were given the code 1, 2, and 3, respectively [appendix table 3 ]. participants were also divided into two groups : medico and nonmedico group, depending on whether they belong to medical field or not. all paramedics, nurses, and doctors irrespective of education level were clubbed together and labeled as medicos and given code b. all the remaining participants were labeled as nonmedicos and given code a [appendix table 4 ]. pre- and post - course scores were compared and p value was calculated in all participants and intra- and inter - group comparisons were made. initial codes of participants of becc final code after merging of various categories of education final coding after merging various categories as nonmedico (code a) and medico (code b) initially, a code was given to the participants on the basis of their education level and profession [appendix table 2 ]. however, for analysis, the participants were assigned three codes depending upon their education level. those who had studied up to 12 class (low education), graduates, and postgraduates (higher education) were given the code 1, 2, and 3, respectively [appendix table 3 ]. participants were also divided into two groups : medico and nonmedico group, depending on whether they belong to medical field or not. all paramedics, nurses, and doctors irrespective of education level were clubbed together and labeled as medicos and given code b. all the remaining participants were labeled as nonmedicos and given code a [appendix table 4 ]. pre- and post - course scores were compared and p value was calculated in all participants and intra- and inter - group comparisons were made. initial codes of participants of becc final code after merging of various categories of education final coding after merging various categories as nonmedico (code a) and medico (code b) the overall precourse score of participants on knowledge about cpr and acute emergency care was 12.7 3.8. post - becc course, there was significant improvement in the score (17.9 2.1) as depicted in table 1. there was significant increase in score after undertaking becc in all the groups irrespective of their education level and profession. precourse and postcourse score (meansd) and p value intergroup comparison revealed that participants who are graduates and postgraduates had more significant gain in knowledge as compared to participants who are less educated, i.e., till class xii. the difference in knowledge gain between graduates and postgraduates participants was not significant [table 2 ]. difference in knowledge gain among various groups and their p value on comparing medico and nonmedico groups, it was found that medicos had better knowledge gain than the nonmedico (p < 0.05). out of 1283 participants, 1263 participants gave valid feedback and evaluated the quality of course on the basis of content, presentation, and usefulness. final code lies in between excellent and good on all the three scales of quality determination on a likert scale (content 1.11 0.35, presentation 1.18 0.39, and usefulness 1.16 0.46). they underwent 1 day instructor course, out of them, 25 participants became certified instructors. it is evident from the results that knowledge and skill of participants improved by our becc. there was significant knowledge gain at all education level including medicos and nonmedicos. by creating this program, we addressed the need of basic emergency care skills for healthcare and nonhealthcare personnel. there was a significant impact of the course as the variability in education, understanding, profession, and loco - regional factors were taken care of. it is being taught in local dialect such as hindi, marathi, and other local languages. the faculty was trained with micro - teaching skills in dialectics as well as taking skill stations. in a study by meaney., the authors compared novel techniques such as increased student : teacher ratio and feedback mannequins with traditional american heart association basic life support (bls) course. they found that cost - effective training strategies and devices are not inferior to the traditional techniques. they concluded that such courses should be developed in resource - limited settings to train the healthcare professionals. life supporting first aid was a term coined by safar and bircher for few simple measures which are crucial to make a difference for a patient 's immediate survival while waiting for the help. the american college of emergency physicians strongly encourages cpr training for the lay public. in recent years, various initiatives to optimize prehospital care have been developed such as organization of mass cpr training events, cpr training of family members of patients suffering from heart disease, mass education, television campaigns, and training of high school students. however, in a country such as india, affordability, language problem, and a demand far exceeding availability are the major issues. in a study by gombeski., they compared two training courses, one was 8 h long with three sessions and the other was 4 h long, single session, and they found that knowledge and performance scores were significantly higher for trainees from the long course. they further concluded that the length of the training program should be determined on the basis of the community 's needs and resources. in india, emergency medical service (ems) is in its infancy, a longer training course, which gives trainees a greater opportunity to expertise and retaining the skill is more appropriate. authors have trained doctors, nurses, and lay persons across india, and also recommend a longer (at least 8 h) training module with more hands on practice in view of poor availability of ems access in our country. in a meta - analysis by husain and eisenberg, the authors concluded that providing the police officers with basic cpr skills and training in the use of aed can increase survival rates for out - of - the hospital cardiac arrests (major link of early defibrillation in the chain of survival). in a study by papalexopoulou., the authors concluded that education level affects positively and age has an adverse effect on both acquisition and retention of cpr / aed skills. they recommended that the resuscitation courses might be designed according to the candidate 's literacy level. our course content was simple, easy to understand, and the basic minimum required for saving a life was taught. in our study we also found that the education level and profession too had an influence on knowledge gain with better gain in participant with higher education and medical personnel. in india, prehospital emergency care is not included in the medical curriculum, so most doctors have little knowledge of difficulties associated with the prehospital management of cardiac arrest victims. allison. developed an undergraduate prehospital trauma course and 205 medical students in the 4 year of medical school participated in the course. the feedback from the students and doctors completing the course was positive and they all felt better equipped to deal with the emergency situations. the authors also recommend the inclusion of chapter on basic prehospital emergency care for school children as well as training program for medical curriculum. our course mainly stresses on improving the knowledge and skill whereas the respondent 's intention to perform cpr on a real victim is predicted by his attitude. in a study by nielsen., they compared the effect of local television broadcast with bls and aed courses on the attitude of people toward different aspects of resuscitation. they concluded that a targeted media campaign and widespread education can significantly increase the willingness to use an aed and the confidence in providing chest compressions and mouth - to - mouth ventilation rather than a targeted campaign. we also feel that attitude can be changed with the support of media and mass education program along with frequent exposure and cpr training courses such as becc. the cpr guidelines recommend that the refresher training should be done within 12 - 24 months. in a study by papalexopoulou., the authors re - evaluated the participants 1, 3, and 6 months after initial training. they found that practical performance during the cpr / aed scenario was worse in the 1 month of re - evaluation, but due to repetition of the algorithm, there was an improvement in the performance in subsequent re - evaluations. regarding written evaluation, the mean scores improved over time. hence, they suggested that 6 months would be the ideal time for re - evaluation. in another study by nishiyama., the authors compared the cpr quality at 6 months and 1 year after the initial training. the cpr quality at 1 year was better as compared to 6 months, so they suggested that the 6 months evaluation can serve as refreshing training to improve and maintain cpr skills. the authors feel that every training course should be followed by a refresher course after 6 months. one of the major drawbacks of our study is the absence of refresher courses. the authors feel that every training course should be followed by a refresher course after 6 months becc has been an effective community emergency care initiative in improving the knowledge and skill of healthcare workers and laypersons in basic emergency care in india. our vision is to expand the pool of becc certified instructors across the country, so that they can disseminate the knowledge of prehospital care to each and every person across india leading to improvement in the outcome. all india institute of medical sciences, new delhi, disseminated the course with the logistic and financial support of national rural health mission and state government across india. all india institute of medical sciences, new delhi, disseminated the course with the logistic and financial support of national rural health mission and state government across india. | background : due to lack of training in emergency care, basic emergency care in india is still in its infancy. we designed all india institute of medical sciences basic emergency care course (aiims becc) to address the issue.aim:to improve the knowledge and skill of healthcare workers and laypersons in basic emergency care and to identify impact of the course.materials and methods : prospective study conducted over a period of 4 years. the target groups were medical and nonmedical personnel. provider aiims becc is of 1 day duration including lectures on cardio - pulmonary resuscitation, choking, and special scenarios. course was disseminated via lectures, audio - visual aids, and mannequin training. for analysis, the participants were categorized on the basis of their education and profession. a pre- and a post - course evaluation were done and individual scores were given out of 20 and compared among all the groups and p value was calculated.results:a total of 1283 subjects were trained. 99.81% became providers and 2.0% were trained as instructors. there was a significant improvement in knowledge among all the participants irrespective of their education level including medicos / nonmedicos. however, participants who had higher education (graduates and postgraduates) and/or belonged to medical field had better knowledge gain as compared to those who had low level of education (12th standard) and were nonmedicos.conclusion:becc is an excellent community initiative to improve knowledge and skill of healthcare and laypersons in providing basic emergency care. |
hypertension in kidney transplant recipients has a prevalence of 7590% and is a major modifiable cardiovascular risk factor.. however, in 824% of kidney transplant recipients, hypertension treatment targets are not reached despite intense medical treatment. the last resort therapy for post - renal transplant therapy - resistant hypertension is a bilateral nephrectomy of the native kidneys. however, the benefits of improved bp control usually do not balance the high peri - operative morbidity risks. in recent years, the observations on bilateral native nephrectomy as antihypertensive treatment founded the rationale for catheter - based renal denervation (rdn) in non - renal transplant patients. subsequently, rdn has been elaborated for treatment of resistant hypertension. the proof - of - concept symplicity htn-1 study (2010) [5, 6 ] and the symplicity htn-2 trial (randomized controlled against medical therapy alone, 2012), reported bp effects similar to that of bilateral native nephrectomies. against this background we set out to assess the feasibility of rdn of the native kidneys of patient with post - renal transplant therapy - resistant hypertension (netherlands trial registry 3866) by performing an uncontrolled clinical study in 20 consecutive patients. shortly after rdn in our first included patient, the randomized sham - intervention controlled symplicity htn-3 trial showed no benefit of rdn compared with sham intervention in general treatment - resistant hypertensive patients. this finding took away the rationale for our study design and therefore we discontinued the study. here, we report on our single patient receiving rdn. we studied a 50-year - old caucasian male patient who had received a renal allograft from a non - heart beating donor in 2004. mean 24-h ambulatory bp measurement (abpm) (watchbp o3, microlife, inc.) was 143/89 mmhg while compliantly using nifedipine 60 mg 1dd, doxazosine 4 mg 1dd, metoprolol 200 mg 1dd, aliskiren 150 mg 1dd and furosemide 80 mg 1dd. in the past years he had been using an increasing number of antihypertensive agents with for blood pressure beyond targets. the renal graft function had been stable over a period of > 3 years, with a creatinine level of 208 mol / l and a measured creatinine clearance of 37 ml / min while using mycophenolate mofetil 2000 mg and prednisolone 10 mg. no cardiac ultrasound was available. on abdominal ultrasound both native kidneys appeared atrophied (length of the right kidney was 5.6 cm and the left 5.0 cm). the right renal native artery was 5.8 mm in diameter, sufficient for access of the ablation catheter. no flow was visualized in the left native renal artery and therefore we decided to perform an angiography peri - procedurally to further assess its accessibility. the renal denervation procedure was performed via the left femoral artery under sedation (propofol 14 mg and alfentanil 300 mcg) and with an intravenous hydration protocol of 2000 ml sodium chloride 0.9% peri - procedurally. the angiography revealed that both native renal arteries were accessible, but no filling of parenchymal intrarenal vessels could be visualized in either kidney. rdn was performed using the symplicity catheter system (medtronic), in a spiral pattern with 4 radiofrequency ablation pulses to the right and 7 pulses to the left native renal artery (figure 1). to prevent over - heating in the left artery, a validated questionnaire on antihypertensive medication compliance with hill bone to high blood pressure therapy scale was taken before the intervention and at every follow - up visit. filling of the renal arteries with contrast - agent is shown ; however no filling of intrarenal parenchymal vessels is visualized. filling of the renal arteries with contrast - agent is shown ; however no filling of intrarenal parenchymal vessels is visualized. two weeks after the procedure, office bp measurement fell from 139/93 to 127/82 mmhg. moreover, the patient developed orthostatic complaints that allowed stepwise withdrawal of nifedipine and doxazosine and reduction of metoprolol by 50%. at 6 months, abpm showed a mean of 134/84 mmhg (9/5 mmhg), while on treatment with metoprolol 100 mg 1dd, furosemide 80 mg 1dd and aliskiren 150 mg 1dd (figure 2). the absent dipping pattern, i.e. the nocturnal bp drop, was not reversed after rdn. the plasma creatinine levels up to 6 months after the procedure remained roughly unchanged (208 mol / l pre - rdn to 185 mol / l post - rdn) nor the creatinine clearance changed (37 ml / min pre - rdn to 41 ml / min post - rdn) (figure 1). g / l) and medication compliance remained equal as assessed by the hill - bone compliance scale. an ecg performed 18 months after rdn revealed a decrease in voltages compared with an ecg before the rdn, indicating a possible reduction of left ventricular mass. the abpm after rdn was recorded while the patient had discontinued two antihypertensive agents and one drug dosage was reduced to 50%. the abpm after rdn was recorded while the patient had discontinued two antihypertensive agents and one drug dosage was reduced to 50%. this is the first reported case of catheter - based renal denervation in a kidney transplant recipient. the case does not prove the efficacy of renal denervation in posttransplant hypertension per se. however, it illustrates that renal denervation of the native kidneys is feasible. the rationale to apply renal denervation to non - functioning native kidneys seems stronger than the rationale to apply rdn in so called treatment - resistant hypertension in patients without kidney disease. for kidney transplant recipients it can serve as an alternative to native nephrectomy and the (native) kidney function is not set at risk. also, if rdn is successful the total daily drug dose might be decreased and it might increase adherence in this population with a high burden of daily drug intake. there is only one case description that reports on blood pressure reduction after renal denervation in a patient with esrd on dialysis. however, the lesson from the symplicity htn-1,-2,-3 saga is that the effectiveness of renal denervation can only be reliably studied in a sham - intervention controlled study design. therefore we discontinued our uncontrolled open label study. also in our patient we can not rule out that the blood pressure effects are due to increased medication compliance, such as has been suggested to explain the blood pressure changes as observed in symplicity htn-1 and -2. this case provides an argument for performing a sham - intervention controlled trial on rdn in kidney transplant recipients. rdn could be an attractive alternative for bilateral nephrectomy for treatment of post - renal transplant therapy - resistant hypertension. c.t.p.k. is supported by grants ip-11.40 and kjpb12.29 from the dutch kidney foundation and zonmw clinical fellowship (40007039712461). | there is a strong rationale for renal denervation (rdn) of the native kidneys in kidney transplant recipients with treatment - resistant hypertension. we present a patient with a stable graft function, who underwent rdn for posttransplant therapy - resistant hypertension (24-h ambulatory blood pressure measurement (abpm) 143/89 mmhg, while compliantly using five different antihypertensive agents). after rdn, bp measurements and orthostatic complaints required withdrawal of two antihypertensive agents and halving a third. at 6 months, abpm was 134/84 mmhg and allograft function remained unchanged. this case calls for designing well - designed prospective studies on rdn in kidney transplant recipients. |
in japan s rapidly aging society, approximately 80% of individuals in elderly care facilities use a wheelchair for mobility and everyday activities. however, most of the wheelchairs used in elderly care facilities are of the standard type (conveyance devices) with minimal functions. these wheelchairs are not suitable for long - term use, and as shown in fig. in addition, because the japanese industrial standards for currently used wheelchairs are based on north american standards, these wheelchairs are too big and not suitable for the physical dimensions of the smaller japanese elderly who are often on the verge of falling when seated in these wheelchairs (fig sekikawa1 reported that little attention is paid to the wheelchair fit for individual users, because a wheelchair is generally considered as merely a device for mobility. issues related to wheelchair fit sugihara.2 described falling as a risk factor in elderly individuals who use wheelchairs. among wheelchair users, a common reason for falls is a change in body position3. being seated for long periods in a poorly fitted wheelchair could lead to excessive stress4, and frequent changes in body position could lead to falls and injuries. these stresses affect the autonomic nervous system (ans)5, 6, and unconscious reflexive responses7 presumably occur to avoid distress. previous studies6,7,8,9,10,11,12 have shown the effect of emotions on ans functions including heart rate and respiration. caregivers may discuss comfort with wheelchair users and adjust their wheelchair positioning (fig. 1-c) to promote comfort with a moderate amount of tension in order to reduce the risk of falls. recent research in postural maintenance has included posture adjustment and prevention of pressure ulcers based on seating pressures13,14,15 and the adjustment of backrest angles16,17,18. comfort can be assessed if communication between the caregiver and wheelchair user is smooth, but in elderly persons with dementia or a speech impairment, obtaining this information depends on the caregiver s experience. therefore, the purpose of the present study was to develop an algorithm that can predict the comfort of a subject using a wheelchair, based on common clinical measurements and without depending on verbal communication. twenty healthy males (mean age : 21.5 2 years ; height : 171 4.3 cm ; weight : 56 12.3 kg) participated in this study. comfort was evaluated every 5 min from the start of testing using a visual analogue scale (vas) for obtaining information from the subjects. this vas was a 10 cm line on which 0 cm represented a state of relaxation, as when going to sleep, and 10 cm represented the worst discomfort experienced previously. posture quality (good or poor) was evaluated by the vertical component of a force plate (bp400600hf, amti, watertown, ny, usa). a good posture was defined as one in which the center of gravity of the head, arms, and trunk (hat) segment and the sitting center of pressure were aligned, while a poor posture was defined as one with an inclined ground reaction force vector. the pelvic tilt angle is used to identify a posterior pelvic tilt, or the so - called sacral sitting, which occurs with poor posture. in addition, several markers were attached to the body, and thoracoabdominal breathing was recorded using 14 infrared cameras (mx - t10s, vicon, oxford, uk) and a 3d motion analysis system (vicon - nexus1.82, vicon, oxford, uk). to acquire exercise physiology data, a respiratory and metabolic analysis system (k4b2, cosmed, rome, italy) was attached to each subject, and parameters such as energy consumption, respiratory rate, and ventilation amount were measured. to acquire ans data, a heart rate monitor (hrv - live, biocom, warren, mi, usa) was attached. in addition to assessment of the increase in heart rate, a frequency analysis of the heart rate data over 256 points was performed, and the sympathetic and parasympathetic nervous system components were determined. a sphygmomanometer (hem-7500f, omron, kyoto, japan) was used to measure systolic and diastolic blood pressures. in addition, salivary amylase activity was measured using a salivary amylase monitor (t-110-n, nipro, tokyo, japan), and the percentage change was used as an indicator of sympathetic nervous system activity and as a stress marker. verbal instructions such as do not move after starting until the experiment is complete were given to each subject. each subject underwent testing under 4 experimental conditions (table 1table 1.experimental conditionsexperimental levelnotationconditionsa1ncg good posture, no cushion(non - cushion good posture)a2cggood posture, with cushion(cushion good posture)b1ncbbad posture, no cushion(non - cushion bad posture)b2cbbad posture, with cushion(cushion bad posture)). these were good posture without a cushion as non - cushion good (ncg) and with a cushion as cushion good (cg), and bad posture without a cushion as non - cushion bad (ncb) and with a cushion as cushion bad (cb). the experimental wheelchairs were built from standard wheelchairs so that the seat height, footrest height, and reclining angle could be adjusted for each subject. to assess the effects of a standard cushion and those of a high - performance cushion, 2 types of cushions were used in the experiment : a j2 cushion (j2:jfusion1414, access international, tokyo, japan) and a wheelchair cushion (flatfit, jci, sendai, japan). the subjects were divided into 2 groups to assess the differences in the effects of the 2 cushions. the j2 cushions are generally perceived as high - end products, while the flatfit cushion is considered a popular price product. this was a single system design, with the first 10 min in the recumbent resting position as the baseline and the next 30 min in the sitting position, which was followed again by the recumbent resting posture. the evaluated parameters were extracted for the time points from a to f (fig. the vas score was used as an objective variable, and the other evaluation parameters were used as explanatory variables for multiple regression analysis, which was performed using a statistical analysis software (juse - statworks v5, the institute of japanese union of scientists & engineers, tokyo japan). this study underwent ethical review and received approval from the hokkaido university of science, and written informed consent was obtained from each subject. a regression formula is shown for predicting the vas score as the objective variable (table 2table 2.regression formula to predict vasvariablesstandard regression coefficientx1systolic blood pressure0.066x2hf (high frequency) component0.0014x3respiratory rate0.134x4lf / hf (low frequency / high frequency) component0.299x5heart rate increase rate0.046x6ventilation amount1.404x7amylase elevation rate0.002x8posture (good posture 1, poor posture 2)0.983x9measurement time (minutes)0.077x10with / without cushion (with 1, without 2)1.853x11heart rate0.116bconstant term9.389 : p < 0.01. the actual measurement value of each parameter is substituted for each variable (x1x11) in table 2, multiplied by the partial regression coefficient, and all the variables are then added, including a constant term (b), to predict the vas score. the regression formula is shown below.predicted vas= 9.389(0.066x1)(0.0014x2)(0.134x3)(0.299x4)(0.046x5)(1.404x6)(0.002x7)+(0.983x8)+(0.077x9)+(1.853x10)+(0.116x11) : p < 0.01. residual standard deviation = 1.2 for example, during sitting ; x1 : systolic blood pressure is 140 mmhg, x2 : hf (high frequency) component (parasympathetic nervous system component) is 500 ms, x3 : respiratory rate is 14/min, x4 : lf / hf (low frequency / hf) ratio is 1.2, x5 : rate of increase in heart rate(rate of increase with value at rest as baseline) is 120%, x6 : ventilation amount is 0.5 l / min, x7 : amylase elevation rate (rate of increase from value at rest as baseline) is 100%, x8 : posture is good posture 1, x9 : measurement time is 15 min, x10 : without cushion condition is 2, and x11 : heart rate is 75 beats / min ; then, by substituting these variables in the formula : predicted vas= 9.389(0.066 140 mmhg)(0.0014 500ms)(0.134 14/min.)(0.299 1.2 ratio)(0.046 120%)(1.404 0.5 l)(0.002 100%)+(0.983 1)+(0.077 15 min.)+(1.853 2)+(0.116 75 beats / min.)= 5.15 the adjusted multiple correlation coefficient, which shows the accuracy of the regression formula, was 0.72 (table 2). 3.predicted vas score and actual vas score over time in subject a (worst fit) and subject x (best fit). dotted line : energy consumption measured values. solid line : vas predicted value, dotted line : vas measured value. the right vertical axis : energy consumption (kcal / h) of cumulative per one hour. cg : cushion good posture ; ncb : non - cushion bad posture ; vas : visual analogue scale shows the graph for subject a (worst fit) and subject x (best fit) during the ncb and cb conditions. the horizontal axis is the time ; the left vertical axis shows the vas score ; and the right vertical axis shows energy consumption based on respiratory and metabolic analyses. the results demonstrated that the predicted vas varied greatly and did not completely correspond with the actual measurement values in subject a (fig. 3-a, b). however, subject x showed a very good fit (fig. 3-c, d). predicted vas score and actual vas score over time in subject a (worst fit) and subject x (best fit). dotted line : energy consumption measured values. solid line : vas predicted value, dotted line : vas measured value. the right vertical axis : energy consumption (kcal / h) of cumulative per one hour. cg : cushion good posture ; ncb : non - cushion bad posture ; vas : visual analogue scale the purpose of the present study was to predict the comfort of a subject seated in a wheelchair, based on common clinical measurements and without depending on verbal communication for subjective comfort assessment. it was found that in healthy adult male, wheelchair comfort could be predicted with an accuracy of 72%. however, caution is needed for a vas score of 7.6, when using this algorithm. this algorithm, which predicts comfort based on wheelchair - seated postural data and ans parameters, is necessary so that caregivers can adjust the wheelchair - seated posture of patients who can not communicate well conveniently and objectively. the present study results showed that in healthy male, the vas score could be predicted with an accuracy of 72%. for example, for a predicted vas score of 7.6, there is a variation of 1.2. statistically, this indicates that 95% of the data fall within the mean 2 sd, so that if the predicted value exceeds 7.6, there is a 2.5% possibility that the actual vas score is the maximum possible value of 10. therefore, when utilizing this algorithm measurement system to predict the comfort of a wheelchair fit, caregivers should be cautioned when the predicted value exceeds 7.6. in a similar study, to validate the prediction accuracy, huang.19 performed regression analysis using the vas score as the dependent variable and the ratio of the lumbar multifidus muscle cross - sectional area of the unaffected and affected sides as an independent variable to predict the severity of chronic lower back pain. for the prediction accuracy, they reported a coefficient of determination of 0.72 and a standard deviation of 1.24. thus, with regard to prediction accuracy and variation, similar results were found, even though the measurement conditions were different. watanuki.20 attempted to create an estimation model using discriminant analysis, with psychological excitement (vas) when watching television programs as a dependent variable and ans parameters such as blood pressure and heart rate as independent variables. they reported a distinction rate of 83% for the calm condition and a mean error of 17%. in the present study, the residual standard deviation for the vas (range 010) was 1.2 ; in other words, the prediction error was 12%. figure 3 shows the serial changes in the predicted vas in subject a. during the ncb condition, compared to the cg condition, when the energy consumption was higher, the measured vas was also higher. the predicted vas was also higher during the ncb condition ; therefore, identifying a difference, exceeding an error of 12%, would be possible. our research group is currently focusing on development of a wheelchair fit support system using kinect 2 for windows (kinect 2). kinect 2 acquires body skeletal coordinate data, so that posture can be assessed with a camera recording the wheelchair - seated posture. moreover, with image processing technology, the heart rate and respiratory data can be obtained from kinect 2 without any contact. by combining the present algorithm for predicting wheelchair comfort, as established in this study, with a wheelchair fit support system using kinect 2, appropriate guidelines, necessary precautions, and other important information | [purpose ] the purpose of this study was to develop an algorithm to predict the comfort of a subject seated in a wheelchair, based on common clinical measurements and without depending on verbal communication. [subjects ] twenty healthy males (mean age : 21.5 2 years ; height : 171 4.3 cm ; weight : 56 12.3 kg) participated in this study. [methods ] each experimental session lasted for 60 min. the clinical measurements were obtained under 4 conditions (good posture, with and without a cushion ; bad posture, with and without a cushion). multiple regression analysis was performed to determine the relationship between a visual analogue scale and exercise physiology parameters (respiratory and metabolism), autonomic nervous parameters (heart rate, blood pressure, and salivary amylase level), and 3d - coordinate posture parameters (good or bad posture). [results ] for the equation (algorithm) to predict the visual analogue scale score, the adjusted multiple correlation coefficient was 0.72, the residual standard deviation was 1.2, and the prediction error was 12%. [conclusion ] the algorithm developed in this study could predict the comfort of healthy male seated in a wheelchair with 72% accuracy. |
the main molecular mechanism underlying signal transduction in eukaryotic cells relies on the regulation of protein function by posttranslational modifications. the transient and reversible attachment of reactive moieties on specific residues is able to induce a plethora of effects on protein function, thereby giving rise to a dynamic interplay of protein interactions capable to convey signals within the cell. among these, redox signal is highly specific and represents a prerogative of sulfur - containing residues. in particular, cysteine is more versatile than methionine in forming adducts because of its capability to be present under numerous oxidation states. this feature allows cysteine reacting with many oxidant species, such as hydrogen peroxide, glutathione disulfide (gssg), or nitric oxide (no) moiety, generating in such a way the reversible s - hydroxylated (soh), s - glutathionylated (ssg), or s - nitrosated (sno) derivative, respectively. among them, glutathionylation or, widely, disulfide bond formation is the most stable cysteine oxidative modification. this is the reason why, physiologically, both s - hydroxylated and s - nitrosated proteins usually convert in s - glutathionylated (in the presence of high concentrations of gsh, as normally occurs inside the cells) or, widely, disulfide adducts. it should be also reminded that, similarly to hydrogen peroxide, no overproduction has been reported being associated with irreversible sulfhydryl oxidation, such as sulfinylation (so2h) or sulfonylation (so3h) of metalloproteases. however, these last modifications likely imply the production of peroxinitrite (onoo), a more dangerous and more oxidant reactive nitrogen species (rns) generated by the reaction between no and superoxide anion (o2), which has been copiously reported being involved in protein tyrosine nitration (see below). nitric oxide is a gaseous and membrane - diffusible radical molecule produced by the class of nadph - dependent enzymes no synthase (nos) [4, 5 ]. the first evidence of no involvement in signal transduction goes back to 1983 when it was demonstrated that cgmp - mediated regulation of blood vessel tone depended on the direct binding of no to the heme iron (fe - nitrosylation) of guanylyl cyclase [6, 7 ]. since then, increasingly data provided further and indisputable lines of evidence pointing out this pathway being, in fact, implicated in many other functions, such as immune response, neurotransmission, and mitochondrial respiration. indeed, physiologically no can bind to free iron within any heme - containing protein with a free ligand position. by this reaction, and also by binding the copper binuclear centers in a noncompetitive manner, no can regulate cytochrome c oxidase activity and, more widely, it can tune mitochondrial respiration. alongside these findings, the involvement of no in redox signaling was emerging and progressively assuming distinctive signatures. over those years, it became clear, indeed, that s - nitrosation is the main reversible posttranslational modification induced by no able to regulate different classes of proteins [1315 ]. the discovery of denitrosating enzymatic systems, namely, those dependent on thioredoxin 1 (trx1) and s - nitrosoglutathione reductase (gsnor) activities, which actively participate the s - nitrosothiol - to - sulfhydryl (sno - to - sh) reduction [1619 ] (figure 1), definitively sealed the importance of s - nitrosation in cell physiology and human health (table 1). actually, no can also trigger irreversible modifications to proteins, such as the formation of nitrotyrosine. however, this is an event occurring only under certain conditions (nitrosative stress) that do not deal with signaling but just represents marker of damage. in particular, when no is overproduced and no longer neutralized, it can react with oxygen - derived radical and nonradical species (ros) thereby generating more dangerous rns, for example, onoo [20, 21 ] (figure 1). as previously mentioned, protein s - nitrosothiols (psnos) generation is specific, redox - mediated, and reversible depending on several factors, such as the environmental hydrophobicity conditions and the steric hindrance, as well as the net charge and the presence of oxygen [2, 13 ]. in addition, it has been reported that the specificity of s - nitrosation can also depend on the presence of an s - nitrosation motif roughly characterized by acid - base residues surrounding the target cysteine. nevertheless, many other factors deeply impact on the identity of specific proteins undergoing s - nitrosated, such as cellular localization and compartmentation of no production. in addition, the evidence that no moiety can be also transferred among proteins or low - molecular - weight s - nitrosothiols (e.g., s - nitrosoglutathione, gsno), adds further complexity to the regulation of protein s - nitrosation. the major determinant for no transfer (transnitrosation) is the difference between the redox potential of the two interacting cysteine residues. this aspect takes more importance if transnitrosation does not occur with low - molecular - weight thiols, but takes place between proteins. indeed, this reaction is responsible for the propagation of many no - mediated cell signaling pathways and its significance has been highlighted quite recently in many physiopathological processes, such as (i) no exchange between hemoglobin and the anion exchanger 1, which mediates no release from erythrocytes ; (ii) transnitrosation among thioredoxin (trx), caspase-3 and the inhibitor of apoptosis (iaps) proteins, which is involved in the regulation of cell death by apoptosis [27, 2931 ] ; (iii) glyceraldehyde 3-phosphate dehydrogenase (gapdh)-mediated s - nitrosation of nuclear proteins, which contributes to cell death and accounts for the pathogenesis of several neurodegenerative diseases [32, 33 ] ; (iv) transnitrosation between the neuronal - specific cyclin dependent kinase 5 (cdk5) and dynamin - related protein 1 (drp1), which plays a pivotal role in mitochondrial dysfunction typical of neurodegenerations [26, 34 ]. psnos levels are counterbalanced by denitrosation systems, the most important of which are the glutathione (gsh)/gsnor and the trx1/trx reductase (trxr) couples [2, 18, 35, 36 ] (figure 1). in the light of what mentioned above, only a specific subset of proteins is s - nitrosated, resulting in the selective modulation of specific signaling pathways. in this scenario, it is plausible that the propagation or modulation of cell signals by s - nitrosation often implies a crosstalk with signaling modalities mediated by other mechanisms of posttranslational modification. in the last decades, the discovery of s - nitrosation of both protein kinases and phosphatases suggested the influence of this modification in a wide range of signal transduction pathways mediated by phosphorylation / dephosphorylation [3840 ]. this aspect is of great importance if one considers that s - nitrosation can convert into s - glutathionylated / disulfide adduct and that this is a well - known mechanism driving signal transduction mediated by phosphorylative cascades. likewise, it has emerged that s - nitrosation may also operate in the nucleus on epigenetic mechanisms of transcriptional regulation, in particular by interfering with histone acetylation status. ubiquitination of proteins, which represents the pivotal reaction underlying protein turnover and quality control, might be also affected by s - nitrosation because many enzymes involved in ubiquitination process have critical cysteines, which have been reported undergoing oxidation [4345 ] or, actually, sumoylation. s - nitrosation could therefore have deep implications in a number of pathophysiological conditions involving ubiquitin - proteasome system (ups). ubiquitination is an enzymatic posttranslational modification process occurring on proteins, based on the ligation of ubiquitin (an 8.5 kda protein) on a target protein lysine residue (monoubiquitination). this first step may be followed by the formation of ubiquitin chains through the attachment of additional ubiquitin moieties to one or more of the seven lysine residues within conjugated ubiquitin (polyubiquitination). the covalent attachment of ubiquitin on lysine residues requires the coordinated reaction of three enzymes. the first reaction is accomplished by the ubiquitin - activating enzymes (e1), which promote ubiquitin adenylation required for its covalent binding to the cysteine residue located at the e1 active site. ubiquitin - charged e1 enzymes next transfer ubiquitin to the cysteine of the ubiquitin - conjugating enzymes (e2) that, in concert with a wide class of enzymes known as ubiquitin ligases (e3) needed for target recognition, finally transfer ubiquitin on lysine residues of specific substrates. protein ubiquitination is the major mechanism underlying protein turnover and quality control, as it is responsible for the redirection of damaged / unfolded proteins towards the proteasome to be degraded. in addition, it mediates the recognition of damaged organelles, or protein aggregates, by means of adaptor proteins (i.e., p62/sequestosome) that are also implicated in autophagy - mediated degradation. this further function emphasizes the paramount role of ubiquitination in cellular homeostasis, as it is at the crossroads between different degradative pathways (both proteasome and autophagy mediated). although ubiquitination was initially shown to drive protein degradation, it is now commonly accepted that the nature of ubiquitination (monoubiquitination versus polyubiquitination), as well as the type of interubiquitin linkages in polyubiquitin chains, mediates different response in cellular processes and signaling, including antigen processing, apoptosis, cell cycle, dna transcription, and repair. nitric oxide can affect ubiquitin conjugation steps and proteasomal degradation of ubiquitinated proteins at different level (figure 2). for instance, the catalytic site of ubiquitinating enzymes (e1-e2-e3) contains a cysteine residue that it is now arising could be susceptible to s - nitrosation [5355 ]. s - nitrosation has been also shown to inhibit e3 ligase activity in ring (really interesting new gene) finger motif - containing proteins, modulating in such a way the downstream signaling cascades. notably, ring e3s do not have recognizable active sites that define the canonical enzymes. instead, they have large binding interfaces and act as scaffold proteins bringing together the participant e2 and substrate proteins. therefore, s - nitrosation might affect the interacting properties of this class of e3 ligase. one example is the ring finger e3 ligase parkin, whose mutations have been demonstrated being implicated in parkinson 's disease etiopathogenesis. s - nitrosation of parkin inhibits its activity, thereby resulting in enhanced accumulation of protein aggregates, as well as impairment of autophagy - mediated removal of damaged mitochondria (mitophagy) (figure 2). likewise, s - nitrosation of the ring finger e3 ligase x - linked iap (xiap) has been reported to inhibit ubiquitin - mediated proteasomal degradation of caspase 3, thereby resulting in the promotion of cell death by apoptosis [30, 55 ] (figure 2). beside the effects on ubiquitin conjugating system,, s - nitrosoglutathione (gsno) exposure revealed that the 20s catalytic core of the 26s proteasome contains 10 cysteines which undergo s - nitrosation, thus resulting in the inhibition of all three catalytic activities of the complex (chymotrypsin-, trypsin-, and caspase - like) (figure 2). since the 26s proteasome is responsible for the time - dependent degradation of cell cycle proteins (e.g., cdk2, cdk4, cyclins, and the cyclin - dependent kinase inhibitors p21 and p27), the inhibition of its activity by s - nitrosation can affect cell cycle progression and proliferation the effects of s - nitrosation - mediated modulation of protein turnover can also directly impact on target proteins, such as in the cases of the key apoptosis regulatory protein bcl2 and the antiapoptotic flice inhibitory protein (flip), whose s - nitrosation inhibits their ubiquitination and proteasomal degradation and finally leads to apoptosis suppression [58, 59 ] (figure 2). furthermore, s - nitrosation may indirectly inhibit ubiquitination via the regulation of alternative posttranslational modifications, such as in the case of the no - mediated activation of nuclear factor -light - chain enhancer of activated b cells (nf-b). s - nitrosation of ib kinase (ikk) inhibits its kinase activity, making it unable to phosphorylate the inhibitor of nf-b (ib) which, in turn, does not undergo ubiquitination and degradation via the proteasome, leaving nf-b unable to translocate into the nucleus and to induce transcription [60, 61 ] (figure 2). while many observations argue for s - nitrosation being a posttranslational modification that negatively affects ups efficiency, there is a literature supporting the hypothesis that it can also indirectly enhance ubiquitin - mediated protein degradation. in regards to this aspect, it should be reminded that polyubiquitination - mediated degradation of some proteins relies upon the conversion of n - terminal domain - located asparagine, glutamine or cysteine residues into arginine. this is required in order to allow recognition by e3 ligases of proteins being degraded (the so called n - rule). arginylation of the n - terminal cysteines seems to be facilitated by s - nitrosation thereby suggesting the involvement of this modification in the turnover of many substrates. the propensity of a number of proteins to undergo ubiquitination after s - nitrosation is not so unusual. an exhaustive example is provided by the key dna repair protein o - alkylguanine - dna alkyltransferase (agt), whose s - nitrosation has been reported to induce its massive proteasomal degradation and to negatively affect dna repair (figure 2). skeletal muscle atrophy can be defined as wasting or decrease in muscle mass owing to injury, lack of use, or disease. muscle atrophy arises either from damage to the nerves that supply the muscles (neuromuscular disease) or disease of the muscle itself (musculoskeletal disease). the causes of atrophy rely on genetic mutations, such as in amyotrophic lateral sclerosis and muscular dystrophies, or are derived from systemic diseases, such as diabetes, cancer, and metabolic inflammation. nevertheless, the totality of atrophic conditions shares an imbalance between protein synthesis and degradation, resulting in reduced protein synthesis and increased protein breakdown, which in turn leads to reduced muscle mass and muscle fiber size. indeed, independently of the etiology, muscle atrophies are commonly identified by the upregulation of the same set of genes, the so - called atrophy - related genes, or atrogenes, among which atrogin-1/muscle atrophy f - box (mafbx) and muscle ring finger 1 (murf1) are well documented. these genes belong to the family of e3 ligase enzymes, which are responsible for the massive protein breakdown occurring in these diseases. in skeletal muscle atrophy, the central role of the ubiquitin - proteasome pathway has been characterized through the pioneering studies on gene expression profile independently performed by the research groups of goldberg and glass [65, 66 ]. in particular, they revealed that atrogin-1/mafbx and murf1 are the two muscle - specific ubiquitin ligases upregulated in different models of muscle atrophy and responsible for the increased protein degradation via the ups. another interesting common point of muscular atrophies is the occurrence of nitroxidative stress [67, 68 ] ; indeed, accumulation of nitrotyrosine adducts has been detected in models of disuse - induced atrophies, as well as genetic - based dystrophies. in skeletal muscle, the maintenance of a fully functioning fiber requires the correct assembly of the dystrophin glycoprotein complex (dgc). it is composed by several transmembrane and peripheral accessory proteins which are highly expressed in the sarcolemma and constitute a critical link between the cytoskeleton and the extracellular matrix. it has been reported that dgc participates in cell signaling through the involvement of nnos, which is predominant muscular isoform of nos found to be associated to the complex via the alpha - syntrophin. one possible mechanism underlying the overproduction of no in muscle cell under atrophic conditions is the dislocation of nnos from the dgc underneath the sarcolemmal membrane, followed by its redistribution into the cytosol where it produces no. interestingly, the dislocation of nnos occurs in many types of dystrophies, such as duchenne muscular dystrophy, which is characterized by the complete ablation of dystrophin, and in autosomal recessive limb girdle muscular dystrophy (ar - lgmd), where mutations of sarcoglycan proteins seem to be the main causative events of the pathology. furthermore, dislocation of nnos from the dgc occurs also in rat models of disuse- or denervation - induced atrophy, indicating that this mechanism could underlie, at least in part, the pathology of muscular disorders. more recently, it has been also demonstrated that nnos dislocation induces force reduction, which is typical feature of dystrophin - null mouse models, by means of still not elucidated mechanisms putatively involving tyrosine nitration and also s - nitrosation. the first evidence of s - nitrosation involvement in this class of pathologies involves the s - nitrosation, and the subsequent hyperactivation, of the ca release channel ryanodine receptor 1 (ryr1). such a modification leads to a chronic ca leakage from sarcoplasmatic reticulum [76, 77 ] and triggers mitochondrial fragmentation underlying muscle atrophy. moreover, no has been reported being involved in the activation of forkhead box o (foxo) 3a transcription factor (foxo3a). although the molecular mechanisms underlying this process are not well established yet, the increase of intracellular no levels within the cell seems to be capable of mediating foxo3a activation and nuclear translocation, thereby inducing skeletal muscle atrophy by upregulating murf1 or atrogin-1/mafbx [79, 80 ]. in this context, it is of note to remind that also myogenin, a protein involved in myofiber differentiation and development of functional muscles, has been reported undergoing s - nitrosation, reasonable at the level of cys61 and cys65. this modification profoundly impacts on myogenin ability to bind dna at the promoter regions to activate downstream gene expression (e.g., caveolin-3) and finally result in muscle atrophy (table 2). indeed, denervation or peripheral nerve injuries (e.g., those characterized by partial loss of fibers or myelin in the nerve) strongly contribute to muscle wasting. besides the already mentioned muscular dystrophies, also cancer and diabetes, as well as aging - related cachexia, show alterations of nerve physiology associated with no dysbalance and psnos increase [72, 83 ]. moreover, it has been reported that no overproduction and s - nitrosation could be directly associated with the transduction pathways underlying fatigue and myalgia deriving from muscle wasting, which are typical features of skeletal muscle atrophic states. in particular, recent lines of evidence argue for s - nitrosation of the transient receptor potential vanilloid 1 and ankyrin 1 (trpv1 and trpa1, resp.), two polymodal ion channels of peripheral sensory dorsal root ganglia, being the principal event underlying the sensitivity of noxious stimuli impinging on peripheral nociceptors [85, 86 ] (table 2). as above reported for correct muscle maintenance, a balanced ratio between protein synthesis and degradation is important also for neuronal viability. actually, an efficient removal of unfolded or damaged proteins and organelles is crucial to prevent neuronal death and to preserve axonal integrity. in regard to this aspect, several proteins have been reported playing a pivotal role in neurodegenerative diseases when s - nitrosated. drp1 is a case in point, as its mitochondrial translocation and gtpase activity seem to be enhanced when the protein undergoes s - nitrosation at cys644. this gain - of - function modification which has been found associated with alzheimer 's disease and pathological conditions affecting central nervous system (table 1)alters mitochondrial dynamics process by increasing mitochondrial fragmentation and finally contributes to neuronal cell demise. we readily refer to other comprehensive and more focused reviews dissecting in detail this aspect, while attempting here to deal with how s - nitrosation of proteins involved in ubiquitination process can impact on peripheral nervous system physiology. among them, the ubiquitin e3 ligase trim2 (tripartite motif containing protein 2), which is involved in the regulation of axonal specification and polarization, has been very recently proposed to be neuroprotective. in particular, ylikallio and colleagues reported that trim2 mutations that result in the complete loss of the protein are associated with childhood onset of axonal neuropathy leading to muscle mass reduction. mouse models of trim2 deficiency recapitulate the human phenotype due to an aberrant axonal accumulation of neurofilaments that are no more ubiquitinated and degraded via the proteasome. although no evidence on possible redox reactions, namely, s - nitrosation, have been provided yet on trim2, it is plausible that its occurrence could inhibit trim2 activity, as already demonstrated for many other members of the ubiquitin e3 ligase superfamily, thereby allowing speculating that the existence of an s - nitrosated form of trim2 could correlate with the onset of axonopathy and muscle atrophy - associated peripheral neuropathy. likewise, the mitochondrial ubiquitin e3 ligase mitol has been demonstrated to regulate mitochondrial dynamics, as well as to counteract the toxicity of polyglutamine - containing protein ataxin 3 and mutant superoxide dismutase 1, which are the main causes of machade - joseph disease and amyotrophic lateral sclerosis, respectively. very recently it has been indicated that mitol undergoes s - nitrosation and loss of activity, thereby resulting in mitochondrial aggregation and neuronal cell death. among the large amount of substrates, mitol also regulates the turnover of microtubule - associated protein 1b - light chain 1 (lc1) that, intriguingly, is ubiquitinated by mitol and then subjected to proteasome - mediated degradation only when s - nitrosated. thus modified, indeed, lc1 translocates to the cytoskeleton, stabilizes microtubules and, consequently, freezes organelle transport. therefore, under moderate (physiological) no concentration, mitol is required to maintain intracellular traffic by promoting lc1 degradation. conversely, under nitrosative / toxic conditions, such as upon n - methyl - d - aspartate (nmda) rector chronic activation, mitol is inactivated, resulting in lc1 accumulation and mitochondrial dysfunction typical of neurodegenerative disease. on the basis of what previously described, excessive s - nitrosation seems to play a detrimental role in neurological disorders mostly due to its direct inhibitory effect on ubiquitin e3 ligases involved in the maintenance of cellular homeostasis (e.g., mitol and trim2). moreover nitrosative stress has been indicated to negatively affect muscle function and to induce muscular atrophy, owing to an excessive activation of the ups (e.g., by means of atrogene induction via foxo). in accordance with the above reported results, s - nitrosation has been also demonstrated being deeply implicated in sensitivity to nociceptive stimuli due to its impact on trp ion channels. altogether, these observations correlate with recent lines of evidence indicating that the sulfhydryl - containing molecule n - acetylcysteine (nac) reduces pain and ameliorates muscle performance [95, 96 ], protects dystrophic myofibers against eccentric muscle damage, and contrasts abnormal calcium influx. being nac a well - known antioxidant and denitrosating agent, this evidence suggests that nitrosative stress might represent a condition underlying or contributing to some pathological features of skeletal muscle disorders. along this line, it has been demonstrated that pharmacological inhibition or genetic ablation of nnos reverts neuromuscular pathological phenotypes ; however, these approaches have still not allowed discriminating whether tyrosine nitration or cysteine s - nitrosation is the principal mediator of neuropathy and myopathy induced by no overproduction. undoubtedly, the use of different no donors does not represent a good model to unravel this issue. indeed, their delivery of no, which recapitulates a burst more than a persistent, and physiological, flux, has so far produced still questionable results. cellular and mouse models of genetically altered s - nitrosation (e.g., gsnor downregulating or knock - out models) could be of help in the next future to evaluate the specific contribution of different no - mediated protein modifications : nitrationversus s - nitrosation. figuring out this issue would open new avenues for the pharmacological treatment aimed at the restoration of a correct neuromuscular physiology for pathologies whose prognosis, on the contrary, is characterized by a progressive and irreversible loss of motion and cognitive abilities accompanied by chronic pain. | protein s - nitrosation is deemed as a prototype of posttranslational modifications governing cell signaling. it takes place on specific cysteine residues that covalently incorporate a nitric oxide (no) moiety to form s - nitrosothiol derivatives and depends on the ratio between no produced by no synthases and nitrosothiol removal catalyzed by denitrosating enzymes. a large number of cysteine - containing proteins are found to undergo s - nitrosation and, among them, the enzymes catalyzing ubiquitination, mainly the class of ubiquitin e3 ligases and the 20s component of the proteasome, have been reported to be redox modulated in their activity. in this review we will outline the processes regulating s - nitrosation and try to debate whether and how it affects protein ubiquitination and degradation via the proteasome. in particular, since muscle and neuronal health largely depends on the balance between protein synthesis and breakdown, here we will discuss the impact of s - nitrosation in the efficiency of protein quality control system, providing lines of evidence and speculating about its involvement in the onset and maintenance of neuromuscular dysfunctions. |
the role of exercise on adult cognition has been extensively researched (lambourne and tomporowki, 2010 ; tomporowski, 2003), with cognitive performance assessed during exercise (mcmorris and graydon, 1996), following an acute bout of exercise (coles and tomporowski, 2008 ; hopkins., 2012 ; tomporowski., 2005) and following long - term exercise exposure (castelli., 2007 ; hopkins., 2012). despite this, the effect of exercise on cognitive performance is equivocal. this ambivalence is due in part to the different exercise protocols, methods of assessing exercise intensity and mode of exercise employed by various studies (lambourne and tomporowski, 2010). for example, when investigating the exercise intensity - cognitive performance relationship, several studies and meta - analyses have suggested an inverted u - shaped relationship (chmura., 1994 ; mcmorris and graydon, 2000 ; mcmorris., 2011) such that moderate levels of exercise increased physiological arousal and facilitated cognition, however, when physiological arousal approached a maximal level, cognitive performance began to deteriorate. in contrast, maximal levels of exercise intensity have been found not to be generally associated with declines in cognition (tomporowski, 2003) with research by lyons. (2008) reporting an inverted - u relationship between exercise intensity and post - exercise coincidence anticipation performance in novice performers and not experts ; whereas subsequent work by duncan. (2012) found an inverted - j relationship between exercise intensity and coincidence anticipation performance (cat) during treadmill running at 90% of heart rate reserve (hrr), where cat performance incrementally reached an optimal point before dramatically dropping off at 90% of hrr). httermann and memmert (2014) presented data showing an inverted - u relationship in cognitive performance for non - athletes while cycling at exercise intensities of 50, 60 and 70% of the age predicted maximal heart rate. on the contrary, a linear relationship was seen for athletes, leading the researchers to conclude that physical fitness acted as a moderator in the exercise intensity - cognitive performance relationship (httermann and memmert, 2014). however, the use of the age predicted heart rate to determine exercise intensity in the httermann and memmert s (2014) study is limited, particularly when comparing individual fitness levels. for example, regular exercise participation was shown to be associated with a lower resting heart rate (karvonen., 1957), thus, the use of the age predicted heart rate alone does not accurately account for this issue nor it has any scientific basis in exercise physiology and sports medicine (robergs and landwehr, 2002) where exercise intensity is commonly determined as a percentage of maximal oxygen uptake. furthermore, considering that httermann and memmert s (2014) high exercise intensity condition was set at 70% of the age predicted maximal heart rate and a linear relationship between intensity and cognitive performances for trained athletes was reported, it suggests that cognitive performance was still on the increase. consequently, it can be proposed that the intensity level of 70% for trained athletes was moderate at best and not high intensity as reported by httermann and memmert (2014). 2015) examined the simon task performance in 14 participants while cycling at a low, moderate or very high level of intensity, as defined by the ventilatory threshold. in their study, there was no significant difference in the reaction time (rt) across exercise intensities leading the authors to conclude that cognitive control was robust and did not appear to be influenced by the intensity of exercise. there is also debate as to the duration of exercise needed to elicit any change in cognitive performance with studies reporting changes after as little as 6 min of exercise (mcmorris., 2008) to 100 min of exercise (collardeau. there are a number of sports and exercise situations which require high levels of exertion, are aerobically based, but of relatively short duration which facilitate cognitive performance. yet, the impact of exercise intensity during short duration aerobically based exercise has not been widely examined. therefore, given the different conclusions drawn in the literature regarding the effect of exercise intensity on cognition, it is of extreme interest to sport performance practitioners to examine if and when exercise intensity impacts cognitive performance. also of interest is what the actual cut off point (i.e. exercise intensity) is before cognitive performance and consequently decision making deteriorates, which may have detrimental consequences for in the field performance. the aim of this study was to examine the effect of short duration, moderate and high intensity exercise on a go / nogo task in habitually trained adults. we hypothesised that cognitive performance during moderate intensity exercise would improve ; however, cognitive performance would be poorer during high intensity exercise compared to rest. following institutional ethics approval and informed consent fifteen habitually trained adults (9 females and 6 males, aged 28 5 years) that trained a minimum of 5 hours per week throughout the last 2 years participated in the study. all participants completed a health history questionnaire to ensure they inclusion criteria, i.e. being participants were excluded if they had a musculoskeletal injury or cardiovascular condition which would restrict exercise performance. to measure changes in cognitive performance participants completed a go / nogo task modelled on one developed by pontifex. the task used in the present study was a rt paradigm during which subjects performed a binary decision on each stimulus. one of the outcomes required subjects to make a motor response (go), whereas the other required subjects to withhold a response (no - go). the go / nogo task is considered a measure of response inhibition and is generally used to assess the ability to inhibit the prepotent response. specifically, the test required participants to respond quickly and accurately to a circle of 5.5 cm diameter that occurred on 20% of the trials and not to respond to a non - target circle of 3.0 cm diameter that occurred on 80% of the trials. the cognitive task consisted of one unique block of 100 trials performed during the last 2 min of exercise once the target intensity (high - intensity exercise at 90% of hrr or moderate - intensity at 70% of hrr) had been reached. stimuli were presented for 300 ms with a 1000 ms interstimulus interval via open source experiment software (matht., 2012) at the centre of a computer monitor located on the treadmill in front of the participant. for each trial, participants were asked to press a trigger button with their dominant hand when the target stimulus was presented. this trigger button process enabled participants to complete the go / nogo task during exercise, thereby addressing key criticism of prior research that studied the effects of exercise on cognitive performance (lambourne and tomporowski, 2010) pre and post exercise. participant s performance on the go / nogo task was calculated and comprised of three measures. two error rates were calculated, one for omission errors relating to instances where the stimulus was presented and the trigger not pressed, and another for decision errors, relating to instances when the non - target stimulus was presented and the trigger was pressed. rts (ms) were also calculated for target stimulus trials indicating the time taken to respond when the target stimulus was presented. a resting heart rate (hrrest) was also obtained from each participant by getting them to lie down in a prone position for 10 min while wearing a heart rate monitor (polar rs400, polar electro oy, kempele, finland), in a quiet room void of visual or auditory distractions. a maximum heart rate (hrmax) was estimated as 220 minus the participant s age. both the hrrest and hrmax were then recorded and used to calculate 70% and 90% of heart rate reserve (hrr) (karvonen., 1957). the study used a repeated - measures design consisting of three separate sessions performed on different days : rest, moderate intensity and high intensity sessions performed in a counterbalanced order. participants attended the laboratory at the same time of the day in a well - rested and hydrated state with no prior consumption of caffeine or other ergogenic aids that may have influenced cognitive performance. during the initial test session, each participant was allowed 200 attempts at the go / nogo task to familiarise themselves with the test protocol (pontifex., 2009). an incremental running protocol on a motorised treadmill (hp cosmos ltd, germany) was used to induce moderate and high intensity exercise states congruent with previous studies assessing effects of moderate and high intensity exercise on skilled (lyons., 2008) and perceptual (duncan., 2012) performance. whilst in the rest condition, participants stood on the treadmill for a period of approximately 10 min (the approximate duration for the exercise trials) before completing the go / nogo task. the workload was then increased by 1.6 km / h every 30/60 s until the participant reached the desired intensity as determined by 70% and 90% of heart rate reserve (hrr) (karvonen., 1957). throughout the test procedures, the borg s (1970) rating of perceived exertion (rpe) scale was also used as an adjunct to monitoring of the heart rate. participants were required to achieve an rpe of 15 - 17 for the moderate intensity exercise condition and 18 - 19 for the high intensity exercise condition. once the desired intensity was reached, as determined by both measures simultaneously (i.e. % hrr and rpe), participants were then required to maintain this intensity for further 2 min. this ensured that participants were truly at the desired steady - state intensity. at this point, participants performed a validated go / nogo task (pontifex., 2009) while still running. each exercise trial lasted approximately 10 min and included approximately 2 min of exercise while completing the go / nogo task. the effects of exercise intensity on error rates (omission errors and decision errors) and the rt were analysed using separate 3 (exercise intensity) ways repeated measures analysis of variance. where significant differences were found, bonferroni post - hoc pairwise comparisons were used to determine where the differences lay. partial eta squared (2) was also used as a measure of effect size. the statistical package for social sciences (spss, version 20, chicago, il, usa) was used for all analysis and statistical significance was set, a priori, at p = 0.05. following institutional ethics approval and informed consent fifteen habitually trained adults (9 females and 6 males, aged 28 5 years) that trained a minimum of 5 hours per week throughout the last 2 years participated in the study. all participants completed a health history questionnaire to ensure they inclusion criteria, i.e. being participants were excluded if they had a musculoskeletal injury or cardiovascular condition which would restrict exercise performance. to measure changes in cognitive performance participants completed a go / nogo task modelled on one developed by pontifex. the task used in the present study was a rt paradigm during which subjects performed a binary decision on each stimulus. one of the outcomes required subjects to make a motor response (go), whereas the other required subjects to withhold a response (no - go). the go / nogo task is considered a measure of response inhibition and is generally used to assess the ability to inhibit the prepotent response. specifically, the test required participants to respond quickly and accurately to a circle of 5.5 cm diameter that occurred on 20% of the trials and not to respond to a non - target circle of 3.0 cm diameter that occurred on 80% of the trials. the cognitive task consisted of one unique block of 100 trials performed during the last 2 min of exercise once the target intensity (high - intensity exercise at 90% of hrr or moderate - intensity at 70% of hrr) had been reached. stimuli were presented for 300 ms with a 1000 ms interstimulus interval via open source experiment software (matht., 2012) at the centre of a computer monitor located on the treadmill in front of the participant. for each trial, participants were asked to press a trigger button with their dominant hand when the target stimulus was presented. this trigger button process enabled participants to complete the go / nogo task during exercise, thereby addressing key criticism of prior research that studied the effects of exercise on cognitive performance (lambourne and tomporowski, 2010) pre and post exercise. participant s performance on the go / nogo task was calculated and comprised of three measures. two error rates were calculated, one for omission errors relating to instances where the stimulus was presented and the trigger not pressed, and another for decision errors, relating to instances when the non - target stimulus was presented and the trigger was pressed. rts (ms) were also calculated for target stimulus trials indicating the time taken to respond when the target stimulus was presented. a resting heart rate (hrrest) was also obtained from each participant by getting them to lie down in a prone position for 10 min while wearing a heart rate monitor (polar rs400, polar electro oy, kempele, finland), in a quiet room void of visual or auditory distractions. a maximum heart rate (hrmax) was estimated as 220 minus the participant s age. both the hrrest and hrmax were then recorded and used to calculate 70% and 90% of heart rate reserve (hrr) (karvonen., 1957). the study used a repeated - measures design consisting of three separate sessions performed on different days : rest, moderate intensity and high intensity sessions performed in a counterbalanced order. participants attended the laboratory at the same time of the day in a well - rested and hydrated state with no prior consumption of caffeine or other ergogenic aids that may have influenced cognitive performance. during the initial test session, each participant was allowed 200 attempts at the go / nogo task to familiarise themselves with the test protocol (pontifex., 2009). an incremental running protocol on a motorised treadmill (hp cosmos ltd, germany) was used to induce moderate and high intensity exercise states congruent with previous studies assessing effects of moderate and high intensity exercise on skilled (lyons., 2008) and perceptual (duncan., 2012) performance. whilst in the rest condition, participants stood on the treadmill for a period of approximately 10 min (the approximate duration for the exercise trials) before completing the go / nogo task. the workload was then increased by 1.6 km / h every 30/60 s until the participant reached the desired intensity as determined by 70% and 90% of heart rate reserve (hrr) (karvonen., 1957). throughout the test procedures, the borg s (1970) rating of perceived exertion (rpe) scale was also used as an adjunct to monitoring of the heart rate. participants were required to achieve an rpe of 15 - 17 for the moderate intensity exercise condition and 18 - 19 for the high intensity exercise condition. once the desired intensity was reached, as determined by both measures simultaneously (i.e. % hrr and rpe), participants were then required to maintain this intensity for further 2 min. this ensured that participants were truly at the desired steady - state intensity. at this point, participants performed a validated go / nogo task (pontifex., 2009) while still running. each exercise trial lasted approximately 10 min and included approximately 2 min of exercise while completing the go / nogo task. the effects of exercise intensity on error rates (omission errors and decision errors) and the rt were analysed using separate 3 (exercise intensity) ways repeated measures analysis of variance. where significant differences were found, bonferroni post - hoc pairwise comparisons were used to determine where the differences lay. partial eta squared (2) was also used as a measure of effect size. the statistical package for social sciences (spss, version 20, chicago, il, usa) was used for all analysis and statistical significance was set, a priori, at p = 0.05. results indicated significant exercise intensity main effects for the rt (f2, 28 = 6.169, p = 0.01, partial 2 = 0.320, figure 1). bonferroni post - hoc pairwise comparisons indicated significantly slower rts during high intensity exercise compared to rest (p = 0.023) and moderate intensity exercise (p = 0.039). the omission error rate (f2, 28 = 4.108, p = 0.027, partial 2 = 0.255) and decision error rate (f2, 28 = 9.213, p = 0.011, partial 2 = 0.397) were also significantly different across exercise intensities. post - hoc analysis indicated a significantly higher omission error rate at high intensity compared to moderate (p = 0.038) intensity exercise and rest (p = 0.043). this pattern was replicated for the decision error rate with higher decision errors being made at high intensity exercise compared to moderate intensity (p = 0.008) and rest (p = 0.002). mean se of go / nogo task rts (ms) to target stimuli during rest, moderate and high intensity treadmill running (p = 0.023, p = 0.039) mean se of go / nogo task omission error and decision error rates (%) to target stimuli during rest, moderate and high intensity treadmill running the aim of the present study was to examine the effect of exercise intensity on a go / nogo task performance. (2012) who investigated the relationship between running speeds of 4.8, 8.0 and 12.8 km / h, exercise intensities of 70% and 90% of hrr and cognitive performance, with the largest decrements in cognitive performance taking place at 12.8 km / h and exercise intensity of 90% of hrr, but do not align with other studies suggesting that moderate intensity exercise results in enhanced cognitive performance (chmura., 1994 ; mcmorris and graydon, 2000 ; mcmorris., 2011). cognitive performance is significantly impaired during high intensity exercise (90% of hrr) which extends the findings proposed by httermann and memmert (2014) who failed to reach an exercise intensity at which cognitive performance was negatively affected in trained athletes. the results of the current study are also contrary to those recently published by davranche. (2015) which reported no effect of exercise intensity on the simon task performance during a 20 min cycling task. moreover, davranche. (2015) highlighted in their study that there was no sign of worsening rts during very high intensity exercise. from a sporting point of view, it is extremely important to determine at what point cognitive performance is negatively affected by exercise intensity and the resulting fatigue. for example, in soccer it is well known that a large number of goals are scored in the final minutes of a game when the relationship between fatigue and decision making of some players may be at their poorest. consequently, further investigation is required so that a clearer theoretical explanation can be proposed which will help clarify the effects of exercise intensity on cognitive performance. a number of authors who have proposed a theoretical explanation for effect of exercise intensity on cognitive performance have suggested that acute aerobic exercise is an arousing stressor (audiffren, 2009) and as such the theoretical explanations have been anchored in unidimensional theories of arousal including the inverted - u theory (yerkes and dodson, 1908). however, if arousal is assumed to be a mechanism by which performance changes, then some form of explanation is also required for the role of cognition in this process (hardy and parfitt, 1991). it may be that due to the multidimensional construct of arousal, which has a cognitive and physiological component, the catastrophe model (fazey and hardy, 1988) may provide a more accurate account of the relationship between cognitive performance and exercise intensity. specifically, the catastrophe model predicts that when physiological arousal and cognitive anxiety are low, performance will follow an inverted - u, which has been reported before (chmura., 1994 ; mcmorris and graydon, 2000 ; mcmorris., 2011 however, when physiological arousal and cognitive anxiety are at their highest, the effect on performance will be at its worst which is what was found in the present study at an exercise intensity of 90%. although cognitive anxiety was not measured in the present study, it can be assumed that due to extremely demanding nature of the physiological component (i.e. 90%) of the study that cognitive anxiety would be at its highest, which goes some way in supporting the predictions of the catastrophe model (fazey and hardy, 1988). such intensity of exercise has also been suggested to be anxiety provoking in the study by davranche. (2015). in this context, higher intensity exercise coupled with performance of cognitive tasks may result in increased demands of the concurrent activities leading to greater demand on attentional resources and potentially poorer performance. (2007) found that there was a prioritization for postural control over the cognitive stimulus when the highest threat was to postural stability. 2007) suggested that it was not until the appropriate postural responses had been initiated (or inhibited) that the cognitive stimulus could be completely attended to. in the context of the present study, an exercise intensity of 90% the results of the present study would broadly support the assertion that allocation of attentional resources is inhibited during high intensity exercise resulting in poorer cognitive task performance compared to lower exercise intensities. furthermore, such an argument may explain the discrepancy between the results presented in the current study and those of davranche., the use of a cycle based exercise modality reduced the postural prioritisation effect, unlike the current study where postural prioritisation during treadmill running may have been more of a factor. indeed in their meta - regression analysis, lambourne and tomporowski (2010) had previously reported that cycle and treadmill based exercise produced different results in respect to effects of exercise intensity on cognitive performance. in the present study, it is possible that when running at high intensity a speed accuracy trade - off was evidenced as, in order to continue to run and remain upright, rts worsened and additional errors were made.. it is also important to note that during moderate and high intensity exercise conditions, the cognitive workload required to perform at such velocity on a treadmill is very high. thus, when comparing the resting condition with the exercise conditions, there is an effect of exercise and a strong dual task effect. this may be one reason why there was no observation of facilitation in the moderate intensity condition and impaired performance in the high intensity condition. the use of a 10 min rest period as a control condition in the present study was undertaken to provide a true rest period of the same duration as the exercise bouts and to avoid comparing to rest pre - exercise where there may have been anticipatory responses as a result of the upcoming tasks. for future studies, a more relevant control condition could comprise of very low exercise intensity rather than simply standing on a treadmill. until now the focus of the argument has mainly revolved around the effects of changes in exercise intensity on cognitive performance with very little discussion on the influence of the cognitive test on performance outcomes. the importance of choosing an appropriate cognitive test can not be underestimated, for example, memmert. (2009) who investigated the relationship between visual attention and expertise in sport using a functional field of a view task, a multiple - object tracking task, and an attentional blindness task found that team sports experts showed no better performance on the basic attention tasks than athletes from non - team sports or novice athletes which is unlike the httermann and memmert (2014) and the present study where significant differences in cognitive performancewere reported 2009) failed to include any form of a physiological component in their study and although the authors suggested that any attentional focus task that reveal group differences could potentially be used to design training programs to improve sport - specific attention capacity, we propose that this proposal should be viewed with caution unless some form of exercise intensity is included. we also acknowledge that the go / nogo test of cognitive performance employed in the present study was simple in nature and unlike the protocol used in the httermann and memmert s (2014) study that used a more cognitively demanding attentional breadth cognitive test, which may be the reason for the disparity of results between the present study and that of hutterman and memmert (2014). a more complex version of the same go / nogo task used in the present study is available (pontifex., 2009) which includes an additional square distracter stimulus which may provide a more detailed account of cognitive performance. however, a cautionary note is that in the present study it was difficult to utilise a more complex cognitive performance test while running at 90% of hrr due to the trade - off between the time requirement to complete the test and the physical capacity of individuals to remain running at this intensity. therefore, future research will seriously need to consider alternative and effective ways that can both ensure the safety of the participant while exercising at high intensities whilst at the same time completing more difficult and demanding cognitive tests. a further limitation in the present study is that the thresholds for moderate and high intensity exercise were calculated using the karvonen formula (karvonen., 1957). this was employed in order to account for individual variation in a resting heart rate as a consequence of different fitness levels in participants. the use of the karvonen formula in the present study was also chosen because it is recommended as a means to set a target heart rate by the american college of sports medicine (2006) and had been cited in prior studies reporting the effect of moderate and high intensity exercise on cognitive performance (borg, 1970 ; duncan., 2012 ; lyons., 2008 however, future studies may be more effective by either using an alternative equation to estimate the maximum heart rate or by establishing exercise intensity as a percentage of vo2max. in conclusion, the present study suggests that high intensity exercise results in poorer cognitive performance in habitually active adults compared to rest or moderate intensity exercise. to accurately understand the exercise intensity and cognitive performance relationship in athletes, research must adopt a multidimensional approach that includes both a high exercise intensity condition of at least 90% of either vo2max or hrr and an equally demanding cognitive task that is transferable to actual sport performance. | abstractthis study examined the effect of short duration, moderate and high - intensity exercise on a go / nogo task. fifteen, habitually active (9 females and 6 males aged 28 5 years) agreed to participate in the study and cognitive performance was measured in three sessions lasting 10 min each, performed at three different exercise intensities : rest, moderate and high. results indicated significant exercise intensity main effects for reaction time (rt) (p = 0.01), the omission error rate (p = 0.027) and the decision error rate (p = 0.011), with significantly longer rts during high intensity exercise compared to moderate intensity exercise (p = 0.039) and rest (p = 0.023). mean se of rt (ms) was 395.8 9.1, 396.3 9.1 and 433.5 16.1 for rest, moderate and high intensity exercise, respectively. this pattern was replicated for the error rate with a significantly higher omission error and decision error rate during high intensity exercise compared to moderate intensity exercise (p = 0.003) and rest (p = 0.001). mean se of omission errors (%) was 0.88 0.23, 0.8 0.23 and 1.8 0.46% for rest, moderate and high intensity exercise, respectively. likewise, mean se of decision errors (%) was 0.73 0.24, 0.73 0.21 and 1.8 0.31 for rest, moderate and high intensity exercise, respectively. the present study s results suggest that 10 min workout at high intensity impairs rt performances in habitually active adults compared to rest or moderate intensity exercise. |
tuberculosis (tb) is a chronic granulomatous infectious disease due to mycobacterium tuberculosis that afflicts increasing number of people every year and has the highest mortality among treatable infectious diseases. tuberculosis can either be primary or secondary and can involve any part of the body. the oral cavity is an unusual site to be affected in tuberculosis and is generally due to secondary infection. these lesions manifest as non - healing ulcers, nodules, fissures, verrucous proliferation, erythematous patches or plaques, indurated lesions, or as jaw lesions. among these, ulcers and papillomas are the commonest form and usually present as single lesions. herein we report one such case with multiple oral ulcers as initial presenting complaint of tuberculosis. this 47-year - old male presented with a non - healing tongue ulcer of 3 months duration and associated pain for 2 months. he had initially noticed the asymptomatic ulcer on the ventral surface of tongue which had been increasing in size for the last 1 month. he had smoked beedis for the last 20 years and had consumed alcohol daily for past 15 years. on examination, ulcers were noticed in the tongue and buccal mucosa. a solitary ulcer (3 cm 4 cm) with undermined edges and minimal induration was seen on right ventral surface of the tongue extending from the midline past the lateral border, up to the dorsal area of the anterior two - thirds of the tongue [figure 1a ] another ulcer (0.5 cm 0.5 cm), also with an undermined edge was seen on the dorsal surface of tongue. in the left buccal mucosa, a single ulcer (1 1 cm) covered with pseudomembrane was present, extending 3 cm from the angle of the mouth and 5 mm below the occlusal plane [figure 1b ]. a single firm, non - tender (< 1 cm) sub - mandibular lymph node was present on the right side. tongue ulcers- a larger ventral ulcer and a smaller ulcer superiorly, both with undermined edges left buccal mucosal ulcer covered with pseudomembrane provisional diagnoses of squamous cell carcinoma and lichen planus were given for the lesions of the tongue and buccal mucosa, respectively. incisional biopsy from the edge of tongue ulcer revealed proliferating epithelium with the underlying connective tissue exhibiting chronic inflammatory cell infiltrate without evidence of epithelial dysplasia or malignant invasion. biopsy was repeated from a different area of the tongue ulcer for further review. on examining serial sections, giant cells with peripherally arranged nucleus resembling langerhans cells chest radiography revealed bilateral upper lobe infiltrates [figure 1d ], and sputum was positive for acid - fast bacilli. histopathology of tongue ulcer showing chronic inflammatory infiltrate surrounding the caseation necrosis chest radiography revealing bilateral upper - lobe infiltrates suggestive of tuberculosis the prevalence in india is reported to be 5.05 per 1,000. oral tuberculosis on the other hand, accounts for 0.2 to 1.5% of all cases of extra - pulmonary tuberculosis. tuberculous infection can either be primary or secondary ; the primary form affects the lungs lymph nodes, meninges, kidneys, bones, and skin. two types of presentation are seen in oral tb : primary lesions occurring as a result of direct inoculation of oral tissues and secondary infection occurring due to haematogenous or lymphatic spread or from direct extensions from neighboring structures. primary tuberculosis presenting as oral lesions are uncommon, since factors like an intact oral mucosa, salivary enzymes, and tissue antibodies act as barriers to infection. both systemic and local factors play a role in incidence of oral lesions. local factors comprises poor oral hygiene, local trauma, chronic inflammation, tooth eruption, extraction sockets, periodontal disease, carious teeth with pulp exposure and presence of lesions like leukoplakia, dental cysts, dental abscesses, and jaw fractures. oral tuberculosis affect the gingiva, floor of the mouth, palate, lips, buccal folds, tooth sockets, and jaw bones, with the tongue being the commonest site. sometimes, oral ulcers may follow opalescent vesicles or nodules which may break down as a result of caseation necrosis to form an ulcer. ulcers apart, tubercular tongue lesions present as tuberculoma, tuberculous ssure, tubercular papilloma, diffuse glossitis, or atubercular cold abscess. oral tuberculosis is to be differentiated from traumatic lesions, granulomatous disease, syphilis, aphthous ulcers, mycotic infections, sarcoidosis, crohn 's disease, deep mycoses, cat - scratch disease, foreign - body reactions, and malignancies. recent development of dna probes, polymerase chain reaction assays, and liquid media now allow more sensitive and rapid diagnosis. occasionally, the recognition of oral tuberculosis precedes the detection of ptb like in our patient. multiple oral ulcers are a rare presenting complaint of tuberculosis in a patient with simultaneous pulmonary tb but without clinical symptoms. in our case, diagnosis of pulmonary tb was considered only after reviewing multiple histopathology sections of the tongue ulcer. in a dental outpatient setup, caution is needed while dealing with such ulcers not only to miss an important medical entity but in also to prevent transmission of infection to dental staff through respiratory droplets. | we report a 47 year old man who presented with painful non - healing tongue ulcers of 3 months duration. examination revealed an additional buccal ulcer that he was unaware of. histopathology of the ulcers showed caseation necrosis. following this report, chest radiography and sputum microscopy performed revealed pulmonary tuberculosis. from this case - study, one should be aware of coexisting pulmonary tuberculosis in patients with chronic non - healing oral ulcers, both for diagnosis as well as prevention of transmission through respiratory droplets. |
although 90% of breast cancers occur sporadically, 2% are genetically linked to heritable mutations in the breast cancer associated gene 1 (brca1). germline mutations in brca1 confer increased susceptibility to developing breast cancer, with a lifetime risk of 80%. mutations in the brca1 gene also result in an elevated risk for various other types of cancer in women, including ovarian, fallopian tube and peritoneal cancer. in addition, these mutations are associated with an increased risk of pancreatic cancer in women and men, and surprisingly an elevated risk for prostate and breast cancer in men [26 ]. the human brca1 gene is located on chromosome 17, specifically at 17q21 ; it consists of 24 exons and encodes for a protein of 1863 amino acids (1812 in mice). brca1 is also known to encode at least two additional smaller - sized variant proteins due to alternate splicing [811 ]. the mature, full - length protein is located in the nucleus and comprises multiple functional domains, including an n - terminal ring finger domain, two nuclear localization signals, an sq cluster containing several serine and threonine residues that can be phosphorylated, a coiled - coiled domain, and c - terminal tandem brca1 c - terminus (brct) domains (fig the majority of brca1 's functions are mediated by its zinc - binding ring finger motif that forms an enzymatically active e3 ubiquitin - protein ligase when it heterodimerizes with brca1-associated ring domain 1 (bard1) and the tandem brct domain, which facilitates numerous protein protein interactions via binding to phosphorylated serines. the importance of these two domains is underscored by the fact that a significant number of breast cancer predisposition mutations are located in these two domains. interacting proteins and phosphorylation sites required for regulating homologous recombination (hr) and non - homologous end - joining (nhej). interacting proteins and phosphorylation sites required for regulating homologous recombination (hr) and non - homologous end - joining (nhej). following its discovery, research has focused on identifying and characterizing brca1 's function(s). to this end, multiple functions have been ascribed to brca1, including a role in transcription - coupled dna repair, transcription regulation, chromatin remodeling, apoptosis, and ubiquitin ligation [12, 13 ]. despite contributing to a diverse array of cellular pathways, brca1 's function as this was initially proposed with the discovery that tumor cell lines and mouse embryonic fibroblasts (mefs) deficient in brca1 exhibit evidence of extensive genomic instability, including patterns of aneuploidy, centrosomal amplification, and chromosomal aberrations [1, 11, 15, 16 ]. brca1 primarily promotes genomic stability via its numerous functions in the cellular response to dna double - strand breaks (dsbs). dsbs are deleterious dna lesions that may lead to gene mutations, senescence, apoptosis, mitotic cell death, genomic instability, and tumorigenesis if misrepaired or left unrepaired. an immediate and complex cellular response to dsbs drives multiple processes, including modulation of the cell cycle, a number of signaling cascades collectively known as the dna damage response (ddr), and repair pathways that correct the dna lesion. dsbs are repaired by three major pathways in mammalian cells : the error - free and accurate homologous recombination (hr) pathway, the error - prone but relatively precise classical non - homologous end - joining (c - nhej) pathway, and the error - prone alternate non - homologous end - joining (a - nhej) pathway. hr repairs dsbs by utilizing a dna template, typically via a homologous sister chromatid in the s or g2 phases of the cell cycle, to drive repair. c - nhej mediates the direct re - ligation of the broken dna molecule, and is active throughout the cell cycle, partly due to lack of constraints such as the requirement of a dna template for repair completion. a - nhej is active in all phases of the cell cycle, backing up the other two pathways. it is an error - prone process due to its propensity to utilize microhomologies distant from the dsb to mediate repair, which results in deletions. collectively, these dna repair mechanisms are responsible for fixing the countless insults our genomes are exposed to, including those induced both by fault (ionizing radiation (ir)-induced dsbs, replication errors, etc.) and by design (v(d)j recombination). brca1 plays a multifaceted role in the cellular response to dna damage, including modulation of dsb repair and activation of cell cycle checkpoints. the first evidences of brca1 involvement in dsb repair came from studies showing that upon irradiation (ir), brca1 is hyperphosphorylated and forms discrete nuclear foci that co - localize with the hr factors rad51 and brca2 [22, 23 ]. brca1 primarily functions as a mediator in the cellular response to dna damage ; it serves as a scaffold protein that recruits multiple repair proteins to the dsb via the formation of multiprotein complexes. these distinct multiprotein complexes function in specific processes in the dna damage response, in particular those that influence dsb repair. brca1-specific complexes include the following : (i) a complex with the brca1 interacting protein c - terminal helicase 1 (brip, also called fancj or bach1) that inhibits c - nhej and promotes hr ; (ii) a complex with the ctbp - interacting protein (ctip) and mre11-rad50-nbs1 (mrn) that promotes dna end resection, a prerequisite for the onset of hr ; (iii) a complex with brca2, palb2 and rad51 that is required for dna strand invasion for hr ; and (iv) a complex with rap80 and abraxas that blocks aberrant dna end resection to promote genomic stability. collectively, these brca1 complexes indicate a role for brca1 in promoting high - fidelity repair of dsbs, in particular by promoting hr. the positive influence of brca1 on hr is supported by studies showing that brca1-deficient cells are sensitive to ir and dna cross - linking agents, which both produce dna damage that is repaired by hr. additionally, brca1-deficient cells also display increased frequency of chromatid breaks, which are frequently observed in hr - deficient cells. finally, brca1 deficiency leads to a reduction in hr repair, as evaluated by reporter assays, in both human and mouse cells [25, 26 ]. the role of brca1 in the hr pathway has been thoroughly dissected and properly reviewed by a number of groups [12, 13, 27 ]. brca1 also influences the cellular response to dna damage by modulating the cell - cycle checkpoints in response to dsbs. following dsb induction, brca1 is phosphorylated by the ataxia telangiectasia mutated (atm) kinase at serine residues 1387 and 1423, and these phosphorylation events are required for activation of the s and g2/m checkpoints, respectively [28, 29 ]. furthermore, the brca1bard1 interaction is important for atm and ataxia telangiectasia and rad 3-related (atr)-mediated phosphorylation of p53 at serine 15 following ir- or uv - induced dna damage to activate the g1/s checkpoint. although it is well established that brca1 plays an important role in the cellular response to dsbs, in particular hr, the role of brca1 in c - nhej and a - nhej remains a conundrum [31, 32 ]. over the years, conflicting evidence pertaining to brca1 's role in each pathway significant effort has also been directed at uncovering a role for brca1 in c - nhej. one study showed that extracts derived from brca1-null mefs exhibit significantly reduced end - joining activity compared with mefs with wild - type brca1, providing initial insight into brca1 's function in c - nhej. similarly, whole - cell extracts from the human brca1-defective cell line hcc1937 had significantly reduced c - nhej activity compared with control cell extracts. however, a number of studies suggest that brca1 is not required for c - nhej. for example, no discernible defect in dna dsb rejoining was observed in hcc1937 cells when assayed by pulsed - field gel electrophoresis (pfge) [35, 36 ]. furthermore, in vitro nhej assays performed on a host of sporadic breast cancer and brca1-deficient cell lines revealed no major overall repair deficiency and demonstrated similar end - joining efficiencies and accuracies. this glut of conflicting data has made it difficult to clearly define a role for brca1 in c - nhej. the contradictory results are likely due to variations in the assays used, differences in cell lines, and/or differences in the cell cycle phases when the assays were performed. closer analyses of the end - joining events revealed that brca1 is required for precise end - joining [34, 38, 39 ]. this was supported by a study showing that sirna - mediated knockdown of brca1 reduced the frequency of precise ligation by c - nhej in chromosomally induced dsbs. the decrease in precise repair in the brca1-deficient cells was similar to that observed when the c - nhej components ku70, xrcc4 and ligase iv were knocked down. furthermore, brca1 knockdown increased the proportion of deletions relative to knockdown of the nhej components, indicating that brca1 not only promotes precise end - joining, but may also divert some dsbs away from end - joining by precise c - nhej. expression of the brca11415 splice variant or downregulation of wild - type brca1 in the breast cancer cell line mcf-7 led to a reduction in the overall, as well as precise, end - joining efficiency, indicating that expression of this splicing variant has a dominant negative effect on the efficiency and fidelity of c - nhej. overexpression of the other brca1 splicing variant, termed brca11719, lacking a portion of the brct domain that enables its interaction with critical dna end - processing factors including ctip and abraxas, resulted in delayed dynamics of ir - induced brca1 foci formation, impaired hr, and undermined c - nhej activity. finally, decreased fidelity in dna end - joining was observed in lymphoblastoid cell lines from breast cancer patients harboring a brca1 missense mutation [38, 42 ]. to follow up on the intriguing results of brca1 regulating precise end - joining, phosphorylation of brca1 by chk2 at serine 988 plays a role in promoting precise end - joining [43, 44 ]. brca1 is also phosphorylated by atm kinase in response to dsbs, and atm - mediated phosphorylation of brca1 at serine 1423 and serine 1524 was found to be important for precise end - joining activity by c - nhej. it was also reported that the n - terminal fragment of brca1 (1304 aa), containing the ring finger domain, accumulates and dissociates rapidly after laser irradiation induced damage and that this fast association with dsbs is dependent on the c - nhej factor ku80. the brca1ku interaction and the rapid recruitment of brca1 to dsbs were abolished via cancer causing missense mutations in the ring finger domain. this finding suggests that this interaction is important in brca1 's ability to promote genomic stability. however, another study reported that amino acids 262803, but not amino acids 1200 of brca1, mediates the interaction between brca1 and ku80. in addition, knockdown of brca1 resulted in a significant reduction in c - nhej in g1 phase cells, with no effect in g2/s phase cells. collectively, the data in the literature suggests that interaction of brca1 with the c - nhej factor ku80 stabilizes the ku heterodimer at dsbs and that this is required for precise end - joining repair by c - nhej in g1 phase of the cell cycle. brca1, as a regulator of genomic stability, has been shown to mostly influence dsb repair processes, such as hr and precise end - joining, involved in precise ligation / repair of the broken dna strand. however, a few reports have suggested that this may not be entirely true, as brca1 has been shown to positively influence the inherently error - prone a - nhej pathway. first, brca1 null mefs exhibited a 50100-fold deficiency in microhomology - mediated end - joining (mmej)/a - nhej of a defined chromosomal dsb. furthermore, a recent study found that brca1 in conjunction with ctip are required for telomeric fusions in trf2-depleted cells (uncapped telomeres), independent of ku80/ligase iv (c - nhej), but dependent on parp1/ligase iii, well known components of a - nhej. bard1, an interaction partner of brca1, was shown to mediate the rapid recruitment of brca1 to dna damage sites. the tandem brct domains of bard1 were found to be a poly adp - ribose (par) binding module, and binding of the bard brcts to par targets the brca1/bard1 heterodimer to dna damage sites. pars are linked to proteins via par polymerases (parps), with parp1 being a factor required for a - nhej. parp1 inhibition suppresses the early recruitment of the brca1/bard1 complex to dna lesions, suggesting that the a - nhej pathway may influence brca1 's recruitment to dsbs. in contrast, a significant amount of data suggests that brca1 blocks a - nhej. knockdown or loss of brca1 protein resulted in an increased frequency of overall plasmid dna mutagenesis and microhomology - mediated end - joining (mmej)/a - nhej following dsb induction. furthermore, inhibition of the exonuclease activity of the dna end processing and a - nhej factor, mre11, with the specific inhibitor mirin significantly decreased the occurrence of a - nhej / mmej, but did not considerably affect the overall mutagenic frequency of plasmid dsb repair. these results suggest that brca1 protects dna from mutagenesis during non - homologous dsb repair. brca1 is also known to interact with brip1, and disruption of the brca1brip1 complex through mutation in brip1 compromised c - nhej and accelerated error - prone a - nhej / mmej. furthermore, disruption of the integrity of the brip1 helicase domain resulted in a modest decrease in extrachromosomal (but not intrachromosomal) a - nhej / mmej. we propose that brca1 typically blocks a - nhej, but may promote error - prone repair when c - nhej is absent and/or inhibited, like at clustered or complex lesions and telomeric dsbs, circumstances when repair of the broken dna ends takes precedence over restoring sequence accuracy. we propose that brca1 promotes genomic stability by modulating multiple dsb repair pathways in a cell cycle specific manner. first, brca1 promotes hr, the prominent dsb repair pathway in s / g2 phases [12, 13 ]. as brca1 positively influences hr, brca1 is believed to primarily be biologically active in s and g2 phases of the cell cycle. this is supported by early studies showing that brca1 expression is extremely low in g1 phase, but high in s and g2 phases [48, 49 ]. however, brca1 expression is normal in g1 in cycling cells, suggesting that brca1 expression is only low in g1 phase when cells are contact inhibited. it was found that two circuits, the pro - hr factors brca1/ctip and the pro - c - nhej factors 53bp1/rif1, influence each other antagonistically, with brca1/ctip displacing 53bp1/rif1 from dsbs in s phase to allow dna end resection to proceed to initiate hr, whereas 53bp1/rif1 blocks localization of brca1 to dsbs in g1 [50, 51 ]. the inability of brca1 to form detectable dsb - induced foci in g1 suggests that brca1 should not be able to modulate c - nhej in this cell cycle phase. however, we propose that brca1 differentially influences specific dsb repair processes by either directly interacting with proteins at the sites of dsbs or in the vicinity of the dsb site in a cell cycle phase this is supported by a recent study demonstrating that brca1 is recruited to both the dsb site and to regions surrounding the dsb. brca1 is recruited directly to the vicinity of the dsb through an interaction with the mrn complex factor, nijmegen breakage syndrome 1 protein (nbs1), and this interaction is required for precise re - ligation of genomic dsbs by c - nhej in g1. we hypothesize that brca1 modulates c - nhej directly at the dsb site in g1 by influencing the dynamics of ku70/80 at dsb sites (fig. 2). we predict that the fraction of brca1, which is localized in the flanking regions of the dsb and not at the dsb site, is disrupted by 53bp1/rif1. thus, 53bp1/rif1 does not influence the ability of brca1 to regulate precise end - joining by c - nhej. however, ku80 's function in c - nhej in g1 may only be partially regulated by brca1, because silencing of brca1 does not completely disrupt ku80 binding to dsb ends ; also, the effect of ku80 loss on c - nhej is superior to that of brca1 loss. we speculate that c - nhej may contain subset / multiple pathways, those that are inherently precise or error - prone. if brca1 modulates only a subset of c - nhej in g1 phase that drives precise end - joining, this raises a number of questions. for example, the factors required for this repair process are still unclear. also, it is still unknown if brca1 regulates specific enzymes required for this subset of c - nhej, and if this is dependent on the nature of the dsb (i.e. easily ligatable the requirement for brca1 in a subset of c - nhej, which is inherently precise, may also explain the contradictory reports in regards to brca1 's role in c - nhej. last, it is also possible that brca1 does not actually modulate c - nhej directly, but promotes precise end - joining by blocking a - nhej in g1 phase. as mre11 nuclease activity is required for the formation of microhomology in a - nhej, brca1 may attenuate mre11-dependent dna end processing to drive dsb repair towards the more precise c - nhej pathway in g1 phase. it will be of great interest to determine if and how brca1 promotes precise rejoining of dsbs in g1 directly. fig. 2.in g1 phase, brca1, through its n - terminal interaction with ku80, stabilizes ku80 binding to dna ends (favoring c - nhej) and inhibits end - processing activity of the mrn complex through its interaction with nbs1, preventing dsbs from being repaired by mutagenic a - nhej. in s / g2 phases, brca1 blocks the autophosphorylation of dna - pkcs at s2056 through its c - terminal interaction with dna - pkcs, preventing dsbs from being funneled to the c - nhej pathway. brca1 's interaction with the ctip and mrn complex accelerates end processing, thus driving the repair of dsbs to the hr pathway. in g1 phase, brca1, through its n - terminal interaction with ku80, stabilizes ku80 binding to dna ends (favoring c - nhej) and inhibits end - processing activity of the mrn complex through its interaction with nbs1, preventing dsbs from being repaired by mutagenic a - nhej. in s / g2 phases, brca1 blocks the autophosphorylation of dna - pkcs at s2056 through its c - terminal interaction with dna - pkcs, preventing dsbs from being funneled to the c - nhej pathway. brca1 's interaction with the ctip and mrn complex accelerates end processing, thus driving the repair of dsbs to the hr pathway. in s phase, brca1 plays a number of roles that promote hr [12, 13 ]. one key role is the stimulation of hr by attenuating c - nhej in this cell cycle phase to block inappropriate repair of replication - associated dsbs. this is supported by studies indicating that the embryonic lethality, hr deficiency, and genomic instability associated with loss of brca1 in mouse models is driven by c - nhej in s phase, and that this can be rescued by genomic deletion of the pro - nhej factor 53bp1 [54, 55 ]. furthermore, the serine glutamine (sq) cluster between the n- and c - terminal domains of brca1 contains residues phosphorylated by atm and atr that are critical for hr. mutations at these sites (s1387a, s1423a, s1457a and s1524a) shifted dsb repair from hr to nhej and abrogation of the g2/m checkpoint, leading to increased chromosomal aberrations and mitotic catastrophe. our recent data suggest that brca1 may also modulate c - nhej directly in s phase. we found that dna - pkcs interacts with brca1 independently of dna damage, but that this interaction is specific for s phase of the cell cycle. dna - pkcs autophosphorylation at serine 2056 is cell cycle regulated with phosphorylation at this site, high in g1 but markedly attenuated in s phase. this finding suggests that attenuating 2056 phosphorylation may modulate nhej specifically in this cell cycle phase. we demonstrated that autophosphorylation of dna - pkcs at serine 2056 is attenuated in s phase by brca1. blocking phosphorylation of dna - pkcs at the serine 2056 cluster resulted in an increase in the dna end processing required for hr, as observed via increased rpa and rad51 focus formation. this is different from brca1 's role in nhej in g1 because the interactions of brca1 with ku80 and dna - pkcs are distinct, with brca1 interacting with ku80 in g1 phase and with dna - pkcs in s phase. furthermore, ku80 interacts with the n - terminus of brca1 and dna - pkcs interacts with the c - terminal region of brca1, and this interaction occurs even in the absence of ku70/80. dependent manner via differential interaction with ku80 (g1 phase) and dna - pkcs (s phase). we believe these interactions play important roles in driving precise repair in all cell cycle phases, promoting precise c - nhej and blocking erroneous a - nhej in g1 and driving hr and attenuating c - nhej in s / g2 phases (fig. 2). we propose that brca1 promotes genomic stability by modulating multiple dsb repair pathways in a cell cycle specific manner. first, brca1 promotes hr, the prominent dsb repair pathway in s / g2 phases [12, 13 ]. as brca1 positively influences hr, brca1 is believed to primarily be biologically active in s and g2 phases of the cell cycle. this is supported by early studies showing that brca1 expression is extremely low in g1 phase, but high in s and g2 phases [48, 49 ]. however, brca1 expression is normal in g1 in cycling cells, suggesting that brca1 expression is only low in g1 phase when cells are contact inhibited. it was found that two circuits, the pro - hr factors brca1/ctip and the pro - c - nhej factors 53bp1/rif1, influence each other antagonistically, with brca1/ctip displacing 53bp1/rif1 from dsbs in s phase to allow dna end resection to proceed to initiate hr, whereas 53bp1/rif1 blocks localization of brca1 to dsbs in g1 [50, 51 ]. the inability of brca1 to form detectable dsb - induced foci in g1 suggests that brca1 should not be able to modulate c - nhej in this cell cycle phase. however, we propose that brca1 differentially influences specific dsb repair processes by either directly interacting with proteins at the sites of dsbs or in the vicinity of the dsb site in a cell cycle phase this is supported by a recent study demonstrating that brca1 is recruited to both the dsb site and to regions surrounding the dsb. brca1 is recruited directly to the vicinity of the dsb through an interaction with the mrn complex factor, nijmegen breakage syndrome 1 protein (nbs1), and this interaction is required for precise re - ligation of genomic dsbs by c - nhej in g1. we hypothesize that brca1 modulates c - nhej directly at the dsb site in g1 by influencing the dynamics of ku70/80 at dsb sites (fig. 2). we predict that the fraction of brca1, which is localized in the flanking regions of the dsb and not at the dsb site, is disrupted by 53bp1/rif1. thus, 53bp1/rif1 does not influence the ability of brca1 to regulate precise end - joining by c - nhej. however, ku80 's function in c - nhej in g1 may only be partially regulated by brca1, because silencing of brca1 does not completely disrupt ku80 binding to dsb ends ; also, the effect of ku80 loss on c - nhej is superior to that of brca1 loss. we speculate that c - nhej may contain subset / multiple pathways, those that are inherently precise or error - prone. if brca1 modulates only a subset of c - nhej in g1 phase that drives precise end - joining, this raises a number of questions. for example, the factors required for this repair process are still unclear. also, it is still unknown if brca1 regulates specific enzymes required for this subset of c - nhej, and if this is dependent on the nature of the dsb (i.e. easily ligatable the requirement for brca1 in a subset of c - nhej, which is inherently precise, may also explain the contradictory reports in regards to brca1 's role in c - nhej. last, it is also possible that brca1 does not actually modulate c - nhej directly, but promotes precise end - joining by blocking a - nhej in g1 phase. as mre11 nuclease activity is required for the formation of microhomology in a - nhej, brca1 may attenuate mre11-dependent dna end processing to drive dsb repair towards the more precise c - nhej pathway in g1 phase. it will be of great interest to determine if and how brca1 promotes precise rejoining of dsbs in g1 directly. fig. 2.in g1 phase, brca1, through its n - terminal interaction with ku80, stabilizes ku80 binding to dna ends (favoring c - nhej) and inhibits end - processing activity of the mrn complex through its interaction with nbs1, preventing dsbs from being repaired by mutagenic a - nhej. in s / g2 phases, brca1 blocks the autophosphorylation of dna - pkcs at s2056 through its c - terminal interaction with dna - pkcs, preventing dsbs from being funneled to the c - nhej pathway. brca1 's interaction with the ctip and mrn complex accelerates end processing, thus driving the repair of dsbs to the hr pathway. in g1 phase, brca1, through its n - terminal interaction with ku80, stabilizes ku80 binding to dna ends (favoring c - nhej) and inhibits end - processing activity of the mrn complex through its interaction with nbs1, preventing dsbs from being repaired by mutagenic a - nhej. in s / g2 phases, brca1 blocks the autophosphorylation of dna - pkcs at s2056 through its c - terminal interaction with dna - pkcs, preventing dsbs from being funneled to the c - nhej pathway. brca1 's interaction with the ctip and mrn complex accelerates end processing, thus driving the repair of dsbs to the hr pathway. in s phase, brca1 plays a number of roles that promote hr [12, 13 ]. one key role is the stimulation of hr by attenuating c - nhej in this cell cycle phase to block inappropriate repair of replication - associated dsbs. this is supported by studies indicating that the embryonic lethality, hr deficiency, and genomic instability associated with loss of brca1 in mouse models is driven by c - nhej in s phase, and that this can be rescued by genomic deletion of the pro - nhej factor 53bp1 [54, 55 ]. furthermore, the serine glutamine (sq) cluster between the n- and c - terminal domains of brca1 contains residues phosphorylated by atm and atr that are critical for hr. mutations at these sites (s1387a, s1423a, s1457a and s1524a) shifted dsb repair from hr to nhej and abrogation of the g2/m checkpoint, leading to increased chromosomal aberrations and mitotic catastrophe. our recent data suggest that brca1 may also modulate c - nhej directly in s phase. we found that dna - pkcs interacts with brca1 independently of dna damage, but that this interaction is specific for s phase of the cell cycle. dna - pkcs autophosphorylation at serine 2056 is cell cycle regulated with phosphorylation at this site, high in g1 but markedly attenuated in s phase. this finding suggests that attenuating 2056 phosphorylation may modulate nhej specifically in this cell cycle phase. we demonstrated that autophosphorylation of dna - pkcs at serine 2056 is attenuated in s phase by brca1. blocking phosphorylation of dna - pkcs at the serine 2056 cluster resulted in an increase in the dna end processing required for hr, as observed via increased rpa and rad51 focus formation. this is different from brca1 's role in nhej in g1 because the interactions of brca1 with ku80 and dna - pkcs are distinct, with brca1 interacting with ku80 in g1 phase and with dna - pkcs in s phase. furthermore, ku80 interacts with the n - terminus of brca1 and dna - pkcs interacts with the c - terminal region of brca1, and this interaction occurs even in the absence of ku70/80. dependent manner via differential interaction with ku80 (g1 phase) and dna - pkcs (s phase). we believe these interactions play important roles in driving precise repair in all cell cycle phases, promoting precise c - nhej and blocking erroneous a - nhej in g1 and driving hr and attenuating c - nhej in s / g2 phases (fig. 2). we propose that brca1 promotes precise dsb repair across all cell cycle phases. in the absence of hr in g1, brca1 's interactions with ku80 and the mrn complex positively influences the relatively precise c - nhej pathway, while negatively regulating mutagenic a - nhej. in s phase, the interaction of brca1 with dna - pkcs inhibits c - nhej and drives pathway choice towards the accurate hr pathway (fig. 2). brca1 is thus a critical factor driving repair pathway choice and is required for a cell 's ability to maintain genomic stability. in conclusion, it is this function that promotes brca1 's roles as a tumor suppressor and a driver of genomic stability. the role of brca1 in dna damage response, with emphasis on accurate repair of genomic insults, provides a better understanding of the etiology of brca1-associated tumorigenesis. it also provides a solid platform for the development of therapeutic approaches, some of which have already entered the clinical setting. this work was supported by grants from the national institutes of health [ca092584, ca162804 and ca134991 ] and the cancer prevention research institute of texas [rp110465-p1 ]. | heritable mutations in the tumor suppressor gene brca1 increase a woman 's lifetime risk of developing breast and ovarian cancer. brca1 's tumor suppressor function is directly linked to its myriad of functions in the cellular response to dna double - strand breaks (dsbs). brca1 interacts with an extensive array of dna damage responsive proteins and plays important roles in dsb repair, mediated by the homologous recombination pathway, and in the activation of cell cycle checkpoints. however, the role of brca1 in the other two dsb repair pathways, classical non - homologous end - joining (c - nhej) and alternative nhej (a - nhej), remains unclear. in this review, we will discuss the current literature on brca1 's potential role(s) in modulating both c - nhej and a - nhej. we also present a model showing that brca1 contributes to genomic maintenance by promoting precise dna repair across all cell cycle phases via the direct modulation of dna end - joining. |
the field of innate immunity in invertebrates, especially the study of particular insects, has revealed the importance of antimicrobial peptides in their defense systems. most of the peptides are produced in the fat body or haemocytes and then released into the hemolymph of insects [13 ]. in addition to defense responses in the circulatory system, antimicrobial peptides are synthesized as effector molecules in epithelial and midgut tissues, which form a critical interface from the external environment [911 ]. based on their amino acid sequences and antibacterial activities, most of the peptides are divided into five groups including cecropin, insect - defensins, glycine - rich proteins, proline - rich proteins, and lysozymes. these peptides can be further classified into three distinct groups : linear alpha - helical peptides devoid of cysteine residues, peptides in which proline and/or glycine residues are over - represented, and cysteine - rich peptides with cysteine stabilized - motifs. copris tripartitus spends most of its time in dung, where pathogens are abundant. their larvae feed on the fungi, decaying organic matter, dung, and other organic materials found in dung balls. therefore, it is likely that c. tripartitus defends itself against invading pathogens by means of antimicrobial compounds. the purpose of the present study was to isolate and identify immune related genes in the dung beetle, c. tripartitus. in this study, we constructed a full - length cdna library from bacteria - immunized c. tripartitus and then selected up - regulated clones using differential screening by a dot blot hybridization analysis. this is the first report of the isolation and characterization of the defensin - like peptide, coprisin, from the dung beetle, c. tripartitus. to induce antibacterial peptides, the c. tripartitus larvae were cooled on ice and individually injected with 50 l of e. coli jm109 (5 10 cells) suspended in physiological saline (150 mm nacl/5 mm kcl). as an initial screening process, a total of 1862 cdna clones were randomly selected from a full - length cdna library, spotted onto hybond - n membranes (amersham biosciences, uppsala, sweden) using a 96-well format dot blotter (bio - rad) and then hybridized with probes from bacteria - injected larvae as described previously. gaithersburg, md, usa) from the whole larvae 0, 4, 8, 16, and 24 hours after e. coli injection and quantified by ultraviolet (uv) spectroscopy. hybridization was performed for 3 hours at 65c in the expresshyb hybridization solution, according to the manufacturer 's instruction (clontech). as an internal marker these synthetic peptides were purified by reverse - phase hplc using a capcell pak c18 column (shiseido). elution was performed with a water - acetonitrile linear gradient (0 ~ 80% of acetonitrile) containing 0.1% (v / v) trifluoroacetic acid (tfa). the correct identification of the peptides was confirmed by using an esi mass spectrometer (plaform ii, micromass, manchester, uk) and maldi - tof mass spectrometer (voyager - destr, applied biosystem). the antibacterial activity of each synthetic peptide was initially examined by the radial diffusion assay as described previously. briefly, bacteria were grown overnight in a tryptic soy broth (tsb, difco) to the onset of stationary phase at 37c with shaking at 200 rpm. the cultures were diluted in a fresh tsb and were incubated at 37c until the optical density reached 0.4 at 620 nm. the cultured bacteria were centrifuged at 3000 rpm for 10 min at 4c, washed two times in cold 10 mm sodium phosphate buffer (spb, ph 7.4), and resuspended in cold spb. a volume containing 4 10 cfu bacteria was added to 10 ml of warm (40 to 50c) citrate phosphate buffer (9 mm sodium phosphate, 1 mm sodium citrate, ph 7.4) containing 1% (w / v) low - electroendosmosis - type agarose (sigma) and 0.03% tsb. three - millimeter diameter holes were punched in the set agarose and filled with 5 l of test peptides. after allowing 3 hours for diffusion of the peptides, a 10 ml nutrient - rich overlay gel containing 6% tsb and 1% (w / v) agarose was overlaid and was then incubated overnight at 37c. the diameters of clear zones surrounding each well were measured and expressed in activity units (1 mm = 10 units). in addition to a radial diffusion assay, antibacterial activities of the peptides were also tested by a broth microdilution assay against e. coli and s. aureus. briefly, bacteria were grown overnight in tsb to the onset of stationary phase at 37c with shaking at 200 rpm. the cultures were diluted in a fresh tsb to the final concentration of 2 10 cfu / ml. a stock solution of each peptide was prepared in 0.01% acetic acid at 640 g / ml. the peptide solution was then serially diluted in 0.01% acetic acid to 2 g / ml. after 90 l aliquots of the bacterial suspension were dispensed into each well of a 96-well polypropylene microtiter plate, 10 l of peptide solution was added. the antibacterial activities of peptides were assessed by measuring visible turbidity in each well of the plate after 18 hours of incubation at 37c. mic was expressed as intervals (a to b), where a was the highest concentration tested at which bacteria were still growing and b was the lowest concentration that caused complete growth inhibition. in order to find antibacterial peptides responsible for bacterial resistance, we performed the differential hybridization with all of the cdna probes, synthesized from normal and immunized larvae from a dung beetle, c. tripartitus. thirteen individual cdna transcripts were identified as differentially expressed sequences by the dot blot hybridization. one of the up - regulated genes (hereinafter referred to as coprisin) is a novel member of a family of antibacterial peptides known as insect defensin - like peptides (figure 1(a)). to confirm the inducibility of coprisin by immune challenge, we performed a northern blot analysis using the total rna extracted from the e. coli immunized larvae (figure 1(b)). the immunized larvae were collected and total rna was isolated at different time points after e. coli injection. the mrna expression was up - regulated after 4 hours, and its expression level reached a peak level after 16 hours. this result suggested that the increase of coprisin expression after the e. coli injection may be involved in the immune response of the dung beetle. the full length cdna sequence of coprisin was 412 bp in length, having a 5 untranslated region (utr) of 63 bp, a 3 utr of 106 bp, and open reading frame (orf) of 240 bp (figure 2(a)) coding for a putative preprodefensin of 80 amino acid residues with a predicted molecular mass of 8.6 kda and a pi of 8.72 (figure 2(b)). the coprisin cdna sequence contained predicted signal peptide cleavage sites at cys20 which produces mature 43-residue peptides resulting in a theoretical molecular mass of 4.5 kda and a pi of 8.67. the amino acid sequence of the coprisin precursor exhibits 62% similarity to that of the anomala cuprea defensin (data not shown), whereas the mature portion of coprisin displays 79%, 67%, and 72% similarity to those of a. cuprea, allomyrina dichotoma, and oryctes rhinoceros defensins, respectively, suggesting that coprisin is an insect defensin (figure 2(b)). the six cysteine residues known to form the three disulphide bridges in the defensin molecule are at positions 3, 20, 24, 34, 39, and 41. insect defensins are the best - known peptides with a cs motif, and they all have a c cxxxc c cxc consensus sequence. the deduced amino acid sequence of the coprisin peptide showed that it had a cysteine - stabilized motif with a c cxxxc c cxc consensus sequence, as found in other insect defensins. a multiple sequence alignment analysis using clustalw showed that this peptide is distinct from other insect defensins, indicating that it is a novel peptide with a cs motif. to find the antibacterial active region of coprisin, we synthesized four peptides that had the amidated amino acid residues at their c - terminal corresponding to amino acid residues 1v-43n - nh2 (copn1), 5v-16n - nh2 (copn2), 19a-30k - nh2 (copn3), and 31g-43n - nh2 (copn4) and then examined their antibacterial activity against e. coli and s. aureus by the radial diffusion assay. of these peptides, copn1 and copn3 peptides showed strong antibacterial activity, whereas other peptides had substantially less or no antibacterial activity (data not shown). the copn3 peptide fragment corresponded to the -helical region of a known insect defensin - like peptide. truncation of three amino acids from the copn3 peptide (resulting in copn5) still showed potent activity which was as much as the copn3 fragment. to further increase antibacterial activity of copn5, we then synthesized four 9-mer peptides modified by changing single amino acid residues of copn5 sequence (see table 1). in copa1 and copa3, cysteine and histidine residues were replaced by leucine to increase the hydrophobicity. in copa2 and copa4, cysteine and histidine residues the results of the mic test are shown in table 1. among these peptides, copa3 exhibited the strongest activity, with mic values in 48 g / ml range. these results suggest that a moderate hydrophilic - hydrophobic balance of the -helical antimicrobial peptides is a crucial factor in designing novel peptides in order to increase potent antibiotic activity. the first insect defensin peptide was isolated by matsuyama and natori from the flesh fly sarcophaga peregrina. since then peptides in the insect defensin family commonly have molecular weights of 3 - 4 kda and three disulfide bridge, while they showed potent antibacterial activity against various mrsa and lesser activity against gram negative bacteria. as shown in figure 2(b), amino acid alignments of the insect defensin family indicated that the three - disulfide bridges are conserved in insect defensin peptides. many insect defensin proteins have variable n - terminal loop sizes in which the number of residues ranges from 6 to 17 between the two cysteines. this suggests that this region may not be essential for antibacterial activity but contributes to specificity. | the antibacterial activity of immune - related peptides, identified by a differential gene expression analysis, was investigated to suggest novel antibacterial peptides. a cdna encoding a defensin - like peptide, coprisin, was isolated from bacteria - immunized dung beetle, copris tripartitus, by using differential dot blot hybridization. northern blot analysis showed that coprisin mrna was up - regulated from 4 hours after bacteria injection and its expression level was reached a peak at 16 hours. the deduced amino acid sequence of coprisin was composed of 80 amino acids with a predicted molecular weight of 8.6 kda and a pi of 8.7. the amino acid sequence of mature coprisin was found to be 79.1% and 67.4% identical to those of defensin - like peptides of anomala cuprea and allomyrina dichotoma, respectively. we also investigated active sequences of coprisin by using amino acid modification. the result showed that the 9-mer peptide, llcialrkk - nh2, exhibited potent antibacterial activities against escherichia coli and staphylococcus aureus. |
xenotransplantation is the transplantation of living cells, tissues, and organs from one species to another. xenotransplantation can be beneficial in overcoming the shortage of human organs and tissues for allotransplantation. pigs are considered as the best xenotransplant organ donor due to anatomical and physiological similarities with humans, and the relatively less financial and ethical problems compared with primates. however, the use of porcine samples for human xenotransplantation suffers from possible infectious risks due to the transmission of porcine endogenous retroviruses (pervs) from pigs to humans [1, 2 ]. a recent study reported that pervs can be transmitted to human cells via supernatants of primary porcine liver cells for short term using a bioartificial liver (bal) model. despite this report, more than 200 human patients who received pig cells or tissues did not display perv transmission in the blood cells. another study reported the absence of perv transmission from 21 patients receiving porcine islets and sertoli cells for 4.68 years. conversely, another study suggested that pervs and human endogenous retroviruses (hervs) could possibly form new viruses by recombination, complicating the transmission of perv infection via xenotransplantation. pervs are present in the genome of all pig breeds and are classified as three main types : perv - a, perv - b and perv - c. perv - a and perv - b can infect human cells as polytropic viruses and perv - c infects only porcine cells as an ecotropic virus. a very recent study suggested that recombinant perv - a and perv - c might be important infectious risk factor in human cells. therefore, eliminating infectious pervs is a crucial issue in xenotransplantation. for knockout of active pervs in the porcine genome, however, perv copy numbers differ among pig breeds [7, 8 ], and there are variations in perv integration sites among breeds [9, 10 ]. recent success in the knockdown of perv expressions has been reported using small interfering rna (sirna) [11, 12 ]. for these biomedical experiments, miniature pigs are widely used mainly because they have the similar organ sizes to human [13, 14 ]. long terminal repeats (ltrs) in the virus are mainly composed of the u3, r, and u5 regions. ltrs have important roles for the integration, replication, and regulation of retrovirus expression. moreover, the level of perv expression is associated with copy number of a 39 bp repeat in the perv u3 region, which has an ltr transcription factor binding site. a recent analysis of perv ltr structures using sequences derived from public database of pig genome identified structural differences in the u3 region. to characterize pervs in national institutes of health (nih) miniature pigs, the nih miniature pig bacterial artificial chromosome (bac) library was screened and bac end - sequences were used for the construction of contig maps for perv - positive bac clones and investigation of perv map locations in the pig genome. also, full - length perv sequences, along with ltr sequences, were presently obtained. a nih miniature pig bac library of approximately 15,000 clones was screened for perv - positive clones by pcr analysis using three envelop - specific primers. perv - specific primers were used for the identification of the perv - a, perv - b, and perv - c bac clones (table 1). polymerase chain reaction (pcr) was performed for perv type identification with 20 ng template dna, 1x pcr buffer, 2 mm mgcl2, 10 mm of each dntp, 0.2 m of each primer and one unit of taq polymerase (genet bio, republic of korea). the thermal profiles included an initiation denaturation at 94c for 5 min, following 30 cycles of denaturation at 94c for 30 sec, annealing at 60c for env - a and -b and 56c for env - c for 30 sec and extension at 72c for 30 sec and then a final extension step at 72c for 5 min using a ptc-200 programmable thermal controller (mj research, usa). pcr products were analyzed on 2% standard tris / acetate / edta (tae) agarose gels stained with ethidium bromide (etbr). the 5 and 3 bac end - sequences (bess) were obtained from 45 perv - positive bac clones using t7 and sp6 universal primers for the cycle sequencing reaction. pcr products were run on a model 3730xl automated dna sequencer (applied biosystems, usa). after masking of the repetitive sequences in the bess using repeatmasker software (http://www.repeatmasker.org/), bac contig maps were constructed using the primers designed from bess with the primer 3 software (http://frodo.wi.mit.edu/primer3/) (table 2). pcr mixtures contained 20 ng of template dna, 1x pcr buffer, 2 mm mgcl2, 10 mm of each dntp, 0.2 m of each primer, and one unit of taq polymerase (genet bio, republic of korea). the pcr amplification was carried out in a ptc-200 programmable thermal controller (mj research, usa) for 25 cycles of denaturation at 94c for 30 sec, annealing at 56c for 30 sec and extension at 72c for 30 sec and then a final extension step at 72c for 5 min. the identified positive bac clones were validated by sequencing to determine whether the bac clones possessed full length of perv including the gag, pol, and env genes. to ascertain whether perv sequences could make correct virus proteins, the amino acid sequences of each gene were deduced from nucleotide sequences using the open reading frame finder (orffinder) at ncbi (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). to characterize the ltr of each clone, nucleotide sequences of the ltr were aligned using clustalw program (http://www.ebi.ac.uk/tools/msa/clustalw2/). chromosomal locations of perv - positive clones were identified using the inra / university minnesota porcine radiation hybrid (imprh) panel [23, 24 ] using primers originating from bess in the perv - positive bac clones (table 2). pcr conditions were initiation heating at 94c for 30 sec ; 35 cycle of at 94c for 30 sec, at optimal annealing temperature of each primer set for 30 sec, at 72c for 30 sec ; a final elongation at 72c for 5 min using a ptc-200 programmable thermal controller (mj research). the pcr mixture included 25 ng templates, 1x pcr buffer, 2 mm mgcl2, 10 mm of each dntp, 0.2 m of each primer, and one unit of taq polymerase (genet bio). three types of perv - positive clones were identified by pcr using three envelope - specific primers. from the 15,000 bac clones in the library, forty - five perv positive bac clones were identified including 12 perv - a, 16 perv - b, and 17 perv - c clones. in contrast to previous results that perv - a and -b exist in the genomes of all pig breeds, the present study confirmed that the perv - c could be found in only a few pig breeds, which is different from perv - a and perv - b that were reported in all multitransgenic pigs generated for xenotransplantation. another study documented high perv - c copy numbers in the genome of the miniature pig line. the present study also identified a relatively high percentage of perv - c clones (17/45 ; 38%) among 45 perv - positive bac clones. to construct bac contig maps, 5 and 3 bac ends from 45 perv - positive bac clones were sequenced and primers for contig mapping were designed from the 90 bess derived from both t7 and sp6 ends (table 2). of these, blast searches against the ncbi database indicated that nine clones (2 perv - a, 1 perv - b and 6 perv - c clones) were already present in the genbank database (http://www.ncbi.nlm.nih.gov/genbank/). before designing primers for the contig mapping fifty - two bess derived from 26 t7 primer ends and 26 sp6 primer ends were successfully used to construct contig maps of perv - positive bac clones. sixteen perv bac clones (seven perv - a clones (a1 - 1f, a1 - 1e, a1 - 2 g, a4 - 1h, a1 - 6e, a1 - 6c, and a4 - 1 g) ; four perv - b clones (b3 - 7f, b4 - 13h, b1 - 8d, and b3 - 7 g) ; five perv - c clones (c1 - 1d, c4 - 2 g, c1 - 10 g, c3 - 1e, and c3 - 4b)) were mapped using both t7 and sp6 end - sequences. however, 10 perv - positive bac clones (1 perv - a clone (a4 - 14h) ; 5 perv - b clones (b1 - 7a, b3 - 11c, b3 - 3 g, b4 - 1b and b3 - 12h) ; 4 perv - c clones (c3 - 6f, c2 - 5f, c1 - 9b, and c1 - 9d)) were only mapped with t7 ends. also, 10 perv - positive bac clones (2 perv - a clones (a3 - 9f and a3 - 10e) ; five perv - b clones (b2 - 10d, b2 - 11a, b1 - 11c, b4 - 2e, and b3 - 12e) ; 3 perv - c clones (c2 - 6h, c2 - 3f, and c2 - 6c)) were only mapped with sp6 ends. especially, one perv - a clone (a4 - 1 g), one perv - b clone (b3 - 7 g) and three perv - c clones (c1 - 10 g, c3 - 1e, and c3 - 48) did not overlap with other contigs and so were designated as singletons. on the other hand, nine perv - positive bac clones (two perv - a clones (a3 - 7a and a3 - 5b) ; two perv - b clones (b1 - 11f and b1 - 11 g) ; five perv - c clones (c1 - 12a, c1 - 12c, c1 - 2d, c1 - 5f, and c3 - 5 g)) could not be mapped with both t7 and sp6 ends. the results indicated that 42.2% (38/90) of the bess contained repetitive sequences and could not be used to design primers for construction of contig maps due to the presence of large portion of repetitive sequences in the bess (figure 1). because pervs can be transmitted in a mendelian fashion from parent to offspring through multiple generations, a large number of pervs are known to be inactive. therefore, deducing the amino acid sequence of a perv is important to identify possibly active pervs. full - length perv nucleotide sequences were obtained from 12 selected positive bac clones containing three perv - a (a1 - 1f, a1 - 6c, and a4 - 1 g), four perv - b (b3 - 7f, b3 - 3 g, b3 - 7 g, and b3 - 12e) and five perv - c (c1 - 9b, c4 - 2 g, c1 - 10 g, c2 - 6c, and c3 - 1e). all three selected perv - a clones had low possibility to be active viruses because they had nonsense mutations in the envelope protein. however, one clone (b3 - 7f) from four perv - b bac clones and five perv - c bac clones had an intact open reading frame (orf) and so a high possibility of the production of virus particles, indicating that they were active pervs (figure 2). even though perv - c alone could not infect human cells, the perv - a and perv - c recombinant types can increase infectious risk in relation to xenotransplantation. therefore, the possible reason for this high sequence conservation is that these two regions had tata signal and cap sites related with transcriptional initiation. however, a previous study reported variable repeat numbers and differences in length of the u3 region. presently, similar results were obtained for the differences in repeat sequences in u3 regions (figure 2). three perv - a ltrs were investigated and the sequence results revealed similar repeat patterns. analyses of four perv - b ltrs indicated that one (clone i d : b3 - 7f) displayed differences in repeat numbers. one of the perv - c ltrs (clone i d : c3 - 1e) had an insertion in the u3 region and another perv - c ltr (clone i d : c1 - 10 g) had a 98 bp tandem repeat sequence in the u3 region. recent studies associated the expression activity of perv with the methylation status of ltrs [28, 29 ]. also, ltr elements might be used for the prediction of transcription activity as well as evolution because of insertions and deletions in the ltr region due to recombination event among different perv types. two perv - c clones (clone i d : c1 - 10 g and c3 - 1e) had recombinant pervs in the ltr region ; further research should be carried out with these recombinant pervs, especially when the pigs are used for the xenotransplantation research studies. to investigate perv map locations in the porcine genome, a linker - mediated pcr method was applied. previously, perv chromosomal integration sites were characterized in three pig breeds including large white, westran, and korean native pigs [10, 1820 ]. in this research, 11 perv genomic locations, consisting of three perv - a, four perv - b, and four perv - c clones, were identified in nih miniature pigs and compared with previously published integration sites in other three breeds. eleven perv - positive bac clones were randomly selected from contig maps in each of the loci and the chromosomal locations have been determined using 5000-rad radiation hybrid panel with primers designed from the bess (table 2). of these, three map locations on ssc2, ssc6, and ssc13 were identified for the perv - a clones. the perv - positive bac clone a4 - 14h, located on ssc6q3.5 and significantly linked with sw2419 marker (lod score = 14.72), corresponded to a site previously reported in the westran pig. the fluorescence in situ hybridization (fish) mapping technique used for the perv mapping in westran pigs indicated that they are more possibly the same pervs. also, the perv bac clone a1-f1, located on ssc2q1.3-q2.1 and importantly linked with the swr1342 marker (lod score = 19.36), represented a unique integration site not found in other three breeds. also, the perv bac clone a1 - 6c mapped to ssc13 linked with the sw955 marker (lod score = 4.18). two perv - positive bac clones, b3 - 7 g located on ssc3q1.1-q1.4 and b3 - 12e located on ssc3q2.1-q2.7, were highly linked with the sw1045 (lod score = 8.66) and sw717 (lod score = 18.47) markers, respectively. also, the perv - positive bac clone b3 - 7f was mapped on ssc 18q2.6 linked with the s0062 marker (lod score = 5.64). three perv - b locations identified in nih miniature pigs turned out to possess unique integration sites that have not been identified previously. also, another perv bac clone, b3 - 3 g, has been mapped on ssc4, which was linked to sw1003 marker (lod score = 3.18). according to previously reported integration sites, perv - c types however, perv - c clones were mapped in four chromosomal locations in the nih miniature pigs. two perv - positive bac clones, c1 - 10 g located on ssc12p1.5 and c2 - 6c located on ssc13q4.1-q4.9, were significantly linked with the sw2490 (lod score = 13.44) and sw769 (lod score = 8.31) markers, respectively. the other two perv positive bac clones, c3 - 6f located on ssc15 and c4 - 2 g located on ssc13, were linked with sw1892 (lod score = 6.64) and s0084 (lod score = 7.81), respectively. these perv - c - positive clones were not mapped previously ; the present study is novel in identifying their map locations. in summary, only one perv - a location on the ssc 6q3.5 (clone i d : a4 - 14h) in the nih miniature pig correspond to integration site previously identified in the westran pig, and six distinct retroviral integration sites were found on ssc 2, 3, 12, 13, and 18. on the remaining pig chromosomes, including x and y, any specific perv genomic sites were not found in this study (table 3). in this study, 45 perv - positive bac clones were identified from the nih miniature pig bac library, indicating that the library is an important source for identifying perv - containing clones. a previous report indicated that a miniature pig genome might contain a minimum of 30 genomic regions containing pervs, therefore, 150 perv - containing clones should be found in the nih miniature pig bac library considering that the library has a 5x genome coverage. one of the reasons for this could be due to the complexity of pcr - based library screening techniques compared with the bac filter - based methods, especially for screening the repetitive sequence as in pervs. along with this limitation, the genomic bac library gave an important resource for identifying perv - positive clones from nih miniature pig. the full - length perv nucleotide sequences identified in this study, together with the map information, can give important genomic information for the perv researchers, especially for developing knockout strategy of the specific perv. in conclusion, the perv information in this study from the nih miniature pig bac library will provide valuable information for xenotransplantation studies, especially selection of pigs having specific perv free animals. also, this research can help the development of markers for screening the site - specific pervs in the pig genome. | pigs have been considered as donors for xenotransplantation in the replacement of human organs and tissues. however, porcine endogenous retroviruses (pervs) might transmit new infectious disease to humans during xenotransplantation. to investigate perv integration sites, 45 perv - positive bac clones, including 12 perv - a, 16 perv - b, and 17 perv - c clones, were identified from the nih miniature pig bac library. the analysis of 12 selected full - length sequences of pervs, including the long terminal repeat (ltr) region, identified the expected of open reading frame length, an indicative of active perv, in all five perv - c clones and one of the four perv - b clones. premature stop codons were observed in only three perv - a clones. also, eleven perv integration sites were mapped using a 5000-rad imprh panel. the map locations of perv - c clones have not been reported before, thus they are novel perv clones identified in this study. the results could provide basic information for the elimination of site - specific pervs in selection of pigs for xenotransplantation. |
this disease occurs due to absolute or relative deficiency of insulin secretion with or without varying degrees of insulin resistance (1). diabetics have high blood sugar levels ; regardless of the type of diabetes, patients are required to control their blood glucose with medications or by an exercise program. of various enzymes in the digestive tract, pancreatic -amylase (e.c. -amylases constitute a family of endoamylases that catalyze the cleavages of -d-(1 - 4) glycosidic bonds (2). carbohydrates are the major constituents of the human diet and mainly play a role in the energy supply. the complex components of dietary carbohydrates should be broken down to monosaccharides by the -amylase and glucosidases since only monosaccharides can be absorbed from intestinal lumen and transported into blood circulation (3). retardation of carbohydrate digestion by inhibition of enzymes such as -amylase would lead to blood glucose level reduction and hence could be considered as a therapeutic strategy for the treatment of diabetes. alpha - amylase inhibitors therefore have a therapeutic role and one group of drugs introduced in the management of diabetes is the -amylase inhibitors. alpha - amylase inhibitors currently in clinical use such as acarbose and miglitol prevent the digestion of carbohydrates and provide short - term glycemic control. the drawback of such inhibitors is their non - specificity in targeting different glycosidases (4). also these inhibitors are known to produce serious side effects that limit their use as a therapeutic drug. therefore, natural extracts from available traditional medicinal plants are an important area of investigation with great potential for discovery of new antidiabetic drugs. different plants have been reported to show -amylase inhibitory activity and so may be relevant to the treatment of diabetes (5). more than 400 traditional plants have been recorded with antidiabetic effects, but very few of these traditional plants have received proper scientific or medical investigation (6). in recent years, a variety of research has been done on traditional medicinal plants in iran. the aqueous extract from urtica dioica plant is traditionally used to treat diabetes in iran. gholamhoseinian investigated the inhibitory effect of 100 different plant extract on alpha glucosidase. their results showed that aqueous extract of u. dioica had a poor inhibitory effect on the enzyme (4% inhibition after 30 min incubation). in another study, it has been shown that ethanolic extract from leaf of this plant revealed appreciable -amylase inhibitory activities in a concentration - dependent manner (7). the leaves of this plant have been used mostly in worldwide traditional medicines and recently there are some reports about the antidiabetic effect of the seed extracts and methanolic leaf extract from j. regia l. in iran, there are several in vivo studies about the antidiabetic effect of j. regia l. extract, but no detailed study about the antidiabetic effect of this extracts is available (8). here, we investigated the effect of these two medicinal plants aqueous leaves extracts on the activity of pancreatic alpha - amylase. the main goal of this study was determination of the type of alpha - amylase inhibition by these two plant extract. dixon plot was depicted for 4 different concentration of the extract and probable mechanism of amylase inhibition was revealed. starch, porcine pancreatic -amylase (ppa) and 3,5-dinitrosalicylic acid (dnsa) were purchased from sigma aldrich, usa. other chemicals were purchased from merck and were of analytical grade. fresh leaves of the two plants namely u. dioica and j. regia linn. were obtained from golestan forest of iran and all of them were botanically identified. dried plant materials were subjected to size reduction to a coarse powder by using dry grinder. 100 g of each of the powder was macerated with 100 ml of sterile distilled water in a grinding machine for about 10 - 15 min. the macerate was then first filtered through a double - layer muslin cloth and then centrifuged at 3500 rpm for 30 min. the filtrate was frozen and lyophilized in a lyophilizer at 5 mhg pressures at -50c (labconco, freezone). porcine pancreatic -amylase (ppa) activity was determined calorimetrically with soluble starch as substrate. reducing sugars were measured by the dinitrosalicyclic acid method described by miller (9). in each reaction 280 l of 1% (w / v) starch was dissolved in phosphate buffer, ph 7 containing 20 mm cacl2 ; 20 l of enzyme solution containing 20 g ppa was added, and the samples were incubated at 37c. the reaction was stopped by adding dnsa reagent. in order to determine initial rate in the absence of the plant extracts, measurements were carried out over different substrate concentrations (2, 4, 6, 8 and 10 mg / ml). different blanks were used for each starch co n c entration. in order to study the initial rate in the presence of plant extracts, different substrate solutions, containing various concentrations of inhibitors (u. dioica and j. regia leaf aqueous extracts and acarbose) the -amylase reactions were started by adding 20 l of ppa enzyme solutions to the substrate / inhibitor solutions and then the reaction was stopped in 5 min intervals. one unit of -amylase was defined as the hydrolysis of 1 m of reducing sugars (with maltose as the standard) per min under the assay conditions specified. from the above -amylase reactions, the initial velocities (v0) were determined from the slope of the linear part of the curves of the amount of product, in terms of mm of maltose equivalents, versus time in minutes. dixon plots of 1/v0 versus the concentration of the inhibitor for five concentrations of soluble starch and four concentrations of inhibitor were used to determine the type of inhibition. starch, porcine pancreatic -amylase (ppa) and 3,5-dinitrosalicylic acid (dnsa) were purchased from sigma aldrich, usa. other chemicals were purchased from merck and were of analytical grade. fresh leaves of the two plants namely u. dioica and j. regia linn. were obtained from golestan forest of iran and all of them were botanically identified. dried plant materials were subjected to size reduction to a coarse powder by using dry grinder. 100 g of each of the powder was macerated with 100 ml of sterile distilled water in a grinding machine for about 10 - 15 min. the macerate was then first filtered through a double - layer muslin cloth and then centrifuged at 3500 rpm for 30 min. the filtrate was frozen and lyophilized in a lyophilizer at 5 mhg pressures at -50c (labconco, freezone). porcine pancreatic -amylase (ppa) activity was determined calorimetrically with soluble starch as substrate. reducing sugars were measured by the dinitrosalicyclic acid method described by miller (9). in each reaction 280 l of 1% (w / v) starch was dissolved in phosphate buffer, ph 7 containing 20 mm cacl2 ; 20 l of enzyme solution containing 20 g ppa was added, and the samples were incubated at 37c. in order to determine initial rate in the absence of the plant extracts, measurements were carried out over different substrate concentrations (2, 4, 6, 8 and 10 mg / ml). different blanks were used for each starch co n c entration. in order to study the initial rate in the presence of plant extracts, different substrate solutions, containing various concentrations of inhibitors (u. dioica and j. regia leaf aqueous extracts and acarbose) the -amylase reactions were started by adding 20 l of ppa enzyme solutions to the substrate / inhibitor solutions and then the reaction was stopped in 5 min intervals. one unit of -amylase was defined as the hydrolysis of 1 m of reducing sugars (with maltose as the standard) per min under the assay conditions specified. from the above -amylase reactions, the initial velocities (v0) were determined from the slope of the linear part of the curves of the amount of product, in terms of mm of maltose equivalents, versus time in minutes. dixon plots of 1/v0 versus the concentration of the inhibitor for five concentrations of soluble starch and four concentrations of inhibitor were used to determine the type of inhibition. -amylase inhibition studies demonstrated that the extracts of both u. dioica and j. regia leaf had inhibitory activity. in all experiments, control samples were prepared accordingly without any plant extract and were compared with the test samples containing various concentrations of the plant extract. figure 1 shows the inhibition percent of ppa in the presence of plant extract and acarbose versus time. the extracts strongly inhibited the -amylase activity (i -amylase > 50% after 10 min). results showed that the inhibition activity of the extracts is a time dependent process which means that the inhibition percent increases as the time proceeds. percentage of -amylase inhibition versus different concentrations of (a) juglans regia extract and (b) urtica dioica extract. white columns represent the inhibition of enzyme by urtica dioica extract (2 mg / ml). gray columns represent the inhibitory effect of juglans regia extract on ppa (0.4 mg / ml). black columns represent acarbose (1 m) which is used as the positive control therefore, the dose dependent -amylase inhibitory activities of these plants were further studied and their ic50 values calculated. j. regia extract exhibited the highest inhibitory effect with an ic50 = 0.32 0.07 mg / ml (table 1). - amylase inhibitory effect of plant extracts in order to investigate the dependency of inhibition on the concentration of the extracts, three different concentrations of the extracts were selected and incubated with enzyme - substrate mixture for 30 min. figure 2a and b show the percent of inhibition versus increasing concentration of the extracts. for all experiments % inhibition calculated using the formula : v represents the initial velocity (v0) calculated for each reaction and has the value of mm / min. different blanks were prepared for different enzymatic reactions and all experiments were performed in triplicates. dixon plots of the reaction of ppa with different concentrations of soluble starch [s ] in the presence of (a) urtica dioica and (b) juglans regia aqueous extract and (c) acarbose. each line represents linear regression analysis of reciprocal of average rates of product formation for different substrate concentrations as a function of inhibitor concentration the type of inhibition of u. dioica and j. regia extracts and acarbose with porcine pancreatic -amylase was determined from dixon plots, a graphical method for determination of the type of enzyme inhibition. the effect of the extract on the enzymatic rate (v0) was determined at five substrate concentrations, and over four inhibitor concentrations [i ]. in a plot of 1/v0 against [i ] data for each substrate concentration fall on straight lines. the results showed that the type of inhibition was competitive in which enzyme - inhibitor complex could form. -amylase inhibition studies demonstrated that the extracts of both u. dioica and j. regia leaf had inhibitory activity. in all experiments, control samples were prepared accordingly without any plant extract and were compared with the test samples containing various concentrations of the plant extract. figure 1 shows the inhibition percent of ppa in the presence of plant extract and acarbose versus time. the extracts strongly inhibited the -amylase activity (i -amylase > 50% after 10 min). results showed that the inhibition activity of the extracts is a time dependent process which means that the inhibition percent increases as the time proceeds. percentage of -amylase inhibition versus different concentrations of (a) juglans regia extract and (b) urtica dioica extract. white columns represent the inhibition of enzyme by urtica dioica extract (2 mg / ml). gray columns represent the inhibitory effect of juglans regia extract on ppa (0.4 mg / ml). black columns represent acarbose (1 m) which is used as the positive control therefore, the dose dependent -amylase inhibitory activities of these plants were further studied and their ic50 values calculated. j. regia extract exhibited the highest inhibitory effect with an ic50 = 0.32 0.07 mg / ml (table 1). - amylase inhibitory effect of plant extracts in order to investigate the dependency of inhibition on the concentration of the extracts, three different concentrations of the extracts were selected and incubated with enzyme - substrate mixture for 30 min. figure 2a and b show the percent of inhibition versus increasing concentration of the extracts. for all experiments % inhibition calculated using the formula : v represents the initial velocity (v0) calculated for each reaction and has the value of mm / min. different blanks were prepared for different enzymatic reactions and all experiments were performed in triplicates. dixon plots of the reaction of ppa with different concentrations of soluble starch [s ] in the presence of (a) urtica dioica and (b) juglans regia aqueous extract and (c) acarbose. each line represents linear regression analysis of reciprocal of average rates of product formation for different substrate concentrations as a function of inhibitor concentration the type of inhibition of u. dioica and j. regia extracts and acarbose with porcine pancreatic -amylase was determined from dixon plots, a graphical method for determination of the type of enzyme inhibition. the effect of the extract on the enzymatic rate (v0) was determined at five substrate concentrations, and over four inhibitor concentrations [i ]. in a plot of 1/v0 against [i ] data for each substrate concentration fall on straight lines. the results showed that the type of inhibition was competitive in which enzyme - inhibitor complex could form. now a days, the dependency of the medicine on plants materials is becoming clearer. plants possess a large number of vital compounds that might form a part of healthy diet. clinically useful chemicals are now being obtained from plants even those that have not been classified before as medicinal plants (10). walnut (j. regia linn) is the most widespread tree nut in the world that has been used in human nutrition since ancient times (11). j. regia leaves have been traditionally used for the treatment of disease such as cold and sinusitis and as an antimicrobial and antidiarrheal substance (12). recently it has been shown that the consumption of walnut leaf in alloxan induced diabetic rats at the dose of 185 mg / kg reduced fasting blood sugar which suggests an antidiabetic effect for this plant. methanolic and ethanolic extracts of j. regia leaves have been prepared and the effect of these extracts on fasting blood sugar of alloxan induced diabetic rats has been studied. the results showed that fasting blood sugar decreased meaningfully in diabetic rats treated with j. regia. also there are some reports about the inhibitory effect of leaves methanolic extracts of j. regia on intestinal sucrase and maltase enzymes (8). it has been shown that the water extract of this plant had antioxidant, antimicrobial and analgesic activities (13). here we investigated the inhibitory effect of the leaves water extracts of u. dioica and j. regia on porcine pancreatic -amylase. our results showed that these extracts had concentration dependent and time dependent inhibitory effect on ppa. these results are in accordance with the results of previous studies. to characterize the inhibition process (i.e., competitive, noncompetitive, or uncompetitive) data are often analyzed by techniques that linearize inherently nonlinear relationships. the dixon plot is frequently used for identification of the likely mechanism of enzyme inhibition. plots were prepared of the reciprocal of rate of product formation (1/v0) versus inhibitor concentration at each substrate concentration. the initial velocities (v0) were determined from the slope of the linear part of the curves of the amount of product, in terms of mm of maltose equivalents, versus time in minutes (data not shown). here, dixon plot was depicted for both extracts and acarbose as the standard inhibitor of ppa. this compound has a pseudosugar ring and the glycosidic nitrogen linkage that mimics the transition state for the enzymatic cleavage of glycosidic bond and hence competitively inhibits -amylase (15). in our study, dixon plot of acarbose revealed the competitive inhibition pattern of ppa. on the other hand, dixon plots of the both extracts showed the same pattern as that of the acarbose. for the first time, the mechanism of inhibition for u. dioica and j. regi extract was investigated and the results showed that the extracts inhibited ppa through competitive mechanism. probably, there was a compound in the extract that could compete with the substrate for binding to the active site of the enzyme. the data from this study could provide a basis for further investigations where the active component that results in ppa inhibition could be isolated. the knowledge about the mechanism of inhibition by plant extract could provide successful use of the plant chemicals as drug targets. | objective(s):one strategy for the treatment of diabetes is inhibition of pancreatic - amylase. plants contains different chemical constituents with potential for inhibition of -amylase and hence maybe used as therapeutic.materials and methods : urtica dioica and juglans regia linn were tested for -amylase inhibition. different concentrations of leaf aqueous extracts were incubated with enzyme substrate solution and the activity of enzyme was measured. for determination of the type of inhibition, dixon plot was depicted. acarbose was used as the standard inhibitor.results:both plant extracts showed time and concentration dependent inhibition of -amylase. 60% inhibition was seen with 2 mg / ml of u. dioica and 0.4 mg / ml of j. regia aqueous extract. dixon plots revealed the type of -amylase inhibition by these two extracts as competitive inhibition.conclusion:determination of the type of -amylase inhibition by these plant extracts could provide by successful use of plant chemicals as drug targets. |
a widely embraced set of hypotheses poses an endosymbiont model of mitochondrial development driven by evolutionary modification of permanently enslaved primordial purple non - sulphur bacteria. from a teleological perspective, endosymbiotic enhancement of eukaryotic cellular energy requirements indicates a convergence of metabolic processes within the mitochondrial matrix for optimal synthesis of atp from adp and inorganic phosphate. bacterial and mitochondrial atp synthases (f - atpases) require a defined membrane potential to achieve transductive transmembrane proton - motive force across the inner membrane linked to high efficiency of atp production. this necessitates an evolutionarily driven retrofit of the bacterial plasma membrane into the inner mitochondrial membrane. the proton - motive force is functionally coupled via mechanical transductive events within discrete protein subunits localized to the transmembrane domains of f - atpases and involves sequential protonation and deprotonation of glutamate side - chains of c - subunits within functional pores. evolutionary pressure is predicted to provide an existential advantage to the host eukaryotic cell at this primal level of energy production. recent elegant work has confirmed this key contention by demonstrating an enhanced efficiency of 2.7 vs. 3.35 protons per synthesized atp molecule by eukaryotic vs. prokaryotic f - atpases, respectively. mechanistically, endosymbiosis has apparently resulted in seamless coupling of cytochrome c oxidase (cox) to f - atpase for maximal atp production in respiring mitochondria, thereby effecting essential partitioning of glycolytic and tca cycle metabolic processes within discrete cellular domains. cox is an inner mitochondrial multi - subunit enzyme complex expressed and assembled as a mosaic from nuclear and mitochondrial genomes. a recent review presents the case for cox as a key regulator of mitochondrial atp production. the authors propose that the evolutionarily driven addition of nuclear - encoded cox subunits provides the host eukaryotic cell with high order control over the ancestral activity of cox subunits encoded by mtdna genes in the face of fluctuating mitochondrial oxygen tensions and potentially dangerous reactive oxygen species. mitochondrial biogenesis is a key physiological process that is required for normal growth and development and for maintenance of ongoing cellular energy requirements during aging. of equivalent and/or greater importance is the regulated enhancement of mitochondrial biogenesis upon physiological demand coupled to multiple cellular insults. accordingly, all cellular survival mechanisms following a variety of disease - related pathophysiological insults are entrained by convergent mechanisms designed to regain homeostatic control of mitochondrial biogenesis. recent molecular studies represent a clearly defined approach to maximize normative cellular expression of mitochondrial biogenesis for maintenance of cellular energy requirements and as an anti - aging strategy in healthy human populations. it represents a compelling therapeutic strategy for enhancement of cellular expression of mitochondrial biogenesis in diverse human populations afflicted with metabolic, degenerative, neurodegenerative, and metastatic diseases. the mechanistic foundation of some molecular methods for maintenance and restoration of homeostatic control of mitochondrial biogenesis involves enhanced cellular expression of 2 major regulatory proteins that provide selective protection, transcription, and replication of mitochondrial dna (mtdna) : 1) mitochondrial transcription factor a (tfam) and 2) peroxisome proliferator - activated receptor gamma coactivator 1-alpha (pgc-1). tfam protein is the limiting factor involved in cellular stabilization of mtdna, is a well defined transcriptional activator of mtdna, and is an essential regulator of mtdna copy number. pgc-1 is a key transcriptional coactivator protein that is intimately involved in the regulation of intermediate energy metabolism with direct physiological linkage to homeostasis of mitochondrial biogenesis. pgc-1 is the major regulator of downstream nuclear gene expression that is required for normal mitochondrial function and homeostatic control of mitochondrial biogenesis. the profound regulatory effects of pgc-1 appear to be dependent on evoked enhancement of cellular cyclic guanosine monophosphate (cgmp) by constitutive nitric oxde (no) systems. importantly, tfam and pgc-1 have been demonstrated to exert interactive regulatory control of normal mitochondrial function and homeostatic control of mitochondrial biogenesis. etiological factors linked to the development and persistence of parkinson s disease (pd) have been attributed to mitochondrial dysfunction in cns a9 dopamine - expressing neurons. previously proposed mechanisms of pd - associated neuronal degeneration have focused on free - radical generation within mitochondria. many recent studies, however, suggest that impairment of basic mitochondrial integrity may play a key role in the pathogenesis of pd [1013 ]. accordingly, several pd - associated genes interact with pathways regulating mitochondrial function, morphology, and dynamics. it is at this level of mitochondrial integrity that sporadic and genetic pd appears to converge. recent studies indicate that two distinct pd - associated genes are required for normative functional integrity of mitochondria. genetic studies have shown that pink1 is upstream of parkin in a pathway that regulates mitochondrial morphology and degradation [1720 ]. one model proposes that parkin is a pink1 substrate activated by phosphorylation, while other studies have failed to demonstrate selective phosphorylation events. wang., 2011, proposed another model, where pink1 and parkin bind to the same target : miro. additional studies have demonstrated that both pink1 and parkin bind to miro when expressed in hek293 t cells, indicating that the interaction of miro with pink1 and parkin is triggered by depolarization of the mitochondria. temporal transit of intact mitochondria from somata to distant axonal or dendritic sites is on the orders of days. the mitochondrion - specific adaptor proteins, miro and milton, are regulatory players in mitochondrial motility, as demonstrated by the ability of miro to prevent pink1/parkin - induced mitochondrial shut - down in rat hippocampal axons. mitochondrial depolarization stabilizes pink1 on the outer surface of the mitochondrial membrane, promoting its interaction with miro. subsequent interaction of parkin with miro and likely ubiquitination causes miro to be removed from the membrane and degraded by the proteasome, inducing the release milton and kinesin from the mitochondrion. the ability of parkin to induce miro degradation is consistent with its ability to ubiquitinate mitofusin. wang., 2011 has identified two miro peptides that are phosphorylated by pink1, and one phosphorylation site, serine 156, which is important for the subsequent expression of parkin. their data suggest that pink1 expression inhibits the expression of downstream parkin, but the inability of mg132 to prevent this inhibition further suggests that the degradation of miro may in fact occur after the pink1-parkin complex has been removed from the mitochondrial surface and motility has ceased. previous reports have demonstrated that in various cell lines, damaged mitochondria can selectively recruit parkin and are subsequently targeted for mitophagy. wang., 2011 demonstrate that this parkin recruitment also occurs in axons. these results are consistent with parkin s ability to inhibit mitochondrial motility upon overexpression. on the other hand, lower parkin expression levels induced recruitment of parkin to mitochondria (by treatment with antimycin). parkin recruitment is initiated by the depolarization - induced - stabilization of pink1 on the mitochondrial surface, and pink1 is upstream of parkin in regulating mitochondrial morphology [1720 ]. in conclusion, the potential molecular targets described above may represent a defined approach to evaluate normative cellular expression of mitochondrial biogenesis and ongoing mitochondrial viability for maintenance of cellular energy requirements and as an anti - aging strategy in healthy human populations. in light of what has been presented above, primordial signaling may have been instrumental in the establishment of the mitochondrion as a viable eukaryotic organelle. aberrant regulatory events at the mitochondrial level are proposed as causative factors in a variety of pathophysiological states that associated with very basic metabolic dysfunction. | summarymitochondrial biogenesis is a key physiological process that is required for normal growth and development and for maintenance of ongoing cellular energy requirements during aging. of equivalent and/or greater importance is the regulated enhancement of mitochondrial biogenesis upon physiological demand coupled to multiple cellular insults. basically, cellular survival mechanisms following a variety of disease - related pathophysiological insults are entrained by convergent mechanisms designed to regain homeostatic control of mitochondrial biogenesis. recent molecular studies represent a clearly defined approach to maximize normative cellular expression of mitochondrial biogenesis for maintenance of cellular energy requirements and as an anti - aging strategy in healthy human populations. this report focuses on mitochondrial transcription factor a, peroxisome proliferator - activated receptor gamma coactivator 1-alpha, pink1 and parkin. designing agents to target mitochondrial function represents a compelling therapeutic strategy for enhancement of cellular expression of mitochondrial biogenesis in diverse human populations afflicted with metabolic, degenerative, neurodegenerative, and metastatic diseases. |
prosthetic valve thrombosis (pvt) is one of the most serious complications of prosthetic heart valves. the overall incidence is reported to range from 0.1% to 5.7% per patient year.1) the incidence of pvt is differed from the valve position, it reported as 0.5% per patient - year in the mitral position2) and 1% to 4% in the tricuspid position.3)4) although the incidence of pvt of tricuspid position is high, there are not enough data on the management of it, in contrast to left - sided pvt.5 - 8) also identifying a thrombus on a tricuspid prosthesis with transthoracic echocardiography (tte) or trans - esophageal echocardiography (tee) is more challenging than mitral prosthesis, especially if the thrombus is non - obstructive. we herein present a case of tricuspid pvt which was diagnosed with multi - detector - row computed tomography (mdct) and successfully treated without thrombolytic therapy or surgery. a 57-year - old female patient was admitted to the hospital with the complaint of dyspnea [the new york heart association (nyha) functional class ii ] in december, 2010. tte showed left ventricular ejection fraction of 59%, severe mitral stenosis, severe aortic stenosis and severe tricuspid regurgitation. in january 2011, the patient underwent mitral valve replacement with a 25 mm on - x valve (on - x life technologies inc., austin, tx, usa), tricuspid valve replacement with a 31/33 mm on - x valve, and aortic valve commissurotomy. eleven days after valve replacement, tte revealed that the normal function and gradients of the two prosthetic valves. at the time of discharge, the patient 's international normalized ratio (inr) was 2.36. she was discharged from the hospital with the recommendation to use warfarin with goal inr 2.0 - 3.0. in december 2012, the patient complained of dyspnea again. doppler echocardiographic examination of the prosthetic tricuspid valve demonstrated the peak e velocity of 1 m / s, peak pressure gradient of 5 mmhg, and pressure half time of 144 ms (fig. she complained of intermittent, small amount of melena and microcytic and hypochromic anemia with hemoglobin level of 7.8 mg / dl was detected. therefore, under impression of iron deficiency anemia caused by gastrointestinal bleeding, oral iron supplement was prescribed and esophagogastroduodenoscopy (egd) was planned. after four days of withholding warfarin therapy without reversal the effect of it, egd was done. egd showed erosive gastritis without active bleeding focus, no hemostatic intervention was performed and the patient resumed taking warfarin the next day. the patient was hospitalized for evaluation of the causes of worsening dyspnea (nyha functional class iii) despite correction of anemia in february 2013. on admission day, her blood pressure was 121/59 mmhg, pulse rate was 80 beats per minute and inr was 2.13. tte revealed that the prosthetic mitral valve had normal function and gradients, whereas the prosthetic tricuspid valve showed limited motion without definite obstruction. doppler measurements including peak e velocity and mean gradient, however, were within acceptable range. the peak e velocity was 1 m / s and mean gradient was 3 mmhg. the only parameter suggested prosthetic tricuspid valve dysfunction was prolonged pressure half time, 382 ms (fig. the fluoroscopy showed that one leaflet of the prosthetic tricuspid valve had limited motion (supplementary movie 1). for evaluation of the cause of impaired prosthetic tricuspid valve motion, mdct was performed. 2, supplementary movie 2 and 3). with the diagnosis of prosthetic tricuspid valve thrombosis, the patient was administered 60 mg of low molecular weight heparin twice a day for three days. after three days, she discharged from the hospital with the recommendation to adjust warfarin dose with goal inr 3.0 - 3.5. two weeks after discharge from the hospital, she visited the outpatient clinic for follow - up. dyspnea was disappeared and her exercise capacity was improved. then, after four months, follow - up tte was done. the images showed unrestricted motion of prosthetic tricuspid valve with normal pressure half time (fig. the lower pressures on the right side of the heart with a slower blood flow across the tricuspid valve are the important cause of higher risk of thrombus formation in prosthetic tricuspid valves. moreover, the risk is even higher in prothrombotic states such as pregnancy or atrial fibrillation, with inadequate anticoagulation, and in patients with multiple prosthetic valves.9) our patient with atrial fibrillation and multiple prosthetic valves including tricuspid prosthesis had high risk of thromboembolism. the american society for gastrointestinal endoscopy guidelines recommend that warfarin should be discontinued for 3 - 5 days in high - risk patients undergoing high risk procedures, and consideration should be given to bridging therapy with heparin or low molecular weight heparin.10) however, these provide limited guidance only with elective situations and there are few recommendations during the acute gastrointestinal hemorrhage and care after the procedures. although the previous studies showed low incidence of thromboembolic events with warfarin withhold,11)12) in light of high risk of thromboembolism, bridging therapy with heparin might be needed to prevent thrombotic complication in our patient. the diagnosis of pvt is usually confirmed by tte, tee and cine - fluoroscopy. however, acoustic shadowing and artifacts created by the mechanical prosthetic valves limit the availability of tte to evaluate the motion of the leaflets. also, in non - obstructive pvt, tte is commonly normal. doppler parameters have been aided to detect prosthetic valve dysfunction. according to the guideline from the american society of echocardiography, obstruction of prosthetic tricuspid valve suggested on continuous wave doppler by an e velocity > 1.7 m / s, mean gradient > 6 mmhg or pressure half - time > 230 ms. in this case, increased pressure half time was the only abnormal parameter.13)14) suspicion based on history, and thorough echocardiographic examination was the key role in the diagnosis of non - obstructive pvt. after performance of tte and cine - fluoroscopy, the diagnosis is usually confirmed by tee. however, tricuspid valve evaluation via tee is difficult because of complex structure and relative distance from the esophagus. therefore, we chose mdct as a diagnostic tool for the confirmation of pvt. mdct can provide sharp images to characterize the reduced mobility of prosthetic leaflets or even directly visualize and distinguish between thrombus and pannus.15 - 17) in the present case, mdct provided good image quality of prosthetic tricuspid valve and showed large size of thrombus directly. once diagnosis of pvt is confirmed, several therapeutic modalities can be considered : surgery, fibrinolysis, heparin treatment, or optimization of anticoagulation therapy. selecting one of these modalities is largely influenced by the presence of valvular obstruction, valve location (left- or right - sided), and clinical status. according to the guidelines of american heart association / american college of cardiology, thrombolytic therapy is reasonable for thrombosed right - sided prosthetic heart valves with nyha functional class iii - iv symptoms or a large clot burden.18) the european society of cardiology guideline also recommends thrombolytic therapy for tricuspid pvt.19) however, even the consideration of relative lower complication rates of right - sided pvt, thrombolytic agents are associated with risks of embolism and bleeding. in tricuspid valve thrombosis, shapira.8) reported one patient who has mild symptom treated effectively by intensifying anticoagulation. even in left - sided pvt, al habib.20) reported a patient who successfully treated of mechanical mitral valve thrombosis with antithrombotic agents alone. in this regard, in stable patients with non - obstructive, intensification of anticoagulation can be an alternative therapy. in this case, the patient suffered from exertional dyspnea and tte showed no significant hemodynamic change except increased pressure half time. suspicion, thorough echocardiographic examination and mdct attributed in the diagnosis. despite large thrombus size, our patient successfully treated by low molecular weight heparin bridging therapy followed by intensifying anticoagulation. although this conservative approach is inappropriate as first - line therapy, we do suggest that high dose anticoagulation therapy alone could be a reasonable therapeutic option for patients with hemodynamically stable tricuspid pvt. cardiac computed tomography (valve protocol) showing a large 14 6 11 mm thrombus on the prosthetic tricuspid valve. cardiac computed tomography (valve protocol) showing a large 14 6 11 mm thrombus on the prosthetic tricuspid valve. | prosthetic valve thrombosis (pvt) can be a life - threatening complication that requires immediate treatment. we present a case of 57-year - old woman with tricuspid pvt who was definitely diagnosed by multi - detector - row computed tomography limited with echocardiography. the patient was treated successfully with an alternative approach using low molecular weight heparin bridging therapy followed by intensifying anticoagulation alone. |
bacterial biofilm caries models can roughly be divided into two groups : closed batch culture and open continuous culture models (table 1). continuous methods can be further divided into artificial mouth models (amm) and flow cells. batch and continuous culture methods are used to grow a monoculture biofilm, a defined consortium biofilm (from two up to ten species) or a microcosm biofilm (using saliva or plaque sample as inocula). the different bacterial biofilm models are used to study the origins of caries, caries prevention, how cariogenicity changes with different bacteria and how diet or other compounds and materials affect cariogenicity (7). biofilm models can be difficult to compare due to the differences in biofilm formation times, different growth media, and varying bacterial species used in different situations. the main differences between batch biofilm model, artificial mouth model (amm), and flow cell biofilm models with batch biofilm models, a biofilm is formed either on a plate wall, on the surface of discs, coupons or pegs or on human or bovine enamel within the well. a closed system is used so that the environment inside the well changes during the test as nutrients are consumed and metabolic products accumulate unless the growth media are replaced (8). the frequency of the growth media changes depends on the model set up. unlike the oral cavity, there is no flow of fluids and nutrients with these models, although some models do create a liquid shear force by dipping the biofilms in saline or other liquid during biofilm formation (9). however, batch models do offer means of comparing multiple test compounds or conditions simultaneously ; they only require small amounts of reagents and are convenient, reproducible, and economical to use (8). one of the most commonly used batch biofilm models is the zrich biofilm model which uses six microbial species (streptococcus oralis, streptococcus sobrinus, actinomyces naeslundii, veillonella dispar, fusobacterium nucleatum, and candida albicans) (9). using fluorescently labeled antibodies and confocal laser scanning microscopy (clsm), this model allows the interspecies associations to be studied with respect to biofilm formation and how macromolecules of different sizes can penetrate the biofilm in vitro (9). this model and its variants have been used extensively to evaluate the effect of different substances in the biofilm formation process [e.g. plant extracts (10), chlorhexidine (11), and xylitol (12) ]. furthermore, the model has been used to study the effect of oral probiotics on a growing biofilm (13), as well as de- and remineralization (9, 14) in a biofilm with variable formation times. it has also been used for developing methods to analyze biofilm microbes (15). (16) used a variation of this model incorporating three species of bacteria (streptococcus mutans, streptococcus sanguinis, and a. naeslundii) to study the effect of xylitol in a young biofilm. they observed that 5% (w / v) xylitol diminished the s. mutans counts in a young (8 h) biofilm, while total bacterial counts were unchanged, indicating a shift in the composition of the biofilm through a small change in the environment. another modification of this model is the three - species version (s. mutans, s. oralis, and a. naeslundii) developed to mimic ecological changes with respect to cariogenic biofilm formation and to investigate the relationship between s. mutans and exopolysaccharides (17). the biofilm was grown in tryptone yeast broth in the presence of glucose within 24-well plates, and sucrose was added after 29 h to create a cariogenic challenge. in the multispecies biofilm, this also resulted in an increased biofilm mass due to augmented exopolysaccharide production (17). klein. (18) further showed that s. mutans adapts to the multispecies environment by changing the expression of the genes associated with glucan synthesis, remodeling, and glucan - binding. in this way, s. mutans out - competes other bacteria by optimizing its metabolism to a sucrose environment, thus increasing its competitiveness and thereby its virulence. a fluorescent ph indicator dye was used to determine the ph changes within the biofilm, and the results indicated that the exopolysaccharide matrix helps to create low ph niches in the biofilm which favor the acid - tolerant s. mutans (19). the calgary biofilm device (a 96-well plate system using lids with 96 pegs for biofilm formation) was developed in 1999 (20). this model allows rapid testing for antibiotic susceptibility in a biofilm model, with or without agitation. as biofilm growth differs in comparison to planktonic growth, it was important to develop a means of testing susceptibility of the bacteria within biofilm to antimicrobials. in a calgary device, inhibitory concentrations can be analyzed by comparing the positive control to the lowest concentration of the antimicrobial with minimum 10% of difference in od650 nm. in addition, biofilms can be visualized using scanning electronic microscopy (sem) or clsm (5). the method has been used extensively to determine the minimal biofilm inhibitory concentration, minimal biofilm eradication concentration and biofilm bactericidal concentration for various antibiotics and antimicrobials, but mainly in non - caries related biofilm studies (5, 20). many batch biofilm models have a constant exposure to sucrose during biofilm growth ; however, this is usually not the case in the oral environment. to address this discrepancy, ccahuana - vasques and cury (21) modified the s. mutans batch biofilm model. originally designed to test short exposure of antiplaque agents on bovine enamel demineralization (22), it was modified to test the cariogenic challenge of sucrose exposure eight times a day. to validate the model, the effect of different concentrations of chlorhexidine and 0.05% naf was tested on biofilm formation and demineralization two times a day. this was also shown in clinical trials indicating the sensitivity of the model to detect changes in biofilm formation and enamel demineralization (21). the same model has more recently been used to evaluate anticariogenic properties of an apple concentrate, where a decrease in enamel demineralization and extracellular polysaccharide production was seen (23). as antibiofilm compounds are tested against a mature biofilm in this model, it can not be used to evaluate the effect of bacterial adhesion properties ; instead the model focuses on intermittent exposure to sucrose and a test substance. a similar approach was used by steiner - oliveira. (24) to study caries formation in human dentin. the s. mutans monospecies biofilm model was applied with artificial saliva as a growth medium with periodical exposures to sucrose. in accordance with in vivo studies, the model demonstrated that sucrose increased lesion development, but as the model had no saliva clearance it was not able to achieve a proper remineralization between sucrose exposures. a microcosm batch biofilm was grown in a polystyrene based coverslip with different media, and it was evaluated using checkerboard dna dna hybridization analysis (25). this model was used to assess responses to environmental factors such as changes in growth media, growth volume, and sucrose addition. it showed a behavior similar to an in vivo biofilm, and the model was able to illustrate individual responses to environmental changes. (26) developed a microcosm batch biofilm model for estimating demineralization using bovine enamel discs, saliva analogue growth media, and periodical sucrose exposures. it was seen that under sucrose exposure biofilms showed similar microbiological changes and mineral loss regardless of the individuals, thus suggesting that diet and behavioral factors can be more important causes of caries development than transmission of microbes (27). new and improved detection methods using the quantitative light - induced fluorescence - digital illuminator (qlf - d) can quantify biofilm bacteria and the red fluorescence observed by qlf - d was shown to correlate with cariogenicity of the biofilm in a microcosm model (28, 29). it was therefore effective in monitoring biofilm maturation, and the results from this in vitro method suggest that qlf - d could be used to monitor cariogenic biofilm maturation also in clinical practice. the term artificial mouth model (amm) is usually used to describe dental biofilm systems with a continuous, open - surface fluid flow rather than flow cells with closed flow (30). the amm provides intermittent or continuous flow of nutrients over the biofilm, mimicking the in vivo situation as closely as possible (31). an amm simulates oral conditions in terms of temperature, humidity, sucrose supply, ph, and nutrient (i.e. saliva) flow rate, but still there are differences between different amms in biofilm formation time, nutrient media, and equipment used. as the equipment is more complex than in batch systems, amms usually have less replicates, but instead they offer a means to investigate the mechanism of action of microbes and the compounds being tested as well as the overall growth and structure of plaque. this is due to the controlled environment that more closely mimics the oral cavity in vivo (32). tang. (31) provide a review of the history, development, and structure of the amm. a defined multispecies biofilm amm allows for a more detailed and easier analysis of bacteria present in comparison to a microcosm amm. an amm with four - species (s. mutans, s. sobrinus, a. naeslundii, and lactobacillus rhamnosus) has been used to study enamel and root caries and to compare single and multispecies models (30). consortia biofilms were usually larger than monospecies biofilms, and they also tended to cause more enamel softening. the addition of sucrose to the consortia biofilm created a similar ph curve as that found in vivo. a defined multispecies amm with a different set of bacterial species (s. mutans, s. sobrinus, lactobacillus acidophilus, l. rhamnosus, and a. naeslundii) was used to study the mechanism of action of silver diamine fluoride on the biofilm. it was found that it inhibits biofilm formation, and it also reduces demineralization (32). lactobacilli mostly inhabit the upper parts of the biofilm, while mutans streptococci are found in the lower layers. results suggest that high concentrations of silver and fluoride ions inhibit biofilm development. a slightly modified amm using a three - species (s. mutans, s. sobrinus, and streptococcus gordonii) system was developed to evaluate the formation of secondary caries around restorations and to assess the effectiveness of bonding material (33). for the formation of secondary caries, a biofilm was first grown in a continuous flow reactor for 20 h on a saliva - coated specimen and subsequently incubated in a batch system for 730 days. the model produced caries lesions around composite resin restorations and the protective effect of the bonding system was verified. (34) present a dental caries simulator consisting of a continuous flow system with standardized artificial saliva flow (35). hydroxy apatite (ha) discs are used as a model tooth and as an adhesive support for the bacteria (fig. the system can be inoculated with single or multiple bacterial species and test substances can be added either continuously or in pulses during simulation. the system has 16 replicate vessels which enable parallel testing of multiple conditions (34). with this model, it is possible to monitor the initial steps of bacterial adherence to the ha - discs and the subsequent biofilm formation. it can then be used to study the effects of various substances such as polyols on bacterial quantities and adherence. schematic diagram of the dental simulator (after forssten., 2010). of all the in vitro models mentioned, microcosm amm comes closest to replicating in vivo conditions in the oral cavity. however, as the complexity of bacteria increases also the interpretation of the results becomes more complicated. the advances in the methods used for analyzing the biofilm and its components have led to a deeper understanding of the biofilm formation process and the factors connected to it. the microcosm amm is a valuable tool to for studying the function and structure of dental biofilm. the focus with microcosm amm studies was initially on biofilm growth, metabolism (ph changes, the effect of sucrose, and growth media), and de- and remineralization processes (3638). a further variation of the amm is the microcosm constant depth film fermentor which has been used to study the effect of chlorhexidine and tetracycline on the microbiota composition in biofilm (3941). the structure and viability of the biofilm were found to be similar in vivo as judged by clsm (42, 43). thirty - six bacterial species were also identified in the supragingival biofilm using a combination of culture and molecular methods (pcr) (44). the method used to identify different microorganisms in a microcosm biofilm developed ; that is, denaturing gradient gel electrophoresis (dgge) allowed the individual variations and changes of the bacterial populations to be captured during the growth of the biofilm (45). more recent methods of detecting bacteria present in biofilm, such as qpcr and human oral microbial identification microarray (homim), have enabled more accurate analysis of the bacterial population composition (46, 47). in addition, newly developed methods such as cross - polarization optical coherence tomography (cp - oct) enable the evaluation of the early stages of caries formation (48). cp - oct allows visualization of the biofilm without disturbing it. with this method, the sample is kept hydrated, and images are taken within minutes as the sample is removed from the biofilm reactor. lately, microcosm biofilm models have increasingly been used for studying the possibilities of different restoration materials (e.g. dimethylaminododecyl methacrylate and nanoparticles of silver or calcium phosphate) to inhibit the formation of secondary caries (4951). publications describing the use of the microcosm amm with next - generation sequencing have not been published yet, but this new technology will help to more accurately capture changes in the microbiota. in flow cells, the liquid phase moves only in one direction and mixing happens by diffusion ; therefore, conditions vary at different sites within the reactor (8). flow cells are especially useful for studying the development of biofilm formation and morphology. sequential colonization can be observed in real - time using microscopic analyses of undisturbed biofilms (8). (53) provide reviews of various staining and visualization techniques that can be used with flow cell biofilms. a four - species (s. gordonii, a. naeslundii, veillonella atypica, and f. nucleatum) flow cell biofilm model was used to evaluate the mechanism of early biofilm formation. biofilms were analyzed using fluorescent stains and fluorescent in situ hydridization (fish) probes visualized by clsm (54). it was found that species inoculated sequentially had more biomass than coaggregate - inoculated biofilms and s. gordonii was a major component of the formed biofilm. (55) presented a variation of the flow cell biofilm model which focuses on changes in the early caries process when only mildly acidogenic bacteria are present. this five - species (s. oralis, s. sanguinis, s. mitis, streptococcus downei, and a. naeslundii) flow cell biofilm model (26 h - old biofilm) is highly reproducible and shows structural similarity to in vivo biofilms. in addition, the model also uses ph - sensitive ratiometric fluorescent dyes to evaluate ph - levels at the biofilm - substratum interface. the model can be useful for testing substances that affect early stages of caries development, and it has been used to evaluate the influence of osteopontin on biofilm formation (56). osteopontin clearly decreased biofilm formation, but did not disrupt biofilms that had already formed. fish analysis further indicated that osteopontin decreased s. mitis while the proportion of other bacteria increased. (4) developed a six - species (s. oralis, a. naeslundii, veillonella parvula, f. nucleatum, aggregatibacter actinomycetemcomitans, and porphyromonas gingivalis) biofilm model for evaluating biofilm development under flow and shear conditions that can be used to assess, for example, antimicrobial substances. bacteria were first grown in a lambda minifor bioreactor, the bacterial suspension was transferred to a modified robbins device with ha - discs precoated with saliva and biofilm was formed in 39 days. sem and clsm were used to study the composition of the biofilm during formation of the biofilm, and the amount of bacteria was determined by culturing. the model indicated that chlorhexidine in combination with cetylpyridinium chloride is more effective in killing bacteria in the biofilm than chlorhexidine alone or in combination with naf. dental caries is a common disease that affects almost all people at some stage of their life. different biofilm models display a practical and ethical way of exploring new opportunities to investigate and combat dental caries. the development of various biofilm models has increased the understanding of the biofilm formation process and the factors affecting formation and structure of a biofilm. the models are being used to develop new ways of influencing ph - levels in the oral cavity, to improve the remineralization of the enamel, to inhibit the growth of pathogenic bacteria by antimicrobials (e.g. chlorhexidine, sodium hypochloride) and to affect the metabolism of bacteria (e.g. by xylitol) so that they become less harmful (2). also, in the future biofilm models will be used to develop new restoration materials and to minimize possibilities for secondary caries to develop. the authors are employed by dupont ; dupont manufactures and markets xylitol for oral health applications. | a dental biofilm forms a distinct environment where microorganisms live in a matrix of extracellular polysaccharides. the biofilm favors certain bacteria and creates a habitat that functions differently compared to planktonic bacteria. reproducible model systems which help to address various questions related to biofilm formation, the process of caries development, and its prevention are needed and are continuously developed. recent research using both batch culture, continuous culture and flow cells in caries biofilm formation is presented. the development of new techniques and equipment has led to a deeper understanding of how caries biofilms function. biofilm models have also been used in the development of materials inhibiting secondary caries. this short review summarizes available models to study these questions. |
cells in vivo are exposed to basal membranes that have topographic features in the micron and submicron ranges (abrams, goodman, 2000 ; abrams, schaus, 2000 ; abrams 2002). nanoscale pores, fibers, and ridges of the basal membranes present 3d topographical features that provide biophysical cues to the overlying cells (abrams, goodman, 2000 ; abrams, schaus, 2000 ; abrams 2002). even though the topography of the basal membranes has been characterized, their influence on cellular activities in vivo is not well understood. cellular response to nanoscale substrate topography has been investigated using various topographic patterns (andersson, olsson 2003 ; dalby, riehle, 2002 ; dalby, yarwood, 2002 ; rice 2003 ; riehle 2003 ; dalby, gadegaard, 2004), biomaterials (dalby, riehle, 2002 ; dalby 2003), and cell lines (rice 2003 ; miller 2004). studies have shown that nanoscale cellular structures such as filopodia and integrins interact with the underlying topography of the substrate and affect cellular activities such as cell shape and spreading, cell adhesion, differentiation, proliferation and gene expression (goldberg and burmeister 1986 ; polinsky 2000 ; dalby, gadegaard 2004 ; dalby, yarwood, 2002). hence, the topography of the substrate upon which cells are cultured may be used to control and regulate specific cellular function and activity. for example in one study, human fibroblasts responded to arrays of nano - islands of 13 nm in height, 263 nm in diameter, and 527 nm in spacing with changes in gene regulation associated with cell signaling, proliferation, cytoskeleton, and proliferation of extracellular matrix proteins (dalby, yarwood, 2002). in another study, human fibroblasts cultured on arrays of columns of 160 nm in height and 100 nm in diameter showed decreased cell adhesion and spreading as compared with smooth substrates (dalby 2005). similarly, rat pancreatic epithelial cells exhibited decreased cell spreading with decreasing column diameter from 166 nm, 111 nm, 91 nm to 58 nm (andersson, bckhed, 2003). human osteoblasts cultured on porous anodized alumina with a 200 nm pore diameter showed a flattened morphology with filopodia attached to the pores (karlsson 2003). human umbilical vein endothelial cells showed good cell adhesion and proliferation on substrates with a 300 nm pore diameter but had reduced cell adhesion, restricted cell spreading, and limited proliferation on substrates with a 7 m pore diameter (kwon 2005). in a previous study (haq 2005), we showed that pc12 cells developed short neurites, numerous filopodia extensions, and high cell numbers on arrays of nanopillars of 103 nm in diameter and 131 nm in spacing compared with cells on smooth substrates. however, pc12 cells on substrates with arrays of micro - islands of 15 m in diameter and 30 m in spacing developed longer neurites, fewer filopodia, and lower cell numbers as compared with cells on smooth substrates. in this study we intend to investigate the effect of nanopillars and nanopores on neurite development in a parallel manner. specifically, we want to know what will happen to neurite extension if the pc12 cells are exposed to nanopillars and nanopores having dimensions comparable with but slightly larger than that of filopodia (~100150 nm). we hope that such a controlled study of neuronal responses to nanostructured topographies could shed some insights into using nanopillar or nanopore substrates for investigating the electrophysiological activities of neurons, using nanopore substrates as a vehicle for targeted drug delivery to neuronal cells, or using nanopillar substrates as electrodes for electrochemical and biomechanical sensing of cell - matrix interactions. two types of nanostructured substrates were used in this study nanopillars and nanopores, along with two smooth substrates coated coverslips and bare coverslips as controls. for the nanopillar substrates, arrays of standing gold nano - pillars of 200 nm in diameter, 70 nm in spacing and 2 m in height were fabricated using an electrodeposition technique. the details of the electrodeposition can be found elsewhere (anandan 2006). briefly, a thin layer of gold of about 150 nm was sputter - coated onto one side of a porous anodic alumina (paa) disc (whatman inc, middlesex, england) to provide a conductive layer. gold was electrodeposited galvanostatically at 5 ma / cm in orotemp24 gold plating solution (cranston, ri) through the open pores of the paa disc for 3 minutes. after that the paa disc was removed by dissolving it in a 2.0 m naoh solution to obtain a thin film structure with arrays of nanopillars. for the nanopore substrates, commercial paa discs of 25 mm in diameter with a nanopore size of 200 nm were used. the paa discs were coated with a thin layer of gold (50 nm) in a vacuum evaporator (boc edwards, wilmington ma) to give them the same surface material as the nanopillars. for the two smooth substrates (coated and bare coverslips) 25 mm diameter coverslips coated with a thin layer of gold (50 nm) and noncoated coverslips were prepared to serve as two controls. all the substrates were first sterilized in 95% ethanol for 30 minutes. for promoting cell adhesion on these gold - coated substrates, the top surfaces were coated with a self - assembled monolayer (sam) of cysteamine to provide a thiol group (-sh) for molecular binding to gold surfaces. the thiolized substrates and coverslips were further treated with 0.05% poly - l - lysine (70150 kd) for four hours followed by two 10-min washes in sterile deionized water to promote cell adhesion by ionic bonding. a neuron precursor cell line, rat pheochromocytoma pc12, was used to study neurite development on these substrates. pc12 cells were seeded and cultured on these substrates in triplicates at a seeding density of 5,000 (cells/ cm). two sets of experiments were prepared : one for scanning electron microscope (sem) analysis and the other for fluorescent microscopy (fm) analysis. the reason for the fm analysis in addition to the sem analysis was that it did not entail the dehydration process needed for preparing the cell culture for sem examination. in our early study we observed signs of cell damage caused by this dehydration process. thus, the fm analysis was intended to complement the sem analysis as well as to reveal the development of the structural proteins of actin filaments and microtubules in the developing neurites. since pc12 cells differentiate into sympathetic - neurons when exposed to nerve growth factor (ngf) (greene 1998), their differentiation behavior upon ngf exposure was investigated. louis, mo) supplemented with 10% horse serum (jrh biosciences, lenexa, ks), 5% fetal calf serum (atlanta biological, norcross, ga), and 2% v / v penicillin (sigma - aldrich). 100 ng / ml ngf (alomone laboratories, jerusalem, israel) was added to elicit neurite growth in all cultures. cell cultures were maintained at 37c in a humidified atmosphere of 5% co2/95% air for four days. ngf was added at the time of cell plating and at the 48th hour when the culture medium was changed. for the sem analysis, after four days of culture the cells were fixed in 0.25% glutaraldehyde and 4% formaldehyde. quantitative characterization of neurite development was performed using sem (leo 982 fesem, leo electron microscopy inc., thornwood, ny). to prepare biological specimens for sem analysis, cells on substrates were immersed in 1% osmium tetraoxide (oso4) for 15 minutes, washed in buffered solution, and dehydrated by successive immersion in 10%, 30%, 50%, 70%, 90%, and 100% ethanol for five minutes each. subsequently, cells with substrates were dried in a critical point drier (samdri model 780-a, tousimis research, rockville, md). a thin layer of gold (about 7 nm) was then sputter - coated (structure probe inc. quantitative characterization of the cellular morphology (neurite length and neurite density) for pc12 cells on the gold nanopillars and nanopores as well as on the smooth gold coated and bare coverslips was performed based on the sem images. for the fm analysis, after four days of culture cells were fixed in 3.7% formaldehyde for 30 minutes in the dark and co - stained for f - actin and microtubules specific antibodies. the fixed cells were then washed twice in phosphate buffer solution (pbs) and then treated with a 0.1% triton x-100 in pbs for 10 min (to permeabilize the cell membrane) followed by two pbs washes. the permeabilized cells were then stained for actin with rhodamine phallodin (sigma - aldrich) and -tubulin with anti - tubulin (dm1a, sigma - aldrich) by diluting the antibodies at 1:200 and 1:100 in pbs, respectively. the stained cultures were then swirled to evenly distribute the contents and kept in the dark at room temperature for 20 min (for incubating the antibodies). the cultures were then washed again twice in pbs and the microtubule specific secondary antibody, fluorescein isothiocyanate (fitc) goat anti - mouse antibody (sigma - aldrich) diluted at 1:100 in pbs was added to the cultures. the cultures were swirled and kept in the dark at room temperature for 30 min to incubate the secondary antibody. the stained cells on the substrates were then prepared for fluorescent microscopy analysis by covering them with another coverslip using a 1:1 mounting solution of pbs and glycerol. the cells were examined under an upright fluorescence microscope (zeiss axioskop 40, carl zeiss inc., the stained tubulin and actin were observed using fluorescein (488 nm excitation and 510520 nm emission wavelength) and rhodamine (546 nm excitation and 560580 nm emission wavelength) respectively. quantitative characterization of the neurite morphology (neurite length, and neurite density) for pc12 cells in all experimental groups was performed based on the fm images. for quantitative analysis of cell development, cell density in all experimental setups was enumerated using an areal count method in conjunction with trypan blue (erythrosin b, nigrosin) solution to count viable cells. the number of cells in three randomly chosen microscopic fields (with identical surface area) in each replicate was enumerated for each substrate type using an inverted light microscope (nikon eclipse me600, nikon inc., the neurite length and neurite density (number of neurites per cell) of pc12 cells on all types of substrates were measured. a total of 60 cells were counted in each group (20 from each replicate). manual tracing method was used to measure the neurite length. to do so the length of the scale bar specifying the scale (in microns) of the field - of - view was first measured in millimeters using a ruler and the corresponding conversion factor was determined. then the respective neurite lengths were measured in millimeters and converted back to microns using the calculated conversion factor. neurite lengths were measured from their base along the usually curved neurites to the tips of the leading edge of growth cones. neurite density was counted as the number of neurites extending from a single cell body. for assuring a high cell plating efficiency, prior to these studies, a separate plating efficiency study was performed using the same procedure as described elsewhere (haq 2005). the ratio of the adhered viable cells to the plated cells at 6-h after plating was calculated. the mean plating efficiency was found to be 83.4 6.6%, 85.8 6.1%, 86.9 7.3% and 90.1 7.6% for cells on nanopillars, nanopores, gold - coated coverslips, and bare coverslips, respectively, and there was no significant difference in the plating efficiency between different types of substrates. statistical means and standard errors for the neurite length, neurite density, and cell density were calculated. for both the sem and fm analyses, one - way analysis of variance (anova) was performed to determine the statistical differences between different substrates in terms of neurite length, neurite density and cell density. figure 1 shows two sem images of the nanopillar (figure 1a) and nanopore (figure 1b) substrates. these nanopillars had dimensions of 229 28 nm in diameter, 69 32 nm in spacing and 2123 84 nm in height, and these nanopores had dimensions of 206 42 nm in diameter and 41 17 nm in spacing. figure 2 shows four sem images of pc12 cells cultured on four different types of substrates : figure 2a shows a dense culture of cells on nanopillars with short and few neurites, figure 2b shows cells cultured on nanopores with intermediate length and number of neurites, and figure 2c and figure 2d show cells on gold - coated and bare coverslips with long and multiple neurites. figure 3 shows four sem images at a higher magnification of cells on different types of substrates. in cells on nanopillars (figure 3a) the filopodia tightly clung to the nanopillars, while in cells on the nanopore and smooth substrates (figures 3b3d) the filopodia seemed extended out in a more relaxed manner. figure 4 shows the fluorescent images of the actin and microtubule co - staining in pc12 cells on four different types of substrates. cells cultured on nano - pillars (figure 4a) had short and few neurites per cell, while cells cultured on nanopores (figure 4b) had neurites with intermediate lengths and numbers. cells cultured on gold - coated (figure 4c) and bare coverslips (figure 4d) had long and multiple neurites. also, in cells on nanopillars (figure 4a) more actin - rich stains (indicating the presence of filopodia) were found cluttered at the edges of more rounded cells, while in cells on nanopores (figure 4b) the actin - rich stains were scattered at several extending points of more spread cells. in cells on smooth substrates (figures 4c and 4d), however, the actin - rich stains were present at the leading tips of the developing neurites of fully spread cells. figure 5 depicts the mean cell density obtained by pooling together the measurements from both the sem and fm analyses (note that 18 measurements were used from 3 randomly chosen fields, 3 replicates and 2 analysis types). the mean cell density was 22.6 2.3, 16.3 1.6, 14.3 1.4 and 14.3 1.2 (10-cells / cm) for cells on nanopillars, nanopores, gold - coated and bare coverslips, respectively. cells on nanopillars (# p < 0.05) and nanopores (p < 0.05) had a significantly higher cell density than cells on smooth substrates. cells on nanopores (< 0.05) had a significantly lower cell density than cells on nanopillars. there was no significant difference in cell density between cells on gold coated and bare coverslips. figure 6 shows the measured mean neurite length in the sem analysis : 14.5 2.8 m, 33.2 5.0 m, 46.3 2.5 m, and 47.4 4.3 m for cells on nanopillars, nanopores, gold - coated and bare coverslips, respectively. the mean neurite lengths measured in the fm analysis were not significantly different from their sem counterparts. in both the sem and fm analyses, cells on nanopillars (# p < 0.05) and nanopores (p < 0.05) had significantly shorter neurites than cells on smooth coverslips, cells on nanopores (< 0.05) had significantly longer neurites than cells on nanopillars, and there was no significant difference in the mean neuirte length between the cells on gold - coated and bare coverslips. figure 7 shows that the mean neurite density in the sem analysis was 2.3 0.1, 3.8 0.2, 4.3 0.1 and 4.4 0.1 (neurites / cell) for cells on nanopillars, nanopores, gold - coated and bare coverslips, respectively. the mean neurite densities measured in the fm analysis were not significantly different from their sem counterparts. again, in both the sem and fm analyses, cells on nanopillars (# p < 0.05) and nanopores (p < 0.05) had significantly fewer neurites per cell than cells on smooth coverslips, cells on nanopores (< 0.05) had significantly more neurites per cell than cells on nanopillars, and there was no significant difference in the number of neurites per cell between the cells on gold - coated coverslips and bare coverslips. in this study, we investigated the effect of nanopillars and nanopores with dimensions comparable with but slightly larger than that of filopodia on neurite extension in pc12 cells. cells cultured under the identical culturing condition on different types of substrates exhibited different cell development. on nanopillars, cells had a higher density and shorter neurite extension, while on nanopores cells had a lower density and intermediate neurite extension. as discussed previously (haq 2005), the outgrowth of neurites is the result of differentiation activity and the increase in cell counts proliferation activity, thus it is logical to see that the highly populated cells developed shorter neurites. it is unlikely, however, that the less neurite outgrowth in these cells is attributed to the fact that short neurites are required to establish cell - cell contacts because all the cells on nanopillar substrates behaved the same no matter how far they land from their neighbors. thus the obtained result indicates that the nanopillars with slightly larger diameters and separations than that of filopodia restricted the mobility of filopodia and growth cones, which is necessary for guiding the neurite outgrowth. a recent study by arnold and colleagues (2004) showed that the spacing between the nanodots (< 8 nm in diameter) coated with cyclic rgdfk peptide for promoting molecular binding influenced the integrin activation for cell spreading and adhesion. a separation greater than 73 nm between the binding nanodots resulted in limited cell spreading and attachment, and reduced the formation of focal adhesion and actin stress - fibers in various cells including mc3t3, ref52, and 3t3 fibroblasts. for achieving good cell adhesion, it seemed necessary to have a cluster of bound integrins that are spaced no more than 58 nm in between the binding sites. these findings may explain why cells were not well spread on nanopillar substrates having a spacing of about 70 nm in between nanopillars. the nanopore substrates did not seem to pose the same restriction as did the nanopillars to the mobility of the filo - podia and growth cones, thus an intermediate level of neurite extension was observed. this result may be attributed to the connected ridge network of the underlying substrates that permit the formation of integrin clustering and binding at desired distances. a similar trend was observed in neurite extension in cells on different types of substrates when comparing between the sem and fm analyses. by contrast, cells on the gold - coated and bare coverslips develope d numerous and long extended neurites. the difference in neurite extension seen in cells cultured on smooth and nanostructured substrates is clearly a sign that nanoscale topographic features influenced the neurite outgrowth activities. under the same culturing condition, while cells on smooth substrates showed extensive neurite outgrowth, cells on nanopillars or nanopores had inhibited or limited neurite outgrowth. we believe that in the case of nanopillars the void - spaces between the vertically aligned nanopillars may be responsible for causing difficulty to the mobility of filopodia and growth cones for guiding neurite outgrowth, while in the case of nanopores the connected ridges still provide some support, albeit limited, for the movement of the filopodia and growth cones. others have also reported that neuronal cells cultured on nano - structured substrates showed different cell morphology and neurite development as compared with smooth substrates. with pc12 cells cultured on ridges with widths in the nanoscale (70 nm to 1900 nm), foley and the grooves and ridges constrained the number of neurites that the cells could extend, thus leading to a bipolar rather than branching phenotype typical of these cells when cultured on flat surfaces. nanostructured substrates such as nanopillars and nanopores with dimensions comparable with but slightly larger than that of filopodia inhibited or limited neurite outgrowth in pc12 cells when compared with smooth substrates. these findings may suggest the use of substrates with nanoscale features for controlling neurite development in neuronal cells. | we investigated the effect of nanoscale topography on neurite development in pheochromocytoma (pc12 cells) by culturing the cells on substrates having nanoscale pillars and pores with sizes comparable with filipodia. we found that cells on nanopillars and nanopores developed fewer and shorter neurites than cells on smooth substrates, and that cells on nanopores developed more and longer neurites than cells on nanopillars. these results suggest that pc12 cells were spatially aware of the difference in the nanoscale structures of the underlying substrates and responded differently in their neurite extension. this finding points to the possibility of using nanoscale topographic features to control neurite development in neurons. |
surgery, which is performed by a specialist in gynecologic oncology, is the preferred treatment method. for patients with advanced disease, chemotherapy, which depends on the histology of the tumor, after surgery has been a general standard of care for ovarian cancer for decades. external radiotherapy is not considered to be an effective treatment for ovarian cancer because of its low radiosensitivity. brachytherapy with high dosage to target volume and restriction of normal tissue exposure may play a meaningful role in the treatment of ovarian cancer and its metastases. it provides advantages over external beam radiation therapy : the tumor can be treated with very high doses of localized radiation, while reducing the probability of unnecessary damage to surrounding healthy tissues [4, 5 ]. in this context, we propose a technique using high - dose - rate (hdr) interstitial brachytherapy to treat abdominal wall metastases of ovarian cancer. we encountered a 44-year - old patient with abdominal wall metastases from ovarian cancer complaining of pain in the lower abdomen. six months before being admitted to our clinic, she was diagnosed with ovarian cancer (stage ia), and received radical surgery on march 18 2014. the pathology result after surgery was serous papillary adenocarcinoma of the left ovary with no lymphovascular, nerve or omentum involvement. taking into account general state, pathological examination, stage of the disease, and medical history, the patient qualified for adjuvant chemotherapy. chemotherapy with 175 mg / m of paclitaxel and 400 mg / m of carboplatin was immediately started and continued at the same dosage in the 2 cycle. after 1 month, the patient noticed a dull pain in the lower abdomen. ultrasound examination in june 2014 revealed a mass (4.2 2.7 4.2 cm) located in the subcutaneous tissue of the lower abdomen, below the surgical incision. a diagnostic biopsy, prompted by immunohistochemical markers, revealed a metastatic malignant tumor (originating from the ovary). the patient therefore underwent initial radiotherapy by external beam : a total of 39.6 gy in 1.8 gy fractions for the tumor area (see fig., the tumor size had decreased to 2.2 1.5 2.5 cm according to the pelvic mri examination. the symptoms in the patient 's lower abdomen, however, were not markedly relieved. dose distribution in the external radiotherapy plan high - dose - rate interstitial brachytherapy, following external radiotherapy within one week, with a total dose of 18 gy in 6 fractions over 3 days (3 gy each fraction, twice a day with a 6 h interval) was administered to the patient. oncosmart proguide needles (nucletron, an elekta company, elekta ab, stockholm, sweden) were used and the treatment was performed under anesthesia. electrocardiogram, arterial oxygen pressure, respiration, and blood pressure monitoring were performed during the procedure. four applicator needles (1.1 mm in external diameter and 20 cm in length) were inserted into the target under ultrasound guidance, with an interval of 1 cm to ensure adequate dose distribution and target volume coverage (see fig. 2 and 3). oncosmart proguide ct - markers were put inside the catheters in order to facilitate their reconstruction. after implanting the applicators, fine - pitch (2 mm) x - ray ct images were acquired and transferred to the treatment planning computer (see fig. the ct - imaging data combined with the mr before interstitial brachytherapy were used to contour the gross target volume (gtv) and the clinical target volume (ctv). the ctv was expanded from gtv by 2.0 cm and restricted by the volume of the critical organs (especially the small intestine) (see fig. a ct - based treatment plan was created using a graphic optimization tool (treatment planning system oncentra v4.3, nucletron, an elekta company, elekta ab, stockholm, sweden). four applicator needles were inserted into the target under ultrasound guidance the ultrasound images of inserting applicator needles the position of each applicator needle on ct images the target contour of interstitial brachytherapy based ct and mr fusion dose volume histogram (dvh) parameters are recommended for the evaluation of target volume and organs at risk (oars). the dose distribution to target volume and oars are shown in figure 6a. in the brachytherapy plan, 18 gy was prescribed to 100% of the target volume, and d2cc (minimum dose to the most irradiated volume of 2 ml) of the small intestine was mainly considered. in the external radiotherapy plan, 39.6 gy in 1.8 gy per fraction was prescribed to the target. the equivalent dose for a 2 gy fraction schedule was calculated using the eqd2 model, at / = 3 (gyeqd2, / = 3) for the small intestine and / = 10 (gyeqd2, / = 10) for the target [6, 7 ]. dose volume histogram parameters were analyzed taking into account the volume ratio of the target receiving 90% or 150% of the prescription dose (v90% [v2.7 gy ] and v150% [v4.5 gy ], respectively), the equivalent dose delivered to 98% and 50% of the clinical target volume (d98% and d50% respectively), and the volume ratio of the small intestine receiving 25 gy, 35 gy and 45 gy of the equivalent dose (v(25gyeqd2), v(35gyeqd2) and v(45gyeqd2) respectively). the following values were accepted : below v90% was 5.6%, v150% was 63.2% ; d98% was 54.5 gy, d50% was 120.4 gy ; v(25gyeqd2) was 0.9%, v(35gyeqd2) was 1.1%, v(45gyeqd2) was 1.3% ; d0.1cc of the small intestine was 33.6 gyeqd2, / = 3, d1cc was 24.7 gyeqd2, / = 3 and d2cc was 21.3 gyeqd2, / = 3. it shows the high dose distribution of gtv and ctv and low dose distribution of small intestines. b - d) the dose distribution of horizontal, sagittal + coronal positions. the red line shows the position of v100 covering gtv completely. just a small part of v50 (showed by blue line) covered the small intestines after transporting the planning data to an iridium-192 remote afterloader system (microselectron hdr ir-192, nucletron, an elekta company, elekta ab, stockholm, sweden), irradiation was started. the irradiation took approximately 5 min, as shown in (figure 6b, c and d). the needles were removed after irradiation was complete, and the patient was discharged after 2 h under observation. no complications were reported during the treatment and the brachytherapy was well tolerated by the patient. during the follow - up examination in the 3 week after brachytherapy, remission of the metastatic cancer was observed. (2 months after therapy), only radiation - induced skin injury (rtog, grade 1) was observed. according to the recent follow - up over 5 months after therapy, there were no signs or symptoms of abdominal complications and no evidence of recurrence at the site of re - irradiation. the mr of abdominal wall (a, b) before, and (c, d) 3 weeks after brachytherapy generally, external radiotherapy is not a conventional treatment for ovarian cancer patients after surgery, because of the lower radiosensitivity of this tumor. it is rare to see abdominal wall metastases present at such an early stage as in the present case. however, information on previous studies on the use of interstitial brachytherapy for ovarian cancer patients has not been reported. kishi., administered interstitial brachytherapy for abdominal wall metastases of colorectal cancer. although the common pathology result for colorectal cancer is adenocarcinoma and its radiosensitivity is not high, the effect after the interstitial brachytherapy was acceptable. in order to control the residual tumor, interstitial brachytherapy the dvh showed that gtv was covered with high dose irradiation but the dosage to the small intestines was relative low. hdr interstitial brachytherapy provided a superior therapeutic ratio compared with external radiotherapy, and enabled curative dose treatment with prominent therapeutic enhancement. interstitial brachytherapy is a safe and practical supplementary method on top of external beam radiotherapy. it is well tolerated by patients because of the high dose delivered to the tumor and the simultaneous effective protection to the normal organs. interstitial brachytherapy may be a proposed scheme to treat inoperable superficial metastases, especially for low radiosensitivity cancer. it is important to pay careful attention to critical organ protection during implementation of interstitial brachytherapy and an individual approach is needed in every patient. | purposeto report the treatment effect of interstitial brachytherapy for abdominal wall metastases of ovarian cancer.material and methodsthe patient is a 44-year - old female with a diagnosis of stage ia ovarian cancer. after surgery and two cycles of chemotherapy with paclitaxel and carboplatin, the patient noticed dull pain in the lower abdomen and found a mass located in the subcutaneous tissue, below the operative incision. a diagnostic biopsy showed abdominal wall metastases. after external radiotherapy with a dose of 39.6 gy in 22 fractions, the residual tumor was treated with interstitial brachytherapy under ultrasound guidance. the brachytherapy dose was 18 gy in 6 fractions of 3 gy each.resultsafter 3 weeks of brachytherapy, the tumor had disappeared completely. interstitial brachytherapy was feasible.conclusionsinterstitial brachytherapy may be a proposed treatment strategy for inoperable superficial metastases, especially for low radiosensitivity cancer. |
the reproductive development of alligators from a contaminated and a control lake in central florida was examined. lake apopka is adjacent to an epa superfund site, listed due to an extensive spill of dicofol and ddt or its metabolites. these compounds can act as estrogens. contaminants in the lake also have been derived from extensive agricultural activities around the lake that continue today and a sewage treatment facility associated with the city of winter garden, florida. we examined the hypothesis that an estrogenic contaminant has caused the current failure in recruitment of alligators on lake apopka. supporting data include the following : at 6 months of age, female alligators from lake apopka had plasma estradiol-17 beta concentrations almost two times greater than normal females from the control lake, lake woodruff. the apopka females exhibited abnormal ovarian morphology with large numbers of polyovular follicles and polynuclear oocytes. male juvenile alligators had significantly depressed plasma testosterone concentrations comparable to levels observed in normal lake woodruff females but more than three times lower than normal lake woodruff males. additionally, males from lake apopka had poorly organized testes and abnormally small phalli. the differences between lakes and sexes in plasma hormone concentrations of juvenile alligators remain even after stimulation with luteinizing hormone. our data suggest that the gonads of juveniles from lake apopka have been permanently modified in ovo, so that normal steroidogenesis is not possible, and thus normal sexual maturation is unlikely.imagesp680-afigure 1.figure 2.figure 3. afigure 3. bfigure 3. cfigure 4. afigure 4. bfigure 4. cfigure 4. dfigure 5. afigure 5. bfigure 5. c |
|
subcutaneous implantable cardioverter - defibrillator (s - icd) is a novel treatment modality to prevent sudden cardiac death that does not require lead implantation in or on the heart. s - icd automatically analyzes optimal sensing vectors, and the optimal sensing vector is usually selected based on this analysis. this analysis is usually performed in the supine position at rest. in patients with brugada syndrome (brs), icd is the main treatment modality to prevent sudden cardiac death, and s - icd is a therapeutic option designed to avoid complications related to the transvenous system. however, the brs - pattern electrocardiogram (ecg) is known to show dynamic changes, and evaluation of ecgs after s - icd implantation in patients with brs should be undertaken in various situations. moreover, little is known about the method of selection of the optimal sensing vector in patients with brs based only on the automatic analysis of the s - icd at rest. here, we report the case of a patient with brs who experienced inappropriate shock (ias) due to t - wave oversensing (twos) during exercise. a 51-year - old man with brs was referred to our hospital to be evaluated for indications for icd. he exhibited a spontaneous type 1 baseline ecg and had a family history of sudden cardiac death. s - icd (emblem, boston scientific, marlborough, massachusetts) was successfully implanted in the standard position using a standard technique (fig. 1a), and the secondary vector was selected as the optimal sensing vector based on automatic s - icd analysis at rest. the patient experienced a strong impact during exercise 30 days after the s - icd implantation. the secondary vector was still acceptable as the optimal sensing vector, again based on automatic re - analysis by the s - icd at that time. he therefore underwent an exercise test to confirm whether the secondary vector was appropriate. during exercise, 1b), and twos was observed in the primary and secondary vectors on the cardiac signals of the s - icd (fig. 2d), which was then selected as the optimal sensing vector of s - icd instead of the secondary vector. after changing the sensing vector, this is the first report of ias due to twos in a japanese patient with brs after s - icd implantation. a previous registry revealed that the incidence of ias with s - icd was 13.1% at 3 years after implantation. the most common cause of ias was oversensing of the cardiac signal, such as twos, apart from heart rate increase due to supraventricular tachycardia in the shock zone. a recent report showed that patients exhibiting an st segment change during exercise, including patients with hypertrophic cardiomyopathy, were at risk for twos. brs ecg patterns show dynamic changes that affect the qrs complex and st segment amplitude and morphology. a recent report showed that the acceptable sensing vector in s - icd could be changed by injecting ajmaline. ecg changes in brs occur not only due to drugs but also during exercise ; therefore, specific attention to twos is needed in this population. while s - icd is a therapeutic option for patients with brs, it is important to pay close attention to the selection of the optimal sensing vector in s - icd. furthermore, if all sensing vectors are not available, we can not use s - icd appropriately. in that case, we have to change the lead location or extract the s - icd system and implant transvenous icd. from this point of view, it is still important to adequately evaluate the acceptability of the sensing vector in s - icd before implantation. exercise testing shortly after s - icd implantation should be considered for patients with brs to evaluate the acceptability of the sensing vector in s - icd. | we report the case of a 51-year - old patient with brugada syndrome (brs) who experienced inappropriate shock due to t - wave oversensing (twos) during exercise when the optimal sensing vector was selected based on the automatic analysis by a subcutaneous implantable cardioverter - defibrillator (s - icd). after selecting another vector during exercise testing, twos did not re - occur. selection of appropriate sensing vector based on analyses under various conditions, including during exercise after s - icd implantation, should be considered for patients with brs. |
compartment syndrome of the thigh is an orthopedic emergency whereby increased pressure within a closed osseofascial compartment compromises the circulation, leading to cellular anoxia, muscle ischemia, and death. if compartment syndrome is not recognized or decompressive fasciotomy is delayed, complications such as ischemic contracture, neurologic deficit, infection, and crush syndrome can occur. hence thigh compartment syndrome can be both limb threatening and life threatening, and necessitates prompt management. furthermore, because of the large and compliant thigh compartment, presentation of compartment syndrome of the thigh can potentially be delayed. we present the rare case of an athlete who sustained delayed compartment syndrome of the thigh following a soccer injury. a 30-year - old man presented with a severe right distal thigh pain and knee swelling of 4 days duration. he had sustained a direct blow to the right thigh during a soccer game, after which he was able to stand and ambulate. he received no medical attention, and continued playing for 1 h. he had no significant medical history and was not taking any anticoagulant medication. on examination there was mild knee effusion, tenderness was elicited over the superolateral aspect of the patella, and active knee range of motion measured 0140. the thigh compartment was soft. magnetic resonance imaging (mri) of the right knee identified only a partial musculotendinous junction tear of the distal fibers of the vastus lateralis muscle. however, 4 days later and without further trauma, the patient experienced severe constant pain in his right thigh. he recalled that the pain had acutely worsened and was not relieved by analgesia on the day prior to admission. he was unable to ambulate on the affected leg, and denied any paresthesia. at presentation the circumference of the right thigh was 8 cm larger than that of the left. an urgent mri of the right thigh was performed, which showed a large 11.7 7.6 6.9-cm hematoma within the swollen vastus intermedius muscle with significant surrounding mass effect, and a high - grade tear of the distal half of the posterior fibers of the vastus lateralis muscle (fig. 2). computed tomographic (ct) angiography of the lower extremity did not demonstrate active contrast extravasation in the arterial and venous phases. the patient was taken to the operating room for an emergency fasciotomy using a single lateral thigh incision. the vastus lateralis bulge through the wound and the muscle appeared swollen and contused distally (fig. 3). otherwise, the vastus lateralis was viable and reactive. through the same incision the medial and posterior compartments were evaluated, and were soft and compliant on palpation. the profunda femoris vein was found to be partially ruptured, and was repaired with prolene interrupted suture. fourteen days later, once the swelling in the thigh had reduced, the wound was covered by a split - skin graft. at 2-years follow - up the patient had recovered fully, with no limitation of joint movements or quadriceps weakness. richard von volkmann first described compartment syndrome in 1881, reporting clinical findings of muscle contracture caused by prolonged muscle ischemia after forearm and supracondylar humeral fractures in children. in general, compartment syndrome is uncommon in the absence of fracture. in the thigh, compartment syndrome is often observed in nonfracture conditions such as gunshot wounds, multiple - trauma accidents, prolonged external compression, lower limb revascularization syndrome, and intramedullary nailing of a closed femur fracture. it is noteworthy that the leading cause of thigh compartment syndrome is sporting injury, which represents the most severe spectrum of quadriceps injury. the diagnosis of thigh compartment syndrome in the absence of fracture is often not considered because of a lack of awareness and inexperience. as a result, the time interval for delayed fasciotomy has been reported to be up to 34 h. to the best of our knowledge, this is the only reported case of delayed presentation of thigh compartment syndrome following quadriceps muscle contusion and hematoma formation secondary to rupture of the profunda femoris vein. our case also highlights additional issues not covered in previous studies : (1) the response of thigh musculature to blunt trauma ; and (2) vascular injury and the role of vascular study in evaluating thigh hematoma. the quadriceps muscle is commonly injured in sports because of its vulnerable location anterior to the femur. in 1983, walton. the vastus intermedius, which is attached to the bone, compressed firmly against the femur and sustained the most tissue damage. the lateral forces generated lead to blow - out tear in the posterior aspect of the vastus lateralis, and the superficial muscle layer is spared from injury. our patient sustained blunt trauma to the thigh that resulted in vastus lateralis tear and severe contusion of the vastus intermedius, which progressively swell up over time and lead to thigh compartment syndrome. to our knowledge, only a few cases of thigh compartment syndrome was related to vascular injury, which include common femoral artery dissection, perforating arterial vessels rupture and pseudoaneurysm involving the descending branch of the lateral circumflex femoral artery [3,79 ]. our case described rupture of the profunda femoris vein after blunt trauma to the quadriceps muscle. unfortunately vascular examination might not be reliable to identify either the major artery or vein injury. alternatively, ct angiography of the lower extremity has high diagnostic accuracy in arterial injury after trauma, although it can miss a venous injury, as demonstrated in our case. we emphasize the importance of evaluating for venous injury at the time of surgical exploration when there is high index of suspicion for vascular injury and the ct angiogram is normal. we agree with the recommendation by rooser. that athletes who sustain blunt thigh trauma should stop ongoing activity for at least 1 week even if the primary injury is of moderate degree. persistent muscle activity increases blood flow, further raising the compartmental volume and aggravating intramuscular bleeding. the fibrinolytic activity in the hematoma could also promote persistent bleeding and hematoma expansion, and may explain the delayed presentation observed in our patient. we suggest serial examination of thigh circumference to monitor progression as hematoma may enlarge and compartment syndrome may present after some delay. most athletes will suffer thigh contusion of varying degrees from sporting trauma, and conservative management is often adequate. vascular examination and continual surveillance should be conducted for patients at high risk of delayed compartment syndrome. mri findings of deep thigh muscle swelling and blow - out tear of the vastus lateralis are strongly suggestive of severe quadriceps injury, and may be a harbinger of delayed thigh compartment syndrome. a copy of the written consent is available for review by the editor - in - chief of this journal on request. group 1 - conception and design, acquisition of data, analysis and interpretation of data. | highlightsour case the difficulty of differentiating severe quadriceps contusion from thigh compartment syndrome.we ed the response of thigh musculature to blunt trauma.clinicians should be aware of vascular injury as a cause of thigh compartment syndrome in sports trauma. vascular examination is warranted in all cases of quadriceps injury.mri findings of deep thigh muscle swelling and blow - out tear of the vastus lateralis are strongly suggestive of severe quadriceps injury, and may be a harbinger of delayed thigh compartment syndrome. |
free radicals, resulting from electron transfer, are often observed in living biological systems to give rise to many important, functional processes. nucleic acids and their building blocks are involved in the pathological damage of dna due to electron removal from dna bases. this makes the characterization of the radicals and the study of their reactions with nucleotides extremely important. unfortunately, optical techniques often suffer from insufficient spectral resolution and do not allow unambiguous identification of the radical intermediates of purine nucleotides, while their direct epr detection under physiological conditions is usually problematical because of very short lifetimes of such radicals. most of the observations of the radicals derived from purine bases are performed by epr techniques at low temperatures. we found only limited examples of the detection of radicals derived from purines in solution by means of epr. in order to study the chemical reactivity of two purine nucleotides, adenosine-5-monophosphate (amp) and guanosine-5-monophosphate (gmp), toward 3,3,4,4-benzophenone tetracarboxylic acid (tcbp) in the triplet - excited state in aqueous solutions of different ph at room temperature and to provide further information on the acid base properties of radical intermediates observed in the photo - oxidation reactions of purines in aqueous solution, we have combined two techniques, namely the time - resolved laser flash photolysis (lfp) and the cidnp is the name given to the nonequilibrium nuclear spin state populations produced in chemical reactions that involve radical pair intermediates. the cidnp, detected as enhanced absorptive or emissive signals in the nmr spectra of reaction products, has been exploited for more than the last 40 years to characterize transient free radicals and their reaction mechanisms. this paper reports the results of studying the photoinduced oxidation of gmp and amp with the expectation that the information obtained will provide a basis for understanding reactions associated with electron removal from compounds of this important class. 3,3,4,4-benzophenone tetracarboxylic acid, dcl, naod (30% solution in d2o), and d2o were purchased from sigma - aldrich and were used as received. pka values of amp and gmp phosphoric groups were determined by chemical shift titration. the samples, placed in a rectangular quartz cuvette (1 1 cm), were irradiated by the pulses of a lambda physik lpx-120 xecl excimer laser (308 nm, pulse energy up to 100 mj). monitoring was performed using a 150 w xenon lamp, a hamamatsu r928 photomultiplier tube, an obb / pti monochromator model 101/102, and a digital storage oscilloscope 9410a lecroy interfaced to a pc. in lfp measurements, the concentration of tcbp was 1 10 m, allowing us to avoid the samples were prepared in buffered aqueous solutions at room temperature and purged with argon for 15 min prior to irradiation. the buffer solutions with a concentration of 0.01 m were prepared in doubly distilled h2o with (a) hcl kh2po4, ph = 3.05.0 ; (b) kh2po4na2hpo4, ph = 5.09.0 ; (c) na2hpo4naoh, ph = 9.011.0. ph 11 were adjusted with hcl and naoh, respectively. the samples purged with pure nitrogen gas and sealed in a standard nmr pyrex ampule were irradiated by the pulses of a compex lambda physik xecl excimer laser (wavelength 308 nm, output pulse energy up to 150 mj) in the probe of a 200 mhz bruker dpx-200 nmr spectrometer (magnetic field 4.7 t, resonance frequency of protons 200 mhz). light to the sample was guided using the optical system containing a spherical lens, prism, and light - guide glass fiber (diameter 5 mm). the tr - cidnp spectra were obtained in the following way : the saturation pulses of the broadband homonuclear decoupler the laser pulse triggered by the spectrometer a detecting radio frequency (rf) pulse of 1 s duration. as the background signals from boltzmann polarization were suppressed by saturation pulses, in the cidnp spectra, only the nmr signals from the polarized products of the cyclic photochemical reaction appear. the acidity of nmr samples was varied using small amounts of dcl or naod. as, in this case, the h2o calibrated ph - meter was used to measure ph in d2o solutions, the ph readings correspond to the so - called ph values. thus, the nmr and tr - cidnp data were obtained from pka values rather than from normal pka according to the formula pka = 0.929pka + 0.42. the concentration of tcbp used in cidnp experiments was 2 10 m. it was chosen to avoid sample depletion under laser irradiation. the concentrations of quenchers amounted to 10.0 10 m (gmp, ado), and to 20.0 10 m (amp), respectively. the structures and abbreviations of the compounds used in this work are listed in table 1. the abbreviations gh, g, and g(h) denote the cationic, neutral, and anionic forms of the gmp guanyl moiety, ah and a denote the cationic and neutral forms of the adenyl moiety of either amp or ado, and (hpo4) and (po4) are used to discriminate between the two protonation states of the nucleotide phosphoric group. the ph dependent protonation states of reactive species together with the acidity constants employed in calculations are listed in tables 2 and 1, correspondingly. the equilibrium concentrations of the protonation forms of tcbp were calculated using two mean ground - state acidity constants pka1 = 2.9 and pka2 = 4.9 for h2o, and pka1=2.7 and pka2=4.8 for d2o. the absorption of gmp and amp at 308 nm with the concentrations chosen is much smaller than that of tcbp. thus, after the irradiation of a solution containing tcbp, and gmp or amp, tcbp triplets are generated first, and then quenching occurs. wavelengths of 590 nm (ph pka2 = 4.9) were taken to measure the decay of triplet tcbp. under these conditions, the triplet - excited dye exhibits absorption maxima. since the concentration of tcbp is low (1 10 m) and the triplet triplet annihilation is negligible, the triplet - excited tcbp decay in the absence of a quencher follows the first - order kinetics with kd = (5.58) 10 s. in the presence of a quencher, the reaction between the triplet tcbp and the quencher occurs with the pseudo - first - order rate constant kobs proportional to the concentration of the quencher, [q ] ; k = kq[q ], where kq is a quenching rate constant. transient absorption decays of tcbp with an increase in concentration of gmp and the corresponding stern volmer relation are shown in figure 1a. the ph dependences of the quenching rate constant kq for gmp and amp are presented in figure 1b. (a) transient absorption decays (obs = 550 nm) of triplet tcbp (1 10 m) in the presence of gmp (concentration increasing from bottom to top : 0 to 6.7 10 m) in water at ph = 6.8. (b) ph dependences of the observed quenching rate constant for the reaction of triplet tcbp with gmp (squares) and amp (circles). as seen from figure 1b, the observed ph dependences can be divided into several regions with boundaries at the corresponding pka values of the starting compounds that determine the nature of the reacting species. in the ph region selected, each pair of reagents, tcbp in the triplet - excited state and the quencher, is characterized by a quenching rate constant (kqi). the observed quenching rate constant kq is calculated as the sum of kqi, multiplied by the molar fractions of the dye and the quencher. the molar fractions of the reagents are determined by the ph value of the aqueous solution and by the pka values of reactants. the first protonation state of the gmp guanyl moiety is characterized by the acidity constant pka1 = 2.4. the measurements were carried out at ph > 2, and the observed quenching rate constant was ph - independent up to ph 3.5 within experimental accuracy. so, we were unable to discriminate between all possible reactant pairs in the acidic region (tcbph4 and gh, tcbph4 and g, tcbph2 and gh, tcbph2 and g). surprisingly, for amp, we have failed to simulate the ph dependence of the observed quenching rate constant taking into account the pka values of the adenyl moiety only ; account should be taken of the second pka value of the amp phosphoric group (pka = 6.5). in the case of gmp, there was no need to consider the protonation state of the phosphoric group in our simulations of lfp and cidnp data. thus, the ph dependences of the observed quenching rate constant (kq) were simulated according to eqs 1 (for gmp) and 2 (for amp). the kqi values obtained by the best fits (solid lines, figure 1b) are shown in table 2 together with the corresponding pairs of reactants.12 the change of quenching rate constant caused by deprotonation of either gh or tcbph4 does not exceed experimental error. the abbreviation ah(hpo4) means that the amp adenyl moiety is charged positively and the amp phosphoric group is charged negatively ; in a(hpo4) the adenyl moiety is neutral and the phosphoric group is charged negatively ; a(po4) denotes that the adenyl moiety is neutral and the phosphoric group is doubly negatively charged, i.e., fully deprotonated. data taken from ref (18). in acidic solutions, gmp and amp quench the triplet - excited tcbp with kqi = 1.3 10 and kqi = 1.2 10 m s, respectively, which is close to the diffusion - controlled limit. deprotonating tcbph4 (pka = 2.8) to form tcbph2 has no significant effect on the quenching rate. the first steep decrease of kq in the reaction of tcbp triplets with gmp is due to the deprotonation of tcbph2 into tcbp (pka = 4.9). the second change is characterized by the deprotonation of a guanyl base (pka = 9.4). the deprotonation of tcbph4 and tcbph2 has no noticeable effect on the reaction rate of triplet - excited tcbp quenching by amp. in contrast to the case of gmp, the deprotonation of the phosphoric group (pka = 6.5) decreases the quenching reaction rate constant by a factor of 5. compared to the photoreaction between the triplet - excited tcbp and ado studied in ref (18), one can see that the presence of the negatively charged phosphoric group reduces the quenching rate constant kq 46 times over the entire ph range. although adenosine is generally considered less reactive than guanosine (as guanosine has a lower reduction potential), our results indicate that amp is readily oxidized by tcbp within the ph range from 2 to 12. moreover, amp is about three times more reactive than gmp at 4.0 9.4. since the epr technique is not usually applicable for low concentrations and for short lifetimes of the radicals under study in aqueous solution at room temperature, the adenosyl and guanosyl radicals could be detected in solutions by transient optical spectroscopy. however, using optical detection it is difficult to distinguish the cationic, neutral, or anionic forms of nucleotide radicals due to the overlapping of the transient optical spectra of the different protonation forms of these radicals. therefore, we used the tr - cidnp technique to characterize radical intermediates resulting from the quenching of the triplet - excited tcbp by purine nucleotides adenosine-5-monophosphate and guanosine-5-monophosphate and also by nucleoside adenosine (ado) to confirm the influence of the protonation state of the phosphoric group on the quenching rate constant. the characterization of radical intermediates is of essence with respect to the quenching mechanism, which is unavailable from the lfp data. the quenching of the triplet - excited tcbp by gmp or amp (ado) results in the formation of a spin - correlated radical pair in the triplet state. singlet conversion of the radical pair caused by magnetic interactions in the pair enables back - electron or hydrogen transfer, leading to the restoration of polarized initial compounds. the tr - cidnp experimental facility can be used to detect the so - called geminate cidnp arising at the nanosecond time scale in geminate products. the magnetic resonance parameters of the geminate radical pair are encoded in both the amplitude and the phase of geminate cidnp signals. the structure of the adenosyl and guanosyl radicals formed in the quenching reaction strongly depends on the ph of the aqueous solution (chart 1). in the present paper, the symbols g and a, respectively, denote the cations of guanosyl and adenosyl radicals, g(h) and a(h) for the neutral forms of these radicals, and g(2h) for guanosine radical anion. these notations refer only to the protonation state of the purine base and do not include the protonation state of the phosphoric group. the cidnp spectra detected in the photoreaction between tcbp and the quencher (gmp or amp) immediately after the laser pulse at different ph values are shown in figure 2. the amplitude and the sign of geminate polarization are observed to change with varying ph. the net cidnp sign,, is determined in terms of simple cidnp rules, i.e., = sgn(g) sgn(a) for the geminate recombination product and for the radical pair triplet precursor. in this case, g = g1 g2 is the difference in the radical g - factors of the radical pair, and a is a hyperfine coupling constant (hfcc) for the nucleus concerned. figures 35 show the behavior of both the geminate polarization tcbp and the quenchers gmp (figure 3), amp (figure 4), and ado (figure 5). the vertical scaling factors were chosen so that the maximum of the calculated cidnp value for the tcbp h6 proton in each calculated curve was equal to unity. in the gmp cidnp spectra only the h8 proton is polarized. the polarization of the gmp h8 proton was negative (emission) under acidic conditions and in the extremely basic solution (ph > 13), and positive (enhanced absorption) in neutral and basic solutions. the hfcc sign reported for the h8 proton of the cationic, neutral and anionic guanosyl radicals is negative. in aqueous glass, at 77 k the g - factors of the guanosyl radicals were measured to be 2.0037 (guanosyl radical cation), 2.0034 (guanosyl neutral radical), and 2.0036 (guanosyl anion radical). the g - factor of the tcbp radical anion is 2.0035. it is concluded then that the polarization sign inversion with varying ph is due to the change of the sign of g - factor difference in the dye and guanosyl radical pairs. the polarization signs correspond to the guanosyl radical cation g at ph 13) (chart 1). in our previous work, 2,2-dipyridyl was used as a dye (g = 2.0030 for the neutral radical dipyridyl). the deprotonation of the guanosyl radical cation caused no changes in the sign of the g - factors difference and thus no inversion of the cidnp sign. one more guanosyl radical mentioned in the literature is the dication radical gh. the data on the g - factor and hfccs of this radical are unavailable. in our measurements, we were able to differentiate radical cations and dications because they were involved in a degenerate electron exchange reaction with a parent molecule (guanosine cation for radical dication, and neutral guanosine for radical cation). this reaction proceeds with different efficiency for the two pairs of participants, gh / gh and g / g, which is reflected in cidnp kinetics. in the present study, simulating the cidnp ph, we have taken into account the gmp radical dication and cation (vide supra) with a corresponding pka = 2.1 ; otherwise, it would be impossible to obtain good agreement between experiment and the simulation of cidnp the ph dependence for tcbp (dashed line in figure 3). for adenosine, the two radicals are known, i.e., the neutral one and the radical cation (chart 1). the g - factor for the adenosyl radical cation in aqueous glass at 77 k is 2.0034, and that for the adenosyl neutral radical is 2.0037. the radical cation a has negative hfccs for the h8 and h2 protons ; the neutral radical a(-h) has negative hfcc for the h8 proton and the positive one for the h2 proton. the polarization of the amp h8 proton was positive (enhanced absorption) under acidic conditions and negative (emission) in neutral and basic solutions. the polarization sign of the amp h2 proton remains positive over the entire ph range. these observations are consistent with cidnp originating from the reactions between the dye radical and the radical cation a at ph 4 ; the deprotonation of the gmp phosphoric group (pka = 6.5) has no effect on the titration curve behavior ; a decrease in cidnp intensity in basic solution is related to the deprotonation of the guanosyl moiety (pka = 9.7). the decrease in cidnp intensity for both gmp and tcbp at ph > 13 and the consequent change of cidnp sign at ph = 13.2 are attributed to the formation of the guanosyl radical anion. in the case of amp, the cidnp maximum the amp h8 positive polarization decreases with decreasing acidity until emission is observed at ph > 4. a maximum of emissive signal is reached at ph = 5.5. above this ph, the cidnp signal of h8 decreases with an inflection point equal to pka of the phosphoric group (6.5), which corresponds to the lower quenching rate constant in the case of the fully deprotonated phosphoric group. the cidnp effect of h2 undergoes almost no changes up to ph 5.5 and decreases with deprotonation of -hpo4. the influence of the protonation state of the phosphoric group is confirmed by the absence of any change in cidnp intensity obtained in the photoreaction of the triplet tcbp with ado (figure 5) at ph > 5.9. at ph > 13 guanosyl radical anion, g(2h) is formed due to the interaction between the neutral radical g(h) and oh, which accelerates the deprotonation of the neutral radical. the sign of nuclear polarization originating from the photoreaction of adenosine cation ah(hpo4) at ph 4), the electron transfer leads to the formation of an adenosyl radical cation with pka = 4.0. the radicals with similar pka are known to have a lifetime of about 1 s, which is long enough for the geminate cidnp to be formed in the primary radical before its deprotonation into conjugated base. in the case of the electron transfer, the cidnp observed in our experiments should correspond to that formed with the participation of radical cation and without any change in cidnp sign. thus, the electron transfer is ruled out as the mechanism of triplet - excited tcbp quenching by neutral adenosine. the probable mechanisms are either the hydrogen transfer or pcet leading to the formation of a neutral adenosyl radical. the role of the protonation state of the phosphoric group in the quenching reaction under study, though confirmed by cidnp measurements, still remains unclear. for gmp, it was necessary to take into account the formation of dication and cation radicals in acidic solution (ph 9.7. the neutral guanosyl radical could be formed only via electron transfer from guanosine anion. thus, a rate constant of 3.5 10 m s measured by us for the reaction between tcbp and g(h) corresponds to the quenching via electron transfer, and it is the lowest rate constant for the reaction of this mechanism ever obtained by us. the change in cidnp sign at ph > 13, consistent with the cidnp originating from the reactions of guanosyl anion radical, confirms that this radical is derived from the reaction between the guanosyl neutral radical and hydroxyl ions rather than from quenching : only with hydroxyl ions concentration higher than 0.1 m is the deprotonation rate of g(h) (pka = 10.8) high enough to provide the formation of the g(2h) radical within the lifetime of the triplet spin - correlated radical pair. thus, both the neutral and the anionic guanosines quench the triplet - excited dye to form the neutral guanosyl radical. it is worth noting that a certain inconsistency was found in the obtained data. namely, despite a 7-fold difference in the reactivities of guanosine in neutral and anionic forms toward the triplet - excited tcbp (the quenching rate constants are 2.6 10 and 3.5 10 m s), there is no corresponding difference in the cidnp intensities detected : pi qi for the reactant pair tcbp and g(h) is only slightly lower than that for tcbp and g(h), whereas a several times decrease is expected. this decrease of pi qi should be similar to that observed for amp when the rate constant kqi was slowed down from 5.0 10 m s to 1.0 10 m s. to clarify this apparent inconsistency, we have measured the dependence of cidnp intensity on gmp concentration at ph 7.2 and 11.7. the cidnp intensity of the tcbp h6 was chosen for analysis (figure 6), since at ph > 9.7 gmp in the anionic form is involved in the reaction of degenerate electron exchange with a neutral gmp radical, and this leads to a decrease in the cidnp intensity of the gmp h8 proton detected after the laser pulse. dependences of geminate cidnp of the tcbp h6 protons, obtained during photoreaction of gmp with tcbp, on gmp concentration at ph 7.2 (open circles) and 11.7 (solid circles). the dependence of cidnp intensity on the gmp concentration c obeys the equation5where kq is the quenching rate constant, is the intrinsic lifetime of dye triplets, and i is the cidnp intensity under saturation conditions with c kq. the dependences in figure 6 reflect the differences in cidnp intensities (scaling keeps the relative intensities of signals in cidnp spectra), as well as those in kq values : with higher kq, saturation is observed at lower c. the values of i and kq were obtained from the best - fit simulations using eq 5 and = 1.4 s for the triplet - excited tcbp. the estimated values of kq are 1.4 10 m s at ph 7.2, and 1.1 10 m s at ph 11.7, which, taking into account the expected 2-fold decrease in rate constant due to the deuterium isotope effect, is in satisfactory agreement with the lfp data. taking i at ph 7.2 as unity, at ph 11.7 we obtain i = 6.8, although in both of the cases, the cidnp formed from the radical pairs of dye and neutral gmp radicals should result in identical i values. we offer the following explanation for the difference in i in terms of the reaction mechanism. pcet is the the mechanism of the reaction between fully deprotonated triplet excited tcbp and neutral gmp, in which the electron transfer is followed by the proton transfer within the lifetime of the spin - correlated radical pair initially formed in the triplet state. its magnetic resonance parameters are favorable for gaining a singlet character of radical pairs with the negative nuclear spin projection of the h8 of gmp, and the positive nuclear spin projection of h2 and h6 of tcbp. the consequent proton transfer from the guanosyl radical cation with the formation of the neutral guanosyl radical results in g sign inversion. accordingly, the projections of nuclear spins that provide faster triplet - singlet transitions are changed to the opposite ones. the resulting cidnp signs correspond to that formed with the participation of the neutral guanosyl radical. however, the cidnp intensity is attenuated to the degree depending on the lifetime of the guanosyl radical cation as compared to the lifetime of the spin - correlated radical pairs. thus, a detailed analysis of cidnp effects including cidnp ph and concentration dependences allowed us to establish the mechanism of the reaction of the gmp triplet - excited tcbp over a wide ph range. the photo - oxidation of the purine nucleotides adenosine-5-monophosphate and guanosine-5-monophosphate by 3,3,4,4-benzophenone tetracarboxylic acid has been investigated within the ph range of 2 to 12 in aqueous solution. the ph dependence of the observed quenching rate constant was measured by time - resolved laser flash photolysis and explained in terms of the pka values of the reactants. as a result, the quenching rate constants for each pair of reactants were determined by simulating the ph dependence of the quenching rate constant observed. in acidic solutions, the rate constant of the photo - oxidation reaction is maximal : kqi = 1.3 10 for gmp and kqi = 1.2 10 m s for amp, and was observed to decrease with increasing ph. the deprotonation of the amp phosphoric group was revealed to cause a 5-fold decrease in the quenching reaction rate constant. at the same time, the protonation state of the gmp phosphoric group has no effect on the photoreaction. a detailed study on the ph dependence of the geminate cidnp intensity indicates that the mechanism of the reaction between the triplet tcbp and gmp or amp depends on the protonation state of the reacting species. the reaction between tcbph4 and gh, tcbph4 and g, tcbph2 and g is the electron transfer. we suggest pcet for the reaction between the fully deprotonated tcbp and neutral guanosine involving the so - called pair substitution effect, i.e., the deprotonation of the initially formed guanosyl radical cation within the lifetime of the geminate radical pair. the quenching of dye triplets by guanosine anion proceeds via electron transfer with an extremely low rate constant of 3.5 10 m s. at ph > 13 the concentration of hydroxyl ions is high enough to catalyze the deprotonation of the neutral guanosyl radical formed in basic solution. at ph 4. | the photo - oxidation of purine nucleotides adenosine-5-monophosphate (amp) and guanosine-5-monophosphate (gmp) by 3,3,4,4-benzophenone tetracarboxylic acid (tcbp) has been investigated in aqueous solutions using nanosecond laser flash photolysis (lfp) and time - resolved chemically induced dynamic nuclear polarization (cidnp). the ph dependences of quenching rate constants and of geminate polarization are measured within a wide range of ph values. as a result, the chemical reactivity of reacting species in different protonation states is determined. in acidic solution (ph 9.4), kq = 1.0 108 m1 s1 (amp, ph > 6.5). surprisingly, the strong influence of the protonation state of the phosphoric group on the oxidation of adenosine-5-monophosphate is revealed : the deprotonation of the amp phosphoric group (6.5) decreases the quenching rate constant from 5.0 108 m1 s1 (4.9 6.5). |
regular physical activity is an important for the prevention and treatment of overweight and obesity. although physical activity is not the main means for reducing body fat, it improves cardio - respiratory fitness and lowers the risk of heart disease, among others, if performed regularly and safely (9, 16). despite the knowledge of the benefits of exercise, overweight and obese individuals tend to be sedentary (1, 3). regarding their low level of physical activity, it has been observed that the way the individual perceives physical exercise tends to influence their participation (36). in this sense, the development of strategies that encourage exercise to be perceived more positively may be interesting for this population. music is an important way to reduce monotony during exercise (17, 21, 30). its use can produce psychological and physiological effects, influencing the rating of perceived exertion (rpe) and the attentional focus during exercise (21). the rpe can be defined as the subjective intensity of effort, strain, discomfort, and/or fatigue that is experienced during physical exercise (32). in the context of endurance exercise these terms are dichotomous, while associative attentional focus has been defined as attention in physical sensations or other task - related process, dissociative attentional focus has been defined as attention in sensations or task - not related with the physical work (7, 9). despite knowledge of the effect of music on psychological and psychophysical responses, the use of music seems to influence the rpe when compared to no - music conditions. in a study conducted by potteiger, schroeder, and goff (29), the use of music produced a reduction in all conditions when compared with the no - music condition. moreover, almeida. (3) found that the rpe is higher with fast tempo music compared with the no - music and medium - tempo music conditions. when the exercise is performed at low or moderate intensity, external factors, like music, can be process in parallel with physiological cues, attenuating this response on the information process. however, at higher intensities, physiological cues seem to dominate the processing of information ; while at moderate intensity, external routes, such as the use of music, can be processed in parallel (31, 33). accordingly, a motivational factor of music tempo appears to influence rpe. regarding attentional focus, previous studies have observed that elite runners use an associative attentional focus during a race whereas recreational runners have dissociative focus during the effort (27). the associative attentional focus seems to be more productive in highly conditioned individuals because they are able to meet the physiological demands objectively (8, 11). however, sedentary subjects with lower fitness levels can benefit from a dissociative attentional focus, reducing bodily sensations and positively interpreting the effort. in this manner, strategies to modulate the rpe and make the attentional focus more dissociative could benefit lower - conditioned people. this study observed the effect of music on the rpe and the attentional focus in self - selected paced walking performed by overweight and obese women. a sample of 15 women aged 35 to 50 participated in the study (mean sd, age 42.9 4.9 years, height 1.56 0.07 m, body mass 79.7 11.9 kg, body mass index 32.7 5.1 kg / m, peak oxygen uptake 24.7 4.7 ml.kg.min.). inclusion criteria were as follows : (a) engages in less than 30 minutes of exercise on most days of the week (1) ; (b) has a body mass index (bmi) of between 25 and 39 kg / m ; (c) does not make use of pharmacological resources that could change the outcome of the study ; (d) does not have cardiovascular disease ; (e) answers negative to all questions in the physical activity readiness questionnaire (par - q). this study was approved by the research ethics committee of the federal university of paran, and all participants signed an informed - consent form before starting the research. the medium tempo was between 115 and 120 beats per minute (bpm) while the fast tempo was between 140 and 145 bpm (21). the participants were asked to prepare a list of their three favorite artists, in hierarchical order, to exercise context. upon completion of the list, three medium - tempo and three fast - tempo songs from each artist were used for the experimental sessions (22). body weight (kg stadiometer sanny, so paulo, brazil) and height (cm, toledo, sao paulo, brazil) were measured according to the technique described by lohman, roche, and martorell (26). to calculate the body mass index (bmi) the following formula was used : kg / m. this instrument essentially comprises a category rating scale of 15 points, with scores ranging from 6 (minimal effort) to 20 (maximum effort). the rpe has been analyzed and related to several physiological variables such as heart rate, oxygen uptake, blood lactate, metabolic acidosis, among others markers (5, 24). the attentional focus was measured by the attentional focus questionnaire - afq (8). this questionnaire evaluates the focus of attention asses how much exercisers think about some activities along three domains (association, dissociation and distress), comprising 30 questions, with answers ranging from 1 (not ever) to 7 (all the time), divided into dissociative attention, associative attention, and distress. for the study, we considered only the associative and dissociative attentional domains. some studies has been discussed the psychometric proprieties and utilized afq to evaluate the attentional focus from exercise (25, 35). the participants performed an incremental maximal test (tmax) using the bruce protocol (10). the test started at a speed of 2.7 kilometer per hours (km / hr) and a 10% slope. every three minutes there was a load increment on both the inclination and the speed to increase participants volitional fatigue. the tmax was performed on a reebok fitness treadmill (x fit-7 model, london, uk). the heart rate (hr, beats per min) was measured by a polar monitoring system (polar electro oy, kempele, finland). during the test, oxygen uptake (vo2) was measured using the k-4 system (cosmed, k4b2, rome, italy) in the process peak oxygen uptake (vo2peak) was considered the greatest vo2 achieved during the last 30 seconds of the test. maximum heart rate (hrmax) was defined as the highest value obtained for the hr during the tmax. this study comprised four meetings : (a) familiarization, anthropometric measures and maximal exercise test (laboratory environment) ; (b) three walking sessions in the external environment, with medium - tempo music, fast - tempo music, and no - music conditions. participants were requested not to perform physical exercises 24 hours before each workout and not to have energy drinks, coffee, or caffeinated products in a period of three hours before each session (2). at first meeting, the participants were asked to fill all information and assign the consentient to participate on the research. rpe scale and afq were shown to participants and they were instructed how to use them. a period of 72 hours after performing the incremental maximal test was set for the participants to performed the first of the three experimental sessions. each session had one of three conditions : walking with use of fast - tempo music (ft) ; walking with medium - tempo music (mt) ; and no - music control (nm). the experimental sessions were performed on external environment, on a standard outdoor 400-m track. each session comprised a three - minute of warm - up, 30 minutes of walking at a self - selected intensity and five minutes of cool down. at warm - up, the participants were instructed to walking at an intensity that would prepare them to exercise. at begin of each experimental session, were given the following instruction : you will be allowed to select an intensity you prefer to perform on overground. this should be an intensity that you would choose for a 30-min workout if you were participating in a fitness program. the intensity should be high enough that you would get a good workout, but not so high that you would not prefer to exercise at that intensity daily or at least every other day. after the first 5 min, they were allowed to adjust their walking speed only every 5 min of the 20-min trial (i.e., minutes 5:00, 10:00, 15:00, 20:00 and 25:00). for cool - down, the participants were instructed to walking at a lower intensity that they performed during the 30 minute of exercise, at a self - selected pace that made them decelerate. experimental sessions were conducted individually to avoid effect of group dynamics or social interaction on the psychophysiological responses to exercise (13). the temperature (degree celsius, c) was 22.53 3.24 ; 22.20 3.32 and 23.06 2.52, for nm, mt and ft, respectively. the percent relative humidity of air (%) was 51.26 0.96 ; 51.53 0.83 and 51.26 0.96 for nm, mt and ft, respectively. the order of the sessions was randomized, and participants were not provided with information about the music tempo in sessions spent with the use of music. in the sessions with music, when the participants walking without music, they received the headphone, with this not playing sound. during the experimental sessions, the physiological responses were determined breath by breath and converted to percentages of vo2peak (% vo2peak) and hrmax (% hrmax). the rpe was measured at 5, 10, 15, 20, 25, and 30 minutes of exercise. six points were considered : five - minute averages were used for comparison between conditions (01:0005:00, 06:0010:00, 11:0015:00, 16:0020:00, 21:0025:00 and 26:0030:00). to rpe analysis, were utilized the six time points that they were collected and calculated average of session. to afq analysis, the sum of each variable (dissociation and association) it was utilized to compare the conditions. data are presented as mean standard error (se). for all analysis (physiological, perceptual and attentional focus), the repeated measures anova compared the three conditions : medium - tempo music ; fast - tempo music ; no - music control. in the presence of violations in the sphericity assumptions, when significance was found, bonferroni s post - hoc was utilized to find where was difference. a sample of 15 women aged 35 to 50 participated in the study (mean sd, age 42.9 4.9 years, height 1.56 0.07 m, body mass 79.7 11.9 kg, body mass index 32.7 5.1 kg / m, peak oxygen uptake 24.7 4.7 ml.kg.min.). inclusion criteria were as follows : (a) engages in less than 30 minutes of exercise on most days of the week (1) ; (b) has a body mass index (bmi) of between 25 and 39 kg / m ; (c) does not make use of pharmacological resources that could change the outcome of the study ; (d) does not have cardiovascular disease ; (e) answers negative to all questions in the physical activity readiness questionnaire (par - q). this study was approved by the research ethics committee of the federal university of paran, and all participants signed an informed - consent form before starting the research. the medium tempo was between 115 and 120 beats per minute (bpm) while the fast tempo was between 140 and 145 bpm (21). the participants were asked to prepare a list of their three favorite artists, in hierarchical order, to exercise context. upon completion of the list, three medium - tempo and three fast - tempo songs from each artist were used for the experimental sessions (22). body weight (kg stadiometer sanny, so paulo, brazil) and height (cm, toledo, sao paulo, brazil) were measured according to the technique described by lohman, roche, and martorell (26). to calculate the body mass index (bmi) this instrument essentially comprises a category rating scale of 15 points, with scores ranging from 6 (minimal effort) to 20 (maximum effort). the rpe has been analyzed and related to several physiological variables such as heart rate, oxygen uptake, blood lactate, metabolic acidosis, among others markers (5, 24). the attentional focus was measured by the attentional focus questionnaire - afq (8). this questionnaire evaluates the focus of attention asses how much exercisers think about some activities along three domains (association, dissociation and distress), comprising 30 questions, with answers ranging from 1 (not ever) to 7 (all the time), divided into dissociative attention, associative attention, and distress. for the study, we considered only the associative and dissociative attentional domains. some studies has been discussed the psychometric proprieties and utilized afq to evaluate the attentional focus from exercise (25, 35). the participants performed an incremental maximal test (tmax) using the bruce protocol (10). the test started at a speed of 2.7 kilometer per hours (km / hr) and a 10% slope. every three minutes there was a load increment on both the inclination and the speed to increase participants volitional fatigue. the tmax was performed on a reebok fitness treadmill (x fit-7 model, london, uk). the heart rate (hr, beats per min) was measured by a polar monitoring system (polar electro oy, kempele, finland). during the test, oxygen uptake (vo2) was measured using the k-4 system (cosmed, k4b2, rome, italy) in the process peak oxygen uptake (vo2peak) was considered the greatest vo2 achieved during the last 30 seconds of the test. maximum heart rate (hrmax) was defined as the highest value obtained for the hr during the tmax. this study comprised four meetings : (a) familiarization, anthropometric measures and maximal exercise test (laboratory environment) ; (b) three walking sessions in the external environment, with medium - tempo music, fast - tempo music, and no - music conditions. participants were requested not to perform physical exercises 24 hours before each workout and not to have energy drinks, coffee, or caffeinated products in a period of three hours before each session (2). at first meeting, the participants were asked to fill all information and assign the consentient to participate on the research. rpe scale and afq were shown to participants and they were instructed how to use them. a period of 72 hours after performing the incremental maximal test was set for the participants to performed the first of the three experimental sessions. each session had one of three conditions : walking with use of fast - tempo music (ft) ; walking with medium - tempo music (mt) ; and no - music control (nm). the experimental sessions were performed on external environment, on a standard outdoor 400-m track. each session comprised a three - minute of warm - up, 30 minutes of walking at a self - selected intensity and five minutes of cool down. at warm - up, the participants were instructed to walking at an intensity that would prepare them to exercise. at begin of each experimental session, were given the following instruction : you will be allowed to select an intensity you prefer to perform on overground. this should be an intensity that you would choose for a 30-min workout if you were participating in a fitness program. the intensity should be high enough that you would get a good workout, but not so high that you would not prefer to exercise at that intensity daily or at least every other day. after the first 5 min, they were allowed to adjust their walking speed only every 5 min of the 20-min trial (i.e., minutes 5:00, 10:00, 15:00, 20:00 and 25:00). for cool - down, the participants were instructed to walking at a lower intensity that they performed during the 30 minute of exercise, at a self - selected pace that made them decelerate. experimental sessions were conducted individually to avoid effect of group dynamics or social interaction on the psychophysiological responses to exercise (13). the temperature (degree celsius, c) was 22.53 3.24 ; 22.20 3.32 and 23.06 2.52, for nm, mt and ft, respectively. the percent relative humidity of air (%) was 51.26 0.96 ; 51.53 0.83 and 51.26 0.96 for nm, mt and ft, respectively. the order of the sessions was randomized, and participants were not provided with information about the music tempo in sessions spent with the use of music. in the sessions with music, when the participants walking without music, they received the headphone, with this not playing sound. during the experimental sessions, the physiological responses were determined breath by breath and converted to percentages of vo2peak (% vo2peak) and hrmax (% hrmax). the rpe was measured at 5, 10, 15, 20, 25, and 30 minutes of exercise. to physiological analysis, six points were considered : five - minute averages were used for comparison between conditions (01:0005:00, 06:0010:00, 11:0015:00, 16:0020:00, 21:0025:00 and 26:0030:00). to rpe analysis, were utilized the six time points that they were collected and calculated average of session. to afq analysis, the sum of each variable (dissociation and association) it was utilized to compare the conditions. data are presented as mean standard error (se). for all analysis (physiological, perceptual and attentional focus), the repeated measures anova compared the three conditions : medium - tempo music ; fast - tempo music ; no - music control. in the presence of violations in the sphericity assumptions, when significance was found, bonferroni s post - hoc was utilized to find where was difference. with regarding physiological responses, there were no differences between conditions for % vo2peak (f2:30= 0.329 ; p= 0.723 ; p= 0.29) or % hrmax (f2:30= 0.904 ; p= 0.382 ; p= 0.076). nm, mt and ft were performed under 77.45 2.89 ; 75.14 2.91 and 75.98 2.86 % hrmax, respectively. with regarding % vo2peak, nm, mt and ft performed at 59.04 3.48, 56.81 3.81 and 58.00 3.90, respectively. anova found condition effect in perceptual responses (f2:28= 4.380 ; p= 0.02 ; p= 0.238). the post - hoc bonferroni found that rpe it was lower at mt than at nm (10.5 0.5 vs. 12.05 0.6, respectively). there were no differences between ft and mt (10.9 0.4 vs. 10.5 0.5, respectively) or between ft and nm (10.9 0.4 vs. 12.05 0.6, respectively). attentional focus is present in figure 2. regarding the dissociative focus, there was effect of condition (f2:30= 5.975 ; p= 0.008 ; p= 0.352). the post - hoc bonferroni found that nm was lower than mt and ft (39.0 4.1 ; 48.4 4.1 and 47.9 4.5, respectively). the anova found no effect of the condition on associative focus (f2:30= 0.013 ; p= 0.987 ; p= 0.001). this study observed the effect of music on the rpe and attentional focus at a self - selected paced exercise sessions performed by overweight and obese women. the results of this study were as follows : rpe was greater in the no - music control compared with that in medium - tempo music ; the dissociative attentional focus was higher in conditions with medium and fast tempo music compared with the no - music control ; no differences were observed among the three conditions in associative attentional focus. reducing the rpe through the use of music has been found in previous studies (29 ; 34). however, this effect depends on the intensity at which the exercise is performed. at high intensities, the physiological feedback from exercise seems to dominate the processing of information for the modulation of the rpe. on the other hand, at low and moderate intensities, external factors such as the use of music can be processed in parallel in the process of the rpe (8, 11). the intensity of walking sessions were self - selected paced, that were performed at moderate intensity (1). in this sense, using music in low- or moderate - intensity exercise, such as walking, can be interesting for the participants to experience exercise in a more positive way. the fact that the rpe shows no differences between ft and nm may be due to the stimulus exposure time. in fact, the literature shows that the tempo of music can influence the rpe of the subject during physical exercise (3). (21) suggest that continuous exposure to fast tempo music may result in reduced motivation, leading to loss of interest in the activity. the relevance of the stimulus is the causative factor in changing the attentional focus, that can be explained by social - cognitive perspective of perceived exertion and exertion tolerance (33). with low or moderate intensity, the focus on stimuli unrelated to the exercise predominates in the formation of cognitive response because the exercise has been undertaken lightly. on the other hand, at higher intensities the brain shifts attention to internal cues information due to changes caused by the increased exercise intensity. our results can confirm this theory, where the session s intensity were at moderate intensity (1). dissociative attentional focus has been received attention because your association with factor linked at adherence to exercise (like affective response, enjoyment, and others). is well established that if the exercise is not perceived as enjoyable, tolerable or comfortable, probably individuals will not repeat the activity and will drop out the training (15). the dissociative strategies can be a solution to how the exercise stimulus is experienced (25). dissociative techniques have been suggested to diverting attention away from uncomfortable or displeasure stimulus during exercise. moreover, dissociative focus has been positively associated with revitalization, positive engagement, and reductions in physical exhaustion during exercise (23). for example pennebaker and lightner (28) found that external focus was better enjoyment and satisfaction compared to internal focus during aerobic exercise. another question, is that manipulating attentional focus during exercise, like music use, for example, can influence feeling of pleasure and enjoyment during exercise session, even when at intensities slightly above from ventilatory threshold (20). dissociative attentional focus has been suggested improve both immediate and long - term exercise program adherence (14). however, few studies has been investigated the relationship between dissociative attentional focus and adherence or maintenance. annesi (4) found that dissociative attentional focus during exercise had significantly lower drop out, as well as trend toward to higher attendance than control condition. nonetheless, the causal effects between dissociative attentional focus and adherence need of experimental designs to be explained. the present sample was comprised of overweight and obese women adults and thus the findings can not be readily generalized to the other population without replicate the same design. the benefit of exercising outdoors versus indoors has been established in the literature (12). the present participants walking at an external environment in relative isolation, and it is noteworthy that inmost real life exercise environments. the present findings show that at moderate exercise intensity, external factors can modulate psychological responses. the use of music while walking at a self - selected paced intensity can improve dissociative attentional focus during exercise. moreover, medium tempo music can lower perceived exertion in overweight and obese individuals. our results have practical implication for people that could benefit from strategies that cause a lower interpretation from internal cues during exercise, as overweight and obese women. for future studies, we suggest designs that use dissociative strategies on specific people, as obese man, elderly and sedentary. | this study investigated the influence of music on the rating of perceived exertion (rpe) and attentional focus during walking at a self - selected pace. fifteen overweight and obese women volunteered to participate in the study. they underwent four sessions : the first for incremental maximal test and anthropometric measurement followed by three experimental sessions. after the first session, they were exposed to three 30-minute walking sessions at a self - selected pace in a counterbalanced order : fast - tempo music (ft), medium - tempo music (mt) and no - music control (nm). borg s rpe scale and an attentional focus questionnaire were used to measure the perceptual response and attentional focus, respectively. results showed that the rpe was higher in the no - music control than in the medium - tempo music (12.05 0.6 vs. 10.5 0.5). furthermore, dissociative attentional focus was greater for both conditions with music in comparison with the no - music control (nm= 39.0 4.1 ; mt= 48.4 4.1 and ft= 47.9 4.5). the results indicated that the use of music during walking can modulate attentional focus, increasing dissociative thought, and medium - tempo music can reduce the rpe. |
the sacroiliac joint (sij) connects the pelvis to the base of the spine and transmits forces of everyday activities. sij dysfunction, defined as pain and disability related to poor functioning of the sij, is associated with a burden of disease equivalent to that of many conditions commonly treated surgically, such as hip and knee degeneration and lumbar spinal stenosis,1 and quality of life scores that are at least as depressed, compared to these conditions.2 in patients evaluated for chronic low back pain, pain emanating from the sij occurs in 15%23% of cases.3,4 nonsurgical treatments for sij dysfunction include medication management, physical therapy, chiropractic treatment, intra - articular sij steroid injections, and percutaneous radiofrequency (rf) ablation of the lateral branches of the sacral nerve roots. high - quality evidence to support intra - articular steroid injections, which are commonly used in the us, is lacking. two blinded randomized trials support the safety and short - term benefit (up to 3 months) of an rf ablation procedure,5,6 with modest evidence of benefit up to 1 year.7 surgical treatments for chronic sij dysfunction include open sij fusion surgery (ie, open surgical decortication and reconstruction of the sij) and minimally invasive sij fusion. retrospective comparative studies have provided strong evidence that both process variables (procedure time, blood loss, length of hospital stay) and clinical outcomes (pain relief at 1 and 2 years) from minimally invasive surgery are superior to open fusion,810 and minimally invasive approaches to sij fusion now appear to be preferred.11 evidence of the clinical superiority of minimally invasive sij fusion was provided in insite, a prospective multicenter randomized controlled trial of sij fusion with titanium implants vs nonsurgical management (nsm) in patients with chronic sij dysfunction.12 in insite, nsm consisted of medication management, physical therapy for the sij according to american physical therapy association guidelines, intra - articular steroid injections, and rf ablation of the lateral branches of the sacral nerve roots. nsm was consistent with standard clinical care in the us at the time of study design. twelvemonth outcomes from this study showed that sij fusion reduced pain and disability levels and improved quality of life more than nonsurgical treatment. moreover, subjects who crossed over from nonsurgical to surgical treatment (allowed by the study protocol after the month 6 study visit) showed improvements in these outcomes similar to those originally assigned to surgical treatment. insite s results are supported by a second us prospective multicenter clinical trial, showing similar improvements in pain, disability, and quality of life.13 a systematic review of published studies suggests that pain relief persists for 5 years.14 due to fiscal constraints, payers and policymakers are aggressively looking for sources of cost savings, with attention often focused on high - cost procedures. while some stakeholders are interested only in direct medical costs, employers and payers may also consider indirect costs, such as the impact of disease and its treatment on aggregate worker productivity. given the high health and quality of life burden of sij dysfunction, untreated disease can substantially impact worker health, leading to decreased worker productivity and turnover, all of which are associated with incremental costs. in this study, we combine data from two high - quality sources to calculate the expected changes in productivity for workers with chronic sij dysfunction who are treated either nonsurgically or surgically using triangular titanium implants. to estimate the effects of surgical fusion using triangular titanium implants for chronic sij dysfunction on productivity, we used regression analysis and simulation based on a two - step approach used by dall in a previous study. the first step used regression analysis based on the national health interview survey (nhis) data to estimate a general relationship between functional status and productivity, as measured by employment status and earnings. next, functional status and other health - related factors for patients receiving surgical management and nsm of chronic sij dysfunction were used to predict economic outcomes using the first step s regression results. we computed expected productivity for an individual by multiplying the predicted probability that person is working by a forecast of their earnings conditional on being employed. first, we accounted for selection bias resulting from censored earnings in the nonworking population. second, we ran a multistage bootstrap simulation to compute a difference - in - difference productivity estimate across treatment groups and to conduct statistical inference. in our study, difference - in - difference means the difference in change scores from baseline to 6 months across treatments. the bootstrap approach allowed for better accounting for uncertainty in both the estimated relationship between functional status and economic outcomes and the effects of sij fusion surgery on patient outcomes. many inputs for our models were from two prospective multicenter clinical trials conducted in the us. all trial sites (total of 45 sites) received institutional review board approval for the studies prior to study initiation. the 2013 nhis is an ongoing cross - sectional health survey funded by the national center for health statistics (nchs) to 33,000 adults annually.16 the survey collects data on a wide variety of topics including health status, employment, and earnings. we excluded individuals under 20 years or above 79 years of age as well as individuals who refused to respond to certain health and functional status questions. the final sample size included 31,543 individuals (see table s1 for descriptive statistics on the nhis sample). the other data source was two prospective clinical trials, which were used to estimate the effects of sij fusion using triangular titanium implants on patient functional status and other clinical outcomes. insite (nct01681004) is a randomized trial of 148 patients with sij dysfunction who underwent either sij fusion using the ifuse implant system (si - bone, inc., san jose, ca, usa) or nsm nsm consisted of pain medication management, physical therapy, sij steroid injections, and rf ablation of the lateral branches of the sacral nerve roots. sifi (nct01640353) is an ongoing prospective multicenter single - arm clinical trial with enrollment criteria identical to insite., subjects underwent preoperative and follow - up assessment using a visual analog pain score (0100 scale) for sij pain, the short form 36 health survey (sf-36),17 oswestry low back disability questionnaire (odi),18 and the euroqol-5d questionnaire (eq-5d).19 assessments took place at baseline, and at 1, 3, 6, 12, 18, and 24 months. the 12-month results from insite showed marked, immediate, and sustained improvements in the surgical group in self - rated sij pain, disability as measured by odi, and quality of life (using both sf-36 and eq-5d).12 in the nonsurgical group, changes in all of these measures were minor and not clinically important. twelve - month results in sifi mirrored those observed in insite.13 as enrollment criteria were identical between the two studies, data from both studies were combined for the purposes of the current analysis, resulting in a final sample size of 265 subjects treated with minimally invasive sij fusion and 43 treated with nsm. as the odi, sf-36, and eq-5d used in the sij fusion trials contain different informational elements that are also included in the nhis, we used trial participant data from all three instruments. for questions and/or response categories in the nhis that corresponded imperfectly to the other three survey instruments, we mapped responses from the nhis to each of the relevant survey instrument responses (available from author upon request). at 6-month follow - up, less than 3% of patients as crossover in insite increased considerably after month 6, we used responses from the 6-month follow - up period for purposes of measuring treatment effects. only subjects with complete responses in all questionnaire fields used were included in this analysis. we used a two - stage heckman selection model to estimate the relationship between earnings and functional status (tables s2 and s3). for example, someone who is not working may be choosing not to work because the wage they could command is less than the wage they require to work. if so, an earnings model estimated using only data from a working population may not make unbiased predictions applicable to a nonworking population. to attempt to do so would likely result in overestimating the income of individuals entering the workforce, and thus overstating the value of the employment benefit of surgery. the heckman model is widely used to estimate models of worker earnings in the labor economics literature, and corrects for selection bias resulting from the unobserved earnings of the nonworking population.20 the first estimation stage used a probit model to predict employment, and the second estimation stage used a linear regression equation to predict earnings. the nchs has an earnings model to impute income.21 we included most of the explanatory variables used in the nchs earnings model in both estimation stages of our heckman model. however, variables included in the nchs earnings model that were not collected from clinical trial participants and that could be affected by treatment assignment were excluded from our models. other sources of income and presence of other working household members were included in the employment model as instruments, but excluded from the earnings model. as personal income is sometimes imputed in the nhis, multiple imputation techniques were applied to correct for deflated standard errors. we used the results of this heckman selection model regression analysis to estimate both the probability of working and earnings conditional on working for each patient in the clinical trial database at both baseline and 6-month follow - up. difference - in - difference estimates were calculated using a multistage simulation model. in each iteration of the simulation, 265 surgical patients and 43 nsm patients were sampled with replacement from the combined insite and sifi datasets. using model estimates for each sample, we calculated the probability of working and income conditional on working from the employment and earnings predictive distributions for each observation in our bootstrapped sample at baseline and 6-month follow - up. change in productivity was computed by subtracting the product of the baseline employment probability and baseline income from the product of the posttreatment employment probability and posttreatment income. we calculated the mean change in productivity across all observations for each treatment group, and computed a difference - in - difference estimate by comparing these averages. the result is an estimate of the difference in change in the probability of working and earnings potential between the two treatments at 6 months after treatment initiation. our models included some variables that were not collected from trial participants, such as educational attainment and marital status. such variables were imputed by randomly matching selected trial participants with an nhis respondent of the same sex and age category, and then populating missing variables with information from the matched nhis respondent. if the same trial participant was resampled, he / she was not necessarily matched with the same nhis respondent. however, within each iteration, the matched nhis respondents were held constant for baseline and postestimation analysis. many inputs for our models were from two prospective multicenter clinical trials conducted in the us. all trial sites (total of 45 sites) received institutional review board approval for the studies prior to study initiation. the 2013 nhis is an ongoing cross - sectional health survey funded by the national center for health statistics (nchs) to 33,000 adults annually.16 the survey collects data on a wide variety of topics including health status, employment, and earnings. we excluded individuals under 20 years or above 79 years of age as well as individuals who refused to respond to certain health and functional status questions. the final sample size included 31,543 individuals (see table s1 for descriptive statistics on the nhis sample). the other data source was two prospective clinical trials, which were used to estimate the effects of sij fusion using triangular titanium implants on patient functional status and other clinical outcomes. insite (nct01681004) is a randomized trial of 148 patients with sij dysfunction who underwent either sij fusion using the ifuse implant system (si - bone, inc. nsm consisted of pain medication management, physical therapy, sij steroid injections, and rf ablation of the lateral branches of the sacral nerve roots. sifi (nct01640353) is an ongoing prospective multicenter single - arm clinical trial with enrollment criteria identical to insite., subjects underwent preoperative and follow - up assessment using a visual analog pain score (0100 scale) for sij pain, the short form 36 health survey (sf-36),17 oswestry low back disability questionnaire (odi),18 and the euroqol-5d questionnaire (eq-5d).19 assessments took place at baseline, and at 1, 3, 6, 12, 18, and 24 months. the 12-month results from insite showed marked, immediate, and sustained improvements in the surgical group in self - rated sij pain, disability as measured by odi, and quality of life (using both sf-36 and eq-5d).12 in the nonsurgical group, changes in all of these measures were minor and not clinically important. twelve - month results in sifi mirrored those observed in insite.13 as enrollment criteria were identical between the two studies, data from both studies were combined for the purposes of the current analysis, resulting in a final sample size of 265 subjects treated with minimally invasive sij fusion and 43 treated with nsm. as the odi, sf-36, and eq-5d used in the sij fusion trials contain different informational elements that are also included in the nhis, we used trial participant data from all three instruments. for questions and/or response categories in the nhis that corresponded imperfectly to the other three survey instruments, we mapped responses from the nhis to each of the relevant survey instrument responses (available from author upon request). at 6-month follow - up, less than 3% of patients as crossover in insite increased considerably after month 6, we used responses from the 6-month follow - up period for purposes of measuring treatment effects. twelve - month postsurgical results from both studies were nearly identical to 6-month results. only subjects with complete responses in all questionnaire fields used were included in this analysis. we used a two - stage heckman selection model to estimate the relationship between earnings and functional status (tables s2 and s3). for example, someone who is not working may be choosing not to work because the wage they could command is less than the wage they require to work. if so, an earnings model estimated using only data from a working population may not make unbiased predictions applicable to a nonworking population. to attempt to do so would likely result in overestimating the income of individuals entering the workforce, and thus overstating the value of the employment benefit of surgery. the heckman model is widely used to estimate models of worker earnings in the labor economics literature, and corrects for selection bias resulting from the unobserved earnings of the nonworking population.20 the first estimation stage used a probit model to predict employment, and the second estimation stage used a linear regression equation to predict earnings. the nchs has an earnings model to impute income.21 we included most of the explanatory variables used in the nchs earnings model in both estimation stages of our heckman model. however, variables included in the nchs earnings model that were not collected from clinical trial participants and that could be affected by treatment assignment were excluded from our models. other sources of income and presence of other working household members were included in the employment model as instruments, but excluded from the earnings model. as personal income is sometimes imputed in the nhis, multiple imputation techniques were applied to correct for deflated standard errors. we used the results of this heckman selection model regression analysis to estimate both the probability of working and earnings conditional on working for each patient in the clinical trial database at both baseline and 6-month follow - up. difference - in - difference estimates were calculated using a multistage simulation model. in each iteration of the simulation, 265 surgical patients and 43 nsm patients were sampled with replacement from the combined insite and sifi datasets. using model estimates for each sample, we calculated the probability of working and income conditional on working from the employment and earnings predictive distributions for each observation in our bootstrapped sample at baseline and 6-month follow - up. change in productivity was computed by subtracting the product of the baseline employment probability and baseline income from the product of the posttreatment employment probability and posttreatment income. we calculated the mean change in productivity across all observations for each treatment group, and computed a difference - in - difference estimate by comparing these averages. the result is an estimate of the difference in change in the probability of working and earnings potential between the two treatments at 6 months after treatment initiation. our models included some variables that were not collected from trial participants, such as educational attainment and marital status. such variables were imputed by randomly matching selected trial participants with an nhis respondent of the same sex and age category, and then populating missing variables with information from the matched nhis respondent. if the same trial participant was resampled, he / she was not necessarily matched with the same nhis respondent. however, within each iteration, the matched nhis respondents were held constant for baseline and postestimation analysis. table 1 shows characteristics of members of the nhis sample and the two clinical trials (both at baseline and at 6 months posttreatment). as expected, patients in the nhis were younger and reported better health status than those in the trials. patients in the trials were nearly twice as likely to report fair or poor overall health status as compared to nhis respondents. as a result of randomization, baseline characteristics of the sij fusion and nsm groups were similar. at 6 months posttreatment, sij fusion patients reported better health and functional status than those in the nsm group, although health and functional status improved in both groups relative to baseline. table 2 shows simulation results for modeled economic outcomes. for nonsurgical patients, the expected probability of working increased by 3% from baseline to 6-month follow - up (not statistically significant). in contrast, for patients undergoing sij fusion, the estimated likelihood of working by 6 months increased by 19% (ie, from 19% to 38%, p0.001). the expected improvement in earnings conditional on working was higher for patients undergoing sij fusion compared to those undergoing nsm ($ 3,683 [p=0.08 ] vs $ 555 [p=0.93 ]), but the difference in earnings increase was not statistically significant. combining the expected change in employment and earnings, we estimated a statistically nonsignificant increase of $ 1,283 in expected annual earnings for nsm patients and a statistically significant increase of $ 8,206 for sij fusion patients. table 3 shows incremental differences in the probability of working, earnings, and productivity at 6 months when electing for sij fusion as compared to nsm. that is, the table shows the difference in change scores (shown in table 2) between the two treatments for the selected economic outcomes, along with cis. compared to baseline, the change in the probability working at 6 months was 16% higher (95% ci 9%22%) in the surgical group than in the nonsurgical group. the difference in aggregate productivity, which incorporates both the likelihood of working and earnings potential, was also higher in the surgical group (mean $ 6,924, 95% ci $ 1,890$11,945). figure 1 shows the prediction percentiles for the expected aggregate productivity change for surgical and nonsurgical patients. these intervals are wider than the mean productivity intervals shown in table 3, because they represent the distribution of the estimated change in productivity for individuals, as opposed to average changes. approximately 60% of surgical patients could expect a productivity improvement following surgery, as opposed to 50% of nonsurgical patients. thirty percent of surgical patients are estimated to experience an annual productivity improvement exceeding $ 10,000, compared to 10% of nonsurgical patients. in this study, we used two data sources and a two - step regression approach to estimate indirect cost benefits of sij fusion surgery compared to nsm for individuals with sij dysfunction. we estimated that the incremental improvements in health status observed in two prospective clinical trials would result in an expected worker productivity increase valued at $6,900 per year. these indirect cost savings are substantial and may offset a substantial portion of the direct costs associated with surgical care. failure to consider these indirect cost savings may result in understating the overall cost - effectiveness of surgical treatment for sij dysfunction. to our knowledge, ours is the only study to estimate the indirect cost offsets associated with surgical treatment of sij dysfunction. while building on the approach used by dall,15 we implemented a number of improvements. first, we corrected for selection bias in our employment and earnings nhis models by using a two - stage heckman selection model. second, to the extent we relied on imputed income data from the nhis, increased variability that resulted from this method was incorporated into our standard errors through the use of multiple imputation techniques. third, when using our model to project economic outcomes for trial participants, we simulated missing model covariates from an approximate distribution rather than assuming fixed values. finally, we used a multistage bootstrap simulation that allowed us to generate cis that incorporate uncertainty at all stages of the estimation process. as reviewed by dagenais, several studies have estimated national indirect costs of low back pain, with us estimates ranging from $ 7$28 billion per year.22 workers with back pain lose productive times of 5.2 hours / week with an estimated national loss of $ 19.8 billion per year.23 among employees with low back pain, indirect costs vary from $ 7,000$25,000 per employee per year, depending on pain severity level.24,25 analyses from other countries have shown similar impacts of low back pain on indirect costs in affected individuals.26 while the impact of back pain interventions on direct health care costs is commonly studied, assessments of indirect costs of back pain treatments are far rarer and have generally been limited to disc replacement or discectomy, and methods have varied substantially.27 even fewer studies on indirect costs associated with surgical interventions have been published. a norwegian randomized trial compared direct and indirect health care costs associated with disc replacement for chronic low back pain with those associated with nsm.28 mean indirect costs for days missed work were 56,000 and mean costs for time spent by relatives were 12,000. the differences were not statistically significant. in a randomized trial of surgical vs nonsurgical care for lumbar disc herniation, indirect costs represented approximately one - quarter of surgical costs and 57% of nonsurgical costs.29 however, there were no statistical differences in mean 2-year indirect costs across groups. in a head - to - head trial of disc replacement vs fusion for lumbar disc degeneration, indirect costs were estimated from self - reported rates of absenteeism at follow - up visits and us average weekly salaries. after both surgical procedures, the likelihood of being employed decreased markedly but was similar in both groups throughout the study, suggesting no differential impact on indirect costs.30 postsurgical lost wages averaged $2,800 per year. our study estimated an indirect 1-year cost savings of $ 6,900 associated with surgical vs nonsurgical care of sij dysfunction. a markov simulation analysis of direct costs associated with surgical and nonsurgical treatments of sij dysfunction using the same clinical trial data showed an incremental cost of $ 9,833 at 5 years associated with use of surgical as opposed to nonsurgical treatments.31 the potential indirect cost savings of $ 6,900 in 1 year offsets a substantial portion (70%) of the 5-year net cost associated with surgery. this estimate may be conservative, as there is now substantial evidence from several studies with longer follow - up periods to suggest that the benefit from surgery may continue beyond 1 year.14 if the full benefit from surgery persists for at least 2 years, then overall costs (direct and indirect) may be lower in the surgical groups, ie, surgery may be cost saving from the societal perspective. more precise estimates of the incremental cost - effectiveness of surgical care can be achieved by incorporating our findings into a direct cost model and estimating total lifetime direct and indirect costs for each treatment option. we note that although 5-year follow - up suggests persistent pain relief, no clinical outcomes data are available beyond this time period.32 our study reports indirect cost benefits from sij fusion using a societal perspective. this perspective implies that the full described benefit is not necessarily secured by a single party, but could instead be shared by numerous parties. worker productivity improvements can benefit employers through increased profits, employees through increased earnings, and governments through increased tax revenue. while each party s benefit allotment is ambiguous, it is likely that in the short term, the greatest benefits from sij fusion are incurred by the employer. thus, lost productivity due to sij dysfunction is likely to be experienced more by the employer than the employee. second, as this study found surgery to significantly improve workforce participation, self - insured employers who offer short- or long - term disability benefits may experience a reduction in payouts. this payout reduction could be significant, as approximately one - third of employees participate in employer disability insurance programs which pay claimants, on average, 60% of salary.33 based on our study, and assuming an employer has a disability plan with full participation, expected reduction in disability payment could be as high as $ 2,976 per year (product of annual salary of $ 31,000 [from table 2 ], 60% salary replacement, and 16% increase in probability of working and reduced probability of receiving disability payments). another reduction in payout that we did not consider is retraining costs, which could be reduced with reduced employee turnover after sij fusion surgery. our study compared the effectiveness of sij fusion surgery to state - of - the - art nsm, which, at the time of study design included medication management, physical therapy, intra - articular sij steroid injections, and rf ablation of the lateral branches of the sacral nerve roots, delivered in a stepwise fashion to meet patient needs for pain control and improvement of sij - related disability. nsm in the trial was patterned after nsm commonly delivered in the us. a comparison of surgical outcomes to conservative treatment (ie, no specific treatment for sij dysfunction) would likely result in an increased estimated indirect cost benefit from surgery. as conservative management is not an accepted form of treatment for sij dysfunction, first, we assumed that effects of health and functional status on economic outcomes are largely independent of the cause of health or functional impairments. if this assumption does not hold, our regression models could be biased. second, in calculating differences in indirect costs over a single year, our model relied on an assumption regarding the persistence of the health benefit of sij fusion for 1 year. the randomized trial was designed to allow crossover from nonsurgical to surgical care after the 6-month visit was complete, because it was assumed that, for the target patient population, response to nsm could be inadequate for many patients. this was indeed the case, and by 12 months, nearly 80% of subjects in the nsm group crossed over to surgical care ; those subjects derived pain, disability, and quality of life benefits similar to those initially assigned to sij fusion.12 due to high crossover rates, direct comparative data for 12-month outcomes were not available. for our analysis, we assumed that the differences observed at 6 months in the randomized trial persisted for 12 months. this assumption is reasonable as crossover subjects showed nearly no benefit at 6 months and trial subjects, on average, had experienced sij pain for 6 years. moreover, nsm subjects who elected not to cross over derived no further benefit from treatment after month 6. finally, the 12-month postsurgical outcomes in the randomized trial were nearly entirely replicated in a separate, large (n=172) prospective multicenter single - arm trial of the same device / procedure.13 together, these findings validate the 1-year assumption our model used. including missed workdays in our productivity estimates would likely result in double - counting, as earnings are sometimes mechanically linked to days worked. however, to the extent lost productivity from missed work is not captured by earnings differences, our findings could understate the productivity improvements associated with surgery. over the next 10 years, health care costs are expected to grow faster than incomes.34 in this environment, policymakers will likely be aggressively searching for sources of cost savings. back surgery and other orthopedic procedures have high direct medical costs and utilization rates that vary significantly across geographic regions.35 these factors may result in elevated scrutiny toward back surgery in the coming years. basing insurance coverage policies solely on direct medical expenditures can result in unintended consequences.36 in this study, we find that sij fusion provides incremental improvements in health and functional status relative to nonsurgical managements, and that these improvements likely result in indirect cost savings that significantly offset net direct medical costs associated with the procedure. payers and policymakers should consider these factors when making policies that affect access to the procedure. for employees with chronic, severe sij dysfunction, minimally invasive sij fusion may improve worker productivity compared to nsm. | introductionsacroiliac joint (sij) dysfunction is associated with a marked decrease in quality of life. increasing evidence supports minimally invasive sij fusion as a safe and effective procedure for the treatment of chronic sij dysfunction. the impact of sij fusion on worker productivity is not known.methodsregression modeling using data from the national health interview survey was applied to determine the relationship between responses to selected interview questions related to function and economic outcomes. regression coefficients were then applied to prospectively collected, individual patient data in a randomized trial of sij fusion (insite, nct01681004) to estimate expected differences in economic outcomes across treatments.resultspatients who receive sij fusion using ifuse implant system have an expected increase in the probability of working of 16% (95% confidence interval [ci ] 11%21%) relative to nonsurgical patients. the expected change in earnings across groups was us $ 3,128 (not statistically significant). combining the two metrics, the annual increase in worker productivity given surgical vs nonsurgical care was $ 6,924 (95% ci $ 1,890$11,945).conclusionfor employees with chronic, severe sij dysfunction, minimally invasive sij fusion may improve worker productivity compared to nonsurgical treatment. |
almost half of annually diagnosed females with breast cancer belong to developing countries, where they present at a younger age with advanced - stage disease. the advanced stage of presentation of breast cancer in developing countries was attributed to a lack of mass education and screening programs, poverty, poor access to health care facilities, lack of expertise, and poor country infrastructure [17 ]. it is an established fact that ethnic disparities affect breast cancer outcome. despite correction of well - known factors associated with breast cancer - related outcome, such as tumor size, lymph node status, hormone receptor expression, her2/neu gene expression, stage, and age at presentation, racial differences were prominent as prognostic factors and have been associated with genetic differences between races. investigators have proposed multiple reasons to explain these differences between races [1, 812 ]. the sultanate of oman is a developing asian country in the gulf region with a developing health care system. like women worldwide one out of five omani women is diagnosed with breast cancer in her lifetime, and the age - standardized incidence rate is 15.6 per 100,000. in our last reported study, we found that age at diagnosis is younger in oman than in the western world, and the majority of patients present at advanced stages of disease (iii and iv). in our last study, we reported the clinicopathologic features, such as treatment modalities, outcome, and associated prognostic factors for omani women, that have a diagnosis of breast cancer between the years of 1996 and 2002. the results of this previous study revealed that patients in oman presented at a younger age and with an advanced stage of disease. furthermore, there is an underutilization of neoadjuvant (na) therapy with 5-year relapse - free survival (rfs) and 5-year overall survival (os) of 64% and 62%, respectively. in this present paper we also analyzed whether the trends of disease presentation or associated outcome had changed between 19962002 and 20032008. we analyzed patient data using the computerized hospital information system of our university hospital for patients admitted with the diagnosis of invasive breast cancer from january 2003 to december 2008. our hospital (sultan qaboos university hospital) is one of the two main hospitals providing cancer treatment in the sultanate of oman. among the patients included in this retrospective data, the majority were diagnosed and treated in this hospital, but some patients presented either after being diagnosed in other hospitals or after undergoing surgery at peripheral hospitals. our pathology department reviewed almost all histopathological specimens for confirmation of diagnosis and immune staining of tissue for estrogen receptor (er), progesterone (pgr), and her2/neu status. due to the advanced stage of breast cancer at presentation, the breast cancer stage in most patients was determined by ct scans of the chest, abdomen, and pelvis, as well as with bonescans. the records of all patients with a confirmed diagnosis of invasive breast cancer were reviewed, and a database was created. variables were identical to those presented in our previous published study and included age and sex ; date of diagnosis ; side of involved breast ; histopathological type of tumor ; clinical and pathological tumor size ; pathological or clinical involvement of skin or nipple areola complex ; clinical and pathological lymph node involvement ; tumor grade ; marker status of tumor, including er, pgr, and her2/neu status ; clinical and pathological stage of the patients. records were also reviewed for the date of last followup exam, date and site of relapse, and date of death, when relevant. relapse - free survival (rfs) was measured from diagnosis to the date of documented relapse and was censored at the date of last followup. overall survival (os) was measured from the date of diagnosis to the date of death and censored by the last date of followup. kaplan - meir curves were used to determine os and rfs and the log - rank test was used for comparison analysis. the cox proportional hazard model was used for univariate analysis with the variables included being age, menopausal status, tumor size, lymph node status, tumor grade, and estrogen receptor status. the cox model was used for multivariate analysis including all statistically significant factors as per univariate analysis. all reported p - values herein are nominal 2-sided. the mean age of all patients was 47.41 (sd 12.88) years and 3 of 122 patients were male (table 1). almost one - third (32%) of the patients were younger than 40 years of age at the time of diagnosis and 55.7% were premenopausal. twenty - nine patients (23.7%) received neoadjuvant (na) chemotherapy, which is equivalent to 47% of the patients who presented with locally advanced disease stage (stage iib to iiic). of the total, 38% of tumors were negative for hormone receptor (er and pgr) expression, and 21% were positive for the her2/neu gene detected by immunohistochemistry. an additional 15% of patient data regarding her2 status were missing. all patients were treated locally, differing from our previous paper due to the fact that radiation facilities were not available in oman at the time. mean clinical tumor size was 5.3 cm (2.7 cm), while mean pathological size was 3.8 cm (2.7 cm) which is almost identical to our previous paper (5.4 cm (s.d. forty - four patients (36%) had a tumor size of > 5.5 cm. among those 44 patients with large tumor size, 34 patients presented with clinical t4 disease, versus only 9 patients who presented with a clinical t1 lesion (38 and 22 patients, resp., were reported to have clinical t4 and t1 lesions, resp., in our last paper). more than half of patients presented with advanced disease, with stages iii and iv diagnosed in 41.2% and 18.5% of patients, respectively (34.9% and 15.8%, resp. of the 89 patients (73% of total) who underwent axillary lymph node dissection, including 29 patients after na chemotherapy, 18 (20%) had n3 (10 positive lymph nodes) disease, while 18 (20%) and 19 (21%) patients had n2 (4 to 6 positive lymph nodes) and n1 (13 positive lymph nodes), respectively. among the 29 patients who received na chemotherapy, 9 (31.0%) patients showed complete pathological response in the primary lesion and axillary lymph nodes (pcr), and 18 patients had n0 upon pathological exploration. all patients who were treated with neoadjuvant chemotherapy received anthracyclines followed by taxanes and trastuzumab where indicated, which resulted in significant pathological responses and reason for better outcome than our previous study as patients were treated with anthracycline or cmf- (cyclophosphamide, methotrexate, and fluorouracil) based regimens in the past paper. ductal carcinoma was a major histopathological subtype, identified in 120 (98.4%) patients, with lobular carcinoma and carcinosarcoma identified in one patient each. grade iii disease was identified in 43 (35.2%) patients, while 60 (49.2%) and 10 (8.2%) patients had grade ii and grade i differentiation, respectively (in 35.5%, 48.1%, and 16.4% patients, respectively, during years 19962002 as reported in our last paper). hormone receptor status was available for 118 (96.7%) patients and, among those, 71 (60.2%) and 74 (62.7%) patients expressed estrogen and progesterone receptors, respectively. information regarding her2/neu status was available for 103 (84.4%) patients, revealing that 26 (21.3%) had her2 positive disease. of all the 26 patients who were positive for her2/neu gene, 21 received trastuzumab. seven patients were treated in neoadjuvant setting with pcr in 2 patients and more than good partial response in the remaining five. five patients received trastuzumab in palliative setting for stage iv disease while the remaining 9 patients were treated with trastuzumab in adjuvant setting. with a mean followup duration of 54 months, 27 patients died, and 4 patients were lost to followup. among the patients that died, 10 deaths were of the metastatic group and 17 were of the nonmetastatic group. among the 33 patients who experienced a relapse, 18 of those patients subsequently died from their disease. in nine patients, disease relapse led to bone metastases, and five patients had brain metastases ; lungs, pleura, liver, and local relapse were also manifestations identified at the time of disease recurrence. seventy - six patients were living at the end of the study, with no evidence of disease. additional 15 patients have experienced persistent disease, with 12 of those 15 patients belonging to the metastatic group. skin involvement at presentation (p =.003), t size (p =.023), and stage (p =.004) were significant factors associated with os as determined by univariate analysis. additionally, skin involvement at presentation (p =.003), t size (p =.09), lymph node status (p =.013), and stage (p =.003) were strong predictors associated with rfs (table 3). stage at presentation was the only significant factor (p =.006) for os, as determined by multivariate cox regression analysis. the os rates per stage were 100%, 87%, 62%, and 38% for patients for stages i, ii, iii, and iv, respectively (figure 2), which is better in comparison with our previous paper in which 5-year cumulative survival for patients presenting with stage i, ii, and iii was 88%, 75%, and 59%, respectively (figures 1 and 2). the risk factors associated with poor outcome of breast cancer such as young age at presentation, advanced stage, and negative hormone receptor status have been well recognized. in addition to these well - established risk factors, quality of provided care, health awareness, access to the health care system, and sociocultural beliefs are also closely linked to the ultimate outcome of disease [13, 6, 7, 10, 12 ]. this paper enables the comparison with the conclusions formulated in the previous paper. we can thus analyze the changes in breast cancer patients with regards to presentation of clinical and pathological features, treatment modalities used, and outcome. in total consistent with the previous published paper, we observed that the age at presentation was still quite young, with a mean age of 47.41 (12.88) years. significantly, this age at presentation is almost a decade younger than women who present with invasive breast cancer and are from developed countries. in contrast, the age at presentation in the present study is relatively consistent between oman and other developing countries, including neighboring arab countries [2, 4, 6, 7, 1315 ]. however, it should be highlighted that the presentation of breast cancer at younger age in the developing world may be due to younger population age distribution compared to western countries. the majority of patients in this study were premenopausal, with 32% of women younger than 40 years of age and most having an advanced stage of disease at the time of diagnosis. furthermore, only 8% of patients presented with a tumor smaller than 2 cm, which is also in contrast to the data from affluent countries, but consistent with data from neighboring regional and other developing countries [24, 6, 7, 10, 1315 ]. the mean age at presentation in this present paper is a year younger compared to our previously published paper. furthermore, fewer patients presented with stage i disease in this present paper, versus the previous paper (8% versus 14.5%). more than one - third (35.2%) of patients had tumors that were highgrade and negative expression of hormone receptors (40%), both of which are factors contributing to the aggressive nature and poor disease - associated outcome. na chemotherapy administered to patients for locally advanced breast cancer this type of treatment is the reason for the increasing number of breast - conserving surgeries (bcss) and is also associated with better os [1620 ]. however, data from various papers regarding the treatment of breast cancer in developing countries clearly demonstrates the underutilization of bcs. furthermore, most patients undergo unwarranted surgeries early in the course of the disease at peripheral hospitals or have an advanced stage of tumor growth [1, 2, 6, 7, 13, 14, 16 ]. similar to our previous published paper, the use of na therapy was underutilized. however, the use of na therapy did show some improvement, as in the present study, 29 patients (23.7%) were treated with na chemotherapy, which accounts for 23.7% of total patients and 47% of patients who presented with locally advanced disease stage (stage iib to iiic). all those patients who received na chemotherapy showed an excellent response, with 31% pcr in primary breast lesion and 62% pcr in recovered nodes. adjuvant chemotherapy was administered to 95% of patients, a rate which is significantly improved over the previous study, in which only 60.2% of patients received adjuvant therapy. we noticed better 5-year survival in patients of this present study, in which patients had a 5-year os of 78% as compared to 64% in our last study though disease stage at presentation was almost identical and reasons for better outcome are most likely due to introduction of frequent use of taxanes and trastuzumab along with aromatase inhibitors which were used very infrequently for patients reported previously (figure 2). the 5-year os is similar or better in comparison to studies regarding the efficacy of breast cancer treatment reported from other regional or developing countries [2, 6, 13 ]. racial differences are now a known factor for breast cancer - related clinical outcomes, excluding other risk factors, as reported by two large database american studies. o'malley and colleagues studied racial disparities affecting breast cancer - related clinical outcomes among white asian, hispanic, and african females diagnosed in california. the results of this study revealed significant differences in the 5-year survival rate between these groups. furthermore, chu and coworkers reported the same survival differences in young black and white american females. in both of these studies, besides differences attributed to race, investigators uncovered significant associations between socioeconomic and education status of the patients as well. in addition to other established risk factors of poor clinical outcome, stage at presentation has a very significant impact on os. patients who present with stage iv breast cancer have an almost 14-fold increase in risk of death, compared to patients diagnosed with stage i disease. this data is consistent with our study, which reveals that patients who presented with stage i disease had a 5-year os of almost 100%, versus 38% for patients with stage iv disease at presentation. significantly, the 5-year os for stage iv disease is almost twice as high as reported in our previously published study regarding the os for metastatic disease. presentation at an advanced stage is common among patients with breast cancer in undeveloped countries. socioeconomic issues, cultural barriers, and low literacy rates have been reported as the factors responsible for advanced stage of presentation, in addition to lack of screening programs and poor access to health care facilities [1, 5, 6, 11, 14, 15 ]. in conclusion, although the number of patients in this study is relatively small, the study results show that patients in oman still present with advanced stages of disease at a relatively young age. however, breast cancer patients enrolled in the present study have markedly improved rfs and os. the improvement in rfs and os is most likely due to utilization of various treatment modalities, including updated chemotherapy protocols and the use of trastuzumab. further comparisons between this and the previous study reveal that omani breast cancer patients still present with advanced disease, poor tumor differentiation, at a young age, and have a low percentage of hormone - positive tumors, all of which are known factors associated with poor overall disease outcome. mass education programs, health awareness measures, and establishing screening programs are basic ways to decrease the disease burden and enable diagnosis at earlier stages of disease. | breast cancer is the leading cause of cancer - associated mortality in women, with elevated incidence in developing countries. this retrospective study included all 122 patients diagnosed with breast cancer from january 2003 to december 2008 in the sultanate of oman. age at presentation was 47.41 years (sd12.88), with one - third of patients younger than 40 years. the majority of patients presented with stage iii (41.2%) and iv (18.2%) breast cancer. t size (p =.023), skin involvement (p =.003), and stage at presentation (p =.004) were significantly associated with overall survival. skin involvement at presentation (p =.003), t size (p =.09), lymph node status (p =.013), and stage (p =.003) were strong predictors of relapse - free survival. patients had a 5-year survival of 78%, compared to 64% of breast cancer patients diagnosed between 1996 and 2002 identified in our previously published study. thus, despite omani breast cancer patients continuing to present with advanced breast cancer, survival rates have significantly improved. |
iliotibial band syndrome is a common knee injury caused by inflammation of the distal portion of the iliotibial band (itb), which results in lateral knee pain. the distal iliotibial band slides over the lateral femoral epicondyle, and during repetitive flexion and extension activities of the knee excessive friction and potential irritation results in pain. potential risk factors for the development of iliotibial band syndrome include preexisting iliotibial band tightness, high weekly mileage, time spent walking or running on a track, interval training, and muscular weakness of knee extensors, flexors, and hip abductors [1, 2 ]. populations who expose their knees to a greater amount of flexion and extension activities, such as athletes, particularly long distance athletes, put themselves at a higher risk for iliotibial band syndrome. due to the pathophysiology of it band syndrome, runners have been a group often looked at for prevalence and management of this syndrome. itb syndrome has been documented to have as high as a 22.2% incidence of all lower extremity injuries in runners. despite a clear pathophysiology, few studies have shown any direct relationship between biomechanical factors and the development of iliotibial bad syndrome [1, 2, 46 ]. athletes with itb syndrome typically complain of a sharp or burning pain roughly 2 cm superior to the lateral joint line. the pain may radiate proximally or distally, and in less severe cases, the pain may quickly subside upon cessation of activities. often pain will occur as activities proceed. it is not uncommon that the athlete will experience popping on the lateral aspect of the knee with activities. itb syndrome is a clinical diagnosis and most often additional diagnostic studies are not necessary. it should be suspected in overuse and nontraumatic cases of knee pain where rest has not been helpful. ober 's test is one of numerous physical exam tests often used to assess the tightness of the itb. if the leg can be passively stretched to a position horizontal but not completely adducted to a table, this constitutes minimal tightness. if the leg can be passively adducted to horizontal at best, this constitutes moderate tightness, and if it can not be passively adducted to horizontal, this is maximal tightness. popping of the itb over the lateral femoral condyle can also occur in this position as the knee is brought through range of motion. history, however, is much more important than physical exam in diagnosis and short - term resolution of symptoms following corticosteroid injection and be both diagnostic and therapeutic. mri may be of use if there is doubt about the diagnosis as well as to exclude an intra - articular problem such as a lateral meniscal tear ; however, isolated itbfs often does not lead to mri abnormalities and can be misdiagnosed if a minor but different lesion is present. two studies revealed that in patients with iliotibial band syndrome, mri studies have shown that the distal portion of the itb may thicken, and a bursa deep to the iliotibial band over the lateral epicondyle becomes inflamed and filled with fluid [8, 9 ]. when the athletic population was isolated, normal, or cystic, poorly defined signal intensities at the distal portion of the itb predominated. only in chronic cases was a thickening of the distal itb at the level of the lateral femoral epicondyle seen. while the majority of patients respond to a nonsurgical, conservative approach, this does not occur for all, and escalation of treatment is necessary. this is especially true in athletes that present with refractory cases, and at this time surgical intervention can be used. unfortunately, refractory cases can occur quite often, and no treatment has been shown to work best. the purpose of this review is to outline both the conservative and surgical options for treatment of iliotibial band syndrome in athletes. in order to find the most current treatment options for itb syndrome in athletes, a literature search was conducted in the pubmed database. criteria for inclusion in this review were papers that primarily (but not exclusively) focused on the athletic population, achieved a level iii or greater level of evidence, addressed therapeutic options for itb syndrome (conservative or surgical), and were written in english. an initial search of iliotibial band syndrome yielded 176 results. after limiting the results to those articles that discussed treatment options, and focused on the athletic population many of these treatment modalities have been geared toward the runner population, and certain guidelines to return to sport (running) have been suggested. table 1 illustrates four studies that outlined conservative treatment modalities. in a randomized controlled trial (rct), schwellnus. investigated the effect of initial treatment (day 07 : rest, ice application, and medication) in 43 patients with unilateral itbs. all subjects received physical therapy consisting of ultrasound, deep transverse friction massages on days 3, 5, and 7 and daily stretching of the it band. medication was delivered over the 7 days in a double - blind, placebo - controlled fashion with group 1 taking a placebo anti - inflammatory, group 2 an anti - inflammatory (voltaren), and group 3 an anti - inflammatory / analgesic (myprodol). compared with the other groups, group 3 had less pain during running from day 3 onward, and their running time / distance on the treadmill significantly increased from day 0 to 7. in another randomized controlled trial, 18 runners with acuteonset itb syndrome (6 months) symptoms despite conservative treatment, with an average age at onset of 29 (2441) years. after a minimum of 20-month followup, all patients were able to return to their preinjury tegner activity levels, and all reported less pain (11-point visual analogue scale score decreased by 6 points). nine of the 11 patients said that knowing what they know now they would have the surgery performed again for the same problem. this population, however, was a mix of athletic and the general population, and the study did not separate out the results of each population. iliotibial band syndrome (also called iliotibial band friction syndrome) is a common problem encountered in the knees ' of athletes, especially endurance athletes whose sport requires repetitive knee flexion. itbs can often recur in the athletic population, causing significant morbidity and delay in return to sport. there is debate on whether iliotibial band syndrome is truly a friction syndrome where the itb itself is pathologic or whether a pathologic bursa forms between the itb and the lateral femoral condyle, causing the pain. this is an important concept because successful surgical treatment of the syndrome must address the underlying pathological causes. regardless of stance on the pathophysiology, conservative management is the first line of therapy for itbs. however, both conservative and surgical therapies play a major role in recalcitrant cases. a combination of therapies (rest, pain relief, stretching, strength training, and running habit modification) works best for returning athletes to their preinjury level and reducing their symptoms. however, a systematic regimen involving all aspects of conservative therapy has not been established. a recent systematic review on iliotibial band syndrome in runners concluded that there is limited evidence to support one specific approach to the diagnosis and treatment of itbs, suggesting that additional research is needed to elucidate an optimal treatment regimen. in our review, conservative therapy alone was found to have a 44% complete cure rate with return to sport at 8 weeks and a 91.7% return to sport rate at 6 months [2, 12 ]. most surgeons who have published in the literature ascribe to the iliotibial friction band syndrome theory, and numerous procedures that excise or release this supposedly pathologic portion of the itb have been described. cortisone injections should still be used first in these scenarios, as itbs is considered an inflammatory friction syndrome. however, as the duration of symptoms increases and conservative measures fail, surgical treatment may be needed for resolution of symptoms. three of these procedures have been described above, all in athletes, with a return to sport rate of 100% at an average of 3 months and 7 weeks. did not find a bursa in either the 6 cadaveric specimens they dissected or the 2 symptomatic patients on whom they performed an mri. in patients with iliotibial band syndrome mri findings of the itb can be normal. in a study of 16 patients with itbs, 31% had a discrete fluid collection medial to the itb, with a normal looking itb. however, it was hypothesized that this collection likely arose from chronic inflammation beneath the itb, resulting in the formation of a secondary or adventitious bursa rather than from the inflammation of an existing primary bursa. there are also those that ascribe to the theory that the itb itself is not pathological in patients with iliotibial band syndrome, but rather the pain and functional deficits are generated by a pathological bursa that forms beneath the itb due to compression of that underlying tissue rather than a friction mechanism. in the study performed by hariri. described above, they consistently found what appears to be an inflamed bursa underlying a benign - appearing itb. this study, however, was not done solely on the athletic population whereas the ones described which favor the friction theory of iliotibial band syndrome were. surgical intervention is often only utilized after patients have failed conservative management for itbs, making return to preinjury level a difficult task. although there are two theories on the pathophysiology of itbs, when looking at return to sport rate in the athletic population, resection of the lateral synovial recess, after failure of conservative therapy provides an excellent return to sport rate. iliotibial band syndrome is a common cause of lateral knee pain in the athlete, especially runners and other endurance athletes. both conservative and surgical approaches are viable treatment options, and both need to be considered during treatment planning. while the majority of cases resolve with conservative management, resistant cases are seen in many athletes, requiring surgical intervention. the cases that require surgical intervention are often chronic in nature, and it is important to recognize the duration of symptoms so that surgical treatment can be initiated early. despite many options for both surgical and conservative treatment, there has yet to be consensus on one standard of care. further research is needed to delineate the true pathology behind iliotibial band syndrome in athletes, as well as the optimal treatment regimen. | iliotibial band syndrome (itbs) is a common injury in runners and other long distance athletes with the best management options not clearly established. this review outlines both the conservative and surgical options for the treatment of iliotibial band syndrome in the athletic population. ten studies met the inclusion criteria by focusing on the athletic population in their discussion of the treatment for iliotibial band syndrome, both conservative and surgical. conservative management consisting of a combination of rest (26 weeks), stretching, pain management, and modification of running habits produced a 44% complete cure rate, with return to sport at 8 weeks and a 91.7% cure rate with return to sport at 6 months after injury. surgical therapy, often only used for refractory cases, consisted of excision or release of the pathologic distal portion of the iliotibial band or bursectomy. those studies focusing on the excision or release of the pathologic distal portion of the iliotibial band showed a 100% return to sport rate at both 7 weeks and 3 months after injury. despite many options for both surgical and conservative treatment, there has yet to be consensus on one standard of care. certain treatments, both conservative and surgical, in our review are shown to be more effective than others ; however, further research is needed to delineate the true pathophysiology of iliotibial band syndrome in athletes, as well as the optimal treatment regimen. |
the nurse and doctor, both inexperienced and sincerely wishing they were n't there, watch the monitor anxiously. they have left the security of one hospital for that of another ; like in a circus trapeze act, they hang suspended for a moment. for at that instant the sickest patient in the region is travelling at over 100 km / hour down an unknown highway. will they catch the trapeze, or will they fall ? in an era in which we want to know the physiology and status of our patients continuously throughout their hospital stay, patients who are in transit between institutions are almost completely unobserved. so how good is the care they receive ? in this issue of critical care, ligtenberg and coworkers try to answer just this question. in truth, many studies have examined the effects of transferring critically ill patients. some have focused on changes in physiology and monitoring, finding few changes of questionable consequence. indeed, others have focused on later outcomes [3 - 5 ], showing a moderate effect on mortality and length of stay. however, the study by ligtenberg and coworkers goes one step further and takes a pragmatic, patient - centred view of the consequences of transfer. half of the time this can be related to failure to follow advice from the receiving centre. of these events 70% are, in the authors ' opinion, avoidable and 30% are related to technical problems. it is not due to lack of guidelines or expert opinion [6 - 8 ]. this is a problem that has truly been out of sight and out of mind. how then do we make things better ? first, transfer equipment must be standardized, because many of the adverse events described in the report by ligtenberg and coworkers are equipment related. publication of european standards for ambulance vehicles (cen 1789) may represent an opportunity to achieve this. that document sets out standards for safety that will mean the end of syringe drivers lying on stretchers, ventilators clipped on trolleys and monitors lying on shelves. noncompliance will technically invalidate any eu ambulance 's motor insurance policy. each hospital must nominate a specialist with responsibility for critical care received during transfer such a small change would generate the sense of discomfort necessary to finally stimulate improvement. | how good is the care patients receive during interhospital transfer ? the results of a study in this journal make for some disturbing reading. adverse events occur in about one - third of cases. half the time this can be related to not following advice from the receiving centre. of these events, 70% are, in the author 's opinion, avoidable and 30% are related to technical problems. so how do we make things better ? all transfer equipment needs to be standardized and be " fit - for - purpose ". each hospital needs to take responsibility for the quality of care received in transfer, and this should include guidelines, training and equipment. |
stress fractures occur in individuals in whom repetitive strenuous muscle and tendon force act on bone ; that have not adapted to such forces. under a constant load, osteoclast resorption and osteoblastic reconstruction of bone are in equilibrium, resulting in normal remodeling. if loading increases, additional bone resorption occurs. increased osteoclastic activity at sites of stress may cause local weakening and predispose to micro damage. a 30-year - old man presented with right thigh pain for 3 days without any history of significant trauma. he was a military recruit with history of running 5 miles a day for last 12 years and was running 20 miles a day for last 5 days before he developed pain. here we have reported a case of stress fracture of proximal femur in intertrochanteric region which to our knowledge has not been reported in the literature so far. this fracture is important to recognize early as there are high chances of displacement resulting in increased risk of complications. we suggest immediate anatomical reduction and stable internal fixation to prevent complications and early mobilization to decrease the morbidity. stress fractures occur in individuals in whom repetitive strenuous muscle and tendon force act on bone ; that have not adapted to such forces.[1 - 3 ] stress fractures can be subdivided into fatigue fractures, caused when normal bone is exposed to repeated abnormal stress, and insufficiency fractures, where normal stress is applied to abnormal bone. under a constant load, osteoclast resorption and osteoblastic reconstruction of bone are in equilibrium, resulting in normal remodelling. if loading increases, additional bone resorption occurs. increased osteoclastic activity at sites of stress may cause local weakening and predispose to micro damage. although stress fractures can arise at any site, the most common locations are postero - medial tibia, particularly in runners ; metatarsals in runners, dancers, and military recruits ; iliopubic and ischiopubic rami in military recruits, gymnasts, dancers, and soccer players ; and femur in crosscountry runners. stress fractures of the femur are usually seen in osteoporotic elderly people, but in healthy young athletes they are less common. fractures localized to the superior surface of neck of femur are termed tension fractures, and those localized to the inferior surface, compression fractures. to our knowledge, the literature contains no reports of stress fracture of proximal femur in intertrochanteric region. here, we describe a case of stress fracture of the proximal femur in intertrochanteric region in a male military recruit. the patient was informed that data concerning the case would be submitted for publication, and he consented. a 30-year - old man presented with right thigh pain for 3 days without any history of significant trauma. he was a military recruit with history of running 5 miles a day for last 12 years and was running 20 miles a day for last 5 days before he developed pain. all blood investigations including serum levels of calcium, phosphorus, pth and creatinine were normal except for low 25-hydroxy vitamin d3 levels (22.4 ng / ml). reports of 99m - technetium mdp bone scan, magnetic resonance imaging (mri) and computed tomography (ct) were consistent with stress fracture with no other pathology. patient was managed by closed reduction and internal fixation with dynamic hip screw with anti - rotation screw. initially patient was molilised toe touch walking with cruch support with regular follow up and at the present time patient is walking full weight wearing, no pain, without support and performing his daily routine activities and joined his duties as well. the literature renders different opinions and data with regard to stress fractures and the structural integrity of bones. a number of authors feel that wolff 's law is applicable with stress fractures in that the bone is attempting to adapt to the ongoing stresses. it appears that bone resorption with accelerated repetitive stress occurs at a greater rate than bone deposition. the end result is a stress fracture from repetitive, cumulative stress exceeding the structural strength of the bone. histologically, as humans mature from adolescence, the bone in the femoral neck undergoes internal remodeling of circumferential lamellar bone to adult osteonal bone. experimentally, the greater the percentage of osteones with lamellar bone, the greater the resistance to failure with repeated loading. fractures appear to be related to the rate of loading, if the rate of loading exceeds the rate of there modeling of bony buildup, then a fracture may occur with stress. the femoral neck is subjected to loading forces several times body weight and with stands considerable tensile and compressive forces. it is important to consider these two distinct forces separately because they lead to different injury types and outcomes. tensile forces occur at the superior aspect of the femoral neck, where as compressive forces occur at the inferior aspect. [12 - 14 ] other biomechanical factors, such as leg length inequality, coxavara, and pescavus, may also be important in the development of compressive and tensile injuries at the femoral neck. femoral neck stress fracture has many associated complications such as nonunion, malunion, osteonecrosis, and arthritic changes. many authors suggest that tension side femoral neck stress fractures require internal fixation because of potential instability and high rate of complications ; however, there are reports of successful conservative management for non - displaced tension side fractures compression side fractures are generally treated conservatively with a period of rest followed by gradual return to activity and exercises. femoral neck stress fractures treated conservatively should have frequent radiographic monitoring for progression given the high incidence. return to running is considered when full weight bearing is asymptomatic, there is no tenderness to palpation on physical examination, and imaging studies are consistent with healed fracture. literature is not available on stress fracture in pertrochanteric region so biomechanics related to it is not clear. the pertrochanteric region is quite variable in its combination of cortical and cancellous bone structure. the well - vascularized pertrochanteric region is dependent on the structural integrity of a laminated cancellous bone arcade from the femoral head and epiphyseal scar, around ward 's triangle to the lesser trochanter, where the solid nature of the structure changes to a tubular construct with the origin of the femoral medullary canal ; the strong plate of bone posteriorly is named the calcar femorale. this is the region most affected with the posteromedial fracture comminution leaving only the anteromedial cortex potentially stable. the main structural attachments to the proximal femur include the hip capsule and the musculotendinous junctions of the gluteus medius and minimus (greater trochanter), iliopsoas (lesser trochanter), pirifomis and short external rotators (posterior trochanteric region from the greater trochanteric region to the lesser trochanter), the oblique head of the rectus femoris (anterior capsule), and the vastus lateralis (lateral femur distal to the greater trochanter). the hip capsule is especially important in reduction of pertrochanteric fractures and its continuity with the distal fragment is the soft tissue attachment on which a stable reduction is possible. with capsular disruption, the displacement of the fracture fragments is dependent on the musculotendinous attachment to the respective fragments. the greater trochanter is abducted and externally rotated by the gluteus medius and short external rotators, the shaft is displaced posteriorly and medially by the adductors and hamstrings. lambotte described the four components of surgical treatment of fractures at the turn of the twentieth century, and they are as applicable today as then. the first is exposure of the fracture, which today means visualization of the fracture deformity, and the safest approach to ensure reduction and placement of the implant in the correct position. the second is reduction of the fracture, which is critical to the stability and functional recovery of the patient. inadequate reduction is the major preventable etiology for lost reduction and implant failure in pertrochanteric fractures. the third step is provisional fixation in an anatomically reduced position ; this is frequently the most neglected step in hip fracture surgery. this involves the reduction of the fracture and then maintenance of the fracture with either provisional kirschner pins and/or clamps to hold the fracture in position while the bone is prepared for the definitive implant. the last step is definitive fixation, which should maintain the reduced fracture in an acceptable anatomic and functionally correct position until fracture healing is complete. [lambotte principal of fracture management was basically given for traumatic fractures that is still followed for such injury. it means lambotte principal of fracture management can be applied for fracture caused by severe trauma and also for stress fracture. here we have reported a case of stress fracture of proximal femur in intertrochanteric region which to our knowledge has not been reported in the literature so far. this fracture is important to recognize early as there are high chances of displacement resulting in increased risk of complications. we suggest immediate anatomical reduction and stable internal fixation to decrease the morbidity and prevent complications. so any patient particularly military recruit if presented with mild pain in groin during activity and relieved by rest must be suspected for insufficiency fracture. if on plane radiography lesion is not visible, go with the most common investigation i.e. mri. if the fracture is displaced, it should be fixed to prevent complications and early mobilization to decrease morbidity of patient. | introduction : stress fractures occur in individuals in whom repetitive strenuous muscle and tendon force act on bone ; that have not adapted to such forces. under a constant load, osteoclast resorption and osteoblastic reconstruction of bone are in equilibrium, resulting in normal remodeling. if loading increases, additional bone resorption occurs. increased osteoclastic activity at sites of stress may cause local weakening and predispose to micro damage. if allowed to progress, such micro fractures may progress to complete fractures.case report : a 30-year - old man presented with right thigh pain for 3 days without any history of significant trauma. he was a military recruit with history of running 5 miles a day for last 12 years and was running 20 miles a day for last 5 days before he developed pain. examination revealed pain to palpation along the proximal medial and lateral right thigh. range of motion was painful and limited. radiograph of right hip showed fracture line in intertrochanteric region of femur.conclusion:here we have reported a case of stress fracture of proximal femur in intertrochanteric region which to our knowledge has not been reported in the literature so far. this fracture is important to recognize early as there are high chances of displacement resulting in increased risk of complications. we suggest immediate anatomical reduction and stable internal fixation to prevent complications and early mobilization to decrease the morbidity. |
there are roughly 5 to 10 million persons infected with human t - lymphotropic virus type 1 (htlv-1) worldwide, and the safety of treating this population with biologics remains poorly understood. an htlv-1-infected 66-year - old female with htlv-1 uveitis (hu) and htlv-1-associated myelopathy / tropical spastic paraparesis (ham / tsp). her hu had been in remission and her ham / tsp symptoms had been managed effectively with oral steroids for years. however, she developed severe rheumatoid arthritis (ra) after failing to respond well to conventional anti - rheumatic agents. subsequently, her ra symptoms resolved, but she suffered a recurrence of hu and exacerbation of ham / tsp symptoms. when she was switched back to steroid - based treatment, hu and ham symptoms both improved, but ra symptoms again worsened. finally, an attempt to substitute the biologic abatacept and reduce the steroids failed when ham / tsp symptoms again became aggravated. to the best of our knowledge, this represents the first report worldwide of a biologic aggravating htlv-1-associated conditions. this report suggests that caution is advised when using biologics to treat htlv-1-infected patients, though further research is required to clarify the situation. it is estimated that there are 5 to 10 million individuals worldwide infected with human t - lymphotropic virus type 1 (htlv-1), and this is widely perceived to be an underestimate. htlv-1 causes a variety of inflammatory conditions as well as a rare but aggressive cancer known as adult t - cell leukemia / lymphoma. there are approximately 1 million htlv-1-infected persons in japan, an htlv-1-endemic country, with the highest prevalence in the southwestern areas of the country, namely kyushu and okinawa. htlv-1 uveitis (hu) develops when activated htlv-1-infected lymphocytes invade the eye and release inflammatory cytokines, invoking an inflammatory immune response. hu accounts for a relatively high percentage of uveitides in southwestern japan (estimated 3% to 5% compared with the national average of roughly 1% of uveitides). the rare neurodegenerative disease htlv-1-associated myelopathy / tropical spastic paraparesis (ham / tsp) develops in a small fraction of infected persons, with estimates ranging from 0.25% to 3% lifetime incidence. ham / tsp presents as progressively worsening myelopathic symptoms such as spastic paraparesis, lower limb sensory disturbances, and bladder, bowel, and erectile dysfunction. many elderly patients require treatment for more than 1 condition, and htlv-1-infected patients are no exception. there are a number of infected patients seeking treatment for rheumatoid arthritis (ra), and it is unclear how certain therapies may affect them differently from their uninfected counterparts. this is especially relevant in japan, where htlv-1 is endemic and the average life expectancy is relatively high. are biologics, such as tocilizumab (tcz), a humanized monoclonal antibody against the interleukin-6 (il-6) receptor, which is an immunosuppressive drug used to treat ra. we herein report a case in which an htlv-1-infected patient with ra was treated with tcz and suffered a recurrence of hu and exacerbation of ham / tsp symptoms. to the authors knowledge a 66-year - old female patient who had developed dry eyes and mouth was seen at kagoshima university hospital, kagoshima city, kagoshima prefecture in 1988. she was diagnosed with sjgren syndrome due to her symptoms and positive lab tests for anti - ss - a / ro antibody (103.0 u / m), anti - ssb / la antibody (35.4 u / ml), and antinuclear antibodies (1:40) (fig. she soon began to notice numbness and weakness in both legs as well. in 2002, she developed uveitis in both eyes and was prescribed steroid eye drops. in 2006, she presented with paresthesia of the palms and soles of the feet, abnormal heaviness in the legs, and dysuria. laboratory tests revealed that she was htlv-1-positive (particle agglutination method), and she was diagnosed with ham / tsp. peripheral nerve lesions were ruled out because the symptoms were symmetrical without various focal points and because she presented with hyperreflexia and spasticity rather than hyporeflexia. at kagoshima university hospital, she was treated with methyl - prednisolone (mpsl) pulse therapy (1000 mg / d for 3 days) followed by oral prednisolone (psl) maintenance therapy, which alleviated the ham / tsp symptoms, and then she was referred for follow - up at ohkatsu hospital, kagoshima city, kagoshima prefecture. there, from 2007 to 2010, her ham / tsp symptoms were managed effectively with psl, and her uveitis remained in remission she only required regular eye drops (0.1% sodium hyaluronate) for dry eyes. timeline of the events leading up to the administration of tocilizumab and subsequent exacerbation of htlv-1-related symptoms. left column : year during which the event occurred. right column : actions taken by the attending physician such as making a diagnosis, prescribing or administering a treatment, or performing a test. then in 2010, vision in the right eye became blurred, and she visited miyata eye hospital in miyakonojo city, miyazaki prefecture. as neither test results nor fundoscopy was suggestive of any other type of uveitis, she was diagnosed with hu (fig. 2). inflammation rapidly resolved with hypotensive treatment and steroid eyedrops, and intraocular pressure normalized. top left : mutton - fat keratic precipitates are present in the anterior of the right eye. hu and ham symptoms subsequently remained stable, but joint pain worsened, and she was referred to yamano clinic, aira city, kagoshima prefecture in 2011. more than 10 sites of inflammatory arthritis were present including large joints, and the symptoms had persisted for more than 6 weeks, suggesting ra. laboratory tests were used to confirm : the anti - ccp antibody titer was elevated (208.7 u / ml compared with reference range < 4.5 u / ml) ; rheumatoid factor was positive (31 iu / ml ; reference range 015) ; and crp levels were elevated. thus, she fulfilled the 2010 acr/ eular classification criteria for ra and was diagnosed with ra. various anti - ra pharmacotherapies were tried, but the patient was unable to continue taking salazosulfapyridine due to nausea and did not respond sufficiently well to methotrexate (mtx). while the patient also was still taking psl to treat the inflammation from ham / tsp, these steroids did not alleviate the joint inflammation symptoms from ra. because the ra symptoms were worsening considerably, with associated bone destruction, the patient was given intravenous tcz at 8 mg / kg at yamano clinic in september 2012. although the patient subsequently responded well in terms of ra symptoms, ham symptoms worsened (bladder and rectal dysfunction, gait disorder), and hu in the right eye recurred. laboratory tests revealed that although serum c - reactive protein (crp) levels (an established marker for ra activity) had dropped precipitously as expected, csf levels of cxcl10/ip-10 (a chemokine known to play a role in ham / tsp pathogenesis and a marker known to be elevated in ham / tsp patients) had risen dramatically (fig. crp fell from 4.12 mg / dl in august to 0.02 mg / dl in october ; cxcl10/ip-10 rose from the last recorded level of 1.90 ng / ml in january to 16.75 ng / ml in october. proviral load (pvl), on the other hand, remained more or less constant throughout the year and did not change at all between august (0.48 copies per 100 cells) and october (0.46 copies per 100 cells). timeline showing treatments administered and levels of markers recorded before and after administration of tocilizumab. solid lines represent treatments : 6 mg / wk methotrexate (mtx) in pink, 500 mg / d salazosulfapyridine (sasp) in yellow, 8 mg / d prednisolone (psl) in light blue, and 2 injections of 8 mg / kg tocilizumab (tcz) in orange. dotted lines represent markers : c - reactive protein (crp) in blue, cxcl10/ip-10 in red, and proviral load (pvl) in green. crp and pvl quantities are graphed according to the left y axis, whereas cxcl10/ip-10 is measured on the right y axis. after administration of tcz, ra symptoms improved and ham / tsp symptoms worsened ; these clinical responses are noted next to the crp and cxcl10/ip-10 levels, respectively, because those quantities are the corresponding markers for disease severity. ham / tsp = htlv-1-associated myelopathy / tropical spastic paraparesis, ra = rheumatoid arthritis. due to the apparent negative effects of tcz on the patient 's htlv-1-related symptoms, again, steroid eye drops were prescribed to treat the hu, and mpsl semipulse therapy (500 mg / d for 3 days) was administered to combat the aggravated ham / tsp symptoms. as a result, the patient remained on oral psl alone, and 2 months later her ra symptoms had again worsened. she was administered intravenous abatacept (another biologic used to treat ra) at 250 mg / dose starting in december 2012. this treatment was repeated 2, 4, and every 4 weeks thereafter for 7 months, and ra symptoms were improving. while she was being treated with abatacept, an attempt was made to reduce the dose of her oral psl maintenance therapy. it was unclear whether or not the abatacept, as another immune - modulating biologic, had played a role in exacerbating the ham / tsp symptoms, and treatment with abatacept was discontinued. since then, we have been struggling to control the ra symptoms using oral psl at 8 mg / d and mtx at 6 mg / wk. the patient has so far shown no signs of developing atl. here, we described how a patient with both ra and the htlv-1-associated diseases hu and ham / tsp was given 2 biologics, first tcz and then abatacept, to treat her severe ra symptoms. laboratory tests revealed trends that corresponded to these clinical observations : reduced serum crp and elevated csf cxcl10/ip-10 following tcz treatment. interestingly, pvl remained relatively constant throughout the year, suggesting that the treatment did not cause the infection to spread but rather stimulated the existing infected cells to increase the level of inflammation. as a limitation of this study, it should be noted that there was no cxcl10/ip-10 data available for several months immediately preceding tcz treatment. this is because, due to the relative difficulty of extracting csf compared with taking blood, cxcl10/ip-10 was only measured on the rare occasions it was deemed clinically necessary for diagnostic purposes. this is in contrast to blood tests that were conducted routinely to monitor disease progression. thus, it is difficult to say with certainty that cxcl10/ip-10 levels rose in response to tcz treatment. later, it was suspected that abatacept may have also aggravated her ham / tsp while relieving her ra symptoms, and biologics were henceforth abandoned for the treatment of this patient. this decision was made even though we were unable to distinguish between the effects of starting the patient on abatacept and reducing her daily dose of psl. it is difficult to deduce the mechanism by which biologics may have exacerbated this patient 's htlv-1-related symptoms. tcz works to reduce the proinflammatory activity of il-6 by binding to the il-6 receptors as a competitive inhibitor. there has been a report indicating that this mode of action causes a transient increase in the levels of free il-6, which may have pathologic significance. it is well established that il-6 is involved in the pathogenesis of both hu and ham / tsp. thus, it is possible that this elevated free il-6 may have downstream effects that increase the inflammatory activity of htlv-1-infected cells, but further studies are necessary to conclude whether this theory has merit. it should also be noted that biologics such as tnf- inhibitors have been reported to disrupt the blood however, this phenomenon has not been observed with tcz specifically, according to the literature. moreover, the symptoms in this case more closely resembled the typical presentation of hu than the ocular inflammation typically caused by drug - induced autoimmunity or toxicity. when trying to determine why the same drug may ameliorate and aggravate different inflammatory diseases simultaneously, one naturally begins to contemplate how the origins of inflammation differ between those diseases. it is therefore interesting to note that some scientists claim that htlv-1 infection can cause ra. there have been reports that htlv-1-infected persons are more likely to develop arthritis and conversely that there is a high seroprevalence of htlv-1 among patients with rheumatoid arthritis. however, there are also several reports claiming the opposite, that there is no association between htlv-1 and ra. the purpose of this report is to caution physicians about the use of biologics when treating htlv-1-infection patients and to encourage researchers to conduct further studies on this topic. while biologics can be very effective for treating rheumatic diseases such as ra, this report suggests that there may be a risk of these treatments exacerbating htlv-1-related diseases | abstractrationale : there are roughly 5 to 10 million persons infected with human t - lymphotropic virus type 1 (htlv-1) worldwide, and the safety of treating this population with biologics remains poorly understood.patient concerns and diagnosis : an htlv-1-infected 66-year - old female with htlv-1 uveitis (hu) and htlv-1-associated myelopathy / tropical spastic paraparesis (ham / tsp). her hu had been in remission and her ham / tsp symptoms had been managed effectively with oral steroids for years. however, she developed severe rheumatoid arthritis (ra) after failing to respond well to conventional anti - rheumatic agents.interventions:she was administered two intravenous 8mg / kg doses of the biologic tocilizumab.outcomes:subsequently, her ra symptoms resolved, but she suffered a recurrence of hu and exacerbation of ham / tsp symptoms. when she was switched back to steroid - based treatment, hu and ham symptoms both improved, but ra symptoms again worsened. finally, an attempt to substitute the biologic abatacept and reduce the steroids failed when ham / tsp symptoms again became aggravated.lessons:to the best of our knowledge, this represents the first report worldwide of a biologic aggravating htlv-1-associated conditions. this report suggests that caution is advised when using biologics to treat htlv-1-infected patients, though further research is required to clarify the situation. |
mosapride citrate (mosapride) is a serotonin 5-hydroxytryptamine 4 (5ht4) receptor agonist that is known to promote gastric emptying and large - intestine motility (1). it is available in japan, as well as in some other asian countries, but not in the usa or european countries (2). in general, mosapride is considered to be safe and is well - tolerated by patients ; however, the potential for drug - induced liver injury (dili) should be considered. dili can be subdivided into idiosyncratic ' and intrinsic ' categories (3). idiosyncratic dili, which is associated with a prolonged latency, occurs in a small number of susceptible individuals. intrinsic dili results from direct drug - induced hepatotoxicity over the course of a few days. he had been taking mosapride (15 mg per day) and trimebutine maleate (trimebutine) (300 mg per day) for functional dyspepsia (fd) for 4 months prior to his admission. he reported that he had no history of alcohol abuse, recent travel, blood transfusion, eating raw meat, or sexual contact. on examination, he had neither jaundice nor edema, but mild epigastralgia was present. his blood test results (table 1) were as follows : aspartate aminotransferase (ast), 800 iu / l ; alanine aminotransferase (alt), 983 iu / l ; alkaline phosphatase (alp), 127 iu / l ; -glutamyltranspeptidase (gtp), 307 iu / l ; prothrombin time (pt) 82.1% ; and eosinophils, 0.7%. the patient 's serum immunoglobulin g (igg) level was 1,067 mg / dl. the patient was negative for igm hepatitis a antibody (igm anti - ha), hepatitis b surface antigen (hbs ag), hepatitis c virus antibody (anti - hcv), anti - cytomegalovirus igm (anti - cmv igm), and anti - epstein - barr virus viral capsid antigen igm (anti - ebv - vca igm). tests for antinuclear antibodies (ana), and antimitochondrial antibodies (ama)-m2 were both negative. an abdominal ultrasound scan and computed tomography (ct) revealed neither biliary obstruction nor space - occupied lesions. a probable diagnosis of dili was considered, and mosapride and trimebutine were discontinued (fig. wbc : white blood cell, rbc : red blood cell, ast : aspartate aminotransferase, alt : alanine aminotransferase, alp : alkaline phosphatase, gtp : -glutamyltranspeptidase, crp : c - reactive protein, ig : immunoglobulin, ana : antinuclear antibodies, ama : antimitochondrial antibodies, hbsag : hepatitis b surface antigen, anti - hbc : hepatitis b core antibody, anti - hcv : hepatitis c virus antibody, anti - ha : hepatitis a antibody, anti - hev : hepatitis e virus antibody, anti - cmv : cytomegalovirus antibody, anti - ebv vca : anti - epstein - barr virus viral capsid antigen antibody, ebna : epstein - barr virus nuclear antigen the clinical course of case 1. liver biopsy at day 11 showed the presence of collapsed hepatocytes in zone 3 with slight infiltration of the acini by inflammatory cells, including lymphocytes and histiocytes (fig. a drug - induced lymphocyte stimulation test (dlst) was performed [a stimulation index (si) of 180% was considered to indicate a positive response ]. mosapride gave a positive response, with an si of 219% ; trimebutine also gave a positive response, with an si of 263%. the patient 's score, based on the criteria for dili from the digestive disease week japan (ddw - j) 2004, was 9 (hepatocellular type), which suggested that dili was highly probable. on the basis of these results, a diagnosis of dili due to mosapride and trimebutine maleate the cessation of these drugs led to the immediate improvement of elevated liver enzyme levels, and he was discharged 17 days after admission. he is currently being followed up in our outpatient clinic, and his liver enzyme levels have remained within the normal ranges. liver biopsy at day 11 showed collapsed hepatocytes in zone 3 with slight infiltration of the acini by inflammatory cells, including lymphocytes and histiocytes. a 54-year - old man visited our hospital because of jaundice and elevated transaminase levels. he had been taking mosapride (15 mg per day) for chronic gastritis for 6 months prior to his admission. the patient had no history of excessive alcohol intake, recent travel, blood transfusion, eating raw meat, or sexual contact. his blood test results (table 2) were as follows : t - bil, 11.9 mg / dl ; ast, 1,407 iu / l ; alt, 1,290 iu / l ; alp, 499 iu / l ; gtp, 420 iu / l ; pt 61.9% ; and eosinophils, 0.1%. the patient was negative for igm anti - ha, hbsag, anti - hcv, anti - ebv - vca igm. the ana was 80 and anti - smooth muscle antibodies (asma) was 40. since dili was suggested based on the patient 's clinical course and the laboratory data, mosapride was discontinued soon after admission. wbc : white blood cell, rbc : red blood cell, ast : aspartate aminotransferase, alt : alanine aminotransferase, alp : alkaline phosphatase, gtp : -glutamyltranspeptidase, crp : c - reactive protein, ig : immunoglobulin, ana : antinuclear antibodies, asma : anti - smooth muscle antibodies, ama : antimitochondrial antibodies, hbsag : hepatitis b surface antigen, anti - hcv : hepatitis c virus antibody, anti - ha : hepatitis a antibody, anti - ebv vca : anti - epstein - barr virus viral capsid antigen antibodies on day 5, his pt was 45.5% (pt - inr 1.57), and methylprednisolone (500 mg / day) was administered for 3 days based on the diagnosis of acute liver failure (alf) without hepatic coma (fig. the patient 's clinical findings and biological data showed gradual improvement, and laparoscopy on day 11 showed reddish markings on the surface of the liver (fig. 4). a histological examination of a liver specimen taken at laparoscopy demonstrated distinct interface hepatitis, bridging necrosis with regenerative micronodules, numerous foci of lobular inflammation and collapsed hepatocytes (fig. 5). mosapride gave a positive response in a dlst with an si of 794% (positive si : > 180%). the patient 's score, based on the criteria for dili from the ddw - j 2004, was 8 (hepatocellular type), which suggested that dili was highly probable. the patient was discharged 32 days after admission and is currently in a favorable condition with normal liver enzyme levels. liver biopsy at day 11 showed distinct interface hepatitis, bridging necrosis with regenerative micronodules, numerous foci of lobular inflammation, and collapsed hepatocytes. he had been taking mosapride (15 mg per day) and trimebutine maleate (trimebutine) (300 mg per day) for functional dyspepsia (fd) for 4 months prior to his admission. he reported that he had no history of alcohol abuse, recent travel, blood transfusion, eating raw meat, or sexual contact. on examination, he had neither jaundice nor edema, but mild epigastralgia was present. his blood test results (table 1) were as follows : aspartate aminotransferase (ast), 800 iu / l ; alanine aminotransferase (alt), 983 iu / l ; alkaline phosphatase (alp), 127 iu / l ; -glutamyltranspeptidase (gtp), 307 iu / l ; prothrombin time (pt) 82.1% ; and eosinophils, 0.7%. the patient 's serum immunoglobulin g (igg) level was 1,067 mg / dl. the patient was negative for igm hepatitis a antibody (igm anti - ha), hepatitis b surface antigen (hbs ag), hepatitis c virus antibody (anti - hcv), anti - cytomegalovirus igm (anti - cmv igm), and anti - epstein - barr virus viral capsid antigen igm (anti - ebv - vca igm). tests for antinuclear antibodies (ana), and antimitochondrial antibodies (ama)-m2 were both negative. an abdominal ultrasound scan and computed tomography (ct) revealed neither biliary obstruction nor space - occupied lesions. a probable diagnosis of dili was considered, and mosapride and trimebutine were discontinued (fig. wbc : white blood cell, rbc : red blood cell, ast : aspartate aminotransferase, alt : alanine aminotransferase, alp : alkaline phosphatase, gtp : -glutamyltranspeptidase, crp : c - reactive protein, ig : immunoglobulin, ana : antinuclear antibodies, ama : antimitochondrial antibodies, hbsag : hepatitis b surface antigen, anti - hbc : hepatitis b core antibody, anti - hcv : hepatitis c virus antibody, anti - ha : hepatitis a antibody, anti - hev : hepatitis e virus antibody, anti - cmv : cytomegalovirus antibody, anti - ebv vca : anti - epstein - barr virus viral capsid antigen antibody, ebna : epstein - barr virus nuclear antigen the clinical course of case 1. liver biopsy at day 11 showed the presence of collapsed hepatocytes in zone 3 with slight infiltration of the acini by inflammatory cells, including lymphocytes and histiocytes (fig. a drug - induced lymphocyte stimulation test (dlst) was performed [a stimulation index (si) of 180% was considered to indicate a positive response ]. mosapride gave a positive response, with an si of 219% ; trimebutine also gave a positive response, with an si of 263%. the patient 's score, based on the criteria for dili from the digestive disease week japan (ddw - j) 2004, was 9 (hepatocellular type), which suggested that dili was highly probable. on the basis of these results, a diagnosis of dili due to mosapride and trimebutine maleate the cessation of these drugs led to the immediate improvement of elevated liver enzyme levels, and he was discharged 17 days after admission. he is currently being followed up in our outpatient clinic, and his liver enzyme levels have remained within the normal ranges. liver biopsy at day 11 showed collapsed hepatocytes in zone 3 with slight infiltration of the acini by inflammatory cells, including lymphocytes and histiocytes. a 54-year - old man visited our hospital because of jaundice and elevated transaminase levels. he had been taking mosapride (15 mg per day) for chronic gastritis for 6 months prior to his admission. the patient had no history of excessive alcohol intake, recent travel, blood transfusion, eating raw meat, or sexual contact. his blood test results (table 2) were as follows : t - bil, 11.9 mg / dl ; ast, 1,407 iu / l ; alt, 1,290 iu / l ; alp, 499 iu / l ; gtp, 420 iu / l ; pt 61.9% ; and eosinophils, 0.1%. the patient was negative for igm anti - ha, hbsag, anti - hcv, anti - ebv - vca igm. the ana was 80 and anti - smooth muscle antibodies (asma) was 40. since dili was suggested based on the patient 's clinical course and the laboratory data, mosapride was discontinued soon after admission. wbc : white blood cell, rbc : red blood cell, ast : aspartate aminotransferase, alt : alanine aminotransferase, alp : alkaline phosphatase, gtp : -glutamyltranspeptidase, crp : c - reactive protein, ig : immunoglobulin, ana : antinuclear antibodies, asma : anti - smooth muscle antibodies, ama : antimitochondrial antibodies, hbsag : hepatitis b surface antigen, anti - hcv : hepatitis c virus antibody, anti - ha : hepatitis a antibody, anti - ebv vca : anti - epstein - barr virus viral capsid antigen antibodies on day 5, his pt was 45.5% (pt - inr 1.57), and methylprednisolone (500 mg / day) was administered for 3 days based on the diagnosis of acute liver failure (alf) without hepatic coma (fig. the patient 's clinical findings and biological data showed gradual improvement, and laparoscopy on day 11 showed reddish markings on the surface of the liver (fig. 4). a histological examination of a liver specimen taken at laparoscopy demonstrated distinct interface hepatitis, bridging necrosis with regenerative micronodules, numerous foci of lobular inflammation and collapsed hepatocytes (fig. 5). mosapride gave a positive response in a dlst with an si of 794% (positive si : > 180%). the patient 's score, based on the criteria for dili from the ddw - j 2004, was 8 (hepatocellular type), which suggested that dili was highly probable. the patient was discharged 32 days after admission and is currently in a favorable condition with normal liver enzyme levels. liver biopsy at day 11 showed distinct interface hepatitis, bridging necrosis with regenerative micronodules, numerous foci of lobular inflammation, and collapsed hepatocytes., mosapride is said to be administered to about 9 million patients per year in japan (4). although mosapride is known to be a causative agent of dili, there are very few original case reports on this topic. in 2004, the ministry of health, labour and welfare (mhlw) revised its cautions on the use of mosapride. in this revision, close observation was recommended during administration due to the possibility of liver dysfunction. in 2012, based on this instruction, the package insert was revised to indicate that after the two - week administration of mosapride, a patient 's gastrointestinal symptoms should be assessed for improvement and the necessity of continuing administration should be evaluated. in the two case reports presented here, dili due to mosapride was the most likely etiology of the patient 's acute liver injury, and the results of extensive testing performed to identify other causes were negative. two algorithms have been published that are specifically designed to assess the cause of dili in suspected cases : the roussel uclaf causality assessment model (rucam) and the maria & victorino (m&v) scale (5). although they are not widely used in the clinical setting, they do offer useful frameworks for investigating cases of suspected dili. in japan, the criteria for dili from the ddw - j 2004 is well known and widely used (6). the ddw - j 2004 scores of cases 1 and 2 indicated that dili was highly probable in both, while the patients ' rucam scores (8 and 7) indicated that dili was probable. although the m&v scores of both cases (9 and 6) indicated that dili was unlikely, the performance of this scale has been said to be poor in reactions that involve long latency periods, and the score is heavily weighted based upon whether a rechallenge with the offending medication results in repeated dili. rechallenge with mosapride was not attempted in the present cases due to concerns for the patients ' safety. the histological findings are not included in any of the three existing dili scoring systems. liver biopsy was performed in order to diagnose the liver injury in both cases. in case 1, these findings were compatible with a pattern of drug - induced hepatocellular injury. in case 2, the histological examination revealed distinct interface hepatitis, bridging necrosis with regenerative micronodules, numerous foci of lobular inflammation, and collapsed hepatocytes. it is well known that some commonly used agents, such as acetaminophen, amiodarone, and methotrexate, are associated with patterns of liver injury (7). the accumulation of further cases will hopefully elucidate the relationship between mosapride and liver injury. to date, there is only one previously published case of dili associated with the administration of mosapride in the japanese literature (8). in 2004, suyama. described the case of a 68-year - old man who developed jaundice and liver dysfunction after the initiation of mosapride treatment. the patient developed severe hepatitis four months after the initiation of mosapride, which resolved after discontinuing the medication. reported the data of seven cases of dili due to mosapride, which were introduced on the basis of information from the mhlw ; however, the detailed clinical courses of the patients were not shown. they concluded that mosapride can induce acute cellular injury or mixed liver injury, and that a dlst is useful in the diagnosis of dili. our cases were similar to the previously published case in that both patients had acute cellular injury - type dili and that the latency period to the onset of dili was relatively long. these common findings may be meaningful in resolving the characteristics of dili due to mosapride. we believe that it was much less likely that trimebutine explained the patient 's clinical picture, because this drug has not been associated with significant hepatotoxity in previous reports. however, the results of the dlst show that trimebutine might have had some effect on the liver dysfunction in case 1. second, the exact mechanism underlying the emergence of dili due to mosapride was not elucidated. idiosyncratic dili development is thought to involve multiple events, such as reactive metabolite formations, oxidative stress, and signaling pathway inductions, with the mitochondria taking center stage (9). in mosapride, the main metabolite m1 (des - p - fuluorobenzyl mosapride) is catalyzed by cytochrome p450 3a4 (cyp3a4) (10). it is possible that m1 has an influence on liver injury ; however, further studies are required to clarify the relationship between mosapride and dili. in summary, our patients experienced dili due to mosapride. mosapride is very popular and is frequently prescribed in asian countries ; however, the potential for dili should be kept in mind. to our knowledge, this is the first english language case report of dili due to mosapride. in japan and other asian countries, we urge clinicians to be alert when performing follow - up liver function tests and to monitor patients ' gastrointesitinal symptoms carefully when mosapride is administered. | we herein report two cases of drug - induced liver injury (dili) due to mosapride. case 1 : a 78-year - old man was admitted with elevated transaminase levels. the cessation of mosapride led to the improvement of elevated liver enzyme levels. case 2 : a 54-year - old man was admitted with jaundice. mosapride was discontinued immediately, and methylprednisolone was administered for acute liver failure. the patient 's data showed improvement, and he was discharged on day 32. in both cases, mosapride gave a positive response to a drug - induced lymphocyte stimulation test (dlst), and the patient 's score based on the criteria for dili was highly probable. |
fragile x syndrome (fxs) is the most common cause of inherited mental retardation, affecting up to one in 4,000 individuals in the general population. fxs most commonly occurs in association with an expansion of a cgg trinucleotide sequence within the fmr1 gene located at band 27.3q of the x chromosome. this expansion generally leads to hypermethylation of the gene, resulting in reduced production of fmr1 protein (fmrp). fmrp is thought to be involved in regulating mrna expression by either stimulating or inhibiting protein translation at the molecular level. the deficiency of fmrp observed in fxs leads to abnormalities in both brain development and function, primarily thought to be related to aberrant development and plasticity of synapses. reduced levels of fmrp are a risk factor for behavioral and cognitive deficits that encompass the areas of memory and learning, information and sensory processing, and social and emotional conduct [11, 23, 27, 28, 30 ]. previous research has also indicated that individuals with fxs possess characteristic structural abnormalities in specific brain regions including increased volume of the caudate nucleus [6, 15 ]. other brain regions show reduction in size in comparison to control subjects, including the cerebellar vermis and the superior temporal gyrus [22, 29 ], key brain regions involved in motor control and auditory processing. several lines of data suggest that abnormal processing or modulation of sensory (particularly auditory) stimuli and motor output may contribute to neurocognitive dysfunction in fxs. for example, children with fxs often show hyper - responsivity to auditory stimuli, have a fast and fluctuating rate of speech, and demonstrate hyperactive and stereotyped motor behavior. recent studies of the fmr1 knockout mouse suggests that they have abnormal sensitivity to auditory stimuli [4, 25 ] and also show deficits of cerebellar learning that depend on precise timing (cerebellar - mediated classical eye - blink conditioning ;). a fundamental component of sensorimotor function is the correct perception and organization of the temporal characteristics of sensory stimuli and motor output. accordingly, abnormalities in timing perception could contribute to a broad array of cognitive, language and motor deficits in fxs [3, 33 ]. in a recent study employing magneto - encephalography (meg), rojas and colleagues found that in patients with fxs, the amplitude for the n100 m auditory evoked field was significantly greater than that of controls, suggesting that more neurons are activated by auditory stimuli in fxs. activation was also found to be significantly less right - lateralized than in control patients, suggesting that neural networks involved in responding to auditory stimulation may be dysfunctional in individuals with fxs. temporal processing has been studied in healthy controls using functional magnetic resonance imaging (fmri) by examining brain activation in response to auditory stimuli [16, 24, 26 ]. in the study conducted by rao and colleagues, for example, four consecutive tones (organized into two pairs) were presented in sequence and subjects were asked to discriminate whether the interval between the second tone pair was shorter or longer than the first tone pair. activations specific to the timing task included regions in the basal ganglia, cerebellum, thalamus, right inferior and superior parietal cortex, bilateral premotor cortex, and right dorsolateral prefrontal cortex. a right hemispheric bias was observed for this temporal processing, especially in the parietal cortex. interestingly, a pitch discrimination task performed by the participants using similar stimuli activated a strongly left - lateralized set of regions in the frontal (dorsolateral prefrontal cortex, anterior cingulate cortex) and parietal (inferior and superior parietal) cortex. in the current imaging study, we employed fmri to investigate auditory temporal processing in fxs using an fmri paradigm similar to that employed by rao. specifically, we compared brain activation in individuals with fxs to a developmental age - matched group of individuals without fxs while subjects were performing an auditory temporal discrimination task. through this analysis, we wanted to gain an increased understanding of the neural processes underlying auditory processing in fxs. this study is of particular interest to understanding the pathogenesis of neurobehavioral abnormalities in fxs, as the regions that rao and colleagues implicate in different components of timing perception in healthy controls include key areas that have been reported to be morphologically and/or functionally aberrant in individuals with fxs : the cerebellum, caudate nucleus, prefrontal cortex and parietal cortex [15, 20 ]. ten female subjects diagnosed with fxs (mean age = 18.7 years, sd = 3.81 years) and ten female developmental age - matched typically developing (td) controls with no known history of neurological or psychiatric disorder also participated in the study (mean age = 14.7 years, sd = 2.95 years). the subjects with fxs were participating in a longitudinal study investigating the development of cognition, behavior and brain function in adolescents and young adults with fxs. two of the girls with fxs were taking antidepressant and stimulant medication and two were taking antidepressant medication only. td subjects were recruited from the local area and were selected so that their developmental ages matched the subjects with fxs. table 1characteristics of the sample and in - scanner behavioral performance age (years)iqdevelopmental agepercent correctmean response time (ms)percent fmrpfxs subject 119.26512.4887.50787.7537 219.47614.7481.25977.0027 321.67115.3481.251048.8822.5 424.08420.16100.001033.5062 519.08015.2281 622.88419.1568.75835.4857.5 711.49510.8362.501014.5664.5 816.79515.8668.75599.1370.5 918.38916.29100.00826.7539 1014.312417.7781.25899.5862td subject 118.711120.7687.5874.61 213.910714.0256.25878.75 319.610219.9868.75861.75 414.512117.5368.75875.59 511.211713.0993.75980.12 612.311914.6487.51509.84 71511216.7856.251128.72 815.811217.711001090.48 915.88413.2362.5994.39 1010.5811710.18100687.88developmental age = chronological age iq/100button box malfunctionnot applicable characteristics of the sample and in - scanner behavioral performance developmental age = chronological age iq/100 button box malfunction the mean iq of individuals with fxs was 86.3 (sd = 16.41) while the mean iq of td participants was 110.2 (sd = 10.84). although the mean ages and iq s of the groups were significantly different [t(18) = 2.58, p < 0.05 ; t(18) = 3.84, p < 0.005, respectively ], the mean developmental ages [ma = ca (iq/100) ] of the groups were comparable [fxs group = 15.78 (sd = 2.82) ; td group = 15.79 (sd = 3.32), t(18) = 0.006, p = n.s. ]. the mean fmrp level of individuals with fxs, as measured by standard techniques was 52.3% (range = 22.5% to 81.0%). parents of all children under 18 years consented for their child to participate, and children assented if they understood the procedure, consistent with guidelines approved by the local institution review board. a blocked design was employed with rest (r), experimental (e) and control (c) conditions presented in the following order : r, e, c, e, c, e, c, e, c, r, with each block lasting 30-s in duration. in each experimental and control block, instructions were displayed on the screen for 6 s, followed by the presentation of four trials. each trial lasted for 6 s. trials began with a fixation cross presented at the center of the screen for 250 ms. after a 1,000 ms interval, a second comparison auditory tone was presented. in experimental blocks, the duration of the second tone was either 250, 500, 1,000 or 1,250 ms (presented in pseudo - random order within each block). in control blocks, the second tone duration was the same as the first tone duration (i.e., 750 ms). all tones were presented to the subject at a pitch of 1,500 hz via headphones. on experimental trials, the task of the subject was to determine whether the comparison tone was longer or shorter than the standard tone during the remainder of the trial. if subjects thought the comparison tone was longer than the standard tone, they were instructed to press button 1 with their index finger. if subjects thought the comparison tone was shorter than the standard tone, they were instructed to press button 2 with their middle finger. in control blocks, subjects were instructed to press either button 1 or button 2 after the presentation of the two equal duration tones. thus, the control blocks were identical to the experimental blocks in almost every respect except that no discrimination was required during control blocks. all subjects had received prior training on the task during a 1-h session conducted in a mock scanner. data were collected at stanford university lucas center (stanford, ca usa) using a 3.0-t signa scanner (general electric, milwaukee, wi usa) with a prototype head coil and button box. a t2 -weighted gradient echo spiral pulse sequence was used with the following acquisition parameters : volumes = 645, tr = 2,000 ms, te = 30 ms, flip angle = 80, fov = 200 mm, matrix = 64 64, 28 oblique slices, and resolution = 3.125 3.125 4.0 mm with a 0.5 mm gap. statistical analysis was performed using statistical parametric mapping software (spm2 ; wellcome department of cognitive neurology, london, uk). the first four functional volumes were discarded to establish equilibrium magnetization. after image reconstruction, each subject s data were analyzed for motion, and realigned to the first functional volume. sessions were then normalized using the mean functional volume resampled to 2 2 2 mm voxels in montreal neurological institute (mni) stereotaxic space (12 nonlinear iterations, 7 8 7 non - linear basis functions, medium regularization, sinc interpolation). spatial smoothing was done with a gaussian filter of 8 mm full - width at half - maximum. each subject s data was high - pass filtered at 128 s, and analyzed using a fixed - effects model. one - sample t - tests were conducted between experimental vs control blocks for the fxs and td groups separately. in addition, a two - sample t - test was conducted by comparing activation in the fxs group and the td group. significant clusters of activation in all tests were determined using the joint expected probability distribution with height (p = 0.01) and extent thresholds (p = 0.05). since there were significant differences in age and iq between the fxs and td groups, we examined correlations between iq and age, and brain activation, in order to exclude the possibility that the brain regions we found significantly different between fxs and td groups were due to these factors. contrast values at regions of interest (rois), defined as all areas that showed a significant difference in brain activation between fxs and td groups, were extracted and correlated with age and iq in the fxs group. further, in order to examine whether activation of these brain regions could potentially covary with development and fmrp level, contrast values extracted from these rois were also correlated with developmental age and fmrp level in the fxs group. coordinates of activation were converted from mni to talairach space using the mni2tal function (http://www.mrc-cbu.cam.ac.uk/imaging/common/mnispace.shtml). brain regions were then identified from these x, y and z coordinates using the talairach daemon (research imaging center, university of texas health science center in san antonio (ric uthscsa, tx, usa) and confirmed with the talairach atlas. ten female subjects diagnosed with fxs (mean age = 18.7 years, sd = 3.81 years) and ten female developmental age - matched typically developing (td) controls with no known history of neurological or psychiatric disorder also participated in the study (mean age = 14.7 years, sd = 2.95 years). the subjects with fxs were participating in a longitudinal study investigating the development of cognition, behavior and brain function in adolescents and young adults with fxs. two of the girls with fxs were taking antidepressant and stimulant medication and two were taking antidepressant medication only. td subjects were recruited from the local area and were selected so that their developmental ages matched the subjects with fxs. table 1characteristics of the sample and in - scanner behavioral performance age (years)iqdevelopmental agepercent correctmean response time (ms)percent fmrpfxs subject 119.26512.4887.50787.7537 219.47614.7481.25977.0027 321.67115.3481.251048.8822.5 424.08420.16100.001033.5062 519.08015.2281 622.88419.1568.75835.4857.5 711.49510.8362.501014.5664.5 816.79515.8668.75599.1370.5 918.38916.29100.00826.7539 1014.312417.7781.25899.5862td subject 118.711120.7687.5874.61 213.910714.0256.25878.75 319.610219.9868.75861.75 414.512117.5368.75875.59 511.211713.0993.75980.12 612.311914.6487.51509.84 71511216.7856.251128.72 815.811217.711001090.48 915.88413.2362.5994.39 1010.5811710.18100687.88developmental age = chronological age iq/100button box malfunctionnot applicable characteristics of the sample and in - scanner behavioral performance developmental age = chronological age iq/100 button box malfunction the mean iq of individuals with fxs was 86.3 (sd = 16.41) while the mean iq of td participants was 110.2 (sd = 10.84). although the mean ages and iq s of the groups were significantly different [t(18) = 2.58, p < 0.05 ; t(18) = 3.84, p < 0.005, respectively ], the mean developmental ages [ma = ca (iq/100) ] of the groups were comparable [fxs group = 15.78 (sd = 2.82) ; td group = 15.79 (sd = 3.32), t(18) = 0.006, p = n.s. ]. the mean fmrp level of individuals with fxs, as measured by standard techniques was 52.3% (range = 22.5% to 81.0%). parents of all children under 18 years consented for their child to participate, and children assented if they understood the procedure, consistent with guidelines approved by the local institution review board. a blocked design was employed with rest (r), experimental (e) and control (c) conditions presented in the following order : r, e, c, e, c, e, c, e, c, r, with each block lasting 30-s in duration. in each experimental and control block, instructions were displayed on the screen for 6 s, followed by the presentation of four trials. each trial lasted for 6 s. trials began with a fixation cross presented at the center of the screen for 250 ms. after a 1,000 ms interval, a second comparison auditory tone was presented. in experimental blocks, the duration of the second tone was either 250, 500, 1,000 or 1,250 ms (presented in pseudo - random order within each block). in control blocks, the second tone duration was the same as the first tone duration (i.e., 750 ms). all tones were presented to the subject at a pitch of 1,500 hz via headphones. on experimental trials, the task of the subject was to determine whether the comparison tone was longer or shorter than the standard tone during the remainder of the trial. if subjects thought the comparison tone was longer than the standard tone, they were instructed to press button 1 with their index finger. if subjects thought the comparison tone was shorter than the standard tone, they were instructed to press button 2 with their middle finger. in control blocks, subjects were instructed to press either button 1 or button 2 after the presentation of the two equal duration tones. thus, the control blocks were identical to the experimental blocks in almost every respect except that no discrimination was required during control blocks. all subjects had received prior training on the task during a 1-h session conducted in a mock scanner. data were collected at stanford university lucas center (stanford, ca usa) using a 3.0-t signa scanner (general electric, milwaukee, wi usa) with a prototype head coil and button box. a t2 -weighted gradient echo spiral pulse sequence was used with the following acquisition parameters : volumes = 645, tr = 2,000 ms, te = 30 ms, flip angle = 80, fov = 200 mm, matrix = 64 64, 28 oblique slices, and resolution = 3.125 3.125 4.0 mm with a 0.5 mm gap. statistical analysis was performed using statistical parametric mapping software (spm2 ; wellcome department of cognitive neurology, london, uk). the first four functional volumes were discarded to establish equilibrium magnetization. after image reconstruction, each subject s data were analyzed for motion, and realigned to the first functional volume. sessions were then normalized using the mean functional volume resampled to 2 2 2 mm voxels in montreal neurological institute (mni) stereotaxic space (12 nonlinear iterations, 7 8 7 non - linear basis functions, medium regularization, sinc interpolation). spatial smoothing was done with a gaussian filter of 8 mm full - width at half - maximum. each subject s data was high - pass filtered at 128 s, and analyzed using a fixed - effects model. one - sample t - tests were conducted between experimental vs control blocks for the fxs and td groups separately. in addition, a two - sample t - test was conducted by comparing activation in the fxs group and the td group. significant clusters of activation in all tests were determined using the joint expected probability distribution with height (p = 0.01) and extent thresholds (p = 0.05). since there were significant differences in age and iq between the fxs and td groups, we examined correlations between iq and age, and brain activation, in order to exclude the possibility that the brain regions we found significantly different between fxs and td groups were due to these factors. contrast values at regions of interest (rois), defined as all areas that showed a significant difference in brain activation between fxs and td groups, were extracted and correlated with age and iq in the fxs group. further, in order to examine whether activation of these brain regions could potentially covary with development and fmrp level, contrast values extracted from these rois were also correlated with developmental age and fmrp level in the fxs group. coordinates of activation were converted from mni to talairach space using the mni2tal function (http://www.mrc-cbu.cam.ac.uk/imaging/common/mnispace.shtml). brain regions were then identified from these x, y and z coordinates using the talairach daemon (research imaging center, university of texas health science center in san antonio (ric uthscsa, tx, usa) and confirmed with the talairach atlas. in - scanner behavioral data are shown in fig. 1. a 2 (group) 4 (condition) repeated measures analysis of variance (anova) indicated that there was no significant difference between the groups in the percentage of correct responses obtained [fxs group = 81.25% (sd = 13.26) ; td group = 78.13% (sd = 17.49), [f(1, 17) = 0.19, p = n.s. ]. there were also no significant difference between the groups in overall response times [fxs group = 891.40 ms (sd = 146.21) ; td group = 971.49 ms (sd = 237.57), [f(1, 17) = 0.76, p = n.s. ]. there was no significant effect of condition for percentage correct responding [f(3, 51) = 0.33, p = n.s. ], though there was a significant main effect of condition for the response time data [f(3, 51) = 4.20, p = 0.01 ]. post - hoc analyses revealed that response times were significantly longer for the 750 vs 250 ms discrimination than for the 750 vs 500 ms discrimination (p < 0.05). 1mean percent correct (left panel) and mean response time (right panel) for fxs and td groups as a function of comparison tone duration (250, 500, 1,000 or 1,250 ms). the standard tone duration (750 ms) is represented by the vertical line mean percent correct (left panel) and mean response time (right panel) for fxs and td groups as a function of comparison tone duration (250, 500, 1,000 or 1,250 ms). the standard tone duration (750 ms) is represented by the vertical line brain activation during the control task was subtracted from the activation in the experimental task. figure 2 shows brain activation for the single group analyses, with the group of fxs participants shown in red and the td group in green. in the td group, activation was primarily observed in the left lingual gyrus of the occipital lobe (ba 18), as well as in the left inferior parietal cortex (ba 40). sites that were close to reaching the cut - off threshold were found in the right caudate head and right cerebellum. in the fxs group, activation was seen across a much more widely distributed set of brain regions, including the left precentral gyrus (ba 6), left middle frontal gyrus (ba 6/10), bilateral cingulate gyrus (ba 23/32), and bilateral activation in superior temporal gyrus (ba 22/38) which extended superiorly into left inferior parietal cortex, as well as in left cerebellum and bilateral caudate body (see table 2). thus, activation in the fxs group was more diffuse and distributed over a larger number of regions. 2experimental minus control task contrasts for the fxs group (activation shown in red) and td group (activation shown in green). (p < 0.01, uncorrected)table 2experimental minus control task contrasts for fxs and td groups anatomical descriptionbapeak locationno. of voxelsz - maxcluster p - value (uncorrected)xyzfxs frontalleft precentral gyrus6361265703.330.003 frontalright precentral gyrus44651494183.150.009 frontalleft middle frontal gyrus6406487753.320.001 limbicleft cingulate gyrus23824292603.130.033 limbicright cingulate gyrus326293239834.62<0.0005 temporalleft superior temporal gyrus, extending to inferior parietal cortex3850171833293.86<0.0005 temporalright superior temporal gyrus3844191810793.57<0.0005 temporalright superior temporal gyrus224829019063.37<0.0005left cerebellum2471115444.45<0.0005left caudate body161183002.860.023right caudate body101173803.330.012td parietalleft inferior parietal404433403223.070.037 occipitalleft lingual gyrus18108314283.260.019right cerebellum2860321493.690.139right caudate head101222403.80.066 experimental minus control task contrasts for the fxs group (activation shown in red) and td group (activation shown in green). (p < 0.01, uncorrected) experimental minus control task contrasts for fxs and td groups figure 3 shows brain activation following subtraction of the td group activation from the fxs group activation during the task. after subtraction, greater activation in the fxs group was observed over a number of brain regions including the left medial frontal gyrus (ba 6), left middle temporal gyrus (ba 21), left cerebellum (anterior lobe) and left brainstem (pons ; see fig. 3 and table 3). on the other hand, there were no regions that showed significantly greater activation in the td group compared to fxs. 3brain regions that showed significantly greater activation in fxs compared to the td group in the experimental control contrast. (p < 0.01, uncorrected)table 3between group contrasts of experimental vs control conditionsfxstdanatomical descriptionbapeak locationno. of voxelsz - maxcluster p - value (uncorrected)xyzfrontalleft medial frontal gyrus6629375003.220.035temporalleft superior and middle temporal gyrus21/38445158293.720.009left cerebellum2053198433.490.009left pons425274503.720.044 brain regions that showed significantly greater activation in fxs compared to the td group in the experimental control contrast. (p < 0.01, uncorrected) between group contrasts of experimental vs control conditions since the fxs group was significantly older and had lower iq s compared to the td group, we performed confirmatory analyses to exclude the possibility that these factors contributed to brain activation differences observed between fxs and the td group. if the greater activation observed in the fxs group compared to the td group is independent of age and iq, then one might not expect to observe increases in brain activation with older age or lower iq in the fxs group. as expected, contrast values of significantly activated brain regions showed no significant correlation with age or iq. we also speculated that if the regions that showed significantly greater activation in fxs compared to the controls were playing a compensatory role that changed with development, these regions may show increasingly greater brain activation with greater developmental age in fxs. however, only the left pons showed a significant (positive) correlation with mental age in the fxs group (r = 0.53, p = 0.03). further supporting the specific role of these regions and its association with development in fxs, there were no significant correlations between mental age and brain activation in any region in the td group. interestingly, performance (percent correct) did correlate with activation in the cerebellum in the td group (r = 0.53, p = 0.02), and performance was significantly correlated with activation in middle temporal gyrus in the fxs group (r = 0.45, p = 0.05). in the fxs group, the main goal of our study was to examine the neural basis of auditory time perception in girls with fxs by comparing them with healthy individuals matched for in - scanner task performance and mental age. we found that several areas including a left - lateralized network of frontal, temporal and cerebellar regions displayed greater activation in the fxs group in comparison to the td group. this finding could be explained by the possibility that fmrp, the protein product of the fmr1 gene, plays a critical role in the development of brain regions underlying auditory processing. previous fmri studies related to temporal processing in healthy controls have reported increased activation in several brain regions. rao and colleagues reported activation in the basal ganglia, cerebellum, bilateral premotor, right dorsolateral prefrontal cortex, right inferior parietal, right superior temporal and left middle temporal gyrus during a time duration discrimination task similar to the one employed in our study. nenadic and colleagues found activation in the right dorsolateral and middle prefrontal cortices, as well as left anterior cingulate, bilateral temporal (superior and middle temporal gyri) and bilateral basal ganglia (caudate nucleus and putamen) when subtracting a control task from an auditory timing task. similarly, harrington and colleagues asked participants to perform a temporal judgment, but analyzed the beginning of the trial (devoted to encoding) separately from the later portions of the trial (presumably reflecting decision - making and response - planning). during the encoding portion, these researchers observed activation in regions of frontal cortex (bilateral medial frontal, left anterior cingulate, right posterior cingulate, and left superior frontal gyrus), temporal cortex (right parahippocampal gyrus and left superior temporal gyrus), and parietal cortex (bilateral inferior and superior parietal), in addition to activations in right lingual gyrus in occipital cortex, bilateral cerebellum and bilateral caudate nucleus. they found a bilateral, though primarily left - lateralized, group of activations in frontal (superior, middle and inferior frontal gyri), temporal (superior temporal), and parietal (supramarginal gyrus and superior parietal) cortex to be involved specifically in the decision - making portion of the trials. in searching for commonalities in the temporal discrimination literature, it should be noted that, while often bilateral, the reported activity is generally right - lateralized during the timing task itself, perhaps indicating a right hemispheric bias for temporal processing. in the current study, individuals in the td group demonstrated activation in the left lingual gyrus (ba 18) as well as in the left inferior parietal cortex (in addition to near - threshold activity in the right caudate head and right cerebellum). one reason why we did not observe significant activation in other brain regions that have been implicated in auditory time perception studies (e.g.,) may be due to the simple and relatively easy in - scanner task we adopted. the methods employed by rao. and harrington. involved the use of two sets of brief tone pairs, demarcating two time intervals, which subjects were then asked to compare. in order to study temporal processing in a population of developmentally delayed participants, we designed a task such that fxs and developmental age - matched td individuals could equally and successfully perform the time discrimination task in the scanner. because of the relative difficulty of discriminating between four tones (and the two intervals defined by them), we chose to adopt a simpler task involving the discrimination of two tones, with one tone always played for 750 ms to serve as a reference. participants were asked to determine whether the second tone was played for a longer or shorter period than the reference tone. in our task therefore, the working memory component was quite reduced (two items, as opposed to four) in order to reduce the difficulty and thus ensure participant success. our behavioral results indicate that the two groups were matched for in - scanner task performance, which allowed us to conduct a proper comparison between the two groups. as a result of making our task easier in order to equate behavioral performance, we may have inadvertently reduced the cognitive load required to perform this relatively simple task, leading to reduced activations in the td individuals. it seems that a wide set of brain areas was still recruited in the fxs group, perhaps as a result of the relative difficulty they experience in processing auditory stimuli in a complex auditory environment such as an mri scanner. indeed, in the group analysis of fxs participants, significant activation occurred in many regions, including left middle frontal and bilateral cingulate gyrus. it is possible that these frontal regions are involved because of an increase in task difficulty for the fxs group relative to the td group. previous research has described increased activation in this region during more difficult temporal discrimination tasks and it has been proposed that this occurs as a result of the greater role that working memory plays in more challenging temporal discrimination tasks. more interestingly, a direct comparison between fxs and the td group revealed several brain areas with significant activation differences that have been implicated in auditory time perception ; however, these areas were localized to contralateral left homologous regions. the most notable findings were regions that showed significantly greater activation in fxs compared to the td individuals : in the medial frontal gyrus, superior and middle temporal gyrus, cerebellum and pons, with relative activation differences predominantly in the left hemisphere. in comparison, nenadic and colleagues found activations in right middle and inferior frontal gyrus as well as left anterior cingulate, and bilateral superior and middle temporal, and bilateral basal ganglia during a time discrimination task. their sites of activation in frontal and temporal cortex are reasonably similar to those in the fxs group, with the notable difference that our fxs participants tend to activate left- rather than right - lateralized regions of frontal cortex. the left inferior parietal cortex was activated in both of our groups when analyzed separately (in the fxs group it is reported as part of a larger cluster weighted toward the superior temporal gyrus). this region has been implicated in time perception studies, and may be involved in intrahemispheric networks used for timing, though there is also some evidence that its role is in the decision - making process, rather than the timing encoding per se. interestingly, other studies have implicated right inferior parietal cortex in a time estimation task, as well as in a task requiring determination of a sound s location in azimuth [1, 2 ]. in addition, rao and colleagues found the right inferior parietal cortex to be activated during an fmri study similar to our own and proposed that this region may be responsible for the regulation of pulses generated by an internal clock. rao also suggests that the inferior parietal cortex may be involved in maintaining attention, as attention - keeping processes are central to the subjective perception of the passage of time. it is not yet clear why our participants recruited left inferior parietal cortex rather than the expected right inferior parietal cortex. greater activation was observed in the left cerebellum in fxs, a region that has been suggested to be involved in decision - making processes of temporal discrimination tasks, specifically by optimizing sensory input from auditory nuclei and thus allowing the comparison of different time intervals in one s working memory. an alternative explanation is that the primary function of the cerebellum is to assist in the process of encoding timing intervals. it is important to note that in previous studies, activation has been found in the cerebellar vermis, a region noted for its cognitive functions related to both tactile perception and working memory. it is possible that the cerebellar vermis monitors and adjusts sensory input from the cerebral cortex. activation in the caudate nucleus and the putamen [24, 26 ] has been observed at the beginning of trial epochs, thus suggesting that the basal ganglia may participate in encoding time intervals and forming one s representation of time. our findings are limited because only a small number of subjects were included in the study, thus severely limiting the generalizability of our results. in addition, four of the girls with fxs were taking antidepressant medication at the time of the study that may have affected the degree to which we found activations in these subjects. subjects were also matched for developmental age, but not for chronological age, introducing the possibility that younger participants may recruit different neural networks for temporal processing than older subjects as a result of age - based neurodevelopmental differences. thus, group brain activation may have varied because of the difference in absolute age between our groups of subjects. our correlation analysis, however, did not support this possibility ; there were no significant correlations between age and brain activation in any of the regions that differed between the two groups. future research should focus on examining temporal processing in fxs in larger groups of chronological and developmental - age matched individuals to control for the development of brain circuitry and its consequent implications for regional activation during temporal processing tasks. in addition, it may be fruitful to investigate other aspects of auditory stimuli such as pitch perception, or the processing of speech sounds. finally, event - related designs could help us further disentangle the different roles of the brain regions discussed here during temporal processing. in conclusion, we found that brain activation during a temporal auditory discrimination task in girls with fxs differed significantly from typically developing individuals. activation in girls with fxs occurred diffusely over several brain regions, while activation in the td group was seen in localized regions, mainly in the left inferior parietal cortex and left lingual gyrus. while these findings should be considered preliminary due to the small sample sizes, these data support a previous meg study in which brain activation in response to auditory stimulation was found to be more diffuse and less right - lateralized in patients with fxs than in controls. these findings may indicate that fmrp plays a critical role in the development of brain circuitry involved in auditory temporal processing in fxs. given that synaptic pruning is impaired in fxs, particularly in occipital and temporal cortex, it seems likely that an overabundance of synapses in these regions could create noise in the processing of the auditory signal. deficits in temporal processing may be responsible for the cluttered speech and motor coordination problems shown by individuals with fxs, particularly in males. future studies should look more comprehensively at primary auditory processing in fxs, perhaps using a tonotopic fmri approach. | fragile x syndrome (fxs) is a common genetic disorder in which temporal processing may be impaired. to our knowledge however, no studies have examined the neural basis of temporal discrimination in individuals with fxs using functional magnetic resonance imaging (fmri). ten girls with fragile x syndrome and ten developmental age - matched typically developing controls performed an auditory temporal discrimination task in a 3 t scanner. girls with fxs showed significantly greater brain activation in a left - lateralized network, comprising left medial frontal gyrus, left superior and middle temporal gyrus, left cerebellum, and left brainstem (pons), when compared to a developmental age - matched typically developing group of subjects who had similar in - scanner task performance. there were no regions that showed significantly greater brain activation in the control group compared to individuals with fxs. these data indicate that networks of brain regions involved in auditory temporal processing may be dysfunctional in fxs. in particular, it is possible that girls with fxs employ left hemispheric resources to overcompensate for relative right hemispheric dysfunction. |
the number of surgeries performed using less - invasive techniques has increased dramatically over the last two decades. while the minimally invasive approach has become the standard of care for many surgical procedures in the thoracic, abdominal and pelvic cavities, this shift was initially slower in cardiac surgery, since most heart operations are very complex, requiring not only cardiopulmonary circulation but also outstanding precision to achieve successful results. advancements in diagnostic tools, development of specific cardiac endoscopic instruments, the introduction of peripheral cardiopulmonary bypass circuitry systems and novel surgical techniques have enabled cardiac surgeons to start operating on the heart through very small incisions. among the different areas of cardiac surgery, the minimally invasive approach has gained particular popularity in the field of mitral valve (mv) treatment. after initial reports in late 90s suggesting that the right - sided minithoracotomy approach to mv can be used with relative safety and efficacy, high volume centers have recently presented their excellent results based on their experiences on thousands of patients. the minimally invasive approach was shown to provide at least equivalent results to those achieved via sternotomy with both in - hospital mortality and stroke rates under 1% in isolated mv disease. providing the option of a small incision with favourable cosmetic effect without the disadvantage of inferior durability or surveillance drives further development of minimally invasive access and changes the treatments paradigms in favour of patient treatment at earlier disease stage before adverse effects of mv disease appear. minimally - invasive mv repair is based on several procedural concepts, which have undergone significant development since this technique was applied for the first time in animals in the early 90s and several years later in humans [1, 6 ]. this article briefly describes three methods, which have been frequently discussed in the literature recently : (i) internal and external aortic occlusion, (ii) use of goretex - neo - chordae to repair mv regurgitation and (iii) feasibility and efficacy of the minithoracotomy approach in mv treatment of patients after previous cardiac surgery. effective and non - traumatic occlusion of the ascending aorta is a challenging procedure that requires experience, especially in the settings of atherosclerotic changes and fragile aortic walls in older patients. due to improvements in the diagnostic radiology, we can identify patients at increased risk for aortic cross - clamp complications preoperatively and adjust the treatment strategy accordingly. iatrogenic aortic rupture or dissection, a potential fatal complication of cross - clamp injury, is a catastrophic disaster, which may lead to death or serious neurologic complications, even in the operating room. fortunately, these serious complications only occur sporadically during open - heart procedures [7, 8 ]. the first endoscopic mv procedures were performed by applying endoluminal aortic clamping with an endoaortic balloon [1, 9 ]. this promising approach, however, was disappointing at first, leading to fatal aortic injury in a significant number of patients [1, 2 ]. however, careful patient selection and numerous modifications to the endoaortic balloon have led to better results, such that it has become a feasible concept of aortic occlusion. nevertheless, surgeons partially accepted it, since the incidence of aortic dissection due to balloon occlusion still ranges between 0.3 - 1.4%. the unfavourable results of aortic endovascular occlusion have led chitwood and coworkers to develop a clamp that can be introduced through intercostal spaces and, if carefully applied under video assistance, enables a secure grasp of the aorta. potential problems, which may occur when the ascending aorta is clamped, are injury to the aorta, the main or right pulmonary artery and the left atrial appendage. furthermore, aortic cross - clamping requires a purse - string suture on the ascending aorta for antegrade cardioplegia delivery and aortic root venting, which can lead to bleeding from this cannulation site. mohr and colleagues reported, in one of the largest published series of patients undergoing minimally invasive mv surgery, that bleeding was the most common indication for conversion to sternotomy. the authors concluded that the chitwood clamp should be placed very carefully and under ongoing visual examination of the ascending aorta and the left atrial appendage. in case of any difficulties in placing the clamp, a 12-year experience from the east carolina university and university of pennsylvania (479 patients with endovascular aortic occlusion vs. 573 patients with transthoracic aortic clamping) revealed that the incidence of aortic dissection and strokes was higher when endoaortic occlusion was applied, even though this difference was not statistically significant (1.5% vs 0.4%, p=0.09 ; 2.7% vs 1.2%, p=0.08). similarly, reichenspurner. reported higher incidence of bleeding in patients who underwent aortic endoclamping (6/60 vs 1/60) and recommended the use of the transthoracic clamp for initial surgery and endovascular aortic occlusion for redo endoscopic mv surgery. in contrast, loforte. did not find iatrogenic dissection or intraoperative bleeding in a series of 138 patients (93 transthoracic aortic clamping vs. 45 endoaortic balloon occlusion). further studies are necessary to provide an ultimate recommendation on the strategy of aortic occlusion. whenever aortic clamping is judged to be unsafe due to adhesions or severe atherosclerosis, hypothermic fibrillation as a means of myocardial protection may be an alternative. this method has received particular attention recently, when minimally invasive mv surgery was expanded to patients with previous sternotomy. chitwood. (1996 - 2006, 167 redo cases) used hypothermic fibrillation in 77% of these patients without serious complications necessitating sternotomy and with no cerebrovascular accidents. they operated on 181 patients with previous cardiac surgery, avoiding aortic clamping in 77% of their patients with an acceptable postoperative stroke rate of 3.8%. hypothermic fibrillation seems to be a safe alternative to aortic cross - clamping and endovascular occlusion. goretex neo - chordae with premeasured loops in mv repair mv repair achieves better results compared with valve replacement therapy [19, 20 ], and is thus the procedure of choice for almost all types of mitral regurgitation. leaflet resection achieves excellent results when used to treat prolapse of the posterior leaflet, the most common pathology [4, 21 ]. as far as more complex valve regurgitation is concerned, other techniques must be applied, like chordal shortening transposition, papillary muscle sliding plasty, papillary muscle shortening, commissural plication, remodeling ring annuloplasty or alfieri edge - to - edge repair. these techniques allow surgeons to perform reconstructive surgery in almost all patients with mv regurgitation. recently, more attention has been paid to the construction of neo - chordae using ptfe sutures (gore - tex, w.l. gore&associates, flagstaff, az), which was introduced 20 years ago by david.. this technique provided excellent results, but did not obtain broad clinical acceptance due to difficulties in achieving a reproducible neochordal length. this difficulty was even more pronounced when surgeons tried to apply this technique via a minimally invasive approach. in 2000, mohr. introduced the loop technique to address these limitations, which consisted of a pre - manufactured pledget with 4 single 5 - 0 gore - tex loops. the pledget was sutured to the papillary muscle and the ends of the loops were then fixed to the leaflet segments. the length of the loops was chosen according to the distance measured between edge of normal non - prolapsing segment and the tip of the papillary muscle. in treatment of anterior leaflet prolapse, neo - chordae undersizing is more reasonable than oversizing, because in non - beating hearts, the distance between the reference non - prolapsing segment free edge and the papillary muscle may easily be overestimated. furthermore, the appropriate loops length is strongly influenced by left ventricular size and location of stiches in the papillary muscle. one decade of experience with the loop technique has made possible the analysis of early- and mid - term results on a significant number of patients. reported on 522 patients who underwent minithoracotomy and mv repair using premeasured loops, showing excellent results with 99% 30-day survival and 0.6% late cardiac reoperations in a mean follow - up period of 18 months. recently, a prospective randomized trial was performed to compare the neo - chordae technique with leaflet resection for posterior mv prolapse. the authors concluded that the loop technique may be superior to leaflet resection because it resulted in a significantly longer line of leaflet coaptation and might therefore be more durable. on follow - up, both techniques showed excellent valve function in the majority of patients. the surgical society is currently awaiting long - term follow - up results, which are expected to confirm the efficacy and durability of the pre - manufactured neo - chordae concept in the mv repair. minimally invasive mv repair in patients with previous cardiac surgery operating on mv in patients who have undergone previous cardiac surgery is challenging and associated with an increased rate of perioperative morbidity and mortality. the conventional access through a median sternotomy may lead to mortality of 26% in patients with previous aortic valve replacement and 9%-14% in patients with previous coronary artery bypass grafting [27, 28 ]. encouraged by their growing experience with minimally invasive techniques, an increasing number of surgeons is opting to apply the minithoracotomy access to reoperative patients. their interest is also driven by the fact that while good exposure through a sternotomy is challenging, particularly in patients with prior aortic valve replacement, it is not an issue in right - sided lateral minithoracotomy. additionally, avoiding extensive dissection, especially in patients with functional coronary artery bypasses, significantly reduces the risk of redo procedures. when the minimally invasive approach was applied for the first time in patients with previous cardiac surgery, efficient myocardial protection was a challenge. another is to carefully dissect the ascending aorta away from the pulmonary artery and to clamp the aorta transthoracically. finally, one method that is currently gaining increasing acceptance is hypothermic fibrillation arrest, which circumvents the need for aortic clamping and cardioplegia delivery. this technique is especially valuable in case of patent coronary bypasses, but necessitates a competent aortic valve. the concept of hypothermic fibrillation has become the preferred approach due to its simplicity and reliable myocardial preservation [17, 18 ]. several centers that have introduced minimally invasive mv surgery have recently reported their results in the reoperative settings. presented outcomes of 167 patients with a 30-day mortality of 3% and no conversion to sternotomy or aortic dissection. similarly, excellent results were presented by seeburger. who analysed data of 181 consecutive patients and reported a 6.6% in - hospital mortality and conversion to sternotomy in 3 patients. in both centers, the minimally invasive approach has become the preferred method to correct mv regurgitation in patients with prior cardiac surgery. for two decades, we have bore witness to the ongoing development of minimally invasive mv repair. this technology is based on several concepts, which have proven their superiority over the conventional sternotomy approach. they have given their recommendations for aortic occlusion strategy, presented novel valve repair techniques and proved the feasibility of minimal invasive access in reoperative settings. at the moment, transthoracic aortic clamping with ante- and retrograde cardioplegia in the primary setting and hypothermic fibrillation in reoperative setting are favoured myocardial protection techniques. the neo - chordae concept of mv repair has gained general recognition and has become the technique of choice for many surgeons. increasingly, minimally invasive approach is the preferred means to correct mv regurgitation in patients with prior cardiac surgery. the excellent results of minimally invasive mv repair will have to be considered whenever already available or new transcatheter techniques are offered to a wider group of patients. | minimally invasive mitral valve repair is based on several procedural concepts. recently, three of them have been intensively discussed : aortic occlusion strategy, use of goretex - neo - chordae to repair mitral valve regurgitation and feasibility and efficacy of the minithoracotomy approach in mitral valve treatment of patients after previous cardiac surgery. twenty years of experience in minimally invasive mitral valve repair have enabled high - volume centers to present valid data and give their recommendations. transthoracic aortic clamping with ante- and retrograde cardioplegia in the primary setting and hypothermic fibrillation in reoperative setting are currently favoured means of myocardial protection. neo - chordae concept of mitral valve repair has gained general recognition and has become the technique of choice for many surgeons. the excellent results of minimally invasive mitral valve repair must be considered whenever already available or any new transcatheter techniques are offered. |
malaria was endemic in the dry zone of sri lanka and was a major public health problem in the country in the past. chalmers reported the presence of 10 anopheline species in the country by chalmers. to date, 22 anopheline species have been reported in sri lanka. anopheles culicifacies was regarded as the only malaria vector in the country till about the early 1980s. enzyme - linked immunosorbent assay (elisa) based evidence has shown a large number of anopheline species to be infected with malaria parasites in addition to a. culicifacies. these include anopheles aconitus, anopheles annularis, anopheles barbirostris, anopheles nigerrimus, anopheles pallidus, anopheles subpictus, anopheles tessellatus, anopheles vagus, and anopheles varuna. among these species that have consistently been incriminated as malarial vectors are a. annularis, a. subpictus, a. varuna, and a. tessellatus. determination of risk of malaria transmission requires quick and accurate methods of identification of anopheles mosquitoes, especially when targeting vector control. anopheles mosquitoes breed in areas with water bodies such as ponds, rivers, surface water, wells, and wastewaters. moreover, these areas are suitable for growth and development of various strains of mosquitoes as ponds, wells, and water bodies of different sizes that are available during rainy seasons. anopheles culicifacies, the primary vector of malaria in sri lanka, is known to breed primarily in stream and river systems. however, this species also breeds in other surface water collections and habitats in sri lanka. recent studies have reported that a. culicifacies breeds in brackish water bodies and wastewater drains in the trincomalee district of sri lanka [10, 11 ]. mathematical models based on the correlation between the abundance of anopheline species and environmental factors such as rainfall, temperature, and humidity may be used to predict vector abundance and thereby malaria epidemics. over three decades of civil unrest, the conflict situation has had detrimental effects on vector control activities and management of malaria in trincomalee district, which is an endemic region for malaria in sri lanka. with the background that only a few small - scale studies on malaria and its vectors have been reported from this district, a study was designed to explore the current abundance and distribution of malaria vectors in these areas. therefore, the aim of this study is to identify various anopheles species and the dynamics of anophelines including malaria vectors in trincomalee district for effective vector control under the current malaria elimination program embarked in the country. trincomalee district is situated in the dry zone of the country within the eastern province of sri lanka. the district has a land area of 2,727 km and a population density of 135/km. the average temperature varies from 24.8c to 30.7c and the district receives a mean annual rainfall of 1, 649 mm. however, very few entomological investigations have been carried out for about three decades in the northern and eastern provinces until 2009, due to the terrorist war that took place in the country including this district. five sentinel sites, namely, gomarankadawala, ichchallampaththu, mollipothana, thoppur, and padavisiripura, were selected for surveillance in consultation with the national malaria control programme. the factors such as past malaria history, availability of breeding sites, an established agricultural community, and feasibility of field operations to collect relevant data were also considered in selecting the study areas. entomological surveillance was conducted in these 20 localities which lasted 1 week every month (figure 1). mosquitoes were collected at monthly intervals using five standard sampling methods from june 2010 to june 2012 according to who standard techniques for anopheline mosquitoes. collections were made during the morning (06.0008.30 hrs) by two vector collectors spending a maximum of ten minutes per house. bedrooms, preferably with complete walls and the highest number of persons slept last night were given priority. two mosquito window (exit) traps were fixed in a sentinel site for 16 nights per month. on the following day mosquitoes the trap was made out of white cotton drill (3 m 3 m 1.5 m) with net windows (2 m 1 m) on sides and erected using a strong centre pole of two - meter height and four side sticks of the same height. the trap was set about 50 m away from the houses and away from the place, where cattle are usually tethered or herded during the night. a distance of 1525 cm gap was allowed between the lower edge of the net and the ground, enabling mosquitoes to enter. at sunset a cattle introduced into the trap in the evening and tethered to the pole fixed to the mid of the hut. the cattle removed at dawn for collecting the mosquitoes. all anophelines resting inside the trap were collected. the size of the hut suited the size of the cattle bait and was approximately 2 m 1.25 m 1.25 m. it was made of sticks, poles, and thatched with woven cadjan. at sunset, a removable door made out of sticks and cadjan was fitted to the hut to facilitate the movement of the calf and the collector in and out of the hut. a space of about 1015 centimeters (cm) between the ground and the cadjan thatched wall and about a five cm space between the roof and the wall were left for the movement of mosquitoes. all potential breeding habitats were identified in all 20 localities through a preliminary survey conducted for a period of one month prior to the research study and certain fixed and temporary breeding places were identified for the larval survey. a minimum of 50 dips were taken from each breeding habitat depending on the size of the breeding place using standard dippers (250 ml capacity). large plastic pipettes and small white enamel pans were used for small and shallow water bodies. the anopheles mosquito larvae were classified as early instar stage (i and ii) or late instar stage (iii and iv) according to gillies and coetzee. all mosquitoes collected by hc, wt, cbnt, and cbht and adults emerging from larvae were identified using an achromatic magnifying lens (10) and the taxonomic keys. the density of each mosquito species collected by cbht, cbnt, and wtc was calculated as per trap densities (number of mosquitoes from each species / total number of traps) and hc as density per house (number of mosquito from each species / total number of houses surveyed), and larval densities were calculated as density per 100 dips { (number of mosquitoes from each species / total number of dips) 100}. monthly climatic data including rainfall (rf), temperature (mt), and relative humidity (rh) of the trincomalee district monitored at various locations were obtained from the department of meteorology, colombo, sri lanka. the data obtained in the study were collected and analyzed with respect to anopheles species abundance in the study area. pearson 's correlation coefficients were used to determine the associations between climatic variables and anopheline densities. ethical clearance to conduct the study was obtained from the ethics review committee of the faculty of medicine, university of kelaniya, sri lanka. the overall results of the mosquito collection made by five mosquito sampling techniques named cbhc, cbnc, wtc, hc, and ls during the study period are given in table 1. a total of 87,710 female mosquitoes representing 17 species were recorded throughout the study. the majority (62%) of adults was collected by cattle - baited collections (cbhc and cbnc) in the district. the density of each mosquito species collected by cbht, cbnt, and wtc was calculated as per trap densities (number of mosquitoes from each species / total number of traps) and hc as density per house (number of mosquito from each species / total number of houses surveyed) and larval densities were calculated as density per 100 dips { (number of mosquitoes from each species / total number of dips) 100}. the most abundant species among the immature and adult collections was anopheles subpictus (26%). the density of a. culicifacies, a. subpictus, and all anophelines by different surveillance technique is illustrated in table 3. a. subpictus was the most predominant species, while a. culicifacies comprised only 0.01% (2/10,626) of all indoor resting mosquitoes. all other anopheline species were present, but in much less densities (< 14%). a total of 1,790 anopheles representing 12 species were recorded from 3,560 traps performed during the study period. a. subpictus (63.85%) was the most abundant species (1,143/1,790), followed by 12.12% (217/1,790) of anopheles nigerrimus, 10.95% (196/1,790) of anopheles vagus, 5.86% (105/1,790) of anopheles peditaeniatus, 3.52% (63/1,790) of anopheles barbirostris, 1.45% (26/1,790) of anopheles pallidus, 0.84% (15/1,790) of anopheles varuna, 0.78% (14/1,790) of anopheles annularis, 0.28% (5/1,790) of anopheles barbumbrosus, 0.22% (4/1,790) a. culicifacies, 0.05% (1/1,790) of anopheles jamesii, and 0.05% (1/1,790) of anopheles tessellatus. a total of 42,325 anophelines belonging to 15 species were recorded from 1,621 hut days. a. peditaeniatus, 42.97% (18,185/42,325), was the most dominant species followed by a. nigerrimus, 30.57% (12,938/42,325). a total of 11,622 anophelines representing 16 species were collected from 1,620 trap - days of collection. the average number of anopheline collected per trap day was 7.2. among the 16 species collected, the most predominant species was a. subpictus, 46.62% (5,419/11,622), followed by 15.26% (1,774/11,622) of a. nigerrimus, 10.4% (1,209/11,622) of a. peditaeniatus, 9.35% (1,087/11,622) of a. vagus, 5.16% (600/11,622) of a. annularis, 4.85% (564/11,622) of a. barbirostris, 4.48% (521/11,622) of a. pallidus, and 1.91% (138/11,622) of a. jamesii. immature stages were collected from all types of breeding sites recorded in each locality of the sentinel sites on a monthly basis (table 3). a. subpictus 24.72% (5,278/21,347) was predominant followed by 24.67% (5,267/21,347) of a. nigerrimus and 14.56% (3,109/21,347) of a. peditaeniatus. the total annual rainfall in 2010 and 2011 was 1376.22 mm and 2532.44 mm, respectively. the highest rainfall was recorded during the months of october to december (figure 2). the mean relative humidity was 60% during the study period while the mean monthly temperature ranged from 25.0c to 30.4c (figure 2). the association between both adult and larval anopheline densities and climatic variables, namely, rf, tm, and rh, were investigated by correlation analysis. a. culicifacies density in hc was positively, though not significantly, correlated with rf having a one - month lag period (r = 0.25 ; p = 0.23) and a two - month lag period (r = 0.39 ; p = 0.063). a. subpictus and all anopheline densities in hc were positively, though not significantly, correlated with rf having one - month lag (r = 0.05 ; p = 0.81, r = 0.087 ; p = 0.69, resp.). a. culicifacies, a. subpictus, and all anopheles densities recorded from hc were positively, though not significantly, correlated with rh having a one - month lag period (r = 0.28 ; p = 0.15, r = 0.21 ; p = 0.35, r = 0.24 ; p = 0.27, resp.) and a two - month lag period (r = 0.35 ; p = 0.11, r = 0.30 ; p = 0.17, r = 0.32 ; p = 0.14, resp.). mean temperature of the current month was positively correlated with a. subpictus density in hc (r = 0.28 ; p = 0.177) (table 5). a. culicifacies and a. subpictus densities were positively, but not significantly, correlated with rf of the current month (r = 0.36, 0.29 ; p = 0.07, 0.15, resp.). there was a positive but not significant correlation between rh of the current month, a. culicifacies (r = 0.242 ; p = 0.245). a. subpictus density was positively correlated with rh having a one - month lag period (r = 0.399 ; p = 0.054) and a two - month lag period (r = 0.389 ; p = 0.067). a. culicifacies density was positively correlated (not significant though) with tm having a one - month (r = 0.196 ; p = 0.357) and a two - month lag periods (r = 0.18 ; p = 0.408) (table 5). a. culicifacies density was positively correlated with rf of the current month (r = 0.187 ; p = 0.37), having one - month lag (r = 0.25 ; p = 0.25) and two - month lag periods (r = 0.33 ; p = 0.125). the rh of the current month (r = 0.21 ; p = 0.3), having one - month lag period (r = 0.27 ; p = 0.20) and having two - month lag period (r = 0.2 ; p = 0.35), was correlated with a. culicifacies. mean temperature of the current month, having one- and two - month lag periods, was negatively correlated with a. culicifacies and a. subpictus densities (table 5). a. culicifacies density was positively correlated, though not significant, with rf of the current month (r = 0.066 ; p = 0.75), having one - month lag (r = 0.23 ; p = 0.28) and two - month lag periods (r = 0.36 ; p = 0.09). a. subpictus was positively correlated with the rf of the current month (r = 0.31 ; p = 0.31) and rf having two - month lag period (r = 0.31 ; p = 0.13). relative humidity of the current month, having one- and two - month lag periods, was positively correlated with a. culicifacies and a. subpictus densities (table 5). all anophelines densities including a. culicifacies and a. subpictus densities were negatively correlated, though not significant, with tm of the current month, having one- and two - month lag periods. in larval collections, a. culicifacies, a. subpictus, and all anopheles were positively correlated with the tm of the current month (r = 0.18 ; p = 0.39, r = 0.53 ; p = 0.007, r = 0.30 ; p = 0.14, resp.), having a one - month lag period with a. culicifacies (r = 0.004 ; p = 0.97) and a. subpictus (r = 0.30 ; p = 0.15). larval density of a. subpictus was also positively correlated with rh having a two - month lag period (r = 0.14 ; p = 0.95). there was a significant negative significant correlation between tm of the current month, having two - month lag periods, with a. supictus and all anophelines (table 5). the density of all anopheline was observed to be high during the monsoonal rains (may to july and november to january) (figure 3). a. subpictus was the most abundant and only indoor resting species collected throughout the study period. a. culicifacies was also collected from trincomalee district only in december 2011 and january 2012, but very little in numbers when compared to a. subpictus. all anopheline density by wtc was high during november to january periods (figure 4). the highest indoor resting densities by wtc peaked approximately one to two months after a high rainfall received for a particular period. the similar pattern was observed for a. subpictus also a. culicifacies was detected only in october 2011. the highest densities were observed during may to june and november to february (figure 5). all anopheline density was high in july 2010, march 2011, and january 2012. a. subpictus density was observed to be high during december 2010 to may 2011 with increasing rainfall. the outdoor resting anopheline density by cbhc peaked approximately one to two months after that of the indoor resting population. a. subpictus density by cbhc was low, when the indoor resting by hc was observed to be high. it was recorded only from october 2011 to april 2012 throughout the study period, where the highest density was detected in december 2011. the larval density of all anophelines was high during february to may in both 2011 and 2012, approximately one to three months after heavy rains were received in december 2010 and october 2011, respectively (figure 7). a similar pattern was not identified for a. subpictus densities, where the higher densities were found in march to may in both years. a. culicifacies was detected continuously since may 2011 to june 2012 except in january 2012. the abundance of malaria vector anopheles mosquitoes has not been studied in some parts of sri lanka, especially in northern and eastern provinces over the past 30 years because of the security situations. mosquito species may have shifted their niche with changing weather patterns and ecology in order to attain a wide dissemination in the environment. the current investigation was focused on the study of malaria vectors and their abundance in selected areas in trincomalee district. vector incrimination studies done for most of these anopheline species under experimental laboratory and field conditions have been reported to play a role in malaria transmission in sri lanka. hence, the study of their abundance becomes important for implementation of effective malaria control measures. anopheles subpictus, the predominant species in all collection techniques we carried out including intradomestic habitats, was the only anopheline species recorded throughout the study period in indoor habitats. although a. subpictus has been incriminated only as a secondary vector of malaria in sri lanka, given its relative abundance in intra- and peridomestic habitats, it is possible that it plays a more dominant role as a primary vector in the transmission of malaria in sri lanka. the outdoor resting anopheline population demonstrated two distinctive peaks corresponding to periods following monsoonal rains. about 47% and 5% of collections from cbht and cbnt, respectively, were a. subpictus. in cattle - baited net trap collections, anopheles peditaeniatus (43%) and anopheles nigerrimus (31%) were observed ; they were not encountered among the indoor resting populations, indicating their exclusive exophilic nature. the presence of a. nigerrimus in these areas might contribute to malaria transmission since this species is considered as a secondary vector for malaria. however, indoor residual spraying of insecticides (irs) is commonly used as the major malaria control intervention targeting adult mosquitoes. therefore, the tendency of resting adult vector mosquitoes in outdoor resting surfaces will depreciate the effectiveness of irs as a controlling measure. hence, the health authorities need to be vigilant to prevent any future epidemics of malaria in these areas.. this technique may be good to study the general mosquito abundance in an area especially in monitoring vector species during a malaria elimination phase as in sri lanka and even thereafter. the results revel that the mosquitoes collected from cbnt were approximately five times than those of cbht. the possible reason for this observation may be the fact that since the cbht is a fixed one at a permanent place, the collection may vary with the seasonality. however, the cbnt is a mobile trap ; therefore, during the study period the net traps were placed in different locations proximity to breeding sites and resting places of adult mosquitoes. the seasonal distribution of anopheline varies in time and space depending upon environmental conditions and availability of breeding habitats. the minimal larval breeding in the district was observed, when rainfall was above 400 mm a month probably due to flushing of larvae as a result of high levels and rapid flow of water in streams and rivers and subsequent flooding that may have led to larval deaths due to reduction in oxygen tension causing physical harm to the larvae. larvae of anopheles mosquitoes have been found in aquatic bodies such as rice fields, the edges of streams and rivers, and small temporary rain pools. many species prefer habitats with vegetation, while some breed in open, sunlit pools. the frequency of larval occurrence varied considerably in different habitats. in this study, anopheles subpictus was the predominant species indicating the presence in all 21 habitat categories. there was no habitat found to have larvae of a single anopheline species. some species such as anopheles annularis, anopheles varuna, anopheles tessellatus, anopheles barbirostris, anopheles barbumbrosus, anopheles pallidus, and anopheles pseudojamesi were limited to selective breeding habitats. this pattern of larval distribution has been attributed to the specificity of mosquito species to prefer different degrees of physicochemical properties of larval habitats. interestingly, anopheles culicifacies, a. subpictus, and some potential vectors were encountered in a variety of breeding habitats including blocked drains with wastewater having low dissolved oxygen levels (<3 mg this has serious implications on the epidemiology of malaria in general and the application of control measures in the country in particular, which have focused on rural populations based on the bioecology of the vector. rapid unplanned urbanization observed in many parts of the country is changing the context of human population settlements and natural ecosystem interactions that may have contributed to adaptation of anopheline breeding sites that we observed in this study. the evidence of the adaptation and survival of a. culicifacies and a. subpictus in polluted water should be a warning signal of the potential for the emergence of urban malaria in sri lanka, a phenomenon that has not been reported yet. this needs to be seriously considered by malaria control authorities as the majority of malaria cases reported recently in the country are imported cases detected in people in urban areas. moreover, adaptation of anophelines to breed in polluted water in urban areas could be a serious concern when a. stephensi plays an important role in transmitting urban malaria in neighboring southern india. during this study, there was minimal variation in temperature and humidity. the mean monthly temperature ranged between 25.0c and 30.4c ; the upper limit of rh was over 62% (62.2%88.5%). the minimal variation in temperature and humidity may also have contributed to the lack of relationship between the abundance of anopheline species and climate variables. the fact that this study could not sample all possible resting or breeding sites of anophelines in the different localities is acknowledged ; our assessment of overall anopheline abundance is based on obtaining representative samples from the selected sampling sites. it is possible that rapid changes in weather conditions and availability of breeding sites within the month may have influenced our results. the association between rainfall and density of vectors may have been confounded by changes in the environment affecting the mosquito population and application and effectiveness of malaria control interventions in these areas. only a few mosquito species recorded in the country have been incriminated as malarial vectors. it is important to monitor the density of these species, both indoors and outdoors, as well as their breeding habitats for application of vector control measures as sri lanka is on the threshold of malaria elimination. a key point from these results is the potential impact of other mosquito species mainly a. subpictus and a. nigerrimus on malaria transmission. this survey makes an important contribution in assessing relative abundances of mosquito vectors which may not be considered in malaria control intervention and may point to ways in which mosquito control could be targeted to address the transmission potential of these vectors. additionally, a. culicifacies may actually contribute a relatively small amount of transmission given its low abundance, which again is an important point for effective vector control under the current malaria elimination program in sri lanka. it is important to determine the abundance, distribution, biology, and relationship with climatic factors of main and secondary malaria vectors in sri lanka in order to apply efficient controlling programs under the current malaria elimination program in sri lanka. | background. malaria was an endemic problem in trincomalee district, eastern province of sri lanka. very few recent data concerning anopheles are available which transmit malaria. therefore, the aim of this study is to identify various anopheles species and the dynamics of anophelines including malaria vectors in trincomalee district for effective vector control under the current malaria elimination program embarked in the country. method. entomological surveys were conducted on a monthly basis, using five entomological techniques, namely, indoor hand collection (hc), window trap collection (wtc), cattle - baited net collection (cbnc), and cattle - baited hut collection (cbhc) from june 2010 to june 2012 in 32 study areas under five entomological sentinel sites. results. seventeen anopheline species were encountered, of which anopheles subpictus was the predominant species in all sampling methods. it is noted that a. culicifacies and a. subpictus have adapted to breed in polluted water in urban settings which may cause serious implications on the epidemiology of malaria in the country. conclusions. it is important to determine the abundance, biology, distribution, and relationship with climatic factors of main and secondary malaria vectors in sri lanka in order to initiate evidence based controlling programs under the current malaria elimination program in sri lanka. |
extensive functional magnetic resonance imaging (fmri) research over the last 25 years has revealed abnormal brain activation patterns in major depression. evidence from numerous imaging studies converges on an imbalance between a hypoactive prefrontal network and a hyperactive limbic network [1, 2 ]. this imbalance is proposed to underlie altered emotional and cognitive processing, such as increased reactivity as well as increased attentional and cognitive bias towards negative stimuli in major depressive disorder [3, 4 ]. the hypoactive cortical circuit mainly comprises the dorsolateral prefrontal cortex (dlpfc), the ventrolateral prefrontal cortex (vlpfc), the dorsal cingulate cortex (dacc) and the inferior parietal cortex. the limbic network is mainly comprised of the ventral or subgenual anterior cingulate cortex (vacc), the hippocampus, the hypothalamus, the amygdala and the insula. interestingly, this neural activation pattern seems, at least partly, reversed by the intake of psychopharmacological substances, e.g., antidepressants. in the last ten years, substantial research has been undertaken to identify the effects of antidepressant treatment (e.g., selective serotonin reuptake inhibitors (ssri), noradrenalin reuptake inhibitors (nri)) on neural circuitry functioning in major depression. a considerable part of this research has dealt with the short - term effects of antidepressant treatment on neural activation patterns in healthy subjects, using the so - called pharmacological fmri design. most of this research in patients and healthy subjects has been devoted to the pharmacological effects on the processing of emotions and on their underlying neural correlates. in the following review, we briefly summarize studies on short - term effects of antidepressant medication on brain activation patterns in healthy individuals. then, we investigate the antidepressant treatment effects on brain activation patterns in patients with (major) depression and we conclude with studies exploring potential predictive neural markers of successful clinical response during the depressive state. moreover, as an attempt to account for some discrepant findings reported mainly in studies in depressed patients, we discuss the potential role of the specific paradigm employed in each study as a factor that could have a crucial impact on brain activation patterns and may interact with treatment effects. such an attempt to take into account potential confounding effects of the specific paradigm has not been made in previous reviews and has not been formally tested (mainly due to insufficient number of studies) by meta - analyses on the topic. in healthy subjects, most studies investigated the single - dose effects of selective serotonin reuptake inhibitors (ssris) or (selective) noradrenalin reuptake inhibitors (nris) on blood oxygenation level dependent (bold) responses to different kind of emotional stimuli (pictures, words, faces) or emotional tasks. for clarity, we grouped findings from these studies based on the substance under investigation. in a series of studies, investigating the effect of ssri intake on bold responses to emotional and neutral stimuli in healthy, never - depressed participants, decreased amygdala activity in response to aversive stimuli has been observed relatively consistently [6 - 12 ]. this effect has been shown in studies using single dose treatment [6, 8, 10, 11 ] as well as those applying a 7 to 21 days treatment [7, 9, 12 ] with an ssri (e.g., citalopram, escitalopram, fluvoxamine). further, attenuation of limbic (mainly amygdala) activation to aversive stimuli after ssri treatment was reported during overt and covert stimulus presentation as well as for different stimulus types (faces, pictures). norbury and colleagues even showed increased amygdala responses to happy faces following 7 to 10 days ssri treatment. in addition to the described changes in task - related neural activation after ssri administration, pharmacological intervention also appears to modify healthy individual s resting - state neural activity. recently, kraus and colleagues observed enhanced resting - state connectivity within ventral precuneus and pcc (dmn) in healthy study participants after 10 days ssri treatment and this enhanced connectivity was associated with gray matter volume increases in the pcc and ventral precuneus. furthermore, following a 2-weeks duloxetine treatment, functional connectivity between the default mode network (dmn) and task - positive network (tpn) was decreased, showing reduced connectivity between medial pfc and lateral parietal cortex and decoupling between medial pfc and dorsolateral pfc. this effect may reflect less self - referential processing after antidepressant treatment, leading to less negatively biased self - perception and rumination. in line with this finding, depressed patientsexhibited increased dominance of the dmn over the tpn at rest compared to healthy subjects and this dmn dominance over tpn was associated with higher levels of rumination. studies investigating the effects of noradrenaline reuptake inhibitors on neural response patterns to emotional stimuli in healthy individuals are more sparse. after single dose reboxetine administration, norbury and colleagues showed similar dampening effects on amygdala responses to fearful faces and increased amygdala response to happy faces. further, in a task where participants are instructed to categorize and subsequently recognize self - referent positive and negative personality trait words, single - dose reboxetine administration had no effect on neural response patterns during categorizing personality traits, but in the following recognition test participants receiving reboxetine showed reduced activation in fronto - parietal brain circuits during the correct recognition of positive target vs. distractor words, accompanied by an increased speed to recognize positive vs. negative self - referential words. this finding suggests facilitated memory retrieval for positive self - referential stimuli after single - dose reboxetine intake. these effects were partially replicated in a second study of that group which applied a 7 days reboxetine treatment. in this study, reboxetine also changed neural response patterns during the categorization of self - referent positive personality characteristics by increasing activation in the precuneus and inferior frontal gyrus. reversely, decreased neural activation in the precuneus, acc and medial frontal gyrus was observed during the recognition of positive words. this reversal of neural activation patterns has been proposed to underlie increased positive bias following successful treatment in depressive patients. this is in line with results from papadatou - pastou and colleagues who showed that, after single dose reboxetine treatment, brain activation differences in the processing of positive versus negative autobiographical memories were accompanied by increased memory speed for positive memories in healthy individuals. few studies have investigated the differential effects of serotonin and noradrenalin reuptake inhibitors on neural activation patterns. comparing the neural responses to rewarding and aversive stimuli before and after ssri and nri treatment in healthy individuals demonstrated decreased activation of ventral striatum and ventral medial ofc to rewarding stimuli after ssri treatment, but increased activation in medial ofc and no suppression of ventral striatal activity to reward after nri treatment. this result nicely mimics clinical observations and patient reports of emotional blunting during ssri treatment. both substances had beneficial effects for the processing of aversive stimuli, reflected by decreased activation of lateral ofc to aversive stimuli. taken together, results of pharmacological fmri studies in healthy individuals present a pattern of decreased limbic (mainly amygdala) activation in response to aversive stimuli and either unchanged or increased neural activity to positive stimuli after ssri treatment. unfortunately, only few studies included positive stimuli in their experimental paradigms or they collapsed stimuli of different valence in the respective data analyses. interestingly, nri treatment seems to facilitate processing of positive information (e.g. memory for positive events ; categorization or recognition of positive personality traits) and reward, whereas at least for rewarding stimuli, ssri appears to have an opposite effect. in a series of studies, investigating the effect of ssri intake on bold responses to emotional and neutral stimuli in healthy, never - depressed participants, decreased amygdala activity in response to aversive stimuli has been observed relatively consistently [6 - 12 ]. this effect has been shown in studies using single dose treatment [6, 8, 10, 11 ] as well as those applying a 7 to 21 days treatment [7, 9, 12 ] with an ssri (e.g., citalopram, escitalopram, fluvoxamine). further, attenuation of limbic (mainly amygdala) activation to aversive stimuli after ssri treatment was reported during overt and covert stimulus presentation as well as for different stimulus types (faces, pictures). norbury and colleagues even showed increased amygdala responses to happy faces following 7 to 10 days ssri treatment. in addition to the described changes in task - related neural activation after ssri administration, pharmacological intervention also appears to modify healthy individual s resting - state neural activity. recently, kraus and colleagues observed enhanced resting - state connectivity within ventral precuneus and pcc (dmn) in healthy study participants after 10 days ssri treatment and this enhanced connectivity was associated with gray matter volume increases in the pcc and ventral precuneus. furthermore, following a 2-weeks duloxetine treatment, functional connectivity between the default mode network (dmn) and task - positive network (tpn) was decreased, showing reduced connectivity between medial pfc and lateral parietal cortex and decoupling between medial pfc and dorsolateral pfc. this effect may reflect less self - referential processing after antidepressant treatment, leading to less negatively biased self - perception and rumination. in line with this finding, depressed patientsexhibited increased dominance of the dmn over the tpn at rest compared to healthy subjects and this dmn dominance over tpn was associated with higher levels of rumination. studies investigating the effects of noradrenaline reuptake inhibitors on neural response patterns to emotional stimuli in healthy individuals are more sparse. after single dose reboxetine administration, norbury and colleagues showed similar dampening effects on amygdala responses to fearful faces and increased amygdala response to happy faces. further, in a task where participants are instructed to categorize and subsequently recognize self - referent positive and negative personality trait words, single - dose reboxetine administration had no effect on neural response patterns during categorizing personality traits, but in the following recognition test participants receiving reboxetine showed reduced activation in fronto - parietal brain circuits during the correct recognition of positive target vs. distractor words, accompanied by an increased speed to recognize positive vs. negative self - referential words. this finding suggests facilitated memory retrieval for positive self - referential stimuli after single - dose reboxetine intake. these effects were partially replicated in a second study of that group which applied a 7 days reboxetine treatment. in this study, reboxetine also changed neural response patterns during the categorization of self - referent positive personality characteristics by increasing activation in the precuneus and inferior frontal gyrus. reversely, decreased neural activation in the precuneus, acc and medial frontal gyrus was observed during the recognition of positive words. this reversal of neural activation patterns has been proposed to underlie increased positive bias following successful treatment in depressive patients. this is in line with results from papadatou - pastou and colleagues who showed that, after single dose reboxetine treatment, brain activation differences in the processing of positive versus negative autobiographical memories were accompanied by increased memory speed for positive memories in healthy individuals. few studies have investigated the differential effects of serotonin and noradrenalin reuptake inhibitors on neural activation patterns. comparing the neural responses to rewarding and aversive stimuli before and after ssri and nri treatment in healthy individuals demonstrated decreased activation of ventral striatum and ventral medial ofc to rewarding stimuli after ssri treatment, but increased activation in medial ofc and no suppression of ventral striatal activity to reward after nri treatment. this result nicely mimics clinical observations and patient reports of emotional blunting during ssri treatment. both substances had beneficial effects for the processing of aversive stimuli, reflected by decreased activation of lateral ofc to aversive stimuli. taken together, results of pharmacological fmri studies in healthy individuals present a pattern of decreased limbic (mainly amygdala) activation in response to aversive stimuli and either unchanged or increased neural activity to positive stimuli after ssri treatment. unfortunately, only few studies included positive stimuli in their experimental paradigms or they collapsed stimuli of different valence in the respective data analyses. interestingly, nri treatment seems to facilitate processing of positive information (e.g. memory for positive events ; categorization or recognition of positive personality traits) and reward, whereas at least for rewarding stimuli, ssri appears to have an opposite effect. in this part of the review, we summarize evidence from 31 imaging studies that have examined the effects of antidepressant medication on brain activation patterns during active tasks or resting - state in depressed patients (for details on these studies please refer to table 1 for study design and clinical aspects and to table 2 for paradigm, analysis and results). the majority of these studies (30 out of 31) employed a longitudinal design and examined the effects of antidepressant medication for a period of 6 - 12 weeks [22 - 52 ]. despite the common design, there is huge variation in the type of antidepressant administered, the dose, and the dose adjustment regime. moreover, the specific paradigm used to examine medication - induced changes in brain activity varies across studies. the majority of the studies used visual stimuli with emotional valence and instructed subjects to either passively view or actively process the emotional stimuli or engage in an irrelevant cognitive task during the presentation of emotional stimuli. fewer studies examined cognitive processes (i.e. go / no go task, stroop task), resting - state functional connectivity, or reward processes (monetary incentive task). the focus on emotion - related paradigms is mainly driven by the fact that affective processes are a core domain of the pathopsychophysiology of mdd and antidepressants mainly target networks implicated in emotion processing. converging evidence from studies using emotional stimuli suggests that antidepressants exert a normalizing effect on the depressed brain by attenuating abnormally elevated responses mainly to negative stimuli in limbic areas and more pronouncedly in amygdala [22, 24, 30, 31, 40, 41, 44, 46 ]. although attenuation of amygdala responses following treatment is the most robust finding, a thorough investigation of the literature leads to the observation that less than half of the studies showed attenuation of amygdala responses to negative stimuli and most of these studies employed a paradigm where subjects implicitly process negative stimuli while being engaged on a cognitive task (usually gender identification task). interestingly, only 2 out of 7 studies using implicit processing of negative stimuli did not report any amygdala attenuation following treatment and one of them showed treatment - induced changes in amygdala functional connectivity. on the other hand, only 1 out of 7 passive viewing studies and none of the studies using explicit processing of emotional stimuli reported decreased amygdala responses following treatment. more importantly, the same studies that reported attenuated amygdala response following treatment also showed increased amygdala activation at baseline in depressed patients, compared to healthy controls, suggesting normalization of the abnormally elevated baseline amygdala response due to treatment. therefore, the aforementioned distinction between implicit emotional processing tasks and more explicit or passive viewing tasks may be mainly driven by increased amygdala engagement during implicit processing in unmedicated depressed patients. one explanation of this dissociation is that group - related differences in amygdala reactivity to negative stimuli between unmedicated mdd patients and healthy controls are more pronounced in an implicit emotion processing task where inhibition of stimulus - driven limbic responses are essential for the successful performance of the cognitive task. on the other hand, during passive viewing or explicit processing of emotional stimuli no such inhibition of limbic responses this assumption is in line with a recent review where the authors concluded that additional neuronal resources from the parietal and lateral prefrontal cortices are recruited by medicated mdd subjects during automatic attentional control of emotional information, and during automatic cognitive control. they argued that these additional resources act to override strong bottom - up emotional influences as part of an automatic emotion regulation strategy that may also occur during an implicit emotion processing paradigm. despite the plausibility of this explanation, for instance, 7 out of 8 studies reporting attenuation of amygdala responses after treatment performed region - of - interest (roi) analysis using amygdala masks, raising the question of whether the effect attributed to the type of paradigm is confounded by the analysis method (i.e. roi or whole brain). another robust treatment - related effect in the depression literature is the hyperactive pfc especially in response to negative stimuli. it has been argued that antidepressants act to normalize the hypoactive baseline pfc response especially in response to negative stimuli. neural activity in the lateral pfc modulates limbic responses to emotional stimuli and inhibits enhanced emotional reactivity. thus, normalized pfc activation following treatment may increase the ability for top - down control of emotional processes. medication - related changes in pfc activity were reported in both emotional and cognitive paradigms. however, following treatment, enhancement of pfc activation is found in studies using affective paradigms such as passive viewing of emotional faces, emotion recognition task, and backward masking of emotional faces [28, 33, 42, 43, 47, 51 ] whereas attenuation of pfc activity is reported during cognitively demanding conditions such as the stroop task, emotional oddball task, go / no go task, and self - judgment task [25, 34, 39, 48 ] in depressed patients. this dissociation may be related to the different cognitive demands of the two different types of paradigms or the presence or not of an emotional context. alternatively, employment of automatic or voluntary emotion regulation strategies could also have contributed to differential pfc activation. it has been argued that additional neuronal resources from pfc are recruited by medicated mdd subjects mainly during automatic emotion regulation strategies while during voluntary emotion regulation mdd subjects displayed decreased pfc activation relative to hc. the anterior cingulate cortex (acc) extending from the subgenual part to dorsal acc has also been implicated in mdd. imaging studies have reliably shown increased baseline acc activation especially in response to negative stimuli in mdd patients (see for a meta - analysis). however, heterogeneous findings have been reported for the dorsal, pregenual and subgenual portion of acc with the hyperactive baseline dorsal acc being the most robust finding in the depression literature. despite the relative heterogeneity in the baseline activity levels in mdd, medication - related changes converge on an attenuated acc activity relative to baseline in a variety of tasks ranging from backward masking of emotional faces and implicit processing of emotional stimuli to stroop color word task [24, 25, 30, 33, 36, 39, 47, 48, 51 ]. only one study reported increased activation of left acc after antidepressant treatment. taken together, evidence from these longitudinal studies lends support for a normalizing effect of antidepressants on abnormally elevated baseline acc activity that may reflect increased emotional appraisal and an over reactive salience network in response to negative stimuli. another major component of the salience network, the insular cortex, has also been implicated in mdd. numerous imaging studies have shown increased baseline insular activity in mdd (see for a meta - analysis). however, the pattern of medication - related changes in insula activity are more sparse (only five studies) and more heterogeneous in the depression literature. following treatment with antidepressants, two studies [27, 43 ] reported increased insular activation in mdd patients whereas three studies [30, 36, 51 ] reported attenuated insular responses. despite the different direction of the treatment effect, antidepressants seem to have a normalizing effect in all these studies. the heterogeneity of findings related to baseline insular activation and the antidepressants effects probably reflect the heterogeneous function of this region and allow no firm conclusions to be drawn from these data. treatment - related effects on visual cortex areas seem to be contingent to the valence of the stimuli as treatment increased activation in response to positive stimuli and decreased activation in response to negative stimuli. this pattern is partly similar to the one observed for limbic regions and it can be argued that antidepressants normalize response of the visual cortex in response to the baseline pattern. importantly, the baseline pattern of activation in visual areas and especially in fusiform gyrus supports the hypothesis of a negativity bias in mdd and further suggests that this bias towards negative and away from positive stimuli may be introduced early at the perceptual level [1, 28, 54, 55 ]. given the strong interaction between amygdala and visual cortex during emotional facial processing [56, 57 ], this pattern of activation in the visual cortex may be driven by visual - limbic feedback loop and may be biased in depression due to the hyperactive limbic system. another issue that to date has not been addressed sufficiently in the relevant literature is the effect of antidepressants on functional connectivity and especially on the functional interactions between cortical and subcortical areas. to our knowledge, only three studies have investigated patterns of functional connectivity following antidepressant treatment in depressed patients [23, 26, 35 ]. evidence from these studies, converge on a view that antidepressant treatment enhances coupling between subcortical and cortical areas. following treatment, chen and colleagues demonstrated increased functional connectivity between bilateral amygdala and prefrontal cortex, acc, and subcortical regions during processing of sad faces. similarly, anand and colleagues showed increased acc functional connectivity with thalamus and striatal regions during passive viewing of negative pictures. taken together, the treatment - induced attenuation of amygdala and acc activity, the enhancement of pfc activity, and the increased functional corticolimbic coupling especially in response to emotional stimuli lend support for a normalizing effect of antidepressants on limbic and pfc activity and at the same time enhancement of the functional interaction between these two networks in an effort to compensate for the emotion regulation deficits and to inhibit the increased emotional reactivity that characterize mdd patients. response rates to first - line antidepressant treatment range from 50 - 75%. to date, no clinically useful marker has emerged that can reliably predict clinical response or guide treatment. the last 15 years, numerous neuroimaging studies have sought to identify neural biomarkers (functional and structural) that can predict symptom improvement in depressed patients. a recent meta - analysis of fmri and pet studies concluded that increased acc activity extending into the orbitofrontal cortex and decreased baseline activation of right striatum and anterior insula in acutely depressed patients can predict clinical response to pharmacological or cognitive behavioral therapy (cbt). however, there is substantial heterogeneity of findings implicating other brain regions such as visual cortex or suggesting the inverse relationship between symptom improvement and brain activity. these discrepant findings may be explained by the heterogeneous patient groups, the variety of tasks used ranging from resting - state, to implicit emotional processing and from explicit emotional evaluation to non - emotional cognitive tasks, or the different types of treatment (i.e. pharmacological vs cbt). for instance, the well - replicated correlation between increased acc and clinical response seems to be mainly driven by studies that employed tasks with emotional pictures or sad faces. on the other hand, resting - state studies showed hypermetabolism of acc at baseline in subjects with poorer clinical response. furthermore, acc and anterior insula hyperactivity is more likely to predict response to medication, while hypoactivity in the same areas is associated with response to cbt suggesting that baseline activity in these two areas may in future serve as a criterionfor the type of first - line treatment that will most likely lead to remission. future studies addressing these questions would also benefit from the investigation of treatment - related changes in bold activity in the predictive regions. for instance, siegle and colleagues showed that low sgacc activity in patients compared to healthy controls predicts clinical response butremains low after treatment in responders indicating that a marker of clinical response is not necessarily a good neural target for therapy. taken together, results of pharmacological fmri studies in healthy and depressed individuals present a pattern of decreased limbic (mainly amygdala) activation in response to aversive stimuli and either unchanged or increased neural activity to positive stimuli following antidepressant treatment. it seems that attenuation of acc responses is specific to depressed patients and this may be relevant to the high predictive value of this area as neural marker of clinical response. it should be noted though that this comparison is severely compromised by the vast differences in the study designs and the duration of the treatment (longitudinal design for patients and double - blind, placebo - controlled for healthy subjects) between studies in healthy individuals and patients. nonetheless, a normalizing effect of antidepressants on limbic, acc and pfc activity and at the same time enhancement of the functional interactions between these two networks is obvious in depressed patients. it should be noted that the aforementioned model is only a simplified version of the complex nature of the antidepressant effects on the depressed brain. there is a lack of consistency of positive findings and a relatively great amount of null findings in the literature which could be attributed to differences in the patient population, type of medication and medication dose, the success rate of the pharmacological therapy and the type of analysis used (e.g. whole - brain exploratory or a priori roi analysis). another general limitation in this literature is the absence of placebo - controlled patient studies controlling for a medication - independent depression recovery. most importantly, the context - specific and paradigm - dependent nature of activation findings has been neglected by previous reviews and meta - analyses on the topic. this review constitutes a first attempt to organize the existing literature based on the paradigm employed in each study. using this classification, we offered some speculative explanations for the discrepant findings in the reviewed literature especially regarding the treatment effects on amygdala. nonetheless, it is essential to address these questions by means of meta - analytic studies (provided enough single studies are available for such a meta - analysis) or single studies that can statistically investigate the effects of all these potential factors. another open question is whether and to what extent functional neuroimaging data at baseline can predict clinical response after treatment. recent studies suggest that imaging data have enough predictive capacity to serve as prognostic markers. however, high predictive accuracy at the individual level is required to translate these findings into clinical application. this can be achieved by pattern recognition methods such as support vector machines that have recently shown moderate sensitivity and specificity in discriminating between responders and non - responders at the individual level. | in the last two decades, neuroimaging research has reached a much deeper understanding of the neurobiological underpinnings of major depression (md) and has converged on functional alterations in limbic and prefrontal neural networks, which are mainly linked to altered emotional processing observed in md patients. to date, a considerable number of studies have sought to investigate how these neural networks change with pharmacological antidepressant treatment. in the current review, we therefore discuss results from a) pharmacological functional magnetic resonance imaging (fmri) studies investigating the effects of selective serotonin or noradrenalin reuptake inhibitors on neural activation patterns in relation to emotional processing in healthy individuals, b) treatment studies in patients with unipolar depression assessing changes in neural activation patterns before and after antidepressant pharmacotherapy, and c) predictive neural biomarkers of clinical response in depression. comparing results from pharmacological fmri studies in healthy individuals and treatment studies in depressed patients nicely showed parallel findings, mainly for a reduction of limbic activation in response to negative stimuli. a thorough investigation of the empirical findings highlights the importance of the specific paradigm employed in every study which may account for some of the discrepant findings reported in treatment studies in depressed patients. |
the pancreas has a diverse cellular heterogeneity and function, and can give rise to a number of histologically distinct malignancies. most malignant cancers originate from the ductal epithelium or endocrine cells and include pancreatic ductal adenocarcinomas (pdac) and malignant endocrine tumors (pets). each histologic type has a different molecular signature and clinical course ; pdacs are associated with the worst prognosis, and pets are usually less aggressive.1,2 most patients with pdac (85%) present with locally advanced or metastatic tumors that are unresectable. treatment with gemcitabine - based chemotherapy has been shown to significantly improve survival, albeit to only a small degree.3 in contrast, pets usually present at an earlier stage. chemotherapy is determined by the grade of the tumor, with high - grade tumors more likely to respond.46 thus, the goal of treatment for unresectable pdac or pet is treatment with chemotherapy. by virtue of the anatomic location of the pancreas, locally advanced pdac or pets can lead to thrombosis or occlusion of the splenic, superior mesenteric (smv), and/or portal (pv) vein(s) with resultant hypersplenism. as in patients with cirrhosis and portal hypertension in addition, cytotoxic chemotherapeutic regimens, especially gemcitabine, often induce bone marrow suppression, which results in thrombocytopenia. when this occurs, many patients must stop their treatment, since serious and potentially lethal side effects could develop. we hypothesized that a palliative splenectomy for patients with locally advanced unresectable pdac or pets who developed hypersplenism and thrombocytopenia that limited the administration of chemotherapy, would extend the duration of treatment and improve disease - specific survival (dss). to investigate our hypothesis, we analyzed our experience with 15 patients who were managed with this novel treatment strategy and compared the survival of the pdac subgroup of patients with stage - matched historical controls. approval from the university of california, los angeles office for the protection of research subjects institutional review board was obtained prior to initiating this study. using a prospectively collected pancreatic cancer database, we performed a review of all patients from 2001 to 2009 with locally advanced or metastatic fine needle aspirate or biopsy (core needle, incisional, or excisional) confirmed pdac or pet who were unresectable and underwent a splenectomy for severe thrombocytopenia that developed during administration of chemotherapy. the pathology reports were generated by one of four gastrointestinal pathologists on faculty at ucla. the clinical, radiographic, and histopathologic findings ; treatment and perioperative variables ; and dss of these patients were examined. clinical variables analyzed included gender, age, and stage at the time of diagnosis, and tumor histology (pdac and pet). radiographic variables analyzed included location of the tumor and pv / smv / splenic vein status (patent vs. nonpatent) on high resolution computed tomography (ct) or magnetic resonance imaging (mri) scans. treatment variables analyzed included the pre- and post - splenectomy chemotherapeutic regimen administered and tumor response. variables directly related to splenectomy that were examined included length of hospital stay, need for conversion to an open operation, white blood cell count and hemoglobin immediately after surgery (postoperative day 1), and pre- and postoperative platelet counts. the time to resumption of chemotherapy after splenectomy was also examined. for survival analysis, the dss of all patients with pdac from the time of diagnosis or splenectomy was examined. for those patients who died, the date of death was determined from the clinic charts when available, or alternatively, the social security death index (http://ssdi.rootsweb.ancestry.com/cgi-bin/ssdi.cgi) by an exact match between the patient 's name and birth date. if alive, the date of last follow - up was taken as the last time the patient was seen in clinic. the two patients with pet were not included in the survival analysis, as pet are less clinically aggressive than pdac. for significance analysis, x and fisher 's exact test all statistical analyses were performed using jmp statistical software (sas corporation, cary, nc). approval from the university of california, los angeles office for the protection of research subjects institutional review board was obtained prior to initiating this study. using a prospectively collected pancreatic cancer database, we performed a review of all patients from 2001 to 2009 with locally advanced or metastatic fine needle aspirate or biopsy (core needle, incisional, or excisional) confirmed pdac or pet who were unresectable and underwent a splenectomy for severe thrombocytopenia that developed during administration of chemotherapy. the pathology reports were generated by one of four gastrointestinal pathologists on faculty at ucla. the clinical, radiographic, and histopathologic findings ; treatment and perioperative variables ; and dss of these patients were examined. clinical variables analyzed included gender, age, and stage at the time of diagnosis, and tumor histology (pdac and pet). radiographic variables analyzed included location of the tumor and pv / smv / splenic vein status (patent vs. nonpatent) on high resolution computed tomography (ct) or magnetic resonance imaging (mri) scans. treatment variables analyzed included the pre- and post - splenectomy chemotherapeutic regimen administered and tumor response. variables directly related to splenectomy that were examined included length of hospital stay, need for conversion to an open operation, white blood cell count and hemoglobin immediately after surgery (postoperative day 1), and pre- and postoperative platelet counts. for survival analysis, the dss of all patients with pdac from the time of diagnosis or splenectomy was examined. for those patients who died, the date of death was determined from the clinic charts when available, or alternatively, the social security death index (http://ssdi.rootsweb.ancestry.com/cgi-bin/ssdi.cgi) by an exact match between the patient 's name and birth date. if alive, the date of last follow - up was taken as the last time the patient was seen in clinic. the two patients with pet were not included in the survival analysis, as pet are less clinically aggressive than pdac. all statistical analyses were performed using jmp statistical software (sas corporation, cary, nc). from 2001 to 2009, 15 patients with unresectable pancreatic cancer who developed hypersplenism and thrombocytopenia, which limited the administration of their chemotherapy, underwent a splenectomy at ucla medical center. the distribution of the clinical, radiographic, and histopathologic findings for these patients is listed in composite in table 1 and individually in table 2. thirteen patients (87%) had primary disease ; two patients (13%) recurred after a whipple operation. the median age of patients was 56 years (range 25 to 62 years). most patients had pdac (n = 13, 87%), while only two patients had pet (13%). all patients had locally advanced, stage 3 (n = 6, 40%) or metastatic, stage 4 nine tumors (60%) were located in the head / uncinate process and 6 (40%) were located in the body / tail. on high - resolution ct / mri, the portal or splenic veins were thrombosed in 12 (80%) patients (fig. in fact, splenomegaly was not routinely reported in the radiology report per the usual practice of the ucla gastrointestinal radiologists for pancreas - protocol ct scans or mris. the median spleen weight was 348 g (range 164525) but may be an underestimate of the actual spleen size due to morcellation prior to extraction. the spleen volumes are likewise not reported for similar reasons. table 1composite patients ' clinical, radiographic, treatment, and histopathologic characteristicsage (median years)56 (2562)gendermale9 (60%)female6 (40%)histopathologypdac13 (87%)pet2 (13%)locationhead / uncinate9 (60%)body / tail6 (40%)vein thrombosed12 (80%)splenectomy (procedure type)laparoscopic11 (73%)laparoscopic converted to open4 (27%)hospital stay (median days)3 (26)platelet countpreoperative (median 10)87 (66160)postoperative (median 10)425 (229994)p 0.05). recorded immediately after surgery, the white blood cell count (median 11.05 10/l, range 4.26 1021 10) and hemoglobin (median 11.75 g / dl, range 9.213.3) did not reveal evidence of bone marrow suppression due to preoperative chemotherapy. at the time of splenectomy, 12 patients had national cancer institute (nci)/eastern cooperative oncology group (ecog) grade 1 thrombocytopenia (defined by 75 10150 10), two patients had nci / ecog grade 2 (defined by 50 1074 10), and one patient had impending nci / ecog - defined thrombocytopenia. the platelet counts significantly responded to splenectomy in all patients, preoperative (median 87 10/l, range 66 10160 10) vs. postoperative taken immediately prior to discharge (median 425 10/l, range 229 10994 10), (p 0.05). recorded immediately after surgery, the white blood cell count (median 11.05 10/l, range 4.26 1021 10) and hemoglobin (median 11.75 g / dl, range 9.213.3) did not reveal evidence of bone marrow suppression due to preoperative chemotherapy. at the time of splenectomy, 12 patients had national cancer institute (nci)/eastern cooperative oncology group (ecog) grade 1 thrombocytopenia (defined by 75 10150 10), two patients had nci / ecog grade 2 (defined by 50 1074 10), and one patient had impending nci / ecog - defined thrombocytopenia. the platelet counts significantly responded to splenectomy in all patients, preoperative (median 87 10/l, range 66 10160 10) vs. postoperative taken immediately prior to discharge (median 425 10/l, range 229 10994 10), (p < 0.01). all patients were able to resume full dose of the same chemotherapy regimen after splenectomy within a median of 11.5 days (range 627). the median follow - up for all survivors was 35 months (range 1363) from the time of diagnosis and 25 months (range 0.651) from the time of splenectomy. the 13 patients with pdac had a median survival of 20 months (range 467) with a 5-year dss of 25% from the time of diagnosis, and a median dss of 10.6 months (range 0.639.8) from the time of splenectomy (fig. 2). one patient died of disease after 107 months, and the other is still alive with disease after 60 months. pdac is the fourth leading cause of cancer - related deaths in the united states, with an overall 5-year survival of 4%. in 2009, 42,770 patients in the usa were diagnosed with pdac and 35,240 died from their disease.7 the poor outcome of patients with pdac has been attributed to the advanced stage of disease at diagnosis, the poor response to current systemic and local therapies, and the aggressive biologic nature of the disease. resection for pdac provides the only chance for cure, but only about 15% of patients are eligible for surgery.8 even those patients who undergo a curative resection have a 5-year survival rate of 35% in the best series.9 most patients (85%) present with locally advanced or metastatic tumors, and they have a median survival of less than 12 or 5 months, respectively.7 chemotherapy can significantly extend dss and decrease disease - related morbidity.3 pets have been studied much less frequently than pdac primarily due to their low prevalence ; only about 2,500 new pets are diagnosed annually in the united states.1012 pets are categorized as functional or nonfunctional depending on whether the secreted peptide is biologically active and produces a clinical syndrome ; about 50% of nonfunctional pets secrete peptides that are clinically silent.13 insulinomas are the most common type of pet, and a majority are benign.14 in contrast, approximately 60% of non - insulin - secreting pets are malignant.11,15 due to their less aggressive clinical behavior than pdac and resistance to most current chemotherapeutic agents, pets are treated aggressively with resectional therapy. therapy is determined by the grade of the tumor.46 thus, chemotherapy is the primary goal of treatment for unresectable pet or pdac for as long as the patient can tolerate it. locally advanced or recurrent pancreatic tumors of either histologic type in the head of the gland can involve the splenic vein, smv, or pv. tumors in the body or tail can involve the splenic vein. either can cause venous occlusion from compression by the tumor mass or thrombosis of the vessel.16 left - sided portal hypertension, hypersplenism, and thrombocytopenia may result, which limits the patients ' ability to tolerate aggressive chemotherapy. in this study, we examined the perioperative morbidity and effectiveness of splenectomy on restoring platelet counts to normal, administration of chemotherapy, and survival in our small series of 15 patients. a similar analysis was performed on 11 patients with hepatitis c, cirrhosis, and portal hypertension.17 in this series, splenectomy reversed the hypersplenism - induced thrombocytopenia, and patients could resume pegylated interferon therapy. a recent meta - analysis3 of 50 trials (7,043 participants) on the effectiveness of 5-fu- or gemcitabine - based chemotherapy and radiotherapy for inoperable pancreatic cancer found that chemotherapy can significantly improve 1-year mortality (p < 0.00001) in patients with locally advanced or metastatic pdac and can also significantly decrease morbidity. platinum combinations significantly reduced 6-month mortality on subgroup analysis (p < 0.001) and currently are the standard of care for the disease. unfortunately, a number of factors often limit administration of chemotherapy to patients with pancreatic cancers. these include a poor functional or nutritional status ; an unresponsive tumor and thus no clinical benefit to giving the drugs ; bone marrow suppression that can result in severe anemia, leucopenia, and thrombocytopenia,18 or isolated thrombocytopenia. the potential causes of isolated thrombocytopenia include hypersplenism, bone marrow suppression with preferential inhibition of platelet production, or other very rare causes such as gemcitabine - associated thrombotic microangiopathy,19 or capecitabine (xeloda)-induced idiopathic thrombocytopenic purpura. in fact, a major side - effect profile listed on the gemcitabine package insert includes thrombocytopenia. thus, patients who are receiving chemotherapy, particularly gemcitabine - based regimens, are at risk of developing thrombocytopenia. with concurrent hypersplenism, the risk is even higher, as bone marrow production of platelets is usually be suppressed. hypersplenism may unmask subclinical thrombocytopenia. a recent study to develop a prognostic score that would predict survival after resection for pets, using 3,851 patients from the national cancer data base (19852004), found that age, grade, and distant metastases were the most significant predictors.20 administration of adjuvant chemotherapy nevertheless, cisplatin and etoposide combination therapy is effective in treating patients with poorly differentiated pets, while streptozocin, doxorubicin, and 5-fluorouracil is the standard cytotoxic regimen for functional pets.21 in fact, several studies suggest that pets are more responsive to chemotherapy than endocrine tumors in other parts of the gastrointestinal tract, most notably carcinoid tumors. our two patients with pets who underwent splenectomy and aggressive chemotherapy have had excellent survival outcomes. as listed in table 2, one patient is still alive with disease after 60 months and recently underwent an extensive resection of the primary tumor and multiple liver metastases. patients, with either pdac or pet, who are offered splenectomy must demonstrate a good functional status, preferably with thrombocytopenia as the only factor limiting treatment. a complete blood cell count should be obtained preoperatively to exclude cytotoxic chemotherapy - induced bone marrow suppression as the primary cause of thrombocytopenia. if other blood elements are also low, particularly the absolute neutrophil count, then the chemotherapy should be considered as the primary cause of thrombocytopenia and splenectomy deferred. in this case, the dose of chemotherapy should be lowered or combination changed ; alternatively, one might elect to give drugs that stimulate bone marrow production, such as granulocyte colony - stimulating factor or erythropoietin. if isolated thrombocytopenia is present, with the other elements normal, and there is evidence of hypersplenism on high - resolution imaging (e.g., portal vein thrombosis or an enlarged spleen), then splenectomy should be pursued. ideally, we prefer that patients have a good response to chemotherapy, as measured by a decrease in tumor size or extent of disease on imaging and tumor markers ; although, this was not the case in the present series, as patients underwent splenectomy over a wide time range from the time of diagnosis. ca19 - 9 is the best serum marker of response for pdac;22 chromogranin, synaptophysin, pancreatic polypeptide, or gastrin can be used for pet.23 patients must not have end - stage disease and severe malnutrition. we require that patients have a preoperative abdominal ct or mri scan, which are usually being done for disease surveillance during treatment. the primary tumor is evaluated to ensure that it is not growing into the splenic hilum or to note additional features (varices, etc.) that will help in planning the procedure. in addition, the abdomen is evaluated for any signs of carcinomatosis and/or ascites. by using these stringent preoperative criteria prior to splenectomy, perioperative morbidity and mortality can be minimized, and platelet counts are likely to respond. patients who are not operative candidates can alternatively undergo splenic artery embolization or external beam splenic irradiation, as these two treatments can also potentially reverse hypersplenism - induced thrombocytopenia.24 embolization should be considered as second - line treatment after splenectomy because it can be associated with significant postoperative pain and splenic abscesses.25 furthermore, splenic irradiation is rarely performed for hypersplenism but can be effective for relief of pain associated with splenomegaly in patients with hematologic disorders.26 in our experience, as discussed previously, splenectomy is safe and can be performed with minimal morbidity and a short hospital stay. there were no deaths in our series ; hospital stay was short (median 3 days), and patients ' platelet counts responded rapidly with quick resumption of chemotherapy (median 11.5 days). the median follow - up for all survivors was 35 months (range 1363) from the time of diagnosis. the 13 patients with pdac had a median survival of 20 months (range 467) with a 5-year dss of 25% from the time of diagnosis, and a median survival of 10.6 months (range 0.639.8) from the time of splenectomy. in conclusion, while the optimal treatments for patients with locally advanced or metastatic pdac or pet are in evolution, we found that our novel strategy of splenectomy for the development of hypersplenism - induced thrombocytopenia that limited chemotherapy treatment was effective. splenectomy was performed with minimal morbidity, and was associated with a rapid increase in platelet counts and a short time before resuming chemotherapy. in addition, patients with pdac who underwent this novel treatment strategy had significantly improved dss as compared to historical controls. | backgroundpatients with unresectable pancreatic cancer (pdac) or endocrine tumors (pet) often develop splenic vein thrombosis, hypersplenism, and thrombocytopenia which limits the administration of chemotherapy.methodsfrom 2001 to 2009, 15 patients with recurrent or unresectable pdac or pet underwent splenectomy for hypersplenism and thrombocytopenia. the clinical variables of this group of patients were analyzed. the overall survival of patients with pdac was compared to historical controls.resultsof the 15 total patients, 13 (87%) had pdac and 2 (13%) had pet. all tumors were either locally advanced (n = 6, 40%) or metastatic (n = 9, 60%). the platelet counts significantly increased after splenectomy (p < 0.01). all patients were able to resume chemotherapy within a median of 11.5 days (range 627). the patients with pdac had a median survival of 20 months (range 467) from the time of diagnosis and 10.6 months (range 0.639.8) from the time of splenectomy.conclusionssplenectomy for patients with unresectable pdac or pet who developed hypersplenism and thrombocytopenia that limited the administration of chemotherapy, significantly increased platelet counts, and led to resumption of treatment in all patients. patients with pdac had better disease - specific survival as compared to historical controls. |
isolated bone affection due to fungi are rare and we present one such case with fungal osteomyelitis of terminal phalanx of second toe. we present a rare case of fungal osteomyelitis of right second toe in a 30 year old indian female who presented with swelling of 8 months duration. the patient was treated with surgical debridement and amphotericin - b was given for 6 weeks after debridement. isolated aspergillus osteomyelitis of the bone are very rare and mostly seen in immunocompromised patients and larger bones like spine, femur and tibia. treatment with wound debridement and subsequently followed up with a course of amphotericin - b for 6 weeks provided good results. fungi should be kept in mind for differential diagnosis of osteomyelitis and culture should be appropriately ordered. author 's photo gallery fungal osteomyelitis is a rare disease and generally present in an indolent fashion [1 - 4 ]. incidence of fungal infection has been on rise with immunodeficiency diseases and invasive surgical procedures [5 - 7 ]. it is rare to find an isolated fungal bone affection in a immunocompetent person without any obvious predisposing factors. we report one such rare case with isolated affection of terminal phalanx of the second toe. a 30 year old female presented with swelling of right second toe for the past 8 months following direct trauma to the right foot when she hit a wooden door (fig.1). she consulted local doctors and was given pain medication but the symptoms did not subside. when she presented to us there was swelling of the toe with moderate tenderness and bogginess around the nail bed. radiographs of right foot was taken which showed irregular margins, lytic and sclerotic edges of the terminal end of distal phalanx of 2nd toe (fig. routine blood investigations were within normal limits with a slightly elevated esr (35mm / hr). a preliminary diagnosis of chronic osteomyelitis was made and decision for excision biopsy was taken. under local anesthesia a fish mouth incision was taken (fig. distal phalanx was found to be completely involved and a decision to excise the whole distal phalanx was taken. the excised bone was sent as a specimen (fig.4) for the histo - pathological examination. bacterial culture was negative but histology showed that bone contained fungal hyphae and subsequently the bone culture showed growth of aspergillus. treatment was started with amphotericin - b according to her body weight for 6 weeks. the patient was followed regularly at 1 month, 3 months, 6 months and one year and no signs of recurrence was noted. clinical photograph showing swelling of the second toe radiograph showing irregular margins and scerotic lesion with lytic areas fish mouth incision used to expose the lesion excised terminal phalanx fungii such as aspergillus are known to be ubiquitus in nature and are the common commensals of the respiratory tract. in patient with immunosupression, these organisms multiply and cause widespread infection involving respiratory system and sometimes even skeletal system. there have been published accounts of fungal osteomylitis in literature but aspergillus osteomyelitis is infrequently reported [3,7 - 12 ]. fungi infections are common in cases of polytrauma where multiple surgeries cause a break in the natural barriers of skin and mucous membrane and compromises the patients immune system. in such cases staphylococcus aureus is the most common cause of osteomyelitis and the long bone metaphysis is the most common localization of osteomyelitis. cases of fungal osteomylities in literature that were reviewed showed that surgery with systemic antifungals had a lower recurrence and higher success rate as compared to those that were treated with antimycotics alone, which may be due to the fact that penetration of most drugs into the bone tissue is low. we treated our patient with surgical debridement along with amphotericin - b with good results. this is a rare case of apsergillus osteomyelitis affecting the terminal phalanx of the toe. sclero - lytic lesion with suspicion of chronic osteomyelitis can be fungal in origin even in immunocompetent host. this needs to be kept in differential diagnosis and also while sending cultures for such lesions | introduction : fungal osteomyelitis is an uncommon diseases and generally present in an indolent fashion. isolated bone affection due to fungi are rare and we present one such case with fungal osteomyelitis of terminal phalanx of second toe.case report : we present a rare case of fungal osteomyelitis of right second toe in a 30 year old indian female who presented with swelling of 8 months duration. diagnosis was based on the histo - pathological report and culture showing aspergillus growth. the patient was treated with surgical debridement and amphotericin - b was given for 6 weeks after debridement. there was no recurrence one year post surgery.conclusion:isolated aspergillus osteomyelitis of the bone are very rare and mostly seen in immunocompromised patients and larger bones like spine, femur and tibia. treatment with wound debridement and subsequently followed up with a course of amphotericin - b for 6 weeks provided good results. there was no recurrence noted at 1 year follow up. fungi should be kept in mind for differential diagnosis of osteomyelitis and culture should be appropriately ordered. |
calculi may lead to obstruction and infection, causing loss of renal tissue and function. this complication, often referred to as pyonephrosis, is considered a urological emergency and warrants prompt drainage and management. presentation of pyonephrosis may vary from asymptomatic bacteriuria to septicemia, and is occasionally complicated further by spread of purulent exudate into the surrounding spaces. we report a rare case where stone - induced pyonephrosis contiguously spread to the liver and presented as a hepatic abscess. a 25-year - old lady presented to the urological emergency with complaint of episodes of dull aching colicky pain in the right lumbar region for the past 1 year, which had increased in severity and become continuous for the past 2 weeks. she also reported weakness and malaise, but did not give any history of urinary or bowel complaints. physical examination revealed a pulse rate of 104/min, low blood pressure of 104/60 mm of hg, respiratory rate of 22/min, and a temperature of 101f. there was tenderness in the right hypochondrium and the right renal angle, but no visible fullness. keeping a differential diagnosis of gall stone disease and pyonephrosis, an urgent ultrasound examination was done which showed grade iii dilatation of the right kidney with internal echoes and multiple calculi, largest of size 18 mm, located in the pelvis. the liver showed a hypoechoic lesion of 10 10.2 cm in the right lobe. a breach in the renal capsule was demonstrated, communicating with the lesion in the liver. laboratory investigations revealed marked leukocytosis, severe anemia (5.5 g / dl), mildly deranged renal function (blood urea 60 mg / dl, serum creatinine 1.6 mg / dl) and coagulopathy (international normalised ratio 1.63). based on a working diagnosis of pyonephrosis with liver abscess with septicemia, the patient was resuscitated with fluids and given intravenous antibiotics and blood transfusion. dehydration and coagulopathy were corrected and a contrast - enhanced computed tomography (ct) was obtained, revealing a hypodense peripherally enhancing lesion with air in the right lobe of the liver communicating with the upper calyx of the hydronephrotic right kidney with multiple calculi [figure 1 ]. right pleural effusion with consolidation of the right lower lobe of the lung was also seen. the patient 's condition improved on antibiotics, and right dj stenting was performed along with an ultrasound - guided drainage of 800 ml pus from the right lobe of the liver. she responded well to treatment and was discharged with a plan for right percutaneous nephrolithotomy after 6 weeks. on subsequent follow - up visits, it produces obstruction to the passage of urine and acts as a nidus for microorganisms, creating perfect conditions for accumulation of pus and destruction of functional parenchyma. pyonephrosis has been better defined as a disease spectrum ranging from infected hydronephrosis, where kidney function is preserved, to xanthogranulomatous pyelonephritis, where the renal function is severely affected. this is further complicated when necrosed renal tissue gives way to the accumulating pus, leading to spread of infected exudates outside the kidney. a review of literature showed that rupture of pyonephrosis is relatively common into the peritoneum, and sometimes the retroperitoneum, both of which act as free spaces in immediate vicinity of the kidney for collection of pus. rare reports of pyonephrosis causing nephro - bronchial fistula, splenic abscess, and renal vein and caval thrombosis also exist. our search for literature regarding reno - hepatic communication revealed only one case where xanthogranulomatous pyelonephritis led to the formation of a pyelo - hepatic fistula in a middle - aged lady. considering the strong anatomical barrier offered by the gerota 's fascia and the gilsson 's capsule, it seems rather difficult to have pyonephrosis cause an ascending infection to the liver. however, a thorough history was suggestive of a primary renal pathology giving rise to a secondary liver abscess. the management of pyonephrosis is by urgent antegrade or retrograde drainage followed by definitive management of the underlying pathology. in view of the deranged coagulopathy, an urgent dj stenting was done followed by aspiration of the residual liver abscess after correcting the coagulation profile. patient was empirically managed on third - generation cephalosporin and aminoglycosides and she responded well. the only reported case demonstrating the possibility of a renal infective pathology spreading to the liver is that of a pyelo - hepatic fistula following xanthogranulomatous pyelonephritis by chung., which was managed by partial hepatectomy and nephrectomy, a treatment befitting this more severe spectrum of pyonephrosis. our case demonstrates the success of a conservative approach in managing this rare complication of renal calculi when detected early in its course. | neglected renal calculi can lead to a variety of complications secondary to obstruction and infection. pyonephrosis arising in this scenario often presents as a urological emergency and requires urgent surgical intervention. in rare circumstances, when left unaided, the kidney is unable to contain the infection and spread of pus may occur into the surrounding spaces like the retroperitoneum and the peritoneum. we report a very unusual complication of pyonephrosis leading to a hepatic abscess. we believe this is the first reported case of an acute renal infection due to stone disease ascending into the liver. |
crispr / cas systems are used by various bacteria and archaea to defend against viruses and other foreign nucleic acids (reviewed in horvath and barrangou and marraffini and sontheimer). the adaptation of this system for gene editing in mammals has had a considerable impact on development of disease models, identification and validation of novel therapeutic targets, and correction of genetic mutations.3, 4, 5 lentiviral vectors (lvs) are an important means of delivering crispr / cas9 components due to their ability to accommodate large dna payloads and efficiently transduce a wide range of dividing and non - dividing cells. lvs also display low cytotoxicity and immunogenicity and have a minimal impact on the life cycle of the transduced cells (reviewed in kantor.). such features have led to lvs being used as the gene - editing regimen of choice to treat hiv-1, hbv, and hsv-1 infections, as well as to correct defects underlying human hereditary diseases, such as cystic fibrosis.7, 8, 9, 10 despite these successes, this system suffers from significant drawbacks. permanently expressed crispr / cas9 may facilitate undesirable off - target effects, hindering their utility for genome - editing applications that require high levels of precision. indeed, rise of promiscuous interactions with off - target genes due to excess guide rna (grna)/cas9 is well - documented.11, 12 furthermore, sustained expression of grna / cas9 in vitro increases the tolerability of mismatches in the guide - matching region and the protospacer adjacent motif (pam), thereby promoting non - specific double - strand breaks (dsbs).13, 14 along the same lines, the ratio of insertions and deletions (indels) at off - target versus target sites in vivo increases with higher cas9 and grna concentrations. strategy for permanent modification of the targeted loci would be beneficial for high - precision gene editing. several transient - delivery systems have been developed and employed to minimize non - specific effects of the crispr / cas9 system (reviewed in nelson and gersbach). for example, it has been recently shown that direct delivery of purified cas9 protein and single grna (sgrna) into cells results in reduced off - target effects compared to the delivery of plasmid sequences encoding cas9 and sgrna. furthermore, it was demonstrated that cas9-sgrna ribonucleoprotein (rnp)-mediated dna cleavage is followed by their almost instant degradation and clearance from the cells, which suggests that gene editing might only require a short - term presence of its components. more importantly, the high turnover rate of rapidly degraded rnps corresponded to a reduced rate of off - target mutations. however, low transduction efficiency remains a serious limitation of rnps and other non - viral delivery platforms. to overcome this limitation, a lentivirus - prepackaged cas9 protein (cas9p lv) system was developed recently and was shown to be effective for disruption of gene expression in naive t cells. significantly, transiently delivered cas9 showed high target specificity and induced no measurable indels at off - target dna sites. however, production titers of the prepackaged - cas9 system were observed to be lower than those of conventional lvs. conversely, production titers are traditionally high with adeno - associated vectors (aavs) that have become a widely adopted platform for delivery of crispr / cas9 components in recent years (reviewed in nelson and gersbach). indeed, platt and colleagues successfully packaged a streptococcus pyogenes (spcas9)/sgrna construct into aav particles for in vivo modeling of loss - of - function mutations in p53 and lkb1 genes in mouse lung adenocarcinomas. however, the large size of the spcas9 gene (4.2 kb) imposes a significant burden on the packaging capacity of aavs. to overcome this bottleneck, oskar ortiz s group recently developed a split - intein cas9 system that can be separated into two aav cassettes. this approach allows for increase in overall packaging capacity, but necessitates production and co - transduction of two aav vectors. the discovery of a shorter, but equally potent cas9 enzyme derived from staphylococcus aureus (sacas9) led to the development of sacas9/guide rna system that could be efficiently packaged and delivered by aav vectors. this system was shown to efficiently target the cholesterol regulatory gene pcsk9 in the mouse liver. nevertheless, the packaging efficacy of all - in - one aav vector systems, especially those intended for clinical applications, needs further improvement to efficiently accommodate multiple components, including the 3.2-kb sacas9, the rna polymerase ii (pol ii) promoter and poly(a), a nuclear localization signal (nls), sgrna(s), and the rna polymerase iii (pol iii) promoter(s), as well as other cis - acting elements, such as woodchuck hepatitis post - transcriptional regulatory element (wpre). episomal idlvs are an ideal platform for delivery of large genetic cargos where only transient expression of the transgene is desired (reviewed in kantor., and wanisch and yez - muoz).23, 24, 25, 26, 27, 28, 29, 30, 31, 32 we demonstrated more recently that idlvs retained residual (integrase - independent and illegitimate) integration rates of 0.2%0.5% (one integration event per 200500 transduced cells), which could be further reduced by packaging a novel 3 polypurine tract (ppt)-deleted lentiviral vector into integrase - deficient particles. several studies have demonstrated broadly similar levels of illegitimate integration.27, 34, 35 idlvs have garnered significant interest among researchers for precise in vivo analysis of genetic diseases, since they significantly reduce the risk of insertional mutagenesis inherent in integrating delivery platforms. have successfully employed idlvs in mouse models as gene replacement therapies for degenerative retinal disease and hemophilia b, respectively. furthermore, the efficacy of idlvs in cancer immunotherapy and as a means of inducing protective immune responses to human pathogens has been characterized in different experimental settings.38, 39, 40 a growing body of literature describes idlvs carrying zinc - finger nucleases as an effective means of gene editing for clinical and basic science applications28, 30, 31, 32. for instance, lombardo and colleagues have successfully employed non - integrating vectors as a means of avoiding genotoxicity associated with continuous expression of zinc - finger nucleases (zfns) and for delivering the donor dna template required for dna repair - mediated gene editing. these researchers demonstrated that the idlv - zfns system is capable of effectively disrupting expression from the gene encoding the hiv-1-co - receptor ccr5. additionally, joglekar and colleagues successfully employed idlvs to deliver zfns and donor templates for site - specific gene modification at the human adenosine deaminase (hada) locus in primary t - lymphocytes. most recently, hoban and colleagues demonstrated efficient gene editing of the mutated human -globin gene in cd34 + hematopoietic stem and progenitor cells by co - delivering crispr / cas9 reagents and donor templates via idlvs. the ability to simultaneously deliver cas9 and sgrna through a single vector enables facile and robust in vivo gene editing, which is particularly advantageous for developing a translatable gene therapy products (reviewed in maeder and gersbach). in the current manuscript, we aimed to establish an all - in - one idlv - crispr / cas9 system for efficient gene editing in vitro and in vivo. to this end, we designed and tested novel non - integrating vectors carrying binding sites for the transcription factor sp1 in the expression cassette. we demonstrate that these vectors permit efficient, rapid, and sustainable crispr / cas9-mediated gene editing in hek293 t cells and post - mitotic brain neurons in vivo. furthermore, we demonstrate that the idlv - crispr / cas9 system is expressed transiently and has a significantly lower capacity to induce off - target mutations than its integrating counterparts have. taken together, our findings validate idlvs as a robust, effective, and safe means for in vivo delivery of programmable nucleases, with substantial advantages over other delivery platforms. we started with the titer - optimized lenticrispr - v2 in which we removed the unnecessary buffer sequences (2 kb) and introduced a unique restriction site for reducing unwanted recombination, increasing growth rates, and enabling easy screening for sgrna - positive clones in bacteria (figure 1a, upper panel ; materials and methods). lenticrispr - v2 is characterized by higher production yields compared to the original crispr - v1vector ; nevertheless, its titers are still lower than is typical of conventional lvs. to improve vector titers, we sought to reinstate binding site(s) for the transcription factor sp1 into the shorter version of lenticrispr - v2. the idea is premised on previous data demonstrating that sp1 plays a pivotal role in the life cycle of wild - type hiv-1, but is deleted from most of the vector cassettes.44, 45, 46, 47 we first cloned two copies of the sp1 binding site upstream of the u6-promoter (figure 1a, lower panel). next, we generated iclvs (integrase - competent) and idlvs (integrase - deficient) with or without sp1 by packaging corresponding vector cassettes into either integrase - wild - type, or integrase - deficient (d64e mutant) viral particles supplemented with vesicular stomatitis virus g envelope (vsv - g). as shown in figure 1b, idlvs harboring sp1 binding sites demonstrated a 2.5-fold increase in p24 production compared to the parental vector. interestingly, we observed a similar level of increase in p24 production with iclvs (figure 1b). we further assessed the production efficiency of iclvs with or without sp1 using an antibiotic - resistance (puromycin) colony forming assay. we observed a 7-fold increase in the number of puromycin - resistant colonies with iclvs harboring sp1 binding sites compared to the no - sp1 vector counterpart (figure 1c). to examine knockout efficiency of the new vector system, we designed three sgrna constructs targeting different regions of enhanced green fluorescent protein (egfp) stably expressed in hek293 t cells. we first packaged a sgrna - to - gfp / cas9 expression cassette into integrase - wild - type particles and assessed target gene knockout in the reporter gfp - positive hek293 t cells using flow cytometry. the sgrna1/cas9 vector that demonstrated near complete depletion of the gfp signal was selected for further evaluation (figure s1). next, we asked if sgrna1/cas9 packaged into integrase - deficient particles could induce efficient gfp knockout in dividing cells. to this end, idlv - sgrna1/cas9 and iclv - sgrna / cas9 vectors were transduced into 293 t cells and knockout levels were evaluated at 7, 14, and 21 days post - transduction (pt) by flow cytometry. both integrated and episomal vectors displayed a 5-fold reduction in the number of gfp - positive cells as early as 7 days pt, with a nearly complete signal depletion observed by 21 days pt (figure 2). these results clearly demonstrate that crispr / cas9 delivered by idlvs is capable of mediating rapid, robust, and sustained gene editing in dividing cells. next, we assessed the integration capacity of non - integrating vectors to rule out the possibility that overexpressed crispr / cas9 may alter the rate of integration. we transduced 293 t cells with integrating and non - integrating vectors carrying sgrna1/cas9 as described above, cultured the cells for 3 weeks to dilute out non - integrated genomes, and finally, isolated viral dna from these cells for subsequent analysis with real - time pcr. the rate of integrase - independent (illegitimate) integration of idlvs determined as a ratio between copy numbers at week 3 and at 24 hr post transduction was found to be 0.8% (figure s2). this finding suggests that crispr / cas9 does not significantly alter the integration capacity of non - integrating vectors since only slightly lower rates (0.2%0.5%) of integration were reported previously for non - crispr - vectors. the integration frequency of iclv - crispr / cas9 was found to be 30%, also consistent with our previous observations (figure s2). having established the ability of the idlv - crispr / cas9 system to mediate robust and sustained gene editing in dividing cells, we next examined target - specificity of the vectors. we employed t7 endonuclease i to detect mis - annealed dna that form upon crispr / cas9-induced dsbs. using the reporter system described in figure 2, we observed efficient dna cleavage within the target gene gfp at 7 days pt (figure 3a). mutations were not observed in naive (untransduced) cells or upon incubation with non - sgrna - vector (figure 3a, 1 and 6, respectively). additionally, we extracted gdna from iclv and idlv - transduced cells (figure 3b), amplified them with the primers that flank the target gfp sequence, cloned the pcr products into the pcr2.1 topo vector (thermo fisher), and sequenced them. analysis of the sequencing data revealed that indels were present in the target sequences at rates 84% and 80% for the iclv and idlv vectors, respectively (figure 3b). consistent with earlier observations, we saw a random pattern of mutations formed at the target site. to comprehensively evaluate the off - target capacity of idlvs, we adopted a whole - exome sequencing (wes) analysis (see description in materials and methods). first, sequences with less than 30 total reads (30) were not counted. third, we required indels to be in the frequency range of 1 to 25 ; higher rates were excluded as potential snps and lower rates were considered background noise. fourth, we excluded sites showing clustered hot - spots in which high variability in mutations rates is found within neighboring sequences that represent indels that are likely to arise by technical artifacts and repetitive sequences errors.48, 49 fifth, indels with no pam, or with pam located > 10 bp away from seed sequence, or if guide - seed mismatch was more than 5 bps were filtered out as likely technical artifacts5, 15, 20, 50 (the seed sequence has been defined as 10-most proximal nucleotides to pam).3, 51 using these criteria, we identified 16 genes in which iclv - crispr / cas9 induced noticeable changes (figure 3c). the frequencies of iclv - induced indels at these sequences were in the range of 3.4%24% (figure 3c). in contrast, idlv - crispr / cas9 demonstrated significantly weaker capability to induce off - target indels at these sequences (figure 3c). with idlvs, we observed close - to - baseline indels frequency in seven genes and only a slight increase in six others. however, we also observed a higher - than - baseline indels frequencies in three genes c6orf226, hist1h2bm and chrna4at the rates of 3%, 4%, and 6.47%, respectively (figure 3c). altogether, these results suggest that although transiently expressed idlv - crispr / cas9 is capable of inducing off - target mutations, it does so at significantly lower levels than iclv - crispr / cas9. we sought to evaluate the efficacy of the novel idlv - sgrna / cas9 platform by assessing the depletion gfp signal in dissociated post - mitotic neurons. to this end, we transduced the cells with gfp or mcherry - expressing lentiviral vectors, co - delivering idlv - sgrna1/cas9 vector 1 day later. as shown in figure s3, a robust depletion of the gfp was observed 10 days post - transduction with sp1-idlv vectors. notably, significantly less depletion of the gfp signal was observed following delivery of crispr / cas9 by the vector without sp1 (figure s3). to verify the efficacy of the idlv - sgrna / cas9 platform as an in vivo gene editing system, we targeted expression of a -amino - butyric acid a (gabaa) receptor subunit 2 in the nucleus accumbens (nac) of adult male sprague - dawley rats using an idlv-2/cas9 vector. the nac is a region in the ventral striatum implicated in processing of reward and relevant for clinical symptoms of drug abuse and major depressive disorders. the majority of neurons (95%) within the nac synthesize gaba and express gabaa receptors that incorporate 1, 2, or 3 subunits localized to synaptic membranes.52, 53 using western blotting, we detected 2-subunits in nac tissue homogenates from control animals at levels similar to those previously observed. at 3547 days following microinjection of the idlv 2/cas9 vector, the identity of the subunit confers distinct functional properties on the assembled gabaa receptor. specifically, 2 and 3 subunit - containing gabaa receptors generate synaptic currents that last longer than those generated by 1 subunit - containing gabaa receptors.53, 55, 56, 57 we took advantage of this distinction to verify the efficiency of 2-knockout at the level of receptor function by measuring gabaa receptor - mediated miniature inhibitory post - synaptic currents (mipscs) in medium spiny neurons of the nac. at 3547 days following microinjection of the idlv 2/cas9, the duration of mipscs was characterized by broad cell - to - cell variability, contrasting sharply with the narrow distribution of mipsc duration in cells from control animals (figures 4b4d). distribution of mipsc amplitudes, an indicator of the number of post - synaptic receptors, was similar between idlv 2/cas9 and control groups (figure 4e), and no differences in mipsc frequency, a marker of presynaptic changes, were observed. these results indicate that idlv 2/cas9-induced knockout of gabaa receptor 2 subunits in the nac was effective in altering the subunit composition of remaining gabaa receptors in the nac, but did not change the number of post - synaptic receptors available for activation. of greater relevance to this study, these findings highlight the utility of idlv sgrna / cas9 platform for long - term reduction of gene function in non - dividing brain cells. idlvs present an attractive platform for viral - mediated gene transfer due to their numerous advantages over other delivery methods : (1) they are capable of efficiently transducing a broad range of cells and tissues, (2) they have large packaging capacity, (3) they demonstrate low cytotoxicity and immunogenicity, and (4) they retain very weak integration capacity and are transiently expressed from episomal genomes. these advantages make idlvs a powerful tool in basic science and clinical research (reviewed in kantor., and wanisch and yez - muoz).24, 58 throughout this study, we sought to establish a single - molecule idlv platform for efficient delivery of crispr / cas9 components in vitro and in vivo. the advantages of lentiviral vectors used for crispr / cas9 delivery are counterbalanced by the low titers associated with their production. therefore, we started by improving the titers of the all - in - one crispr / cas9 system, to match those reported for the binary - crispr / cas9 or naive vectors. we demonstrated that the addition of an sp1 binding site into all - in - one vector cassettes results in 2.5-fold increase in the packaging efficiency of the vectors (figure 1b) and 7-fold increase in the overall functional production titers. the additional effect of sp1 post - transfection (figures 1b and 1c) suggests that this transcription factor may play a multifaceted role in the lentivirus life cycle. such versatility is supported by earlier work from various groups highlighting sp1 as a key transcriptional regulator of wild - type hiv-1.44, 46, 47, 59 furthermore, berkhout and colleagues demonstrated that a vaccine - attenuated hiv strain was able to regain its replication fitness and virulence by duplicating sp1 binding sites. it has also been shown that deletion of the sp1 binding motif from viral ltrs and gag - intragenic regions results in dramatic loss of viral replication and infectivity. most of the available vector expression cassettes lack sp1 binding sites and neither rna pol iii promoters (e.g., u6 and h1), typically used to express sgrna, nor viral core promoters (e.g., efs - nc) expressing cas9, harbor sp1 binding sites. thus, it would be interesting to determine whether addition of sp1 to a relatively weak core promoter could substitute for the use of more powerful, but larger full - size counterparts. based on our results, we speculate that insertion of sp1 binding sites could be adopted as a universal approach to enhance production, transcription, and infectivity of other viral systems used for delivering crispr / cas9 cargoes. this approach could be especially valuable for smaller viruses (e.g., aav), where limited packaging capacity precludes effective use. furthermore, our findings become important in the context of idlvs, since expression from episomal forms is generally lower than expression from the integrated genomes.25, 26 indeed, we previously showed that idlvs are organized into nucleosomal structures, enriched in histone modifications typical of silenced chromatin and thus subjected to layers of gene regulation involved in transcriptional silencing of cellular gene expression. we show that sp1-crispr / cas9 delivered by idlvs can efficiently edit targeted sequences in the gfp - positive 293 t cells. the rate and kinetics of gfp depletion were very similar to those observed for the integrase - wild - type vector. furthermore, we found that short - term expression of crispr / cas9 is sufficient to induce robust and permanent changes in the dna. indeed, we observed > 80% of the cleavage activity within 7 days post - transduction and almost complete depletion of the gfp signal within 2 weeks. this observation is in line with previous work in which ribonucleoprotein complexes (cas9 rnps) were introduced into a variety of mammalian cells through liposome - mediated transfection and electroporation to achieve highly efficient genome cleavages within 2 days post transfection. similarly, idlvs induce only transient accumulation of episomal dna in the nucleus, as they retain a very weak integration capacity compared to the integrating vectors. nevertheless, idlvs are capable of integrating into chromosomes due to illegitimate integrase - independent insertions at a low rate. the rates of idlv - crispr / cas9 integration found in the current study were only slightly higher (0.8%), which suggests that crispr / cas9 does not significantly enhance this rate. our observations are in agreement with previous findings in which idlvs have been used to detect and map off - target cleavages by crispr / cas9 and talen systems. in their study, wang and colleagues reported that co - delivery of idlv and crispr / cas9 (delivered as expression plasmids) induced a 2- to 3-fold increase in integration. furthermore, the 1%10% off - target indels formation reported in wang. is consistent with our observations of mild increase in the overall integration rate of idlv - crispr / cas9. altogether, our results demonstrate that the episomal status of non - integrating vectors is not compromised by crispr / cas9, and that the gene editing reported in figure 2 arises from transient expression of the episomal vector. importantly, we report that episomal hiv-1 vectors are capable of attaining a strong and sustained crispr / cas9 expression in dissociated post - mitotic neurons and in the rat brain (figures 4 and s3). using the improved idlv - based system, we were able to efficiently and specifically knock down the gfp signal in cultured neurons and deplete the gabaa receptor 2 subunit protein in the nucleus accumbens shell. this depletion is associated with increased variability of observed mipsc decay times in the recorded neurons. duration of gabaa receptor - mediated mipscs depends on identity of the subunit, as follows : 3 > 2 > 1.53, 55, 56, 57 therefore, the increased variability in mipsc decay times that we observe may be due to compensatory upregulation of short - lasting synaptic currents mediated by 1-containing gabaa receptors and longer - lasting currents mediated by the 3-containing gabaa receptors. importantly, a population of cells that continued to express 2-containing gabaa receptors may have contributed to these results, as our idlv-2/cas9 construct did not incorporate a fluorescent tag that could enable positive identification of neurons transduced by the virus. we demonstrate that idlvs have improved specificity over iclvs by measuring their off - target activities. using wes analysis, we detected a total of 16 sequences in which delivery of crispr / cas9 by integrating vectors has been associated with significantly higher rates of off - target indels than with the non - integrating vector (figures 3c and s2). we demonstrated that following transduction with idlv, minimal rates of indels (100-fold by ultracentrifugation (2 hr at 22,000 rpm). vector and viral stocks were aliquoted and stored at 80c. for integrating vectors expressing a fluorescent reporter (gfp), titers were determined using a p24 gagelisa method and by counting gfp - positive cells, as described previously. for non - integrating vectors and vectors carrying no reporter gene, the titers were determined using pgagelisa equating 1 ng pgag to 1 10 viral particles. the multiplicity of infections (mois) was calculated as the ratio between the number of viral particles and number of cells. the pgag elisa assay was carried out as per the instructions in the hiv-1 p antigen capture assay kit (nih aids vaccine program). briefly, high - binding 96-well plates (costar) were coated with 100 l monoclonal anti - p24 antibody obtained from the nih aids research and reference reagent program (catalog # 3537), which was diluted 1:1,500 in pbs. plates were blocked with 200 l 1% bovine serum albumin (bsa) in pbs and washed three times with 200 l 0.05% tween 20 in cold pbs. plates were incubated with 200 l samples, inactivated by 1% triton x-100 for 1 hr at 37c. sp968f) were subjected to a 2-fold serial dilution and added to the plates at a starting concentration equal to 4 ng / ml. samples were diluted in rpmi 1640 supplemented with 0.2% tween 20 and 1% bsa applied to the plate and incubated at 4c overnight. plates were then washed six times and incubated at 37c for 2 hr with 100 l polyclonal rabbit anti - p antibody (catalog # sp451 t), diluted 1:500 in rpmi 1640, 10% fetal bovine serum (fbs), 0.25% bsa, and 2% normal mouse serum (nms ; equitech - bio). plates were washed as above and incubated at 37c for 1 hr with goat anti - rabbit horseradish peroxidase igg (santa cruz biotechnology), diluted 1:10,000 in rpmi 1640 supplemented with 5% normal goat serum (ngs ; sigma), 2% nms, 0.25% bsa, and 0.01% tween 20. plates were washed as above and incubated with tmb peroxidase substrate (kpl) at room temperature for 10 min. plates were read by a microplate reader at 450 nm and analyzed in excel. hek293t - egfp cells were transduced with relevant vectors and examined for gfp fluorescence intensity. for fluorescence - activated cell sorting (facs) analysis, cells were harvested using 0.05% trypsin - edta solution. the samples were precipitated by centrifugation at 2,000 rpm at 4c, and the pellet was resuspended in 1 ml cold pbs. an equal volume of 4% formaldehyde solution was added to the samples for 10 min. mean fluorescence intensity (mfi) and percentage of gfp - positive cells were determined. we used naive (i.e., not transduced with gfp virus) cells to define a population of gfp - negative cells. the collected tissue was reverse - crosslinked to retrieve antigen epitopes and incubated with ripa buffer (50 mm hepes ph 7.6, 1 mm edta, 0.7% deoxycholate, 1% nonidet p-40, and 0.5 m licl). 7723 ; cell signaling technology), supplemented with 100 mm dtt, and denatured by boiling for 10 min. subsequently, sds polyacrylamide gel electrophoresis was performed followed by transfer to (nc / pvdf) membrane, which was later blocked by 5% non - fat dry milk for 60 min at room temperature with constant agitation. anti - gabaa 2 receptor antibody, # aga-002, was acquired from alomone labs (israel) and used at 1:250 dilutions. the reference control antibody was mouse -tubulin (dm1a) antibody (cell signaling technologies) used at 1:1,000 dilution. the membrane was incubated with the antibody - containing solution for overnight at 4c through gentle agitation. the membrane was then washed three times for 5 min each, after which, 0.05% tween 20 in cold pbs (pbst) and the goat - anti - rabbit or goat - anti - mouse secondary antibodies were applied at dilution 1:10,000 for 1 hr at room temperature through gentle agitation. blot detection was performed using an enhanced chemiluminescence (ecl) detection system (pierce). to quantify rates of integration of idlv and iclv, we used the following qpcr - protocol. genomic dna was isolated from the transduced cells and digested with rnase a and dpni overnight at 37c. the following primers were used to amplify vector dna : rre - f- 5-gcaacagacatacaaac-3 and u6p - r- aaaactgcaaactacccaagaaa-3. we used -beta - actin as a reference gene ; actin - f- 5- aatctgccaccacaccttc-3 and actin - r- 5-ggggtgttgaaggtctcaaa-3. itaq universal sybr green supermix was used for the reactions (bio - rad). real - time pcr was carried out using the icycler iq system (bio - rad), and the results were analyzed by icycler software (bio - rad). the pcr - products were extracted and purified from the gel using qiagen gel extraction kit. there were 2 l nebuffer 2 and dh2o that were added for a total of 19 l and subjected to a denaturation - renaturation cycle in a pcr cycler as follows : 5 min, 95c ; ramp down to 85c at 2c / s ; ramp down to 25c at 0.1c / s ; and hold at 4c. next, t7 endo i enzyme (neb) was added (1 l [10 u ]) to the reaction mix, and the samples were incubated at 37c for 1 hr. the reaction was stopped by adding 2 l of 0.25 m edta and immediately loaded on a 1.2% agarose gel. the results were analyzed and quantified by e - gel imager system software (life technologies). human embryonic kidney (hek293 t) cells were obtained from atcc (catalog number crl-3216). cells were grown in dmem (gibco), supplemented with 10% fetal bovine serum (gibco), penicillin / streptomycin 1% (thermo fisher scientific), 4.5 g / l d - glucose, 2 mm l - glutamine, 1% mem neaa (gibco), and 1 mm sodium pyruvate (gibco). hek293t - egfp cells were generated by transduction of hek293 t cells with plenti - gfp vector (vbk201a) at an moi 25% over the course of data acquisition. all analyses of intracellular recordings were carried out with clampfit 10 (molecular devices). the weighted time constant of decay was based on a double exponential fit to the decay phase of an average mipsc trace computed from a minimum of 50 individual mipscs. 293 t cells were transduced with idlv - gfp - sgrna / cas9 or / and iclv - gfp - sgrna / cas9 at mois = 5 and harvested at day 21 pt. gdna was isolated from the samples and hybridized to the probes of exome library (seqcap ez library sr dna - seq ; roche). the library was pooled (4-plex), and exomes were enriched via nimblegen protocol using seqcap ez exome enrichment kit v3.0 (roche). each pool was sequenced in one illumina hiseq lane v4 (125 bp paired end) with on - target rates of 65%. dna - seq data underwent strict quality control with the trimgalore package that removed all illumina adaptor sequences or low quality base calls from the 3 end of the reads. reads were aligned to the hg19 version of the human genome with the bwa algorithm. alignment processing and variant calls were performed using gatk,67, 68 following the broad institute s best practices workflow. any indels present in at least one sample was reported along with the filtered read - depth supporting that particular indels across the samples. designed experiments, analyzed data, and wrote the manuscript ; b.k., p.i.o., x.d., and b.o. supervised the study ; and all of the authors discussed the results and assisted in the preparation of the manuscript. | the crispr / cas9 systems have revolutionized the field of genome editing by providing unprecedented control over gene sequences and gene expression in many species, including humans. lentiviral vectors (lvs) are one of the primary delivery platforms for the crispr / cas9 system due to their ability to accommodate large dna payloads and sustain robust expression in a wide range of dividing and non - dividing cells. however, long - term expression of lv - delivered cas9/guide rna may lead to undesirable off - target effects characterized by non - specific rna - dna interactions and off - target dna cleavages. integrase - deficient lentiviral vectors (idlvs) present an attractive means for delivery of crispr / cas9 components because : (1) they are capable of transducing a broad range of cells and tissues, (2) have superior packaging capacity compared to other vectors (e.g., adeno - associated viral vectors), and (3) they are expressed transiently and demonstrate very weak integration capability. in this manuscript, we aimed to establish idlvs as a means for safe and efficient delivery of crispr / cas9. to this end, we developed an all - in - one vector cassette with increased production efficacy and demonstrated that crispr / cas9 delivered by the improved idlv vectors can mediate rapid and robust gene editing in human embryonic kidney (hek293 t) cells and post - mitotic brain neurons in vivo, via transient expression and with higher gene - targeting specificity than the corresponding integrase - competent vectors. |
franz enzinger in 1965, who recognized it as a distinct entity of tendons and aponeuroses in young adults with a propensity to the lower extremity and described its morphological similarity to malignant melanoma [1, 2 ]. about 40% of cases the tumor was formerly termed malignant melanoma of soft parts because of its morphological and immunohistochemical similarity to melanoma. the finding of a chromosomal translocation ewsr1-atf1 gene fusion as a result of the t(12:22)(q13:q12) chromosomal translocation distinguishes it from melanoma [4, 5 ]. a 35-year - old african - american female presented with a painful lump at the distal third metatarsal of the left forefoot that had been present for approximately 1 year. a preoperative mri showed a 1.0 1.0 0.8 cm soft tissue mass dorsal to the mid - diaphysis of the left third metatarsal, partially surrounding the extensor digitorum tendon. t1-weighted images showed a predominantly t1-hyperintense mass, while t2-weighted images showed predominant t2 hyperintensity, with several small hypointense foci within the mass (fig. 1). surgical excision revealed a soft tissue mass completely encasing the extensor digitorum longus tendon and slightly extending to the third interspace. the mass measured 2.9 1.5 1.1 cm and appeared multilobulated. the cut surface of the mass was grey - tan, firm, and homogenous, with no hemorrhage, necrosis, or cystic changes. the tumor cells were polygonal or spindle - shaped with clear or slightly eosinophilic cytoplasm and exhibited a nested or fascicular growth pattern with thin fibrous septa (fig. 3c) and negative for epithelial membrane antigen (ema), muscle - specific actin, desmin, and cd45. ewsr break - apart fish analysis was performed on the paraffin section, showing positive break - apart signals in > 20% of the cell population. this finding, together with the immunohistochemical study and tumor morphology, confirmed the diagnosis of ccsst. our patient had an initial resection, followed by re - excision to obtain wider margins. follow - up mri performed 8 months after surgery showed no evidence of a local recurrent or residual mass and no evidence of distal metastasis. written informed consent was obtained from the patient for publication of this case report and accompanying images. the exact histogenesis is obscure, but the presence of intracellular melanin in two thirds of cases supports an origin from migrated neural crest cells that have the capacity to produce melanin. the differential diagnosis includes malignant peripheral nerve sheath tumor, monophasic synovial sarcoma, deep - seated epithelioid sarcoma, adult fibrosarcoma, psammomatous melanotic schwannoma, and metastatic malignant melanoma. all these tumors can involve deep soft tissues of extremities and bear similar microscopic morphology as ccsst. ccsst is usually immunopositive for s-100, hmb-45, melan - a, microphthalmia transcription factor, bcl-2, and vimentin, viable positive for synaptophysin, cd56, and ema, rarely positive for ae1/ae3, and immunonegative for smooth muscle actin (sma), desmin, and cam5.2. our case shows focal staining for ae1/ae3, which is seldom reported positive in the published data. malignant peripheral nerve sheath tumor is immunopositive for s-100, but the staining is usually only focal. synovial sarcoma is generally positive for cytokeratin, ema, bcl-2, cd99, and calponin. it is characterized by the syt - ssx1 or syt - ssx2 fusion, detectable by either rtpcr or fish. epithelioid sarcoma is immunoreactive for vimentin, low- and high - molecular - weight cytokeratins, and ema, partial active for cd34, occasional active for sma and s-100, and frequently negative for ini1. however, psammomatous melanotic schwannoma has widespread psammoma bodies and usually affects spinal nerves, paraspinal ganglia, and autonomic nerves of viscera, which is not typical for ccsst. the most troubling differential is metastatic malignant melanoma, which has a similar deep soft tissue location as well as an identical microscopic morphology and immunohistochemical profile as ccsst. moreover, metastatic melanoma, similar to ccsst, may not show a primary skin lesion (that may have been removed, sloughed off, or be in a difficult to find location such as within the mucosal membranes). more than 90% of ccsst are associated with a distinct t(12;22)(q13;q12) chromosomal translocation, resulting in the formation of a fusion protein, ews - aft1, which is absent in metastatic malignant melanoma [4, 5 ] and psammomatous melanotic schwannoma. mr imaging is an important tool to diagnose soft tissue tumors. because of t1 shortening caused by the paramagnetic effect of intralesional melanin, high signal intensity on t1-weighted images and low signal intensity on t2-weighted images has been the classic description in ccsst. however, a literature review of mr imaging for ccsst showed highly variable results. in a review of 31 ccsst cases [7, 8, 9, 10, 11, 12, 13 ], mr images showed t1-hypointense signal in 33%, isointense signal in 19%, and t1-hyperintense signal in 48% of cases. the t2 characteristics showed t2 hypointensity in 22% of cases, isointense signal in 26%, and t2-hyperintense signal in 52% of these cases. the variable mr signal characteristics for ccsst can not be explained only by melanin content. tumors with similar melanin content can have quite different mr signals. in a case reported by isoda., both t1- and t2-weighted images exhibited hypointense signals, and no intracellular melanin was observed microscopically. our case also did not show melanin microscopically, but presented with mildly hyperintense signal on t1-weighted images and predominantly hyperintense t2 signal with scattered foci of low signal intensity. the prognosis of metastatic malignant melanoma is dismal. comparatively, the outcome in ccsst, although poor, is more protracted with high local recurrence, distant metastasis, and death from tumor. the survival rate for ccsst at 5, 10, and 20 years was 67, 33, and 10%, respectively, in one study. it has been a diagnostic difficulty for radiologists, podiatrists, and pathologists due to its rarity. the limited role of mr imaging in the diagnosis of ccsst and the variable immunoprofile, i.e. focally positive ae1/ae3 staining as shown in this paper, which is extremely rare, further complicate the diagnosis. when a slow - growing, nodular lesion is detected in a tendon or aponeurosis of a young to middle - aged patient, it should always raise the concern for ccsst. awareness of this rare tumor is crucial because it can be mistaken for other types of soft tissue tumors, especially metastatic malignant melanoma, an entity with an entirely different prognosis and management. | clear cell sarcoma of soft tissue is a rare, aggressive soft tissue tumor, which is morphologically similar to malignant melanoma but has no precursor skin lesion and, instead, has a characteristic chromosomal translocation. it is critical, yet challenging, to recognize clear cell sarcoma of soft tissue because the outcome is very different to that of metastatic melanoma. we report a case of clear cell sarcoma of soft tissue arising in the left foot of a 35-year - old african - american woman. |
nonarteritic anterior ischemic optic neuropathy (naion) is the most common form of acute optic neuropathy in people over the age of 50 years. the exact pathophysiology remains unclear ; however, transient hypoperfusion of the optic nerve head circulation and embolic lesions of the arteries / arterioles feeding the optic nerve head are the most common causes of naion.1 risk factors include systemic hypertension, nocturnal hypotension, diabetes mellitus, ischemic heart disease, hyperlipidemia, atherosclerosis, and optic disc pathologies like a small cup - to - disc ratio and optic nerve head drusen. various drugs, including phosphodiesterase type 5 inhibitors and interferon - alpha, have also been implicated in the development of naion ; however, there has been no report of naion attributed to corticosteroids. he also had a history of a lumbar herniated disc, for which he was prescribed triamcinolone acetonide (ta ; kenacort retard 40 mg, bristol - myers squibb, new york, ny, usa). four hours after intramuscular injection of his first dose of ta, the patient noted a sudden and profound decrease of vision in his right eye. in the neuroophthalmologic examination on the next day, best - corrected visual acuity was finger counting at 1 m in the right eye and 20/20 in the left eye accompanied by an afferent pupillary defect in the right eye. a dilated fundus examination of the right eye revealed prominent swelling of the disc with a disc rim hemorrhage. dilated fundus examination of the left eye revealed a healthy but crowded disc with a cup - to - disc ratio of 0.2 (figure 1). testing with a humphrey visual field analyzer (carl zeiss meditech ag, jena, germany) showed an absolute defect in the right eye (figure 2). fluorescein angiography revealed hyper - fluorescence of the right optic disk and leakage from it, indicating edema (figure 3). the patient s medical history revealed a 7-year history of hypertension treated with captopril 25 mg (kapril ; mn pharmaceuticals, istanbul, turkey). the patient stated that he had unstable hypertension and that he had not been examined for many years ; therefore, the information regarding the long - term blood pressure data from the last several years can not be provided. he reported no symptoms of arteritic anterior ischemic optic neuropathy, including painful jaw, muscle spasms, scalp tenderness, or shoulder pain. results of laboratory tests, including complete blood count, erythrocyte sedimentation rate, and serum c - reactive protein, were within normal range. a systemic evaluation was performed by a physician, and with the exception of senile hypertension, there was no evidence of cardiovascular disease, hypotension, diabetes, or hyperlipidemia. a diagnosis of unilateral naion was made, and the patient was counseled to discontinue using ta. three months later, visual acuity was finger counting at 1 m and the optic disc was pale in od. though hypertension may alone precipitate an naion, the short duration between the ta injection and the visual loss raises a fair question about a relationship of these factors in our patient. ta is a synthetic floriated corticosteroid that has anti - inflammatory, antipruritic, and vasoconstrictive properties. to our knowledge, synthetic corticosteroids are more potent than natural corticosteroids and have a longer duration of action.4,5 additionally, when given intramuscularly, synthetic corticosteroids are absorbed much more rapidly from the injection site.6 in a study by derendorf,7 plasma levels of ta after 5 mg of oral administration of ta achieved a maximum level of 10.5 ng / ml after 1 hour. regarding this finding, we may speculate that the intramuscularly - administered triamcinolone was able to enter the circulatory system in this short period of time. the injection of ta might have an effect on optic nerve circulation by the following possible mechanisms. first, the impaired optic nerve circulation is related to the inhibition of nitric oxide synthesis. nitric oxide, known as a physiological vasodilator, is synthesized in vascular endothelial cells. corticosteroids reduce its synthesis by altering the glucocorticoid receptor, which has been identified in endothelial cells.8 thus, impaired endothelium - dependent dilation may result in vasoconstriction of the arteries / arterioles that feed the optic nerve head, thus decreasing the optic nerve circulation. corticosteroids raise the vascular tone by potentiating the effects of vasoconstrictor hormones and by acting directly on vascular smooth muscle cells.9 corticosteroids also enhance agonist - mediated pharmacomechanical coupling by increasing ca mobilization and ca sensitivity of myofilaments.8 these vascular changes have been shown to develop within hours to days. in experimental studies regarding the time course for corticosteroids to potentiate vascular tone, rapid responses by activation of the sodium proton exchanger, stimulation of inositol phosphates, and cytosolic calcium mobilization have been shown in cultured vascular smooth muscle cells.10 third, since the patient is already known to have arterial hypertension, an acute hypertensive peak secondary to corticosteroid administration may have occurred. fourth, this may have been an incidental occurrence ; even though naion developed 4 hours after corticosteroid injection, it may have occurred incidentally on the grounds of unstable hypertension. since the systemic status of the patient before the visual loss is unknown, an increase in the r hayreh1 recently reported that systemic corticosteroid therapy given during the acute phase of naion significantly improved visual acuity and the visual field by leading to the faster resolution of optic disc edema. in contrast, our case suggested that synthetic corticosteroids may precipitate the development of a naion as well. although it is a unique case and there is no certain evidence about the relationship between ta and naion, the short duration between ta injection and naion is noteworthy. in this regard | a 56-year - old man noted a sudden decrease of vision in his right eye 4 hours after intramuscular triamcinolone acetonide (ta) injection. a diagnosis of unilateral nonarteritic anterior ischemic optic neuropathy (naion) was made, and the patient was counseled to discontinue using ta. examination for possible risk factors revealed controlled hypertension. final visual acuity was finger counting at 1 m, and the optic disc was pale in his right eye. this is the first reported case of unilateral naion that has occurred in a patient after intramuscular corticosteroid injection. although a cause - and - effect relationship is difficult to prove, the short duration between the ta injection and the naion is noteworthy. the history of corticosteroid injection should be questioned in cases with predisposing conditions such as hypertension. |
accumulating evidence suggests that the orbitofrontal (ofc) sulcogyral pattern could be used as morphometric trait marker of psychosis. the gross anatomy of the ofc varies widely between individuals ; ofc sulcogyral patterns are classified into four types, types i iv. since ofc sulcogyral patterns are largely determined during prenatal development and independent of longitudinal changes after birth, it is possible to examine these patterns to gain insight into abnormal perinatal brain development in sz. magnetic resonance imaging (mri) studies of ofc have consistently demonstrated the most frequent pattern, type i, was decreased in sz. however, sample sizes of previous studies were small - medium effects for detection. moreover, as shown in supplementary information (supplementary si-1), samples of the previous studies are predominantly male subjects and gender manifestation for ofc sulcogyral patterns is unclear. therefore, this study assessed ofc sulcogyral pattern in a larger cohort of subjects (n = 530), and also investigated gender effects. the demographic data of the subjects for each gender are shown in table 1. sz ofc distribution patterns significantly differed from healthy subjects (hs) in the left (= 14.55, p = 0.002), but not the right (= 5.38, p = 0.15) hemisphere (fig. 1b).table 1demographic and clinical characteristics of subjects for each genderhealthy subjectspatients with schizophrenia t or 2 p male subjects n = 185 n = 94age (years)36.3 13.034.3 10.91.90.22education (years)15.4 2.314.4 2.63.40.01iq111.8 12.1 (n = 181)88.6 18.1 (n = 81)12.0 sz : = 12.34, p sz : = 6.76, p = 0.009) and increased type ii expression (hs sz : = 12.34, p sz : = 6.76, p = 0.009) and increased type ii expression (hs < sz : = 11.56, p < 0.001) in the left hemisphere. p < 0.01, p < 0.001 to evaluate gender effects, tests were performed for each gender. in females, patients exhibited altered ofc patterns in left (= 12.38, p = 0.006) but not in right (= 5.04, p = 0.17) compared with hs. in female sz, post - hoc analyses revealed significantly decreased type i expression (= 6.76, p = 0.009) and increased type ii expression (= 11.56, p = 0.001) in left (fig. in male subjects, ofc patterns of sz were not significantly different from hc in both hemispheres (= 6.38, p = 0.1 for left, = 2.21, p = 0.53 for right). since nakamura. reported that sz patients with type iii expression evinced poorer cognitive function compared to patients without type iii expression, we have assessed iq difference between female subjects with and without type iii expressions in the left hemisphere. female patients with type iii showed significantly lower iq (74.7 10.8) compared to patients without type iii (85.6 17.1) (t = 2.4, p = 0.03). in the present large - sample study, ofc sulcogyral patterns were significantly altered in sz compared to hs, and this finding was partially consistent with previous findings. comparable with previous studies, right hemisphere type i ofc pattern diminished significantly in sz. in contrast to previous studies, we found altered ofc sulcogyral patterns in the left hemisphere in female sz. there was significantly lower prevalence of type i and significantly higher prevalence of type ii patterns in the left hemisphere. the recent mri study reported abnormal left hemispheric ofc patterns in adolescents born extremely preterm and/or at an extremely low birth weight. the sulcogyral pattern of the brain is formed during neurodevelopment, and it may be possible that our female sz sample presented altered ofc patterns in the left hemisphere. previous studies have reported that development of the right hemisphere occurs earlier than that of the left, and the authors ref. 8 speculated that a prolonged period of vulnerability for the left hemisphere is related to the increased chance of abnormal development. clinically, the present study showed that subjects with type iii showed significantly lower iq in female sz. type iii expression may be a part of a neurodevelopmental alteration ; however, further study will be needed in a larger female sz subjects. however, frequencies of types ii, iii, and iv expressions are lower compared to type i, and hence whether statistical significance is found may depend heavily on the subject group evaluated. although the present investigation is the first to detect ofc pattern effects in the left hemisphere in sz, limited sample size prevented prior investigations from sufficiently exploring small to medium effect sizes (see supplementary si-2, si-3). in conclusion, the present study revealed the diminished type i and the increased type ii ofc sulcogyral patterns in the left hemisphere in female sz. three patients and three hs withdrew their consents for this study, so they were excluded. the remaining subjects were the same as those in our most recently published mri study, and the subject recruitment, inclusion criteria and diagnostic evaluations have been described in the study. the protocol followed that of the previous publication. for consistent identification of the sulcogyral pattern, images were realigned using the line between the anterior and posterior commissures and the mid - sagittal plane to correct any head tilt, and resampled into isotropic voxels (0.9375 mm). we used the ofc pattern classification by the method of nakamura., and type iv was undifferentiated type. classification methods for the ofc sulcogyral patterns have been described in detail elsewhere (see fig. we used medical image analysis software packages (3d slicer, www.slicer.org), and the sulcogyral pattern classification in each hemisphere of the 530 subjects was done by s.i., who was blinded to the diagnoses. intraclass correlation coefficients were computed for the sulcal patterns by three independent raters, who were also blinded to the diagnoses. the intraclass correlation coefficients were 0.95 for left and 0.92 for right. to evaluate group differences in sulcogyral pattern distribution, | abnormalities in prenatal brain development contribute to schizophrenia vulnerability. orbitofrontal cortex sulcogyral patterns are largely determined during prenatal development, and four types of orbitofrontal cortex sulcogyral patterns have been classified in humans. altered orbitofrontal cortex patterns have been reported in individuals with schizophrenia using magnetic resonance imaging ; however, sample sizes of previous studies were small medium effects for detection, and gender manifestation for orbitofrontal cortex sulcogyral patterns is unclear. the present study investigated orbitofrontal cortex patterns of 155 patients with schizophrenia and 375 healthy subjects. the orbitofrontal cortex sulcogyral pattern distributions of schizophrenia were significantly different compared with healthy subjects in the left hemisphere (2 = 14.55, p = 0.002). in female schizophrenia, post - hoc analyses revealed significantly decreased type i expression (2 = 6.76, p = 0.009) and increased type ii expression (2 = 11.56, p = 0.001) in the left hemisphere. the present study suggested that female schizophrenia showed altered orbitofrontal cortex patterns in the left hemisphere, which may be related to neurodevelopmental abnormality. |
the major histocompatibility complex (mhc) gene of sheep is located on chromosome 20 and is called ovar. the mhc gene family includes two major subfamilies : class i and class ii genes. studies have shown the existence of class ii loci that are homologous to hla - dqb [36 ]. as in other vertebrate species, a high degree of polymorphism is found in the ovar - dqb genes, with most of the polymorphic sites located in exon 2, which encodes the antigen - binding site. due to its highly polymorphic character, a variety of studies have been applied in many fields. it has been well - reported that alleles of different mhc genes correlate with disease resistance in sheep ; furthermore, specific mhc alleles are associated with parasite resistance in sheep. currently, relevant research on ovar polymorphism and disease resistance or susceptibility mainly concentrates on ovar - drb1 [1014 ] and ovar - dqb [7, 15 ]. c.e is a cosmopolitan zoonotic parasitic disease caused by the larval stage (metacestode stage) of the tapeworm echinococcus granulosus that cycles between canines, particularly dogs, as definitive hosts and various herbivores as intermediate hosts. in the intermediate hosts and humans, c.e is associated with severe morbidity and disability, especially in pastoral areas in northwestern china, the prevalence of which not only results in a considerable decrease in livestock production, but also seriously affects the life quality of people. chinese merino sheep, well known as the character of well wool, is beneficial to local sheep husbandary ; however it is relatively more susceptible to c.e. therefore, this disease will result in low performance on chinese merino sheep. at present, many studies focus on mhc - hydatid disease associations in human [1619 ]. however, few reports have been published on the study of the ovar association with c.e in sheep. in this study, efforts were made to investigate mhc - drb1/dqb1 gene polymorphism and its association with resistance / susceptibility to c.e in chinese merino sheep, screening out the molecular genetic marker of antiechinococcosis. we received blood samples from 204 2-year - old chinese merino sheep, donated from mission 165, agricultural division 9, xinjiang production and construction corps. the c.e sheep and healthy sheep were distinguished by ovine hydatidosis elisa kit (shenzhen combined biotech co., ltd.). samples of genomic dna were obtained from whole blood and stored at 20c until analysis. the major materials and reagents were obtained from promega company and shanghai sangon biological engineering technology and service co., ltd. the first round of pcr was performed with primers ola - erb1 (gc) 5-ccg gaa ttc ccg tct ctg cag cac att tct t-3 and hl031 5-ttt aaa ttc gcg ctc acctcg ccg ct-3. 100 ng of genomic dna was used as dna template in a total volume of 20 l pcr reaction which was composed of 1.5 mm mgcl2 and 120 m dntps, to which 0.2 mm of each primer and 1.5 u of taq polymerase were added. reactions were performed in a thermocycler under the following conditions : one cycle of initial denaturation for 5 min at 94c followed by 15 cycles of 94c for 30 s, 50c for 30 s, and 72c for 60 s, with final extension at 72c for 10 min. three l of first step pcr was used for the second step pcr by using primers ola - erb1(gc) and ola - xrbi (5-agc tcg agc gct gca cag tgaaac tc-3). the conditions were one cycle for 5 min at 94c, followed by 30 cycles of 94c for 30 s, 63c for 30 s, and 72c for 60 s with final extension at 72c for 10 min. the second exon of dqb1 was amplified by primers fw : 5-ccc cgc aga gga ttt cgt g-3 and rev : 5-acc tcg ccg ctg cca ggt-3 ; 150 ng of genomic dna was amplified in a total volume of 112 50 l, including 1.5 mm mgcl2, 100 m dntps, 0.2 mm of each primer, and 2 u of taq polymerase. reactions were performed in a thermo cycler under the following conditions : one cycle of initial denaturation for 5 min at 94c, followed by 33 cycles of 94c for 30 s, 67c for 30 s, and 72c for 45 s, with final extension at 72c for 10 min. the cleavage map typing method and allele nomenclature referred to that of konnai.. each 10 l of drb1 pcr product was digested with 5 u of saci, hin1i, haeiii, mvai, and sacii, respectively, in a total volume of 20 l, including 2 l 10 buffer. each 10 l of dqb1 pcr product was digested with 5 u of mroxi, scai, sacii, ncii, taqi, mvai, and haeiii, respectively. samples were resolved by agarose gel electrophoresis at varying concentrations (table s1) (see supplementary material available online at http://dx.doi.org/10.1155/2014/272601). according to the typing results of restriction digest, the samples 54 and 74 were selected for cloning and sequencing, because the samples were haeiiimm, haeiiinn, mvaiyy, and mvaizz genotype, which are inconsistent with the previous reports. so the amplified pcr products of these samples were cloned into pgem - t vector, the ligated plasmids was selected by blue - white colony screening, then masculine clone were sent to sequence. to verify the validity and reliability of the above research results, sixteen 2-year - old chinese merino sheep, which were negative by hydatidosis elisa kit detection, were chosen to conduct the experiment of artificial infection with e.g. eight of the sheep with the haplotype of drb1-saciab / drb1-mvaibb / dqb1-taqiaa / dqb1-haeiiinn were taken as the test group, and the other eight sheep with the haplotypes of drb1-saciab / drb1-mvaibc / dqb1-taqiaa / dqb1-haeiiinn, drb1-saciab / drb1-mvaibc / dqb1-taqiaa / dqb1-haeiiimn, or drb1-saciab / drb1-mvaibb / dqb1-taqiaa / dqb1-haeiiimm, which were not associated with hydatidosis resistance or susceptibility, were taken as the control group. allelic and genotypic frequencies in c.e - negative and -positive chinese merino sheep were analyzed by t - test to assess the relationship between different genotypes and c.e significance. the chi - square test was performed to analyze the relationship between the different haplotypes and c.e resistance. the c.e infection rates of the test and control groups were compared by fisher 's exact test after artificial infection with e.g. ovar - drb1 exon 2 was amplified by pcr with primers ola - erb1, ola - hl031, and ola - xrbi ; one specific band of 296 bp was observed on 1.5% agarose (figure s1b). ovar - dqb1 exon 2 was amplified by pcr with primers fw and rev, and one specific band of 280 bp was observed on 2% agarose (figure s1b). from restriction digestion of drb1 exon 2 pcr product, genotypes of saci, hin1i, mvai, sacii, and haeiii (table s2b) were observed, and some of genotypic restriction maps were in figure 1. in addition, genotypes of restriction enzymes mroxi, scai, sacii, ncii, taqi, mvai, and haeiii (table s2b) for dqb1 pcr products were also observed, and some of their genotypic restriction maps were in figure 2. we verified the predicted rflp profiles of ovar - drb1 alleles by sequencing cloned 184 amplified products, and all of the observed patterns of fragments matched exactly with those predicted from dna sequences. sequencing of ovar - dqb1 exon 2 cloned amplified products revealed two single point mutations, t to g and a to g, at base positions 32 and 159, respectively, resulting in new alleles, haeiiimm and haeiiinn. in addition, two g - to - a point mutations at base positions 96 and 246 resulted in new alleles, mvaiy and mvaiz. comparison of sequencing results to the original sequence of dqb1 exon 2 (genbank, accession numbers : z28523) are shown in figure s3. statistical comparisons of genotypic frequencies in c.e sheep and healthy controls revealed that drb1 genotypic frequencies of mvaibb (p < 0.01), haeiiiee, and saciab (p < 0.05) in negatives were higher than in c.e sheep, indicating a strong association between these genotypes and c.e resistance, while genotypes in terms of saciiab (p < 0.05), haeiiidf (p < 0.05), haeiiibd (p < 0.01), and mvaibc (p < 0.01) in drb1 exon 2 occurred more often in c.e individuals when compared with the healthy group, which implied that there was a strong association between these genotypes and hydatidosis susceptibility (table 1). dqb1 genotypic frequencies of taqiaa and haeiiinn (p < 0.01), mvaidz (p < 0.05) in negatives were higher than in positives, while genotypes of taqiab and haeiiimn (p < 0.01), mvaicz (p < 0.05) in positives were higher than in negatives (table 2). therefore, we concluded that dqb1 genotypes of taqiaa, haeiiinn, and mvaidz were resistant to c.e, while genotypes of taqiab, haeiiimn, and mvaicz were susceptible to c.e. analyzing the haplotype of resistant genotypes, it was found that the haplotype frequency of drb1-saciab / drb1-mvaibb / dqb1-taqiaa / dqb1-haeiiinn in c.e - negative sheep was higher than in c.e sheep (p < 0.01), indicating that this haplotype was the resistant haplotype of chinese merino sheep (table 3). the haplotypes of drb1-mvaibc / dqb1-mvaiyy / dqb1-taqiab / dqb1-haeiiimn and drb1-mvaibb / dqb1-mvaicc / dqb1-taqiab / dqb1-haeiiimn in positives were higher than in negatives (p < 0.01), which implied that these haplotypes were susceptible to c.e individuals. the sixteen sheep that were artificially infected with e.g were slaughtered in the second month after e.g infection, and visual inspection of the liver and lung surfaces of each slaughtered animal was made for the detection of larval stages of cestodes. results show that 3 sheep were infected with e.g in the test group, whereas 6 sheep were infected with e.g in the control group ; therefore, the infection rate in the test group was significantly lower than that of the control group (p < 0.05). it is confirmed that the genic haplotype drb1-saciab / drb1-mvaibb / dqb1-taqiaa / dqb1-haeiiinn leads to c.e resistance in chinese merino sheep. the mhc gene is well known to be involved in the vertebrate immune system and encodes antigen recognition proteins used in the adaptive immune response. polymorphism of this gene has become a hot topic in the past decades. a variety of studies, both overseas and domestic, have shown that mhc of sheep and goats introduces polybase mutation and affluent polymorphism. [24, 25]utilized the pcr - rflp method to investigate polymorphism of drb in goats, konnai. researched the polymorphism of drb1 in some sheep, with results indicating that affluent polymorphism exists in the ovis aries - drb1 gene, and dongxiao and yuan studied drb3 polymorphism of chinese local sheep and goats. in addition, ovis aries - dqb1 gene investigations have been conducted abroad [21, 27 ], and chinese scholars have studied mhc - dqb and dqa in human, swine, and cattle [30, 31 ]. however, there are still no domestic reports of ovis aries - dqb1. in the present study, we used mroxi, scai, sacii, ncii, taqi, haeiii, and mvai by pcr - rflp to analyze dqb1 exon 2 and found the existence of 2, 2, 4, 2, 3, 3, and 6 alleles, as well as 3, 3, 7, 3, 4, 6, and 16 genotypes, respectively. the results of cloning and sequencing of the alleles, that is, haeiiim, haeiiin, mvaiy, and mvaiz, indicated that they are new alleles resulted from mutation in chinese merino sheep. the extensive diversity at many mhc loci provides a valuable source of genetic markers for examining the complex relationships between host genotype and disease resistance or susceptibility. suggested that the ovar - drb1 gene plays an important role in the enhanced resistance of suffolk sheep to nematode infection. by comparing phenotypic frequencies of a.e patients with healthy controls, it has been speculated that hla - drb1 11 may have a certain resistance to a.e, but hla - dqb1 02 would exacerbate the disease process. the potential immunogenetic predisposition for susceptibility and resistance to unilocular echinococcosis was investigated by hla - drb1 typing, and a statistically significant positive association was found between hla - dr3 and hla - dr11, and the occurrence of c.e. hla - dr3 antigen was positively associated with the occurrence of isolated, multiple pulmonary cysts. differences have been shown between hla characteristics of a.e patients with different courses of e.m, notably the association of the hla b8, dr3, and dq2 haplotype with more severe forms of this granulomatous parasitic disease, which suggested that hla characteristics of the host could influence immune - mediated mechanisms. this study found that the drb1-saciab / drb1-mvaibb / dqb1-taqiaa / dqb1-haeiiinn haplotype is echinococcosis resistant and selected the genetic markers of resistance to hydatidosis. in this study, analysis of polymorphisms of mhc - drb1/dqb1 by the pcr - rflp method was performed, as well as screening of genetic markers of antiechinococcosis in chinese merino sheep. artificial infection was used to verify the relationship between different haplotypes of polymorphic mhc gene loci and the resistance of echinococcosis, which would lay a theoretical foundation for sheep breeding of disease resistance in the future. | the aim of this study was to analyze the relationship between polymorphism of the mhc - drb1/dqb1 gene and its resistance to cystic echinococcosis (c.e), as well as to screen out the molecular genetic marker of antiechinococcosis in chinese merino sheep. the mhcii - drb1/dqb1 exon 2 was amplified by polymerase chain reaction (pcr) from dna samples of healthy and hydatidosis sheep. pcr products were characterized by restriction fragment length polymorphism (rflp) technique. five restriction enzymes (mval, haeiii, saci, sacii, and hin1i) were employed to cut drb1, while seven restriction enzymes (mroxi, scai, sacii, ncii, taqi, mval, and haeiii) were employed to cut dqb1.results showed that frequencies of patterns mvalbb (p < 0.01), saciab in drb1 exon 2 (p < 0.05), and taqiaa, haeiiinn (p < 0.01) in dqb1 exon 2 were significantly higher in the healthy group compared with the c.e individuals, which implied that there was a strong association between these genotypes and hydatidosis resistance or susceptibility. chi - square test showed that individuals with the genic haplotype drb1-saciab / drb1-mvalbb / dqb1-taqiaa / dqb1-haeiiinn (p < 0.01) were relatively resistant to c.e, while individuals with the genic haplotypes drb1-mvalbc / dqb1-mvalyy / dqb1-taqiab / dqb1-haeiiimn (p < 0.01) and drb1-mvalbb / dqb1-mvalcc / dqb1-taqiab / dqb1-haeiiimn (p < 0.01) were more susceptible to c.e. in addition, to confirm these results, a fielding experiment was performed with chinese merino sheep which were artificially infected with e.g. the result was in accordance with the results of the first study. in conclusion, mhc - drb1/dqb1 exon 2 plays an important role as resistant to c.e in chinese merino sheep. in addition, the molecular genetic marker of antiechinococcosis (drb1-saciab / drb1-mvalbb / dqb1-taqiaa / dqb1-haeiiinn) was screened out in chinese merino sheep. |
chairside soft denture lining materials are becoming a valuable resource especially for dentists practicing prosthodontics and implants. because of their viscoelastic property, these materials can act as shock absorbers and help distribute and reduce stresses on denture - bearing areas.1 the major characteristics for soft lining materials are high dimensional stability, adequate tear resistance, permanent resiliency, lack of odor and taste, ease of cleaning, adhesion to denture base and biocompatibility.2 with chairside denture lining materials, a direct technique is applied where uncured relining material is placed in the patient 's mouth and auto - polymerized.3,4 since denture liners are in direct contact with oral tissue, they have to be non - irritating, non - toxic, and incapable of supporting bacterial and fungal colonization.5,6 as time passes, the properties of soft liners can change as some ingredients may leach out from the material or extrinsic elements may be incorporated into the material.7 these materials may become more rigid and inelastic due to loss of plasticizer, thereby removing the most important characteristic physical property of a resilient denture liner which is the elastic modulus.8 evaluating the biocompatibility of a material is a vital step towards its acceptance in addition to testing of the material 's physical properties.9 park.10 evaluated the cytotoxicity of short - term use soft liners after repeated elution. another study by ozdemir.7 evaluated five commonly used soft lining materials and the study results showed that all tested materials had various degrees of cytotoxicity, especially at 96-hour test period. a systematic review by chaves.11 provided some evidence that heat - polymerized resins had lower cytotoxic effects than autopolymerizing denture acrylic resins and light - polymerized reline resins. although the study evaluated cytotoxicity, the materials utilized were hard denture lining materials since only a few studies have been undertaken regarding the cytotoxicity of soft denture lining materials.12 thus, the aim of this in vitro study was to evaluate the effect of aging on four soft denture lining materials in terms of cytotoxicity and tear strength. four commonly used soft lining materials were utilized for tear strength and cytotoxicity testing (coe - comfort gc america inc., alsip, il, usa ; coe - soft gc america inc., alsip, il, usa ; visco - gel dentsply caulk milford, de, usa ; and sofreliner tough m tokuyama dental corporation tokyo, japan) (table 1). sixty trouser - leg designed test specimens per lining material (240 specimens total) were fabricated using a stainless steel mold with dimensions of 50 mm long, 10 mm wide, and 1 mm thick (fig. the stainless steel mold was placed on a glass slide and each material was mixed according to the manufacturers ' instructions. by the use of a disposable plastic syringe, an additional glass slide was placed on top of the mold and firm hand pressure was applied to remove the excess material and the material was polymerized according to the manufacturers ' instr uctions. specimens were cut vertically (25 mm long) with a number 15 blade to form the trouser leg design. the 60 specimens per lining material were divided into three groups (20 specimens per group), non - thermocycling, 1000-thermocycling, and 3000-thermocycling group. the 1000- and 3000-cycle groups of all the lining materials were subjected to thermal cycling with a dwelling time of 30 seconds and a resting time of 6 seconds with temperatures of 5 and 55. mechanical testing was performed on a universal testing machine (shimadzu ag10knx, tokyo, japan) at a crosshead speed of 50 mm / min. testing of cytotoxicity and preparation of test specimens were executed in accordance with iso 10993 - 5.13 twenty - four disk specimens per lining material (96 specimens total) were fabricated using a stainless steel mold with dimensions of 10 mm diameter and 1 mm thickness (fig. the specimens were grouped in accordance to aging or incubation period (6 specimens per group), 0, 24, 48, and 72 hours, and stored at 37 in an atmosphere of 5% co2. the specimens were transferred into a 24-well cluster culture plate and washed with phosphate buffered saline (pbs) and kept under ultraviolet light to avert bacterial contamination.14 l929 mouse fibroblasts (korea cell line bank) were used to determine the cytotoxicity of the soft denture lining material. the l929 cell suspension was prepared at a concentration of 5 10 cells / ml and was dispensed into a 24-well cluster culture plate with direct contact with the specimens. the cells were grown as a monolayer culture in a cell culture dish at 37 in an atmosphere of 5% co2, sub cultured two times a week, and maintained at the third passage. the culture medium used was roswell park memorial institute (rpmi) 1640 (gibcolife technologies corporation, grand island, ny, usa) supplemented with 10% fetal bovine serum (fbs) and 1% antibiotic - antimycotic. adherent cells at the logarithmic phase were detached with 0.25% trypsin - ethylenediaminetetraacetic acid (edta) (gibcolife technologies corporation, grand island, ny, usa) and were incubated for 1 minute at 37. the cell proliferation kit ii (roche, mannheim, germany) was used for the xtt assay. xtt labeling reagent and electron - coupling reagent were thawed in a water bath at 37. the vials were thoroughly mixed until clear solutions were obtained. 5 ml of xtt labeling reagent was mixed with 0.1 ml of electron coupling reagent on a dark, clean bench. a 250 l volume of xtt labeling mixture was added per well in the 24-well cluster culture plate and the plate was incubated for 3 hours at 37 and 5% co2. after incubation, 150 l of mixture per well were aspirated and transferred to a 96-well cluster culture dish. the spectrophotometrical absorbance of the samples was measured using a microplate enzyme - linked immunosorbent assay (elisa) reader. the wavelength used to measure the optical density (od) of the absorbance of the formazan product was 450 nm, according to the filters available for the elisa reader used. cell viability and cell cytotoxicity were calculated in percentage of control groups according to the following modified formula:15 cell cytotoxicity (%) = 100 - cell viability (%) = (od of the test group / od of the control group) 100 cell viability was the scored according to the following classification : - more than 90 percent cell cytotoxicity : severely cytotoxic- 60 - 90 percent cell cytotoxicity : moderately cytotoxic- 30 - 59 percent cell viability : slightly cytotoxic- less than 30 percent cell cytotoxicity : non - cytotoxic - more than 90 percent cell cytotoxicity : severely cytotoxic - 60 - 90 percent cell cytotoxicity : moderately cytotoxic - 30 - 59 percent cell viability : slightly cytotoxic - less than 30 percent cell cytotoxicity : non - cytotoxic data were analyzed by two - way analysis of variance for group comparison and one - way analysis of variance for individual group comparisons using ibm spss version 20.0 (ibm spss statistics for windows, version 20.0 armonk, ny, usa). the means and standard deviations were recorded for both tests and significant differences of the results and between groups were analyzed using dunnett 's test (p<.05). table 2 shows the numerical tear strength test results and the same information is shown graphically in fig. 3. before thermocycling, sofreliner tough m (10.36 1.00 n) had the highest tear strength value while coe - comfort (0.46 0.10 n) had the lowest. after 3000 cycles sofreliner tough m (9.65 1.66 n) still presented the highest value and coe - comfort (0.42 0.08 n) the lowest. the results were significantly different from those of the other materials (p<.05). after 3000 cycles of thermocycling coe - comfort, coe - soft, and sofreliner tough m did not show any significant differences compared to their nonthermocycling and 1000-cycle groups (p<.05). with viscogel, the tear strength value went down after 1000 cycles, compared to the non - thermocycling group, but the difference was not significant. after 3000 cycles of thermocycling, the tear strength value was significant when compared to the 1000 cycle group (p<.05). table 3 shows the numerical cytotoxicity test results and this information is shown graphically in fig. 4. sofreliner tough m, in all incubation periods was least toxic and showed significant differences compared with all other materials (p<.05). coe - comfort, coe - soft, and sofreliner tough m did not have any significant differences across all incubation periods when compared to their respective groups (p<.05). with visco - gel, after soaking for 24 hours, the cytotoxicity of the material decreased and showed a significant difference compared to its non - soaking group (p<.05). for visco - gel in the 24-, 48-, and 72-hour groups, although the values changed, the changes were not significant (p<.05). temporary soft relining material can be used for a short period of time to improve the comfort and fit of dentures until they can be remade or permanently relined. these materials take the anatomy of the residual ridge and gel in that position and continue to flow slowly after application and distribute stress on denture - bearing tissues.4,16,17 soft denture lining materials are mainly made up of polyethyl or polymethyl methacrylate resin with a plasticizer such as dibutyl phthalate or ethanol. being low molecular weight compounds, these plasticizers are usually leached out in the saliva over a period of time. this leaching out of the plasticizers may result in reductions in softness of the material and also, since it is in direct contact with the oral mucosa, may cause adverse reactions like allergies and local chemical irritation.8,11 biologic and toxicologic aspects of dental materials are important in relation to their clinical usage.18 cytotoxicity is used to describe the cascade of molecular events that interfere with macromolecular synthesis, causing disruption of cellular functions and structural damage.7 cell culture studies are usually the preliminary point of an evaluation of biocompatibility. in vitro cytotoxicity tests are a essential screening step in the testing of new materials used in humans because they provide an investigation of toxicity in a simplified system that reduces the effects of confounding variables.19,20 testing of dental materials by cell culture methods is relatively simple to perform, reproducible, and cost - effective and such tests can be controlled.14 the choice of cell line for in vitro cytotoxicity testing remains controversial and a vast number of cell lines have been used.21 continuous cell lines, like 3t3 or l929 mouse fibroblasts, are suggested by international standards for the testing of medical devices used in dentistry because of the ease of controlling cell conditions.13,22 thonemann.23 indicated that l929 mouse fibroblasts are more sensitive than primary human gingival fibroblasts and differences in the responses of the cell types depend on the dental material tested. in this study, cytotoxicity was measured using a direct method which permits a more legitimate comparison between aging intervals as each set of specimens is statistically independent.24 to evaluate potential of such materials to cause irritation, the xtt colorimetric assay is applicable. xtt offers a high degree of sensitivity, while providing a considerable savings in time and labor by eliminating the need to solubilize the formazan product prior to absorbance measurements thus making it quick, easy and safe to perform.25,26 since leaching of unreacted monomer causes a reduction in the softness of soft denture lining materials and happens intraorally during function, various accelerated aging methods have been applied to these materials to simulate oral conditions.1,10,27,28,29,30,31 by means of thermocycling, cumulative effects of fatigue arising from sudden temperature changes can be determined. in this current study, temperature variation between 5 and 55 was chosen as these temperatures depict the temperature range of foods ingested during meals and do not damage oral tissues.29 as to the use of 1000 and 3000 thermal cycles, the objective was to evaluate the cumulative effect of fatigue within soft denture liner materials rather than to represent a certain wearing time for soft denture liners.32 after subjecting coe - comfort and coe - soft to thermocycling, the tear strength of the materials was not affected after 3000 cycles. although the values changed from non - thermocycling to 1000 cycles to 3000 cycles, statistically, the tear strength values did not have any significant differences when compared to each other. according to previous studies, leaching of plasticizers could affect the softness of the material, however with coe - comfort and coe - soft the tear strength was not affected. this result is supported by a study by munksgaard.12 that investigated coe - comfort, which is composed mainly of benzyl benzoate, and coe - soft, which is composed mainly of benzyl salicylate. the results of these experiments showed that leaching of plasticizers happens from 1 day up to 30 days. between 40% and 64% of the plasticizers found in the materials leached out within 30 days. the cumulative amount of plasticizers that had leached out in 30 days from each of the materials was between 128 mg g and 253 mg g. however this leaching of plasticizers not only affects the physical properties of the materials but also, according to past studies, may cause local irritation on the mucosa. in this current study, it was observed that both coe - comfort and coe - soft were toxic even after 72 hours (3 days) of soaking in normal saline solution. this result can also be related to the study by munksgaard12, which showed that in 30 days there were still plasticizers leaching from the materials tested. we saw that after subjecting the material to 3000 cycles of thermocycling, there was a significant difference in tear value when compared to its 1000 cycle result. we also saw that after soaking the material for 24 hours in normal saline solution, there was a significant decrease in cytotoxicity when compared to the results of the non - soaking group. visco - gel, which is composed of phthalyl butyl glycolate has a different composition than that of coe - comfort and coe - soft. this result can be supported by the study of murata.33 which found that benzyl salicylate, being a larger molecule, would be expected to leach out more slowly than phthalyl butyl glycolate. according to shanmuganathan.8, loss of a plasticizer like phthalyl butyl glycolate produced a more significant change in compliance than loss of benzyl salicylate. sofreliner tough m gave the highest tear strength value and was the least toxic among all the materials tested. these results are supported by the study by ciapetti.34 which found that among soft liners, which are similar to different silicone impression materials, vinyl poly siloxanes are nontoxic even when tested after extended exposure to cells. within the limitations of this in vitro study, it can be concluded that the tear strength of soft lining material depends on the type of plasticizer used. however, these factors can also contribute to toxicity over a long period of time. after interpretation of the gathered results the following conclusions were made : coe - comfort had the lowest tear strength and the highest cytotoxicity in all incubation period. the tear strength of coe - soft was not affected significantly by thermocycling but presented severe cytotoxicity in all incubation periods. after 3000 cycles of thermocycling, visco - gel showed significant increase in tear strength. cytotoxicity significantly decreased after 24 hours of soaking and presented slight cytotoxicity after 72 hours of soaking. sofreliner tough m, a silicone type soft lining material, had the highest tear strength and presented the lowest cytotoxicity. | purposethe aim of this in vitro study was to evaluate the effect of aging on the tear strength and cytotoxicity of four soft denture lining materials.materials and methodsfour commonly used soft denture lining materials, (coe - comfort gc america inc., alsip, il, usa ; coe - soft gc america inc., alsip, il, usa ; visco - gel dentsply caulk milford, de, usa ; and sofreliner tough m tokuyama dental corporation tokyo, japan) were selected. sixty trouser - leg designed specimens per lining material were fabricated using a stainless steel mold for tear strength testing. the specimens were divided into non - thermocycling and 1000-, and 3000- thermocycling groups. for the cytotoxicity test, twenty - four disk shaped specimens per material were fabricated using a stainless steel mold. the specimens were soaked in normal saline solution for 24 h, 48 h and 72 h. cytotoxicity was measured by xtt assay in l929 mouse fibroblasts. data were analyzed by two way analysis of variance and dunnett 's test (p<.05).resultsbefore thermocycling, sofreliner tough m (10.36 1.00 n) had the highest tear strength value while coe - comfort (0.46 0.10 n) had the lowest. after 3000 cycles, sofreliner tough m (9.65 1.66 n) presented the highest value and coe - comfort (0.42 0.08 n) the lowest. sofreliner tough m, in all incubation periods was the least toxic with significant differences compared to all other materials (p<.05). coe - comfort, coe - soft, and sofreliner tough m did not show any significant differences within their material group for all incubation periods.conclusionthis in vitro study revealed that aging can affect both the tear strength and cytotoxicity of soft denture materials depending on the composition. |
spinal epidural hematoma was first described by jackson in 1869. since then, only about 40 other pediatric cases have been reported so far, pointing toward the rarity of this lesion. the majority of these cases are spontaneous epidural hematomas, where only few have a traumatic origin. in all these case reports, the prime importance was early diagnosis and urgent evacuation of the hematoma for a good functional outcome. in this pretext, we report the case of a six -year - old boy who was admitted and managed surgically at our institution. a six - year - old boy presented to the emergency department because of severe neck pain and acute onset of quadriparesis, more prominent in the lower limbs than in the upper limbs. his symptoms had started a few hours earlier when he was practicing judo karate and had a blow on the nape of the neck and fell down. his motor examination revealed bilateral (b / l) upper extremity weakness (power grade - 4/5) and b / l lower limb weakness (power grade 3/5). the patient 's radiographic evaluation included a plain x - ray and mri cervical spine. x - ray of the cervical spine showed no fracture and the anatomical alignment was maintained. sagittal t1-weighed mri images showed a large slightly hyperintense, space - occupying lesion extending from c3 to t4 and displacing the spinal cord. the sagittal t2-weighed image showed the same space - occupying lesion, but it was isointense. on axial imaging the same findings were found on t1 and t2, demonstrating cord compression. hemilaminectomy and surgical evacuation of the hematoma was done by a vertical midline skin incision, extending from the external occipital protuberence to the t4 spinous process. the patient improved neurologically and at the time of discharge had power grade 5/5 in all four limbs. the patient is on a regular follow - up and is totally asymptomatic and neurologically intact. the annual incidence of spontaneous epidural spinal hematoma has been reported to be 0.1 in 100,000 population, whereas, in the pediatric population this incidence is significantly lower. only 40 cases have been reported in literature, out of which 34 were non - traumatic and the rest were traumatic (as in our case). the cause of the hematomas in the non - traumatic cases was probably related to tumors, arteriovenous malformations, epidural hemangiomas, coagulopathies, infections, and bleeding diatheses.[57 ] the location of the hematoma in the vast majority of cases was cervical (as in the present case), but thoracic and lumbar epidural hematomas have also been reported. the clinical presentation of epidural hematomas in pediatric patients varies significantly ; abnormal crying might be the only symptom in infants, which makes an appropriate diagnosis even more challenging. neck pain and tenderness, torticollis, focal motor or sensory deficits (depending on the location of the hematoma), irritability, and the brown sequard syndrome are some of the most commonly reported presenting symptoms. the progression of symptomatology and clinical signs is usually very rapid as was seen in our case, although slower progression over a few days is also possible. the neuroimaging workup of patients with suspected spinal epidural hematoma must include an mri, not only to delineate the hematoma and the relationship with the thecal sac, but also to rule out any underlying vascular or other disorder. in addition, obtaining a preoperative spinal angiogram, and newer noninvasive imaging modalities like computed tomography (ct) angiography and cervical magnetic resonance angiography (mra) could be good supplementary techniques for visualizing suspected vascular abnormalities. furthermore, appropriate laboratory tests are a prerequisite to rule out any bleeding diathesis or coagulation disorders. hemilaminectomy (as in our case) appears to provide adequate exposure for hematoma evacuation, even in the case of large lesions that cross the midline, and it minimizes the risk of developing a postlaminectomy deformity, which has been reported to be as high as 46% in patients younger than 19 years of age. multilevel laminoplasty is another surgical option for evacuating spinal epidural hematomas as this procedure minimizes the risk of developing postlaminectomy deformity. we have not found any comparative analysis of multilevel hemilaminectomy or laminoplasty, for development of postoperative deformities. as far as we know, the development of long - term, postoperative deformities has not been investigated in any comparative study of multilevel hemilaminectomy or laminoplasty. in adult patients, however, laminoplasty appears to be superior to hemilaminectomy in avoiding postoperative worsening of the cervical curvature, although the postoperative range of motion is similar with both techniques. we selected hemilaminectomy in our cases because of the shorter operating time and because we were more familiar with the procedure, but laminoplasty definitely represents a valid surgical option in the management of these cases. in our patient spinal epidural hematoma in pediatric patients is a rare entity, but it does occur. early diagnosis of this condition and rapid surgical evacuation are of paramount importance for a better neurological outcome. unfortunately, the nonspecific presenting symptomatology and clinical signs, especially in infants, makes the diagnosis quite challenging. the clinician should be suspicious of this entity and always include cervical spine epidural hematoma in the differential diagnosis of pediatric patients, who present with acute neck deformity or pain. | pediatric cervical epidural hematoma is an uncommon diagnosis and very few cases have been reported so far. the condition is difficult to diagnose and requires immediate surgical intervention to obtain the best possible neurological outcome. most of the cases are of a spontaneous origin. we report a case of traumatic cervical epidural hematoma, which was managed surgically, resulting in complete neurological recovery. |
the sage method is a highly competent technology that can give a global gene expression profile of a particular type of cell or tissue and also help in identifying a set of specific genes to the cellular conditions by comparing the profiles constructed for a pair of cells that are kept at different conditions [1, 2, 3, 4 ]. since the discovery of sage, for several years now, it has been used to provide a comprehensive analysis of a variety of different tissue samples, each usually consisting of millions of cells. the approach has been extended recently to permit analysis of gene expression in substantially fewer cells, thereby allowing analysis of heterogeneous tissues or microanatomical structures. sage data can also be used to complement studies in cases where other gene expression methods may be more convenient or efficient. (1) a short oligonucleotide sequence tag (1011 base pairs) contains sufficient information to uniquely identify a transcript. these tags are used to identify genes and relative abundance of their transcripts within mrna. (2) concatenation of short sequence tags allows the efficient analysis of transcripts in a serial manner since sage uses serial processing such that 2550 sage tags are analyzed on each lane of dna sequencer. the resulting sequence data are analyzed to identify each gene expressed in the cell and the levels at which each gene is expressed. this information forms a library that can be used to analyze the differences in gene expression between cells. the frequency of each sage tag in the cloned multimers directly reflects the transcript abundance. therefore, sage results in an accurate picture of gene expression at both the qualitative and the quantitative levels. sage technology has been used in a variety of cell lines and in many systems. the following sections describe the significant studies performed in malarial parasite, yeast, plant, and animal systems. sage is particularly well suited for malarial systems, as the genomes of plasmodium species remain to be fully annotated. by simultaneously and quantitatively analyzing mrna transcript profiles from a given cell population, the successful application of sage in plasmodium falciparum, 3d7 strain parasites, from which a preliminary library of 6880 tags corresponding to 4146 different genes was generated, has been reported recently. it was demonstrated that plasmodium falciparum is amenable to this technique, despite the remarkably high a - t content of its genome. sage tags as short as 10 nucleotides were sufficient to uniquely identify parasite transcripts from both nuclear and mitochondrial genomes. moreover, the skewed a - t content of parasite sequence did not preclude the use of enzymes that are crucial for generating representative sage libraries. finally, a few modifications to dna extraction and cloning steps of the sage protocol proved useful for circumventing specific problems presented by a - t rich genomes. in a related study, sage was applied to the malarial parasite plasmodium falciparum to characterize the comprehensive transcriptional profile of erythrocytic stages. a sage library of approximately 8335 tags representing 4866 different genes was generated from 3d7 strain parasites. basic local alignment search tool analysis of high abundance sage tags revealed that a majority (88%) corresponded to 3d7 sequence, and despite the low complexity of the genome, 70% of these highly abundant tags matched unique loci. characterization of these suggested the major metabolic pathways that are used by the organism under normal culture conditions. furthermore, several tags expressed at high abundance (30% of tags matching unique loci of the 3d7 genome) were derived from previously uncharacterized open reading frames, demonstrating the use of sage in genome annotation. the open platform profiling nature of sage also leads to the important discovery of a novel transcriptional phenomenon in the malarial pathogen : a significant number of highly abundant tags that were derived from annotated genes (17%) corresponded to antisense transcripts. these sage data were validated by two independent means : strand specific rt - pcr and northern analysis, where antisense messages were detected in both asexual and sexual stages. sage analysis has been successfully applied for transcript profiling in yeast. of the genes identified in yeast, 1981 genes had known functions while other 2684 genes were previously uncharacterized. the integration of positional information with gene expression data allowed for the generation of chromosomal expression maps identifying physical regions of transcriptional activity and also identified genes that had not been predicted by sequence information alone. a genome - wide characterization of mrna transcript levels in yeast grown on the fatty acid oleate has been determined using sage. comparison of this sage library with that reported for glucose - grown cells revealed the dramatic adaptive response of yeast to a change in carbon source. in oleate - grown cells, this was exemplified by the huge increase of mrnas encoding the peroxisomal beta - oxidation enzymes required for degradation of fatty acids. the data provide evidence for the existence of redox shuttles across organellar membranes that involve peroxisomal, cytoplasmic, and mitochondrial enzymes. induction of genes under the immediate control of these factors was abolished ; other genes were upregulated, indicating an adaptive response to the changed metabolism imposed by the genetic impairment. analysis of global gene expression in saccharomyces cerevisiae by the sage technique has permitted the identification of at least 302 previously unidentified transcripts from nonannotated open reading frames (norfs). transcription of one of these, norf5/hug1, is induced by dna damage, and this induction requires mec1, a homologue of the ataxia telangiectasia mutated (atm) gene. hug1 is the first example of a norf with important biological functional properties and defines a novel component of the mec1 checkpoint pathway. in a recent study, 10 genome expression data sets have been analyzed by large - scale cross - referencing against broad structural and functional categories. this analysis enabled to determine features more prevalent in the transcriptome than the genome, that is, those that are common to highly expressed proteins. starting with simplest categories, it has been found that, relative to the genome, the transcriptome is enriched in alanine and glycine and depleted in asparagine and very long proteins. in particular, some enzymatic folds, such as the tim barrel and the g3p dehydrogenase folds, are much more prevalent in the transcriptome than the genome, whereas others, such as the protein - kinase and leucine - zipper folds, are depleted. furthermore, for a given functional category, transcriptome enrichment varies quite substantially between the different expression data sets, with a variation an order of magnitude larger than for the other categories cross - referenced (eg, amino acids). sage was applied for profiling expressed genes in rice seedlings (oryza sativa l.). only 1367 genes (23.1%) matched the rice cdna or est sequences in the dna database. sage showed that most of the highly expressed genes in rice seedlings belong to the category of housekeeping genes. unexpectedly, the most highly expressed gene in rice seedlings was a metallothionein (mt) gene, and together with three other messages for mt, it accounts for 2.7% of total gene expression. sage was also applied to identify differentially expressed genes between anaerobically treated and untreated rice seedlings. in combination with microarray analysis, sage serves as a highly efficient tool for the identification and isolation of differentially expressed genes in plant. the global gene expression patterns of arabidopsis pollen using sage were characterized recently. it was interesting to note that the number of unique tags in pollen was low compared with the sage library of the leaf constructed on a similar scale. functional classification of the expressed genes reveals that those involved in cellular biogenesis such as polygalacturonase, pectate lyase, and pectin methylesterase make up more than 40% of the total transcripts. the expression level of the great majority of transcripts was unaffected by cold treatment at 0c for 72 hours, whereas pollen tube growth and seed production were substantially reduced. these results strongly suggest that poor accumulation of proteins that play a role in stress tolerance may be why arabidopsis pollen is cold - sensitive. to characterize gene expression in activated mast cells more comprehensively, the changes in genetic transcripts were surveyed by the method of sage in the rbl-2h3 line of rat mast cells before and after they were stimulated through their receptors with high affinity for immunoglobulin e (fcepsilonri). among the diverse genes that had not been previously associated with mast cells and that were constitutively expressed were those for the cytokine macrophage migration inhibitory factor neurohormone receptors such as growth hormone - releasing factor and melatonin and components of the exocytotic machinery. in addition, several dozen transcripts were differentially expressed in response to antigen - induced clustering of the fcepsilonri. included among these were the genes for preprorelaxin, mitogen - activated protein kinase kinase 3, and the dual specificity protein phosphatase, rvh6. sage method was used to systematically analyze transcripts present in a microglial cell line. among the diverse transcripts that had not been previously detected in microglia were those for cytokines, such as endothelial monocyte - activating polypeptide i (emap i), and for cell surface antigens, including adhesion molecules such as cd9, cd53, cd107a, cd147, cd162 and mast cell high affinity ige receptor. in addition, transcripts that were characteristic of hematopoietic cells or mesodermal structures, such as e3 protein, a1, en-7, b94, and ufo were also detected. furthermore, the profile contained a transcript, hn1, that is important in hematopoietic cells and neurological development suggesting the probable neural differentiation of microglia from the hematopoietic system in development. mrna expression of these genes was confirmed by rt - pcr in primary cultures of microglia. the mouse otx2 gene is a homeobox transcription factor required as early as gastrulation for the proper development of the head. the gene expression profiles were compared in wild - type and otx2(-/-) 6.5-day post - coitum embryos by using a sage assay adapted to microdissected structures. using sage, a tag expression library from rop-+/+ mouse kidney has been constructed. tag sequences were sorted by abundance, and identity was determined by sequence homology searching. previously characterized transcripts were clustered into functional groups, and those encoding metabolic enzymes, plasma membrane proteins (transporters / receptors), and ribosomal proteins were most abundant. the most common, kidney - specific transcripts were kidney androgen - regulated protein, sodium - phosphate cotransporter, renal cytochrome p-450, parathyroid hormone receptor, and kidney - specific cadherin. in a recent study, the transcriptome of a highly differentiated mouse clonal cortical collecting duct (ccd) principal cell line (mpkccd(cl4)) and the changes in the transcriptome induced by aldosterone and vasopressin have been analyzed. sage was performed on untreated cells and on cells treated with either aldosterone or vasopressin for 4 hours. statistical comparison of the three sage libraries revealed 34 aits (aldosterone - induced transcripts), 29 arts (aldosterone - repressed transcripts), 48 vits (vasopressin - induced transcripts), and 11 vrts (vasopressin - repressed transcripts). a selection of the differentially expressed, hormone - specific transcripts (5 vits, 2 aits, and 1 art) has been validated in the mpkccd(cl4) cell line either by northern blot hybridization or reverse transcription - pcr. the hepatocyte nuclear transcription factor hnf-3-alpha (vit39), the receptor activity modifying protein ramp3 (vit48), and the glucocorticoid - induced leucine zipper protein (gilz) (ait28) are candidate proteins playing a role in physiological responses of this cell line to vasopressin and aldosterone. the development of cardiovascular diseases such as heart failure involves functional changes that are beneficial short - term, but may be fatal long - term. in a recent study, the current state of genomic research for determination of the transcriptome by the first limited sage analysis of rodent heart gene expression has been described. it has also been discussed that how these results generated with this approach can be applied to the study and treatment of cardiovascular diseases. molecular inventories of the developing mouse neocortex before and after birth were generated using the global gene expression profiling tool sage. the libraries were generated from embryonic day 15 and postnatal day 1 mouse neocortices. the differentially expressed transcripts included genes known to be important in neocortical development (eg, brain factor 1, neurod2, and id2), genes not previously associated with neocortical development (such as brahma - related gene 1, receptor for activated c - kinase i, hypermethylated in cancer 2, and evi9), and genes of unknown identity or function. sage was applied to study differentially expressed genes in mouse brain 14 hours after the induction of focal cerebral ischemia. metallothionein - ii (mt - ii) was the most significantly upregulated transcript in the ischemic hemisphere. mt - i and mt - ii are induced by metals, glucocorticoids, and inflammatory signals in a coordinated manner, yet their function remains elusive. mt - i- and mt - ii - deficient mice developed approximately threefold larger infarcts than wild - type mice and a significantly worse neurological outcome. ftl-1, -3, and -10 are three murine day 14 fetal thymocyte cell lines produced in order to model developmental stages within early (cd3-cd4-cd8) thymocyte differentiation. in a recent study, the sage method was used to perform a systematic analysis of transcripts present in these cell lines. differentially expressed mrna transcripts representing different gene classes were identified, including t cell functional genes, cytokine receptors, adhesion molecules, and transcription factors. expression of the transcription factors runx2 and phd finger protein 2 and of the igf type 1 receptor was shown to have differentially regulated expression patterns in sorted dn1 - 4 cells. these genes, and others identified by this analysis, are likely to play important roles in the development of t cells. in order to identify genes developmentally regulated in the somatic cells of the testis, sage has been used to generate gene expression profiles from these cells in the fetal and adult mouse testes. to avoid germ cell transcripts, a fetal sage library was generated from germ cell - free fetal w(v)/w(v) mice and an adult sage library from adult testes depleted of germ cells with busulfan. the differentially regulated genes are likely to provide insight into mechanisms regulating testis function both during development and in the adult animal. sage technology has been utilized to contrast the differential gene expression profile in rat embryo fibroblast cells producing temperature - sensitive p53 tumor suppressor protein at permissive or nonpermissive temperatures. analysis of approximately 15 000 genes revealed that the expression of 14 genes was dependent on functional p53 protein, whereas the expression of 3 genes was significantly higher in cells producing nonfunctional p53 protein. those genes whose expression was increased by functional p53 include ras, u6 snrna, cyclin g, egr-1, and several novel genes. the expression of actin, tubulin, and hsp70 genes was elevated at the nonpermissive temperature for p53 function. interestingly, the expression of several genes was dependent on a non - temperature - sensitive mutant p53 suggesting altered transcription profiles dependent on specific p53 mutant proteins. these results demonstrate the utility of sage for rapidly and reproducibly evaluating global transcriptional responses within different cell populations. kringle domain, a triple - disulfide - linked domain, is conserved in diverse proteins which play important roles in various biological processes. kremen, a novel member of kringle - containing proteins, has been cloned using a newly developed unique strategy, kringle - sage, which enables comprehensive analysis of kringle - containing proteins. kremen is likely to be a type - i transmembrane protein composed of 473 amino acid residues. kremen has a kringle domain, a wsc domain, and cub domains in the extracellular region, while the intracellular region has no conserved motif involved in signal transduction. in the mouse embryo, the kremen mrna level, which was increased during embryonic development, was localized in the apical ectodermal ridge of limb buds, myotome, and sensory organs (eg, optic vesicle, otic vesicle, and nasal pit). in the adult mouse, kremen mrna was expressed in a variety of tissues with a relatively strong expression in the lung, heart, and skeletal muscle. kremen mrna expression in c2c12 and nie-115 cells increased during respective differentiation into muscular and neural cells. these results suggest a potential role for kremen in the regulation of cellular responses upon extracellular stimulus or cell - cell interaction in neuronal and/or muscle cells. kringle - sage is expected to facilitate further elucidation of structure and functions of kringle proteins. to elucidate the molecular basis of muscle atrophy, the sage method has been performed with control and immobilized muscles of 10 rats. the genes that expressed greater than 0.5% in muscle are involved in the following three functions : (1) contraction (troponin i, c, and t ; myosin light chain 13 ; actin ; tropomyosin ; and parvalbumin), (2) energy metabolism (cytochrome c oxidase i and iii, creatine kinase, glyceraldehyde-3-phosphate - dehydrogenase, phosphoglycerate mutase, atpase 6, and aldolase a), and (3) housekeeping (lens epithelial protein). muscle atrophy appears to be caused by changes in mrna levels of specific regulators of proteolysis, protein synthesis, and contractile apparatus assembling, such as polyubiquitin, elongation factor 2, and nebulin. immobilization has produced a decrease more than threefold in gene expression of enzymes involved in energy metabolism, especially atpase, cytochrome c oxidase, nadh dehydrogenase, and protein phosphatase 1. differential gene expressions of selenoprotein w and uroporphyrinogen decarboxylase, which can be involved in oxidative stress, were also observed. other genes with various functions, such as cholesterol metabolism and growth factors, were also differentially expressed. moreover, novel genes regulated by immobilization were discovered. thus, this study allows a better understanding of global muscle characteristics and the molecular mechanisms of sedentarity and sarcopenia. using the sage method, a gene expression profile of the rat hippocampus a total of 76 790 sage tags were analyzed, allowing identification of 28 748 different tag species, each representing a unique mrna transcript. the tags were divided into different abundancy classes, ranging from tags that were detected over 500 times to tags encountered only once in the 76 790 tags analyzed. the mrna species detected more than 50 times represented 0.3% of the total number of unique tags while accounting for 22% of the total hippocampal mrna mass. the genes expressed at the highest levels were of mitochondrial origin, consistent with a high requirement for energy in neuronal tissue. at a lower level of expression, several neuron - specific transcripts were encountered, encoding various neurotransmitter receptors, transporters, and enzymes involved in neurotransmitter synthesis and turnover, ion channels and pumps, and synaptic components. comparison of relative expression levels demonstrated that glutamate receptors are the most frequent neurotransmitter receptors expressed in the hippocampus, consistent with the important role of glutamatergic neurotransmission in the hippocampus, while gaba receptors were present at approximately ten - fold lower levels. several kinases were present including camkii, which was expressed at high levels, consistent with being the most abundant protein in the spines of hippocampal pyramidal cells. adrenal corticosteroids (cort) have a profound effect on the function of the hippocampus. this is mediated in a coordinated manner by mineralocorticoid (mr) and glucocorticoid (gr) receptors via activation or repression of target genes. using sage, cort - responsive hippocampal genes regulated via mr and/or gr have been identified in a recent study. sage profiles were compared under different conditions of cort exposure, resulting in identification of 203 cort - responsive genes that are involved in many different cellular processes like energy expenditure and cellular metabolism ; protein synthesis and turnover ; signal transduction, neuronal connectivity, and neurotransmission. in situ, hybridization revealed that six randomly chosen cort - responsive genes had distinct expression patterns in neurons of the hippocampus. in addition, using in situ hybridization, it was confirmed that these six genes were indeed regulated by cort, underscoring the validity of the sage data. comparison of mr- and gr - dependent expression profiles revealed that the majority of the cort - responsive genes was regulated either by activated mr or by activated gr, while only a few genes were responsive to both activated mr and gr. this indicates that the molecular basis for the differential effects of activated mr and gr is activation or repression of distinct, yet partially overlapping sets of genes. the putative cort - responsive genes identified in this study will provide insight into the molecular mechanisms underlying the differential and sometimes opposing effects of mr and gr on neuronal excitability, memory formation and behaviour as well as their role in neuronal protection and damage. intraepithelial lymphocytes (iels) are abundant, evolutionarily conserved t cells, commonly enriched in t cell receptor (tcr) gamma delta expression. however, their primary functional potential and constitutive activation state are incompletely understood. to address this, sage was applied to murine tcr gamma delta+ and tcr alpha beta+ intestinal iels directly ex vivo, identifying 15,574 unique transcripts that collectively portray an activated yet resting, th1-skewed, cytolytic, and immunoregulatory phenotype applicable to multiple subsets of gut iels. expression of granzymes, fas ligand, rantes, prothymosin beta4, junb, rgs1, btg1, and related molecules is high, whereas expression of conventional cytokines and high - affinity cytokine receptors is low. differentially expressed genes readily identify heterogeneity among tcr alpha beta+ iels, whereas differences between resident tcr gamma delta+ iels and tcr alpha beta+ iels are less obvious. although extraocular muscle (eom) is a skeletal muscle, aspects of its biology are unlike other striated muscles. in a recent study, sage isolates and sequences 10-bp tags from defined locations in mrna - derived cdna. tag sequence - location was used to extract transcript identity from a curated sage database, and detection frequencies reflected abundance of corresponding mrnas. of the unique tags, 7.8% were detected at high to intermediate levels, 19.3% at lower levels, and 72.9% as single copies ; 40% of the tags matched known expressed sequence tags (ests), most of which (85.7%) represented a unique est. tags without matches in the sage database and those expressed as single copies only were not considered further. sage tags expressed at more than 0.1% of total transcripts reflected several aspects of muscle biology, including sarcomeric structure, energy metabolism, and ribosomal protein expression. genes highly expressed in eom were compared with other existing muscle expression databases to identify conserved and novel patterns in eom. these data provide a normative gene expression database and a novel molecular signature that will facilitate the study of eom development and function and of the mechanisms behind its preferential targeting or sparing in neuromuscular disease. progress in large - scale cdna analysis (est analysis) in many organisms is a prerequisite for the useful application of sage, as the annotation of sage tags is based on preexisting est databases. the uniqueness of sage is that it allows transcript profiles to be given as digital data. accordingly, they become suitable for the construction of gene expression databases on computer networks. yeast and cancer transcriptome databases based on sage are already accessible via the internet. in the organisms where transcript data are limited, sage may initially be the most efficient method of identifying new or differentially expressed genes. the sage data analysis could also be used as reference data for the relative expression data obtained by hybridization experiments on cdna arrays, and may ultimately allow comparison of array data between different experiments in different laboratories. sage is also used as a primary discovery engine that can characterize human diseases at the molecular level while illuminating potential targets and markers for therapeutic and diagnostic developments respectively. the ability of sage to define specific transcriptomes will aid in the development of gene therapies whereby cell- or tissue- specific promoters and genes can be utilized to appropriately express and deliver a given therapy. in general, sage alone or in combination with proteomic approaches can accelerate the identification of high - quality drug targets which could be a next generation of therapeutic products. sage, along with other methods, should yield valuable information about the fundamental biology and virulence mechanism of an important plant or human pathogen. in combination with microarray analysis, sage should serve as a highly efficient tool for the identification and isolation of differentially expressed genes in plants and animals. | the serial analysis of gene expression (sage) method is based on the isolation of unique sequence tags from individual transcripts and concatenation of tags serially into long dna molecules. sage is an innovative technique that offers the potential of cataloging both the identity and relative frequencies of mrna transcripts in a given rna preparation. it can quantify low - abundance transcripts and reliably detect relatively small differences in transcript abundance between cell populations. sage data can be used to complement studies in cases where other gene expression methods may be more convenient or efficient. sage can be used in a wide variety of applications to identify disease - related genes, to analyze the effect of drugs on tissues, and to provide insights into the disease pathways. the most important application of sage is the identification of differentially expressed genes. in this review, we describe various applications of this powerful technology in malarial parasite, yeast, plant, and animal systems. |
lung cancer represents the leading cause of cancer death worldwide.1 non - small - cell lung cancer (nsclc) constitutes ~80% of lung cancers. the most common histological subtypes of nsclc include adenocarcinoma (ac), squamous cell carcinoma (scc), and large - cell carcinoma. metastatic disease is observed in ~40% of newly diagnosed patients with nsclc, and the majority of the remainder will eventually develop metastases.2 despite the recent advances in surgery, radiotherapy, chemotherapeutic agents, and novel molecular targeted drugs in the past decades, the prognosis of nsclc is still poor, and the overall 5-year survival rate is 17.1%.3 it is essential to find novel therapeutic approaches to improve the prognosis of nsclc. an improved understanding of the immune system along with the discovery of tumor - associated antigens (taas) has made it possible to design various immunotherapy strategies for lung cancer.4 folate receptor alpha (fra), a glycosylphosphatidylinositol - anchored cell surface glycoprotein, is overexpressed on the surface of various tumor types, including pancreatic, prostate, head and neck, breast, and ovarian cancer (oc), mesothelioma, as well as nsclc.513 folic acid (an essential b vitamin) is necessary for proper cell growth and one - carbon transfer processes mediated by numerous enzymes that are involved in dna synthesis.14 fra binds folic acid with high affinity and mediates its intracellular transport via receptor - mediated endocytosis.15 the expression of fra allows epithelial tumor cells to proliferate suggesting that fra is an acquired tumor cell proliferation, tumor biology, and patient prognosis marker.6,12,1618 several studies have suggested that levels of fra expression are associated with tumor stage and survival in lung ac.8,13 fra has a much more limited normal tissue distribution, with measurable expression restricted largely to the apical surfaces of the epithelial tissue, predominantly in the kidney, lung, and choroid plexus, where it is inaccessible to the drugs in circulation.19,20 due to its limited expression and restricted distribution pattern in normal tissue, fra is the most widely studied member of folate receptor family and is an attractive taa for cancer immunotherapy.21 to date, various strategies for targeting fra - expressing cancers have been developed. in this review, we further discuss the potential treatment approaches for fra - expressing lung cancer, including conjugated fra agents, an fra - specific monoclonal antibody (mab) farletuzumab, and novel chimeric antigen receptor (car)-based t - cell therapy for nsclc. high level of fra expression in nsclc was well demonstrated by various groups.8,9,22,23 in the largest of these studies, fra expression was examined by immunohistochemistry (ihc) analysis in 320 surgically resected nsclc tissue specimens comprising 202 acs and 118 sccs.9 acs were more likely to express fra than sccs, and the mean expression scores were significantly higher in acs than in sccs at the membrane and cytoplasmic localizations. tumors from never - smokers were significantly more likely to express cytoplasmic fra than those from smokers. further moreover, epidermal growth factor receptor (egfr)-mutant acs demonstrated significantly higher expression scores for membrane fra than wild - type tumors. therapeutic agents targeting the fra or egfr are approved by the us food and drug administration or are in clinical development. christoph found that 47 patients (29%) had high expression of both of the receptors and could be candidates for combined targeted therapy. another study25 also supports that a significantly higher proportion of acs were positive for fra when compared to other histologies (p<0.001) and in females versus males (p=0.003), utilizing aqua technology (genoptix medical laboratory, carlsbad, ca, usa), an automated fluorescence ihc - based method that provides continuous protein expression scores in tissue. however, cagle showed that both lung acs and sccs expressed relatively high levels of fra in the malignant cells. in addition, fra - positive circulating tumor cells were detected in patients with nsclc, even in early - stage tumors.26 taken together, all these results suggest that fra is a highly promising target, and a greater percentage of lung cancer patients may benefit from fra - based therapies. in contrast from studies in breast cancer, oc, and other epithelial cancers,18,27,28 higher fra expression exerts a favorable influence in early - stage nsclc,8,13 suggesting that fra plays a contrasting role with respect to tumor development and/or progression in nsclc. the impact of fra overexpression on prognosis of nsclc is not well understood, and the mechanisms by which this may occur need further investigation. targeting of fra - positive tumor cells in vitro and in vivo has been exemplified using folic acid conjugates with a variety of therapeutic probes (figure 1a). for this approach, folate can be linked to chemotherapeutic agents, nanoparticles, drug - loaded liposomes, and oligonucleotides.29,30 the fra can actively internalize bound folate drug conjugates via the natural process of endocytosis (figure 1a and d).31 because there is limited distribution of fra on normal tissue and folate - bound drug is not active, folate conjugates can achieve cancer - specific drug delivery with minimal toxicity. among those, ec145 (also known as vintafolide or mk-8109) is a novel folate - conjugated vinca alkaloid (desacetylvinblastine monohydrazide ; davlbh)32 that binds to the fra with high affinity. ec145 produces marked antitumor activity specifically against fra - expressing tumor xenografts without significant toxicity,33 thereby prompting the clinical studies. early clinical results34 suggest that ec145 appeared well tolerated, without remarkable toxicity observed in vinca alkaloids. further results of a multicenter trial35 in a highly refractory population with advanced nsclc indicated the antitumor activity of ec145, and in that, a clinical benefit response of 26% was obtained. the median progression - free survival (pfs) and overall survival were 7.4 weeks and 42.9 weeks, respectively. further exploratory analysis demonstrated that patients who are fra(2 +) have superior clinical benefit response compared with those who are fra(1 +) (50% versus 14.3% ; p=0.10) based on ec20 uptake. ec20 is a peptide derivative of folic acid and was designed to efficiently coordinate tc. this new chelate was found to bind fra - positive tumor cells in both a time - and concentration - dependent manner with very high affinity. ec20 uptake may represent a positive prognostic marker, and further development of ec145 and other fra - targeted therapeutics for the treatment of ac of the lung should be explored. the most common drug - related adverse events (aes) were fatigue, peripheral neuropathy, and constipation, primarily grade 1/2 in severity. further, a randomized phase ii trial comparing the activity of ec145 and ec145 plus docetaxel with docetaxel alone in higher fra expression tumors (2 +) has been activated (clinicaltrials.gov identifier : nct01577654). a wide range of other therapeutic folate conjugates the folate - targeted therapeutic agents include a highly immunogenic hapten,21 an epothilone, or a dual - warhead folate conjugate in the same molecule.36 patients were first immunized against a hapten to stimulate an anti - fluorescein isothiocyanate (fitc) antibody (ab) response. ec17 (folate fitc conjugate) redirects anti - fitc - conjugated hapten ab produced by the patients to fra - expressing tumor cells, which leads to the removal of the ab - coated tumor cells ; the safety of this strategy was demonstrated in renal cancer and oc patients.37 epofolate (bms-753493) is a folate conjugate of a microtubule - stabilizing agent epothilone a. currently, epofolate is undergoing phase i / ii clinical trial (clinicaltrials.gov identifier : nct00546247 and nct00550017) sponsored by bristol - myers squibb in advanced cancers. ec0225, a folate conjugated to both vinca alkaloid and mitomycin, has completed a phase i trial (clinicaltrials.gov identifier : nct00441870). the high level of fra expression in lung cancers argues that lung cancers could be a good indication of various conjugated fra agents. the use of mabs (figure 1b and d) therapy can selectively target the fra - expressing tumors, and thus offer potential benefits such as avoiding the cytotoxic toxicity in normal tissue caused by traditional chemotherapeutic agents. ihc studies using an fra - binding murine mab, lk26, showed highly restricted distribution of fra in normal tissues but widespread expression on cancer cells, including oc and renal cancer.38 farletuzumab (morab-003) is a humanized immunoglobulin g subtype 1 kappa mab against fra and was developed by morphotek, inc. farletuzumab exhibited an affinity similar to the original lk26 ab (~2 nm) and a tissue - binding profile consistent with tissue distribution of fra38 after the optimization process using a whole - cell genetic evolution platform.39 rather than blocking fra - mediated folate transport, farletuzumab shows tumor cytotoxicity mediated by ab - dependent cellular cytotoxicity and complement - dependent cytotoxicity.40,41 farletuzumab has also been shown to inhibit the interaction between lyn kinase and membrane signaling complexes, thus reducing the growth advantage of fra - overexpressing cancer cells.45 more recently, wen described a previously unrecognized mechanism that farletuzumab regulated an array of autophagy - related genes and farletuzumab treatment has potential for inhibiting tumor cell growth by sustaining late - stage autophagy. this study also showed that the level of fra expression was correlated with the extent of farletuzumab therapeutic effect and farletuzumab significantly augmented the antitumor effect of docetaxel through an autophagy - associated mechanism. the above encouraging preclinical studies led to the development of a phase i / ii clinical trial43,44 with farletuzumab, which demonstrated the safety and tolerability of farletuzumab in the treatment of heavily pretreated epithelial ovarian cancer (eoc) patients. these results provided a rationale for the beginning of a phase iii, three - arm randomized, placebo - controlled, double - blind clinical trial investigating farletuzumab in combination with taxane and carboplatin in 1,100 patients with platinum - sensitive eoc at first relapse (clinicaltrials.gov identifier : nct00849667). carboplatin and paclitaxel at standard dosages were administered with either farletuzumab at two different dose levels, 1.25 mg / kg (arm 1) and 2.5 mg / kg (arm 2), or placebo (arm 3). median pfs was 9.5 months in arm 1, 9.7 months in arm 2, and 9.0 months in the placebo group (arm 3) with no statistically significant difference between arms. therefore, the study failed to meet its primary endpoint of improved pfs ; however, higher doses of farletuzumab may improve the pfs. more recently, sasaki conducted a phase i trial of farletuzumab in japanese patients with oc and gastric cancer (gc). this trial showed long - term disease stabilization for 20 months and 25 months in one patient with gc (400 mg / m) and one patient with clear cell oc (100 mg / m), respectively. major aes, including nausea and decreased appetite (five patients each, 31.3%), headache (seven patients, 43.8%), and grade 1/2 infusion - related reaction (15 patients, 93.8%), were observed. neither dose - limiting toxicities nor grade 3/4 toxicities were reported, and farletuzumab was generally well tolerated in japanese patients receiving a larger dose (400 mg / m). farletuzumab is also evaluated in nsclc based on preclinical data and safety profile in combination with carboplatin / taxane regimen from oc. a phase ii, double blind, placebo - controlled multicenter study (clinicaltrials.gov identifier : nct01218516), evaluating farletuzumab in 130 patients with fra - expressing metastatic lung acs, has been completed. in this study, fra expression is confirmed by ihc, and eligible patients have tumors with 1 + or greater membranous staining. patients were randomized to receive farletuzumab or placebo in a 1:1 ratio with six cycles of one of three combinations : carboplatin and pemetrexed, cisplatin and pemetrexed, or carboplatin and paclitaxel. after standard pre - medication with acetaminophen, farletuzumab (7.5 mg / kg) or placebo was administered intravenously on cycle 1, week 1 and cycle 1, week 2 (loading dose) followed by once in 3 weeks from cycles 2 to 6 (induction therapy). patients who experience clinical benefit from induction therapy receive maintenance farletuzumab or placebo every 3 weeks until disease progression. the further exploratory studies evaluate the correlation between tissue fra and serum and urine fra and their role as surrogate markers for treatment response and survival. the primary objective of this study is evaluation of 3-month pfs with the addition of farletuzumab to first - line platinum - based chemotherapy regimens. pemetrexed is an anti - folate chemotherapy drug that has been approved for first - line treatment of patients with advanced nonsquamous, nsclc in combination with cisplatin and as a single agent for relapsed or chemotherapy - refractory nsclc after platinum - containing chemotherapy.46 pemetrexed inhibits both purine and pyrimidine syntheses by blocking three key metabolic enzymes involved in dna synthesis : dihydrofolate reductase, thymidylate synthase, and glycinamide ribonucleotide formyl transferase. multiple studies have demonstrated that pemetrexed is effective as first - line47,48 and maintenance therapy of nsclc.49,50 subgroup analyses indicated that pemetrexed is mainly effective and superior to other regimens in non - sccs. farletuzumab combined with pemetrexed may produce synergic effect, but it could also increase aes. a safety and efficacy study of farletuzumab in combination with platinum - based pemetrexed or paclitaxel chemotherapy against placebo plus the same regimens was recently completed (clinicaltrials.gov identifier : nct01218516). currently, there are various forms of natural tumor - reactive immune cells generated for lung cancer in clinical trials, such as tumor - infiltrating lymphocytes, cytokine - induced killer cells, t - cells, and natural killer cells.51 t - cell therapy has emerged as an exciting powerful approach for cancer immunotherapy.52 adoptive cellular therapy involves the ex vivo identification and expansion of autologous t - cells with antitumor activity, which are then adoptively transferred back into cancer patients.52,53 human peripheral blood t - cells can be engineered to express an fra - specific car, which typically comprises an extracellular single - chain variable fragment derived from an mab specific for fra, a spacer domain that provides flexibility and optimizes t - cell and target cell engagement, a transmembrane domain, and signaling modules that trigger t - cell activation and costimulation (figure 1c).54,55 once expressed on t - cell surface, fra - specific car - modified t - cells can recognize fra on the tumor cell surface in a non - major histocompatibility complex - dependent manner and induce an antitumor immune response (figure 1c and d). furthermore, car - modified t - cells actively and specifically home to tumor sites and persist as memory cells in vivo.53 therefore, car t - cells may be more effective than mabs in generating durable tumor responses, and car t - cells have been proposed as the next generation of immunotherapeutic living drugs.53,56,57 in a phase i clinical trial,58 transfer of fra car t - cells for the treatment of metastatic oc failed to induce tumor regression due to the poor persistence of first - generation car t - cells in vivo. according to the two - signaling model for t - cell activation, costimulation is required in addition to the antigen - specific signal from its antigen receptors. investigators have constructed and tested second - generation cars containing costimulatory cytoplasmic signaling domains derived from the t - cell costimulatory molecules. previous studies54,55 showed that cd137(4 - 1bb)-, cd28-, or cd27-costimulated fra car t - cells could overcome the issues of engineered t - cell persistence and tumor localization that limit the fra car t - cell targeting strategy to provide potent antitumor activity in vivo. fra car t - cell therapy can also potentially be used to treat the majority of lung cancers. however, targeting fra expressing on lung cancer may induce severe toxicity such as cytokine storm mediated by on - target efficacy (antitumor effects). previously, deadly toxicity was reported maybe due to the on - target effect even the low levels of taa of erbb2 on normal lung epithelia were recognized by car t - cells.59 thus, car t - cell - targeting taas expressed on vital organs will need to be used with caution. there are a number of strategies that can be employed to improve the safety of fra car t - cell therapy. first and most importantly, a conservative dose - escalation strategy for car t - cell therapy infusion should be evaluated in clinical application, which may prevent the severe toxicities.60 second, generation of transient car t - cells may be a safer approach. for example, developing fra - specific rna encoding car t - cells may be safe, and the toxicity would be expected to abate rapidly, due to the transient nature of car expression on the t - cells.61 rna car t - cells could mediate antitumor activity in patients with advanced solid tumors.62 alternatively, the simultaneous expression of a car molecule and a safety switch suicide gene, such as an inducible caspase 9, would provide an additional safety switch for adoptive t - cell therapy.63 another novel approach to controlling the activity of car t - cells is to utilize an intermediate bifunctional molecule as a switch to redirect the specificity of car t - cells. fitc conjugate that can not only bind to fra on cancer cells but also specifically and dose - dependently redirect anti - fitc car t - cells to target fra - expressing cancers. fitc car t - cells activation and proliferation were strictly dependent on the presence of both folate fitc and fra - positive cells and were dose titratable with the folate fitc switch. importantly, administration of free fluorescein molecule could attenuate anti - fitc car t - cells activity in the case of toxicity, thereby providing an additional method of controlling car t - cells activity. this novel treatment paradigm may ultimately lead to increased safety of fra car t - cells therapy. targeting of fra - positive tumor cells in vitro and in vivo has been exemplified using folic acid conjugates with a variety of therapeutic probes (figure 1a). for this approach, folate can be linked to chemotherapeutic agents, nanoparticles, drug - loaded liposomes, and oligonucleotides.29,30 the fra can actively internalize bound folate drug conjugates via the natural process of endocytosis (figure 1a and d).31 because there is limited distribution of fra on normal tissue and folate - bound drug is not active, folate conjugates can achieve cancer - specific drug delivery with minimal toxicity. among those, ec145 (also known as vintafolide or mk-8109) is a novel folate - conjugated vinca alkaloid (desacetylvinblastine monohydrazide ; davlbh)32 that binds to the fra with high affinity. ec145 produces marked antitumor activity specifically against fra - expressing tumor xenografts without significant toxicity,33 thereby prompting the clinical studies. early clinical results34 suggest that ec145 appeared well tolerated, without remarkable toxicity observed in vinca alkaloids. further results of a multicenter trial35 in a highly refractory population with advanced nsclc indicated the antitumor activity of ec145, and in that, a clinical benefit response of 26% was obtained. the median progression - free survival (pfs) and overall survival were 7.4 weeks and 42.9 weeks, respectively. further exploratory analysis demonstrated that patients who are fra(2 +) have superior clinical benefit response compared with those who are fra(1 +) (50% versus 14.3% ; p=0.10) based on ec20 uptake. ec20 is a peptide derivative of folic acid and was designed to efficiently coordinate tc. this new chelate was found to bind fra - positive tumor cells in both a time - and concentration - dependent manner with very high affinity. ec20 uptake may represent a positive prognostic marker, and further development of ec145 and other fra - targeted therapeutics for the treatment of ac of the lung should be explored. the most common drug - related adverse events (aes) were fatigue, peripheral neuropathy, and constipation, primarily grade 1/2 in severity. further, a randomized phase ii trial comparing the activity of ec145 and ec145 plus docetaxel with docetaxel alone in higher fra expression tumors (2 +) has been activated (clinicaltrials.gov identifier : nct01577654). a wide range of other therapeutic folate conjugates the folate - targeted therapeutic agents include a highly immunogenic hapten,21 an epothilone, or a dual - warhead folate conjugate in the same molecule.36 patients were first immunized against a hapten to stimulate an anti - fluorescein isothiocyanate (fitc) antibody (ab) response. ec17 (folate fitc conjugate) redirects anti - fitc - conjugated hapten ab produced by the patients to fra - expressing tumor cells, which leads to the removal of the ab - coated tumor cells ; the safety of this strategy was demonstrated in renal cancer and oc patients.37 epofolate (bms-753493) is a folate conjugate of a microtubule - stabilizing agent epothilone a. currently, epofolate is undergoing phase i / ii clinical trial (clinicaltrials.gov identifier : nct00546247 and nct00550017) sponsored by bristol - myers squibb in advanced cancers. ec0225, a folate conjugated to both vinca alkaloid and mitomycin, has completed a phase i trial (clinicaltrials.gov identifier : nct00441870). the high level of fra expression in lung cancers argues that lung cancers could be a good indication of various conjugated fra agents. the use of mabs (figure 1b and d) therapy can selectively target the fra - expressing tumors, and thus offer potential benefits such as avoiding the cytotoxic toxicity in normal tissue caused by traditional chemotherapeutic agents. ihc studies using an fra - binding murine mab, lk26, showed highly restricted distribution of fra in normal tissues but widespread expression on cancer cells, including oc and renal cancer.38 farletuzumab (morab-003) is a humanized immunoglobulin g subtype 1 kappa mab against fra and was developed by morphotek, inc. farletuzumab exhibited an affinity similar to the original lk26 ab (~2 nm) and a tissue - binding profile consistent with tissue distribution of fra38 after the optimization process using a whole - cell genetic evolution platform.39 rather than blocking fra - mediated folate transport, farletuzumab shows tumor cytotoxicity mediated by ab - dependent cellular cytotoxicity and complement - dependent cytotoxicity.40,41 farletuzumab has also been shown to inhibit the interaction between lyn kinase and membrane signaling complexes, thus reducing the growth advantage of fra - overexpressing cancer cells.45 more recently, wen described a previously unrecognized mechanism that farletuzumab regulated an array of autophagy - related genes and farletuzumab treatment has potential for inhibiting tumor cell growth by sustaining late - stage autophagy. this study also showed that the level of fra expression was correlated with the extent of farletuzumab therapeutic effect and farletuzumab significantly augmented the antitumor effect of docetaxel through an autophagy - associated mechanism. the above encouraging preclinical studies led to the development of a phase i / ii clinical trial43,44 with farletuzumab, which demonstrated the safety and tolerability of farletuzumab in the treatment of heavily pretreated epithelial ovarian cancer (eoc) patients. these results provided a rationale for the beginning of a phase iii, three - arm randomized, placebo - controlled, double - blind clinical trial investigating farletuzumab in combination with taxane and carboplatin in 1,100 patients with platinum - sensitive eoc at first relapse (clinicaltrials.gov identifier : nct00849667). carboplatin and paclitaxel at standard dosages were administered with either farletuzumab at two different dose levels, 1.25 mg / kg (arm 1) and 2.5 mg / kg (arm 2), or placebo (arm 3). median pfs was 9.5 months in arm 1, 9.7 months in arm 2, and 9.0 months in the placebo group (arm 3) with no statistically significant difference between arms. therefore, the study failed to meet its primary endpoint of improved pfs ; however, higher doses of farletuzumab may improve the pfs. more recently, sasaki conducted a phase i trial of farletuzumab in japanese patients with oc and gastric cancer (gc). this trial showed long - term disease stabilization for 20 months and 25 months in one patient with gc (400 mg / m) and one patient with clear cell oc (100 mg / m), respectively. major aes, including nausea and decreased appetite (five patients each, 31.3%), headache (seven patients, 43.8%), and grade 1/2 infusion - related reaction (15 patients, 93.8%), were observed. neither dose - limiting toxicities nor grade 3/4 toxicities were reported, and farletuzumab was generally well tolerated in japanese patients receiving a larger dose (400 mg / m). farletuzumab is also evaluated in nsclc based on preclinical data and safety profile in combination with carboplatin / taxane regimen from oc. a phase ii, double blind, placebo - controlled multicenter study (clinicaltrials.gov identifier : nct01218516), evaluating farletuzumab in 130 patients with fra - expressing metastatic lung acs, has been completed. in this study, fra expression is confirmed by ihc, and eligible patients have tumors with 1 + or greater membranous staining. patients were randomized to receive farletuzumab or placebo in a 1:1 ratio with six cycles of one of three combinations : carboplatin and pemetrexed, cisplatin and pemetrexed, or carboplatin and paclitaxel. after standard pre - medication with acetaminophen, farletuzumab (7.5 mg / kg) or placebo was administered intravenously on cycle 1, week 1 and cycle 1, week 2 (loading dose) followed by once in 3 weeks from cycles 2 to 6 (induction therapy). patients who experience clinical benefit from induction therapy receive maintenance farletuzumab or placebo every 3 weeks until disease progression. the further exploratory studies evaluate the correlation between tissue fra and serum and urine fra and their role as surrogate markers for treatment response and survival. the primary objective of this study is evaluation of 3-month pfs with the addition of farletuzumab to first - line platinum - based chemotherapy regimens. pemetrexed is an anti - folate chemotherapy drug that has been approved for first - line treatment of patients with advanced nonsquamous, nsclc in combination with cisplatin and as a single agent for relapsed or chemotherapy - refractory nsclc after platinum - containing chemotherapy.46 pemetrexed inhibits both purine and pyrimidine syntheses by blocking three key metabolic enzymes involved in dna synthesis : dihydrofolate reductase, thymidylate synthase, and glycinamide ribonucleotide formyl transferase. multiple studies have demonstrated that pemetrexed is effective as first - line47,48 and maintenance therapy of nsclc.49,50 subgroup analyses indicated that pemetrexed is mainly effective and superior to other regimens in non - sccs. farletuzumab combined with pemetrexed may produce synergic effect, but it could also increase aes. a safety and efficacy study of farletuzumab in combination with platinum - based pemetrexed or paclitaxel chemotherapy against placebo plus the same regimens was recently completed (clinicaltrials.gov identifier : nct01218516). currently, there are various forms of natural tumor - reactive immune cells generated for lung cancer in clinical trials, such as tumor - infiltrating lymphocytes, cytokine - induced killer cells, t - cells, and natural killer cells.51 t - cell therapy has emerged as an exciting powerful approach for cancer immunotherapy.52 adoptive cellular therapy involves the ex vivo identification and expansion of autologous t - cells with antitumor activity, which are then adoptively transferred back into cancer patients.52,53 human peripheral blood t - cells can be engineered to express an fra - specific car, which typically comprises an extracellular single - chain variable fragment derived from an mab specific for fra, a spacer domain that provides flexibility and optimizes t - cell and target cell engagement, a transmembrane domain, and signaling modules that trigger t - cell activation and costimulation (figure 1c).54,55 once expressed on t - cell surface, fra - specific car - modified t - cells can recognize fra on the tumor cell surface in a non - major histocompatibility complex - dependent manner and induce an antitumor immune response (figure 1c and d). furthermore, car - modified t - cells actively and specifically home to tumor sites and persist as memory cells in vivo.53 therefore, car t - cells may be more effective than mabs in generating durable tumor responses, and car t - cells have been proposed as the next generation of immunotherapeutic living drugs.53,56,57 in a phase i clinical trial,58 transfer of fra car t - cells for the treatment of metastatic oc failed to induce tumor regression due to the poor persistence of first - generation car t - cells in vivo. according to the two - signaling model for t - cell activation, costimulation is required in addition to the antigen - specific signal from its antigen receptors. investigators have constructed and tested second - generation cars containing costimulatory cytoplasmic signaling domains derived from the t - cell costimulatory molecules. previous studies54,55 showed that cd137(4 - 1bb)-, cd28-, or cd27-costimulated fra car t - cells could overcome the issues of engineered t - cell persistence and tumor localization that limit the fra car t - cell targeting strategy to provide potent antitumor activity in vivo. fra car t - cell therapy can also potentially be used to treat the majority of lung cancers. however, targeting fra expressing on lung cancer may induce severe toxicity such as cytokine storm mediated by on - target efficacy (antitumor effects). previously, deadly toxicity was reported maybe due to the on - target effect even the low levels of taa of erbb2 on normal lung epithelia were recognized by car t - cells.59 thus, car t - cell - targeting taas expressed on vital organs will need to be used with caution. there are a number of strategies that can be employed to improve the safety of fra car t - cell therapy. first and most importantly, a conservative dose - escalation strategy for car t - cell therapy infusion should be evaluated in clinical application, which may prevent the severe toxicities.60 second, generation of transient car t - cells may be a safer approach. for example, developing fra - specific rna encoding car t - cells may be safe, and the toxicity would be expected to abate rapidly, due to the transient nature of car expression on the t - cells.61 rna car t - cells could mediate antitumor activity in patients with advanced solid tumors.62 alternatively, the simultaneous expression of a car molecule and a safety switch suicide gene, such as an inducible caspase 9, would provide an additional safety switch for adoptive t - cell therapy.63 another novel approach to controlling the activity of car t - cells is to utilize an intermediate bifunctional molecule as a switch to redirect the specificity of car t - cells. fitc conjugate that can not only bind to fra on cancer cells but also specifically and dose - dependently redirect anti - fitc car t - cells to target fra - expressing cancers. fitc car t - cells activation and proliferation were strictly dependent on the presence of both folate fitc and fra - positive cells and were dose titratable with the folate fitc switch. importantly, administration of free fluorescein molecule could attenuate anti - fitc car t - cells activity in the case of toxicity, thereby providing an additional method of controlling car t - cells activity. this novel treatment paradigm may ultimately lead to increased safety of fra car t - cells therapy. nsclc is the leading cause of cancer - related death worldwide, and novel treatments are still needed. restricted distribution of fra in normal tissues and its high expression in nsclc allow this antigen to be adapted to a larger panel of therapeutic strategies. the current reports of folate acid conjugates and mab targeting fra are promising, and developing powerful car t - cell therapy should be undertaken with caution in clinic. taken together, this review provides results of encouraging preclinical and clinical studies, which indicates a need for further exploration of various treatment strategies targeting fra - expressing nsclc. in conclusion, these fra - based therapeutic strategies, in sequence with other antitumor therapeutics, hold great promise for improving the prognosis of lung cancer patients in the future. | lung cancer remains the leading common cause of cancer - related death, with non - small - cell lung cancer (nsclc) accounting for 80% of all cases. to date, platinum - based doublet chemotherapy is the cornerstone of first - line therapy. however, these agents have limited use in patients who have relapsed and have metastatic disease. therefore, novel strategies are required to improve the clinical outcome. folate receptor alpha (fra) is overexpressed in the majority of nsclc, particularly in lung adenocarcinomas. fra is largely absent from normal tissue, making it an attractive therapeutic target. in this review, we discuss fra expression in nsclc, conjugated fra agents, monoclonal antibody, and fra - specific t - cell - based therapeutic strategies aiming to improve the cure rate of fra - expressing nsclc. |
a 74-year - old woman, with a firm, slow - growing, variably pigmented nodule on her thigh was referred to our unit. the lesion was elevated at the periphery and partially ulcerated, well delimited and asymptomatic (figure 1a). dermoscopy showed asymmetry, white - blue color at the periphery and polymorphous vessels in the center associated with crystalline structures and multiple erosions (figure 1b). analysis of rcm images revealed a well - demarcated tumor (figure 2a) composed of dark homogeneous islands surrounded by bright stroma (figure 2b). tumor cells were small and uniform in size and shape and vessels were well represented (figure 2c). the rcm features were not indicative of basal cell carcinoma because of the lack of palisading, clefting and typical shape of tumor nests. furthermore, no melanocytic proliferation was detected upon rcm and thus a diagnosis of melanoma was excluded. histologic examination, at scanning view, showed a well - circumscribed lesion with a pattern of growth in broad anastomosing bands (figure 3a)., it was composed of monomorphous cuboidal cells with features of poroid maturation into small ductal lumina (blue arrows) and containing variably sized melanin granules (arrows) (figure 3c d). atypical mitoses, cytologic atypia or other features suggestive of malignant transformation were not seen. this benign adnexal neoplasm often appears as a firm, flesh - colored to reddish nodule, papule or plaque, at the acral sites, which are the sites with higher concentration of eccrine sweat glands. it is more frequent between the fourth and sixth decades of life without sex predilection. its pathogenesis is unknown, but may be related to trauma, radiation or scars. this variant seems to be more frequent in non - white people and on non - acral sites. frequently it is confused clinically with seborrheic keratosis, epithelialized pyogenic granuloma, basal cell carcinoma (bcc), squamous cell carcinoma (scc), angiofibroma, and cutaneous melanoma. for these reasons it can be regarded as big simulator, and thus diagnostic tools can be of help in differentiating eccrine poroma from other entities. ferrari. summarized dermoscopic structures in a series of non - pigmented poroma in which the main dermoscopic clues were : a white - to - pink halo surrounding the vessels, pink - white structureless areas, vascular structures of glomerular and linear irregular vessels, hairpin vessels, and linear irregular vessels. valuated pep, describing 12 cases in which vascular structures, globule - like structures and comedo - like openings were the hallmarks. more recently, it has been shown that eccrine poroma might mimic several benign and malignant tumors also from a dermoscopic aspect. additional to the use of dermoscopy, reflectance confocal microscopy is currently used to increase diagnostic accuracy of skin tumors since it provides skin imaging in vivo at cellular level resolution close to conventional histology. in the current case, rcm highlighted the presence of tumor nests with clearly visible outline, small sized tumor cells and overall symmetric silhouette. although the diagnosis of pigmented eccrine poroma was not possible since diagnostic rcm criteria have been not previously identified, the findings were not suggestive of bcc or melanoma : furthermore, the overall analysis of the architecture and cytology suggested the diagnosis of an epithelial benign lesion. on histology basaloid cells growing in nests and solid nodules are, by definition, characterized by more or less evident poroid differentiation, that is, small ductal lumina bordered by an eosinophilic cuticle. poroid differentiation occurs also in other entities such as hydroacanthoma simplex, dermal ductal tumor and poroid hidradenoma. benign tumors arising from the eccrine ducts often are difficult to differentiate from an eccrine poroma. even if the diagnosis of eccrine poroma remains histopathological still, as in this case report, noninvasive tools such as dermoscopy and rcm examinations can be of help to rule out the diagnosis of melanoma and non - melanoma skin cancers. larger studies on this rare pigmented variant of eccrine poroma could shed new light on the identification of specific diagnostic dermoscopic and confocal features. | eccrine poroma is a rare benign adnexal tumor of epithelial cells originating from the terminal ductal portion of the sweat glands that is typically located on palms and soles, although other cutaneous sites can be affected [1 ]. it is usually nonpigmented even if there is a pigmented variant that corresponds to 17% of cases and it is usually underdiagnosed, since it is mistakenly confused with other pigmented tumors [2,3 ]. dermoscopy and reflectance confocal microscopy (rcm) may assist in the correct diagnosis of this tumor.herein, we report one case of pigmented eccrine poroma (pep) that simulated clinically a cutaneous melanoma or a basal cell carcinoma. dermoscopy and rcm excluded the possibilities of those two diagnoses ; the overall confocal findings were suggestive for a benign epithelial tumor. histology was fundamental to diagnose this lesion as a pigmented eccrine poroma. even if the diagnosis of eccrine poroma remains histopathological still, as in this case report, noninvasive tools such as dermoscopy and rcm examinations can be of help to rule out the diagnosis of melanoma. larger studies on this rare pigmented variant of eccrine poroma could shed new light on the identification of specific diagnostic dermoscopic and confocal features. |
enhanced recovery (er) programs have been implemented in general surgery and have helped optimize preoperative, perioperative, and postoperative factors to reduce the physiological and psychological stress of surgery.1 several factors are responsible for functional deterioration and increased risk of morbidity after major surgical procedures, and include the surgical stress response, increased cardiac demand, impairment of pulmonary function, changes in coagulation and fibrinolysis, catabolism and loss of muscle mass, sleep disturbance, and paralytic ileus.2 the er program begins with preoperative care and detailed patient education prior to admission to hospital. strictly defined discharge criteria and a prescheduled discharge plan are implemented.3 postoperative care includes early introduction of oral nutrition supplements, early mobilization, and restricted opiate use to minimize nausea and ileus.4 the multimodal rehabilitation program has enabled early restoration of gastrointestinal function, reduction of fatigue, and improved physical performance in some general surgical procedures.5 such protocols have also reduced length of hospital stay (los).67 with approval from the department of clinical governance at our hospital, we implemented an er program for patients undergoing elective total hip arthroplasty (tha) and compared the results with a similar patient population who had undergone hip replacement surgery prior to the advent of the er program. between november 2006 and january 2008, 64 consecutive patients underwent total hip arthroplasty on an er program. the control group consisted of 63 consecutive patients who underwent tha between november 2004 and october 2006 prior to the er program (non er). the mean age for the er patients was 70.5 years (range 4889 years) and for the non er group was 72.5 years (range 5691 years, p=0.9). there were 27 men and 37 women in the er group and 22 men and 41 women in the non er group. the er program incorporates a multidisciplinary team composed of surgeons, nurses, physiotherapists, and occupational therapists, and includes the patient as an active participant. the program is followed clearly in a stepwise manner to maximize efficiency of the care pathway [table 1 ]. enhanced orthopedic recovery in summary the program was outlined to each patient being admitted for a primary joint replacement. a patient information leaflet was supplied at the initial clinic visit and a mini pre - assessment check carried out at that stage. the key aspects of er were explained again at the pre - assessment clinic prior to admission. at the pre - assessment clinic the er program was emphasized again and patients were supplied with supplement drinks (build - up by nestle nutrition) [table 2 ] to be taken 2 days before hospital admission in the morning. patients were asked to take three sachets of build - up dissolved in 150 ml of water 2 days before surgery and two sachets 1 day before surgery. food values and calorie content of supplemental drinks all patients attended a pre - admission joint replacement class run by the physiotherapists and occupational therapists and were encouraged to bring a member of their family or a friend for support. this class lasts for approximately 1 h. the er program was discussed in detail again. patients were usually admitted on the eve of surgery. on the day of admission, which is a day before the operation, the patient was given high carbohydrate drink of two sachets of preload (by vitaflo) [table 2 dissolved in 400 ml of water at 8 p.m. in the evening. a further high carbohydrate drink with one sachet dissolved in 400 ml of water was given 3 h before surgery. all patients were given the high energy drink irrespective of any comorbidities, e.g. diabetes or high body mass index (bmi). the high energy drink helps reduce the risk of anesthetic and starvation - induced diabetes, and helps maintain higher energy levels following the operation. the physiological benefits of managing the metabolic insult of a prolonged starvation period followed by the traumatic insult of surgery are central to our intervention8 and, we believe, are new to orthopedics. traditional patient starvation regimes (nil by mouth for 6 h) are based on the premise that this will reduce the incidence of pulmonary aspiration. a recent review, however, has provided no scientific support for this practice.9 recommendations now suggest clear fluids up until 2 h before the initiation of anesthesia and a 6 h solid food fast. this reduces preoperative thirst, hunger, and anxiety, and significantly reduces postoperative insulin resistance.10 preoperative oral carbohydrates also reduce postoperative nausea and vomiting, which can prevent the rapid postoperative recovery of the patient.11 all patients were given spinal or epidural anesthesia and propofol was used for sedation and maintenance of light general anesthesia which helps reduce postoperative nausea and vomiting. shortacting opiates decrease the incidence of opiate toxicity, and accurate fluid resuscitation avoids iatrogenic hyperchloremic acidosis and fluid overload. postoperatively, the patient was sat up in bed in the recovery room and oral fluids were commenced. pneumatic intermittent calf compression was instituted to minimize the risk of deep vein thrombosis. in the ward, there was an emphasis on oral intake with protein and carbohydrate - rich drinks, rather than reliance on intravenous fluid administration. they were given two sachets of build - up drink on the evening after surgery and three sachets for 3 days thereafter. the strategy aims to maintain the gut flora, preserve immune function, and optimize wound healing and recovery.12 the multimodal approach to perioperative nutrition is cumulative in its benefits. dedicated joint replacement physiotherapy started on the evening of the operation and patients were encouraged to sit out of bed in the chair. enoxaparin (40 mg) was administered subcutaneously in the evening following surgery and for the duration of the in - patient stay only. however, the antithrombotic effects of early mobilization have been shown to reduce the incidence of thromboembolic events after lower limb joint replacement surgery.13 wound drains were removed on the first postoperative day. mobilization was goal - oriented. the patient was encouraged to reach a white board at the end of the ward and to sign it on reaching that target. discharge plans were again confirmed. at discharge, patients were escorted to the hospital exit by a physiotherapist or nurse and shown how to get in and out of a car safely. following discharge, wound care was undertaken either by a district nurse or practise nurse in the community. all patients were reviewed by a physiotherapist between 1 and 3 weeks following discharge, but they could contact the hospital ward should they have any concerns. all patients were scored according to the american association of anesthesiologists (asa) physical status classification system, preoperative hemoglobin (hb), and bmi. the los (defined as the number of nights spent in hospital) was recorded. we obtained approval from the department of clinical governance at our hospital and followed ethical standards on human experimentation. we performed the procedure in accordance with the helsinki declaration of 1975, as revised in 2000, to implement an er program for patients undergoing elective total hip arthroplasty. we obtained approval from the department of clinical governance at our hospital and followed ethical standards on human experimentation. we performed the procedure in accordance with the helsinki declaration of 1975, as revised in 2000, to implement an er program for patients undergoing elective total hip arthroplasty. the average age of the er group was 70.1 years (range 4889 years, sd=8.79). the average age of the non er group was 72.5 years (range 5691 years, sd=8.72). er group was significantly higher than the non er group (29.4 vs. 27.9, p=0.1). the er patients spent a significantly shorters time in hospital at an average 5.3 days (median 4 days) as against an average 8.3 days (median 7 days) spent by the non er group (p 14 had significantly shorter stay in days when compared with their lower hb counterparts in each cohort (er and non er), and there was a significant difference between similar groups in each cohort the non er patients with an hb of 14 g / dl, although this was not statistically significant (p = 0.45). analysis of the asa scores showed that the non er subgroup of asa 1 and 2 patients spent an average 7.86 days in hospital [figure 2 ] compared to 9.46 days spent by asa 3 patients. however, this difference between the two groups was not statistically significant (p=0.33). in the er group, however, patients with asa 1 and 2 had significantly shorter hospital stay (4.72 days) compared to asa 3 patients who spent an average of 6.79 days in hospital (p=0.01). asa 3 patients in the er group spent an average 1.07 days less than the asa 1 and 2 patients of the non er group (p=0.08). the patients with asa 1 and 2 in the er group spent a significantly shorter time of 4.72 days in the hospital compared to 7.86 days spent by the asa 1 and 2 patients in the non er group (p 30 spent 6.3 days in the hospital compared to 7.7 days spent by non er patients (p 30 (p=0.04). it was again observed that er patients with a bmi of > 30 spent an average 2.3 days less in hospital as against those of the non er group with bmi of 30) within each cohort. within the non er cohort, there was no significant difference between the two groups ; however, those with lower bmi had significantly shorter stay in the er cohort. overall, both groups had significantly shorter stay in the er cohort the readmission and complication rates were similar in both the groups and are summarized in table 3. there was no statistical difference (p=0.57) in the rate of dislocations, with two in the er group as compared to one in the non er group. the aim is to reduce hospital length of stay and unplanned readmission to hospital, and improve the coordination of services following discharge from hospital, thereby bridging the gap between hospital and place of discharge.14 furthermore, the risk and morbidity associated with surgical procedures has been steadily decreasing in recent decades, primarily because of improvements in patient preparation for surgery and anesthetic and surgical techniques.2 within the setting of inpatient recovery following major joint replacement, increased length of stay is often attributed to patient factors such as bmi, existing co - morbidities, and age.15 our two cohorts (er and non er) had the same profile with respect to these factors. we compared preoperative hb, asa grade, and bmi to length of stay, between our two matched groups. further subdivision of the groups was made to separate out the so - called healthier patients that would be expected to have a shorter los. however, we found that despite subdivision of each cohort (er and non er) into groups, er patient groups still demonstrated a significantly reduced hospital stay. 2008) in study looking at hb levels on discharge and change in quality of life scores from preoperative to postoperative in patients over 65 years of age who had undergone primary hip arthroplasty has shown that patients with lower hb on discharge consistently reported less improvement.16 in our study group, every attempt was made to minimize the intraoperative blood loss, and therefore a higher preoperative hb was advantageous for postoperative recovery and this was reflected in the early discharge of er patients with an hb of > 14 g / dl (average 4.37 days). the non er patients with preoperative hb of > 14 g / dl spent slightly longer in hospital than the er patients with a preoperative hb of 30 kg / m and we divided our patients into two groups of bmi greater or less than 30 kg / m to determine the effect on the los. sadr azodi,24 reported a mean increase in hospital stay in patients with a bmi of 14, bmi 30, and asa 3). it was also observed that patients with favorable parameters in the non er group took longer to be discharged from the hospital when compared with patients with less favorable parameters in the er group. this program resulted in an overall 36.5% reduction in los in patients undergoing total hip arthroplasty surgery. the er protocol confers an advantage for recovery even in less healthy or obese patients without affecting the complication or readmissions. to conclude this program to be effective, it is imperative that the patient is actively involved throughout the pre- and perioperative period | background : enhanced recovery program (erp) was implemented to optimize the hospital stay in total hip arthroplasty. this study assessed the effects of optimizing preoperative and perioperative care using enhanced recovery (er) on patients undergoing total hip arthroplasty.materials and methods : we compared a prospective group of 64 patients on the er program with a historic cohort of 63 patients that received conventional care (non er).results : er patients were discharged earliest from hospital [mean length of stay (los) 5.3 days, median 4 ; p 30 on er program spent shorter time in hospital as compared to the non er 's conventionally treated patients with more favorable physiological parameters of asa grade 1 and 2, preoperative hemoglobin of > 14 g / dl, and bmi < 30.conclusion:the er protocol is universally beneficial and confers an advantage regardless of the patients preoperative condition. |
primary hcc tissues were collected from 288 patients who were treated with curative hepatectomy at samsung medical center, seoul, korea from july 2000 to may 2006 (237 males and 51 females). we defined curative resection as complete resection of all tumor nodules with clear microscopic resection margins and no residual tumors as indicated by a computed tomography scan one month after surgery. the patients ' ages ranged from 17 to 76 years with an average of 52.6. two hundred and eighteen (75.7%) patients were infected with hepatitis b and 30 (10.4%) with hepatitis c. no viral marker was recognized in 40 (13.9%) patients. none of the patients had received preoperative chemotherapy, transarterial chemoembolization, or radiofrequency ablation. tumor differentiation was graded histologically according to the criteria of edmondson and steiner.13 microvascular invasion was considered present when at least one or more endothelial cells or the tunica media of the vessel surrounded a neoplastic cell group. intrahepatic metastasis and multicentric occurrence were defined according to the previously reported criteria.14 briefly, intrahepatic metastasis is defined as : 1) portal vein tumor thrombi or cancer lesions that have putatively proliferated from a tumor thrombus, 2) groups of cancer lesions that are most abundant adjacent to the largest main lesion and decrease in number with distance from the main lesion, or 3) small solitary cancer lesions located adjacent to the largest main lesion and of the same histological type that are definitely smaller than the main tumor and differentiated to the same degree or less differentiated than the main lesion. multicentric occurrence is defined as : 1) adenomatous hyperplasia or early hccs that preserve the existing liver architecture, 2) well differentiated hccs found at the edge of moderately or poorly differentiated cancer tissues, or 3) multiple hcc lesions that can not be classified as metastasis based on the above criteria. tumor stage was determined according to both the american joint committee on cancer (ajcc)15 and the barcelona clinic liver cancer (bclc) staging classification.16 patients were followed by monitoring serum -fetoprotein levels and three phase dynamic computed tomography scans every three months after surgery. the median follow - up period was 97.1 months (range, 40 to 126 months). disease - free survival (dfs) was defined from the date of resection until the detection of tumor recurrence. we chose hcc - related mortality (disease - specific death) as the clinical endpoint for survival analysis, defined by hoshida.17 as : 1) tumor occupying more than 80% of the liver, 2) portal venous tumor thrombus proximal to the second bifurcation, 3) obstructive jaundice due to the tumor, 4) distant metastases, or 5) variceal hemorrhage with portal venous tumor thrombus proximal to the first bifurcation. disease - specific survival (dss) was defined from the date of resection to hcc - related death. tumor recurrence was detected in 189 (65.6%) patients and 99 (34.4%) patients died of hcc. thirty of the 129 deaths in this study were due to non - hcc causes. tissues with dysplastic nodule (dn), which is a precancerous lesion of hcc (n=28), were included and dns were subdivided into low - grade dn and high - grade dn according to the guideline of the international working party.18 histologic sections were examined by two pathologists and representative tumor regions free from necrosis or hemorrhage were marked in formalin - fixed paraffin - embedded blocks. two 2.0 mm - diameter tissue cores were punched from the marked areas of each block and arranged in recipient paraffin blocks. two cores of normal liver tissue from 12 patients with metastatic colonic carcinoma of the liver were included in each array block. immunohistochemical staining was performed as described elsewhere.19 antigen retrieval was performed with 0.01 mol / l citrate buffer (ph 6.0) for 30 minutes in a pressure cooker. the sections were incubated overnight at 4 with the rabbit polyclonal antibody to bcl9 (ab37305, 1:100, abcam inc., cambridge, ma, usa). the positive control (human colon carcinoma) showed intense nuclear bcl9 expression in cancer cells while no immunoreactivity was observed in the tissue sections used as negative controls, in which the primary antibody was replaced by preimmune rabbit serum. in order to validate the concordance between the tissue microarrays and whole tumor sections, we also detected bcl9 expression for 40 corresponding whole tumor sections randomly chosen from the 288 cases. immunohistochemical staining was assessed by two independent pathologists (c.k.park and j.hyeon) without knowledge of the patients ' characteristics and any discrepancies were resolved by consensus. the sections were scored by combining the proportion and intensity of the stained tumor cells as reported previously.9 the proportion of stained tumor cells was determined semi - quantitatively and each sample was scored on a scale of 0 - 3 (0, < 5% ; 1, 5 - 30% ; 2, 31 - 60% ; 3, 61 - 100%). the staining intensity was classified as 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). the immunoreactive score of each tumor was calculated by multiplication of the scores of the proportion of stained cells and the staining intensity. duplicate tissue cores for each tumor showed high levels of homogeneity for both the proportion of stained cells and the staining intensity. when there were differences between the duplicate tissue cores, the higher score was taken as the total score. chicago, il, usa). the chi - square test and fisher 's exact test were used for comparison of the variables. cumulative survival time was calculated by the kaplan - meier method and compared by the log - rank test. primary hcc tissues were collected from 288 patients who were treated with curative hepatectomy at samsung medical center, seoul, korea from july 2000 to may 2006 (237 males and 51 females). we defined curative resection as complete resection of all tumor nodules with clear microscopic resection margins and no residual tumors as indicated by a computed tomography scan one month after surgery. the patients ' ages ranged from 17 to 76 years with an average of 52.6. two hundred and eighteen (75.7%) patients were infected with hepatitis b and 30 (10.4%) with hepatitis c. no viral marker was recognized in 40 (13.9%) patients. none of the patients had received preoperative chemotherapy, transarterial chemoembolization, or radiofrequency ablation. tumor differentiation was graded histologically according to the criteria of edmondson and steiner.13 microvascular invasion was considered present when at least one or more endothelial cells or the tunica media of the vessel surrounded a neoplastic cell group. intrahepatic metastasis and multicentric occurrence were defined according to the previously reported criteria.14 briefly, intrahepatic metastasis is defined as : 1) portal vein tumor thrombi or cancer lesions that have putatively proliferated from a tumor thrombus, 2) groups of cancer lesions that are most abundant adjacent to the largest main lesion and decrease in number with distance from the main lesion, or 3) small solitary cancer lesions located adjacent to the largest main lesion and of the same histological type that are definitely smaller than the main tumor and differentiated to the same degree or less differentiated than the main lesion. multicentric occurrence is defined as : 1) adenomatous hyperplasia or early hccs that preserve the existing liver architecture, 2) well differentiated hccs found at the edge of moderately or poorly differentiated cancer tissues, or 3) multiple hcc lesions that can not be classified as metastasis based on the above criteria. tumor stage was determined according to both the american joint committee on cancer (ajcc)15 and the barcelona clinic liver cancer (bclc) staging classification.16 patients were followed by monitoring serum -fetoprotein levels and three phase dynamic computed tomography scans every three months after surgery. the median follow - up period was 97.1 months (range, 40 to 126 months). disease - free survival (dfs) was defined from the date of resection until the detection of tumor recurrence. we chose hcc - related mortality (disease - specific death) as the clinical endpoint for survival analysis, defined by hoshida.17 as : 1) tumor occupying more than 80% of the liver, 2) portal venous tumor thrombus proximal to the second bifurcation, 3) obstructive jaundice due to the tumor, 4) distant metastases, or 5) variceal hemorrhage with portal venous tumor thrombus proximal to the first bifurcation. disease - specific survival (dss) was defined from the date of resection to hcc - related death. tumor recurrence was detected in 189 (65.6%) patients and 99 (34.4%) patients died of hcc. thirty of the 129 deaths in this study were due to non - hcc causes. tissues with dysplastic nodule (dn), which is a precancerous lesion of hcc (n=28), were included and dns were subdivided into low - grade dn and high - grade dn according to the guideline of the international working party.18 histologic sections were examined by two pathologists and representative tumor regions free from necrosis or hemorrhage were marked in formalin - fixed paraffin - embedded blocks. two 2.0 mm - diameter tissue cores were punched from the marked areas of each block and arranged in recipient paraffin blocks. two cores of normal liver tissue from 12 patients with metastatic colonic carcinoma of the liver were included in each array block. immunohistochemical staining was performed as described elsewhere.19 antigen retrieval was performed with 0.01 mol / l citrate buffer (ph 6.0) for 30 minutes in a pressure cooker. the sections were incubated overnight at 4 with the rabbit polyclonal antibody to bcl9 (ab37305, 1:100, abcam inc., cambridge, ma, usa). the positive control (human colon carcinoma) showed intense nuclear bcl9 expression in cancer cells while no immunoreactivity was observed in the tissue sections used as negative controls, in which the primary antibody was replaced by preimmune rabbit serum. in order to validate the concordance between the tissue microarrays and whole tumor sections, we also detected bcl9 expression for 40 corresponding whole tumor sections randomly chosen from the 288 cases. immunohistochemical staining was assessed by two independent pathologists (c.k.park and j.hyeon) without knowledge of the patients ' characteristics and any discrepancies were resolved by consensus. the sections were scored by combining the proportion and intensity of the stained tumor cells as reported previously.9 the proportion of stained tumor cells was determined semi - quantitatively and each sample was scored on a scale of 0 - 3 (0, < 5% ; 1, 5 - 30% ; 2, 31 - 60% ; 3, 61 - 100%). the staining intensity was classified as 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). the immunoreactive score of each tumor was calculated by multiplication of the scores of the proportion of stained cells and the staining intensity. duplicate tissue cores for each tumor showed high levels of homogeneity for both the proportion of stained cells and the staining intensity. when there were differences between the duplicate tissue cores, the higher score was taken as the total score. chicago, il, usa). the chi - square test and fisher 's exact test were used for comparison of the variables. cumulative survival time was calculated by the kaplan - meier method and compared by the log - rank test. bcl9 was detected on the cytoplasm in 3 - 10% of the normal hepatocytes with weak or moderate staining intensity. in hcc, immunoreactivity for bcl9 was observed in the nuclei of tumor cells with or without cytoplasmic expression. we regarded bcl9 as positive when the total score for nuclear immunoreactivity was 1 - 9. bcl9 protein expression was observed in 74 (25.7%) of the 288 hccs (fig. bcl9 expression was significantly associated with younger age (p=0.038), higher edmondson grade (p=0.001), microvascular invasion (p=0.013), and intrahepatic metastasis (p=0.017) (table 1). tumor recurrence was significantly associated with larger tumor size (p=0.011), higher edmondson grade (p=0.029), microvascular invasion (p=0.001), major portal vein invasion (p=0.038), intrahepatic metastasis (p<0.001), higher ajcc t stage (p<0.001), higher bclc stage (p=0.004), higher -fetoprotein level (p=0.002), viral etiology (p=0.004), and liver cirrhosis (p=0.009) (table 1). the dfs and dss rates for the 288 hcc patients were 42.7% and 78.2% at three years, 36.3% and 71.4% at five years, 30.1% and 67.1% at seven years, and 27.9% and 60.8% at nine years, respectively. based on univariate analyses, larger tumor size, edmondson grade iii, microvascular invasion, major portal vein invasion, intrahepatic metastasis, higher ajcc t stage, higher bclc stage, lower albumin level, and higher -fetoprotein level showed unfavorable influence on both dfs and dss. bcl9 expression showed an unfavorable influence on both dfs (p=0.012) and dss (p=0.032) (table 2). the five - year dfs rate of the bcl9-positive group was significantly lower than that of the bcl9-negative group (24.2% vs 39.2%) (fig. the median dfs of the bcl9-positive group and the bcl9-negative group were 9.9 and 23.8 months, respectively. the five - year dss rate of the bcl9-positive group was significantly lower than that of the bcl9-negative group (61.7% vs 73.6%) (fig. the median dss of the bcl9-positive group and the bcl9-negative group were 63.1 and 86.5 months, respectively. since tumor size, vascular invasion, intrahepatic metastasis, ajcc stage, and serum albumin level were associated with bclc stage, we did not perform multiple analyses with these indices in order to avoid potential bias. an evaluation of the significant weight of the serum -fetoprotein level was not performed due to missing data (n=277). based on multivariate analyses, higher bclc stage (p<0.001), viral etiology (p=0.022), and liver cirrhosis (p=0.011) were independent predictors of shorter dfs. bcl9-positive patients were more likely to suffer from recurrence than bcl9-negative patients (hazard ratio=1.351, 95% confidence interval 0.967 - 1.888). however, bcl9 expression was not an independent predictor of dss (p=0.115) (table 3). bcl9 was detected on the cytoplasm in 3 - 10% of the normal hepatocytes with weak or moderate staining intensity. in hcc, immunoreactivity for bcl9 was observed in the nuclei of tumor cells with or without cytoplasmic expression. we regarded bcl9 as positive when the total score for nuclear immunoreactivity was 1 - 9. bcl9 protein expression was observed in 74 (25.7%) of the 288 hccs (fig. bcl9 expression was significantly associated with younger age (p=0.038), higher edmondson grade (p=0.001), microvascular invasion (p=0.013), and intrahepatic metastasis (p=0.017) (table 1). tumor recurrence was significantly associated with larger tumor size (p=0.011), higher edmondson grade (p=0.029), microvascular invasion (p=0.001), major portal vein invasion (p=0.038), intrahepatic metastasis (p<0.001), higher ajcc t stage (p<0.001), higher bclc stage (p=0.004), higher -fetoprotein level (p=0.002), viral etiology (p=0.004), and liver cirrhosis (p=0.009) (table 1). the dfs and dss rates for the 288 hcc patients were 42.7% and 78.2% at three years, 36.3% and 71.4% at five years, 30.1% and 67.1% at seven years, and 27.9% and 60.8% at nine years, respectively. based on univariate analyses, larger tumor size, edmondson grade iii, microvascular invasion, major portal vein invasion, intrahepatic metastasis, higher ajcc t stage, higher bclc stage, lower albumin level, and higher -fetoprotein level showed unfavorable influence on both dfs and dss. bcl9 expression showed an unfavorable influence on both dfs (p=0.012) and dss (p=0.032) (table 2). the five - year dfs rate of the bcl9-positive group was significantly lower than that of the bcl9-negative group (24.2% vs 39.2%) (fig. the median dfs of the bcl9-positive group and the bcl9-negative group were 9.9 and 23.8 months, respectively. the five - year dss rate of the bcl9-positive group was significantly lower than that of the bcl9-negative group (61.7% vs 73.6%) (fig. the median dss of the bcl9-positive group and the bcl9-negative group were 63.1 and 86.5 months, respectively. since tumor size, vascular invasion, intrahepatic metastasis, ajcc stage, and serum albumin level were associated with bclc stage, we did not perform multiple analyses with these indices in order to avoid potential bias. an evaluation of the significant weight of the serum -fetoprotein level was not performed due to missing data (n=277). based on multivariate analyses, higher bclc stage (p<0.001), viral etiology (p=0.022), and liver cirrhosis (p=0.011) were independent predictors of shorter dfs. bcl9-positive patients were more likely to suffer from recurrence than bcl9-negative patients (hazard ratio=1.351, 95% confidence interval 0.967 - 1.888). however, bcl9 expression was not an independent predictor of dss (p=0.115) (table 3). bcl9 is required for wnt signal transduction at the level of nuclear -catenin and to exert its function by physically linking pygopus to -catenin.5 kramps.5 reported that wild - type cells expressed bcl9/legless protein in the nuclei and the nuclear localization of the bcl9/legless appeared to be essential for its signaling activity. recent reports showed that nuclear bcl9 staining was absent in human normal colon mucosa, but elevated in human colorectal cancer.8,9 in this study, nuclear immunoreactivity for bcl9 was not observed in normal liver or dn tissues. recent studies have shown that the bcl9 - 2 protein was significantly up - regulated in human colon adenomas compared with normal colon mucosa,9 which suggests that the deregulation of bcl9 occurs during early stages of colonic carcinogenesis. in colorectal cancer patients, almost all cases showed high bcl9 - 2 protein expression and it was not correlated with overall survival, indicating that bcl9 - 2 is not a predictor for advanced tumor stages in colorectal cancer.9 in the current study, we applied tissue microarrays in order to evaluate the prognostic significance of bcl9 protein expression in a large cohort of hcc patients and demonstrated that bcl9 expression was correlated with higher edmondson grade, microvascular invasion, and intrahepatic metastasis, which suggest the involvement of bcl9 in the pathogenesis of hcc. tumor recurrence was remarkably associated (p<0.005) with microvascular invasion, intrahepatic metastasis, higher ajcc t stage, higher bclc stage, higher -fetoprotein level, and viral etiology. in addition, hcc with bcl9 expression had a lower five - year dfs rate than hcc without bcl9 expression and bcl9 expression tended to be an independent predictor of shorter dfs. hcc with bcl9 expression had a lower five - year dss rate than hcc without bcl9 expression. these findings indicate that bcl9 is a potential new marker of shorter dfs in hcc after curative resection and the results could help clinicians identify patients at high risk of recurrence. this study demonstrates, for the first time, that bcl9 protein expression in hcc tissues might be a marker of shorter dfs in hcc after curative hepatectomy in a large number of hcc patients with long - term follow - up. further study is needed in order to examine the mechanism of the actions regarding bcl9 protein expression in hcc prognosis. | backgroundbcl9 enhances -catenin - mediated transcriptional activity regardless of the mutational status of the wnt signaling components and increases the cell proliferation, migration, invasion, and metastatic potential of tumor cells. the goal of this study was to elucidate the prognostic significance of bcl9 protein expression in hepatocellular carcinoma (hcc) patients.methodswe evaluated bcl9 protein expression by immunohistochemistry in tumor tissue from 288 primary hcc patients who underwent curative hepatectomy. the impact of bcl9 expression on the survival of the patients was analyzed. the median follow - up period was 97.1 months.resultsnuclear bcl9 protein expression was observed in 74 (25.7%) of the 288 hccs. bcl9 expression was significantly associated with younger age (p=0.038), higher edmondson grade (p=0.001), microvascular invasion (p=0.013), and intrahepatic metastasis (p=0.017). based on univariate analyses, bcl9 expression showed an unfavorable influence on both disease - free survival (dfs, p=0.012) and disease - specific survival (dss, p=0.032). multivariate analyses revealed that higher barcelona clinic liver cancer stage was an independent predictor of both shorter dfs (p<0.001) and shorter dss (p<0.001). bcl9 expression tended to be an independent predictor of shorter dfs (p=0.078).conclusionsbcl9 protein expression might be a marker of shorter dfs in hcc patients after curative hepatectomy. |
all generated fasta - formatted files are stored within the document - based nosql mongodb (http://www.mongodb.org). since metadata from publicly accessible genome data are often not uniformly written, such a system allows each file to contain its own attributes with mongodb s key value documents. as a result, updated information can easily be added to any given fasta file, without needing to change the structure of our database. by default, each document contains keys titled sequence, country, accession, date, gene, and note which map to their corresponding values. a restful web service23 has been created using the flask python microframework (http://flask.pocoo.org) ; this permits users to query stored documents via several parameters, including country of isolation, date, and accession number. although the queries can be completed through standard http get and post requests, a user interface has also been developed for accessing the data. the parser utilizes each genbank file s cds tags in order to retrieve information about each gene sequence. then with the start and end nucleotide found in the tags, the gene sequence is taken from the genome within the genbank file. post - processing of the records was performed using python scripts developed in - house ; these scripts remove any duplicate records (an artifact of duplicate gene annotations within the genbank file) as well as create fasta - formatted sequence files. the pymongo library (https://pypi.python.org/pypi/pymongo/) was used to insert the data into the mongodb. hiv-1 genomes were downloaded as genbank files from the ncbi nucleotide database specifying the following : human immunodeficiency virus 1 (porgn:_txid11676) and (8000:11000[sequence length ]). data were collected from the ncbi on february 26, 2013, obtaining 4,724 individual sequence records. records missing country of isolation and/or collection date information, totaling 1,622 records, were manually curated via one of two sources. records retrieved which are also available via los alamos national laboratory (lanl) s hiv database (http://www.hiv.lanl.gov/) were referenced to ascertain whether the isolation / date information was available. in the event that these data were also missing from lanl, publications referenced in the genbank file were evaluated. the database was updated at a later date (september 25, 2015), further exemplifying the ease of use for the proposed method of data aggregation and exposure in the form of a restful web service. this update expanded the sequence database to include an additional 1,342 sequences (6,066 total). data are stored through figshare (figshare.com) and can be retrieved via wget http://files.figshare.com/2304758/hiv.tar.gz. first, sequences were aligned via clustalw, and neighbor - joining trees with partial deletion (site coverage cutoff, 75%) were computed with the maximum composite likelihood model using the mega 5 software tool33 ; trees were visualized using the tool phylowidget34 and produced using the adobe illustrator. the trees shown in figures 3 and 4 were created using this strategy. in parallel, a second strategy was employed : sequences were aligned using muscle and maximum likelihood trees using the jukes cantor and generalized time - reversible models that were generated via fasttree35 within the geneious tool (biomatters ltd.). in deriving these trees, trees were visualized using geneious ; supplementary files 1 and 2 contain the phylogenies (derived using the jukes cantor model and with support values shown) for the same set of sequences as shown in figure 3a and b, respectively. newick format files can be found for all five trees (figs. 3 and 4) derived using this second strategy with the jukes cantor model in supplementary file 3. all generated fasta - formatted files are stored within the document - based nosql mongodb (http://www.mongodb.org). since metadata from publicly accessible genome data are often not uniformly written, such a system allows each file to contain its own attributes with mongodb s key value documents. as a result, updated information can easily be added to any given fasta file, without needing to change the structure of our database. by default, each document contains keys titled sequence, country, accession, date, gene, and note which map to their corresponding values. a restful web service23 has been created using the flask python microframework (http://flask.pocoo.org) ; this permits users to query stored documents via several parameters, including country of isolation, date, and accession number. although the queries can be completed through standard http get and post requests, a user interface has also been developed for accessing the data. the parser utilizes each genbank file s cds tags in order to retrieve information about each gene sequence. then with the start and end nucleotide found in the tags, the gene sequence is taken from the genome within the genbank file. post - processing of the records was performed using python scripts developed in - house ; these scripts remove any duplicate records (an artifact of duplicate gene annotations within the genbank file) as well as create fasta - formatted sequence files. the pymongo library (https://pypi.python.org/pypi/pymongo/) was used to insert the data into the mongodb. hiv-1 genomes were downloaded as genbank files from the ncbi nucleotide database specifying the following : human immunodeficiency virus 1 (porgn:_txid11676) and (8000:11000[sequence length ]). data were collected from the ncbi on february 26, 2013, obtaining 4,724 individual sequence records. records missing country of isolation and/or collection date information, totaling 1,622 records, were manually curated via one of two sources. records retrieved which are also available via los alamos national laboratory (lanl) s hiv database (http://www.hiv.lanl.gov/) were referenced to ascertain whether the isolation / date information was available. in the event that these data were also missing from lanl, publications referenced in the genbank file were evaluated. the database was updated at a later date (september 25, 2015), further exemplifying the ease of use for the proposed method of data aggregation and exposure in the form of a restful web service. this update expanded the sequence database to include an additional 1,342 sequences (6,066 total). data are stored through figshare (figshare.com) and can be retrieved via wget http://files.figshare.com/2304758/hiv.tar.gz. first, sequences were aligned via clustalw, and neighbor - joining trees with partial deletion (site coverage cutoff, 75%) were computed with the maximum composite likelihood model using the mega 5 software tool33 ; trees were visualized using the tool phylowidget34 and produced using the adobe illustrator. the trees shown in figures 3 and 4 were created using this strategy. in parallel, a second strategy was employed : sequences were aligned using muscle and maximum likelihood trees using the jukes cantor and generalized time - reversible models that were generated via fasttree35 within the geneious tool (biomatters ltd.). in deriving these trees, trees were visualized using geneious ; supplementary files 1 and 2 contain the phylogenies (derived using the jukes cantor model and with support values shown) for the same set of sequences as shown in figure 3a and b, respectively. newick format files can be found for all five trees (figs. 3 and 4) derived using this second strategy with the jukes cantor model in supplementary file 3. | as sequencing technologies continue to drop in price and increase in throughput, new challenges emerge for the management and accessibility of genomic sequence data. we have developed a pipeline for facilitating the storage, retrieval, and subsequent analysis of molecular data, integrating both sequence and metadata. taking a polyglot approach involving multiple languages, libraries, and persistence mechanisms, sequence data can be aggregated from publicly available and local repositories. data are exposed in the form of a restful web service, formatted for easy querying, and retrieved for downstream analyses. as a proof of concept, we have developed a resource for annotated hiv-1 sequences. phylogenetic analyses were conducted for > 6,000 hiv-1 sequences revealing spatial and temporal factors influence the evolution of the individual genes uniquely. nevertheless, signatures of origin can be extrapolated even despite increased globalization. the approach developed here can easily be customized for any species of interest. |
noninvasive imaging techniques for staging of liver fibrosis have become increasingly popular in patients with chronic liver disease. although liver biopsy is the criterion standard for assessment of morphological liver alterations, it has the disadvantages of an invasive procedure with rare but clinically relevant complications. in addition, technical aspects such as sampling errors, small portal tract count, and variabilities among pathologists must also be taken into account. it has been shown that transient elastography (te) and acoustic radiation force impulse (arfi) are reliable techniques for diagnosing and excluding liver cirrhosis. in the clinical management of transplant patients, the value of these techniques, especially the role of arfi, is not yet well established. continuous improvements in surgical techniques and immunosuppression regimens have greatly improved the long - term results after liver transplantation. however, some patients develop acute complications after surgery (e.g., stricture of anastomosis, infections, acute rejection) or chronic complications during immunosuppressive treatment (e.g., chronic rejection, disease - relapse, drug - induced renal or hepatic complications). high liver stiffness (te) due to advanced fibrosis is accompanied by hepatic complications, mortality, and potentially the need for re - transplantation. postoperative b - mode and doppler us are standard procedures for the assessment of liver graft complications. based on the combined information of abnormal laboratory findings, us findings and clinical symptoms liver biopsy (lb) can be indicated. whether the assessment of liver stiffness is helpful for the management of post - olt patients is currently unknown. some studies have shown a correlation of te with non - viral graft disease, rejection, and grade of fibrosis in patients with recurrent viral hepatitis c with or without antiviral treatment after olt [57 ]. arfi imaging is a promising us - based elastography device, which is based on short experience in the follow - up of post - olt patients [811 ]. in contrast to te, arfi is not limited in patients with ascites and severe obesity due to technical failures. arfi is included in a conventional ultrasound machine and it can therefore be performed during a conventional b - mode examination of post - olt patients (figure 1). in this prospective study we analyzed arfi - values in asymptomatic and symptomatic patients following olt and correlated the results with invasive and non - invasive parameters of fibrosis and clinical condition. between may 2012 and may 2014, consecutive patients after olt were recruited for the study during their follow - up visits. patients were asked to participate in additional assessment of arfi elastography. one patient had to be excluded because the arfi - examination was unable to produce reliable values. prior to patient enrollment, the local ethics committee approved the project and the prospective study was registered (clincaltrials.gov identifier : nct01664780). written informed consent descriptive data (sex, age, body - mass - index (bmi), period of time since the olt, cause of liver failure or end - stage liver disease prior to olt, and current immunosuppression) and blood samples (total bilirubin, ast, alt, -gt, ap, albumin, and platelet count) were evaluated. thereafter, the aspartate aminotransferase - to - platelet ratio index (apri) was calculated as a non - invasive parameter for liver fibrosis (table 1). b - mode us examination of the abdomen and doppler measurements (peak systolic velocity and resistance index (ri) in the hepatic artery and the mean portal vein velocity) were performed prior to arfi by 1 experienced sonographer with more than 9 years of experience in us (german society of ultrasound in medicine [degum ] level 2). elastometry can be performed during real - time b - mode us with a single transducer of the acuson s2000 us system (virtual touch tissue quantification, siemens acuson s2000, siemens medical solutions, erlangen, germany). a quadratic cursor with a size of 105 mm representing the anatomic region of interest to be measured is placed in the requested area of the liver parenchyma. at the push of a button a short - duration acoustic pulse is transmitted, which leads to localized tissue displacement and consecutive shear wave propagation away from the area of excitation. the share wave propagation velocity (expressed in m / s) is proportional to the square root of tissue elasticity within the cursor. all patients in our study were in the fasting state and followed the instruction for a relaxed breathing arrest. arfi imaging was performed on the same day as the clinical examination and blood withdrawal with a curved array transducer (6c1hd ; 4 mhz) of the acuson s2000 us system. ten valid measurements in the left (segment iii) and right (segment vii) hepatic lobe could be achieved in all patients, avoiding large vessels or bile ducts. liver fibrosis shows slow progression and implies potential complications (e.g., risk of significant bleeding, pain). therefore consistent lb was not an inherent part of the study protocol due to ethical reasons (especially for asymptomatic patients) and was performed if indicated in patients with suspected graft damage. biopsy had been performed sonographically guided with a core tissue needle (external diameter 18 g ; 2.2 cm sample notch) in our department. biopsy specimens of all patients were fixed in formalin (10%) and analyzed by an experienced pathologist, in the institute of pathology, university hospital erlangen. the ludwig score classification was used for graduation of the degree of fibrosis (f0=no fibrosis, f1=minimal portal fibrosis, f2=moderate periportal fibrosis with no architectural distortion, f3=substantial septal fibrosis with architectural distortion, and f4=liver cirrhosis). statistical analysis was performed using the statistical package for the social sciences (version 19.0.0.1, ibm spss statistics, new york, usa). clinical and laboratory data of the patients and arfi - values are expressed as mean standard deviation (sd), counts, and percentages, as appropriate. the relationships between variables were examined using spearman s two - tailed pairwise correlation coefficient (r). non - parametric tests were chosen to compare median values of 2 independent samples by mann - whitney u test in non - normally distributed data. diagnostic accuracy and arfi cutoff values were evaluated by using receiver - operating characteristic curves (roc). between may 2012 and may 2014, consecutive patients after olt were recruited for the study during their follow - up visits. patients were asked to participate in additional assessment of arfi elastography. one patient had to be excluded because the arfi - examination was unable to produce reliable values. prior to patient enrollment, the local ethics committee approved the project and the prospective study was registered (clincaltrials.gov identifier : nct01664780). written informed consent descriptive data (sex, age, body - mass - index (bmi), period of time since the olt, cause of liver failure or end - stage liver disease prior to olt, and current immunosuppression) and blood samples (total bilirubin, ast, alt, -gt, ap, albumin, and platelet count) were evaluated. thereafter, the aspartate aminotransferase - to - platelet ratio index (apri) was calculated as a non - invasive parameter for liver fibrosis (table 1). b - mode us examination of the abdomen and doppler measurements (peak systolic velocity and resistance index (ri) in the hepatic artery and the mean portal vein velocity) were performed prior to arfi by 1 experienced sonographer with more than 9 years of experience in us (german society of ultrasound in medicine [degum ] level 2). elastometry can be performed during real - time b - mode us with a single transducer of the acuson s2000 us system (virtual touch tissue quantification, siemens acuson s2000, siemens medical solutions, erlangen, germany). a quadratic cursor with a size of 105 mm representing the anatomic region of interest to be measured is placed in the requested area of the liver parenchyma. at the push of a button a short - duration acoustic pulse is transmitted, which leads to localized tissue displacement and consecutive shear wave propagation away from the area of excitation. the share wave propagation velocity (expressed in m / s) is proportional to the square root of tissue elasticity within the cursor. all patients in our study were in the fasting state and followed the instruction for a relaxed breathing arrest. arfi imaging was performed on the same day as the clinical examination and blood withdrawal with a curved array transducer (6c1hd ; 4 mhz) of the acuson s2000 us system. ten valid measurements in the left (segment iii) and right (segment vii) hepatic lobe could be achieved in all patients, avoiding large vessels or bile ducts. liver fibrosis shows slow progression and implies potential complications (e.g., risk of significant bleeding, pain). therefore consistent lb was not an inherent part of the study protocol due to ethical reasons (especially for asymptomatic patients) and was performed if indicated in patients with suspected graft damage. biopsy had been performed sonographically guided with a core tissue needle (external diameter 18 g ; 2.2 cm sample notch) in our department. biopsy specimens of all patients were fixed in formalin (10%) and analyzed by an experienced pathologist, in the institute of pathology, university hospital erlangen. the ludwig score classification was used for graduation of the degree of fibrosis (f0=no fibrosis, f1=minimal portal fibrosis, f2=moderate periportal fibrosis with no architectural distortion, f3=substantial septal fibrosis with architectural distortion, and f4=liver cirrhosis). statistical analysis was performed using the statistical package for the social sciences (version 19.0.0.1, ibm spss statistics, new york, usa). clinical and laboratory data of the patients and arfi - values are expressed as mean standard deviation (sd), counts, and percentages, as appropriate. the relationships between variables were examined using spearman s two - tailed pairwise correlation coefficient (r). non - parametric tests were chosen to compare median values of 2 independent samples by mann - whitney u test in non - normally distributed data. diagnostic accuracy and arfi cutoff values were evaluated by using receiver - operating characteristic curves (roc). a total of 58 post - transplant patients [37 men (64%) and 21 women (36%) ; age 55 years 11.9 ; mean bmi 25.9kg / m 4.10 ; years since olt 11.623.16 ] gave written informed consent and were included in the prospective study. the main causes of liver failure or end - stage liver disease were hepatocellular carcinoma (26%), alcoholic liver disease (22%), and viral hepatitis (17%). most patients had several conspicuous findings of b - mode us of the abdomen but normal findings by means of doppler us parameters. splenomegaly [n=36 (62%) ], an irregular surface [n= 27 (47%) ], irregular course of the hepatic veins [n=22 (38%) ], and an inhomogeneous texture of the parenchyma [n=23 (40%) ] were most commonly found. the peak systolic velocity of the hepatic artery was 60.1 cm / s 21.4 (range 30138) with a mean ri of 0.690.10 (range 0.40.9), and a mean portal vein velocity of 28.7 cm / s 12.8 (range 1378). a statistically significant correlation of mean arfi values was found with the age (r=0.35, p 0.90 in all cases. these results were confirmed by several complementary studies and 2 systematic reviews. based on these study results, the cut - off values for the detection of patients with > f2 fibrosis vary between 7.9 and 10.1 kpa, while the cut - off values for cirrhotic transplanted with cadaver donation range from 12.0 to 12.5 kpa [6,1722,31,32 ]. showed an even higher level of accuracy in hcv patients as regards the prediction of f24 fibrosis in patients with transplants as compared to those without. here, we could also identify a correlation between the measured arfi values and the examined apri - score in our cohort, which reflects a correlation between the arfi values and liver fibrosis [correlation between apri value and arfi velocity in the right liver lobe : (r=0.44, p<0.001) ]. although apri as a noninvasive marker of fibrosis correlated well with advanced fibrosis and cirrhosis, arfi elastometry performed better than noninvasive markers (correlation for f3 : apri : r=0.446, p=0.038 ; arfi : r=0.620, p=0.002) in the present study. in conclusion, the initial absolute arfi values and their changes during the clinical follow - up must be interpreted in combination with anamnestic information and laboratory values. the arfi - elastography in transplanted patients showed higher absolute values compared to previously published data of patients without transplantation. a shear wave velocity of 1.390.63 m / s in the right and of 2.000.93 m / s in the left lobe of the liver could be measured in the currently examined transplanted collective (n=58). this difference of values from measurements in the left and right liver lobe is in accordance with data from non - transplant patients (goertz rs. therefore, the recommendations for arfi measurements in the right liver lobe (in segment vii) should also be respected in post - olt patients. in our cohort we found mean arfi values of 2.850.90 m / s for patients with f3 fibrosis, while the shear wave velocities in patients with f02 fibrosis were significantly lower (1.570.57 m / s). thus, a clear differentiation between low- and high - grade fibrosis after olt seems to be possible. several studies in non - transplant patients have reported that arfi imaging provides good diagnostic performance and excellent accuracy for assessing hepatic fibrosis in chronic liver disease. for fibrosis staging by arfi elastography in post - olt patients, heterogeneous patient collectives (etiology, comorbidity, and disease course) in the post - transplant cohort hinder the comparison and realization of large prospective clinical studies the auc for early fibrosis (f1) was 72.1%, assuming the arfi cutoff value of 1.058 m / s (sensitivity 95.5% and specificity 25.7%). a limitation of the study is the small amount of advanced fibrosis (n=3 for f2 ; total n=57) and the absence of cirrhotic (n=0 for f4) patients after olt. focusing on the results of our study, the areas under the roc curves for patients with advanced fibrosis (f3) and cirrhosis (f4) were 92.9% and 80%, respectively (figure 3). on the basis of our data, we can show that post - olt patients present higher absolute arfi values compared to the normal population. olt patients with elevated liver enzymes, cholestasis, acute viral hepatitis, and fibrosis show significantly increased arfi velocities. therefore, arfi - values must be interpreted within the context of serum tests and the clinical condition. in patients after olt, arfi imaging quickly provides information on liver fibrosis during on - site examination, irrespective of unclear grey - scale or doppler us parameters. therefore, unnecessary diagnostics and interventions in cases involving low values might be reduced in the clinical context. in summary, arfi is a promising additional tool in the daily routine care of patients after olt. for this to be verified, it is necessary that further validations in patients after olt should be carried out in larger collectives. | backgroundacoustic radiation force impulse (arfi) elastography is a reliable diagnostic device for quantitative non - invasive assessment of liver fibrosis in patients with chronic liver disease. the aim of our prospective study was to evaluate the impact of arfi in patients after orthotopic liver transplantation (olt). therefore, we compared arfi shear wave velocities with clinical features, non - invasive markers, and the histology of patients following olt.material/methodspost-transplant patients underwent a clinical examination and blood samples were taken. b - mode and doppler ultrasound (us) of the portal vein and the hepatic artery were performed. subsequently, a minimum of 10 valid arfi values were measured in the left and right liver lobe. liver biopsy was performed if indicated.resultsbetween may 2012 and may 2014, 58 patients after olt were included in the prospective study. laboratory markers and aspartate aminotransferase - to - platelet ratio index (apri) correlated with arfi values (r=0.44, p<0.001). the histological (n=22) fibrosis score (ludwig) was significantly correlated with the arfi of the biopsy site (r=0.55, p=0.008). the mean shear - wave velocities were significantly increased in advanced fibrosis (f2 1.570.57 m / s ; f3 2.850.66 m / s ; p<0.001), obstructive cholestasis and active viral hepatitis. the area under the receiver operating characteristic (auroc) curves for the accuracy of arfi were 74% (f1), 73% (f2), 93% (f3), and 80% (= f4).conclusionsarfi elastography correlates well with laboratory values and with noninvasive and invasive markers of fibrosis in patients after olt. in this regard, elevated arfi - velocities should be interpreted with caution in the context of obstructive cholestasis and active viral disease. |
ammoxidation (or ammonoxidation), that is the simultaneous treatment of a given organic substrate with ammonia and oxygen, has been established and advanced as an appropriate method to convert technical, virtually nitrogen - free lignins into nitrogenous soil - improving materials. in particular lignins mild reaction conditions (t 100 c ; po2 0.2 mpa ; 5% aqueous ammonia) have been demonstrated to share similarities with natural humic substances. they act as soil amendments with slowly nitrogen releasing, water storing, ion exchanging, and texture improving properties, and are hence beneficial for plant growth. positive effects of ammoxidized lignins on the growth of agricultural crops or trees have been reported, such as in forest plant breeding, ornamental horticulture, or rehabilitation of degraded soils. however, there are still some uncertainties with regard to the application of ammoxidized lignocellulosic materials in soil improvement and crop cultivation. besides insufficient knowledge about different types of nitrogen bonding and the resulting fertilizing properties, the major concern is about possible formation of ecotoxic, carbohydrate - derived nitrogenous compounds under ammoxidation conditions. the reaction of mono-, oligo-, and polysaccharides under aqueous alkaline conditions in general, and of sugars with ammonia in maillard - type reactions in particular, have been comprehensively studied in the past decades. base - catalyzed degradation of cellulose and monosaccharides was reviewed by knill and kennedy, the reaction of carbohydrates with ammonia were summarized by kort, while fay and bernard gave a more recent overview of the maillard reaction. to the best of our knowledge, no study investigated the types of nitrogenous products obtained by a joint treatment of carbohydrates with aqueous ammonia and oxygen, even though a considerable number of papers on technical aspects of biomass ammoxidation and ammoxidative pretreatments (ammonia recycle pretreatment, arp) have been published. this paper investigates the reaction behavior of cellulose, xylan, d - glucose and d - xylose under ammoxidative conditions at different temperatures (70 c, 100 c, 140 c), oxygen pressures (0.2 mpa, 1.0 mpa), but constant initial ammonia concentration (5%, w / v) and ph of about 11.9. in addition to the weight of the product fractions (solid phase, aqueous phase, ethyl acetate extracts), the composition of the different phases was studied by gc / ms, in part after derivatization. authentic samples of the main identified n - heterocyclic reaction products were synthesized. these pure compounds were used in ecotoxicity studies with regard to growth inhibition of the fresh - water algae pseudokirchneriella subcapitata (oecd ecotoxicity test 201), and as analytical standards in gcms. as phytotoxicity correlated mainly with the content of monosaccharides, gel permeation chromatography was additionally used to study the degradation of polysaccharides under ammoxidation conditions. beech xylan (97.4% xylose, 0.8% glucose, 0.2% mannose, 0.2% rhamnose, 0.2% cellobiose, 1.1% 4-o - me - glucuronic acid ; mw 10.210 kg / mol) was provided by lenzing ag (lenzing, austria). all other chemicals, including cellulose (acid - washed and milled cotton linters for column chromatography), were purchased from sigma - aldrich handels gmbh (vienna, austria) in the highest purity available, and were used, unless otherwise noted, without further purification. ethyl acetate (etoac) was dried over anhydrous calcium chloride, distilled once with acetic anhydride and sulfuric acid, and subsequently over potassium carbonate in order to remove water, ethanol and acetic acid, respectively. pyridine and ethyl acetate for derivatization were stored over molecular sieves, and filtered through a 0.45 m syringe filter prior to use. was accomplished in a 100 ml 4566 c series laboratory - scale pressure vessel (parr instruments, frankfurt, germany) equipped with a glass liner and a septum valve, and heated with an oil bath. monosaccharides : 10 ml of 10% aqueous ammonia were placed inside the reactor. after flushing three times with oxygen, the reactor was closed and heated under continuous stirring to the respective temperature (70 c, 100 or 140 c). then, a solution of 1.0 g of the respective monosaccharide in 10 ml of water was added through a septum by a syringe, initiating the reaction (t = 0). the reactor was pressurized with 0.2 and 1 mpa of o2, respectively, and left in connection with the gas supply via a back - pressure valve in order to guarantee constant pressure throughout the reaction. the final pressures including the respective vapor pressure of the aqueous solution of ammonia (5%) were for the 0.2 mpa pressure stage 0.27 mpa (70 c), 0.38 mpa (100 c), 0.68 mpa (140 c), and for the 1.0 mpa pressure stage 1.20 mpa (70 c), 1.39 mpa (100 c) and 1.80 mpa (140 c). polysaccharides : deviating from the above - described procedure, a suspension of the respective polysaccharide in 10 ml of water was first pretempered in the reactor before the reaction was initiated by addition of 10 ml of 10% aqueous ammonia. after stirring the reaction mixtures at the respective temperature and pressure for 3 h, workup procedure prior to optimization : the reaction mixture was extracted three times with 20 ml ethyl acetate. the combined extracts were dried over na2so4, and evaporated under reduced pressure to dryness. optimized workup procedure : the reaction mixture was evaporated at 3.5 kpa (35 c) to remove ammonia, solids were separated by centrifugation, washed with water, and freeze - dried for sec and elemental analysis. the ph value was adjusted to 8.5 using 2% aqueous ammonia in order to ensure complete deprotonation of imidazole and pyrazine functionalities. higher concentrations of ammonia should be avoided in order to prevent acetamide formation from ethyl acetate during extraction. after filling up to 20 ml, the aqueous phase was extracted four times with 100 ml of water - saturated ethyl acetate. the combined organic phases were evaporated to approximately /10 of their volume under reduced pressure, whereupon the water was removed by azeotropic distillation. the residue was redissolved in 10 ml of dry etoac and evaporated at 35 c (9 kpa) affording a yellowish oil. aliquots of the extract were used for gc / ms analyses, and for phytotoxicity testing. an aliquot containing approximately 1 mg of dry matter was lyophilized overnight at 25 c and 1020 pa. then, 200 l of dry pyridine, containing 1.5 g / l of the catalyst 4-(n, n - dimethylamino)pyridine (dmap), and 10 l of a 10 g / l solution of the internal standard phenyl -glucopyranoside in pyridine were added. the mixture was vortexed for a minimum of 30 s, before 100 l of the silylation mixture (bstfa containing 10% trimethylchlorosilane) was added. silylation was performed at 70 c for 2 h. after cooling to room temperature, 900 l of dry ethyl acetate were added, the mixture was vortexed and analyzed by gc / ms within 24 h. for reference spectra of silylated compounds, a 200 g aliquot of the respective substance was subjected to the above procedure. mild oxidation of 2,5-dimethylpyrazine (2.16 g, 20 mmol) with n - chlorosuccinimide (3.19 g, 23.9 mmol) and dibenzoylperoxide (123.6 mg, 0.68 mmol) in 50 ml of ccl4 as described elsewhere. yield after purification by column chromatography : 936 mg (38%) and 143 mg (5.1%) of the byproduct 2,5-bis(hydroxymethyl)pyrazine. the product was stored in a dark place at 4 c. h nmr (cdcl3) : 2.59 (s, 3h, ch3), 3.16 (s, 1h, oh), 4.18 (s, 2h, ch2oh), 8.43 (s, 1h, pyrazine - h6), 8.53 (s, 1h, pyrazine - h3). c nmr (cdcl3) : 21.1 (ch3), 62.6 (ch2oh), 141.6 (c3), 143.1 (c6), 152.5 (c2), 151.6 (c5). synthesis by portionwise addition of d - glucosamine hydrochloride (2.16 g, 10 mmol) to a solution of 3.05 g (25 mmol) of phenylboronic acid in aqueous sodium hydroxide as described elsewhere. h nmr (dmso - d6) : 2.71 (1h, dd, ch2, j = 13.8 hz, 9.3 hz), 3.04 (1h, dd, ch2, j = 2.8 hz, 13.8 hz), 3.36 3.45 (m, 3h), 3.53 3.63 (m, 3h), 3.72 3.77 (m, 1h), 4.45 and 4.68 (7h, br, oh), 4.92 (d, 1h, j = 3.4, tetrahydroxybutyl - h1), 8.38 (d, 1h, j = 1.2), 8.61 (d, 1h, j = 5.2). c nmr (dmso - d6) : 18.97 (ch2), 56.42, 63.62, 63.98, 71.68, 71.74, 74.24, 75.38 (7 c, choh), 142.70, 143.67 (2 c, ch), 153.62, 156.151 (2 c, c). synthesis by condensation of d - fructose (5.40 g, 30 mmol), formamidine acetate (5.03 g, 36 mmol) and liquid ammonia (20 ml) at 75 c using a parr 4566 c pressure reactor. yield : 2.04 g (36%). h nmr (cd3od) : 3.603.66 (1h, m, ch2oh), 3.68 3.75 (2h, dd, tetrahydroxybutyl - h2/h3), 3.773.82 (m, 1h, ch2oh), 4.97 (1h, tetrahydroxybutyl - h1, d, j = 1.7 hz), 7.04 (1h, s, imidazole - h5), 7.61 (1h, d, imidazole - h2, j = 1.0 hz). c nmr (dmso - d6) : 64.8 (tetrahydroxybutyl - c4), 68.0 (tetrahydroxybutyl - c1), 73.1 and 75.67 (tetrahydroxybutyl - c2/3), 136.0 (imidazole - c2). nmr spectra were recorded on a bruker avance ii 400 (resonance frequencies 400.13 mhz for h and 100.63 mhz for c) equipped with a 5 mm observe broadband probe head (bbfo). gc - ms was performed on a gc 6890n / msd 5975b instrument equipped with a 30 m 0.25 mm i.d. helium total flow was 27.5 ml / min at 46.9 kpa ; the column flow was 0.9 ml / min. temperature program : 50 c (2 min), 5 c / min to 280 c (20 min). 0.2 l aliquots of the dissolved samples were injected at 230 c inlet temperature in splitless mode, or with a 1:2 split, depending on the concentration. data were acquired and processed with the agilent chemstation e.02.02.1431 software package. unless otherwise noted, tentative peak assignment was accomplished by comparison with the nist ms library, version 2.0f. size exclusion chromatography (sec) : dionex dg-2410 online degasser ; kontron 420 pump with pulse damper ; hp 1100 auto sampler ; gynkotek sth 585 column oven ; shodex ri-71 refractive index and a wyatt dawn dsp, 488 nm laser multiple - angle light scattering detector., 20 m pl gel mixed a ls columns (agilent, germany), an injection volume of 100 l, eluent flow of 1.00 ml / min and run time of 45 min. mobile phase : n, n - dimethylacetamide / lithium chloride (0.9% v / w), filtered through a 0.02 m filter. activation of cellulose : 20 mg of dry cellulose was subsequently soaked in a large excess of deionized water, ethanol, and n, n - dimethylacetamide and left in the latter under shaking overnight. after filtration, 2 ml of n, n - dimethylacetamide / licl 9% (v / w) was added and the sample was left for dissolution on a vertical shaker overnight. prior to measurement, 0.3 ml of the respective samples were diluted with 0.9 ml of n, n - dimethylacetamide and filtered. carbonyl and carboxyl group contents were determined after labeling with the fluorescence markers carbazole-9-carboxylic acid [2-(2-amino - oxyethoxy)ethoxy]amide (ccoa ; carbonyl groups) and 2-diazomethyl fluorene (fdam ; carboxyl groups), respectively. elemental analyses were performed at the microanalytical lab of the university of vienna. dilution series (dilution factors 1, 2, 4, 8, 10, 16, 32, 64, 100, 256, 1000, 1024, and 10 000) of all studied compounds were prepared from respective stock solutions containing 10 mg of sample in 20 ml of water, adjusted to ph 7.0 0.3 with 1 m naoh. two ml of this solution was transferred to well plates, inoculated with the exponentially growing test organisms pseudokirchneriella subcapitata (oecd test 201, approximately 20.000 cells per well) and cultivated for 72 h under following conditions : illuminated shaker, 6.5007.000 lx, day / night = 16h/8h, 22 c. all measurements (all concentration levels of samples and reference, blank) were performed in triplicate. photometric measurements at 485 nm were performed at 0, 24, 48, and 72 h of incubation time. quantitation was based on the areas of the growth curves that can be calculated according to the following equations where mn is the extinction at the time of the n measuring tn, and a the integral of the growth curve. inhibition was calculated from the integrals of the growth curves of both the blank (ab) and that of the sample (as). ammoxidation of both monosaccharides (d - glucose, d - xylan) and polysaccharides (cellulose, xylan) at 70140 c (0.21.0 mpa o2) afforded a broad spectrum of lower - molecular compounds with distinctly higher total amounts in the case of the monosaccharides as compared to polysaccharides, especially at lower ammoxidation temperature. gc / ms analysis of the crude products revealed the presence of a large variety of nitrogenous compounds as shown for d - glucose (100 c, 0.2 mpa o2, 3 h) in figure 1. in addition to aminosugars, glycosylamines, amides, urea, and ammonium salts of carbaminic, oxalic, aldonic and deoxyaldonic acids, some unexpected compounds, such as -hydroxyamides and -amino acids, were detected (table 1). chromatograms of the crude reaction mixture obtained by ammoxidation of d - glucose at 100 c (0.2 mpa o2, 3 h) after freeze - drying and per - trimethylsilylation. numbers in parentheses refer to peak assignments for figures 1 and 4. distinctly higher yields of compounds extractable with ethyl acetate (etoac) as obtained after ammoxidation confirmed the formation of less polar compounds from both the monosaccharides glucose and xylose and the polysaccharides cellulose and xylan (table 2). gc / ms analysis revealed that n - heterocyclic compounds of low h2o / etoac partition coefficients (log p 0) were the main constituents of the organic phases (figure 2). therefore, the extraction protocol was optimized toward virtually quantitative (97%) extraction of the key compound 4-methyl-1h - imidazole. following this approach a significantly higher yield of extractives was isolated from the reaction mixtures, in particular for the 100 and 140 c variants (table 2). however, independent of the extraction method used, the amount of extractives was consistently 1 order of magnitude higher for the monosaccharides than for the polysaccharides ammoxidized under comparable conditions. the two monosaccharides afforded nearly the same amount of extractives, with xylose giving slightly higher yields. the amount of extractives from xylan was generally higher than that obtained from cellulose. chromatograms of per - trimethylsilylated ethyl acetate extracts of the reaction mixtures obtained after ammoxidation (100 c, 0.2 mpa o2, 3 h) of d - glucose (a) and d - xylose (b). for peak assignment see table 1. aqueous ammonia (5 w%), 0.2 mpa oxygen partial pressure, 3 h of reaction time. the fraction of moderately polar to nonpolar compounds that was extractable with etoac increased with the ammoxidation temperature for all studied substrates, and ranged about 1417.7% for the monosaccharides and 1.23.9% for the polysaccharides at 140 c, relative to the mass of the respective starting material. the amount of dark - colored, water - insoluble products increased correspondingly with temperature, which is indicative of polymerization reactions as shown previously. cellulose was increasingly degraded upon ammoxidation beyond 100 c, which is evident from the amounts of water - soluble products that increased 4-fold when raising the reaction temperature from 100 to 140 c. for xylan, which was partly soluble in aqueous ammonia (39% relative to the amount of educt) due to its glucuronic acid side groups, the weight of the water - soluble product fraction increased when raising the ammoxidation temperature from room temperature to 70 c (77.4 mg/100 mg xylan). the water solubility was lower at 100 c (26.3 mg/100 mg xylan) which is assumed to be due to a loss of glucuronic acid groups. at 140 c, the fraction of water - soluble products increased up to 43.5%, and the optical appearance changed from white fibrous flakes (70 c) to brown syrup, suggesting that decomposition of the xylan was so pronounced that water - soluble products of low molecular weight formed. compared to the influence of temperature during ammoxidation on the weight of the different fractions, the effect of oxygen pressure was rather small. at least for xylose and xylan (140 c), a higher oxygen pressure favors the formation of water - soluble products (likely by generation of carboxyl groups) at the expense of water - insoluble ones, whereas the amount of compounds extractable with ethyl acetate remained at the same level. size exclusion chromatography multiangle laser light scattering (sec - malls) in combination with fluorescence labeling of carbonyl and carboxyl groups provides additional information on the extent and nature of alkaline degradation in presence of ammonia and oxygen. the total amount of carbonyls and carboxyls was measured according to the ccoa and fdam labeling approaches, respectively, and the theoretical number of reducing end groups (regs) was calculated from the number - average molecular weight (mn) obtained through sec - malls. sec - malls analysis of the studied cellulose (cotton linters, mw 153 kg / mol) prior to and after ammoxidation confirmed that the increasing amounts of etoac - soluble and water - soluble compounds formed at higher temperature correlated with the obtained loss in molar mass of cellulose (figure 3). however, at moderate ammoxidation temperature of 70 c, the chemical integrity of cotton linters is little compromised (mw = 139 kg / mol). the amount of carbonyls and the difference between total carbonyls and regs (equates to the content of along - chain carbonyls) remains unaffected, indicating only a very minor extent of oxidative damage along the chain as well as little participation in reactions with ammonia. a significant decrease of mw was observed with increasing temperature (100 c) and oxygen pressure, as expected. at 140 c, cellulose was severely degraded (mw = 43 kg / mol). however, the number of carbonyls increased only slightly. at this temperature, alkaline peeling / stopping commence and fast alkali - induced chain scission (beta - elimination) play a major role. along - chain carbonyls are immediately consumed by the latter processes, so that their content can be assumed to be nearly zero. thus, the amount of carbonyls measured is approximately equal to the amount of regs available for labeling. this amount is smaller than the theoretical amount derived from mn, as many reducing ends are converted by peeling / stopping - type processes and thus can not be labeled. in addition, carbonyls and carboxyls of cellulose engage in reactions with ammonia as demonstrated by increasing nitrogen content. mw (left) and carbonyl / carboxyl groups (right) of cotton linter cellulose after ammoxidation at different temperature and oxygen pressure. thereby, fluorescent aromatic structures are formed which is indicated by a weak fluorescence signal of the unlabeled cellulose in sec - malls. the formation of numerous poly(hydroxyalkyl) pyrazine or -imidazole derivatives from monomeric sugars suggests that similar structures can be formed at the reducing ends of cellulose or by reaction of other carbonyl groups along the cellulose chains (figure 4). proposed formation of n - heterocyclic moieties covalently attached to the reducing ends of cellulose : pyrazines from -amino carbonyl compounds (left) and 1h - imidazoles from aldehydes (right). the ethyl acetate extracts were analyzed by gc / ms after per - trimethylsilylation, which is considered to be one of the most versatile derivatization methods. however, 1h - imidazoles, which turned out to be major ammoxidation products, are somewhat resistant to the initially employed silylation reagent n, o - bis(trimethylsilyl) trifluoroacetamide (bstfa). in an attempt to optimize the yield of silylated reaction products, a test mixture consisting of 4-methyl-1h - imidazole, glycolic acid, glycine, urea, d - glucose, d - gluconic acid, glucosamine - hydrochloride, and 4-(d - arabino tetrahydroxybutyl)-1h - imidazole was silylated with a mixture of trimethylchlorosilane (tms - cl) and/or catalytic amounts of n, n - dimethyl-4-aminopyridine (dmap) in bstfa. while urea, carboxy- and hydroxy - functionalities were confirmed to give comparable yields with or without catalysts, the use of tms - cl alone increased significantly the yields of per - silylated glucosamine and glycine, and dmap was especially effective in increasing the yields of 1h - imidazoles with free nh functionalities. a mixture of bstfa containing 10% of tmcs and 1.5 g / l of dmap performed best. higher concentrations of any of the reagents did not further increase yields, but rather promoted side reactions, such as dehydration of silylated urea to n, n-bis(trimethylsilyl) carbodiimide. ethyl acetate is considered to be a solvent that is well - suited for extracting compounds of different polarity from complex mixtures as its polarity index (pi 4.3) is almost exactly between those of water (pi 9.0) and the nonpolar alkanes (pi 0.1). the extracts obtained from the ammoxidation mixtures contained a large variety of products, which is shown in the chromatograms of the ethyl acetate extracts of ammoxidized (100 c, 0.2 mpa o2, 3 h) d - glucose and d - xylose (figure 2). the comparison of the gas chromatograms revealed many similarities in the product pattern of the etoac extracts of ammoxidized d - glucose and d - xylose, even though some of the constituents are present in significantly different amounts. derivatives of 1h - imidazole, pyrazine, and pyridine that carry short side - chains such as methyl, hydroxymethyl, hydroxyl, or 1,2-dihydroxyethyl groups constitute the major fraction of extractives, with 4-methyl-1h - imidazole (5) and pyrazine-2-methanol (7) being the dominating compounds. apart from n - heterocyclic compounds, a variety of rather hydrophilic compounds, such as glycol amide, urea and sugars, were also detected, albeit in smaller amounts. pyrrole, furan and oxazole derivatives, which are known to be formed in maillard - type reactions, were not detected. as such compounds are sensitive to oxidative polymerization reactions their incorporation into the polymeric melanoidin fraction under oxidative conditions is assumed. major differences in the peak pattern were found only for those constituents in which carbon skeleton and stereoconfiguration of the parent sugar molecule are partially preserved, such as the tetrahydroxybutyl- (24, 25) and trihydroxybutyl pyrazines (29), which each were only found in the glucose and xylose extracts, respectively, or the different dihydroxyethyl-5-methyl - pyrazine isomers (21). the amounts of major n - heterocyclic compounds present in the ethyl acetate extracts, which are the most critical constituents with respect to ecotoxicity differ considerably for mono- and polysaccharides (table 3). whereas the total amounts of n - heterocyclic compounds reached 5 mg / g for cellulose and 16 mg / g for xylan, they were considerably higher for the monosaccharides (100 mg / g of educt). ammoxidation temperature has a great impact on the amount of n - heterocyclic compounds formed. while for the studied polysaccharides the fraction of extractable nitrogenous products increased with temperature, there was a maximum of yield at 100 c reaction temperature for the monosaccharides (d - glucose : 158 mg / g of educt, d - xylose : 122 mg / g of educt). interestingly, the total amount of n - heterocyclic compounds decreased again for the monosaccharides when the temperature was increased from 100 to 140 c, and additional compounds were formed. furthermore, larger differences were found between the yields of individual n - heterocyclic compounds at higher temperature (100, 140 c). 4-methyl-1h - imidazole contributed the main share to the product spectrum from monosaccarides at all studied temperature levels. however, from the polysaccharides it was formed at high (140 c) temperature only. 1h - imidazole was formed in higher yields from xylose and xylan as compared to glucose and cellulose at all temperatures. the yields of 1h - imidazoles are highest at 100 c. below 100 c, pyrazine derivatives were generally formed in minute amounts only. at higher temperatures, comparatively large amounts of pyrazines are formed from glucose, whereas xylose afforded only about one - third of the amount of glucose, and polysaccharides produced them only in traces. besides the afore - discussed nitrogenous constituents of the ethyl acetate extracts, a fraction of more hydrophilic nitrogenous compounds were detected in the crude reaction mixtures. these are n - heterocyclic pyrazine- and 1h - imidazole derivatives carrying hydrophilic side chains, such as deoxyfructosazine and 4-(arabino - tetrahydroxybutyl)-1h - imidazole, aminosugars, such as glucose amine, fructose amine and di(glucopyranosyl)-amine. surprisingly, some hydroxyamides (glycol- and lactamide) and amino acids (glycine, alanine, serine and 2-amino malonic acid) were also found. for glucose ammoxidized at 100 c (0.2 mpa o2, 3 h), more than 60 water - soluble nitrogenous compounds were unambiguously confirmed to be present in the crude reaction mixture. 1h - imidazoles are well - known products of the reaction of sugars with ammonia. however, no mass spectra of trimethylsilylated substituted 1h - imidazoles could be found in the literature. 4(5)-methyl-, 4(5)-(hydroxymethyl)-, and 4(5)-(tetrahydroxybutyl)-1h - imidazole were therefore identified by comparison with authentic, trimethylsilylated samples. further 1h - imidazole derivatives known to be formed under these conditions were tentatively assigned by the fragmentation pattern of their trimethylsilyl derivatives (table 4). per - trimethylsilylated polyhydroxyalkyl-1h - midazoles can be easily identified by their abundant m ion along with the characteristic m / z 241 fragment ion which is formed by scission of the alkyl chain in beta position to the imidazole ring. values were calculated as ratio of the peak areas of the analytes relative to the internal standard phenylglucoside. n - silylated, 4-substituted 1h - imidazoles give rather broad peaks with the chosen weakly polar phase, which is useful to identify them within the chromatogram, but increases the detection limit. however, there is evidence from the mass spectra that the special peak shape is not only due to the particular retention behavior on the stationary phase but also due to the existence and virtual coelution of isomer pairs formed by n - trimethylsilylation of 4-substituted 1h - imidazole derivatives at either the n-1 or the n-3 position. table 4 shows 4-(arabino - tetrahydroxybutyl)-1h - imidazole to be by far the most abundant imidazole derivative formed from d - glucose at 70 c ammoxidation temperature, followed by 4-(hydroxymethyl)-1h - imidazole. at 100 c, the total yield of 1h - imidazole derivatives decreased to less than one - third, and the spectrum of products changed considerably. while the amount of tetrahydroxybutyl-1h - imidazole dropped to less than 10%, the content of other 1h - imidazole derivatives such as 4-methyl-1h - imidazole, 4-(2,3,4-trihydroxybutyl)-1h - imidazole, or 2-acetyl-4-(tetrahydroxybutyl)-1h - imidazole increased significantly. the obtained results provide strong evidence that the formation of 1h - imidazoles involves condensation of an -dicarbonyl compound, two molecules of ammonia and a highly reactive aldehyde such as formaldehyde or methyl glyoxal (pathway a, figure 5 ; radziszewski reaction). other mechanisms proposed such as condensation of -amino hemiaminals with carboxylic acids (pathway b), reaction of -dicarbonyl compounds with ammonia and an amide (pathway c) or condensation of a glycosyl amine and an amino sugar to a dihydroimidazole with two polyhydroxyalkyl side chains, followed by heat - induced scission of the side - chains (pathway d) are not likely either due to the alkaline ph which renders carboxylic acids less reactive, and/or the absence of 2-substituted 1h - imidazoles (r2 substituent in figure 5) in the product mixtures. main reaction pathways for the formation of 1h - imidazole derivatives from monosaccharides and ammonia (a, b, c, d). the tms derivatives of poly(hydroxyalkyl) pyrazines afford readily discernible m and characteristic fragment ions, most importantly those produced by cleavage of the c c bond in position to the pyrazine ring. by thoroughly screening the chromatograms for these ions, many combinations of polyhydroxyalkyl and 1-deoxy - polyhydroxyalkyl side chains in the position 2 and 5 (or 2 and 6) of the pyrazine ring were identified. two peaks with very similar mass spectra were found for all disubstituted pyrazines and assigned to the respective 2,5- and 2,6-disubstituted isomers. for fructosazine and 2-(tetrahydroxybutyl)-pyrazine, additional isomers were found which were assigned to diastereomers with a different configuration of the side chain. pyrazines are formed by condensation of two molecules of -amino carbonyl compounds, e.g. amino sugars, initially to a dihydropyrazine and subsequent aromatization to pyrazines. this aromatization step proceeds either through oxidation (pathway a, figure 6), or elimination of a hydroxy group from the side - chain (pathway b, figure 6). main reaction pathways for the formation of pyrazine derivatives from two -aminocarbonyl compounds (pathway a), condensation of amino sugars with -dicarbonyl derivatives and ammonia (b), or formation of hydroxy - pyrazines by condensation of two -dicarbonyl compounds and ammonia (c). the greatest share of the obtained pyrazine derivatives contained a methyl or hydroxymethyl substituent (i.e., c1 substituent in figure 6), which, according to the above mechanisms, should originate from a c3 fragment. therefore, we conclude that the main route of glucose degradation comprises its conversion to fructose or 1-amino-1-deoxy - fructose, followed by retro - aldol scission into two c3 fragments. the minor importance of other scissions is reflected by the frequency of the occurrence of pyrazine substituent chain lengths which decreased in the order c1 >. formation of 2-(tetrahydroxybutyl)-pyrazine derivatives carrying a (poly)hydroxyalkyl substituent of different chain length (n = 04) at 5 or 6 position of the heterocyclic ring occurred already at 70 c ammoxidation temperature, however at a very slow rate (figure 7). the rate of formation was proportional to the amount of sugars and amino sugars present in the reaction mixture. prolonged reaction times, and in particular further elevation of the temperature (140 c), promoted follow - up reactions and hence decreased the concentrations of the 2,5(6)-bis(polyhydroxyalkyl) pyrazines. the formation of 3-methyl-2,5-bis(polyhydroxyalkyl) pyrazines as found previously could not be confirmed to occur during ammoxidation. besides 2,5- and 2,6- polyhydroxyalkyl pyrazines, pyrazin-2-ols were also found in the crude reaction products. for their formation see figure 6, pathway c. ammoxidation of d - glucose at 70 c, 100 c, and 140 c : kinetics of the formation of 2-(tetrahydroxybutyl)-pyrazine derivatives with different chain lengths of the substituents in 5(6)-position (isobar 0.2 mpa o2). legend : solid black squares, c0 ; solid black circles, c1 ; solid gray triangles, c2 ; open white circles, c3 ; open white squares, c4. to the best of our knowledge, this is the first time that this compound class is actually identified in reaction mixtures of sugars and ammonia, although their presence has been hypothesized. 2-hydroxypyrazine itself was identified by comparison with an authentic sample, while peak 78 (figure 1) was tentatively assigned to 2-hydroxy-5(6)-tetrahydroxybutyl pyrazine, based on the mass fragmentation pattern. ms data suggested the presence of other (polyhydroxyalkyl)pyrazinols, however, the respective peaks were too small or too overlapped for unambiguous assignments. they constitute only a very small fraction of the crude products, but their formation is highly undesirable due to their considerable ecotoxicity, as observed in the conducted oecd 201 screening tests. 3-hydroxypyridine is the most abundant pyridinol being present in the ammoxidation products of all studied mono- and polysaccharides, with its yield strongly increasing with reaction temperature (table 3). furfural is usually considered to be precursor of pyridinols. however, the observed formation of the latter under alkaline conditions and at low temperature (70 c) points toward a different pathway of formation. unicellular algae, such as the fresh - water alga pseudokirchneriella subcapitata (oecd 201 test) respond with growth inhibition to a large variety of nonspecific toxic substances and are thus widely used as reliable bioindicators for a first phytotoxicity (ecotoxicity) screening of water - soluble chemicals or environmental samples. besides the crude reaction mixtures and the ethyl acetate extracts, phytotoxicity screening was focused on a set of target substances that was compiled based on the analytical results of this study and literature data (figure 8). low - molecular, moderately lipophilic n - heterocyclic compounds were in the main focus of the study as many of them are known to exhibit considerable bioactivity. hence, two representative hydroxalkyl substituted derivatives were chosen as representatives for each of the two main classes of n - heterocyclic compounds formed by ammoxidation of carbohydrates, that is, 1h - imidazoles and pyrazines : that with the shortest possible side chain (1h - imidazol-4-yl - methanol (103) and 5-methylpyrazin-2-yl - methanol (100), respectively) and that with the longest one (4-(d - arabino - tetrahydroxybutyl)-1h - imidazole (102) and deoxy - fructosazine (103), respectively). the set was complemented by 1h - imidazole (104), 2-methyl-1h - imidazole (107), 4-methyl-1h - imidazole (108), pyrazine (112), 2,5-dimethylpyrazine (101), pyridine (111), and its derivatives 3-pyridinol (109), 6-methyl-3-pyridinol (108), and -picoline (110). glucosamine (105) as one of the very first reaction products of glucose with ammonia was also included, as it is known to have phytotoxic effects on corn and barley. sugars, ammonia salts of carboxylic acids (e.g., aldonic acids, deoxy - aldonic acids), and amino acids on the other hand were not considered in this study, as many of them are widespread in nature and usually are not considered to be phytotoxic. the oecd tests revealed that none of the tested pyrazine derivatives had a relevant growth - inhibiting effect toward the unicellular microalgae pseudokirchneriella subcapitata as all ec50 values were beyond 1 the toxicity of 1h - imidazoles was confirmed to be much higher as for the pyrazines with 4-(hydroxymethyl)-1h - imidazole (ec50 18 mg / l, table 5), 2-methyl-1h - imidazole (ec50 28 mg / l), and 4-methyl-1h - imidazole (ec50 66 mg / l) being about 1 order of magnitude more toxic than nonsubstituted 1h - imidazole (ec50 500 mg / l). among the pyridine derivatives, the nonsubstituted n - heteroaromatic compound showed the highest algae growth - inhibiting response (ec50 0.9 mg / l) followed by 3-hydroxy-6-methyl - pyridine (ec50 1.2 mg / l) and 3-hydroxypyridine (ec50 44 target substances for the conducted ecotoxicity tests according to oecd 201. 2,5-dimethylpyrazine, 4-tetrahydroxybutyl-1h - imidazole, 2-hydroxymethyl-5-methylpyrazine, glucosamine hydrochloride, deoxy - fructosazine, pyrazine, and -picoline were found to have ec values higher than 1 g / l and were therefore considered not to be relevant from the ecotoxicological point of view. the gentle slope of the 4-(hydroxymethyl)-1h - imidazole inhibition curve may be a hint for several modes of action for this compound (figure 9). response relationships for different n - heterocyclic compounds as obtained from freshwater algae test according to oecd 201. all phytotoxicologically active compounds share a medium lipophilicity and basic functionalities with medium basicity of pkb = 6.59.0. in principle, this enables them to cross biological membranes easily, and to accumulate in more acidic cell compartments, such as chloroplasts. the less basic (pyrazine) and the more hydrophilic (4-tetrahydroxybutyl-1h - imidazole) do not show any toxic response. the ethyl acetate extracts of reaction mixtures obtained from ammoxidation of glucose and xylose at 100 and 140 c, respectively, were shown to have ec50 values similar to that of their main nitrogenous constituent, 4-methyl-1h - imidazole (table 5). the shallow slope of the sigmoidal dose / response curve, which is especially pronounced for the xylose sample, is likely caused by the multitude of different components of the extract (figure 10). the extract of the glucose ammoxidation at 140 c is significantly less active than the 100 c extract, which coincides with the lower percentage of the more toxic imidazoles and higher percentage of less toxic pyrazines formed at higher reaction temperatures. for all ammoxidation batches conducted with the polysaccharides as starting materials, and for all crude products obtained from the monosaccharide at 70 c reaction temperature, the amount of organically extractable compounds was too low for meaningful phytotoxicity screening. response relationships (oecd 201 test) for selected ethyl acetate extracts of the crude reaction products obtained after ammoxidation of d - glucose and d - xylose. in contrast to the organic phases, the crude ammoxidation mixtures were demonstrated to exhibit low phytotoxicity, which approximately corresponds to their content of 4-methyl-1h - imidazole. the crude reaction mixtures of both cellulose and xylan, as well as those of glucose and xylose subjected to ammoxidation at 70 c did not show any inhibition. the phytotoxicity tests of the ammoxidized samples and their extracts demonstrated that acute phytotoxicity must only be expected from lignocellulosic materials with a high monosaccharide content ammoxidized at temperatures > 70 c. by appropriately choosing reaction temperature and/or a pretreatment procedure capable of largely reducing the monosaccharide content, lignocellulosic biomass can be converted into nitrogen - rich (soil improving) materials without formation of phytotoxic substances. | ammoxidation of technical lignins under mild conditions is a suitable approach to artificial humic substances. however, carbohydrates as common minor constituents of technical lignins have been demonstrated to be a potential source of n - heterocyclic ecotoxic compounds. ethyl acetate extracts of ammoxidation mixtures of the monosaccharides glucose and xylose exhibited considerable growth inhibiting activity in the oecd 201 test, with 4-methyl-1h - imidazole, 4-(hydroxymethyl)-1h - imidazole, and 3-hydroxypyridine being the most active compounds. the amount of n - heterocyclic compounds formed at moderate ammoxidation conditions (70 c, 0.2 mpa o2, 3 h) was significantly lower for the polysaccharides cellulose and xylan (1630 g / g of educt) compared to glucose (15.4 mg). ammoxidation at higher temperature is not recommendable for carbohydrate - rich materials as much higher amounts of n - heterocyclic compounds were formed from both monosaccharides (100 c : 122.4160.5 mg / g of educt) and polysaccharides (140 c : 5.5216.03 mg / g of educt). |
apoptosis, or programmed cell death, is orchestrated by a family of proteases known as caspases that cleave their substrates after specific aspartic acid residues. caspases, including initiator caspases and effector caspases, are synthesized as catalytically inactive precursor proteins that become activated in response to specific death stimuli. the activation of initiator caspases such as caspase-8, -10, and -9 usually requires the assembly of the multicomponent complex disc or apoptosome. the processes have been described as two major pathways : extrinsic and intrinsic pathway. in the extrinsic pathway, apoptosis is mediated primarily by tumor necrosis factor (tnf) 1 family death receptors (drs) such as cd95 or trail receptors. upon activation of the dr, the adaptor molecule fadd / mort-1 is recruited to the receptors through its c - terminal death domain motif while it binds through its n - terminal ded to the two ded repeats in the n - terminal of caspase-8, forming disc [35 ], and the resultant disc will trigger the activation of procaspase-8. the functional caspase-8 protease is then released into the cytosol, where it cleaves a number of cellular substrates such as effector caspases (caspase-3, -6, -7) initiating a caspase cascade and the subsequent apoptotic events. the active caspase-8 also mediates the proteolytic cleavage of bid into tbid, which is translocated to mitochondria and amplifies the intrinsic apoptosis pathway. therefore, caspase-8 plays a vital role in the propagation of enzymatic cascade that results in cell apoptosis [69 ]. to date, eight different isoforms, including mcha1 - 3, mchb14, and mch5 (also designated as caspase-8/a h) have been described at the mrna level. in this study, we found a new caspase-8 isoform in acute leukemia (al) and normal bmmncs (bone marrow mononuclear cells), which encodes the first ded and part of the second ded, missing the c - terminal catalysis domain. functional analysis indicated that the new isoform could bind to fadd and promote the apoptosis stimulated by fas - agonistic antibody ch11 when stable transfected in jurkat cells. in the caspase-8-induced apoptosis pathway, but there is a controversy about the functions of the two deds of caspase-8 in the interaction between caspase-8 and fadd. the novel caspase-8s isoform we obtained only carries the first ded and a small part of the second ded, but it still can interact with fadd, indicating that the first but not the second ded represents a crucial element in interaction between caspase-8 and fadd, and that the second ded is not a necessary domain for caspase-8 to bind to fadd. bone marrow samples were obtained from patients with al enrolled in the institute of hematology and blood disease hospital, chinese academy of medical sciences. as control, bone marrow samples were obtained from healthy donors for hematopoietic stem cell transplantation as well. bmmncs were prepared by density gradient centrifugation over ficoll solution (invitrogen, usa) following the instructions of the manufacturer. human embryonic kidney 293 t cells were cultured in dulbecco modified eagle medium (life technologies, usa). human t - cell leukemia jurkat cells were cultured in 1640 medium supplemented with 10% fetal calf serum at 37c in a humidified environment of 5% co2. anti - fas (human, activating), clone ch11 (upstate, ca), was used as apoptosis inducer. total rna was extracted from 1 10 cells using trizol (invitrogen, usa) according to manufacturer 's protocol. cdna was synthesized from 2 g rna with moloney murine leukemia virus reverse transcriptase (mmlv, promega, usa) following the procedure provided by the manufacturer. pcr was performed to investigate the expression of caspase-8 mrna with the primers : sense primer 5-aatgttggaggaaagcaatc-3 and antisense primer 5-catagtcgttgattatcttcagc-3. pcr was carried out using taq polymerase (takara, japan) and conducted as follows : 95c 5 minutes, 35 cycles of 95c 30 seconds, 55c 30 seconds, 72c 45 sec, and 72c 8 minutes. primers spanning the whole cds of caspase-8 transcript are : sense primer 5-cgggatccgccatggacttcagcagaaatc-3 and antisense primer 5-tcccccgggcaccatcaatcagaaggg-3. pcr was conducted as follows : 95c 5 minutes, 35 cycles of 95c 30 seconds, 55c 1 minute, 72c 1 minute, and 72c 8 minutes. the whole cds region of fadd (genbank accession no.nm_003824) was amplified with the sense primer 5-gaattcgacccgttcctggtgct-3 and antisense primer 5-ctcgagagtgctgggctaccttcc-3 under the following conditions : 95c 5 minutes, 35 cycles of 95c 45 seconds, 55c 45 seconds, 72c 50 seconds, and 72c 8 minutes. the pcr products of the cds of caspase-8, caspase-8s and fadd were cloned into the pmd18-t vector (takara, japan) and sequenced by abi prism 377 - 96 genetic analyzer (applied biosystems, usa). the resulting plasmids were named pmd18-t - casp-8, pmd18-t - casp-8s and pmd18-t - fadd, respectively. cell pellets were lysed in lysis buffer (50 mm kcl, 2 mm mgcl2, 1 mm edta, 5 mm dtt, 25 mm tris (ph 7.5), 1 g / ml leupeptin, 10 g / ml aprotinin, and 1 mm phenylmethylsulfonyl fluoride) on ice for 30 minutes and centrifuged for 5 min at 20,000 g at 4c. protein concentration of the supernatant was determined using bca protein assay reagents (pierce, usa). the equal amounts of protein (50 g) were separated by 10% sodium dodecylsulfate - polyacrylamide gel electrophoresis (sds - page), electroblotted on nitrocellulose membranes, and immunostained with rabbit antiprocaspase-8 (c7849, sigma) followed by horseradish peroxidase - conjugated antirabbit secondary antibodies (jackson immunoresearch laboratoriesm inc, usa). finally, the proteins were detected using enhanced chemiluminescence (pierce, usa) according to the manufacturer 's instructions. the pmd18-t - casp-8 and pmd18-t - casp-8s were digested with restriction enzymes bamh i and ecor i ; the products containing only the two deds of caspase-8 and caspase-8s were then cloned into the pcdna 3.1 to construct the expression vectors pcdna3.1-casp-8 - 2ded and pcdna3.1-casp-8s-2ded. the pmd18-t - fadd was digested with ecor i and xho i to construct pcdna3.0-fadd. 293 t cells were transiently transfected using calcium phosphate precipitation method and harvested after 48 hours, and then the cells were lysed and cleared by centrifugation. rabbit anti - fadd (h-181 sc-5559, santa cruz) was added to the supernatant, and the cell lysate / antibody mixture was incubated overnight at 4c on a rotator, then protein a or g agarose bead was added to the immunocomplex and incubated for another 1 h on a rotator, the immunoprecipitate was collected by centrifugation for 5 minutes at 20,000 g at 4c, the supernatant was discarded, and the beads were washed for 4 times with ice - cold pbs and resuspended in sds - page sample buffer and mixed gently and boiled for 5 minutes. then western blot was performed with antiprocaspase-8 as described above. the sequences of the primers were devised as follows : forward 5'ccggaattccggatggacttcagcagaaatc3 ', and reverse 5'cgcggatccgcgatcttcagcaggctcttg3 '. the 414 bp pcr product was inserted into pcdh1-mcs1-ef1-copgfp (sbi, usa), which was an hiv - based lentivector expression vector. a positive recombinant was identified by utilizing ecor i / bamh i double digestion and direct sequencing. this construct and the other three packing plasmid mixture ppackh1-gag, ppackh1-rev and, pvsv - g were transfected into 2.5 10 293 t cells in six - well plate using calcium phosphate precipitation method. viral supernatant was harvested after 48 hours and added to the 2 10 jurkat cells at different dosages in 24-well plates. at 6 hours after infection, the culture medium was changed and followed by incubation at 37c for 48 hours. as a control, a parallel vector without an insert was also performed. both fluorescent microscopy and flow cytometric analysis of gfp were used to monitor lentivector infection of jurkat cells. individual clones with gfp expression were isolated by limited dilution, and stable cell lines containing pcdh1 empty vector and pcdh1-caspase-8s were established. empty vector or caspase-8s transfected jurkat cells and wild - type jurkat cells were untreated or treated with monoclonal antihuman fas antibody (clone ch11), and then the annexin v pe/7-aad apoptosis detection kit (pharmingen, san diego, ca) was used to determine the frequency of apoptosis in cells according to the manufacturer 's instructions. early apoptotic cells were defined as those cells with annexin v - pe/7-aad in the gfp expression positive cells. dna ladder formation was analyzed by conventional electrophoresis. approximately 2 10 cells were collected and washed twice with pbs. the pellet was incubated with lysis buffer (10 mm tris - hcl ph 8.0, 0.15 m nacl, 10 mm edta, 0.5% sodium lauroylsarcosinate (sds), 10 m proteinase k, 100 m rnase a) at 50c for 2 hours. after measuring the dna concentration, an equal amount of dna was examined on a 2% agarose gel stained with ethidium bromide (eb). briefly, 2 10 cells were plated in each well of 96-well microtiter plates with 100 l of fresh medium containing ch11 in various concentrations. after 24 h of further incubation, 20 l of mtt solution (2.5 mg / ml) was added to each well and the cells were further incubated for 4 h. the medium was then removed and the formed formazan crystals were dissolved in 150 l of dimethyl sulfoxide (sigma, usa). the plates were placed on a plate shaker for 10 min and the absorbance of the resulting solution was immediately measured at 546 nm using a microplate reader (slt - lab, salzburg, austria). inhibition ratio was calculated with the formula : inhibitory rate = (1 t / c) 100% where t is the absorbance rate of treatment group with ch11 and c is the absorbance rate of control group. 5 10 cells were washed in pbs and incubated at 37c for 30 min with 40 nm 3,3 dihexyloxacarbocyanine (dioc6, sigma aldrich) in combination with 5 mg / ml propidium iodide (pi, sigma). total rna was extracted from wild - type jurkat cells, empty vector, and caspase-8s - transfected jurkat cells ; then rt - pcr was performed with the sense primer 5-caagggattggaattgagga-3 and antisense primer 5-gacaaagccaccccaagtta-3 under the following conditions : 94c 5 min, 28 cycles of 94c 45 sec, 58c 50 sec, 72c 50 sec, and 72c 8 min. cell surface fas antigen, were quantified as follows : cells (5 10 cells / sample) were collected and washed with pbs and then were incubated with pe anti - human fas (cd95) monoclonal ab (dx-2, biolegend, san diego, ca) or pe - conjugated mouse igg1 (pharmingen) as a isotype negative control at room temperature for 30 min. after two washes with pbs, the cells were analyzed for surface fas expression by flow cytometry. it was reported that the caspase-8 gene contains at least 11 exons on human chromosome band 2q3334, a region where loss of heterogeneity (loh) has been found in a number of tumors. in a panel of human cancer and cell lines, recent studies showed that the hypermethylation of the caspase-8 gene promoter region and subsequent lack of caspase-8 expression is related to some tumor cells [1821 ]. all these researches suggested that abnormalities of caspase-8 gene may be correlated with tumors. in our study, reverse transcriptase - polymerase chain reaction (rt - pcr) was performed to investigate the expression of caspase-8 mrna in bmmncs derived from al patients. to our surprise, a shorter amplified product was visible in addition to the wild type product of caspase-8 (figure 1(a)). by sequencing, a 106 bp deletion was identified compared to the released caspase-8 database (genbank accession no.nm_033355). subsequently, the entire cds (coding sequence region) of this short caspase-8 transcript as well as the part of untranslated region (utr) was amplified and sequenced, and no other mutations were found in addition to the 106 bp deletion. the new caspase-8 transcript was also expressed in bmmncs from healthy individuals and was named as caspase-8s (caspase-8 short form, genbank accession no. rt - pcr detected transcripts representing caspase-8 as well as caspase-8s in most cell lines. rt - pcr also revealed that the ratio of caspase-8 to caspase-8s varied in different cell lines, but the expression level of caspase-8 mrna was higher than that of caspase-8s in all the cell lines (figure 1(b)). analyses of nucleotide and deduced amino acid sequences revealed that the 106 bp deletion resulted in a frameshift mutation carrying a stop codon and termination of the transcript in advance, with the predicted generation of a 108aa protein, as compared with the 479aa of caspase-8 (genbank accession no.aad24962). the complementary dna (cdna) and protein sequences of which were shown in figure 2. by western blot assays, we detected the caspase-8s protein product existed in some but not all leukemia samples. for caspase-8, eight different isoforms, including mcha13, mchb14, and mch5, have been described at the mrna level. mcha1, mcha2, and mch5 are the three procaspase-8 isoforms, all of which possess a long n - terminal prodomain harboring two highly homologous deds, ded1 (175aa) and ded2 (99176aa), followed by a c - terminal protease domain that can be divided into two subunits, p18 and p11. mrna of these three procaspase-8 isoforms are expressed in a wide variety of tissues, with the highest expression in peripheral blood leukocytes, spleen, thymus, and liver but barely detectable expression in brain, testis, and skeletal muscle. but only two of them, mcha1 and mcha2, were detected at the protein level of all cell lines tested. other isoforms, mcha3 that lacks ded, and mchb14 that lacks catalytic domain, are supposed to modulate the activity of caspase-8. caspase-8l is a recently reported novel isoform of caspase-8, which was generated by alternative splicing of intron 8, carrying a 136 bp insertion and frame shift of the transcript. functional assays indicated that caspase-8l acted as an inhibitor of caspase-8 by interfering with the binding of caspase-8 to fadd and was involved in the regulation of fas - mediated apoptosis. kisenge. also confirmed the existence of a caspase-8 variant in some neuroblastoma cell lines, which was impaired in the first ded and showed moderate sensitivity to fas - mediated cell death. in our study, the new caspase-8s isoform only carries the first ded (75 aa) and part of the second ded (7aa), which is not reported in the published literature. in the caspase-8-induced apoptosis pathway, the interaction between caspase-8 and fadd is necessary for the formation of the disc. to determine whether caspase-8s can bind to fadd through its incomplete deds and whether two intact tandemly repeated deds are necessary for interacting between caspase-8 and fadd, we performed in vivo binding and co - immunoprecipitation assays ; the results demonstrated the specific binding of fadd to caspase-8s as well as to caspase-8 (figure 4). the apoptotic signal from ligand - induced oligomerization of death receptors is mediated by a complex of proteins containing specialized interaction domains. this complex consists of the death domain (dd), the caspase recruitment domain (card), and the ded. the ded was first described in the fadd / mort1 protein and later shown to also occur in several other proteins [2529 ]. caspase-8 protein has two deds, which are essential for the binding between the caspase-8 prodomain and fadd by yeast two - hybrid experiments [4, 5 ]. previous studies using deletion and chimeric mutants of caspase-8 deds demonstrated that the two domains are necessary for caspase-8 to function normally, and when one domain was deleted, function of the resulting mutant protein decreased to about half that of normal caspase-8. liu. reported a novel caspase-8 mutant with a naturally occurring deletion of leucine 62 in the first ded, which failed to interact with fadd and lost proapoptotic activity. identified a procaspase - specific binding surface on the ded of fadd, suggesting a preferential interaction with one, but not both, of the deds of procaspase-8 in a perpendicular arrangement. all these showed that there is a controversy about the functions of the two deds. the novel caspase-8s isoform we obtained only carries the first ded and a small part of the second ded, but it still can interact with fadd, indicating that the first but not the second ded represents a crucial element in interaction between caspase-8 and fadd, and that the second ded is not a necessary domain for caspase-8 to bind to fadd. the ability of caspase-8s to integrate with fadd in vivo suggests that it might be involved in apoptosis pathway. to test this possibility, we stably transfected jurkat cells with a lentivector expression vector construct encoding caspase-8s. the jurkat cell line was chosen by two reasons : first, caspase-8s expression was detected to be lower than caspase-8 expression in this cell line ; second, the cell line was sensitive to apoptosis stimuli such as anti - fas antibody. individual clones with green fluorescent protein (gfp) expression were isolated by limited dilution and successful expression of caspase-8s constructs was confirmed by western blot analysis (figure 5). western blot revealed that wild type jurkat cells and pcdh - empty vector - jurkat cell clone jp4 did not express caspase-8s protein and that the pcdh - caspase-8s - jurkat cell clones js2 and js3 expressed caspase-8s protein, and that they all expressed endogenous caspase-8. to evaluate the effect of caspase-8s expression on fas - induced apoptosis, the annexin v pe/7-amino - actinomycin d (7-aad) apoptosis detection kit was used ; js2 and js3 cells displayed higher apoptosis rates when compared to wild type jurkat and jp4 cells treated with serial dilutions of ch11 (figure 6). dna fragment formation assay which is the characteristic for apoptosis also indicated dna degradation of js2 cells treated with ch11 comparing to wild type jurkat cell, and jp4 cells (figure 7). in addition, the methyl thiazoleterazolium (mtt) assays showed that the mean growth inhibitory rate of ch11 for js2 cells was higher than that of wild type jurkat cells and jp4 cells. there was no significant difference between wild type jurkat cells and jp4 cells (figure 8). these data suggested that caspase-8s itself might not exhibit proapoptotic activity ; however, overexpressed caspase-8s promoted cell apoptosis and dna fragmentation formation induced by death receptor agonists (anti - fas antibodies). in fact, some other ded - containing proteins are found to regulate apoptotic signal pathways. c - flip and pea-15 (phosphoprotein enriched in astrocytes 15-kda) inhibit apoptosis by blocking recruitment of the caspases into aggregates [25, 32 ]. the function of ded proteins in apoptosis has been extensively reviewed elsewhere. in our study, caspase-8s might be involved in the progression of apoptosis pathway, but the definite mechanism still needs to be confirmed. in fas signaling apoptosis, two pathways are involved, in which the activation of caspase-8 is different. in type i pathway, induction of apoptosis was accompanied by activation of large amounts of caspase-8 by disc, whereas in type ii pathway, disc formation was strongly reduced and activation of caspase-8 and caspase-3 occurred following the loss of mitochondrial transmembrane potential ; however, in type ii but not type i pathway, overexpression of bcl-2 or bcl - xl blocked caspase-8 and caspase-3 activation as well as apoptosis [34, 35 ].. showed that cardiolipin is required for apoptosis in the type ii mitochondria dependent response to fas stimulation. cardiolipin provides an anchor and activating platform for caspase-8 translocation to, and embedding in, the mitochondrial membrane, where it oligomerizes and is further activated ; whether caspase-8s binds to mitochondria and induces apoptosis. since jurkat cells are of type ii cells, to further explore the effect of caspase-8s expression on apoptosis pathway, dioc6/pi test was used to monitor the mitochondrial membrane potential. ng / ml) induced a decrease of dioc6 staining about 79% in caspase-8s - transfected jurkat cells js2, but the mitochondrial membrane potentials of empty vector - transfected jurkat cells jp4 and wild - type jurkat cells were not significantly influenced by ch11 (figure 9). this indicates that caspase-8s overexpression may induce apoptosis in mitochondria dependent way. in the study, to exclude the effect of lentiviral transduction of jurkat cells on the expression of fas antigen, rt - pcr and flow cytometry were performed to detect the expression of fas mrna and protein in empty vector or caspase-8s - transfected jurkat cells and wild - type jurkat cells. the results indicated that there was no statistically significant difference in fas expression between wild jurkat cells and lentiviral transfected jurkat cells (figures 10 and 11). had examined the effect of lentiviral transduction of microglial cells on the expression of cell surface markers by flow cytometry including fas antigen ; no difference of fas antigen expression was observed. in conclusion, a novel isoform of caspase-8, named caspase-8s, was identified in human leukemia patients and healthy individuals. the transcript encodes the first and part of the second stretches of ded but lacks the proteolytic domain. in addition, we also found that the first ded was an important structure mediating combination between caspase-8 and fadd. in al patients, imbalanced expression of caspase-8s is being studied in our laboratory. | caspase-8 is a key initiator of death receptor - induced apoptosis. here we report a novel short isoform of caspase-8 (caspase-8s), which encodes the first (death effector domain) ded and part of the second ded, missing the c - terminal caspase domain. in vivo binding assays showed that transfected caspase-8s bound to (fas - associated death domain protein) fadd, the adaptor protein in (death - induced signal complex) disc. to investigate the potential effects of caspase-8s on cell apoptosis, jurkat cells were stably transfected with caspase-8s. overexpression of caspase-8s increased sensitivity to the apoptotic stimuli, fas - agonistic antibody ch11. these results suggest that caspase-8s may act as a promoter of apoptosis through binding to fadd and is involved in the regulation of apoptosis. in addition, the results also indicate that the first ded was an important structure mediating combination between caspase-8 and fadd. |
this is the first study on the taeniid species infecting the portuguese population of iberian wolf. taeniid species detected are strongly related to the feeding habits of this top carnivore. a genuine wild cycle for e. intermedius might persist between wolves and wild boars in this region. the iberian wolf (canis lupus signatus, cabrera 1907) is an endangered carnivore subspecies that inhabits the northern iberian peninsula. in portugal, where a population of 200400 individuals is estimated, the habitats of this top predator overlap rural human communities, where wolves have access to domestic ungulates, their main preys (lvares., 2000 ;. on such occasions with a close contact between wolves, domestic animals and humans, transmission of pathogens, especially those whose life cycle is based on predator - prey interactions, might occur. taeniid species (cestoda : taeniidae) are a remarkable example of this one health perspective. several taeniid species have been described in animals and humans in portugal, including the zoonotic echinococcus granulosus sensu lato, which, although in a lesser degree than in the past, is still responsible for human morbidity as well as ungulate offal rejection, mainly in sheep (beato., 2010 ; david de morais, 2010). two e. granulosus genotypes have so far been described in portugal, namely e. granulosus sensu stricto (g1) in cattle and sheep, and e. intermedius in domestic pigs (formerly e. granulosus g7) (castro., 2005 ; thompson, 2008 ; beato., 2010). despite their medical and veterinary relevance, these parasites have been poorly investigated in the last decades, and information on wild definitive hosts, possible sources of infection for both humans and livestock, are lacking. the aim of this study was to evaluate for the first time the involvement of the portuguese population of iberian wolf as definitive host of taeniids. sixty - eight (n = 68) iberian wolf fecal samples were collected between october 2008 and january 2009 and stored at 4 c. in order to specifically collect wolf samples, transects were chosen at the areas most intensively used by wolves as established in the frame of the national wolf census performed in 2002/2003 (pimenta., 2005). identification of field samples was done under supervision of experienced field biologists, taking into account morphology, content, odor, as well as additional factors (e.g. absence of stray dogs, reports of wolf attacks to domestic animals). the majority of the samples (n = 57) were collected from an area north of the river douro, where the main portuguese wolf population occurs (fig. a second group of samples (n = 11) was collected from an area south of the river douro, inhabited by a smaller isolated subpopulation (pimenta., 2005) these two study areas are mainly mountainous, with some dispersed rural, aged human populations strongly dependent on agriculture and farming. taeniid eggs were isolated through a combined method of flotation in zinc chloride solution (density 1.45 g / ml) and sieving (mathis., 1996) and identified under an inverted microscope. to increase the sensitivity, two aliquots of 2 the material was not deep - frozen at 80 c before processing since the samples were also used for another study about toxocara, whose eggs are destroyed or deformed with this step (data not shown). however, all other safety procedures (eckert., 2001) were strictly followed. species identification of taeniid egg - positive samples was done by a multipex - pcr, according to trachsel. (2007), using a qiagen multiplex pcr kit (qiagen, hilden, germany). e. granulosus sensu lato amplicons were identified to species level through direct sequencing, after purification using the minelute pcr purification kit (qiagen, hilden, germany) according to the manufacturer s instructions. sequencing was performed by synergene biotech gmbh, biotech center zurich, switzerland (http://www.synergene-biotech.com) with the primers cest5seq and cest4 for taenia spp. and sequencing results were then compared with entries in the genbank nucleotide database, using blast search (http://www.blast.ncbi.nlm.nih.gov). since genotyping to determine individual wolves was not performed for these fecal samples, some of them may have originated from the same animal and, thus, the term occurrence rather than prevalence is used to describe the percentage of positives. to estimate the occurrence of taeniid eggs as well as its confidence interval (95%), the free software quantitative parasitology 3.0 the overall occurrence for taeniid eggs was 23.5%, which is in agreement with previous results based on coprology and necropsy of wolves in nearby regions (torres. the most important result of this study was the finding of e. intermedius for the first time in the iberian wolf and, as far as we know, also for the first time in wolves in europe. although the sequence obtained was short (75 bp), genbank analysis revealed 100% identity only with e. intermedius (e. granulosus g6/g7 genotypes), namely a g7 isolate from a pig in slovakia (genbank accession number : ay462128). e. intermedius is known to occur in domestic pigs in the northern part of the country (castro., 2005) and also in wild boars and goats in spain (mwambete., 2004). highest fertility rates are found in hydatid cysts from wild and domestic swine species (mwambete., 2004), which might be the crucial intermediate hosts for this genotype in the iberian peninsula. the positive sample for e. intermedius originated from the subpopulation south of the river douro (fig. 1area 2) where wild boars are more common and represent the second most frequently predated species by wolves (carreira and petrucci - fonseca, 2000). therefore, it can be concluded that probably a genuine wild animal cycle persists, independent of human activity. however, as wolves in this area are often necrophagous and feed on domestic animal carcasses from illegal dumping sites (pimenta., 2005) few wild animal cycles are described for e. granulosus sensu lato in europe, e.g. wolves and cervids in northern scandinavia (hirvel - koski., 2003) and nearby baltic countries (moks., 2006). other examples throughout the world include dingoes and wild macropodids (kangaroos and wallabies) (jenkins, 2006) in australia or wolves and cervids in north america (jenkins., 2011). with the exception of the wild animal cycle in australia, which was created by human introduction, these life cycles are believed to represent ancestral cycles. the results of this study are in agreement with the current knowledge about the epidemiology of echinococcosis in portugal (castro., 2005 ; due to extensive raising of sheep, lack of hygiene education and close contact between dogs, sheep and humans, there is a predominance of the e. granulosus sheep strain (g1) in southern portugal. in the north, where pigs are a more important resource for human communities, the e. granulosus, no genetic studies are available addressing the e. granulosus genotype infecting humans in portugal. the few analyzed isolates in spain all belonged to e. granulosus sensu stricto (g1) (mwambete., 2004) ; however, human cases with e. intermedius (g7) are common in other european countries (schneider., 2010). further studies in this area would be useful in clarifying the importance of e. intermedius as a zoonotic agent. it was found at four locations (gers, vez, amarela and leomilde) both in the northern and southern areas revealing a wide distribution through the wolf populations. this taenia species is often considered a core species in the helminth fauna of wolves in europe (craig and craig, 2005), whose main preys are ungulates, well - known intermediate hosts of this parasite. most likely, there is a synanthropic life cycle involving wolves and domestic animals in the north of portugal, but also a wild one between wolves and wild ungulates (cervids and wild boar) might exist. shepherd dogs area it probably also an important definitive host and a source of infection for the domestic ungulates. both taenia serialis and taenia pisiformis use as intermediate hosts lagomorphs and rodents, which are of minor importance in the wolves diet in this region (lvares. t. pisiformis was found only in the southern area while t. serialis in pites and amarela, two contiguous areas. likewise, taenia polyacantha, whose intermediate hosts are rodents, was for the first time recorded in iberian wolves, but with a low occurrence (only one positive sample from vez). in eastern europe, it is a known parasite of wolves (craig and craig, 2005) and although no information exists regarding its intermediate hosts in portugal, t. polyacantha had already been found in foxes in nearby regions (carvalho - varela and marcos, 1993). given their respective intermediate hosts, all these three taeniid species mainly circulate in a wild cycle. attention must be paid since high infection rates can be detected in important game resources. for instance, frequent findings of t. pisiformis cysticerci in hunted wild rabbits and hares (madeira de carvalho and valverde, unpublished) entails significant economic losses. a final remark should be made concerning the importance of the methodological approach used in this study. wildlife specimens, especially the ones from protected species, are frequently not available for necropsy examination which represents the gold standard for most intestinal parasites. therefore, identifying parasite infections through the isolation of their eggs in feces is a valuable tool. as taeniid eggs can not be differentiated by morphology, a sieving - flotation technique followed by multiplex - pcr and sequencing was applied for species or genotype identification (deplazes., 2003 ; trachsel., 2007). a study in lithuania detected significant differences between a modified mcmaster method and this sieving - flotation technique (bruinskait. the use of a highly sensitive method is important especially for echinococcus species which tend to produce lower egg loads given their lower biotic potential (gemmell., 2001). moreover, identification of taenia species and echinococcus strains from the isolated eggs allows to trace the sources of infection as well as to clarify the life cycle of the parasites, as it was done in this study. it can be concluded that the iberian wolf is a wild definitive host for e. intermedius in the iberian peninsula. nevertheless, it should be stressed that, according to the current knowledge, the most important definitive host for echinococcus spp. in this region further research on wild intermediate hosts and humans will be useful in clarifying the transmission patterns of these parasites in portugal, as well as the importance of their wild cycle. | graphical abstracthighlights this is the first study on the taeniid species infecting the portuguese population of iberian wolf. taeniid species detected are strongly related to the feeding habits of this top carnivore. first report of taenia polyacantha and echinococcus intermedius in the iberian wolf. a genuine wild cycle for e. intermedius might persist between wolves and wild boars in this region. |
arizona children, age 's 5 - 59-months with the goal of delineating patterns of caries in the primary dentition of pre - school children without a priori pattern definitions. cluster analyses were conducted using all data for children ages 04 years in aggregate : 1) for all subjects, and 2) for subjects without crowned restored teeth. each of these two sets of analyses consisted of 8 differently specified cluster analyses as a validation procedure. the caries patterns identified from the clustering analysis are : 1) smooth surfaces (other than the maxillary incisor), 2) maxillary incisor, 3) occlusal surfaces of first molars, and 4) pit and fissure surfaces of second molars.. these cross - validated patterns may represent resulting disease conditions from different risks or the timing of various risk factor exposures. as such, the patterns may be useful case definitions for caries risk factor investigations in children under 60 months of age. | aimcluster analysis was conducted on data from 5,169 united states (u.s.) arizona children, age 's 5 - 59-months with the goal of delineating patterns of caries in the primary dentition of pre - school children without a priori pattern definitions.methodologycluster analyses were conducted using all data for children ages 04 years in aggregate : 1) for all subjects, and 2) for subjects without crowned restored teeth. each of these two sets of analyses consisted of 8 differently specified cluster analyses as a validation procedure.resultsthe caries patterns identified from the clustering analysis are : 1) smooth surfaces (other than the maxillary incisor), 2) maxillary incisor, 3) occlusal surfaces of first molars, and 4) pit and fissure surfaces of second molars.conclusionthe cluster analysis findings were consistent with results produced by multidimensional scaling. these cross - validated patterns may represent resulting disease conditions from different risks or the timing of various risk factor exposures. as such, the patterns may be useful case definitions for caries risk factor investigations in children under 60 months of age. |
osteoarthritis (oa) is an important health concern and among the top 10 leading conditions in europe with respect to its socio - economic burden to society. the knee joint is the largest joint in the human body and is the most commonly affected site in oa. amongst other structural changes, oa is characterised by loss of cartilage thickness and mr imaging has previously been validated and shown to provide reliable measures of cartilage thickness [4, 5 ] and of cartilage loss in knee oa. further, this methodology has been previously used to determine the magnitude of in vivo cartilage deformation of the patella [79 ] and of the femorotibial joint by comparing cartilage thickness before and after loading. histochemical analyses have suggested that oa cartilage has a lower proteoglycan and collagen content [11, 12 ] and a reduced collagen fibril connectivity and fibril orientation than healthy cartilage [13, 14 ]. further, it was shown that oa cartilage suffers from greater permeability and elevated water concentrations, potentially leading to cartilage swelling [15, 16 ]. oa cartilage also displayed a diminished compressive modulus [17, 18 ] and greater deformation upon loading [16, 19 ] in ex vivo studies, suggesting that oa cartilage is less stiff and has a lower resistance upon loading, due to its altered macro - molecular composition. in vivo studies using dual - orthogonal fluoroscopy and mr imaging - based cartilage 3d modelling have not only evaluated the cartilage thickness distribution in joints, but also cartilage - to - cartilage contact areas and deformation magnitudes during gait in healthy knees [2024 ]. these studies reported greater deformation in the medial than in the lateral femorotibial compartment and that peak deformation occurred in central, weight - bearing areas, where no meniscal coverage was present. these findings have suggested that a regional difference exists in femorotibial load distribution in healthy knees with regions of high vs. low mechanical loading. no previous study, however, has compared the magnitude and the pattern of in vivo cartilage deformation between healthy and osteoarthritic knees using quantitative data from mr imaging. the aim of this investigation therefore was to use an mr imaging - compatible in vivo loading device to study the subregional pattern of cartilage deformation in knees with and without signs of radiographic oa i.e. osteophyte (op) growth and affection of the joint space width (jsw) [26, 27 ]. we tested the hypothesis that (1) the magnitude of deformation differs between osteoarthritic and healthy knees, suggesting differences in cartilage material properties and their response to mechanical loading, and that (2) the regional pattern of in vivo cartilage deformation coincides with the longitudinal pattern of cartilage loss observed in oa, suggesting that the patterns of rates of cartilage loss are mechanically driven. thirty female participants were recruited (age : 55.1 6.0 years, bmi : 28.0 2.4 kg / m ; table 1) by newspaper advertisements from the region of san francisco, ca. general exclusion criteria for this study were mr imaging contraindications, a history of knee disease (other than oa), knee surgery (including meniscus surgery), and intra - articular steroid injections during the last 6 months. inclusion criteria for the healthy cohort were : no evidence of radiographic oa (kellgren lawrence grading [klg ] 0 [no ops and no change in jsw ]) and no pain, stiffness or functional disabilities (when assessed by the womac [western ontario and mcmaster universities ] index for knee osteoarthritis) during the past year (table1). inclusion criteria into the oa cohort were : radiographic evidence of oa in the medial compartment in at least one knee (klg2 [definite ops, but unimpaired jsw ] or klg3 [definite ops and moderate diminution of jsw ] [26, 27 ]), and frequent (most days of a month during the past year) knee pain, aching, or stiffness. the limb axis was evaluated by measuring the knee angle from a fixed - flexion radiograph as previously described by kraus. and moreland. the klg and knee angle readings were performed by a musculoskeletal radiologist (t.l.). exclusion criteria were a medial joint space width (jsw) mt > the subregional pattern of deformation was also very similar between the healthy knee and knees with medial radiographic oa, with the central subregion of cmf displaying relatively the greatest changes during loading (fig. 4subregional magnitude in loss of cartilage thickness due to loading or due to annual progression observed in oa (data summarised from the meta - analysis of eckstein and co - workers). data are given as percentage change from the baseline value subregional magnitude in loss of cartilage thickness due to loading or due to annual progression observed in oa (data summarised from the meta - analysis of eckstein and co - workers). a trend towards greater deformation was observed in knees with medial radiographic oa versus healthy knees in the medial tibia (3.09% in oa versus 2.08% in healthy ; p = 0.47) and in the medial central, weight - bearing femur : (4.79% in oa versus 2.84% in healthy ; p = 0.17). in the lateral tibia, no difference was observed between the healthy and the osteoarthritic knees : (1.70% in oa versus 1.64% in healthy ; p = 1.00). in the lateral central, weight - bearing femur some deformation occurred in osteoarthritic knees (0.81%) but none in the healthy knees (+ 1.83% ; difference p = 0.10) (see table 2 and fig. 3) 3change in the percentage of cartilage thickness upon loading in the 4 femorotibial cartilage plates (mt, lt, cmf, clf) between healthy knees (n = 11) and knees affected by medial oa (n = 19). differences were not significant between all groups change in the percentage of cartilage thickness upon loading in the 4 femorotibial cartilage plates (mt, lt, cmf, clf) between healthy knees (n = 11) and knees affected by medial oa (n = 19). the relative pattern of deformation amongst the 4 femorotibial cartilage plates (cmf, mt, clf, lt) did not differ between the healthy and the oa knees. independent of radiographic disease status, the medial central, weight - bearing femur displayed the greatest deformation and the lateral central, weight - bearing femur displayed the smallest deformation upon loading (cmf > mt > the subregional pattern of deformation was also very similar between the healthy knee and knees with medial radiographic oa, with the central subregion of cmf displaying relatively the greatest changes during loading (fig. 4subregional magnitude in loss of cartilage thickness due to loading or due to annual progression observed in oa (data summarised from the meta - analysis of eckstein and co - workers). data are given as percentage change from the baseline value subregional magnitude in loss of cartilage thickness due to loading or due to annual progression observed in oa (data summarised from the meta - analysis of eckstein and co - workers). this study has investigated, for the first time, the magnitude and the subregional pattern of in vivo cartilage deformation in healthy knees versus knees with radiographic oa, using an mr imaging - compatible loading device. we found that static loading reduced cartilage thickness significantly in the medial tibia and femur and in the lateral tibia, and that knees affected by oa displayed a trend towards greater deformation compared with knees without radiographic oa. the subregional pattern of deformation, however, was very similar between healthy and osteoarthritic knees. previous studies tested cartilage deformation under loading ex vivo [11, 12, 16, 18, 19 ] without appropriately accounting for in vivo femorotibial loading conditions (networking of inner cartilage, cartilage - to - cartilage or cartilage - to - subchondral bone interactions). the strength of this investigation is the use of a novel mr imaging - compatible loading device for in vivo femorotibial loading. this setting permits the magnitude and pattern of cartilage deformation to be determined and the mechanical properties of cartilage to be (indirectly) evaluated at different stages of knee oa (klg0, 2, 3) under in vivo conditions, without the use of invasive methods. limitations of this study are the small sample size in each klg group, which limits the power by which differences in deformation (between healthy and oa knees) can be ascertained statistically and that only females were studied and therefore the results can not be automatically assumed to apply in men. previous studies, however, did not find significant differences in (patellar) cartilage deformation between men and women under loading [9, 37 ] and therefore we believe that these findings are likely to also hold for men. another limitation is that only relatively small static loads can be applied during imaging, as motion artefacts increase with higher loads because of the participants movements. nevertheless, the effects seen in this study are in principal agreement with ex vivo results on the material properties of oa cartilage (see below) but further investigations need to be performed in larger sample sizes and/or varied loading conditions. it must also be kept in mind that cartilage deformation during in vivo loading is determined not only by the mechanical properties of the cartilage but also by the load magnitude and distribution. however, the loads were applied as a proportion of the body weight in this study, and we found no differences in the subregional pattern of deformation between healthy and oa knees. previous studies reported that cartilage matrix synthesis and degradation are in a state of imbalance in oa [38, 39 ] and that cartilage composition is altered when, for instance, measured by t2 mapping [40, 41 ]. other studies reported greater deformation of osteoarthritic cartilage compared with healthy cartilage in ex vivo models [11, 12, 16, 18, 19 ]. changes in macro - molecular composition have been suggested to account for the altered load response of osteoarthritic cartilage. the trend towards greater deformation in oa versus healthy knees was only apparent in the medial (but not in the lateral) femorotibial compartment, which is interesting, as oa participants were selected based on the presence of medial femorotibial oa (medial osteophytes or joint space narrowing). we therefore speculate that only the compartment displaying radiographic oa may be affected by a decline in cartilage mechanical properties, but not the contra - lateral compartment. although the increased medial deformation may alternatively be explained by more varus malalignment (and hence greater medial versus lateral loading) in the oa participants, measurement of the knee angle revealed similar angles across healthy and oa knees, and more importantly the knee angle did not exhibit a correlation with the medial versus lateral femorotibial compartment deformation ratio across the 30 participants. the largest deformation was observed in the central aspect of the medial femorotibial compartment (medial tibia and weight - bearing femur) and this observation was consistent in both healthy and oa knees. once oa is present because of an individual predisposition, deformations occurring in these regions may lead to changes in cartilage composition, to altered cartilage mechanical properties and if persisting to loss in cartilage tissue. the subregional pattern of cartilage deformation observed here was very similar to that observed with regard to the subregional pattern of cartilage (thickness) loss in mr imaging - based longitudinal studies of knee oa [4346 ]. this agreement of spatial patterns suggests that the subregions encountering the greatest magnitude of deformation (in oa and healthy knees) are the same as those that also encounter the greatest rates of cartilage loss in knee oa, and that progression of cartilage loss in oa may thus be mechanically driven. changes in cartilage composition and mechanical properties are likely to be present before the onset of radiographic changes. potentially, the mechanical properties of the cartilage may be tested using in vivo loading by mr imaging for scientific and diagnostic purposes, in order to detect a potential decline in the mechanical properties of the cartilage in vivo, before the onset of radiographic knee oa. other methods such as t2 mapping, delayed gadolinium - enhanced mri of cartilage (dgemric) or t1 rho have been used to directly evaluate cartilage compositional measures (and their changes during early oa) [4749 ] and the technique proposed here provides the opportunity to evaluate the relationship between compositional changes (as determined by these parametric imaging techniques) and the functional properties (deformation, i.e. as determined in this study). the results of this study indicate that the cartilage in the medial femorotibial compartment (medial tibia and weight - bearing femur) of knees with medial radiographic oa displays a trend towards greater in vivo deformation than that observed in healthy knees. the subregional pattern of deformation, however, displayed great similarities in healthy and oa knees. the pattern of in vivo deformation closely matched that of cartilage loss observed in longitudinal studies of oa progression, indicating that cartilage loss in oa progression is at least partly driven by mechanical factors. | objectiveto explore and to compare the magnitude and spatial pattern of in vivo femorotibial cartilage deformation in healthy and in osteoarthritic (oa) knees.methodsone knee each in 30 women (age : 55 6 years ; bmi : 28 2.4 kg / m2 ; 11 healthy and 19 with radiographic femorotibial oa) was examined at 3tesla using a coronal fat - suppressed gradient echo spgr sequence. regional and subregional femorotibial cartilage thickness was determined under unloaded and loaded conditions, with 50% body weight being applied to the knee in 20 knee flexion during imaging.resultscartilage became significantly (p < 0.05) thinner during loading in the medial tibia (2.7%), the weight - bearing medial femur (4.1%) and in the lateral tibia (1.8%), but not in the lateral femur (+ 0.1%). the magnitude of deformation in the medial tibia and femur tended to be greater in osteoarthritic knees than in healthy knees. the subregional pattern of cartilage deformation was similar for the different stages of radiographic oa.conclusionosteoarthritic cartilage tended to display greater deformation upon loading than healthy cartilage, suggesting that knee oa affects the mechanical properties of cartilage. the pattern of in vivo deformation indicated that cartilage loss in oa progression is mechanically driven. |
human immunodeficiency virus (hiv) infection as one of the most significant pandemics in recorded history is a major health concern globally. worldwide, more than 33 million opportunistic infections are a leading cause of mortality and morbidity in patients living with acquired immunodeficiency syndrome (aids). disseminated mycobacterium avium complex (mac) infection is an opportunistic infection that was recognized as an end stage complication of aids 20 years ago. there has been increasing interest in disseminated mac and other nontuberculous mycobacterial infections as a result of the hiv epidemic. cytomegalovirus (cmv) is one of the most frequently disseminated opportunistic infections seen with aids. cmv is frequently diagnosed in hiv patients and an association of cmv and mac has been reported in cutaneous lesions of aids patients. however, concurrent lymph node involvement of cmv and mycobacteria has not been previously reported. we report here the discovery of three infections or coinfections at the same time in a young male patient who was hospitalized for abdominal pain. a 31-year - old homeless man with severe cachexia presented with abdominal pain for 2 hours prior to admission. during the preceding 3 years, he had several sexual contacts in addition to a history of iv drug addiction. he had a history of night sweats and a 12 kg weight loss in a period of three months. he was afebrile (temperature : 36.5c) and his pulse and respiratory rates were 88 and 26 per minute, respectively. an examination of the oral cavity, pharynx, larynx, salivary glands and skin was unremarkable. a neurological examination showed bilateral normal ankle - tendon reflexes, and sensory and motor exams were normal. sonography revealed several para - aortic lesions of varying size, which were consistent with lymphoma. laboratory data showed leukopenia [white blood cells : 1200/ml, lymphocytes : 26% ; polymorphonuclear leukocytes (pmn) : 68% ], normocytic anemia [hemoglubin (hb) : 115 g / l ], first hour erythrocyte sedimentation rate (esr) was 76 mm / h, c - reactive protein (crp) was 40 mg / l (normal, < 5 mg / l), lactate dehydrogenase (ldh) and alkaline phosphatase were not high (400 iu / l ; and 250 iu / l, respectively), and alanine amino - transferase (alt) and aspartate amino - transferase (ast) levels were in the normal range (45 and 40 iu / l, respectively). the patient continued to have abdominal pain and tenderness after admission, while no source of acute abdominal pain was identified. diagnostic laparotomy was performed for the multiple para - aortic lymph nodes and they were removed for histopathological examination. the cadaver was shifted to legal medicine organization of fars and an autopsy was performed 24 hours after death to determine the exact cause of death. multiple para - aortic lymphadenopathy was identified, and the diameter of the largest lymph node was 25 mm. the central nervous system, heart, gastrointestinal tract, kidneys, bladder and all other organs showed no significant changes. microscopic examination of the lungs showed a predominantly mononuclear inflammatory infiltrate in conjunction with edema and hyperplasia of the alveolar epithelium. the immunoperoxidase technique using monoclonal antibody (clone ddg9 + cch2, dako, denmark) confirmed the diagnosis of cmv infection. examination of the enlarged lymph nodes showed diffuse replacement of nodal architecture by foamy, large and plump macrophages. the cytoplasm of these macrophages contained large amounts of a diastase resistant periodic acid schiff (pas) positive material due to the presence of bacilliform bodies. cmv intra - nuclear inclusions were also detected in these lymph nodes (figure 3). no fungi or bacteria were identified with gram, pas, metenamin silver or warthin - starry stains. serological studies for hiv antibody on peripheral blood (preserved in the hospital blood bank) were positive for enzyme immunoassay, which confirmed a western blot assay. an examination of the oral cavity, pharynx, larynx, salivary glands and skin was unremarkable. a neurological examination showed bilateral normal ankle - tendon reflexes, and sensory and motor exams were normal. sonography revealed several para - aortic lesions of varying size, which were consistent with lymphoma. laboratory data showed leukopenia [white blood cells : 1200/ml, lymphocytes : 26% ; polymorphonuclear leukocytes (pmn) : 68% ], normocytic anemia [hemoglubin (hb) : 115 g / l ], first hour erythrocyte sedimentation rate (esr) was 76 mm / h, c - reactive protein (crp) was 40 mg / l (normal, < 5 mg / l), lactate dehydrogenase (ldh) and alkaline phosphatase were not high (400 iu / l ; and 250 iu / l, respectively), and alanine amino - transferase (alt) and aspartate amino - transferase (ast) levels were in the normal range (45 and 40 iu / l, respectively). the patient continued to have abdominal pain and tenderness after admission, while no source of acute abdominal pain was identified. diagnostic laparotomy was performed for the multiple para - aortic lymph nodes and they were removed for histopathological examination. the cadaver was shifted to legal medicine organization of fars and an autopsy was performed 24 hours after death to determine the exact cause of death. multiple para - aortic lymphadenopathy was identified, and the diameter of the largest lymph node was 25 mm. the central nervous system, heart, gastrointestinal tract, kidneys, bladder and all other organs showed no significant changes. microscopic examination of the lungs showed a predominantly mononuclear inflammatory infiltrate in conjunction with edema and hyperplasia of the alveolar epithelium. the immunoperoxidase technique using monoclonal antibody (clone ddg9 + cch2, dako, denmark) confirmed the diagnosis of cmv infection. examination of the enlarged lymph nodes showed diffuse replacement of nodal architecture by foamy, large and plump macrophages. the cytoplasm of these macrophages contained large amounts of a diastase resistant periodic acid schiff (pas) positive material due to the presence of bacilliform bodies. cmv intra - nuclear inclusions were also detected in these lymph nodes (figure 3). no fungi or bacteria were identified with gram, pas, metenamin silver or warthin - starry stains. serological studies for hiv antibody on peripheral blood (preserved in the hospital blood bank) were positive for enzyme immunoassay, which confirmed a western blot assay. we report here the discovery of 3 infections or coinfections at the same time in a young male patient who was hospitalized for abdominal pain. although ongoing medical progress has allowed a large number of patients with hiv infection to survive despite profound immunosuppression, multiple unusual pathogens in aids patients can be complex. recurrent and polymicrobial infections are frequently observed in hiv - infected patients, but coinfection is rarely reported. in a study on various opportunistic agents in hiv - positive persons, co - infection by cryptococcus neoformans together with mycobacterium aviumintracellulare edmonson. reported histopathological and clinical findings of bacillary angiomatosis involving the palpebral conjunctiva with concomitant infection by cmv and mycobacterium species in a patient with aids. reported an aids patient with a primary clinical presentation suggestive of bacillary angiomatosis. on clinical work - up, mac and cmv described bartonella quintana and mycobacterium tuberculosis coinfection in an hiv - infected patient with lymphadenitis. cmv and mac were isolated from hiv patients and an association of cmv and atypical mycobacteria was found in cutaneous lesions of aids patients, but concurrent lymph node involvement of cmv and mac has not been reported yet. to the best of our knowledge, this is the first report of simultaneous lymph node coinfection of cmv and mac in aids and an unusual presentation of this coinfection as acute abdomen. it is important to consider the possibility of complex infections in immunocompromised individuals and to search for multiple agents in biopsy specimens in such patients. the subsequent pathogenetic events and clinical manifestations of this infection can be divided into three phases : i) an acute retroviral syndrome, ii) a middle chronic phase and, iii) aids. acute retroviral syndrome develops in 40 - 60% of individuals who acquire a primary infection. this phase typically occurs 3 to 6 weeks after infection and clinically is associated with nonspecific symptoms resembling a flue like syndrome. during chronic phase few or no clinical manifestations of the hiv infection are present. after a variable period serious opportunistic infections, secondary neoplasms or clinical neurologic disease | acquired immunodeficiency syndrome patients are known to have an increased tendency for developing opportunistic infections. however, there are no reports of simultaneous lymph node involvement of cytomegalovirus and mycobacterium avium complex in a human immunodeficiency virus - positive patient. we report a 31-year - old man who presented with acute abdominal pain and tenderness and weight loss. he died a few hours after admission. autopsy studies showed coinfection of cytomegalovirus, mycobacterium avium complex and human immunodeficiency virus. our case emphasizes the need to be careful in evaluating opportunistic infections in severely immunodepressed acquired immunodeficiency syndrome patients. this case report is the first manifestation of acquired immunodeficiency syndrome in this patient. |
in the previous issue of critical care, wang and colleagues present interesting data from a large cohort of unselected medical intensive care unit (icu) patients which examined the prognostic utility of two well - established biomarkers : n - terminal pro - brain natriuretic peptide (nt - probnp) and c - reactive protein (crp). in fact, the authors ' observations nicely complement the picture that is emerging from several recent studies [1 - 14 ]. like most of the previous studies, their findings leave the majority of icu physicians in doubt about whether biomarkers are utile or futile. biomarkers complement other clinical information by proving quantitative data regarding a pathophysiological mechanism that can be used for the early diagnosis of a specific disease, to monitor and guide treatment, and to predict the risk of death or other adverse events. the stronger the link between the information provided by the biomarker and the immediate clinical course of action that we physicians take in response, the higher the clinical utility of the biomarker. in most patients finally being admitted to an icu, the diagnosis is made prior to icu admission, most commonly in the emergency department (ed). of course, we still face diagnostic uncertainty in many patients who develop new symptoms or signs during their stay in the icu (for example, respiratory deterioration or fever). to appropriately examine the diagnostic accuracy of a biomarker in these settings, we need to define a gold standard diagnosis against which the blinded biomarker results are then compared. unfortunately, owing to, for example, the low specificity of chest x - ray findings, the adjudication of a final diagnosis often is challenging for many common icu disorders, such as ventilator - associated pneumonia and hypoxemic respiratory failure. in addition, the extent to which experience and diagnostic cutoff levels can be transferred from studies performed in the ed to the critically ill patients in the icu is questionable [7,10 - 14 ]. major differences in patient characteristics, disease severity, comorbidity, resources available for the individual patient, and therapies applied between the icu and the ed require that the potential clinical use of biomarkers in the icu be defined by specific icu studies. what about the utility of biomarkers in monitoring treatment ? for example, urine output and serum creatinine are used to quantify renal function ; tidal volumes, oxygen saturation, and arterial partial pressure of oxygen [pao2 ] are used to tailor ventilator settings ; and body temperature, crp, and procalcitonin are used to assess the response to antibiotics. although the use of biomarkers in many of these indications is mainly empirical and only partly supported by large prospective studies, it is perceived by most clinicians as utile as the links between the biomarker information and therapeutic consequences are strong. the link to a specific consequence is weakest for prognostic biomarkers applied in patients with a wide variety of diseases, such as in unselected icu patients. the added value of most, if not all, previously examined biomarkers on top of current icu mortality scores seems to be too low to justify clinical use [1 - 6 ]. the prognostic accuracy for icu or in - hospital death of most biomarkers is modest and inferior to that provided by, for example, the apache (acute physiology and chronic health evaluation) score [1 - 7 ]. this observation seems to be well explained by the wide range of disorders leading to icu admission and the fact that different organ systems may be the most severely damaged and therefore critical for survival. moreover, it is important to highlight that there is no perceived unmet clinical need to appropriately risk - stratify most patients in the icu. simple clinical variables, many of which are captured in the icu scores, provide immediate and reasonable risk prediction. as cardiovascular function is the key variable in many critically ill patients, bnp and nt - probnp - as quantitative markers of hemodynamic cardiac stress and heart failure summarizing the extent of systolic and diastolic left ventricular dysfunction, valvular dysfunction, and right ventricular dysfunction - have been shown to be predictors of death in several previous studies. we are still searching how to best apply this information in the clinical care of critically ill patients. however, prognostic biomarker studies, particularly with bnp and nt - probnp, have already contributed to a better understanding of many disorders in the icu. in fact, the observation that hemodynamic cardiac stress is present in multiple conditions provided important novel insights into pathophysiology and highlighted a dominant role of the cardiovascular system of many common disorders in the icu, including septic shock and weaning failure. bnp : brain natriuretic peptide ; crp : c - reactive protein ; ed : emergency department ; icu : intensive care unit ; nt - probnp : n - terminal pro - brain natriuretic peptide. cm was supported by research grants from the swiss national science foundation, the swiss heart foundation, abbott (abbott park, il, usa), biosite (san diego, ca, usa), brahms (hennigsdorf, germany), roche (basel, switzerland), siemens (munich, germany), nanosphere (northbrook, il, usa), and the university of basel. | biomarkers complement other clinical information by proving quantitative data regarding a pathophysiological mechanism that can be used for the early diagnosis of a specific disease, to monitor and guide treatment, and to predict the risk of death or other adverse events. the stronger the link between the information provided by the biomarker and the immediate clinical course of action that we physicians take in response, the higher the clinical utility of the biomarker. this link is weakest for prognostic biomarkers applied in patients with a wide variety of diseases, such as in unselected intensive care unit (icu) patients. although the added value on top of current icu mortality scores seems to be too low to justify clinical use, the observation that hemodynamic cardiac stress and inflammation are present in multiple conditions provides important insights into the pathophysiology of common disorders in the icu. |
inadequate understanding of the spatial epidemiology of infectious diseases limits our ability to assess risk, allocate resources, respond to and suppress epidemics and reduce global disease burden. spatial epidemiology is difficult because sampling rates are often low and sampling strategies in the field are rarely clearly defined. furthermore, the spatial autocorrelation induced by the disease transmission dynamics (that we are interested in) can be difficult to control for in statistical models that only consider case dates and locations. for rapidly evolving pathogens, genetic correlations among pathogens record imprints of the chains of transmission, and phylogeography offers tools to systematically use the information contained in genetic sequences to infer underlying spatial patterns of disease transmission. with steady declines in cost and the future promise of field - deployed sequencing technology, an open question is how best to apply current and future phylogeography tools to datasets that vary in size, sampling strategy and underlying molecular dynamics when one needs to balance statistical rigor, computational cost and interpretability. cladistic approaches correlate genetic distances with spatial distribution to identify evidence of spatial structure, but they do not offer an explicit model of transmission history and so are difficult to interpret in an epidemiological context. bayesian phylogenetic models, including discrete phylogeography in beast, and structured coalescent models, provide transmission history reconstructions, inferred transmission models and statistical rigor. however, with typical desktop computing power, they are computationally prohibitive for datasets with more than a few hundred sequences. transmission tree algorithms infer ancestry solely among observed cases and so require minimal inference of unobserved spatial data to reconstruct transmission history. however, transmission trees are most appropriate for densely - sampled data in which many ancestor - descendent pairs are present in the sample. to better understand when various phylogeographic analyses a likely to be useful and as a first attempt to identify an alternate path to compromise among complexity, rigor and interpretability, we introduce a heuristic algorithm to reconstruct partially - observed transmission networks (potn) that retain features of both transmission tree and phylogenetic models. using likelihood ratio tests based on sample dates, genetic distances and a pre - specified molecular clock, the method identifies pairs of sequences that are consistent with relationship by direct descent and excludes pairs that are consistent with relationship by an unobserved common ancestor. the set of all pairs consistent with direct descent forms a transmission history network containing only the connected components best supported by the data. to our knowledge, an algorithm of this type has not been described previously. in the methods section, next, we assess the accuracy of the potn algorithm on simulated data where true ancestry is known. then we demonstrate the potn algorithm on a relevant problem for which phylogeography has enormous potential to add to our understanding of the disease, the ebola virus outbreak in sierra leone, and compare with discrete phylogeography in beast and transmission tree reconstruction in seqtrack. we conclude with an analysis of the vaccine - derived polio outbreak in nigeria that demonstrates fundamental limitations of phylogeographic inference. to summarize our experiences, we propose a simple heuristic for when phylogeographic analysis is likely to be informative about the spatial epidemiology of infectious diseases. for a pair of cases with sample dates t1 and t2 (t2t1), we denote the time to the most recent common ancestor (tmrca) prior to t1 as t. in pairs for which the case at time t1 is a direct ancestor of the case at t2, the tmrca is t=0. the genetic distance between the pair is d12 (measured in nucleotides using any appropriate distance metric). we assume a poisson model for mutation with constant mutation rate (measured in nucleotides per unit time). the poisson likelihood for the tmrca of a pair is (1)l(t|t1,t2,d12,)=((t2t1 + 2t))d12(d12 + 1)exp((t2t1 + 2t)), where (d12 + 1) is the gamma function continuation of the factorial to allow for non - integer d12. to identify pairs for which the genetic distance and time between cases is consistent with relationship by direct descent and to reject pairs that are better explained by relationship through an unobserved common ancestor, we perform a likelihood ratio test to compare the hypotheses of t=0 (null) and t0 : (2)h12=l(t=0|t1,t2,d12,)l(t=t|t1,t2,d12,), where t is the maximum likelihood estimate of the tmrca. the p - value for each likelihood ratio is calculated from the distribution with one degree of freedom. we use the false discovery rate (fdr) paradigm with fdr=0.05 to set the significance threshold for rejecting the null hypothesis and thus exclude pairs from the network. see figure 1 for a graphical depiction of the potn. (a) example sampled pair with candidate parent case at time t1 and candidate child at time t2. the time to the most recent common ancestor (tmrca) is t1t, and so the cumulative time elapsed for genetic evolution between the cases is t2t1 + 2t, as in equation (1). (b) example phylogenetic tree describing the genetic relationships among six cases sampled at different times. for each pair of the blue cases, t0, while for each pair of the red cases and each pair consisting of one red and one blue case, t is greater than zero. (c) the potn corresponding to the phylogenetic tree in panel b. the potn algorithm identifies ancestral links between the blue cases where t0, while it leaves the red cases disconnected because there are no observed direct ancestors of the red cases. for the blue cases, the dashed link indicates a redundant grandparent - child link that is removed by the triangle pruning algorithm. (a) example sampled pair with candidate parent case at time t1 and candidate child at time t2. the time to the most recent common ancestor (tmrca) is t1t, and so the cumulative time elapsed for genetic evolution between the cases is t2t1 + 2t, as in equation (1). (b) example phylogenetic tree describing the genetic relationships among six cases sampled at different times. for each pair of the blue cases, t0, while for each pair of the red cases and each pair consisting of one red and one blue case, t is greater than zero. (c) the potn corresponding to the phylogenetic tree in panel b. the potn algorithm identifies ancestral links between the blue cases where t0, while it leaves the red cases disconnected because there are no observed direct ancestors of the red cases. for the blue cases, the dashed link indicates a redundant grandparent - child link that is removed by the triangle pruning algorithm. the network is partially - observed because cases with no direct ancestors in the sample have unobserved ancestry and are excluded from the network, and because we make no claim that the ancestors are immediate and there may be many unobserved generations along the ancestral lineages. it is thus common to identify redundant ancestry (grandparent - parent, parent - child, grandparent - child) because the pairwise algorithm is unable to detect when deeper relationships are better explained by an intermediate ancestor. to remove this redundancy, we prune the network to remove all significant links for which there is an intermediate observed ancestor (remove grandparent - child ; keep grandparent - parent and parent - child). multiple, conflicting ancestries are preserved by this pruning step if they are present. the researcher is also free to apply additional pruning steps to support specific analyses. for example, to emphasize geographic relationships in a densely sampled network, one can remove links for which both end nodes are in the same location, leaving only location - changing links. further pruning into a transmission tree is possible by keeping only the ancestral link to each case that has the shortest time duration. this will force a single ancestry when the data suggest multiple conflicting ancestries between observed cases, but it may be appropriate when the generation time is shorter than the typical time between sampled cases. the transmission history reconstruction by the potn is subject to sequence alignment and mutation rate uncertainty. to identify robust links, one can use the bootstrapping procedure developed for phylogenetic trees with a prior distribution for the mutation rate. the procedure is as follows : run the potn algorithm repeatedly on bootstrap - resampled alignments with mutation rates drawn from the prior. the percent of realizations in which a link appears defines the robustness of the link with respect to sequence and rate uncertainty. the ancestry identified by the potn is perhaps best thought of in terms of the coalescent model. in the haploid coalescent with effective population size ne, the likelihood of the pairwise effective population size is (3)l(ne|t,)=1neexptne for t0. the pairwise effective population size is a measure of the size of the breeding population responsible for the pair of cases. when ne0, the vanishing size of the breeding population indicates that the earlier case is a direct ancestor of the later case. the maximum likelihood estimate for ne is ne=t, and so direct ancestry, t0, corresponds to the limit of ne0. in other words, the links that the potn identifies with t0 are lines of direct descent for which there is minimal genetic diversity along their lineage, and observed cases that are disconnected from the potn indicate the existence of genetic diversity that is not observed in the sampled cases. note that our definition of the effective population size is related to the definition in beast v1.8.1 by the following relation : ne=/2, where corresponds to the beast variable. in the supplementary information, we discuss how the ability to identify direct ancestry changes with sampling rates through the variance of the effective population size. additional methodological details, asymptotic properties of the potn, code and data needed to reproduce our results are also available in the supplementary information. for a pair of cases with sample dates t1 and t2 (t2t1), we denote the time to the most recent common ancestor (tmrca) prior to t1 as t. in pairs for which the case at time t1 is a direct ancestor of the case at t2, the tmrca is t=0. the genetic distance between the pair is d12 (measured in nucleotides using any appropriate distance metric). we assume a poisson model for mutation with constant mutation rate (measured in nucleotides per unit time). the poisson likelihood for the tmrca of a pair is (1)l(t|t1,t2,d12,)=((t2t1 + 2t))d12(d12 + 1)exp((t2t1 + 2t)), where (d12 + 1) is the gamma function continuation of the factorial to allow for non - integer d12. to identify pairs for which the genetic distance and time between cases is consistent with relationship by direct descent and to reject pairs that are better explained by relationship through an unobserved common ancestor, we perform a likelihood ratio test to compare the hypotheses of t=0 (null) and t0 : (2)h12=l(t=0|t1,t2,d12,)l(t=t|t1,t2,d12,), where t is the maximum likelihood estimate of the tmrca. the p - value for each likelihood ratio is calculated from the distribution with one degree of freedom. we use the false discovery rate (fdr) paradigm with fdr=0.05 to set the significance threshold for rejecting the null hypothesis and thus exclude pairs from the network. see figure 1 for a graphical depiction of the potn. (a) example sampled pair with candidate parent case at time t1 and candidate child at time t2. the time to the most recent common ancestor (tmrca) is t1t, and so the cumulative time elapsed for genetic evolution between the cases is t2t1 + 2t, as in equation (1). (b) example phylogenetic tree describing the genetic relationships among six cases sampled at different times. for each pair of the blue cases, t0, while for each pair of the red cases and each pair consisting of one red and one blue case, t is greater than zero. (c) the potn corresponding to the phylogenetic tree in panel b. the potn algorithm identifies ancestral links between the blue cases where t0, while it leaves the red cases disconnected because there are no observed direct ancestors of the red cases. for the blue cases, the dashed link indicates a redundant grandparent - child link that is removed by the triangle pruning algorithm. (a) example sampled pair with candidate parent case at time t1 and candidate child at time t2. the time to the most recent common ancestor (tmrca) is t1t, and so the cumulative time elapsed for genetic evolution between the cases is t2t1 + 2t, as in equation (1). (b) example phylogenetic tree describing the genetic relationships among six cases sampled at different times. for each pair of the blue cases, t0, while for each pair of the red cases and each pair consisting of one red and one blue case, t is greater than zero. (c) the potn corresponding to the phylogenetic tree in panel b. the potn algorithm identifies ancestral links between the blue cases where t0, while it leaves the red cases disconnected because there are no observed direct ancestors of the red cases. for the blue cases, the dashed link indicates a redundant grandparent - child link that is removed by the triangle pruning algorithm. the network is partially - observed because cases with no direct ancestors in the sample have unobserved ancestry and are excluded from the network, and because we make no claim that the ancestors are immediate and there may be many unobserved generations along the ancestral lineages. it is thus common to identify redundant ancestry (grandparent - parent, parent - child, grandparent - child) because the pairwise algorithm is unable to detect when deeper relationships are better explained by an intermediate ancestor. to remove this redundancy, we prune the network to remove all significant links for which there is an intermediate observed ancestor (remove grandparent - child ; keep grandparent - parent and parent - child). multiple, conflicting ancestries are preserved by this pruning step if they are present. the researcher is also free to apply additional pruning steps to support specific analyses. for example, to emphasize geographic relationships in a densely sampled network, one can remove links for which both end nodes are in the same location, leaving only location - changing links. further pruning into a transmission tree is possible by keeping only the ancestral link to each case that has the shortest time duration. this will force a single ancestry when the data suggest multiple conflicting ancestries between observed cases, but it may be appropriate when the generation time is shorter than the typical time between sampled cases. the transmission history reconstruction by the potn is subject to sequence alignment and mutation rate uncertainty. to identify robust links, one can use the bootstrapping procedure developed for phylogenetic trees with a prior distribution for the mutation rate. the procedure is as follows : run the potn algorithm repeatedly on bootstrap - resampled alignments with mutation rates drawn from the prior. the percent of realizations in which a link appears defines the robustness of the link with respect to sequence and rate uncertainty. the ancestry identified by the potn is perhaps best thought of in terms of the coalescent model. in the haploid coalescent with effective population size ne, the likelihood of the pairwise effective population size is (3)l(ne|t,)=1neexptne for t0. the pairwise effective population size is a measure of the size of the breeding population responsible for the pair of cases. when ne0, the vanishing size of the breeding population indicates that the earlier case is a direct ancestor of the later case. the maximum likelihood estimate for ne is ne=t, and so direct ancestry, t0, corresponds to the limit of ne0. in other words, the links that the potn identifies with t0 are lines of direct descent for which there is minimal genetic diversity along their lineage, and observed cases that are disconnected from the potn indicate the existence of genetic diversity that is not observed in the sampled cases. note that our definition of the effective population size is related to the definition in beast v1.8.1 by the following relation : ne=/2, where corresponds to the beast variable. in the supplementary information, we discuss how the ability to identify direct ancestry changes with sampling rates through the variance of the effective population size. additional methodological details, asymptotic properties of the potn, code and data needed to reproduce our results are also available in the supplementary information. to demonstrate the performance of the algorithm on data where the true ancestral relationships are known, we tested the potn algorithm with grandparent - child triangle pruning against simulated outbreak data generated by haplogen from the r package adegenet v1.42. new infections are created from each previous one in proportion to the previous individual 's reproduction number. mutations accumulate between transmissions at a poisson rate. for our simulations, genomes were 10 000 bases long, each individual had a reproduction number randomly chosen between 2 and 4, the generation time was random with distribution 1 + pois(0.5) and the mutation rate was set at either 1e-4, 3e-4, or 10e-4 per unit time. on each haplogen sequence alignment, we ran the potn algorithm and pruned redundant grandparent - child links as described in the supplement. the r script to run we examined potn links that are exactly correct parent - child links and links that are valid reconstructions of deeper ancestor - child relationships but that miss intermediate parent nodes. for the highest mutation rate, =10e-4 per unit time, the expected number of mutations between generations is 15 and so we expect high accuracy. on average, we found that 66% of the exact true parent - child links are recovered by the potn and > 99% of links in the potn are valid ancestor - child links. thus, for high mutation rates, almost all links in the potn indicate true ancestry, although one - third of the most immediate ancestors are missed. for =3e-4 per unit time, when the expected number of mutations between generations is 4.5, we again find 66% of exact true parent - child links and 93% of all links are valid ancestor - child links. for =1e-4 per unit time (1.5 expected mutations per generation), we find 53% of exact true parent - child links and 70% of all links are valid ancestor - child links. as expected, performance falls off when lower mutation rates produce low genetic diversity such that multiple possible ancestors have the same haplotype. from the observation that only two - thirds of exact parent - child links can be recovered even with high mutation rate data, we observe that the potn is a biased, conservative estimator of transmission network. for data with sufficient genetic diversity, we can expect that most potn links are true, but that some true links will be missed. the bias occurs because the false - discovery rate procedure for selecting links can reject true links if the maximum likelihood estimate of the tmrca is sufficiently earlier than the date of the parent case ; this can occur when the observed genetic distance between true pairs is longer than the expected genetic distance given the time between samples in the pair. we examined the phylogeography in the early stages of the ebola virus outbreak in sierra leone. sequences are available for 78 of an estimated 136 cases prior to 19 june 2014. figure 2 shows summaries of the genetic and location data, and the transmission history reconstructions from the potn, seqtrack and the discrete phylogeographic continuous - time markov chain model in beast. figure 2.three methods for phylogeographic reconstruction of the initial phase of the 2014 ebola virus outbreak in sierra leone. (a) maximum clade credibility phylogenetic tree ; cases (tips) labeled by color according to location, as shown on the map in panel b ; inset : histogram of pairwise genetic distances. the earliest cases are in kissi teng, kailahun (red), and the majority of cases prior to 19 june 2014 were in jawie, kailahun (blue). (b) chiefdom colormap of sierra leone, location of cases analysed in panel a are depicted in corresponding colors on the map. (c) partially - observed transmission network : cases labeled by color according to location, gray lines indicate potn links between case pairs, thick gray lines indicate the parsimonious transmission tree representing a single consistent ancestry that results from pruning to keep only the ancestral link to each case with the shortest duration. (d) seqtrack minimum spanning tree : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) beast discrete phylogeography, maximum clade credibility tree, projected as a transmission network : cases labeled by color according to location with internal nodes colored by highest posterior probability location, gray lines indicate potn links between case pairs. three methods for phylogeographic reconstruction of the initial phase of the 2014 ebola virus outbreak in sierra leone. (a) maximum clade credibility phylogenetic tree ; cases (tips) labeled by color according to location, as shown on the map in panel b ; inset : histogram of pairwise genetic distances. the earliest cases are in kissi teng, kailahun (red), and the majority of cases prior to 19 june 2014 were in jawie, kailahun (blue). (b) chiefdom colormap of sierra leone, location of cases analysed in panel a are depicted in corresponding colors on the map. (c) partially - observed transmission network : cases labeled by color according to location, gray lines indicate potn links between case pairs, thick gray lines indicate the parsimonious transmission tree representing a single consistent ancestry that results from pruning to keep only the ancestral link to each case with the shortest duration. (d) seqtrack minimum spanning tree : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) beast discrete phylogeography, maximum clade credibility tree, projected as a transmission network : cases labeled by color according to location with internal nodes colored by highest posterior probability location, gray lines indicate potn links between case pairs. all three networks tell the same primary story : the outbreak first took hold in sierra leone in kissi teng, spread to jawie and was repeatedly exported from jawie. for example, there are at least two independent exportations from jawie to luawa and the two cases in nongowa, detected only 1 day apart, are due to two separate importations. the ability to disentangle independent chains of transmission on a local scale shows the promise of phylogeography applied to a densely - sampled outbreak with complex spatial dynamics., seqtrack and potn suggest that the case in kpeje bongre is on the transmission chain to malema while beast infers that it is a separate branch from transmission in jawie. the uncertainty arises because there are no cases on the backbone of the clade to anchor the inference (figure 2a). for the case in kissi tongi near the start of the outbreak, beast and seqtrack root the case to kissi teng. however, the potn leaves the kissi teng case disconnected from the network because the relatively deeper root in the phylogeny indicates that the genetic diversity that sourced the case in kissi tongi was not observed in the sample. much of the disagreement between the three methods we observe arises because we are not accounting for uncertainty. for example, the transmission history can not be fully resolved with low genetic diversity data in which samples taken at different times have the same haplotype. in the potn, this uncertainty is represented as multiple conflicting ancestries (figure 2c) where a child node has multiple plausible parents. any algorithm that reduces the network to a single consistent transmission tree hides this uncertainty. beast also naturally characterizes uncertainty through its ability to sample the posterior of phylogenetic tree topology space, but the difficulty of marginalizing over tree topology uncertainty makes visualization and interpretation challenging and so it is common to only visualize a single tree. easy visualization of uncertainty is a feature of the potn since multiple conflicting ancestries can be laid out simultaneously. in figure 3, we show the potn for the first few months of the 2009 h1n1 outbreak using case information from jombart. consistent with prior work, the outbreak started in mexico, went global first from the united states and then from all over the americas, europe and asia. an important feature of the network is that many transmission pathways are traversed multiple times. in this situation, models that try to find a minimally - connected network to explain the data are likely to be misleading. for example, potn has many short links that directly connect china with north america, contrary to earlier results using beast with bayesian stochastic search variable selection that explain the linkage between north america and china through indirect transmission via europe. in figure 4, we show the three largest connected components of the potn within the united states. the components display incomplete geographic segregation (american southwest, east of the mississippi) and unsurprisingly reveal a highly - connected usa. within each component, the multiple conflicting lines of ancestry indicate low genetic diversity (figure 4d) and an inability of the data to resolve the transmission history in finer detail. in figure 4c, there are clear signatures of exportation events. for example, the texas case on 22 may is closely related to new york city cases at the end of may and is not a descendent of the earlier texas case in april. figure 3.progression through time of the partially - observed transmission network for the 2009 h1n1 influenza outbreak. each panel shows the links between cases during the time interval indicated above ; color gradient from blue to green goes from early to late. as described previously, the outbreak started in mexico and went global first from the usa and then from europe. many exportation paths between locations are traversed multiple times over the 4 month period spanned by this dataset. the three largest connected components within the usa, rooted in : (a) california (purple), (b) texas (red, all panels) and (c) new york city (gray, all panels) and new york state (black), with non - root locations (blue, all panels). progression through time of the partially - observed transmission network for the 2009 h1n1 influenza outbreak. each panel shows the links between cases during the time interval indicated above ; color gradient from blue to green goes from early to late. as described previously, the outbreak started in mexico and went global first from the usa and then from europe. many exportation paths between locations are traversed multiple times over the 4 month period spanned by this dataset. the three largest connected components within the usa, rooted in : (a) california (purple), (b) texas (red, all panels) and (c) new york city (gray, all panels) and new york state (black), with non - root locations (blue, all panels). the connected components also show examples of issues that arise from non - representative sampling. the number of samples available grows rapidly in late april upon growing awareness of the burgeoning pandemic. while the attribution of new york city (and the eastern region of the usa and canada) as the driving force of the global epidemic is plausible because of its central role in the global transportation network, within the united states we can not rule out that the algorithm is attributing transmission to new york and not the surrounding states simply because there is more data for new york. the rate of available sequences nationwide drops at the end of april, and the lack of related cases over a 7 week interval provides essentially no information about transmission history. a benefit of the potn for data exploration is that this consequence of incomplete data is easy to see. we are interested in making use of viral sequence data to better understand the subnational transmission pattern of polio in nigeria. due to operational challenges, vaccine cost, supply constraints and complex sociopolitical dynamics, improved risk assessment and the efficient targeting of limited resources are critical if poliovirus is to be eradicated in the remaining reservoirs. here, we focus on the outbreak of type 2 vaccine - derived polio in nigeria, known as nigeria 20058. the outbreak 20058 was first detected in 2006, established itself as endemic by 2007, produced 358 poliomyelitis cases through to the end of 2011 and persists today. any direct ancestor was inferred for only 26% (93 of 358) cases, the majority of links are years in length and the geographic specificity is poor (many cases have ancestral links in multiple states at similar times). entire states are disconnected, indicating that no plausible ancestry was observed at any time. we consider this a graceful failure in that the analysis takes minutes to run and it is obvious that it is not likely to be informative. (a) maximum clade credibility tree with poliomyelitis cases (tips) colored by state, as shown on the map in panel b. (b) state colormap. (d) partially - observed transmission network (potn) : cases labeled by color according to location, gray lines indicate potn links between case pairs. the potn is not informative because links are long compared to the timescale over which the locations are changing in the data and the majority of nodes are disconnected. (f) beast discrete phylogeography, maximum clade credibility tree : gray lines indicate potn links between case pairs ; cases labeled by color according to location with internal nodes colored by highest posterior probability location (internal branches have been collapsed to span nodes with posterior location probability > 0.8). all branches in tree (red) ; collapsed links between nodes with posterior location probability > 0.8 (blue). shortest mean occupancy times estimated for the continuous - time markov chain model are from central states kano and katsina. (h) highlight of the clade that dominates after 2010, traced back to the only confident root in kano in 2007 ; internal nodes colored by posterior location probability (> 0.8 shown). beast produces a fully - connected network, but many of the links that extend after 2009 indicate years with no confident ancestral location reconstruction. the continuous - time markov chain model timescales are long compared to the branching and tip location changing timescales, which limits the ability to infer ancestral locations. (a) maximum clade credibility tree with poliomyelitis cases (tips) colored by state, as shown on the map in panel b. (b) state colormap. (d) partially - observed transmission network (potn) : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) link duration histogram. the potn is not informative because links are long compared to the timescale over which the locations are changing in the data and the majority of nodes are disconnected. (f) beast discrete phylogeography, maximum clade credibility tree : gray lines indicate potn links between case pairs ; cases labeled by color according to location with internal nodes colored by highest posterior probability location (internal branches have been collapsed to span nodes with posterior location probability > 0.8). all branches in tree (red) ; collapsed links between nodes with posterior location probability > 0.8 (blue). shortest mean occupancy times estimated for the continuous - time markov chain model are from central states kano and katsina. (h) highlight of the clade that dominates after 2010, traced back to the only confident root in kano in 2007 ; internal nodes colored by posterior location probability (> 0.8 shown). beast produces a fully - connected network, but many of the links that extend after 2009 indicate years with no confident ancestral location reconstruction. the continuous - time markov chain model timescales are long compared to the branching and tip location changing timescales, which limits the ability to infer ancestral locations. we also analyzed the outbreak using the discrete phylogeographic model with bayesian stochastic search variable selection implemented in beast. beast provides a fully - connected network by construction, but we can see that it suffers many of the same limitations as the potn. the transition rate inferences are supported on the multi - year intervals between clades (figure 5i). within periods of high incidence, when spatial epidemiology could have policy impact, the model predicts roughly equal probabilities for all allowed transitions. within periods of low incidence, where it would be useful to better understand the reservoirs that allow the disease to persist, the low sampling rate of roughly 1 per 2000 infections is too sparse to resolve the interlaced patterns of transmission at the inter - state level. the only strong conclusion one can draw is that the central northern states (kano, katsina and jigawa) are critical for sustaining and exporting polio, but that is unambiguous from the case count data alone. as discussed in the methods section, the precision by which the potn can identify ancestry can be quantified in terms of the pairwise effective population size. for both ebola virus and h1n1, the median pairwise effective population size, ne=t, for pairs in the potn is ne=0. the effective population size describing the entire outbreak for ebola virus grows from roughly 30 to 60 over the course of the data (beast exponential coalescent) and for h1n1, the epidemic - wide effective population size of order 10 (ne=/2 from). for both outbreaks, the potn connects over 80% of nodes into relationships between pairs with much less genetic diversity than between randomly chosen pairs. in contrast, for polio the median pairwise effective population size is ne=7.4 and the epidemic - wide population size is of order 10 (beast bayesian skyline). for polio, only 38% (155 of 358) of nodes are connected and the ancestry is less well resolved as measured by the pairwise ne relative to the total effective population size. thus, the ancestry in the potn is less precise and more incomplete for polio than for ebola virus and influenza. to demonstrate the performance of the algorithm on data where the true ancestral relationships are known, we tested the potn algorithm with grandparent - child triangle pruning against simulated outbreak data generated by haplogen from the r package adegenet v1.42. new infections are created from each previous one in proportion to the previous individual 's reproduction number. mutations accumulate between transmissions at a poisson rate. for our simulations, genomes were 10 000 bases long, each individual had a reproduction number randomly chosen between 2 and 4, the generation time was random with distribution 1 + pois(0.5) and the mutation rate was set at either 1e-4, 3e-4, or 10e-4 per unit time. on each haplogen sequence alignment, we ran the potn algorithm and pruned redundant grandparent - child links as described in the supplement. the r script to run we examined potn links that are exactly correct parent - child links and links that are valid reconstructions of deeper ancestor - child relationships but that miss intermediate parent nodes. for the highest mutation rate, =10e-4 per unit time, the expected number of mutations between generations is 15 and so we expect high accuracy. on average, we found that 66% of the exact true parent - child links are recovered by the potn and > 99% of links in the potn are valid ancestor - child links. thus, for high mutation rates, almost all links in the potn indicate true ancestry, although one - third of the most immediate ancestors are missed. for =3e-4 per unit time, when the expected number of mutations between generations is 4.5, we again find 66% of exact true parent - child links and 93% of all links are valid ancestor - child links. for =1e-4 per unit time (1.5 expected mutations per generation), we find 53% of exact true parent - child links and 70% of all links are valid ancestor - child links. as expected, performance falls off when lower mutation rates produce low genetic diversity such that multiple possible ancestors have the same haplotype. from the observation that only two - thirds of exact parent - child links can be recovered even with high mutation rate data, we observe that the potn is a biased, conservative estimator of transmission network. for data with sufficient genetic diversity, we can expect that most potn links are true, but that some true links will be missed. the bias occurs because the false - discovery rate procedure for selecting links can reject true links if the maximum likelihood estimate of the tmrca is sufficiently earlier than the date of the parent case ; this can occur when the observed genetic distance between true pairs is longer than the expected genetic distance given the time between samples in the pair. we examined the phylogeography in the early stages of the ebola virus outbreak in sierra leone. sequences are available for 78 of an estimated 136 cases prior to 19 june 2014. figure 2 shows summaries of the genetic and location data, and the transmission history reconstructions from the potn, seqtrack and the discrete phylogeographic continuous - time markov chain model in beast. figure 2.three methods for phylogeographic reconstruction of the initial phase of the 2014 ebola virus outbreak in sierra leone. (a) maximum clade credibility phylogenetic tree ; cases (tips) labeled by color according to location, as shown on the map in panel b ; inset : histogram of pairwise genetic distances. the earliest cases are in kissi teng, kailahun (red), and the majority of cases prior to 19 june 2014 were in jawie, kailahun (blue). (b) chiefdom colormap of sierra leone, location of cases analysed in panel a are depicted in corresponding colors on the map. (c) partially - observed transmission network : cases labeled by color according to location, gray lines indicate potn links between case pairs, thick gray lines indicate the parsimonious transmission tree representing a single consistent ancestry that results from pruning to keep only the ancestral link to each case with the shortest duration. (d) seqtrack minimum spanning tree : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) beast discrete phylogeography, maximum clade credibility tree, projected as a transmission network : cases labeled by color according to location with internal nodes colored by highest posterior probability location, gray lines indicate potn links between case pairs. three methods for phylogeographic reconstruction of the initial phase of the 2014 ebola virus outbreak in sierra leone. (a) maximum clade credibility phylogenetic tree ; cases (tips) labeled by color according to location, as shown on the map in panel b ; inset : histogram of pairwise genetic distances. the earliest cases are in kissi teng, kailahun (red), and the majority of cases prior to 19 june 2014 were in jawie, kailahun (blue). (b) chiefdom colormap of sierra leone, location of cases analysed in panel a are depicted in corresponding colors on the map. (c) partially - observed transmission network : cases labeled by color according to location, gray lines indicate potn links between case pairs, thick gray lines indicate the parsimonious transmission tree representing a single consistent ancestry that results from pruning to keep only the ancestral link to each case with the shortest duration. (d) seqtrack minimum spanning tree : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) beast discrete phylogeography, maximum clade credibility tree, projected as a transmission network : cases labeled by color according to location with internal nodes colored by highest posterior probability location, gray lines indicate potn links between case pairs. all three networks tell the same primary story : the outbreak first took hold in sierra leone in kissi teng, spread to jawie and was repeatedly exported from jawie. for example, there are at least two independent exportations from jawie to luawa and the two cases in nongowa, detected only 1 day apart, are due to two separate importations. the ability to disentangle independent chains of transmission on a local scale shows the promise of phylogeography applied to a densely - sampled outbreak with complex spatial dynamics. for example, seqtrack and potn suggest that the case in kpeje bongre is on the transmission chain to malema while beast infers that it is a separate branch from transmission in jawie. the uncertainty arises because there are no cases on the backbone of the clade to anchor the inference (figure 2a). for the case in kissi tongi near the start of the outbreak, beast and seqtrack root the case to kissi teng. however, the potn leaves the kissi teng case disconnected from the network because the relatively deeper root in the phylogeny indicates that the genetic diversity that sourced the case in kissi tongi was not observed in the sample. much of the disagreement between the three methods we observe arises because we are not accounting for uncertainty. for example, the transmission history can not be fully resolved with low genetic diversity data in which samples taken at different times have the same haplotype. in the potn, this uncertainty is represented as multiple conflicting ancestries (figure 2c) where a child node has multiple plausible parents. any algorithm that reduces the network to a single consistent transmission tree hides this uncertainty. beast also naturally characterizes uncertainty through its ability to sample the posterior of phylogenetic tree topology space, but the difficulty of marginalizing over tree topology uncertainty makes visualization and interpretation challenging and so it is common to only visualize a single tree. easy visualization of uncertainty is a feature of the potn since multiple conflicting ancestries can be laid out simultaneously. in figure 3, we show the potn for the first few months of the 2009 h1n1 outbreak using case information from jombart. consistent with prior work, the outbreak started in mexico, went global first from the united states and then from all over the americas, europe and asia. an important feature of the network is that many transmission pathways are traversed multiple times. in this situation, models that try to find a minimally - connected network to explain the data are likely to be misleading. for example, potn has many short links that directly connect china with north america, contrary to earlier results using beast with bayesian stochastic search variable selection that explain the linkage between north america and china through indirect transmission via europe. in figure 4, we show the three largest connected components of the potn within the united states. the components display incomplete geographic segregation (american southwest, east of the mississippi) and unsurprisingly reveal a highly - connected usa. within each component, the multiple conflicting lines of ancestry indicate low genetic diversity (figure 4d) and an inability of the data to resolve the transmission history in finer detail. in figure 4c, the texas case on 22 may is closely related to new york city cases at the end of may and is not a descendent of the earlier texas case in april. figure 3.progression through time of the partially - observed transmission network for the 2009 h1n1 influenza outbreak. each panel shows the links between cases during the time interval indicated above ; color gradient from blue to green goes from early to late. as described previously, the outbreak started in mexico and went global first from the usa and then from europe. many exportation paths between locations are traversed multiple times over the 4 month period spanned by this dataset. the three largest connected components within the usa, rooted in : (a) california (purple), (b) texas (red, all panels) and (c) new york city (gray, all panels) and new york state (black), with non - root locations (blue, all panels). progression through time of the partially - observed transmission network for the 2009 h1n1 influenza outbreak. each panel shows the links between cases during the time interval indicated above ; color gradient from blue to green goes from early to late. as described previously, the outbreak started in mexico and went global first from the usa and then from europe. many exportation paths between locations are traversed multiple times over the 4 month period spanned by this dataset. the three largest connected components within the usa, rooted in : (a) california (purple), (b) texas (red, all panels) and (c) new york city (gray, all panels) and new york state (black), with non - root locations (blue, all panels). the connected components also show examples of issues that arise from non - representative sampling. the number of samples available grows rapidly in late april upon growing awareness of the burgeoning pandemic. while the attribution of new york city (and the eastern region of the usa and canada) as the driving force of the global epidemic is plausible because of its central role in the global transportation network, within the united states we can not rule out that the algorithm is attributing transmission to new york and not the surrounding states simply because there is more data for new york. the rate of available sequences nationwide drops at the end of april, and the lack of related cases over a 7 week interval provides essentially no information about transmission history. a benefit of the potn for data exploration is that this consequence of incomplete data is easy to see. we are interested in making use of viral sequence data to better understand the subnational transmission pattern of polio in nigeria. due to operational challenges, vaccine cost, supply constraints and complex sociopolitical dynamics, improved risk assessment and the efficient targeting of limited resources are critical if poliovirus is to be eradicated in the remaining reservoirs. here, we focus on the outbreak of type 2 vaccine - derived polio in nigeria, known as nigeria 20058. the outbreak 20058 was first detected in 2006, established itself as endemic by 2007, produced 358 poliomyelitis cases through to the end of 2011 and persists today. any direct ancestor was inferred for only 26% (93 of 358) cases, the majority of links are years in length and the geographic specificity is poor (many cases have ancestral links in multiple states at similar times). entire states are disconnected, indicating that no plausible ancestry was observed at any time. we consider this a graceful failure in that the analysis takes minutes to run and it is obvious that it is not likely to be informative. (a) maximum clade credibility tree with poliomyelitis cases (tips) colored by state, as shown on the map in panel b. (b) state colormap. (d) partially - observed transmission network (potn) : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) the potn is not informative because links are long compared to the timescale over which the locations are changing in the data and the majority of nodes are disconnected. (f) beast discrete phylogeography, maximum clade credibility tree : gray lines indicate potn links between case pairs ; cases labeled by color according to location with internal nodes colored by highest posterior probability location (internal branches have been collapsed to span nodes with posterior location probability > 0.8). all branches in tree (red) ; collapsed links between nodes with posterior location probability > 0.8 (blue). shortest mean occupancy times estimated for the continuous - time markov chain model are from central states kano and katsina. (h) highlight of the clade that dominates after 2010, traced back to the only confident root in kano in 2007 ; internal nodes colored by posterior location probability (> 0.8 shown). beast produces a fully - connected network, but many of the links that extend after 2009 indicate years with no confident ancestral location reconstruction. the continuous - time markov chain model timescales are long compared to the branching and tip location changing timescales, which limits the ability to infer ancestral locations. (a) maximum clade credibility tree with poliomyelitis cases (tips) colored by state, as shown on the map in panel b. (b) state colormap. (d) partially - observed transmission network (potn) : cases labeled by color according to location, gray lines indicate potn links between case pairs. (e) the potn is not informative because links are long compared to the timescale over which the locations are changing in the data and the majority of nodes are disconnected. (f) beast discrete phylogeography, maximum clade credibility tree : gray lines indicate potn links between case pairs ; cases labeled by color according to location with internal nodes colored by highest posterior probability location (internal branches have been collapsed to span nodes with posterior location probability > 0.8). all branches in tree (red) ; collapsed links between nodes with posterior location probability > 0.8 (blue). shortest mean occupancy times estimated for the continuous - time markov chain model are from central states kano and katsina. (h) highlight of the clade that dominates after 2010, traced back to the only confident root in kano in 2007 ; internal nodes colored by posterior location probability (> 0.8 shown). beast produces a fully - connected network, but many of the links that extend after 2009 indicate years with no confident ancestral location reconstruction. the continuous - time markov chain model timescales are long compared to the branching and tip location changing timescales, which limits the ability to infer ancestral locations. we also analyzed the outbreak using the discrete phylogeographic model with bayesian stochastic search variable selection implemented in beast. beast provides a fully - connected network by construction, but we can see that it suffers many of the same limitations as the potn. the transition rate inferences are supported on the multi - year intervals between clades (figure 5i). within periods of high incidence, when spatial epidemiology could have policy impact, the model predicts roughly equal probabilities for all allowed transitions. within periods of low incidence, where it would be useful to better understand the reservoirs that allow the disease to persist,. the low sampling rate of roughly 1 per 2000 infections is too sparse to resolve the interlaced patterns of transmission at the inter - state level. the only strong conclusion one can draw is that the central northern states (kano, katsina and jigawa) are critical for sustaining and exporting polio, but that is unambiguous from the case count data alone. as discussed in the methods section, the precision by which the potn can identify ancestry can be quantified in terms of the pairwise effective population size. for both ebola virus and h1n1, the median pairwise effective population size, ne=t, for pairs in the potn is ne=0. the effective population size describing the entire outbreak for ebola virus grows from roughly 30 to 60 over the course of the data (beast exponential coalescent) and for h1n1, the epidemic - wide effective population size of order 10 (ne=/2 from). for both outbreaks, the potn connects over 80% of nodes into relationships between pairs with much less genetic diversity than between randomly chosen pairs. in contrast, for polio the median pairwise effective population size is ne=7.4 and the epidemic - wide population size is of order 10 (beast bayesian skyline). for polio, only 38% (155 of 358) of nodes are connected and the ancestry is less well resolved as measured by the pairwise ne relative to the total effective population size. thus, the ancestry in the potn is less precise and more incomplete for polio than for ebola virus and influenza. for ebola virus in sierra leone, our analysis is consistent with the observations from contact tracing in guinea : the epidemic consists of a highly - localized series of outbreaks characterized by within - chiefdom transmission, linked closely in time by traveling individuals, as evinced by the vertical links in the potn between cases in different locations with zero genetic distance and zero difference in time to onset. this one example centered in jawie also suggests that the rate of long - distance exportation from a focal outbreak cluster increases with the size of the cluster. we expect that the multi - national ebola virus outbreak is built from many local chains like this early one for which data is available. insofar as it is possible, additional sequencing of ebola cases needs to be completed and made publically available with corresponding case timing and location data, so that epidemiologists and public health officials can learn patterns of ebola virus transmission to help anticipate how to terminate this epidemic and to limit the extent of the next epidemic. for pandemic influenza however, we note that transmission history reconstruction is sensitive to unrepresentative sampling. for polio in northern nigeria, our epidemiological question about transmission between states on timescales of months was poorly matched to the data and no algorithm is likely to provide a meaningful transmission history on those scales. ping - back behavior in which transmission routes are traversed multiple times in both directions is a common occurrence in all three diseases studied here. this can be an important mechanism for sustaining endemic disease, and its ubiquity indicates the value of intervening along links that have already been traversed once early in an outbreak to suppress further disease transmission. ancestry reconstruction and phylogeography are most likely to be useful when genetic evolution is faster than the spatial process and when the typical time between sampled cases is short compared to the correlation time of the spatial process. figure 6 provides a graphical description of this intuition. for estimating the genetic and sampling timescales, we propose two simple heuristics. a researcher faced with a new dataset can expect the genetics to be able to resolve ancestry with little ambiguity on timescales longer than the mean time for a substitution to occur, t1. to estimate if the sampling rate is sufficient to resolve the spatial history, consider the disease dynamics along an ancestral lineage in the potn. during an exponential epidemic, new infections accumulate along a lineage like rr1expr1t1, where r is the effective reproductive number and is the generation time. thus, the typical time interval between cases on a lineage sampled at rate per infection is approximately tlog(1/)r1. for an endemic disease (r1), the typical time is inverse in the sampling rate, t/. when the sampling time is shorter than the spatial correlation time, such that typical ancestor - descendent pairs are in the same or similar locations, then properties of the spatial dynamics can be inferred. figure 6.phylogeographic inference is most informative when genetic evolution is faster and when the spatial observations are more densely sampled in time than the correlation time of the spatial process. observed case / inferred ancestor are depicted as solid / open circles ; circle size corresponds to the precision of genetic ancestor inference ; location is indicated by color ; unobserved spatial pathway is indicated by the gray line. the spatial process is densely sampled in time and the genetics provide precise estimation of ancestry. the genetics provide less precise estimates for ancestry and there is little information to infer spatial history. phylogeographic inference is most informative when genetic evolution is faster and when the spatial observations are more densely sampled in time than the correlation time of the spatial process. observed case / inferred ancestor are depicted as solid / open circles ; circle size corresponds to the precision of genetic ancestor inference ; location is indicated by color ; unobserved spatial pathway is indicated by the gray line. (a) cartoon of a well - resolved situation. the spatial process is densely sampled in time and the genetics provide precise estimation of ancestry. the genetics provide less precise estimates for ancestry and there is little information to infer spatial history. for ebola virus in sierra leone, the expected sampling timescale from the formula with sampling rate 78/136 and growth rate based on the sequenced cases of (10 days) is t6 days. for the 2009 h1n1 influenza pandemic, the genetic timescale using the neuraminidase gene only is roughly 50 days and the observed link duration in the potn is 1 week. for polio, for the available ebola virus and h1n1 sequences, sampling is dense enough to provide useful spatial information on the timescale of weeks and the uncertainty in the history reconstruction is dominated by the lack of genetic diversity. for polio, the low sampling rate and more closely linear transmission dynamics leave little information about spatial mixing on policy - relevant timescales. furthermore, in epicenters of outbreaks experiencing exponential growth, the time interval between phylogenetically - linked cases is only logarithmically - sensitive to the sampling rate and so phylogeographic analysis is likely to be somewhat insensitive to a sampling strategy that is not stable or well - defined. in contrast, for an endemic disease, the time interval between phylogenetically - linked cases is linear in the sampling rate and therefore low sampling rates and unmeasured changes to the sampling strategy can increase susceptibility to sampling bias. these examples demonstrate that the partially - observed transmission network has similar ability to generate plausible hypotheses for transmission history as the leading statistically rigorous approach implemented in beast and as the easily - interpreted heuristic transmission tree finding algorithm, seqtrack. the potn is fast to compute in comparison to more rigorous models, it facilitates visualizing uncertainty in transmission history reconstruction and it fails gracefully when the data are uninformative. the second use is for disease surveillance in a future where field - deployable sequencing technology leads to massive expansion of near - real - time sequencing capability. by virtue of being a pairwise algorithm, the potn can be easily extended to allow for the assimilation of new data into an existing network without having the reprocess all data. with data adequate to address the epidemiological questions of interest, multiple routes to phylogeography are likely to be informative and available methods support and complement each other. as sequencing continues to become more ubiquitous, phylogeography will become an increasingly valuable tool, but research into how to match field sampling strategies, analysis methods and epidemiological needs to obtain reliable and useful results requires continued attention. with data adequate to address the epidemiological questions of interest, multiple routes to phylogeography are likely to be informative and available methods support and complement each other. as sequencing continues to become more ubiquitous, phylogeography will become an increasingly valuable tool, but research into how to match field sampling strategies, analysis methods and epidemiological needs to obtain reliable and useful results requires continued attention. | backgroundphylogeography improves our understanding of spatial epidemiology. however, application to practical problems requires choices among computational tools to balance statistical rigor, computational complexity, sensitivity to sampling strategy and interpretability.methodswe introduce a fast, heuristic algorithm to reconstruct partially - observed transmission networks (potn) that combines features of phylogenetic and transmission tree approaches. we compare the transmission network generated by potn with existing algorithms (beast and seqtrack), and discuss the benefits and challenges of phylogeographic analysis on examples of epidemic and endemic diseases : ebola virus, h1n1 pandemic influenza and polio.resultsfor the 2014 sierra leone ebola virus outbreak and the 2009 h1n1 outbreak, all three methods provide similarly plausible transmission histories but differ in detail. for polio in northern nigeria, we discuss performance trade - offs between the potn and discrete phylogeography in beast and conclude that spatial history reconstruction is limited by under-sampling.conclusionspotn is complementary to available tools on densely - sampled data, fails gracefully on under - sampled data and is scalable to accommodate larger datasets. we provide further evidence for the utility of phylogeography for understanding transmission networks of rapidly evolving epidemics. we propose simple heuristic criteria to identify how sampling rates and disease dynamics interact to determine fundamental limitations of phylogeographic inference. |
specialized neuronal circuits integrate metabolic signals related to energy stores and needs and consequently adjust energy intake, utilization and expenditure. the melanocortin system is one of the most well described circuits which control body weight and food intake. the two main antagonistic components of this system are the anorexigenic pomc and orexigenic npy neurons located in the arcuate nucleus of the hypothalamus. it has been recently shown that density and input type on pomc and npy neurons vary in adult mice, depending on the metabolic state and the associated fluctuation of circulating hormones [46 ]. such synaptic plasticity modifies the activity of these neurons and thereby the responsiveness of the melanocortin system. it has been proposed that the synaptic plasticity of this system in response to acute changes in fuel availability was essential to the accurate control of food intake and the maintenance of body weight in adulthood [79 ]. moreover, altered synaptic plasticity of pomc and npy neurons was found in diet - induced obese rodents suggesting that inability to dynamically rewire feeding circuits could contribute to obesity. polysialic acid (psa) is a cell - surface glycan that modulates cell - to - cell interactions. polysialylation of cell adhesion proteins is involved in various synaptic plasticity - dependent processes in the central nervous system including learning, pain modulation and the control of neuroendocrine functions. we previously reported that polysialylation was also required for the adaptive synaptic plasticity of feeding circuits during acute positive energy balance. precisely, high - fat diet (hfd) given for three days caused a psa - dependent increase in the excitatory inputs connecting pomc neurons in mice. the polysialyltransferase pst-1, encoded by the st8sia4 gene was identified as the enzyme involved in the psa - dependent control of energy intake. however the biological mediators and the intracellular cascade of events leading to the dietary fat - induced psa - dependent synaptic plasticity in the hypothalamus have not been characterized yet. it is now clearly established that modifications in gene expression patterns are required to elicit structural and functional synaptic plasticity in response to experience and environmental cues [1820 ]. the molecular mechanisms supporting these changes in gene expression were explored in several synaptic plasticity - dependent processes such as learning, memory formation, addiction and stress [2123 ]. in these models, alterations in expression, localization or activity of transcription regulatory factors and in chromatin structure are instrumental in the signaling pathway leading to synapse remodeling. in particular, changes in the acetylation of histone tails and in the activity of histone acetyltransferases or histone deacetylases are associated with changes in plasticity - related gene expression in the brain areas supporting these synaptic plasticity - dependent processes, i.e. the hippocampus, the prefrontal cortex and the nucleus accumbens [2528 ]. here we explored the role of hypothalamic polysialylation in the long - term maintenance of body weight. we also deciphered the molecular sequence underlying the activation of polysialylation in the hypothalamus upon overfeeding. hypothalamic psa removal and st8sia4 silencing increased body weight gain on hfd, indicating that st8sia4 is essential to maintain energy homeostasis. we showed that dietary fat rapidly incited post - translational histone modifications on the st8sia4 gene in the mediobasal hypothalamus (mbh). the histone acetyltransferase mof was required for the hfd - induced acetylation of histone h4 on lysine 16 and the subsequent activation of st8sia4 gene transcription. moreover, mof silencing in the mbh of adult mice fed a hfd reduced hypothalamic psa levels, caused overfeeding and exacerbated diet - induced obesity. experiments were carried out on 8-week - old male c57bl/6jola mice (harlan laboratories). animal care and experimental procedures were performed with approval from the animal care and use committee of the university of burgundy. mice were housed in individual cages and maintained on a standard light / dark cycle. they were fed either a standard diet (a04 ; safe laboratories) or a high fat diet (hfd) (safe laboratories as previously described). mice were anesthetized with isoflurane (abbott) and placed in a stereotaxic apparatus (david kopf instruments) in flat skull position. after dermal disinfection with betadine solution, the skin and cranial muscles were incised and the skull was exposed. small holes were drilled and a double cannula with a cap (c235g-0.8/sp 4.6 mm ; plastic one) was inserted to target above the mediobasal hypothalamus (mbh) using the following coordinates : 1.4 mm posterior to the bregma, 0.4 mm lateral to the sagittal suture, and 4.6 mm below the skull surface (supplementary figure 1a). after cannulation, animals were kept under controlled temperature and rehydrated with intraperitoneal injections of physiological fluid. mice were then housed individually and were allowed 1 week for recovery before experiment. for injection mice were injected with either vehicle or endoneuraminidase n (endon, 0.28 units / side, 400 nl ; eurobio) at a rate of 100 nl / min, weekly during one month, with a 5.6 mm injector (c235i / sp 5.6 mm ; plastic one) inserted into the cannula targetting the mbh. mice were anesthetized with isoflurane (abbott) and placed in a stereotactic apparatus (david kopf instruments). mice received a bilateral injection of lentiviral transduction particles (400 nl per side, 23 10 tu / ml), using the following stereotactic coordinates : 1.4 mm posterior to the bregma, 0.4 mm lateral to the sagittal suture, and 5.6 mm below the skull surface (supplementary figure 1b). the lentiviral particles contained either a non - target control shrna (non - mammalian control ; sigma aldrich), or a shrna targeting mof (trcn0000039323 ; sigma aldrich) or st8sia4 (trcn0000093936). the viral suspension was delivered at a rate of 100 nl / min through a 34 g blunt needle mounted on a 10 l syringe (nanofil device from wpi) controlled by a micropump (ump2 from wpi). mice were also injected with analgesic (buprenorphine ; 0.1 mg / kg i.p. ; buprecare, animalcare) and ibuprofen (20 mg / kg ; advil) was added to the drinking water for 3 days. nuclear magnetic resonance was used to determine the body composition of the mice (qnmr system echomri-500 t, echo medical systems). explants were immediately cross - linked in 1.5% formaldehyde for 10 min at room temperature and quenched by adding glycine to a final concentration of 0.125 m. explants were then washed 3 times in ice - cold pbs. tissues were first homogenized in a cell lysis buffer containing 50 mm hepes ph 7.5, 140 mm nacl, 1 mm edta, 10% glycerol, 0.5% np-40 and 0.25% triton x-100, 1 complete protease inhibitors cocktail (roche). the pellets were finally resuspended in a nuclear lysis buffer (tris hcl 10 mm, nacl 140 mm, edta 1 mm, egta 0.5 mm, 0.1% sds, 0.1% na deoxycholate), 1 complete protease inhibitors cocktail (roche) and sonicated for 20 min in a bioruptor (diagenode ; settings : high ; 30 s on/30 s off). this chromatin - shearing protocol produces fragments ranging from 150 to 400 bp in length. for chip, antibodies (listed in table 1) were conjugated to magnetic dynabeads (invitrogen). chromatin was incubated with beads - bound antibodies overnight at 4 c in a buffer containing tris hcl 10 mm, nacl 140 mm, edta 1 mm, egta 0.5 mm, 0.1% sds, 0.5% na deoxycholate, 1% np-40 and 1 complete protease inhibitors cocktail (roche) and then washed 6 times in ripa buffer and once in tris elution buffer (tris 50 mm, edta 10 mm, sds 1%) was added and samples were incubated at 65 c, 1400 rpm, in a thermomixer for 30 min to remove beads. chromatin in the supernatant was then reverse cross - linked by incubating 10 h at 65 c. quantitative pcr analysis was performed using the fast sybr green master mix (applied biosystems). the following primers were used for pcr amplification : were as follow : 5-gccagtaacgcaaggcaaca-3 and 5-cgtagcagggaaacgataag-3 for st8sia4 and 5-tctggctcagctcagtctcc-3 and 5-gcttttcctgcccgaga-3 for st8sia2. quantitative pcr analysis was performed using inventoried taqman gene expression assays and the taqman fast universal pcr master mix (applied biosystems). taqman assay ids for the mrna analyzed were as follow : mm00458911_m1 for mof, mm01292231_m1 for st8sia4, mm00456815_m1 for ncam1, mm00456289_m1 for st8sia2, mm00450174_m1 for gne, mm02342429_g1 for ppia. for each reaction, 1 l of a 1:10 dilution of the rt product was used in a final volume of 10 l and each sample was assayed in triplicate. pcr amplification was run on a stepone plus realtime pcr system (applied biosystems) and the stepone gene expression software was used for gene expression analysis. tissue lysis was performed in ripa lysis buffer using the tissuelyser system (qiagen) and 5 mm stainless steel beads (qiagen). homogenates were then centrifuged 5 min at 5000 g and supernatants were collected for psa assay using an enzyme - linked immunosorbent assay kit (psa ncam elisa kit ; eurobio). total protein concentration was determined using the protein assay kit ll (bio - rad). data sets with two independent groups with similar variances were analyzed for statistical significance using an unpaired two - tailed student 's t test. data sets with more than two groups were analyzed using one - way analysis of variance (anova) followed by a dunnett 's post - hoc test. for statistical analyses in figure 6c and e, significant differences were indicated as follow : p < 0.05, p < 0.01, and p < 0.001. to assess the role of hypothalamic polysialylation in the long - term maintenance of body weight of mice on hfd, we generated psa - depleted mice. we used endoneuraminidase n (endon), a bacterial enzyme that specifically removes psa residues from cell adhesion molecules. endon remains active at least eight days after a single injection in the brain parenchyma. we chronically depleted psa in this area by bilateral intraparenchymal injections of endon once a week during one month in mice fed with hfd (figure 1a). we observed that the repeated injections of endon reduced by 8090% the psa level in the mbh (figure 1b). the repeated injections of endon did not modify body weight in mice fed a standard diet for one month (figure 1c e, and supplementary figure 2). however, the persistent loss of hypothalamic psa caused by endon dramatically increased the weight gain of mice on hfd, in comparison to vehicle - treated mice (figure 1c). as a result, body weight gain and fat mass measured after one month in mice on hfd were higher in endon - treated mice relative to vehicle - treated mice (figure 1d and e). pst-1 is the major polysialyltransferase in adult hypothalamus. to test whether hypothalamic pst-1 is involved in the long - term maintenance of body weight, we examined the metabolic consequences of st8sia4 knock - down in the hypothalamus of mice fed a hfd. we used lentiviral vectors - mediated rna interference for specifically knocking down st8sia4 expression in the hypothalamus of adult mice. control mice received lentiviral vectors carrying a shrna sequence directed against a non - mammalian target. three weeks after surgery, st8sia4 mrna level was reduced by 21% in st8sia4 knock - down (kd) animals (pst-1 kd) mice compared to control mice (figure 2a). the expression of st8sia2, ncam, and gne was not altered (figure 2a), indicating that the rnai - mediated knockdown of st8sia4 was specific and did not modify expression of other genes involved in the signaling pathway of psa. body weight gain and energy intake of control and pst-1 kd mice fed a standard diet for 2 months were similar (supplementary figure 3). to investigate whether a reduction of polysialylation in the hypothalamus increased the vulnerability to dio, pst-1 kd mice were fed a hfd for two months. in these mice, knock - down efficiency was determined by post - mortem analysis of psa level in mbh biopsies. only mice with more than 5% reduction of hypothalamic psa after screening, we detected a significant reduction of the psa level by 25.7% in the mbh of pst-1 kd mice, in comparison to control mice (figure 2b). a retrospective analysis showed that pst-1 kd mice gained progressively more weight during the 2-month hfd than control mice (figure 2c). body weight gain and adiposity of pst-1 kd mice on hfd were therefore significantly increased (figure 2d and e). we next investigated the regulation of st8sia4 expression in the hypothalamus of hfd - fed mice. we determined if hfd exposure triggered chromatin remodeling and transcriptional activation of the st8sia4 gene in the mbh. chromatin modifications were analyzed on the promoter of st8sia4 by chip with chromatin extracts obtained from the mbh of mice fed a hfd for 24 h72 h (figure 3 and supplementary figure 4). after 24 h on hfd, an increase in h3 and h4 acetylation and a decrease in h4 methylation were observed (figure 3a ; 2.25, 1.86 and 1.83 fold for h3k14ac, h4k16ac and h4k20me respectively). the levels of h4k16ac, h4k20me and h3k14ac returned to basal values after 72 h on hfd, indicating that these post - translational modifications were transient (supplementary figure 4b). hfd feeding for 48 h triggered a dissociation of histones h3 and h4 from the promoter of this gene (figure 3b ; 1.66 fold and 1.74 fold decrease respectively). the decrease in histone interaction with st8sia4 promoter preceded an increase in pol2-s5p level -the activated form of rna polymerase ii- indicating an activation of st8sia4 transcription (figure 3b). st8sia4 mrna levels were also significantly higher after 3 days on hfd (figure 3c). additional analysis revealed no post - translational histone modifications, no histone dissociation and no change in rna polymerase ii phosphorylation on the promoter of the st8sia2 gene, encoding the pst-2 polysialyltransferase (supplementary figure 4c and 4d). the chromatin remodeling events detected in the mbh after hfd introduction were thus specific to the st8sia4 polysialyltransferase gene. in order to identify the histone acetyltransferases (hat) that trigger the increase in histone acetylation and the subsequent activation of st8sia4 transcription in the mbh of hfd - fed mice, the recruitment of cbp, gcn5, mof and tip60 was analyzed by chip. these hats are representative members of the 3 different families of histone lysine acetyltransferases and are known to acetylate either h3k14 or h4k16 or both [3234 ]. their interaction with st8sia4 was analyzed in mbh chromatin extracts from mice fed a hfd for 6 h or 10 h (figure 4). after 6 h on hfd, a 2.20 fold increase in mof was detected on st8sia4 promoter. this increase was persistent after 10 h of hfd exposure. at this time point, gcn5 was also recruited. the early recruitment of mof suggested that this hat plays a critical role in mediating the effects of hfd on the activation of st8sia4 transcription in the mbh. to determine the role of mof in hfd - induced hypothalamic polysialylation, we knocked down mof in the hypothalamus and tested whether st8sia4 transcription and psa levels could still be increased upon hfd exposure. lentiviral particles containing a mof - targeting shrna sequence were stereotactically injected in the mbh of adult mice. after 3 weeks of recovery, a 26.73% decrease in mof mrna level was detected in the hypothalamus of silenced mice (mof kd mice) (figure 5a). since h4k16ac has been identified as the main substrate of mof in many cell types and organisms [32,3537 ], we tested whether mof knock - down altered the hfd - induced increase in h4k16ac level on st8sia4 in the mbh (figure 5b). after 24 h of hfd feeding, the level of h4k16ac on st8sia4 was reduced by 25.39% in mof kd mice in comparison to control mice. the level of h4k16ac in hfd - fed mof - kd mice was similar to the level in standard - diet fed mice (figure 3a), indicating that mof knock - down abolished the hfd - induced acetylation of h4k16. after 3 days on hfd, the level of pol2-s5p detected on st8sia4 was strongly reduced in mof - kd mice in comparison to the control group (38.33% reduction, figure 5c). again, pol2-s5p level in mof - kd mice was similar to the level in standard - diet fed mice (figure 3b). we finally assessed polysialylation capacities in mof - kd mice by measuring both st8sia4 mrna level and psa level in the mbh after exposure to hfd for 3 days (figure 5c and d). st8sia4 mrna level was reduced by 38.73% and psa level was reduced by 14.10% in mof - kd mice. altogether, these results indicated that mof is crucial for activating the polysialylation pathway in the mbh in response to hfd. we finally examined the consequences of mof knock - down on the psa - dependent short - term feeding response to hfd and the long - term regulation of body weight on hfd. the short - term feeding response to hfd was assessed over 8 days of hfd exposure. when fed a standard diet, control and mof kd mice displayed similar body weight and daily energy intake (figure 6a and b). in both control and mof kd mice, hfd caused a transient increase in energy intake (figure 6c). however the normalization of energy intake was slightly but significantly altered in mof kd mice. consequently, the cumulative energy intake of mof kd mice during the first week of hfd was higher in this group (figure 6d). hfd feeding revealed an alteration of the homeostatic control of food intake in mof kd mice. to assess the role of mof in the long - term regulation of energy homeostasis, control and mof kd mice food intake and body weight were recorded daily during this period. only mice with more than 5% reduction of hypothalamic mof mrna level as a reference, body weight of control and mof kd mice fed a standard diet was measured over 6 weeks after surgery. no significant differences were observed in body weight gain between control mice and mof kd mice (+ 2.49 0.28 g vs 2.96 0.52 g). however, upon hfd, a dramatic increase in body weight was observed in mof kd mice (figure 6e). the body weight gain of mof kd mice over the 8 weeks of hfd was 31.85% higher than the one of the control group (figure 6f). this increase in body weight gain was due to an increase in fat mass in mof kd mice (figure 6 g). the higher cumulative energy intake of mof kd mice in comparison to control mice over the 8-week period likely explained this phenotype (figure 6h, mof kd mice : 786.83 14.06 kcal and control mice : 708.41 21.79 obesity is on the rise in both developed and developing countries, and it is now considered as a worldwide epidemic. it has been proposed that obesity could be a brain disease, and recently, several molecular brain targets of therapeutic interest have been identified. investigation of central regulatory pathways involved in the control of appetite and body weight could probably help with the fight against obesity. we previously identified polysialylation as an essential process in the nutritionally regulated synaptic plasticity of the melanocortin system. we now show that polysialylation is essential to the long - term regulation of body weight. furthermore, the experimental data presented here unveil an unexpected role for the histone acetyltransferase mof in the brain control of energy balance. developmental malformation of the melanocortin system, i.e. disruption of neural projection pathways within the hypothalamus, could contribute to the obese phenotype and related metabolic disorders. moreover, the wiring of arcuate pomc neurons of rats kept on standard diet predicts vulnerability to weight gain on hfd, suggesting that accurate connectivity in this neuronal system is crucial to maintain energy homeostasis. besides, an abnormal synaptic organization of feeding circuits that can be acutely reversed by hormonal or pharmacological treatments has been found in obese mice and rats. thus, it has been suggested that the altered synaptic plasticity in feeding circuits, in addition to steady neuroanatomical defects, might promote dio. nevertheless, whether synaptic inadequacy is cause or consequence of the metabolic imbalance is still not clear. here, we report that the lack of hypothalamic psa strongly accelerated the onset of dio in mice. given the role of psa in synaptic plasticity, our results suggest that the inflexibility of feeding circuits is a risk factor for obesity. this is in line with the well - documented adaptive function of the plasticity in feeding circuits in response to metabolic fluctuations. the removal of hypothalamic psa was sufficient to cause severe overweight in mice fed a hfd for 12 months, suggesting that the inability to properly rewire feeding circuits depending on the nutritional conditions, makes mice prone to obesity. since the human hypothalamus is able to undergo hormone - dependent structural plasticity, our findings could be relevant to the etiology of obesity in humans as well. indeed, large - scale studies on the genetic determinants of body mass index have revealed the strong influence of some genes involved in neuronal plasticity. interestingly, the polymorphism in negr1, the gene coding the neuronal growth regulator 1, a cell adhesion molecule involved in the brain remodeling, seems to be causal in high body weight. moreover, genetic defects reducing the levels of plasticity - related molecules such as the brain - derived neurotrophic factor (bdnf) or its receptor trkb cause severe early - onset obesity. therefore, it is conceivable that an altered synaptic plasticity could predispose humans to obesity. to gain insight into the molecular sequence underlying the synaptic plasticity - dependent control of energy balance, we explored the chromatin remodeling events underlying the activation of the st8sia4 gene expression upon high fat diet (hfd). we found that the hfd induced a decrease in the level of monomethylated h4k20 and an increase in acetylation of histones h3k14 and h4k16 on the st8sia4 gene. in mammals, histones localized in silent heterochromatic regions are usually characterized by high levels of methylation at certain specific sites and low levels of acetylation. h4k20me1 marks are mostly found in regions of facultative heterochromatin and h4k20 demethylation has been associated with transcription activation in different models [5153 ]. both h3k14 and h4k16 acetylation impact chromatin structure and allow switching from a repressive state to a transcriptionally active state [5457 ]. in our study, the decrease in h4k20me1 and the increase in h3 and h4 acetylation upon hfd the level of rna polymerase ii phosphorylated on the serine 5 of the carboxy - terminal domain increased subsequently. moreover, the phosphorylation of the serine 5 of the rna polymerase ii is acquired during the transcription initiation phase. tracing back the signaling cascade leading to the activation of st8sia4 transcription, we identified two histone acetyltransferases, gcn5 and mof, recruited on st8sia4 within the few hours following the introduction of hfd. transcription activation relies on cross - regulation of histone post - translational modifications through the stepwise or concomitant recruitment of histone modifying enzymes. of note, h3k14 and h4k16 are major acetylation targets for gcn5 and mof, respectively. additionally, mof depletion in drosophila or human cells resulted in a genome - wide loss of h4k16ac. in our study however, phf8 is the only histone h4k20me1 demethylase identified up to now and its activity is associated with a positive regulation of gene expression. phf8 could thus contribute, in cooperation with gcn5 and mof to the activation of st8sia4 transcription in the hypothalamus upon high fat feeding. in our study, since mof recruitment was already detected after 6 h of hfd feeding, we focused on the function of this hat in the activation of st8sia4 expression upon hfd exposure. the depletion of mof in the mbh completely abolished the hfd - induced increase in h4k16 acetylation on st8sia4 and the subsequent recruitment of the rna polymerase ii on this gene. the early recruitment of mof on st8sia4 upon hfd exposure, the absence of activation of st8sia4 transcription and the decrease in psa level after mof knock - down strongly suggested a crucial role for mof in mediating the effect of hfd exposure on the establishment of psa - dependent synaptic plasticity in the hypothalamus. mof kd mice displayed an impairment of the short - term feeding response to hfd, which is actually a psa - dependent process. in addition, we show that mof kd mice displayed a higher propensity to develop dio. reducing polysialylation by st8sia4 silencing or psa removal from the hypothalamus accelerated the onset of a dio phenotype as well. afterwards, studies performed on mammalian cells and tumor biopsies indicated that mof is crucial to several cell functions such as cell proliferation and differentiation, dna damage repair, autophagy and tumorigenesis [6567 ]. in vivo, a purkinje cells - specific deletion of mof in the cerebellum produced neurological abnormalities including impaired motor coordination, ataxia and a backward - walking phenotype. the present work demonstrates that mediobasal hypothalamic mof is involved in the regulation of energy homeostasis through an activation of polysialylation. whereas some studies suggest that mof is globally involved in the activation of transcription, others indicate that this hat rather activates defined subset of genes and has a function in transcription regulation in specific cell types only. though we can not rule out that a larger mof - dependent transcriptomic program contributes to the accelerated onset of diet - induced obesity in mof - depleted mice, the subsequent deficit in hypothalamus polysialylation capacities of these mice might largely contribute to their increased vulnerability to dio. in few recent studies, mof has been detected in enhancer regions on mammalian genes. for instance, mof is recruited to foxp3-target genes by directly interacting with foxp3 and the transcription factor p53 is an acetylation target of mof. this suggests that mof could be recruited to the st8sia4 gene by interacting directly with a transcription factor activating st8sia4 transcription upon high fat feeding. otherwise, its recruitment could involve mediator complex which is known to convey regulatory information to the basal rna polymerase ii transcription machinery by interacting both with gene - specific transcription factors and with histone modifying enzymes. the mechanism by which mof is targeted to st8sia4 upon hfd feeding remains to be determined. in conclusion, the present work clearly indicated the causal role of altered psa signaling in accelerating the development of obesity. given the role of psa in the modulation of cell - to - cell interactions these findings strengthen the concept that individual capacity to synaptic plasticity is a key factor in the development of overweight with obesogenic foods. | overfeeding causes rapid synaptic remodeling in hypothalamus feeding circuits. polysialylation of cell surface molecules is a key step in this neuronal rewiring and allows normalization of food intake. here we examined the role of hypothalamic polysialylation in the long - term maintenance of body weight, and deciphered the molecular sequence underlying its nutritional regulation. we found that upon high fat diet (hfd), reduced hypothalamic polysialylation exacerbated the diet - induced obese phenotype in mice. upon hfd, the histone acetyltransferase mof was rapidly recruited on the st8sia4 polysialyltransferase - encoding gene. mof silencing in the mediobasal hypothalamus of adult mice prevented activation of the st8sia4 gene transcription, reduced polysialylation, altered the acute homeostatic feeding response to hfd and increased the body weight gain. these findings indicate that impaired hypothalamic polysialylation contribute to the development of obesity, and establish a role for mof in the brain control of energy balance. |
the options available for operative management of these fractures include internal fixation of the fracture alone, fixation of the fracture with revision of the prosthesis, and reconstruction of proximal femur with either modified impaction bone grafting or proximal femoral replacement. we present here a case of periprosthetic fracture vancouver type b1 with a broken cemented bipolar prosthesis insitu, in which the broken implant was firmly fixed in the proximal fragment and could not be removed following which the whole of the proximal fragment along with the broken implant was removed and replaced by a customized steel long stem cemented mega prosthesis. since the prosthesis was well fixed, its broken stem could not be removed from the proximal fragment and so the whole of the proximal fragment along with stem was removed and replaced with a long stem custom made bipolar prosthesis. periprosthetic femoral fracture is a devastating complication after total hip arthroplasty and is associated with a high rate of postoperative complications and often a poor clinical result. the rate of intra - operative fracture (with cemented or uncemented stems) has been reported as ranging from 1% and 3%-20% respectively. the exact prevalence of postoperative periprosthetic fracture is more difficult to determine but is estimated to be approximately 1% over the life of the prosthesis. conditions which result in distorted anatomy or diminished bone quality are responsible for intraoperative periprosthetic fracture such as osteopenia, rheumatoid arthritis, osteomalacia, paget 's disease, osteopetrosis, poliomyelitis and parkinsonism. on the other hand the various risk factors for post operative periprosthetic fractures are loosening of the femoral component, osteolysis due to wear debris and most importantly cortical stress risers. the underlying cause in almost all cases is a decrease in mechanical strength of the host bone either due to osteoporosis, stress shielding or osteolytic lesions. the common classification systems include those of johansson., parrish and jones, bethea., however, the vancouver classification currently seems to be the most widely used. preoperative radiograph of the patient - plain radiograph of the left hip and thigh region showing a vancouver type b1 periprosthetic fracture with a broken cemented bipolar prosthesis insitu. treatment recommendations have varied from non - operative to more complicated algorithms based upon the site of the fracture. the options available for operative management of these fractures include internal fixation of the fracture alone, fixation of the fracture with revision of the prosthesis, and reconstruction of proximal femur with either modified impaction bone grafting or proximal femoral replacement. we present here a case of periprosthetic fracture vancouver type b1 with a broken austin moore prosthesis insitu, in which the broken implant was firmly fixed in the proximal fragment and could not be removed following which the whole of the proximal fragment along with the broken implant was removed and replaced by a customized steel long stem cemented mega prosthesis. a 60 years old male presented in june 2010, to our department with complaints of severe pain and swelling in left hip and upper thigh region since last 2 days, following a history of trauma. he was unable to walk and bear weight on the left lower limb following the trauma. pain was present on the anterior and lateral aspect of left hip and upper thigh region. it was constant in nature, was present even at rest, dull aching type, severe in intensity and aggravated by hip movements. it was accompanied with difficulty in walking due to pain and the patient was unable to bear weight on the left lower limb. the patient had a history of hip hemireplacement operation on the left side 5 years back. there was a diffuse swelling over antero - lateral aspect of upper part of left thigh. plain radiographs of the left hip and thigh showed a vancouver type b1 periprosthetic fracture with a broken cemented bipolar prosthesis insitu. the patient was planned for surgery with options for internal fixation of the fracture with revision of the prosthesis, and reconstruction of proximal femur with proximal femoral mega prosthesis. the head of the broken prosthesis was removed easily but the stem was well fixed in the bone stock and could not be removed despite of all the efforts. an osteotomy of the greater trochanter was performed and it was raised separately along with the attached abductors. the rest of the proximal part of the femur up to the fracture site was resected and removed along with the broken prosthesis. the remaining portion of the greater trochanter along with the abductors was attached to the ports provided at the lateral side of the prosthesis. the patient was allowed to bear weight after removal of the stitches on the 12th post operative day with the help of four post walker. he has completed 2 years of follow up and is totally asymptomatic, pain free and walks independently without support. fractures of the ipsilateral femur in patients with previous hip replacements have long been recognized as a significant problem associated with the procedure, but these are becoming more common, as the number of patients with a hip implant increases. treatment options that have been described over the years include non - operative methods including protection of the fracture as described by dysart sh et.al. al, adolphson p et.al, have advised traction as a method of non - operative treatment of these fractures specially in patients with high risk for surgery. casts and braces can also be used to treat these fractures as shown in studies by mont ma et. postoperative radiograph of the patient - plain radiograph of the left hip and thigh region showing the fracture treated by a custom made long stem cemented bipolar prosthesis. one year follow up radiograph of the patient - plain radiograph of the left hip and thigh region after one year of follow up showing a stable prosthesis with no signs of loosening or any other complication. surgical options include either internal fixation using circlage wires or cables as shown by beals rk et. al described the use of screws with and without plates along with the use of circlage wires and cables. special plates that have claws, bands or circlage wires to allow fixation in the region of the femoral stem have been used by missakian ml et. al and zenni jr ej in their studies. other commonly used mode of treatment is revision of the femoral component. options for revision include cemented and uncemented stems, long stems with proximal or extensive porous coating and stems with distal interlocking screws. in rare instances the whole of the proximal femur patients with a failed total hip arthroplasty and massive proximal femoral bone loss can be salvaged with a proximal femoral megaprosthesis if there is no other alternative as shown by shu - tai shih et.. however, this procedure is technically demanding and has a high rate of complications. if the prosthesis is loose, the bone is undergoing resorption and is at increased risk of failure. it therefore follows that treatment of a fracture secondary to a loose prosthesis requires revision of the prosthesis. on the other hand, a fracture in a bone with a well - fixed prosthesis following significant trauma requires treatment along the same principles as any other fracture, the only extra consideration is that of restrictions on choice of trauma implant due to the presence of an intramedullary prosthesis, unless the security of fixation is compromised by the fracture configuration. the choice of treatment is therefore determined primarily by whether or not the prosthesis is well fixed, and only secondarily by the site of the fracture. in our case the prosthesis itself was broken along with a periprosthetic fracture and the stem of the prosthesis was well fixed in the bone. every attempt to remove the stem of the prosthesis failed and so the whole proximal part of the femur had to be sacrificed and replaced by a long stem customized cemented bipolar prosthesis. the variable results of treatment for late periprosthetic femoral fracture, makes it necessary for undertaking every means to prevent this complication. the surgeon must keep in mind patient factors that increase the chance of fracture, including age, gender and index diagnosis. while there is no set of rules that can be applied to all cases, the vancouver classification combines the important factors in the management of these fractures ; fracture location, implant stability and bone quality and can be useful in guiding treatment. the goal is to obtain near - anatomic alignment, stable fracture fixation, and a secure and well - fixed femoral component in proper alignment which allows for early mobilization of the patient to prevent any complications associated with prolonged recumbency in old age. periprosthetic fractures are likely to increase even further in the coming years as the survival rate of the prostheses increases and the life expectancy of the population in general increases. custom made prosthesis may be used in places where the prosthesis is well fixed in the femur. the goal is to obtain stable fracture fixation, and a secure and well - fixed femoral component in proper alignment which allows for early mobilization of the patient to prevent any complications associated with prolonged recumbency in old age. | introduction : fractures involving bones containing a component of a prosthetic joint are becoming more common. the causation is multifactorial but most of these injuries are associated with trivial trauma. the options available for operative management of these fractures include internal fixation of the fracture alone, fixation of the fracture with revision of the prosthesis, and reconstruction of proximal femur with either modified impaction bone grafting or proximal femoral replacement.case report : we present here a case of periprosthetic fracture vancouver type b1 with a broken cemented bipolar prosthesis insitu, in which the broken implant was firmly fixed in the proximal fragment and could not be removed following which the whole of the proximal fragment along with the broken implant was removed and replaced by a customized steel long stem cemented mega prosthesis.conclusion:this case is being presented on account of its unusual presentation and fracture pattern. a broken prosthesis along with a periprosthetic fracture is not a common incident. thus the treatment had to be individualized. since the prosthesis was well fixed, its broken stem could not be removed from the proximal fragment and so the whole of the proximal fragment along with stem was removed and replaced with a long stem custom made bipolar prosthesis. |
" oxygen is vitally important in bronchiolitis and there is little evidence that any other treatment is useful. " reynolds and cook (1963) respiratory syncytial virus (rsv) was first identified in 1956 as the agent that causes chimpanzee coryza and subsequently isolated from children in 1957. since then this medium - sized enveloped rna paramyxovirus has been recognised as the single most important virus causing acute respiratory tract infections in children. the virus replicates in nasopharyngeal epithelium and then spreads to lower respiratory tract one to three days later. rsv infects respiratory epithelial cells by attaching itself to the cell surface by means of an envelope glycoprotein, the g (attachment) protein. a second envelope glycoprotein, the f (fusion) protein, mediates fusion with the epithelial cell membrane along with adjacent cells, resulting in the formation of multinucleated cells the vast majority of rsv research and studies have concentrated on the lungs and the mechanics of pulmonary immunopathology. dr eisenhut 's thorough systematic review of extrapulmonary manifestations of severe rsv infection clearly demonstrates clinical consequences peripheral to the lung parenchyma. it begs the question as to whether these are direct rsv effects (i.e., rsv infection of that tissue) or indirect, being secondary to parenchymal lung disease and its causative respiratory compromise or consequential of prowling inflammatory mediators ? rsv, like the other paramyxiviridae, can infect non - epithelial cells if it can gain access to the receptors on their surface, as demonstrated by the use of monkey kidney cells for rsv culture in vitro. rsv - rna has been detected by rt - pcr in whole blood but not plasma of infants and neonates, but this alone merely indicates cell - associated rsv genome. this is not necessarily viable rsv and is likely to be virus phagocytozed by neutrophils or monocytes. to escape their white cell captors rsv evidence of deposition in distant organs comes from detection in the myocardium, liver, and cerebrospinal fluid. however, strong convincing evidence of rsv - related inflammation or infection of these sites is less forthcoming unfortunately, this is not necessarily indicative of rsv - directed myocardial injury, but more likely the result of (right) heart strain secondary to severe lung parenchymal disease. likewise, it is highly suggestive that raised hepatic transaminases in this patient group are consequential to hepatic congestion or ischaemia due to right heart failure, itself secondary to parenchymal lung disease and/or pulmonary hypertension. proof of a rsv hepatitis would take histological verification (i.e., liver biopsy), which for ethical reasons is only ever going to occur postmortem. apnoeas and seizures undoubtedly occur in rsv infection, but presently there is more support for rsv encephalopathy than rsv encephalitis [12 - 15 ]. unfortunately, many of the reports fail to adequately adjust for the confounding consequence that hypoxic episodes and hypercapnoea may have on the patient 's neurological status. when not related to hypoxic or electrolyte imbalance triggers, rsv 's central influence / effect is probably related to released neurotoxic inflammatory chemokines and cytokines. endocrine impact / consequences, although interesting, appear to be the sequelae of severe rsv pulmonary disease and/or its treatment. it is likely that occurrences of hyponatraemia and hyponatraemic seizures are largely related to the use of hypotonic / electrolyte - poor intravenous solutions. further research is required to scrutinize whether the reported neuroendocrine stress response in rsv bronchiolitis is no more than an epiphenomenon reflecting severity of rsv disease. most of the extrapulmonary effects are likely to be the end result of released inflammatory mediators such as cytokines and chemokines triggered by the rsv respiratory tract infection. the antiviral and cell - mediated immune reaction to rsv infection the storm of t helper 1-type cytokines (ifn, il-2, il-12), t helper 2-type cytokines (il-4, il-5, il-6, il-10), antiviral interferons (ifn, ifn) and chemokines (c, cc, cxc and cx3c subgroups) released from respiratory epithelial cells may regulate the immune profile and reaction in outlying cells. host genetic factors may further manipulate the immune - augmented response at distant extrapulmonary sites. dr eisenhut is correct to remind clinicians of them so that they may be vigilant to their occurrence and consequences. the challenge for researchers is to discern whether these extrapulmonary effects are as a result of site - specific rsv infection or inflammatory mediators dispersed from the provoked respiratory tract. although the basic sentiments of reynolds and cook still ring true, the understanding of rsv disease and its treatment options has progressed over time. | extrapulmonary effects of severe respiratory syncytial virus (rsv) infection are not uncommon. dr eisenhut 's systematic review of extrapulmonary manifestations of severe rsv infection clearly demonstrates clinical consequences peripheral to the lung parenchyma. the extrapulmonary impact of rsv infection raises questions as to whether these are direct rsv effects (i.e., rsv infection of site - specific tissue), secondary to parenchymal lung disease and its causative respiratory failure, or the result of inflammatory mediators dispersed from the provoked respiratory epithelium. |
with advances in early detection and cancer treatments, numbers of cancer survivors are rising, and with the ageing of the population, the number of older cancer survivors will continue to rise even if age - specific incidence rates remain constant. whereas cancer used to be a fatal disease, it is now developing towards a chronic or even curable disease [3, 4 ]. at present, more than 60% of older cancer patients suffer from one or more chronic diseases. because of the chronic character of cancer and the high level of comorbidity, the role of general practitioners (gps) in cancer aftercare will become more prominent [7, 8 ]. studies among cancer survivors have shown that the consequences of cancer treatment are numerous and depend on the type of cancer and treatment characteristics [4, 9 ]. the most common sequelae are second malignancies (due to genetic or environmental risk factors shared with the first tumour and treatment - related factors) and cardiovascular diseases as myocardial infarction and cardiac insufficiency (due to radiotherapy as well as chemotherapy). many other diseases, such as osteoporosis and diabetes, have been related to cancer treatment also. these late effects are also common ageing - related diseases. therefore, within primary care, which is characterized by a heterogeneous patient population and only 50 cancer patients per standard practice (of 2350 patients), the late effects of cancer and its treatment could easily be mistaken for normal ageing and dismissed as such in older cancer survivors. given the gps ' expertise in dealing with multimorbidity, we believe that gps could play an important role in aftercare for cancer survivors. hence, primary care providers are in urgent need of more knowledge on the interaction between cancer, cancer treatment, and comorbidity in older cancer patients. therefore, we aim to examine from a generic gp perspective the occurrence of pre - existing (prevalent) and subsequent (incident) chronic diseases among cancer patients aged over 60, in comparison with non - cancer patients of the same age, sex, and practice in a large retrospective primary care - based cohort study. this study was carried out within the context of the registration network family practices (registratienet huisartspraktijken, rnh). this is a continuously updated computerized primary care database, with a target population of about 135,000 people. all participants were informed about the anonymous use of information about their health status when they registered as patients with the participating general practices (21 participating practices and about 65 general practitioners). all relevant health problems current as well as past are recorded on a problem list. a health problem is defined as anything that has required, does or may require health care management and has affected or could significantly affect a persons ' physical or emotional well - being. health problems are coded using the international classification of primary care (icpc), following the criteria of the international classification of health problems in primary care (ichppc-2-defined) for diagnoses. in the netherlands, gps have comprehensive information on the health status of their patients because gps function as gatekeepers to other health care facilities, and it is compulsory for all dutch residents to have health care insurance and to register with a gp. hence, we can expect the registered population to be representative of the general population. in addition to medical information, the rnh database also contains background information on sex, date of birth, living arrangement, level of education, and the date and reason of removal. the quality of the data is assured by instruction and training sessions, regional consensus groups, quality control experiments, and special software programs, such as an automated thesaurus and automated checking for erroneous or missing entries. the design of this study is a retrospective cohort, including all patients who were members of the rnh database between 1 january 1998 and 31 december 2010, and aged 60 years and over. neoplasms of the skin were excluded as well, as due to the icpc coding we were unable to distinguish between benign and malign neoplasma of the skin. each cancer patient, diagnosed between january 1998 and december 2010 (n = 3835), was matched with four non - cancer patients based on age, sex, and practice. for 239 cancer patients 337, 428, 429, and 3596 cancer patients were matched with one, two, three, and four non - cancer patients respectively. matched non - cancer patients were assigned a reference date (the same as the date of the cancer diagnosis of their matched cancer patient). only icpc codes that correspond to severe or chronic diseases were selected and categorized as previously described by knottnerus. (please see table 1 in the supplementary material available online at doi:10.1155/2012/206414). pre - existing chronic diseases were defined as all diagnoses established before the cancer diagnosis or reference date. subsequent chronic diseases were defined as all diagnoses established after the cancer diagnosis or reference date. all diagnoses that were established within a 3-month period before removal from the rnh database were excluded, as these might reflect the palliative phase, in which the disease pattern might be different. pre - existing chronic diseases were assessed by calculating the lifetime prevalence (per 1000 persons) cross - sectionally at the time of the cancer diagnosis or the reference date and were compared between cancer patients and their matched non - cancer patients using logistic regression analyses, adjusted for age and sex. prevalence and odds ratios were calculated for all cancer patients together, and for breast, prostate, and colorectal cancer patients separately. the occurrence of subsequent chronic diseases was longitudinally assessed by calculating the incidence per 1000 person - years at risk, excluding patients with a previous diagnosis of the disease. hazard ratios and their 95% confidence intervals (95% cis) were calculated using multivariate cox regression analyses, adjusted for age, sex, and presence of cardiovascular diseases, respiratory diseases, or diabetes at baseline (please see table 1 in the supplementary material on the journal website for the precise cardiovascular and respiratory diseases which were included). incidence and hazard ratios were computed for all cancer patients in comparison with their age, sex, and practice - matched controls and for all breast, prostate, and colorectal cancer patients separately, in comparison with their respective matched controls. the proportional hazards assumption was tested using schoenfeld residuals. for venous thrombosis (k93+k94), limited mental function (p28), lipid disorders (t93), and other endocrine / metabolic / nutritional diseases (t99), a two - sided p - value < 0.01 was used as the cut - off point for statistical significance. in the thirteen - year study period (19982010), there were 3,835 patients with a first diagnosis of cancer who were 60 years or older at the time of their cancer diagnosis (see table 1). the prevalence of pre - existing chronic diseases was high ; 78% of all cancer patients had at least one disease additional to the malignancy at time of cancer diagnosis (see table 1). the most common pre - existing chronic diseases were the same for cancer patients and non - cancer patients. these were diabetes, lipid disorders, ischemic heart disease, myocardial infarction, and copd. copd was significantly more prevalent among cancer patients compared to non - cancer patients (or 1.21, 95% ci 1.061.37). furthermore, dementia (or 0.48, 95% ci 0.360.64) and personality disorder (or 0.53, 95% ci 0.330.84) were significantly less prevalent in cancer patients compared to non - cancer patients (see table 2). when stratified by cancer type (data not shown), we found no differences within breast cancer patients (n = 493) compared to their matched controls (n = 1675). for prostate cancer patients (n = 573) compared to their respective controls (n = 1604), we found a higher prevalence of benign prostatic hypertrophy (or 1.44, 95% ci 1.091.88) and a lower prevalence of stroke (or 0.40, 95% ci 0.250.65) and diabetes (or 0.67, 95% ci 0.510.90). for colorectal cancer patients (n = 675) in comparison with their controls (n = 2063), we found a higher prevalence of blindness (or 2.85, 95% ci 1.435.71) and a lower prevalence of stroke (or 0.60, 95% ci 0.410.89), dementia (or 0.26, 95% ci 0.120.56), and benign prostatic hypertrophy (or 0.55, 95% ci 0.360.83). just as for pre - existing chronic diseases, risk of subsequent chronic diseases was similar among cancer survivors and non - cancer patients. the most common incident diseases in cancer patients were diabetes, venous thrombosis, osteoporosis, copd, and heart failure. in non - cancer patients these were diabetes, benign prostatic hypertrophy, stroke, dementia, and copd. in cancer survivors, the incidence of subsequent venous thrombosis was significantly higher compared to non - cancer patients during the first two years of survival (hr 4.20, 95% ci 2.746.44). furthermore, the incidence of hypertension with organ damage (hr 0.66, 95% ci 0.480.92), lipid disorders during the first two years after diagnosis (hr 0.49, 95% ci 0.290.82), and benign prostatic hypertrophy (hr 0.46, 95% ci 0.310.69) was significantly lower in cancer patients compared to non - cancer patients (see table 3). when stratified by cancer type (data not shown), we found no differences for breast cancer patients compared to their respective controls. in prostate cancer patients, the incidence of venous thrombosis (hr 7.10, 95% ci 2.2522.40) was significantly higher compared to non - cancer patients, and the incidence of benign prostatic hypertrophy was significantly lower (hr 0.17, 95% ci 0.060.48). in colorectal cancer patients, the incidence of venous thrombosis (hr 2.43, 95% ci 1.224.81) was significantly higher compared to non - cancer patients. the number of chronic diseases additional to cancer proved to be high and is probably associated with high age in the first place. both prevalence at diagnosis and incidence, however, tend to be largely similar in older cancer and non - cancer patients. the latter is consistent with recent other studies [17, 18 ]. at time of cancer diagnosis, 78% of all cancer patients had at least one disease additional to the malignancy. however, from the perspective of a gp, it is also important that cancer and non - cancer patients were similar with respect to prevalence of chronic diseases. still, there were some exceptions. in cancer patients, when stratified by cancer type, this difference remained significant, only within the group of lung cancer patients (or 2.88, 95% ci 2.203.78) (data not shown). this is in line with previous reports and is probably due to shared risk factors such as smoking. based on previous studies on the interaction between cancer and comorbidity, we would have expected an increased prevalence of diabetes in colorectal cancer patients. the point estimator was higher than one, but the absolute difference was small and not statistically significant. we found a significant lower prevalence of dementia in cancer patients compared to non - cancer patients. probably, malignancies are not less frequently occurring, but less frequently diagnosed in patients with dementia. in line with tabars - seisdedos., we also found inverse comorbidity for diabetes in prostate cancer patients, which may be related to diabetes treatment [23, 24 ]. furthermore, we showed inverse comorbidity for stroke in both prostate and colorectal cancer patients. a negative association between prostate and colorectal cancer and stroke was also shown by others, however, a clear explanation is still lacking. in this perspective stated that further research is needed as analyses of inverse cancer comorbidity can help us understand why some people are protected from certain cancers, and might help to uncover the mechanisms underlying malignancy. after cancer diagnosis we showed similar to pre - existing diseases that the most common new diseases in cancer survivors were also the most common ones in non - cancer survivors. in line, a recent and similar study by khan. showed that long - term cancer survivors are a population at risk but that the absolute increase in disease burden is small. for venous thrombosis we showed a significantly increased hazard ratio during the first two years of survival. this is in line with previous studies on consequences of cancer treatment and was also confirmed for breast (p - value 0.03), prostate (p - value 0.00), and colorectal (p - value 0.01) cancer patients separately. therefore, gps should be alert for the occurrence of venous thrombosis in older cancer survivors, especially within the first two years after diagnosis. although it is not the scope of this study, we were unable to confirm a higher incidence of osteoporosis (due to hormone replacement therapy), hypothyroidism (due to radiotherapy), and heart failure (due to radiotherapy and chemotherapy) in specific groups of cancer survivors compared to non - cancer survivors. furthermore, the time frame of our study does not enable us to study the occurrence of late effects of cancer therapy. as described by hewitt. late effects appear months to years after the completion of therapy. however, we continue our followup of the included patients and hope to come forward with late effect results at a later time. besides the increased risk for venous thrombosis, we found a lower incidence of hypertension with organ damage and lipid disorders (only during the first two years after cancer diagnosis) in cancer patients compared to non - cancer patients. in the first period after diagnosis, a decrease in food intake due to side effects of treatment and emotional factors, and later increased surveillance, and attention for healthy lifestyle might explain this lower incidence. a recent study showed, however, no obvious difference in lifestyle factors among short- and long - term cancer survivors compared to controls. we also found a significant lower incidence of benign prostatic hypertrophy in all cancer patients compared to non - cancer patients. as expected, when stratified by cancer type, this difference only remained for prostate and bladder cancer patients (data not shown). an important strength of this study was that the comprehensive registration of diseases was based on gps ' daily practice and that this data was analysed in a retrospective cohort design. a shortcoming of this study was that information on cancer treatment and smoking status was incomplete. therefore we were unable to analyse the risk of comorbidity according to treatment type and to consider smoking as a confounder. however, to assess the consequences of cancer treatment as such was beyond the scope of this study. the aim of this study was to assess the frequency of comorbidity in cancer patients from a gp perspective, who sees only a small number of cancer patients (about 50 per standard practice) with very diverse cancer types. hence, we aimed to assess in a generic way the disease burden in older cancer patients, and we aimed to assess whether these cancer patients present to their gp with different diseases compared to non - cancer patients of the same age, sex, and practice. another limitation was that some associations may have occurred by chance (type i error) due to multiple comparisons. however, this would dramatically increase the chance for type ii errors. according to rothman it is not necessary to correct for multiple comparisons as the underlying premise of research is that nature follows regular laws that may be studied through observation [29, 30 ]. therefore, we decided not to formally correct for multiple comparisons and to use a p - value of 0.01 as cut - off for statistical significance. this does, however, not prohibit that some findings might have occurred due to chance, such as the increased prevalence of blindness, and the decreased prevalence of prostatic hypertrophy in colorectal cancer patients, and personality disorders in cancer patients in general. furthermore, we showed that prostatic hypertrophy was more prevalent in prostate cancer patients, which is probably due to indication bias. therefore, it is important that these results are validated in similar cohorts. because of the similarities between older cancer and non - cancer patients and the gps ' expertise in dealing with multimorbidity, we believe that gps could play an important role in aftercare for cancer survivors. however, the participation of primary care in cancer care is still in its infancy. future studies could focus on the coordination of aftercare between primary and secondary care, the development of guidelines for cancer patients with comorbidity, and the use of patient goals in the determination of care planning in patients with complex care needs. | objective. to compare the occurrence of pre - existing and subsequent comorbidity among older cancer patients (60 years) with older non - cancer patients. material and methods. each cancer patient (n = 3835, mean age 72) was matched with four non - cancer patients in terms of age, sex, and practice. the occurrence of chronic diseases was assessed cross - sectionally (lifetime prevalence at time of diagnosis) and longitudinally (incidence after diagnosis) for all cancer patients and for breast, prostate, and colorectal cancer patients separately. cancer and non - cancer patients were compared using logistic and cox regression analysis. results. the occurrence of the most common pre - existing and incident chronic diseases was largely similar in cancer and non - cancer patients, except for pre - existing copd (or 1.21, 95% ci 1.061.37) and subsequent venous thrombosis in the first two years after cancer diagnosis (hr 4.20, 95% ci 2.746.44), which were significantly more frequent (p < 0.01) among older cancer compared to non - cancer patients. conclusion. the frequency of multimorbidity in older cancer patients is high. however, apart from copd and venous thrombosis, the incidence of chronic diseases in older cancer patients is similar compared to non - cancer patients of the same age, sex, and practice. |
the flowering aerial parts of o. gratissimum and o. sanctum were collected from the medicinal garden of regional medical research centre (rmrc), belgaum. the plants were identified and authenticated by a taxonomist at rmrc, belgaum, where the voucher specimens have been deposited (rmrc-530 : o. gratissimum and rmrc-531 : o. sanctum). fresh flowering aerial parts (1.0 kg each) of o. gratissimum and o. sanctum were steam distilled separately using copper still fitted with spiral glass condensers for 3 h. water distillate was extracted with hexane and dichloromethane. the organic phase was dried over anhydrous sodium sulfate and the solvent was distilled off using thin film rotary vacuum evaporator at temperature range 25 - 30. the oils were stored in tightly closed dark vials at 4 until analysis. the oil was analyzed by using a varian 450 (tg-5, 30 m0.25 mm i.d., the oven temperature was programmed from 60 to 220 at 3/min, using nitrogen as carrier gas. the injector temperature was 230 and the detector (fid) temperature 240. gc - ms utilized a thermo scientific trace ultra gc interfaced with a thermo scientific itq 1100 mass spectrometer fitted with a tg-5 (thermo scientific) fused silica capillary column (30 m0.25 mm ; 0.25 m film thickness). the oven temperature range was 60 - 220 at 3/min using helium as carrier gas at 1.0 ml / min. the injector temperature was 230, and the injection size 0.1 l in n - hexane, with a split ratio of 1:50. ms were taken at 70 ev with a mass range of m / z 40 - 450. the essential oils of o. gratissimum and o. sanctum (5.0 g each) were chromatographed separately on a silica gel (230 - 400 mesh ; qualigens fine chemicals, mumbai, india) column (3.5100 cm) eluted with increasing polarity mixtures of n - hexane / diethyl ether to give eugenol and methyl eugenol. the purity (99.80% for eugenol and 99.65% for methyl eugenol) was determine by gc (varian 450 gas chromatograph) using the above analytical conditions. each oil component and their isolated constituents were identified on the basis of their retention index (ri, determined with reference to homologous series of n - alkanes c8-c25, under identical experimental condition), from ms library searches using the nist and wiley gc - ms databases and by comparison with literature mass spectral data. the structure of eugenol and methyl eugenol was further confirmed by h- and c - nmr. the microorganisms were obtained from the national collection of industrial microorganisms (ncim), national chemical laboratory, pune. the microorganisms includes, gram - positive bacteria (staphylococcus aureus ncim 2079, staphylococcus epidermidis ncim 2493, streptococcus faecalis ncmi 2080, micrococcus flavus ncim 2379, micrococcus luteus ncim 2103, bacillus subtilis ncim2063), gram - negative bacteria (escherichia coli ncim 2574, klebsiella pneumoniae ncim 2957, serratia marcescens ncim 2078, proteus vulgaris ncim 2813, proteus mirabilis ncim 2241, pseudomonas aeruginosa ncim5029, salmonella typhimurium ncim 2501, enterobacter aerogenes ncim 2694) and fungal strains (aspergillus niger ncim 620, aspergillus fumigatus ncim 902 and penicillium chrysogenum ncim 733). the essential oils, eugenol and methyl eugenol, were dissolved in 10% dimethyl sulfoxide (dmso). solan, himachal pradesh, india), amikacin (iskon remedies, sirmour, himachal pradesh, india) and amphotericin b (chandra bhagat pharma pvt. ltd., ankleshwar, india) were used as the positive reference standards for gram - positive, gram - negative bacteria, and fungi, respectively. the inocula of microbial strains were prepared from 18 h old culture and suspensions were adjusted to 0.5 mcfarland standard turbidity (10 for bacteria and 10 for fungi colony forming unit (cfu) per milliliter). tube - dilution method was used to determine the minimum inhibitory concentration (mic). essential oils, eugenol, and methyl eugenol were dissolved in 10% dmso separately with final concentrations of 5.0 mg / ml. serial two - fold dilutions were prepared from the stock solution to give concentration ranging from 5.0 to 0.009 mg / ml. erythromycin, amikacin, and amphotericin b were dissolved in sterile distilled water and two - fold dilutions were prepared (1.0 - 0.002 mg / ml). a total of 1 ml of each concentration was mixed with 1.0 ml of sterile nutrient broth for bacteria except for streptococcus faecalis (mrs broth) while peptone water was used for fungi (at 0.5 mcfarland turbidity standard). solvent control was prepared with dmso (10%) while blank control was prepared from virgin media. tubes were incubated for 24 and 48 h at 37 for bacteria and fungi, respectively. assay was performed in replicates and the mean value of six experiments was recorded (n=6) with sem. the antioxidant activity of the essential oils, eugenol, and methyl eugenol was determined using 2,2-diphenyl-1-picrylhydrazyl (dpph) radical according to the method of hou.. dpph was dissolved in ethanol to give a 0.05 mm solution. final concentration of trolox (antioxidant reference), essential oil of o. gratissimum and eugenol was 2.4 mg / ml, while 10 mg / ml was used for essential oil of o. sanctum and methyl eugenol. aliquots containing various concentrations (5 - 30 g / ml) of trolox in the final volume of 1.0 ml were mixed with 1.0 ml of ethanol dpph solution. the oil of o. gratissimum and eugenol were tested at concentration range of 25 - 50 g / ml while oil of o. sanctum and methyl eugenol at 50 - 300 g / ml using the same method. the ethanol solution of dpph (1.0 ml) with equal amount of ethanol served as control. reaction mixtures were incubated at 37 for 20 min and the dpph radical scavenging activity was determined by measuring the absorbance at 517 nm using a spectrophotometer. 2,2- azino - bis (3-ethylbenzthiazoline-6-sulphonic acid) (abts) diammonium salt radical cation decolorization test was performed using spectrophotometric method of pellegrini.. the abts reagent stock was prepared by mixing 88 l of 140 mm potassium persulfate (k2s2o8) with 5 ml of 7 mm of abts stock solution (ph 7.4). the working abts reagent was prepared by diluting the stock solution with ethanol to give an absorbance of 0.70.05 at 734 nm. the tested concentrations of trolox, oil of o. gratissimum, o. sanctum, and eugenol and methyl eugenol were same as represented in dpph assay. the abts working solution (1.0 ml) with equal amount of ethanol served as control. the reaction mixtures were incubated at room temperature (28) for 30 min and the absorbance was measured at 734 nm. the scavenging dpph and abts activities of the tested samples were calculated as the following formula : percent (%) inhibition of dpph or abts=(1absorbance of sample / absorbance of control)100. fresh flowering aerial parts (1.0 kg each) of o. gratissimum and o. sanctum were steam distilled separately using copper still fitted with spiral glass condensers for 3 h. water distillate was extracted with hexane and dichloromethane. the organic phase was dried over anhydrous sodium sulfate and the solvent was distilled off using thin film rotary vacuum evaporator at temperature range 25 - 30. the oils were stored in tightly closed dark vials at 4 until analysis. the oil was analyzed by using a varian 450 (tg-5, 30 m0.25 mm i.d., the oven temperature was programmed from 60 to 220 at 3/min, using nitrogen as carrier gas. the injector temperature was 230 and the detector (fid) temperature 240. gc - ms utilized a thermo scientific trace ultra gc interfaced with a thermo scientific itq 1100 mass spectrometer fitted with a tg-5 (thermo scientific) fused silica capillary column (30 m0.25 mm ; 0.25 m film thickness). the oven temperature range was 60 - 220 at 3/min using helium as carrier gas at 1.0 ml / min. the injector temperature was 230, and the injection size 0.1 l in n - hexane, with a split ratio of 1:50. ms were taken at 70 ev with a mass range of m / z 40 - 450. the essential oils of o. gratissimum and o. sanctum (5.0 g each) were chromatographed separately on a silica gel (230 - 400 mesh ; qualigens fine chemicals, mumbai, india) column (3.5100 cm) eluted with increasing polarity mixtures of n - hexane / diethyl ether to give eugenol and methyl eugenol. the purity (99.80% for eugenol and 99.65% for methyl eugenol) was determine by gc (varian 450 gas chromatograph) using the above analytical conditions. each oil component and their isolated constituents were identified on the basis of their retention index (ri, determined with reference to homologous series of n - alkanes c8-c25, under identical experimental condition), from ms library searches using the nist and wiley gc - ms databases and by comparison with literature mass spectral data. the structure of eugenol and methyl eugenol was further confirmed by h- and c - nmr. the microorganisms were obtained from the national collection of industrial microorganisms (ncim), national chemical laboratory, pune. the microorganisms includes, gram - positive bacteria (staphylococcus aureus ncim 2079, staphylococcus epidermidis ncim 2493, streptococcus faecalis ncmi 2080, micrococcus flavus ncim 2379, micrococcus luteus ncim 2103, bacillus subtilis ncim2063), gram - negative bacteria (escherichia coli ncim 2574, klebsiella pneumoniae ncim 2957, serratia marcescens ncim 2078, proteus vulgaris ncim 2813, proteus mirabilis ncim 2241, pseudomonas aeruginosa ncim5029, salmonella typhimurium ncim 2501, enterobacter aerogenes ncim 2694) and fungal strains (aspergillus niger ncim 620, aspergillus fumigatus ncim 902 and penicillium chrysogenum ncim 733). the essential oils, eugenol and methyl eugenol, were dissolved in 10% dimethyl sulfoxide (dmso). solan, himachal pradesh, india), amikacin (iskon remedies, sirmour, himachal pradesh, india) and amphotericin b (chandra bhagat pharma pvt. ltd., ankleshwar, india) were used as the positive reference standards for gram - positive, gram - negative bacteria, and fungi, respectively. the inocula of microbial strains were prepared from 18 h old culture and suspensions were adjusted to 0.5 mcfarland standard turbidity (10 for bacteria and 10 for fungi colony forming unit (cfu) per milliliter). tube - dilution method was used to determine the minimum inhibitory concentration (mic). essential oils, eugenol, and methyl eugenol were dissolved in 10% dmso separately with final concentrations of 5.0 mg / ml. serial two - fold dilutions were prepared from the stock solution to give concentration ranging from 5.0 to 0.009 mg / ml. erythromycin, amikacin, and amphotericin b were dissolved in sterile distilled water and two - fold dilutions were prepared (1.0 - 0.002 mg / ml). a total of 1 ml of each concentration was mixed with 1.0 ml of sterile nutrient broth for bacteria except for streptococcus faecalis (mrs broth) while peptone water was used for fungi (at 0.5 mcfarland turbidity standard). solvent control was prepared with dmso (10%) while blank control was prepared from virgin media. tubes were incubated for 24 and 48 h at 37 for bacteria and fungi, respectively. assay was performed in replicates and the mean value of six experiments was recorded (n=6) with sem. the antioxidant activity of the essential oils, eugenol, and methyl eugenol was determined using 2,2-diphenyl-1-picrylhydrazyl (dpph) radical according to the method of hou.. dpph was dissolved in ethanol to give a 0.05 mm solution. final concentration of trolox (antioxidant reference), essential oil of o. gratissimum and eugenol was 2.4 mg / ml, while 10 mg / ml was used for essential oil of o. sanctum and methyl eugenol. aliquots containing various concentrations (5 - 30 g / ml) of trolox in the final volume of 1.0 ml were mixed with 1.0 ml of ethanol dpph solution. the oil of o. gratissimum and eugenol were tested at concentration range of 25 - 50 g / ml while oil of o. sanctum and methyl eugenol at 50 - 300 g / ml using the same method. the ethanol solution of dpph (1.0 ml) with equal amount of ethanol served as control. reaction mixtures were incubated at 37 for 20 min and the dpph radical scavenging activity was determined by measuring the absorbance at 517 nm using a spectrophotometer. 2,2- azino - bis (3-ethylbenzthiazoline-6-sulphonic acid) (abts) diammonium salt radical cation decolorization test was performed using spectrophotometric method of pellegrini.. the abts reagent stock was prepared by mixing 88 l of 140 mm potassium persulfate (k2s2o8) with 5 ml of 7 mm of abts stock solution (ph 7.4). the working abts reagent was prepared by diluting the stock solution with ethanol to give an absorbance of 0.70.05 at 734 nm. the tested concentrations of trolox, oil of o. gratissimum, o. sanctum, and eugenol and methyl eugenol were same as represented in dpph assay. the abts working solution (1.0 ml) with equal amount of ethanol served as control. the reaction mixtures were incubated at room temperature (28) for 30 min and the absorbance was measured at 734 nm. the scavenging dpph and abts activities of the tested samples were calculated as the following formula : percent (%) inhibition of dpph or abts=(1absorbance of sample / absorbance of control)100. the yields of essential oils from o. gratissimum and o. sanctum were 1.05 and 1.20%, respectively. table 1 shows the compounds identified in the oils of o. gratissimum and o. sanctum along with their percentage composition and retention index on a tg-5 capillary column. volatile constituents identified in the o. gratissimum were 10 monoterpene hydrocarbons (15.5%), 6 oxygenated monoterpenes (1.6%), 9 sesquiterpene hydrocarbons (6.1%), 1 oxygenated sesquiterpene (0.1%), and 5 phenyl derivatives (76.0%) comprising 31 constituents (99.3%) of the total oil. the other minor compounds were terpinolene (14.2%) and germacrene d (3.9%). essential oil composition of o. gratissimum and o. sanctum the major volatile constituent identified in the essential oil of o. sanctum was methyl eugenol (92.4%). the class compositions were 5 monoterpene hydrocarbons (0.3%), -caryophyllene (1.3%). the class compositions were 5 monoterpene hydrocarbons (0.3%), 3 oxygenated monoterpenes (0.2%), 9 sesquiterpene hydrocarbons (2.6%), 5 oxygenated sesquiterpenes (0.9%) and 3 phenyl derivatives (94.9%), comprising 25 constituents (98.9%) of the total oil. ten compounds were found to be common in the oils of o. gratissimum and o. sanctum, which were -pinene, e--ocimene, terpinolene, -terpineol, eugenol, -cubenene, -caryophyllene, - muurolene, -muurolene, epi - cubebol, and -cubebol, and -cadinene in less quantity. the results of antimicrobial activity of the essential oils, eugenol and methyl eugenol are presented in table 2. the minimum inhibitory concentration (mic) values are represented as mg / ml. the essential oil of o. gratissimum was found highly active against e. coli, s. marcescens, and k. pneumoniae. the essential oil of o. sanctum was found to posses significant antimicrobial activity against the microorganisms like s. epidermis, p. aeruginosa, a. niger, and s. faecalis. methyl eugenol was found to possess significant antimicrobial activity against p. aeruginosa and p. mirabilis, while eugenol was found to be effective only against s. aureus. mic values of o. gratissimum and o. sanctum essential oils and eugenol and methyl eugenol compared to the standard antibacterial agents used in the study (erythromycin, amikacin, and amphotericin b), the essential oils of o. gratissimum and o. sanctum and their main components have a weaker antibacterial activity. according to wan., the majority of the essential oils assayed for their antibacterial properties showed a more pronounced effect against the gram - positive bacteria. the resistance of gram - negative bacteria to essential oil has been ascribed to their hydrophilic outer membrane which can block the penetration of hydrophobic compounds into target cell membrane. thus, the methyl eugenol is more hydrophobic than eugenol ; however, hydroxyl group of eugenol may not be involved for hydrogen bonding due to the presence of ome group in ortho position of eugenol produced steric hindrance. this may explain the weaker antimicrobial activity of the eugenol and methyl eugenol against gram - negative bacteria. the other phenolic components though low in the essential oils of o. gratissimum and o. sanctum could be contributing for antimicrobial activity by causing leakage of intracellular atp and potassium ions leading to cell death. dpph and abts assay were adopted for evaluation of antioxidant properties of essential oils, eugenol, and methyl eugenol. antioxidant activity in series of two - fold dilutions, the concentration of each oil and isolated compounds were used to calculate the inhibition concentration ic50 in g / ml. the amount of sample required to decrease the absorption of dpph and abts by 50% were calculated graphically (% of inhibition was plotted against the concentration in g / ml). the essential oil of o. gratissimum showed potent antioxidant activity, which could be due to high amount of eugenol (> 75%). this higher antioxidant capacity of the oil of o. gratissimum could be the synergistic property due to the presence of other phenolic constituents viz. cis - sabinene hydrate, trans - sabinene hydrate, terpine-4-ol, -terpineol, thymol, carvacrol, and epi - cubebol present in small quantity (2.1% of the total oil). hence, the oil of o. gratissimum showed better antioxidant property than pure eugenol. on the other hand, essential oil of o. sanctum expressed feeble antioxidant activity with dpph and abts models with ic50 values of 219.161.01 and 241.501.08, respectively, while methyl eugenol did not show any initial antioxidant activity, which may be due to the absence of participating electron delocalization group or proton (s). the presence of the cineol-1,8, -terpineol, eugenol, epi - cubebol, cubebol, 10-epi - cubebol, 1,10-di - epi - cubenol, and epi--cadinol comprising 3.50% of the total oil could show weak antioxidant activity. the essential oils, eugenol, were compared with known synthetic antioxidant trolox (table 3). the most obvious are the nonspecific responses and synergistic effects of the compounds present in the crude extracts. for this reason a bioassay - directed fractionation of an active extract does not always lead to the isolation of active compounds. an apparent loss of activity on separation of synergistically acting components of low individual potency can not be easily distinguished from the loss of activity resulting from chemical changes induced by a particular isolation technique. in this study, we concluded that o. gratissimum and o. sanctum of this region can be used as a source of food additives, preservatives, and as an antiseptic. antioxidant activity of o. gratissimum, o. sanctum oils, eugenol, methyl eugenol and trolox determined by dpph and abts methods | the essential oils of the flowering aerial parts of two ocimum species viz., ocimum gratissimum and o. sanctum were analyzed by gas chromatography and gas chromatography / mass spectroscopy. the principal constituent of o. gratissimum and o. sanctum was eugenol (75.1%) and methyl eugenol (92.4%), comprising 99.3 and 98.9% of the total oils, respectively. in vitro antimicrobial activity of the essential oils of o. gratissimum, o. sanctum and their major compounds eugenol and methyl eugenol were screened by using tube dilution methods. o. gratissimum oil was found highly active against s. marcescens while o. sanctum oil showed significant activity against a. niger and s. faecalis. methyl eugenol exhibited significant activity against p. aeruginosa while eugenol was effective only against s. aureus. antioxidant activity of oils, eugenol, and methyl eugenol was determined by 2,2-diphenyl-1-picrylhydrazyl and 2,2- azino - bis(3-ethylbenzthiazoline-6-sulphonic acid) assays. essential oil of o. gratissimum showed comparative antioxidant activity with ic50 values 23.660.55 and 23.910.49 g / ml in 2,2-diphenyl-1-picrylhydrazyl and 2,2- azino - bis(3-ethylbenzthiazoline-6-sulphonic acid) models, respectively. eugenol showed slightly weaker antioxidant activity compared to oil of o. gratissimum, while o. sanctum oil demonstrated very feeble antioxidant activity and methyl eugenol did not show any activity. eugenol and methyl eugenol would be elite source from o. gratissimum and o. sanctum, respectively, of this region could be consider as a source of natural food antioxidant, preservatives, and as an antiseptic. |
bone is a living, dynamic tissue that is constantly remodeled in the process of bone turnover. bone health in adults depends on the synchronized performance of bone - resorbing osteoclasts and bone - forming osteoblasts that function together on the bone surface. an imbalance in the activities of bone - resorbing osteoclast cells and bone - depositing osteoblast cells upon aging or reaching menopause leads to osteoporosis. osteoporosis, paget 's disease, and rheumatoid arthritis are the result of overactive osteoclasts, which resorb bone. osteoclasts are tissue - specific macrophage polykaryons created by the differentiation of monocyte / macrophage precursor cells at or near the bone surface. osteoclast differentiation from bone marrow - derived macrophages (bmms) is needed for receptor activator of nuclear factor-b ligand (rankl), which is known to play an important role in osteoclast development. the nuclear factor of activated t cells c1 (nfatc1), noted master transcription factor for osteoclast differentiation, is induced by rankl. nfatc1 promotes the expression of osteoclast differentiation - related factors including tartrate - resistant acid phosphatase (trap), cathepsin k, and dendritic cell - specific transmembrane protein (dc - stamp) [911 ]. traditional oriental herbal medicines have been reevaluated by clinicians because these medicines have fewer side effects and are more suitable for long - term use compared to chemically synthesized medicines. alisma canaliculatum, a member of the plant family alismataceae, is a herb commonly used in traditional korean medicine. rhizoma alismatis, a dried tuber of a. canaliculatum, is the main medicinal part of the plant. previous phytochemical and pharmacological investigations of this plant reported the isolation of protostane- and seco - protostane - type triterpenes such as alisols a, b, and c, alisol a 24-acetate, alisol b 23-acetate, alisol c 23-acetate, and alismalactone 23-acetate, and guaiane - type sesquiterpenes such as alismols a and b, sulfoorientalol a, and orientatols ab, c, e, and f. in our ongoing investigation of biologically active compounds from natural products, the dried rhizomes of a. canaliculatum were examined, and bioactivity - guided fractionations and hplc yielded a triterpenoid, alisol a 24-acetate (figure 1). recombinant mouse receptor activator of nuclear factor-b ligand (rankl) and recombinant mouse macrophage - colony stimulating factor (m - csf) were purchased from r&d systems (mn). cell culture medium, fetal bovine serum (fbs), and penicillin / streptomycin were purchased from invitrogen life technologies (ny). all reagents used in the reverse transcription (rt) and real - time pcr master mix were from enzynomics (kr). nfatc1 monoclonal and actin polyclonal antibody were from santa cruz biotechnology (ca, usa). alisma canaliculatum was purchased from dongbu plant market in suncheon in the south sea in korea. the dried rhizomes of alisma canaliculatum (wet weight, 1.2 kg) were minced and extracted with ethanol at room temperature for five days ; the ethanol was concentrated under vacuum and then partitioned between etoac and h2o (1 : 1). the etoac - soluble layer was concentrated under vacuum to give 18.0 g, which was subjected to silica gel (0.0400.063 mm) column chromatography using a stepwise gradient with solvents of increasing polarity, from 100% ch2cl2 to 100% meoh. the fraction containing triterpenoid mixtures eluting with 2% ch2cl2 in meoh was further purified by rp - hplc [phenomenex luna rp - c18(2), 5 m, 250 10 mm, 2.5 ml / min ] using an isocratic solvent system with 85% acetonitrile in h2o to afford alisol a 24-acetate (1, 7.0 mg, tr 14 min). h nmr (cdcl3, 700 mhz):h 4.65 (1h, s, h-24), 3.89 (2h, overlapped, h-11 and h-23), 2.81 (2h, dd, j = 13.8, 5.9 hz h-12), 2.68 (1h, m h-20), 2.35 (2h, ddd, j = 15.5, 9.6, 3.3 hz, h-2), 2.25 (1h, m, ha-1), 2.20 (3h, s, -coch3), 2.15 (1h, m, hb-1), 2.16 (2h, m, h-16), 2.10 (1h, m, h-5), 2.02 (2h, m, h-7), 1.89 (1h, m, h-15a), 1.74 (1h, d, j = 10.8 hz, h-9), 1.45 (1h, m, h-6a), 1.39 (1h, m, h-6b), 1.38 (2h, m, h-22), 1.36 (1h, m, h-15b), 1.30 (3h, s, h-27), 1.16 (3h, s, h-26), 1.15 (3h, s, h-30), 1.07 (3h, d, j = 11.0 hz, h-21), 1.06 (3h, s, h-28), 1.00 (3h, s, h-18), 0.99 (3h, s, h-19), 0.98 (3h, s, h-29) ; c nmr (175 mhz, cdcl3) : c 220.5 (qc, c-3), 171.5 (-coch3), 138.3 (qc, c-13), 135.5 (qc, c-17), 78.6 (ch, c-24), 73.9 (qc, c-25), 70.0 (ch, c-11), 69.0 (ch, c-23), 57.0 (qc, c-14), 49.6 (ch, c-9), 48.5 (ch, c-5), 47.0 (qc, c-4), 40.5 (qc, c-8), 39.7 (ch2, c-22), 36.9 (qc, c-10), 34.5 (ch2, c-12), 34.3 (ch2, c-7), 33.8 (ch2, c-2), 30.9 (ch2, c-1), 30.5 (ch2, c-15), 29.6 (ch3, c-28), 29.1 (ch2, c-16), 27.9 (ch, c-20), 27.5 (ch3, c-26), 26.6 (ch3, c-27), 25.7 (ch3, c-19), 24.1 (ch3, c-30), 23.2 (ch3, c-18), 20.1 (-coch3), 20.1 (ch3, c-29), 20.1 (ch3, c-21), 20.0 (ch2, c-6) ; lcms m / z : 515 [m - h2o+h ], 497 [m-2h2o+h ]. this study was carried out in strict accordance with the recommendations outlined in the standard protocol for animal study from the korea research institute of chemical technology (krict ; permit number 2012 - 7d-02 - 01). the protocol (i d number 7d - m1) was approved by the institutional animal care and use committee of krict (iacuc - krict). bone marrow cells (bmcs) were collected from femur and tibia of 5 - 6-week - old male icr mice by flushing femurs and tibias with -mem supplemented with antibiotics. bmcs were cultured with m - csf (10 ng / ml) in -mem containing 10% fetal bovine serum (fbs) and antibiotics in a culture dish for 1 day. nonadherent bmcs were cultured for 3 days in a petri dish in m - csf (30 ng / ml), and the adherent cells were used as bone marrow - derived macrophages (bmms). for the formation of osteoclasts, bmms were cultured with rankl (10 ng / ml) and m - csf (30 ng / ml) in the presence or absence of alisol a 24-acetate for 4 days. cells were fixed with 3.7% formalin for 5 min, permeabilized with 0.1% triton x-100 for 10 min, and stained with trap solution (sigma - aldrich, mo, usa) for 10 min. the bmms were cultured with m - csf (30 ng / ml) at a density of 1 10 cells / well on 96-well plates in the presence of alisol a 24-acetate (indicated concentration) for 3 days. the cells were incubated for 3 hours in -mem containing 10% cck-8 reagent. the optical density (od) total rna was isolated from cells with trizol reagent according to the manufacturer 's protocol. first - strand cdna was synthesized with 0.5 g of total rna, 1 m oligo - dt18 primer, and the m - mlv cdna synthesis kit (enzynomics, kr) according to the manufacturer 's protocol. sybr green - based qpcr was performed with the stratagene mx3000p real - time pcr system and toprealtm qpcr 2x premix (enzynomics, kr), with the first - strand cdna diluted 1 : 10 and 20 pmol of primers according to the manufacturer 's protocol. the polymerase was activated at 95c for 10 minutes, followed by 40 cycles of 94c for 30 s (denaturation), 60c for 30 s (annealing), and 72c for 30 s (extension). this was followed by the generation of pcr - product temperature - dissociation curves (also called melting curves) at 95c for 1 min, 55c for 30 s, and 95c for 30 s. all reactions were run in triplicate, and data were analyzed by the 2 method. cells were incubated in lysis buffer (50 mm tris - hcl, 150 mm nacl, 5 mm ethylenediaminetetraacetic acid (edta), 1% triton x-100, 1 mm sodium fluoride, 1 mm sodium vanadate, and 1% deoxycholate, 1 : 1000 proteinase inhibitor) for 30 minutes on ice. cell lysates were separated by sds - page and transferred to a polyvinylidene difluoride membrane (millipore). the membranes were washed with tbst (10 mm tris - hcl ph 7.5, 150 mm nacl, and 0.1% tween 20) and incubated in blocking buffer (5% nonfat milk in tbst) for 1 hour at room temperature. the membranes were incubated with anti - nfatc1 (1 : 500) and anti - actin (1 : 1000) overnight. after three 30 min wash, the membranes were incubated with secondary antibody conjugated to horseradish peroxidase for 2 hours at room temperature and then washed three times for 30 min. specific bands were visualized by chemiluminescence using the las-3000 luminescent image analyzer (fuji photo film co., ltd., japan). each experiment was performed three to five times, and the results from one representative experiment are shown. the p values were described by the comparison between the control and one of the test groups (p < 0.05 ; p < 0.01 ; p < 0.001). a value of p < 0.05 was considered significant. to determine the effect of alisol a 24-acetate on osteoclast differentiation, alisol a 24-acetate was added during osteoclast differentiation with rankl (10 ng / ml) and m - csf (30 ng / ml). the addition of alisol a 24-acetate inhibited the differentiation of bmms into osteoclasts (figure 2(a)). in addition, the number of trap - positive multinucleated cells (3 nuclei) was significantly decreased in a dose - dependent manner by alisol a 24-acetate (figure 2(b)). bmms were incubated in the presence of m - csf (30 ng / ml) and dmso (vehicle) or alisol a 24-acetate for 3 days. alisol a 24-acetate had no cytotoxic effects at the indicated concentration (figure 2(c)). these results suggested that osteoclastogenesis suppression by alisol a 24-acetate was not due to toxic effects on bmms. we investigated mrna expression of osteoclast - specific genes in osteoclast differentiation by real - time pcr. expressed mrna levels of nfatc1, trap, dc - stamp, and cathepsin k were analyzed compared with the control (dmso) for 3 days. furthermore, it decreased osteoclast - related molecules including trap, dc - stamp, and cathepsin k (figure 3). the inhibitory effect of alisol a 24-acetate on the translational expression of nfatc1, a master regulator of osteoclast differentiation, was evaluated by western blot analysis. protein expression of nfatc1 was significantly increased by rankl without alisol a 24-acetate but was dramatically inhibited by alisol a 24-acetate (figure 4). this result indicated that alisol a 24-acetate could inhibit the translational expression of nfatc1 and suppress osteoclastogenesis. osteoporosis is a bone disease characterized by low bone mass and structural deterioration of bone tissue.. low bone mineral density (bmd) is a major cause of bone fracture. the balance between osteoblastic bone formation and osteoclastic bone resorption is crucial for bone homeostasis. generally, bone disorders such as osteoporosis and rheumatoid arthritis involve overactive osteoclasts and/or their increased number. osteoclasts, derived from pluripotent hematopoietic stem cells, are bone - resorbing multinucleated cells [6, 21, 22 ]. rankl, an osteoclasts differentiation factor, is related to the tnf superfamily and expressed by stromal cells in bone marrow and osteoblasts [23, 24 ]. it contains a c - terminal receptor - binding domain and a transmembrane domain and binds to its receptor, rank, which is expressed on osteoclasts. rankl / rank binding activates nfatc1, which regulates many osteoclast - specific genes, such as cathepsin k, trap, and dc - stamp [24, 25 ]. trap is the principal cytochemical marker for osteoclasts, dc - stamp plays an essential role in cell - cell fusion of osteoclasts [11, 27 ], and cathepsin k is a major protease in bone resorption. here, we tested the effect of alisol a 24-acetate on osteoporosis, specifically rankl - mediated osteoclast differentiation. the alisol a 24-acetate, isolated from the dried tuber of alisma canaliculatum, completely inhibited osteoclast differentiation and had no cytotoxic effects at concentrations over 10 m. these results suggested that the alisol a 24-acetate has antiosteoclastogenic activity without cytotoxicity to bmms. so we investigated the transcriptional expression level of nfatc1 and some osteoclast - specific genes for osteoclastogenesis. furthermore, the mrna expression levels of osteoclast - specific genes for osteoclast differentiation such as trap, dc - stamp, and cathepsin k were significantly reduced by alisol a 24-acetate. thus, alisol a 24-acetate inhibited the signal cascade from rankl / rank binding to nfatc1, and osteoclast differentiation was inhibited because of the inhibitive mechanism of alisol a 24-acetate. moreover, alisol a 24-acetate blocked cell - cell fusion of osteoclasts by inhibiting the expression of dc - stamp. the decreased expression of dc - stamp and cathepsin k was related to the decreased expression of nfatc1 [29, 30 ]. we confirmed the inhibition of alisol a 24-acetate on the translational expression of nfatc1 by western blotting. like the transcriptional inhibition of nfatc1, the translational expression of nfatc1 our results suggest that alisol a 24-acetate may be a potential therapeutic molecule for bone disorders and could be utilized as a new structural scaffold for inhibitors of osteoclast differentiation. this is the first report of alisol a 24-acetate, isolated from alisma canaliculatum, and its antiosteoclastogenic activity. alisol a 24-acetate inhibited rankl - induced osteoclast differentiation by downregulating nfatc1, a master factor for osteoclast differentiation, without cytotoxicity and also inhibited the expression of dc - stamp and cathepsin k. therefore, alisol a 24-acetate could be used as a scaffold for the development of a new osteoporosis drug. | osteoporosis is a disease that decreases bone mass. the number of patients with osteoporosis has been increasing, including an increase in patients with bone fractures, which lead to higher medical costs. osteoporosis treatment is all - important in preventing bone loss. one strategy for osteoporosis treatment is to inhibit osteoclastogenesis. osteoclasts are bone - resorbing multinucleated cells, and overactive osteoclasts and/or their increased number are observed in bone disorders including osteoporosis and rheumatoid arthritis. bioactivity - guided fractionations led to the isolation of alisol a 24-acetate from the dried tuber of alisma canaliculatum. alisol a 24-acetate inhibited rankl - mediated osteoclast differentiation by downregulating nfatc1, which plays an essential role in osteoclast differentiation. furthermore, it inhibited the expression of dc - stamp and cathepsin k, which are related to cell - cell fusion of osteoclasts and bone resorption, respectively. therefore, alisol a 24-acetate could be developed as a new structural scaffold for inhibitors of osteoclast differentiation in order to develop new drugs against osteoporosis. |
regulatory gtpases in the heterotrimeric g - protein and adp - ribosylation factor (arf) families provide some interesting parallels and contrasts in their origins but also in the issues that drive current research and the construction of molecular models of their regulation. all gtpases cycle between gtp- and gdp - bound states, with consequent changes in protein conformation and binding partners. because the gtp / gdp ratio in cytosol is thought to be about 10, regulatory gtpases would be overwhelmingly in the active conformation except the rate of spontaneous nucleotide exchange is quite low, especially relative to the biological process they control. today it is generally assumed that activation by a guanine nucleotide exchange factor (gef) is required for the biological function of each gtpase. indeed, nature has devised families of gefs, often quite large, that are specific to families or sub - families of gtpases. there are typically more gefs than their gtpase substrates and because the gefs themselves are regulated and often contain additional domains and activities, they provide specificity as well as spatial and temporal regulation of gtpase activation. g protein coupled receptors (gpcrs) act as g - protein gefs and the arf gefs to date all contain a conserved sec7 domain., gpcrs are tremendously important for clinical medicine and the pharmaceutical industry as the number one class of target for drugs today. though far less developed in chemotherapeutics, the arf gefs have been mimicked by human pathogens (including vibrio cholera and legionella pneumophila), targeted for inhibition by fungi (brefeldin a), or in small molecule screens (golgicide a). as a result these have allowed testable predictions of the role of specific amino acid side chains in binding and hydrolysis. structural analyses of gtpases and their regulators were instrumental in our current understanding of their mechanisms of action. both crystallography and nmr usually employ truncated or modified proteins in higher than physiological concentrations. to reveal the basis of interactions between gtpases and their regulators, two additional approaches are currently being employed : kinetic analyses of in vitro reactions using purified proteins, and monitoring interactions in the context of cells or cell lysates. while each approach has its advantages, it also has limitations that need to be considered. we think that the article from northup. argues convincingly for both continued structural work but also a clear need to couple it to kinetic studies of enzymatic properties. in parallel, the article from casanova summarizes nicely both the importance of cell - based assays and a couple of the approaches that are increasingly important to research into gtpase regulation and biology, as well as cell biology in general. as always, the strongest arguments and soundest models are those that encompass as many different approaches as possible. in this issue, northup. make a case for studying the kinetics of gef - stimulated nucleotide exchange on arfs and heterotrimeric g - proteins. such studies can be used to test mechanistic hypotheses that emerge from structural studies or obtain structure - function information not available from structural studies. one nice example is using such assays to address the question whether the gtpase - nucleotide - free form is a free intermediate or exists mostly when bound to the gef. determining reaction rates and affinities is important not only for elucidating mechanisms of action, but also for pharmacological design and testing of potential therapeutics that target these hubs of cell signaling. while kinetic studies can be used also for determining gef - gtpase specificity, these analyses should be taken with caution due to their reductionist nature. kinetic studies employ purified proteins, usually expressed in bacteria, and depend on the availability of soluble and stable proteins. one important and underappreciated aspect of such kinetic studies is the ability (indeed the need) to characterize each preparation and confirm that it recapitulates the native protein. for practical reasons, these assays frequently use truncated proteins and therefore miss effects of other domains of the regulator (gef) or the substrate (gtpase), or miss effects of post - translational modifications, or of other molecules (proteins, lipids and cofactors) important for the interaction. casanova discusses the importance of cell - based assays for regulation of arfs by gefs. these assays can be used for determining the physiological specificity of regulator - gtpase interactions. this article also makes the point that the issues are largely the same for the gefs, which activate the gtpase and downstream pathways, and the gaps that may terminate or mediate the gtpase signal. two basic types of cell - based assays are discussed, with variations on each type. the first type discussed is arguably not a cell - based assay but a biochemical one that is intended to capture changes in the activation status of a gtpase occurring in the intact cells via specific pulldown from cell lysates. such pulldowns require the generation of reagents that are capable of specific binding to the activated (gtp - bound) gtpase with quantitative recovery. an antibody with a conformational epitope specific to the activated species would be a wonderful reagent but, to our knowledge, exists only for ras. instead, the most common reagents used in these assays consist of fusion proteins of the domain from an effector that binds the active gtpase, fused to a tag that can be used to quantitatively purify the complex from solution. gtpase - binding domains from effectors typically have the specificity and affinity required of such reagents and we can expect to see many more generated for different gtpases. caution should be used when interpreting experiments that employ overexpressed proteins as there are both theoretical and practical reasons to believe that endogenously and exogenously expressed gtpases or their modulators behave, localize and are regulated distinctly. the second type is a microscopic approach that determines regulator - gtpase interaction inside cells and requires fluorescent reporters. such assays follow bi - molecular interactions of a gtpase with a gef or an effector using fluorescence microscopy. the requirements of these assays for fluorescent tagging and (typically) protein overexpression are key limitations. while these are always issues of concern to researchers using fluorescent tags, it is particularly acute when the tag (gfp) is larger than the protein being studied (arf family members). when done without overexpression and in combination with compartmental markers, these assays are the gold standard for determining the cellular location where a certain gtpase is stimulated by a certain gef. both types of cell - based analyses address regulator - gtpase specificity in a physiological context. obviously, the imaging assays can also address the location of the interaction and, therefore, even highly localized interactions can be detected. while both kinetic and cell - based approaches have their advantages, they each have limitations. therefore, getting information from both approaches is essential to the generation of hypotheses focused on mechanisms at atomic resolution and roles in biology / live cells as well as the ability to test them. pulldown assays from cell lysates circumvent the need of other proteins or protein domains, whereas microscopy - based assays also determine the site of interaction and are superior in cases of localized stimulation of a globally expressed gtpase. on the other hand, kinetic analyses of purified regulators or their domains with gtpases are instrumental for dissecting molecular mechanisms suggested by structural studies, which are essential for designing drug therapies. we hope that the two accompanying reasoned debate papers in this issue would encourage researchers to consider including these approaches in future studies aimed at unraveling gtpase regulation as well as drive further research into improved methods capable of addressing these important issues that are highly relevant to a large fraction of cell signaling and regulation studies. | regulatory gtpases are often portrayed as binary molecular switches that control a wide range of cellular processes, including, but not limited to, the generation of second messengers (e.g., camp and inositol phosphates), intracellular traffic, cytoskeleton organization and cell proliferation. gef stimulators and gap inhibitors regulate the nucleotide - bound state of these proteins. because of the relevance of gtpases and their regulators to human diseases, they comprise a major therapeutic target. currently, most of the information about gtpase regulators comes from structure analyses. such structural information is limited to certain conditions and does not necessarily reflect specificity or physiological activity. to address questions about specificity and mechanisms of action, kinetic and cell - based analyses of gtpase regulators is necessary. here, we compare these two approaches in the context of regulators of arf and heterotrimeric g - proteins. |
in recent times, ionic liquids have gained recognition as possible environmentally benign alternatives to the more volatile organic solvents. ionic liquids possess many attractive properties, such as wide liquid range, negligible vapor pressure, ease of recyclability, high thermal stability, and good solvating ability in a wide range of substrates and catalysts, which alleviate some of the environmental issues. their nonvolatile nature can reduce the emission of organic compounds and facilitate the separation of products and/or catalysts from the reaction solvents. furthermore, ionic liquids are found to be an efficient reaction medium for the immobilization of transition metal - based catalysts, lewis acids, and enzymes. the hallmark of such ionic liquids is the ability to alter their properties as desired by manipulating their structure with respect to the choice of organic cation or anion and side chain attached to the organic cation. the extensive use of heterocyclic compounds in the pharmaceutical industry is perhaps attributable to the availability of ample range of reactions that facilitate subtle structural modifications in heterocyclic compounds [47 ]. since indole and its derivatives possess various biological activities, development of new methodologies for the synthesis of indole derivatives, which will yield subsets of heterocycles having potentiality to serve as templates for new biologically active molecules, is of great importance. in this context, we wish to describe a convenient and simple methodology for the synthesis of bis - indolylindane-1,3-dione (by reacting ninhydrin with 3 substituted / unsubstituted indoles), 2-(1,3-dihydro-1h-[2,3]biindolyl-2-ylidene)-indan-1,3-diones, indene-1,3(2h)-denies (from the reaction of ninhydrin, 1,2-phenylendiamine, and indole), and 2,2-bis(4-(dimethylamino)phenyl)-1h - indene-1,3(2h)-diones (from the reaction of ninhydrin with n, n - dimethylaniline). the novelty of the methodology lies in its eco - friendly operation, the formation of structurally unique molecules, short reaction time, and excellent yield. melting points were determined using a linkman hf591 heating stage, used in conjunction with a tc92 controller, and reuncorrected. h and c nmr spectra were measured using deuterochloroform as solvent, and chemical shifts were measured relatively to residual solvent or cfcl3 as an internal standard for f nmr and are expressed in parts per million (). mass spectra were obtained using a micro mass lct machine in es or ei mode. infrared spectra were measured on a perkin elmer paragon 100 ft - ir spectrometer. analytical thin layer chromatography (tlc) for monitoring reactions was performed using merck 0.2 mm silica gel 60 f-254 al - plates. 1 mmol ninhydrin (1) and 2 mmol indole derivatives 2(a e) (for the synthesis 3(a e)), 1 mmol ninhydrin (1) 1 mmol 1,2-phenylenediamine derivatives 4(a c), and 2 mmol indole derivatives 2(a d) (for the synthesis 6aa6ae, 6ba6be, 6ca6ce) or 1 mmol ninhydrin (1), 2 mmol n, n - dimethylaniline 7(a c) (for the synthesis 8(a c)) were added to a 20 ml round bottom flask containing 2 ml [hbim]bf4. the mixture was stirred at room temperature 25c for appropriate time (monitored by tlc). after completion of the reaction, the reaction mixture was added with 5 ml water (il is soluble in water). the precipitate was collected by filtration and purified by crystallization from chloroform / methanol to afford pure products. the filtrate was concentrated under reduced pressure and dried at 100c to recover the ionic liquid for subsequent use. yellow prisms, mp = 121123c, ir (kbr) : max = 3399, 1706, 1254, 755 cm ; h nmr (500 mhz, dmso - d6) : = 7.28 (s, 2h), 7.38 (m, 2h), 7.41 (m, 2h), 7.45 (s, 2h), 7.76 (m, 1h), 7.87 (m, 1h), 8.11 (m, 1h), 8.25 (m, 1h), 12.54 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 58.1 (c), 111.7 (2 c), 112.5 (2 c), 115.1 (2 ch), 125.9 (2 ch), 127.2 (4 ch), 128.8 (2 ch), 129.5 (2 c), 132.5 (2 ch), 137.8 (2 c), 151.6 (d, jcf = 250.3 hz, 2 c f), 197.8 (2 co) ppm ; f nmr (dmso - d6, 470 mhz) : 73.25 ; ms (ei), m / z (%) = 412 (m, 27), 144 (65) ; hrms (ei) found : m, 412.1008. c25h15f3n2s requires m, 412.1011 ; anal calcd. for c25h15f3n2s, c, 72.81 ; h, 3.42 ; n, 6.79. yellow prisms, mp = 224226c, ir (kbr) : max = 3408, 1459, 1121, 763 cm ; h nmr (500 mhz, dmso - d6) : = 7.11 (s, 2h), 7.31 (m, 2h), 7.52 (m, 6h), 7.85 (d, 1h, j = 7.6 hz), 8.03 (d, 1h, j = 8.5 hz), 8.11 (s, 2h), 8.19 (d, 1h, j = 8.5 hz), 8.62 (d, 1h, j = 7.4 hz), 12.45 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 55.2 (c), 112.4 (2 c), 116.8 (2 ch), 117.9 (2 c), 123.7 (ch), 125.8 (ch), 126.7 (ch), 127.5 (ch), 128.0 (ch), 129.2 (2 c), 129.6 (ch), 130.2 (ch), 130.8 (ch), 130.9 (ch), 132.2 (ch), 133.2 (ch), 133.9 (ch), 137.5 (c), 138.2 (c), 138.9 (c), 141.2 (c), 151.8 (d, jcf = 250.1 hz, 2 c f), 154.2 (c), 168.5 (c) ppm ; f nmr (dmso - d6, 470 mhz) : 78.45 ; ms (ei), m / z (%) = 484 (m, 18), 184 (55) ; hrms (ei) found : m, 485.1507. c31h18f2n4 requires m, 484.1501 ; anal calcd. for c31h18f2n4, c, 76.85 ; h, 3.74 ; n, 11.56. found : c, 76.94 ; h, 3.61 ; n, 11.60. green prisms, mp = 195197c, ir (kbr) : max = 3416, 2954, 1468, 763 cm ; h nmr (500 mhz, dmso - d6) : = 2.58 (s, 6h, ch3), 6.98 (s, 2h), 7.02 (t, 2h, j = 7.5 hz), 7.12 (t, 2h, j = 7.3 hz), 7.31 (m, 2h), 7.54 (t, 1h, j = 7.5 hz), 7.68 (m, 4h), 7.94 (t, 1h, j = 7.5 hz), 8.01 (m, 2h), 8.09 (m, 2h), 8.12 (d, 1h, j = 8.2 hz), 8.41 (d, 1h, j = 8.5 hz), 8.41 (d, 1h, j = 7.5 hz) ppm ; c nmr (125 mhz, dmso - d6) : = 32.6 (ch3), 33.1 (ch3), 54.2 (c), 110.1 (2 ch), 115.4 (2 c), 117.9 (2 ch), 122.5 (2 ch), 123.4 (2 ch), 124.2 (2 ch), 126.2 (c), 126.7 (ch), 128.0 (ch), 128.6 (ch), 128.9 (ch), 129.4 (c), 129.5 (2 ch), 130.4 (c), 137.2 (c), 137.8 (2 c), 140.0 (c), 141.2 (c), 152.1 (2 c), 152.4 (c), 159.4 (c) ppm ; ms (ei), m / z (%) = 476 (m, 9), 210 (43) ; hrms (ei) found : m, 476.2008. c, 83.17 ; h, 5.08 ; n, 11.76. found : c, 83.14 ; h, 5.11 ; n, 11.81. brown needles, mp = 210212c, ir (kbr) : max = 3430, 2935, 1454, 746 cm ; h nmr (500 mhz, dmso - d6) : = 3.25 (s, 6h, ch3), 6.81 (s, 2h), 6.91 (m, 4h), 7.21 (m, 2h), 7.55 (d, 1h, j = 7.5 hz), 7.65 (d, 1h, j = 8.5 hz), 7.85 (s, 2h), 7.92 (d, 1h, j = 8.5 hz), 8.12 (d, 1h, j = 7.5 hz), 11.86 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 35.9 (2 ch3), 54.7 (c), 110.4 (2 ch), 114.8 (2 c), 116.9 (2 ch), 122.5 (2 ch), 124.8 (ch), 125.8 (ch), 126.5 (ch), 127.5 (2 c), 128.2 (ch), 129.0 (ch), 130.1 (ch), 130.4 (ch), 131.9 (ch), 131.8 (c), 132.2 (c), 133.4 (c), 135.5 (c), 137.2 (2 c), 139.4 (c), 140.2 (c), 152.8 (d, jcf = 251.6 hz, 2 c f), 155.4 (c), 169.7 (c) ppm ; f nmr (dmso - d6, 470 mhz) : 76.78 ; ms (ei), m / z (%) = 512 (m, 15), 252 (51) ; hrms (ei) found : m, 512.1804. c33h22f2n4 requires m, 512.1807 ; anal calcd. for c33h22f2n4, c, 77.33 ; h, 4.33 ; n, 10.93. found : c, 77.41 ; h, 4.31 ; n, 11.01. green needles, mp = 219221c, ir (kbr) : max = 3427, 2987, 1472, 761 cm ; h nmr (500 mhz, dmso - d6) : = 2.86 (s, 6h, ch3), 7.14 (s, 2h), 7.31 (m, 2h), 7.51 (m, 6h), 7.84 (d, 1h, j = 7.2 hz), 7.86 (d, 1h, j = 8.3 hz), 7.98 (s, 2h), 8.14 (d, 1h, j = 8.3 hz), 8.24 (d, 1h, j = 7.2 hz), 12.24 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 37.2 (2 ch3), 55.7 (c), 111.4 (2 c), 115.7 (2 ch), 117.5 (2 c), 122.6 (2 ch), 125.6 (ch), 126.6 (ch), 126.5 (ch), 127.5 (2 c), 128.2 (ch), 129.0 (ch), 130.1 (ch), 130.4 (ch), 131.9 (ch), 128.5 (ch), 131.2 (2 c), 131.6 (ch), 137.5 (2 c), 138.4 (c), 141.2 (c), 143.8 (2 c), 153.6 (c), 167.2 (c) ppm ; ms (ei), m / z (%) = 634 (m, 25), 384 (75) ; hrms (ei) found : m, 632.0215. c33h22brn4 requires m, 632.0211 ; anal calcd. for c33h22brn4, c, 62.48 ; h, 3.50 ; n, 8.83. found : c, 62.51 ; h, 3.41 ; n, 8.89. yellow needles, mp = 228230c, ir (kbr) : max = 3427, 1438, 747 cm ; h nmr (500 mhz, dmso - d6) : = 6.72 (s, 2h), 6.93 (m, 2h), 7.06 (m, 2h), 7.32 (m, 4h), 7.64 (m, 2h), 7.75 (d, 1h, j = 7.4 hz), 7.96 (d, 1h, j = 7.4 hz), 8.09 (s, 1h), 8.14 (d, 1h, j = 8.3 hz), 12.24 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 53.7 (c), 109.4 (2 ch), 115.4 (2 c), 119.4 (2 ch), 122.7 (ch), 125.9 (ch), 126.8 (2 ch), 127.5 (2 c), 127.9 (2 ch), 1285 (ch), 129.4 (ch), 130.2 (ch), 130.8 (ch), 131.5 (2 ch), 131.8 (c), 130.9 (c), 137.5 (2 c), 138.8 (c), 140.7 (c), 142.8 (2 c), 158.6 (c), 166.2 (c) ppm ; ms (ei), m / z (%) = 517 (m, 22), 257 (65) ; hrms (ei) found : m, 516.0903. c31h18cl2n4 requires m, 516.0908 ; anal calcd. for c31h18cl2n4, c, 71.96 ; h, 13.70 ; n, 10.83. green needles, mp = 199201c, ir (kbr) : max = 3435, 1452, 729 cm ; h nmr (500 mhz, dmso - d6) : = 6.80 (s, 2h), 7.01 (m, 2h), 7.12 (m, 2h), 7.42 (m, 3h), 7.56 (m, 2h), 7.63 (d, 1h, j = 7.5 hz), 7.89 (d, 1h, j = 7.5 hz), 8.10 (s, 1h), 12.37 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 53.5 (c), 107.9 (2 ch), 113.6 (2 c), 117.7 (ch), 121.7 (ch), 123.9 (ch), 124.7 (2 ch), 126.7 (2 c), 128.3 (2 ch), 128.8 (ch), 129.0 (ch), 131.2 (ch), 131.8 (ch), 132.5 (2 ch), 133.5 (c), 134.8 (c), 136.9 (2c), 137.8 (2 c), 141.7 (c), 144.6 (2 c), 156.9 (d, jcf = 253.1 hz, 2 c f), 168.0 (c) ppm ; f nmr (dmso - d6, 470 mhz) : 73.68 ; ms (ei), m / z (%) = 552 (m, 12), 292 (65) ; hrms (ei) found : m, 552.071012. ; h, 2.91 ; n, 10.12. found : c, 67.34 ; h, 2.98 ; n, 10.21. green needles, mp = 223225c, ir (kbr) : max = 3425, 1434, 739 cm ; h nmr (500 mhz, dmso - d6) : = 6.69 (s, 2h), 6.89 (m, 2h), 6.89 (m, 2h), 7.12 (m, 3h), 7.35 (m, 2h), 7.56 (d, 1h, j = 7.2 hz), 7.69 (d, 1h, j = 7.2 hz), 8.05 (s, 1h), 12.22 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 54.7 (c), 111.2 (2 ch), 114.6 (2 c), 118.8 (ch), 120.8 (ch), 122.7 (ch), 123.4 (2 ch), 125.6 (2 c), 126.8 (2 ch), 127.6 (ch), 128.2 (ch), 130.2 (ch), 131.0 (ch), 133.5 (ch), 133.8 (c), 135.4 (c), 136.4 (2 c), 137.4 (2 c), 140.6 (c), 143.8 (2 c), 155.6 (d, 2 c), 169.4 (c) ppm ; ms (ei), m / z (%) = 675 (m, 11), 415 (34) ; hrms (ei) found : m, 671.9112. c, 55.14 ; h, 2.39 ; n, 8.30. found : c, 55.23 ; h, 2.38 ; n, 8.33. yellow needles, mp = 253255c, ir (kbr) : max = 3434, 2982, 1456, 740 cm ; h nmr (500 mhz, dmso - d6) : = 2.32 (s, 3h, ch3), 2.42 (s, 3h, ch3), 6.89 (s, 2h), 6.91 (m, 2h), 7.01 (m, 2h), 7.21 (m, 3h), 7.30 (m, 2h), 7.46 (d, 1h, j = 7.3 hz), 7.51 (d, 1h, j = 7.3 hz), 8.12 (s, 1h), 12.43 (s, 2h, nh) ppm ; c nmr (125 mhz, dmso - d6) : = 21.0 (ch3), 21.6 (ch3), 55.1 (c), 111.2 (2 ch), 114.6 (2 c), 118.8 (ch), 120.8 (ch), 122.7 (ch), 123.4 (2 ch), 125.6 (2 c), 126.8 (2 ch), 127.6 (ch), 128.2 (ch), 130.2 (ch), 131.0 (ch), 133.5 (ch), 133.8 (c), 135.4 (c), 136.4 (2 c), 137.4 (2 c), 140.6 (c), 143.8 (2 c), 155.6 (d, 2 c), 169.4 (c) ppm ; ms (ei), m / z (%) = 545 (m, 10), 285 (35) ; hrms (ei) found : m, 544.1200. c33h22cl2n4 requires m, 544.1205 ; anal calcd. for c33h22cl2n4, c, 72.66 ; h, 4.07 ; n, 10.27. brown needles, mp = 211213c, ir (kbr) : max = 3056, 2984, 1715, 1625, 1451, 749 cm ; h nmr (500 mhz, dmso - d6) : = 3.20 (s, 6h, 2 ch3), 3.35 (s, 6h, 2 ch3), 6.72 (d, 4h), 6.98 (m, 4h), 8.21 (d, 2h, j = 7.5 hz), 8.13 (d, 2h, j = 7.5 hz) ppm ; c nmr (125 mhz, dmso - d6) : = 22.3 (2 ch3), 23.1 (2 ch3), 80.1 (c), 110.2 (4 ch), 113.4 (2 c), 114.8 (2 ch), 115.7 (4 ch), 117.6 (2 ch), 145.2 (2c), 196.8 (2c) ppm ; ms (ei), m / z (%) = 384 (m, 15), 144 (26) ; hrms (ei) found : m, 384.1819. c25h24n2o2 requires m, 384.1821 ; anal calcd. for c25h24n2o2, c, 78.10 ; h, 6.29 ; n, 7.29. found : c, 72.69 ; h, 4.08 ; n, 10.33. yellow needles, mp = 231233c, ir (kbr) : max = 3050, 1705, 1456, 745 cm ; h nmr (500 mhz, dmso - d6) : = 2.65 (s, 3h, ch3), 3.20 (s, 6h, 2 ch3), 3.35 (s, 6h, 2 ch3), 6.72 (d, 3h), 6.98 (m, 3h), 8.21 (d, 2h, j = 7.5 hz), 8.13 (d, 2h, j = 7.5 hz) ppm ; c nmr (125 mhz, dmso - d6) : = 20.4 (ch3), 22.3 (2 ch3), 23.1 (2 ch3), 80.1 (c), 110.2 (3 ch), 113.4 (3 c), 114.8 (3 ch), 115.7 (3 ch), 117.6 (2 ch), 145.2 (2c), 196.8 (2c) ppm ; ms (ei), m / z (%) = 412 (m, 17), 172 (35) ; hrms (ei) found : m, 412.2209. c27h28n2o2 requires m, 412.2211 ; anal calcd. for c27h28n2o2, c, 78.61 ; h, 6.84 ; n, 6.79. found : c, 72.70 ; h, 6.90 ; n, 6.81. yellow needles, mp = 225227c, ir (kbr) : max = 3085, 1712, 1456, 729 cm ; h nmr (500 mhz, dmso - d6) : = 3.23 (s, 6h, 2 ch3), 3.29 (s, 6h, 2 ch3), 6.81 (d, 3h), 6.92 (m, 3h), 8.04 (d, 2h, j = 7.2 hz), 8.15 (d, 2h, j = 7.2 hz) ppm ; c nmr (125 mhz, dmso - d6) : = 22.3 (2 ch3), 23.1 (2 ch3), 80.1 (c), 110.2 (3 ch), 113.4 (3 c), 114.8 (3 ch), 115.7 (3 ch), 117.6 (2 ch), 145.2 (2c), 196.8 (2c) ppm ; ms (ei), m / z (%) = 453 (m, 14), 213 (75) ; hrms (ei) found : m, 412.2209. ; h, 4.89 ; n, 6.18. found : c, 66.27 ; h, 4.91 ; n, 6.14. with an ever increasing quest for the exploration of newer reactions in ionic liquids, the ionic liquid plays the dual role of solvent and promoter. herein, we wish to report, for the first time, the use of [hbim]bf4 ionic liquid as novel and recyclable polar reaction media for the synthesis of bis - indolylindane-1,3-dione, 2-(1,3-dihydro-1h-[2,3]biindolyl-2-ylidene)-indan-1,3-diones, and 2,2-bis(4-(dimethylamino)phenyl)-1h - indene-1,3(2h)-denies (scheme 1). first, 1 mmol ninhydrin (1) and 2 mmol different substituted indole derivatives (2a e) were added to a 20 ml round bottom flask containing 2 ml [hbim]bf4 ionic media. the resulting mixture stirred the appropriate time to afford his - indolylindane-1,3-dione, 2-(1,3-dihydro-1h-[2,3]biindolyl-2-ylidene)-indan-1,3-diones 3(a e) in excellent yield (table 1). differently substituted indole derivatives (2a e) were reacted with ninhydrin (1). of these, 5-fluoro (2b), 5-bromo (2c), 2-methyl (2d), 1-methyl (2e) indoles reacted smoothly to produce novel bis - indolylindane-1,3-dione, 2-(1,3-dihydro-1h-[2,3]biindolyl-2-ylidene)-indan-1,3-diones (table 1, entries 25). the characteristic quaternary carbon signals 3(a e) clearly indicate the attachment of two indole moieties at c-2 of ninhydrin. next, i attempted to synthesize novel indene-1,3(2h)-denies reaction of ninhydrin (1) with 1,2-phenylenediamine 4(a c) and indole 2(a e) derivatives under the same reaction condition (scheme 1). interestingly, a variety of indoles including n-1, c-2, and c-6 substituted indoles participated well in this reaction and gave the corresponding products in excellent yield. as seen, indoles carrying electron - donating substituent act well in this reaction conditions (table 2, entries 615). reaction ninhydrin (1, 1 mmol) and different substituted n, n - dimethyl aniline 6(a c) went smoothly in the ionic liquid [hbim]bf4 under solvent free conditions to afford the corresponding products 7(a c) in high yields (table 3, entries 13). the nucleophilic substitution at c-3 of indole, produced intermediate b, via 1,3-migration hydrogen and aromatization of the indole ring produced c intermediate, which was attacked by another indole moiety and dehydration to form intermediate d. finally, intermediate c after hydrogen remove formed the bis - indolylindane-1,3-dione, 2-(1,3-dihydro-1h-[2,3']biindolyl-2-ylidene)-indan-1,3-diones 3(a e) (scheme 2). in this case, initially the condensation of ninhydrin (1) and 1,2-phenylenediamine 4(a c) took place to produce the intermediate efa, which reacted with 2 mol of indoles 2(a e) via the intermediate a to generate 5aa5ae, 5ba5be, 5ca5ce in high yield (table 2, entries 1 - 15) (scheme 3). reaction ninhydrin (1) with different substituted n, n - dimethyl aniline 6(a c) via intermediates transformation ghi, finally with hydrogen removes and aromatization to produce 7(a we also investigated the recycling of the ionic liquid [hbim]bf4 under solvent free conditions. the reusability of il was tested using a model reaction of ninhydrin and insole, 4,5-dimethylbenzene-1,2-domain and 2-methyl-1h - indole, and n, n - dimethylaniline as substrates for preparation of 3aa, 5bd, and 7a, respectively. after completion of the reaction, the reaction mixture was filtered to isolate the desired il which was washed with ethyl acetate in order to remove the impurities and unreacted substrates and used for the next run. it was observed that there was no any substantial loss of catalytic activity even after the fifth run as indicated in figure 1. thus, we investigated the atom economy for each derivative synthesized and listed the values in tables 1, 2, and 3 (figure 2) (see supplementary data available online at http://dx.doi.org/10.1155/2013/528329). from the values, it is clearly seen that the protocols are atom economy and generate the least amount of waste which is a complimentary ecofriendly aspect of catalyst. the results show that present ionic liquids such as [hbim]bf4 are efficient catalyst with respect to the low reaction times and the high yields. in summary, we describe a novel use of ionic liquids for the synthesis of an efficient synthesis of bis - indolylindane-1,3-dione, 2-(1,3-dihydro-1h-[2,3]biindolyl-2-ylidene)-indan-1,3-diones, and 2,2-bis(4-(dimethylamino)phenyl)-1h - indene-1,3(2h)-denies using [hbim]bf4 ionic medium in excellent yields. the notable features of this procedure are high conversions, operational simplicity, good reaction rates, clean reaction profiles, and ease of isolation of products, which make this process quite simple, convenient, and environmentally benign for the synthesized compounds. | we prepared a brand new molecule in one step for the synthesis of bis - indolylindane-1,3-dione and indan-1,3-diones from the reaction of ninhydrin and 3 substituted / unsubstituted indoles using [hbim]bf4 ionic liquid in excellent yields. the method was also used for the synthesis of novel indene-1,3(2h)-denies derivatives. |
it is crucial to control qd formation to arrange qds with high uniformity and high density. little is known, however, of the growth mechanism of qds, in particular the surface reconstruction of a wetting layer (wl) and qd nucleation sites in stranski - krastanow (s - k) mode. because the surface reconstruction changes microscopically and dynamically in the course of wl growth, an in situ scanning tunneling microscopy (stm) technique such as stmbe is essential. atomic - scale in situ observation of an inas wl on a gaas(001) substrate has revealed that the surface reconstruction of the inas wl changes from c(4 4) to the mixture of (1 3)/(2 3) and (2 4) prior to qd formation. it is considered that such surface reconstructions form domains on inas wl, and investigating their distribution will give a clue to understand a qd nucleation mechanism. the distribution of reconstruction domains is characterized by spatial point patterns : a regular (ordered) pattern, a poisson (random) pattern, and a clustered (aggregated) pattern. in a regular pattern voronoi tessellation, that is a polygonal decomposition of a space by perpendicular bisector lines among neighboring points, is often used in spatial point analysis. the standard deviation of voronoi cell areas represents well the point patterns. for more precise analysis, the distance to the nearest neighbor point from an arbitrary position, r1, let p(t) denote the probability that r1 occurs less than t. the nearest neighbor distance function p(t) is identical to the probability of plotting a random point within the union area of circles whose radii are t and centers are the points., we investigate the surface reconstruction domains on inas wl preceding qd formation by using in situ stm observation and discuss their distribution using spatial point analysis. a piece (11 13 0.6 mm) of gaas(001) first, the surface was thermally cleaned to remove the oxide layer under 1 10 pa of an arsenic atmosphere in an mbe growth chamber. next, a gaas buffer layer was grown on the surface by using mbe until atomically smooth surface was obtained. the substrate was annealed at 430c for 0.5 h to confirm the formation of c(4 4) reconstruction with reflection high - energy electron diffraction (rheed). after 1.5 monolayer (ml) of inas wl growth, the substrate temperature was decreased to 300c, and the as4 flux was shut off. figure 1 shows the stm image of 1.5 ml of inas wl just prior to qd formation at 300c. the pitch of the as stripes, corresponding to the unit cell length along azimuth of inas surface reconstructions, was measured from the stm line profile for each cell. the pitch was classified into three ranges, namely the range from 0.6 to 1.0 nm, the range from 1.0 to 1.4 nm assuming (1 3)/(2 3), and the range from 1.4 to 2.0 nm assuming (2 4). most of the cells had (1 3)/(2 3) or (2 4) surface reconstruction. four neighboring cells having the same surface reconstruction were located in the diagram as indicated by oval markers in fig. a set of these cells correspond to a surface reconstruction domain extending for 16 nm. for each of (1 3)/(2 3) and (2 4) surface reconstructions, the center points of the domains were marked, and their coordinates were measured by using imagej software. the center coordinates were used for the voronoi tessellations of the stm view field (fig. the cells touching the frame of the stm image was not used for the computation since they are not true voronoi cells. for the calculation of p(t), t was normalized by the factor f as follows : where s is the total area of voronoi cells, which are not touching the frame, and n is the number of valid reconstruction domains. 50 nm 50 nm stm image of inas wl on gaas(001) pitch of arsenic dimer row for each cell of 25 25 mesh in fig. 1 surface reconstruction domains of a (1 3)/(2 3) and b (2 4) indicated by oval markers voronoi tessellations of stm view field of fig. 1 according to a (1 3)/(2 3) domains and b (2 4) domains the density of each surface reconstruction domain is listed in table 1. 1. since these values were comparable to the typical density (1 10 cm) of inas qd precursors nucleating afterward, it implies the possibility that a qd formation pattern is based on the distribution of surface reconstruction domains. density, d, and standard deviation of voronoi cell area, vc of surface reconstruction domains the standard deviation of voronoi cells for each surface reconstruction domain is also listed in table 1. the total area of the voronoi cells that are not touching the edge of the view field was normalized to 1.0 for the calculation. a typical value of a poisson pattern by scattering 50 random points was 0.4, whereas that of the surface reconstruction domains was 0.3. the nearest neighbor distance function p(t) of the surface reconstruction domains will give more precise information. figure 5 shows the traces of p(t), which were calculated for the surface reconstruction domains as well as a typical regular point pattern. the p(t) envelope region of typical poisson patterns was calculated by accumulating 50 simulations of scattering 50 random points. traces of the surface reconstruction domains were plotted between that of the ordered pattern and the poisson envelope region. this shows that the surface reconstruction domains were distributed in an ordered pattern rather than a random pattern. if we compare p(t) traces between surface reconstruction domains and qd precursors just after nucleation, the relationship between them and qd growth mechanism will be known more precisely. nearest neighbor distance function p(t) of surface reconstruction domains on inas wl as well as that of typical ordered point pattern. envelope region of typical poisson patterns by accumulating 50 simulations is also shown in conclusion, (1 3)/(2 3) and (2 4) domains were located in the in situ stm image of 1.5 ml of inas wl preceding qd nucleation. the densities of the reconstruction domains were similar to that of qd precursors just after nucleation. spatial point analysis of the surface reconstruction domains revealed that the domains were distributed in an ordered pattern rather than a typical random pattern. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. | surface of an inas wetting layer on gaas(001) preceding inas quantum dot (qd) formation was observed at 300c with in situ scanning tunneling microscopy (stm). domains of (1 3)/(2 3) and (2 4) surface reconstructions were located in the stm image. the density of each surface reconstruction domain was comparable to that of subsequently nucleated qd precursors. the distribution of the domains was statistically investigated in terms of spatial point patterns. it was found that the domains were distributed in an ordered pattern rather than a random pattern. it implied the possibility that qd nucleation sites are related to the surface reconstruction domains. |
alpha - amylase [ec 3.2.1.1 ] cleaves the 1,4--d - glycosidic linkages between adjacent glucose unit inside the linear starches, glycogen, and oligosaccharides in a random manner. multifarious uses of alpha - amylases as a major starch degrading agent in food, paper, textile, and brewing industry necessitates its prolific production that can be effectively met up by solid state fermentation (ssf). agrowastes like wheat bran, rice bran, and coconut oil bran have replaced the high cost media generally used in submerged fermentation for alpha - amylase preparation because of their simplicity, low cost, easy availability, better productivity, and lesser water output. high starch content of almost all agrowastes (6070% by weight) can be effectively utilized as a major nutrient source by microorganisms like bacteria, fungi, and so forth, for the synthesis of inducible alpha - amylase which is under the control of catabolic repression. plethora of evidences exists in favor of wheat bran as the best sources among all the agrosources for extracellular amylase production [4, 5 ]. based on the prior knowledge of primary solid state fermentation culture condition, the present study was initiated using wheat bran as a prime source of nutrient and b. amyloliquefaciens (mtcc 1270) as the producer organism at ph 7 to increase the alpha - amylase yield through media optimization.earlier reports are also in agreement with the fact that most of the bacillus species, namely, bacillus licheniformis and bacillus stearothermophilus, are the most effective producers of alpha - amylase [511 ]. most of the amylases are metalloenzyme requiring ca for their activity, structural integrity, and stabilization [1214 ]. at least three calcium binding sites have been located on barley alpha - amylase isoform that is also visible for plants, mammals, fungi, and bacteria [15, 16 ]. for b. amyloliquefaciens, the calcium binding site is contributed by three conserved regions of the polypeptide chain comprising residues gly - ala, ile - his, and ser - ser. similar stabilization effect has been provided by chloride and nitrate ions as reported by aghajari.. in this work major emphasishas been given in search of conditions as well as for parameters like ions and sugar alcohols whose presence in the fermentation media stimulates alpha - amylase production from ssf. bacillus amyloliquefaciens (mtcc 1207, imtech, chandigarh) was used as working strain for solid state fermentation (ssf) extraction of alpha - amylases. wheat bran was collected from local market and solid state fermentation has been carried out with 4 gm dry wheat bran in a 100 ml erlenmeyer flask. the moisture level of the wheat bran was adjusted to 50% (w / w) with autoclaved distilled water. 25 ml of nutrient broth was taken in a 100 ml flask and was inoculated with a loop full of bacillus amyloliquefaciens cells from a 24-hour - old slant and kept at 37c in a shaker. after 16 hours of growth, 1 ml inoculum (1.52 10 cfu / ml) from this broth culture was added in the wb. it was fermented for various fermentation periods (24 and 48 hours) at different temperatures (30, 33, 37, and 42c). after 24 and 48 hours of fermentation, the fermented media containing wheat bran were mixed with 25 ml 20 mm phosphate buffer (ph = 7.0) for 30 minutes at 4c in a rotary shaker at 150 rpm. the suspension was then centrifuged at 8000 rpm for 15 min at 4c. alpha - amylase activity of the extract was measuredby dns method. in briefthe reaction mixture containing 1% soluble starch, 20 mm phosphate buffer (ph = 7), and fermented extract was taken and incubated at 37c for 20 minutes followed by the addition of 3,5-dinitrosalicylic acid (dns). the amount of the reducing sugar liberated during assay was estimated by measuring color development at 540 nm by uv - vis spectrophotometer. 1u of amylase activity is defined as the amount of enzyme that liberated micromole of maltose per minute under standard assay condition. a 2% starch agar plate (beef extract0.3%, soluble starch1%, and agar2%) has been prepared and streaked from a 24-hour - old culture of bacillus amyloliquefaciens. the plate was grown for 48 hours in 37c. to check the starch hydrolysis property of alpha - amylase 4 gram of wb was supplemented with various concentrations of ions like ca, cl, and no3 (0.1, 0.2, and 0.4 m) from 0.5 m respective stocks of cacl2, nacl, and nano3 salt solutions for a comparative analysis regarding the yield of alpha - amylase with that of the control wb. the relative humidity was kept constant at a level of 50% (w / w) with autoclaved distilled water. the content of the flask was autoclaved and tested for solid state fermentation for 48 hours at 37c with the addition of 1 ml inoculum (1.52 10 cfu / ml) from the broth culture. similar protocol of ssf has been followed for 0.5 and 1% d - inositol and d - mannitol supplementation into the wb, with proper moisture level adjusted. control wb was autoclaved and kept for solid state fermentation under similar experimental condition without any salt and sugar supplementation with equal inoculums size as earlier. effect of each parameter was studied in triplicate and graphically represented as the mean sd (n = 3) using origin 5. the starch agar plate was inoculated with b. amyloliquefaciens (mtcc 1270) and kept for 48 hours at 37c. the plate was flooded with iodine and clear zone of starch hydrolysis has been observed (figure 1). this ensures that this microorganism secretes amylase that is capable of starch hydrolysis. to optimize the appropriate fermentation period for high yield alpha - amylase production, the study had been initiated with wheat bran and b. amyloliquefaciens (mtcc 1270) for 24, 48, and 72 hours. the values of specific activity of alpha - amylase were 7.25 0.25 u / mg, 14.25 0.24 u / mg, and 13.5 0.75 u / mg, respectively, after 24, 48, and 72 hours using ssf under identical fermentation conditions (time and temperature) (figure 2). fermentation conducted for longer period of time was accompanied with decline in the alpha - amylase activity caused by denaturation and degradation of enzyme products. temperature had profound effect on the growth of the microorganism as well as on the enzyme activity. effect of temperature on alpha - amylase production through solid state fermentation had been tested for two fermentation hours (24, 48) and at four different temperatures (30, 33, 37, and 42c). a 24-hour ssf at 37c yielded maximum alpha - amylase production with an activity (7.25 0.25 u / mg) that had been further enhanced with longer fermentation period after 48 hours at the same temperature. although alpha - amylase production was evident at all the four temperatures studied for fermentation, 37c was the best among all to produce maximum amylase from ssf with a specific activity of 14.25 0.24 u / mg (figure 3). this result corroborated well with optimum temperature of alpha - amylase (data not shown) that came around 40c using standard dns assay method. after 42c alpha - amylase activity declined due to the metabolic heat generated as an outcome of microbial growth in the solid state fermentation medium. effect of calcium (ca) on amylase production through solid state fermentation had been checked for 48 hours fermentation at four different temperatures (30, 33, 37, and 42c). effect of ca at a concentration of 100 mm had been tested with a control (without any ion). compared to control the yield of alpha - amylase increased in presence of ca (figure 4). among all the temperatures, 37c solid state fermentation carried out with calcium ion gave maximum alpha - amylase activity (27 1.05 u / mg) where as in absence of calcium it was about 50% less (15 1.75 u / mg). this indicated the supportive role of calcium (ca) in the preservation of amylase structural integrity and stability. there was a gradual increase in the specific activity of amylase from 30c to 37c in presence of calcium (ca) with a downfall of amylase activity at 42c (9.5 1.1 u / mg). effect of chloride and nitrate ion at various concentration ranges (100, 200, and 400 mm) had been tested in order to check the effect of negative ions on the alpha - amylase yield from ssf with a control (without any ion). the result was noteworthy with respect to improved amylase activity in presence of both cl and no3 salts in the ssf media. presence of 400 mm chloride (cl) and (no3) in the fermentation mixture improved amylase yield from 14.5 0.25 u / mg to 58 3 u / mg and 68 0.25 u / mg, respectively, compared to control without any salt (figure 5). this observation can be correlated well with an insight to the alpha - amylase crystal structure derived from porcine pancreatic source at 5 resolutions. chloride ion stabilized amylase structure by making electrostatic interaction with the neighboring positively charged residues like arg 195, lys 257, and arg 337, which were on the other hand very close to the active site cleft of amylase. this was in congruence with the observation by lifshitz and levitzky, identifying one lysine residue close to the active site region that bonded with the chloride ion if present in the vicinity of the enzyme. ssf was conducted in presence and absence of d - inositol and mannitol at 37c for 48 hours and the alpha - amylase activity had been presented in figure 5. the increase in inositol and mannitol concentration in the fermentation media was accompanied with the rise in amylase activity (figure 6). 1% inositol and mannitol had maximum amylase activity of 48.5 1 u / mg and 51.24 1.75 u / mg, respectively, compared to control 14.5 0.25 u / mg. in order to elucidate the role of all the supplements in enhancing alpha - amylase activity in the fermented extract, the extract containing alpha - amylase was subjected to thermal decay at 37c temperature for various incubation periods ranging from 0 to 60 minutes in absence and presence of ions and sugar alcohols. d - inositol and d - mannitol have offered considerable protection against heat induced denaturation at 37c after one hour as manifested from the retention of residual enzyme activity around 73 and 77% compared to 52% observed for amylase in extract alone in absence of any stabilizer. similar trend of stabilization of alpha - amylase activity in presence of various salt ions (100 mm) like calcium, chloride, and nitrate has also been noticed to be subjected under thermal denaturation under similar conditions as before. all the salt ions have protected around 80% of amylase activity compared to control without salts having activity around 52% (figure 7). solid state fermentation carried out with cheap source like wheat bran seemed to be promising for amylase production using bacillus amyloliquefaciens. optimization of different fermentation hours and temperatures for solid state fermentation had been attempted and 48 hours solid state fermentation at 37c gave maximum amylase yield with wheat bran as major nutrient source. this was in agreement with the earlier reports by number of workers that elicited solid state fermented production of alpha - amylase at the range of temperatures from 3760c using number of bacillus species [2427 ]. a wide range of temperature from 3580c had also been proved effective for amylase production using various bacterial species [2830 ]. with an aim to improve the amylase yield, solid state fermentation had been conducted with different ion (chloride, nitrate, and calcium) fortifications. the yield of alpha - amylase had been significantly improved in the fermentation mixture in presence of ions. supported alpha - amylase production as manifested from the increase in yield of alpha - amylase in the fermentation media. role of calcium as well as chloride ion in stabilization of amylase structure had been reported earlier by many workers. role of calcium ion in the stability and catalytic activity of alpha - amylase had been a topic of research since years. presence of calcium ion in the fermentation media was stimulatory as it increased the yield of amylase from 15 u / mg to 27 u / mg in presence of 100 mm ca. this corroborated well with earlier reports discerning the ability of ca to enhance amylase stability and activity from bacillus spp [10, 32, 33 ]. ca significantly improved amylase production by b. sphaericus and b. amyloliquefaciens from ssf [34, 35 ]. equally revealing was the information that addition of ca in the media accelerated amylase production by bacillus spp. as observed by a number of workers [3640 ]. it can been predicted from the crystal structure of amylase that calcium ion was involved in ionic interaction with charged residues like asn 100, his 201 of domain a, and asp 159 and asp 167 of domain b of amylase. active site of amylase was located between domains a and b and calcium ion formed an ionic bridge between a and b domains of amylase promoting its stability and catalytic activity. allosteric activation of amylase by chloride ion has been reported by d'amico. in some gram no3 or clo3 also strengthened amylase activity delineating the fact that any negative charge played a pivotal role facilitating starch degradation reaction [18, 42, 43 ]. compared to chloride, nitrate had offered better stabilization to amylase owing to its planer, triangular geometry that could penetrate well to the active site of alpha - amylase. an insight to the crystal structure of ppa at 5 resolutions as discussed earlier was in agreement with the supportive role of chloride ion as stabilizer. this was in conformity with the present observation that presence of negative ions in the production media as well as in assay mixture enhanced amylase activity (data not shown). inclusion of sugar alcohol like d - inositol and d - mannitol in the ssf production media improved amylase yield by 3.5-fold with respect to the control. result was consistent with the findings by srivastava and baruah (1986) that also supported improved alpha - amylase production using d - inositol in the ssf media [17, 18 ]. ions and sugar alcohol might be protecting alpha - amylase against heat induced denaturation by offering stabilization through hydrogen bond formation with polar residues of amylase due to the presence of number of hydroxyl groups on d - inositol and d - mannitol. in conclusion, amylase production using supplementation of ions and sugars in the solid state fermentation media seemed to increase the yield of amylase that can be propagated in ssf which is carried out with other bacillus species. however this study delineated the supportive role of stabilizing ions and sugars to improve the amylase yield from ssf and can be useful as digestive because of its starch liquefaction property. | demand for microbial amylase production persists because of its immense importance in wide spectrum industries. the present work has been initiated with a goal of optimization of solid state fermentation condition for amylase using agroindustrial waste and microbial strain like b. amyloliquefaciens (mtcc 1270). in an aim to improve the productivity of amylase, fermentation has been carried out in the presence of calcium (ca+2), nitrate (no3), and chloride ions (cl) as well as in the presence of d - inositol and mannitol. amylase needs calcium ion for the preservation of its structure, activity and stability that proves beneficial also for amylase production using solid state fermentation. the inclusion of ions and sugars in the ssf media is promising which can be explained by the protection offered by them against thermal decay of amylase at various incubation periods at 37c. |
teratomas are tumors composed of tissues originating from all three germ cell layers (kumar., 2005). primary central nervous system (cns) teratomas are rare, and can manifest as an intracranial and/or spinal lesions (smoker., 1986 ; agrawal., primary cns teratomas, similar to other germ cell tumors, usually arise in midline structures (schild., 1996 ; kumar.,. a higher prevalence of these tumors is observed in the far east (jennings., 1985 ; suh., these tumors occur mostly in the first and second decade of life, although age distribution from birth to the sixth decade of life has been reported (ho and liu, 1990 ; agrawal., 2010). teratomas are classified as mature, immature, or teratomas with malignant transformation (love., 2008). mature teratomas have fully differentiated ectodermal, mesodermal, and endodermal tissues. presence of undifferentiated tissues resembling fetal tissues defines teratoma as immature. malignant transformation of teratoma include squamous cell carcinoma (matsutani., 1997), adenocarcinoma (freilich., 1995), rhabdomyosarcoma (bjornsson., 1985), leiomyosarcoma (skullerud., 1995), and erythroleukemia (heimdal., 1991) among others. common presenting symptoms are headaches, visual disturbances, and other manifestations of raised intracranial pressure (icp ; ropper and samuels, 2009). we are reporting a case of a young man with primary teratocarcinoma disseminated to the posterior fossa and spinal leptomeninges. a 37-year - old man presented to another institution with generalized headaches associated with nausea and vomiting. he had no photophobia or phonophobia, double or blurred vision, limb weakness, or numbness. he drank an average of 6 l of water daily and had marked polyuria. magnetic resonance imaging (mri) of the brain with and without contrast was unremarkable. three months after onset of symptoms, he had worsening headaches along with posterior neck pain and vomiting. his headaches improved and a ventriculo - peritoneal (vp) shunt was placed the following day. a supratentorial convexity dural and leptomeningeal biopsy was done, but no definitive diagnosis was reached. he again had severe, generalized headaches, recurrent vomiting, and binocular horizontal diplopia. ct head without contrast showed the vp shunt in proper place (figure 1). rheumatology consult suggested a possible autoimmune disorder, since he had positive ana and ss - b antibodies. ss - a, jo-1 antibody, anti - protease 3, anti - myeloperoxidase, smith antibody, rnp antibody, sm / rnp antibody, scl-70, dsdna antibody, ribosomal p protein antibody, chromatin antibody, and anti - centromere antibody were unremarkable. ct chest / abdomen / pelvis with and without contrast showed a right kidney simple cyst and no adrenal masses. axial ct head, 8 months after onset of symptoms, showed a vp shunt in place. two months later, 10 months after initial presentation, he again complained of headaches, vomiting, and horizontal binocular diplopia. a csf protein content of 491 mg / ml and a csf glucose of 66 mg / ml were noted this time (table 1). he had revision of the vp shunt and another shunt was placed, this time in the fourth ventricle. several days later, he was noted to have bilateral sixth and seventh cranial nerve palsies, bilateral lower extremity weakness, unsteady gait, and urinary retention. repeat csf analysis showed a csf protein content of 1201 mg / dl and a csf glucose of 44 mg / dl (table 1). axial t2 flair image demonstrates mild ventriculomegaly with periventricular signal abnormality consistent with acute hydrocephalus. neurologic examination was remarkable for bilateral sixth cranial nerve (cn vi) and lower motor neuron seventh cranial nerve (cn vii) palsies as well as asymmetric lower extremity paraparesis. mri of the entire neuro - axis with and without contrast showed diffuse leptomeningeal enhancement of the basal cisterns and posterior fossa, as well as leptomeningeal enhancement throughout the spinal cord with loculated fluid collection in subdural space causing distortion and compression of the spinal cord (figures 3 and 4). sagittal t1 post - contrast mri of the cervical spine shows diffuse leptomeningeal enhancement in the posterior fossa and cervical spine. sagittal t1 post - contrast image of thoracic spine demonstrates loculated fluid collection in subdural space (arrows) with mass effect on the cord. because his paraparesis had progressed within hours of admission, emergent neurosurgical decompression of the spinal lesion was undertaken. histological analysis of the surgical specimen designated as arachnoid and subdural material showed portions of cartilage, soft tissue with hair follicles, a cyst lined with malignant epithelial cells consistent with a teratocarcinoma. ct chest / abdomen / pelvis showed a 5 cm right kidney simple cyst. serum alpha fetoprotein (afp) and -human chorionic gonadotropin (-hcg) were normal. the patient developed labile blood pressure and bilateral lower extremity deep venous thrombosis, and died within days of pulmonary embolism despite therapeutic heparinization and inferior vena cava (ivc) filter placement. at autopsy brain examination showed the leptomeningeal involvement by a contiguous white, icing - like plaque. the leptomeninges at the base of the brain were filled by white yellow, firm, granular, thickened membranes causing mass - like effect at the ventral surface of the midbrain, and pons. examination of the spinal cord at the previous surgical site showed white plaques attached to the dura ranging in size from 0.1 to 0.2 cm. the leptomeningeal space of the entire spinal cord was filled with dull, white, icing - like membrane (figure 5). the same white yellow membranous structure encased the cauda equina with significant edema of the lumbar spinal cord. immuno - histochemical analysis of the surgical specimen showed that the epithelial component was positive for pankreatin, vimentin, p63, -hcg as well as focally for s-100 (figure 6), and negative for ttf-1, ck7, ck20, cdx-2, afp, and mucin. (a) gross photo of the base of the brain showing icing - like leptomeningeal thickening over the midbrain, pons, and medulla (circle). (b) gross photo of the spinal cord with similar leptomeningeal, icing - like thickening over the surface of the spinal cord. (e) mesenchymal / cartilaginous component (low power ; insert : high power). since no neoplasm was found outside of the cranium or spinal cord, a diagnosis of primary cns teratocarcinoma was made. in a series of 254 teratomas from 1928 to 1982, only nine cns teratomas were identified (excluding those involving the sacro - coccygeal region). data on primary cns teratomas at the nizam s institute of medical sciences in india showed a total of 14 teratomas ; 6 were intracranial and 8 were spinal (agrawal., 2010). the origin of cns germ cell tumors, including teratomas, is as yet unresolved. three mechanisms have been proposed : neoplastic transformation of normal cns germ cells, development of ectopic germ cell nests, or migration of germ cells to the cns later in life (love., 2008). serum afp and -hcg are routinely obtained in patients with suspected germ cell tumors. marked elevation of afp corresponds with histopathological presence of a yolk sac component within the germ cell tumor. a moderate elevation might point toward teratoma with enteric tissue component. increased -hcg suggests choriocarcinoma, mixed germ cell tumors, or germinomas (hoffman.. marked elevation of the csf protein content with decreased glucose content suggests a highly metabolic process like a neoplasm or a disseminated infection. a csf protein content above 1000 mg / dl, consistent with a froin syndrome, suggests blockage of csf flow. in our patient, initial radiologic studies were unremarkable and we suspect, probably contributed to the delayed diagnosis at his local hospital. teratomas commonly present as cystic lesions, with different tissue components including fat, soft tissue, and calcifications being radiographic hallmarks. they are usually heterogeneous on t1weighted images, with increased signal from fatty components and variable signal due to calcification. on t2 weighted images, gradient echo signal is decreased in areas of calcification, while the soft tissue components of the teratoma enhance following contrast administration (osborn., 2004 ; love., 2008). a number of genetic and immuno - histochemical markers point toward immaturity of teratomas including : sox2 gene expression, nestin, and vimentin (phi., 2007 ; sakurada., 2008). our patient s specimen showed tissues of all three germ cell layers and tested positive for vimentin. main treatment option for primary cns teratomas consists of surgical resection (ventureyra, 1981 ; sawamura., 1998). in instances of mature teratomas, and in some cases of immature teratomas, complete resection is possible and curative. in cases of incomplete resection of immature teratomas, as well as in cases of teratomas with malignant transformation, radiation therapy, and chemotherapy are advised (ling., 1993 ; phi., 2005). patients with mature teratomas have a reported survival rate > 90% after 10 years, following complete surgical resection of the tumor (matsutani., teratomas with malignant transformation carry a worse prognosis, with a reported survival rate < 10% after 1 year (sawamura., 1998). there is a reported case of malignant transformation of an intracranial large epidermoid cyst with leptomeningeal carcinomatosis (kano., 2010) as well as intradural squamous cell carcinoma of the sacrum which developed into a posterior fossa. however, we are unaware of a case of leptomeningeal carcinomatosis involving the posterior fossa and spinal cord due to a primary cns teratocarcinoma. the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. | primary central nervous system (cns) teratomas are rare tumors that consist of all three germ cell layers. we describe a young man with a primary malignant cns teratocarcinoma presenting as leptomeningeal carcinomatosis. diagnosis of primary cns teratocarcinomas is challenging ; relentless pursuit of the diagnosis must follow even if early ancillary studies are inconclusive. |
a 59-year - old female weighing 45 kg with body mass index 16, presented with atypical chest pain. the past surgical history was significant for aortic valve replacement and endovascular graft repair of arch of aorta and persistent dissecting aneurysm of thoraco - abdominal aorta (figure 14). the patient was on warfarin 7.5 mg therapy with target inr 2.53.5 for the prosthetic valve. besides warfarin, patient was on amlodipine, metoprolol, hydrocodone, acetaminophen, simvastatin, gabapentin, and temazepam at home. the other laboratory findings were blood urea nitrogen 16 mg / dl, serum creatinine 1.3 mg / dl, glucose 90 mg / dl, hemoglobin 11.9 g / dl, leucocytes 3.7 k / cumm, platelets 104 k / cumm, albumin 3.3 g / dl, total cholesterol 120 mg / dl, triglycerides 89 mg / dl, high - density lipoproteins 44 mg / dl, low - density lipoproteins 58 mg / dl, serum iron 34 mcg / dl, total iron binding capacity 299 mcg / dl, iron saturation 11% and serum ferritin 92 ng / ml. pre - albumin, serum vitamin b-12 and other nutritional indices were not tested at this admission. on further workup of the pain, it was found to be associated with very severe nausea, as if someone pulling her stomach. the patient had severe weight loss due to the avoidance of food altogether and marijuana abuse for medical as well as the recreational purposes. the esophagram (figure 5, figure 6) showed delayed esophageal emptying with findings suggestive of reflux. esophagus and stomach were stretched, enlarged and extended down to the pelvis secondary to the enlarged dissecting thoraco - abdominal aortic aneurysm. the etio - pathogenesis for her pain was the severe pull on the stomach by the endovascular grafted large dissecting aneurysm of the thoraco - abdominal aorta. this pain was associated with the severe nausea, resulting in a loss of appetite that had been interfering with her food intake chronically and hence contributed to the supratherapeutic inr because of the chronic lack of vitamin k food supplements. the treatment was not altered as the plan for the underlying very advanced atherosclerotic disease was palliative ; however, the insight into the underlying etio - pathogenesis ensured that the patient received appropriate non - urgent care in her future emergency room (er) presentations with chest pain and supratherapeutic inr. figure 1computed tomography angiography scan of the lower thoracic cavity in transverse section demonstrating the enlarged aneurysm of descending thoracic aorta compressing / stretching the lower esophagus. computed tomography angiography scan of the lower thoracic cavity in transverse section demonstrating the enlarged aneurysm of descending thoracic aorta compressing / stretching the lower esophagus. figure 2computed tomography angiography scan of the thoracic cavity in coronal section demonstrating the extent and location of the enlarged aneurysm of descending thoracic aorta. computed tomography angiography scan of the thoracic cavity in coronal section demonstrating the extent and location of the enlarged aneurysm of descending thoracic aorta. figure 3computed tomography angiography scan of the abdominal cavity in coronal section demonstrating the extent and location of the dissecting aneurysm of abdominal aorta and associated compression / stretching of the lower esophagus and stomach. computed tomography angiography scan of the abdominal cavity in coronal section demonstrating the extent and location of the dissecting aneurysm of abdominal aorta and associated compression / stretching of the lower esophagus and stomach. figure 4computed tomography angiography scan of the origin and distribution of the celiac trunk from the dissecting abdominal aorta. computed tomography angiography scan of the origin and distribution of the celiac trunk from the dissecting abdominal aorta. figure 5esophagram scan demonstrating the strectched lower esophagus and tubular stomach in the left lumbar region. esophagram scan demonstrating the strectched lower esophagus and tubular stomach in the left lumbar region. figure 6esophagram scan demonstrating the antrum and pylorus of the stomach in the left pelvic region. esophagram scan demonstrating the antrum and pylorus of the stomach in the left pelvic region. the average daily consumption of vitamin k in united states is about 6080 micrograms per person and changes in vitamin k consumption can interfere with maintenance of narrow therapeutic window of inr levels. though the usual focus is on adjusting the daily intake of vitamin k in patients with non - therapeutic inr levels, however the poor vitamin k ingestion by the patient may direct the physician attention to the overall poor food intake in the patient secondary to underlying debility gastrointestinal pathological process. the primary focus in the literature has been directed to predict prevalence and to develop guidelines for managing these non - therapeutic inrs. however, the underlying etio - pathogenesis of these non - therapeutic inrs can be equally important and critical for the long term prognosis and management of these patients. this case highlights the fact that supratherapeutic inrs direct the attention of the treating physicians team to the underlying severely debilitating gastrointestinal diseases. in summary, the supratherapeutic inr can be an objective indicator of chronic loss of appetite with poor nutritional status of the patient and therefore acts as a warning sign for diagnosis of severe debilitating primary gastrointestinal disease. | this case highlights the fact that supratherapeutic inrs direct the attention of the treating physicians team to the underlying severely debilitating gastrointestinal diseases. prolonged fasting or starvation reduces vitamin k levels. such patients are more sensitive to treatment with vitamin k antagonist - based anticoagulants. hence, the supratherapeutic inr can be an objective indicator of chronic loss of appetite with poor nutritional status of the patient and therefore acts as a warning sign for diagnosis of severe debilitating primary gastrointestinal disease. |
studies on the origin of animal multicellularity have increasingly focused on one of the closest living relatives of animals, the choanoflagellate salpingoeca rosetta. single cells of s. rosetta can develop into multicellular rosette - shaped colonies through a process of incomplete cytokinesis. unexpectedly, the initiation of rosette development requires bacterially produced small molecules. previously, our laboratories reported the planar structure and femtomolar rosette - inducing activity of one rosette - inducing small molecule, dubbed rosette - inducing factor 1 (rif-1), produced by the gram - negative bacteroidetes bacterium algoriphagus machipongonensis. rif-1 belongs to the small and poorly explored class of sulfonolipids. here, we report a modular total synthesis of rif-1 stereoisomers and structural analogs. rosette - induction assays using synthetic rif-1 stereoisomers and naturally occurring analogs defined the absolute stereochemistry of rif-1 and revealed a remarkably restrictive set of structural requirements for inducing rosette development. |
|
the use of allosteric modulation to bias highly dynamic protein ensembles toward conformational states favoring dna binding provides a powerful regulatory mechanism for modulating gene activation and repression.(3) the nuclear hormone class of ligand - activated transcription factors regulates the expression of genes involved in diverse physiological processes ranging from embryonic development to adult homeostasis. additionally, this class of transcription factors is involved in inflammatory disease and the etiology of certain cancers. two important examples of ligand - activated nuclear transcription factors are the androgen receptor (ar) and the glucocorticoid receptor (gr). both are structurally similar, with a high degree of conservation in their dna - binding domains, and belong to a subset of dna - binding receptors that includes the progesterone and mineralocorticoid receptors. this receptor subfamily contains a highly conserved three - domain architecture consisting of an n - terminal domain (ntd), a dna - binding domain (dbd), and a c - terminal ligand - binding domain (lbd). although pharmaceutical intervention has been targeted at the lbd, less effort has been directed toward the proteinprotein or proteindna interface. ar and gr small - molecule modulators directed specifically to the proteinprotein or proteindna interface would provide useful tools for understanding gene regulatory pathways and may offer alternative approaches to modulating transcription factor activity.(9) the oversupply of transcription factors can lead to dysregulated gene expression, a characteristic of many human cancers. cell - permeable small molecules that could modulate transcription factordna interfaces would allow for the chemical control of gene networks. pyrrole - imidazole (py - im) polyamides bind the minor groove of dna sequence - specifically, encoded by side - by - side arrangements of n - methylpyrrole (py) and n - methylimidazole (i m) carboxamide monomers. im - py pairs distinguish gc from cg base pairs, whereas py - py pairs are degenerate for ta and at. antiparallel py - im strands are connected by -aminobutyric acid (gaba) linkers to create hairpin- or cyclic - shaped oligomers. stereocontrol of polyamide binding orientation has been achieved by the introduction of an (r)--amino substituent on the gaba turn, leading to increases in affinity and sequence specificity. py - im polyamides have been programmed to bind a broad repertoire of different dna sequences.(14) they have been shown to permeate cell membranes,(15) access chromatin,(16) and disrupt proteindna interactions of medically relevant transcription factors such as hif, ar, and gr. we have recently demonstrated that hairpin py - im polyamides bearing the (r)--amino--turn, and cyclic polyamides bearing two (r)--amino--turns, such as cycle 1 (figure 1), possess favorable dna - binding affinities and are useful in gene regulation studies. structure of cyclic polyamide 1 presented with its ball - and - stick model superimposed over the binding site on the dsdna oligonucleotide sequence used for crystallization. closed circles designate n - methylimidazole, open circles designate n - methylpyrrole, and half open circles substituted with ammoniums designate the -amino - substituted -turn unit. previous studies have shown that py - im polyamides are able to inhibit several distinct structural classes of transcription factordna complexes in vitro using electrophoretic mobility gel shift assays. additionally, py - im polyamides targeted to the dna response elements of the ar and grdna interfaces have resulted in modulation of gene expression in cell culture. chromatin immunoprecipitation data support an inhibition model based on decreased transcription factor promoter occupancy in the presence of the match polyamide. a structural basis for optimizing polyamide structure with regard to disruption of proteindna interfaces valuable insights into py - im polyamide binding site location and orientation have been provided by previous nmr and x - ray structural studies of polyamidedna complexes. antiparallel four - ring polyamide dimer impypypydp, bound to the sequence 5-ccagtactgg-3, appeared to widen the minor groove by 2.(12 g) additionally, x - ray structures of hairpin polyamides bound to the nucleosome core particle (ncp) have revealed increases in minor groove widths of 2 over unliganded ncp dna and, in addition, long - range structural changes in the ncp dna upon polyamide binding.(16) given the modest resolution of previous structures, there is a need for higher resolution crystallographic studies to elucidate dna structural distortions of polyamidedna complexes, in particular, the influence of the turn elements. recently, we reported the atomic resolution structure (1.18 resolution) of an eight - ring cyclic polyamide capped at both ends by (r)--amino--turn units in complex with double - helical dna.(21) the high - resolution structure of the polyamide complexed to the dna sequence 5-ccaggcctgg-3 revealed 4 widening of the minor groove and 4 compression of the major groove along with > 18 bend in the helix axis toward the major groove when compared to unliganded dna.(21) the large perturbations to the dna groove width suggest a molecular basis for the disruption of transcription factordna interfaces by small molecules via allosteric modulation.(21) additionally, a structural basis for the at base - pair sequence specificity of the -amino--turn recognition unit was elucidated, revealing a combination of several interactions. these interactions included hydrophobic packing of the -methylene with the c2 hydrogen of adenine, specific hydrogen - bonding of the connecting amides to the groove floor before and after the turn, water - mediated hydrogen - bonding of the -amine to the groove floor, and a conformational pucker that minimizes steric interactions of the -amino substituent.(21) from this structure one can clearly see that the exocyclic amine of a guanine base under the turn would result in a large steric interaction with the -methylene of the -amino--turn.(21) in light of the insight gained into polyamide turn recognition from this previous study, important structural questions remain unresolved regarding the -amino--turn, especially since these polyamides tend to be higher in affinity for certain sequences and have biological activity. structures and models are needed for allosteric inhibition of specific transcription factordna complexes, such as the ar and gr bound to their cognate dna response elements (5-wgwwcw-3, with w = a or t), using molecules that have proven effective in biochemical, biophysical, and cell culture experiments. here we report a high - resolution x - ray structure of a cyclic polyamide 1, comprised of two antiparallel impypypy strands capped by (r)--amino- turn units, which codes for the sequence 5-wgwwcw-3, in complex with the 10 base - pair dna oligonucleotide sequence 5-ccagtactgg-3, containing an are / gre consensus dna sequence (figure 1). we observe significant structural allosteric perturbations of the dna helix induced upon polyamide binding in the minor groove. a host of noncovalent interactions with the dna minor groove floor and a detailed view of the -amino--turn conformation are present in the structure. the unique opportunity to observe the hydration state at this resolution reveals a network of well - ordered water molecules around the polyamide and dna. importantly, we are able to compare the dna conformation of the small - molecule complex with the transcription factor ar and grdna complexes, demonstrating that structural alterations of dna by these major - groove - binding proteins and minor - groove - binding cyclic polyamides operate in opposite directions. the structure of cyclic polyamide 1 in complex with d(5-cciagtactgg)2 was solved by direct methods to 0.95 resolution with synchrotron radiation (figure 2).(22) one cyclic polyamide bound to a single dna duplex is present in the asymmetric unit of the crystal in the p41212 space group. the final structure was refined anisotropically and unrestrained to rwork = 11.2 and rfree = 12.4 (figure 2). the average b factors were 6.7 and 7.2 for the polyamide and dna, respectively. the asymmetric unit contains one full polyamide - complexed dna double - helix. in the dna complex, the aromatic amino acids are bound with an n - to - c orientation of each impypypy strand of the cycle adjacent to the 5-to-3 direction of the dna. the conformational constraints imposed by the turn unit result in ring placement that is ring - over - ring as opposed to ring - over - amide as previously seen in unlinked 2:1 binders. the substituted gaba turn appears to reinforce an antiparallel strand alignment that prevents slippage of the amide - linked heterocyclic strands, allowing less dna - induced polyamide strand alignment. greater than 40% of the cyclic polyamide surface area is buried, leaving only the top of the methyl groups on the heterocycles, the amide carbonyl oxygens, and the chiral -ammonium turn solvent - exposed. additionally, alternate phosphate conformations are observed for 7 of the 18 nucleotides of the dna duplex, while the sugar pucker at each nucleotide remains conformationally locked. (left) electron density map contoured at the 1.0 level for the x - ray crystal structure of cyclic polyamide 1 complexed to dsdna (0.95 resolution). the incorporation of 5-iodocytosine in the oligonucleotide leads to a unique packing geometry in the p41212 space group where each dna helix is stacked end - to - end with an adjacent helix, forming a pseudocontinuous 20 base - pair dimeric column of polyamide - bound duplexes, effectively desymmetrizing each end of the polyamidedna complex (figure 3a). each dna duplex contains two 5-iodocytosine nucleobases that appear to form bridging halogen bond interactions to the phosphates of two adjacent dna duplexes. halogen bonding interactions have been ubiquitous in liquid crystal design ; however, they are less often observed in biomolecules.(23) recent studies from the ho laboratory have suggested that this interaction can be used for directing macromolecular conformation.(23c) the iodinephosphate distances are less than the sum of the van der waals radii for io (3.50). the first io halogen interaction distance is 3.05, with a cio angle (1) of 167 and a poi angle (2) of 130 (figure 3b). the second halogen bond interaction distance is 2.97, with a cio angle (1) of 168 and a poi angle (2) of 137. the electrostatic potential surface for 5-iodocytosine shown in figure s1 (supporting information) reveals an electropositive crown along the ci axis associated with the highly polarizable iodine atom, consistent with previous studies of halogen bonding interactions.(23) outline of unit cell and 10 symmetry - related copies of the polyamidedna complex showing the iodinephosphate halogen bond crystal contacts. (a) unit cell showing the orientation and end - to - end desymmetrization of adjacent helices along with positions of halogen bonds. halogen bonds occur between the iodine atom of 5-iodocytosine (ci) residues and the oxygen atom of phosphate groups on neighboring helices. (b) expanded view of a ciphosphate halogen bond interaction with an io distance dio = 3.05. halogen - bonded phosphate oxygen atoms are colored cyan in the top figure for clarity and red in the bottom figure. hairpin py - im polyamides linked by a gaba turn substituted at the or position can adopt either of two possible conformations upon binding dna. our previous crystal strucuture of an (r)--amino - substituted gaba - linked cyclic polyamide shows a conformational preference where the amino group is directed up and out of the minor groove, forcing the -methylene to the floor of the minor groove, within van der waals contact distance of the c2 hydrogen of adenine.(21) this result left the possibility of an intrinsic preference for the alternate conformation in the absence of substitution at the -position of the turn, allowing relief of the -methylene interaction with the floor of the minor groove. however, in the presence of the -amino turn, a steric clash with the minor - groove wall appears to be the dominant interaction directing turn conformation.(21) in the -amino gaba - linked polyamidedna complex we observe a conformational inversion where the position is now directed up and out of the minor - groove floor, relieving interaction with the groove floor, orienting the amino substituent along the minor groove (figure 4ac). figure 4b presents a view of the complex looking down the minor groove directly at the -amino--turn, showing van der waals interactions between the outside face of the pyrrole - imidazole strands and the walls of the minor groove. conformation a (left) is the conformation observed in the previously determined -amino--turn x - ray crystal structure. conformation b (right) shows the preferred conformation for the -amino--turn determined by x - ray crystallography in this report. the -carbon conformational preference is puckered up and away from the dna minor - groove floor, aligning the -ammonium substituent along the groove floor. (b) structural view looking down the dna minor groove, showing the bound cyclic polyamide with electron density contoured at the 1.0 level. (c) geometry of the -amino--turn interacting with the adenine and guanine base pairs in the floor of the dna minor groove through water - mediated hydrogen bonds. (d) isolated view of one half of the polyamide (split along a plane through the long axis of the polyamide and the dna helical axis), showing hydrogen bond distances to the dna minor groove floor. hydrogen - bonding interactions of the dnapolyamide complex with electron density contoured at the 1.0 level. the hydration pattern around the turn is conserved at both ends of the structure, and there are two water - mediated hydrogen bonds within 2.792.87 from the ammonium to the dna minor - groove floor (figure 4). the amide nh s and imidazole lone - pairs form a continuous series of direct hydrogen bonds to the floor of the dna minor groove. the imidazoles impart specificity for the exocyclic amine of guanine through relief of steric interaction and a g (n2-hydrogen)im (lone pair) hydrogen bond. the amides linking the aromatic rings and the turns contribute hydrogen bonds to the purine n3 and pyrimidine o2 lone pairs. all amides are within hydrogen - bonding distance of a dna base (3.0 average, figure 4). in all, there are 10 direct amide hydrogen bonds (average distance = 2.72.9), two direct imidazole hydrogen bonds (average distance = 3.15), and four (r)--ammonium turn water - mediated hydrogen bonds (two per turn, average distance from amine to water 2.792.87) to the floor of the dna minor groove. there is at least one interaction for all 12 dna bases in the six base - pair binding site, for a total of 16 hydrogen bond interactions between the cyclic polyamide and the floor of the dna minor groove. the structure has a unit cell volume of 134 162 and a matthews coefficient of 2.24, with a solvent content of 51%. there are 130 water molecules within 3.0 of the polyamidedna complex, with 76 of the 130 water molecules localized around the dna phosphate backbone (figure s2, supporting information). the solvent - exposed surface of the polyamide is hydrated by 22 of the 130 waters found within 3.0 of the complex. most water molecules are clustered and form hydrogen - bonded networks across the carbonyl oxygens of adjacent amides linking polyamide ring pairs. additionally, six water molecules hydrate the polyamide ammonium turns (three at each turn), with four of the six anchoring the polyamide to the floor of the dna minor groove through bridging hydrogen bonds to the base - pair edges (figure 4c). the major groove is also highly hydrated and contains a well - ordered seven - coordinate calcium ion in addition to other calcium ions around the duplex periphery (figure s2). the pattern of hydration around the -amino--turn in this structure is distinctly different from the -amino--turn in our previous structure. the -amino--turn is hydrated by three water molecules, just as in the -amino--turn where one of the water molecules forms a bridging hydrogen bond to the adenine under the polyamide turn. however, the -amino--turn contains an extra bridging hydrogen bond from one of the water molecules to the guanine of the next base pair. this observation points to the possibility of engineering turn specificity through structural modification beyond the formal 6 base - pair binding site to what would now be an 8 base - pair binding site. a slice through the short axis of the dna helix, showing the minor- and major - groove geometry at the center of the polyamide binding site for uncomplexed and complexed dna in figure 5, reveals a > 4 widening of the dna minor groove upon cyclic polyamide binding and a compression of the major groove by more than 4 as compared to unliganded dna.(24) additionally, figure 5 shows a large perturbation in the major - groove depth upon polyamide binding, converting the wide, shallow surface of the major groove from a functionally exposed protein recognition domain to a narrow, deep cleft too small to accommodate the width of a standard protein -helical domain or -sheet from a transcription factor. the helix is bent toward the major groove by > 15, resulting in major groove compression. the base - pair step parameters in figure 6a show a large positive roll throughout the polyamide binding site, which contributes to the significant bend in the dna helix. additionally, polyamide binding induces a more uniform helical twist, resulting in less variability as the base - pair step changes. the helical twist values for polyamide - bound dna range from 29 to 36. values for the helical twist are highly sequence dependent in native dna and range from 21 to 50, depending on step sequence. major perturbations in the dna base - pair buckle and opening are also observed upon polyamide binding (figure 6c). at the four central base pairs of the binding site, the buckle is significantly reduced upon binding and the base pairs are opened toward the dna major groove, with the largest variations at the central at base pairs. a full set of helical parameters and coordinate system definitions can be found in figures s3s5 (supporting information). the possibility that the dna structural alterations we observe are due to the packing forces and crystal contact perturbations can not be ruled out ; however, we observe similar groove distortions and dna bending perturbations in different sequences of dna (5-ccaggcctgg-3) with different cyclic polyamide context (imimpypy) and in different space groups (p1) of dnapolyamide complexes.(21) dna minor- and major - groove dimensions in the absence and in the presence of polyamide 1. native dna structure d(5-ccagtactgg-3)2 solved by rees and co - workers (pdb 1d8 g, 0.74 resolution). (a) comparison of the minor - groove width for dna in the absence of polyamide (yellow curve and structure) and in the presence of bound polyamide (blue curve and structure). (b) comparison of the major - groove width for dna in the absence of polyamide (yellow curve and structure) and in the presence of bound polyamide (blue curve and structure). (a) significant dna bending is observed for polyamide - bound dna (blue structure) versus unbound dna (yellow structure). (b) roll and twist parameters for dna in the absence and presence of polyamide. (c) buckle and opening parameters for dna in the absence and in the presence of polyamide. to better understand the impact of polyamide - induced dna structural modulation on the inhibition of major - groove - binding transcription factors, we analyzed previously reported crystal structures for the androgen and glucocorticoid receptors (ar and gr) in complex with dsdna. for the case of the androgen receptordna complex, only one structure was available with a resolution limit of 3.10 (pdb 1r4i).(25) the comparison revealed a substantial difference in minor - groove widths for ar - bound dna (4.0) versus polyamide - bound dna (8.0). comparison of the major - groove widths also revealed large deviations, with the ardna major groove expanded to > 12.0 and the polyamide - bound dna major groove compressed to < 9.0 (figure 7). the dna corresponds to the androgen direct repeat response element, and the sequence used is 5-ccagaacatcaagaacag-3. the resolution limit of the structure is 3.10, and the space group is p3221. zinc atoms are shown in blue, protein in yellow, and dna in dark and light gray. (b) map of the psa - are site and schematic representation of a cyclic polyamide targeting the psa - are site 5-agaaca-3. potential polyamide binding sites are shaded in gray. (c) major- and minor - groove widths for the ardna structure (circles) plotted with the groove widths for the cyclic polyamidedna structure (triangles) mapped onto the potential polyamidedna - binding sites of the are. (right) model showing groove width measurements mapped directly onto the ardna crystal structure. minor - groove widths are shown in yellow (open circles and triangles) and major - groove widths in blue (closed circles and triangles). for the case of the glucocorticoid receptor, a total of 18 crystal structures were available for analysis, allowing a unique look at the impact of dna sequence variation compared to minor- and major - groove widths.(26) the structures ranged in resolution from 1.61 to 3.00, and 12 of the structures analyzed were found in the c2 space group, with the remainder found in p212121. a few of the dna sequences are shown in figure 8, with conserved and variable regions highlighted. a sequence alignment table with pdb numbers for all 18 structures can be found in the supporting information (table s1). our analysis of the glucocorticoid receptor shows consistency in groove distortions among different dna sequences and different space groups, which parallel those of the androgen receptordna structure irrespective of dna sequence or space group. this analysis provides a molecular basis for the inhibition of ar and grdna binding using gaba turn - linked polyamides. the structural comparison shows that, through polyamide - induced allosteric modulation of the dna structure, the major - groove surface geometry becomes incompatible with ar and grdna binding, an observation that is supported by previous biochemical and biophysical data. zinc atoms are shown in blue, protein in yellow, and dna in dark and light gray. (b) dna sequences used for each crystal structure are shown with the conserved domain highlighted. (c) major- and minor - groove widths for the ardna structure (circles) plotted with the groove widths for the cyclic polyamidedna structure (triangles) mapped onto the potential polyamidedna - binding sites of the are. mean values are shown with the marker on the line, and error bars represent the minimum and maximum values for all structures. (right) model showing groove width measurements mapped directly onto the ardna crystal structure. minor - groove widths are shown in yellow (open circles and triangles) and major groove widths in blue (closed circles and triangles). based on comparison of polyamidedna structure and proteindna structures, our data reveal an allosteric model for disrupting androgen and glucocorticoid receptordna interfaces by small molecules. recent data from the yamamoto laboratory demonstrated that dna can be thought of as an allosteric ligand for the gr, modulating the activity of the receptor to target genes based on dna sequence.(26b) differences at the single - base - pair level were able to affect the conformation and regulatory activity of gr. the possibility of using minor - groove dna - binding molecules as secondary modulators of the already allosteric ligand (dna) to further bias the conformation and regulatory activity of a transcription factor to specific target genes represents a secondary level of transcriptional control in biological systems.(26) this study reiterates the importance of dna shape and flexibility in proteindna recognition and illustrates the use of sequence - specific minor - groove ligands to modulate dna shape as well.(27) to summarize, high - resolution structures of -amino--turn and -amino--turn cyclic polyamides can now can be compared with regard to changes in dna shape and differences in conformation of the -turn unit. regarding global dna shape, both - and -amino--turn cyclic polyamides are similar and able to induce large dna structural perturbations with respect to groove width and helix bending, a critical requirement for allosteric inhibition of transcription factor binding. however, with regard to polyamide turn conformation, they are very different, with the -amino--turn adopting an inverted conformational preference compared to the -amino--turn, allowing the possibility of synthetic modifications for enhanced recognition beyond the six base - pair binding site. importantly, the dna structural alterations by the minor - groove synthetic cycle have been shown to be incompatible with the major - groove - binding transcription factors ar and gr. a critical next step will be to obtain high - resolution x - ray structures of hairpin polyamides and unlinked 2:1 antiparallel polyamide structures in complex with the same dna sequence for comparison to the cyclic polyamidedna structures. chemicals and solvents were purchased from sigma - aldrich and hampton research and were used without further purification. water (18 m) was purified using a millipore milli - q purification system. analytical hplc analysis was conducted on a beckman gold instrument equipped with a phenomenex gemini analytical column (250 4.6 mm, 5 m) and a diode array detector, and the mobile phase consisted of a gradient of acetonitrile (mecn) in 0.1% (v / v) aqueous trifluoroacetic acid (cf3co2h). preparative hplc was performed on an agilent 1200 system equipped with a solvent degasser, a diode array detector, and a phenomenex gemini column (5 m particle size, c18 110a, 250 21.2 mm, 5 m). a gradient of mecn in 0.1% (v / v) aqueous cf3co2h was utilized as the mobile phase. uvvis measurements were made on a hewlett - packard diode array spectrophotometer (model 8452 a), and polyamide concentrations were measured in 0.1% (v / v) aqueous tfa using an extinction coefficient of 69 200 mcm at max near 310 nm. cyclic polyamide 1 was synthesized as previously described and purified by reverse - phase hplc prior to x - ray crystallography.(18a) preparative hplc was performed as described above. oligonucleotides were purchased hplc - purified from trilink biotechnologies (san diego, ca). prior to use for crystallography, oligonucleotides were desalted using a waters sep - pak cartridge (5 g, c-18 sorbent).(21) the sep - pak was prewashed with acetonitrile (25 ml, 3) followed by milli - q water (25 ml, 3). the oligonucleotide was dissolved in 5 ml of 2.0 m nacl and loaded directly onto the sorbent, followed by a wash with 5 ml of 2.0 m nacl and 250 ml of milli - q water. next, the oligonucleotide was eluted with acetonitrile : water (1:1) and lyophilized to dryness. single - strand dna and polyamide concentrations were determined by uvvis spectroscopy on a hewlett - packard diode array spectrophotometer (model 8452 a). single - strand dna was incubated with polyamide in a 2:1 ratio prior to crystallization. crystals were obtained after 14 weeks from a solution of 0.5 mm duplex dna, 0.5 mm polyamide, 23% 2-methyl-2,4-pentanediol (mpd), 35 mm calcium acetate, 10 mm tris, ph 7.5, equilibrated in sitting drops against a reservoir of 35% mpd at 4 c. crystals were collected in hampton nylon cryoloops (10 m, 0.1 mm) and flash - cooled to 100 k prior to data collection. polyamidedna crystals grew in space group p41212 with unit cell dimensions a = 39.83, b = 39.83, and c = 84.57, = 90, = 90, = 90, and one polyamidedsdna complex in the asymmetric unit. data were collected at stanford synchrotron radiation laboratory (ssrl) beamline 12 - 2 with a mar research imaging plate detector at wavelength 0.82654. data were processed with mosflm(28) and scala(29) from the ccp4 suite of programs.(29) the structure was solved by direct methods using the shelx suite of programs (shelxd). model building and structure refinement were done with coot(32) and refmac5.(33) the final polyamidedna complex was refined to rwork = 11.2% and rfree = 12.4%. anisotropic b factors were refined in the final stages and riding hydrogens included prior to four cycles of completely unrestrained refinement. dna groove analysis and helical parameters were calculated using the program curves(34) and x3dna.(35) distance measurements, calculations, and preparation of structural figures were performed using ucsf chimera.(36) all calculations reported were performed using hf/3 - 21 g as implemented in the gamess program. the electrostatic potential surface for 5-iodocytosine (ci) in figure s1 was generated by mapping the electrostatic potential onto a surface of molecular electron density (0.002 electron /) and color - coding, using the chimera program.(36) the molecular electrostatic potential energy values range from 25 kcal / mol for values of negative potential (red) to + 25 kcal / mol for values of positive potential (purple). this range was chosen to emphasize the variations in the electrostatic potential associated with the iodine atom of ci, and some regions of the electrostatic potential associated with other heteroatoms may lie beyond the 25 kcal / mol range. | pyrrole - imidazole polyamides are a class of small molecules that can be programmed to bind a broad repertoire of dna sequences, disrupt transcription factordna interfaces, and modulate gene expression pathways in cell culture experiments. in this paper we describe a high - resolution x - ray crystal structure of a -amino turn - linked eight - ring cyclic py - im polyamide bound to the central six base pairs of the sequence d(5-ccagtactgg-3)2, revealing significant modulation of dna shape. we compare the dna structural perturbations induced by dna - binding transcripton factors, androgen receptor and glucocorticoid receptor, in the major groove to those induced by cyclic polyamide binding in the minor groove. the cyclic polyamide is an allosteric modulator that perturbs the dna structure in such a way that nuclear receptor protein binding is no longer compatible. this allosteric perturbation of the dna helix provides a molecular basis for disruption of transcription factordna interfaces by small molecules, a minimum step in chemical control of gene networks. |
mental illness has an impact on every aspect of life, including physical health and risk behavior. general somatic symptoms that occur with anxiety are fatigue and loss of energy, feeling slowed up or agitated impaired physical, role functioning and restless. in iranian normal population, the prevalence of anxiety is 20.8% among urban and rural dwellers in age group 15 years above. stress is also one of the leading predisposing factors in the development of mental disorders. the prevalence of stress is high in both developing and developed countries and varied with age and job for both men and women. in general, 28 - 39% of iranian adult population suffered from possible psychological stress as measured by the general health questionnaire (ghq)-12. over the past 60 years, there has been increasing interest in normal personality traits and their relationship to neurosis. personality traits are dimensions of individual differences that can affect a wide range of behaviors across many situations. in the past 20 years, a growing consensus has supported the five - factor model (ffm) as a reasonably comprehensive yet manageable taxonomy of personality traits. the ffm is a hierarchical model that organizes personality traits into five broad or higher - order factors of neuroticism, extraversion, agreeableness, conscientiousness and openness to experience. neuroticism reflects one 's tendency to experience negative emotions and cope poorly, extraversion indicates one 's tendency to be sociable and active, agreeableness, one 's orientation toward others ; conscientiousness, one 's organization, motivation and persistence in achieving goals and openness to experience reflects one 's appreciation of experience for its own sake. there are evidences establishing that the personality traits particularly neuroticism and extraversion have important links to psychopathology and are also important vulnerability factors for anxiety disorders that at least partly responsible for the co - morbidity among mental disorders. available evidence suggested these two domains (personality and psychopathology) are intrinsically inter - correlated, such that neither can be fully appreciated without the other. stress and anxiety scores were significantly and positively correlated with neuroticism scores and were also negatively correlated with extraversion scores in both men and women in the general population. neuroticism and introversion are associated with greater prevalence of anxiety disorders. also, there is evidence that lower - order dimensions of agreeableness and facets of conscientiousness have been linked to some anxiety disorders. individual with higher neuroticism and lower extraversion scores experience higher stress and anxiety scores the relation between personality traits and mental problems could be affected by unhealthy lifestyle factors including inadequate physical activity, smoking and some physical illness such as functional gastrointestinal disorders (fgids). in this regard, also, the key role of some other background confounders such as educational level, marital status, age, sex, perceived intensity of stress and obesity can be considered. investigation of relations between personality traits and high - prevalence mental problems can provide important information on the dimensional measures of psychopathology and screen for psychological factors in the primary care settings. such researches can provide a somewhat clear prospective on the relationship between personality traits and psychopathology and finally will enhance our knowledge about psychological problems and lead to improvement in mental and physical health. majority of previous studies on the relationships between personality traits and mental problems, in one hand, have focused only one problem, and in the other hand, have emphasized only two of the five higher - order factors, that is, neuroticism and extraversion. additionally, these studies have been limited to some specific population such as patients and college students and hence that it is unclear to what extent their findings are applicable to the general population. on the other hand, majority of the conducted previous studies have used simple statistical methods, and they did not adjust the impacts of possible confounders. the main objective of current study was to investigate the relationships between psychological stress and anxiety with five - factor personality traits controlling for the impacts of some important possible confounders including sex, age, marital status, education level, body mass index (bmi), perceived intensity of stress, social support, smoking behavior, physical activity, number of fgids using a comprehensive statistical method in a large sample of iranian adults. the current study is a part of the study on the epidemiology of psychological, alimentary health and nutrition (sepahan). in this cross - sectional study, the studied sample was selected using multistage cluster sampling and convenience sampling in the last stage among 4 million people in 20 cities across isfahan province. in sepahan study, data were collected in two separate phases to increase the accuracy as well as the response rate. in the first phase, all participants were asked to complete a self - administered questionnaire about demographic and lifestyle factors including nutritional habits and dietary intakes. in the second phase, further information on gastrointestinal functions and different aspects of psychological variables were collected using another bunch of self - administered questionnaires (response rate : 86.16%). in the current analysis, we used data from 4,763 adults who had completed data on demographic data, personality traits, perceived intensity of stress, social support, and psychological outcome such as stress and anxiety. the protocol of the study was clarified for all the participants, and a written informed consent was obtained from all participants. finally, the information from 3180 people who provided complete information on all studied variables in the current study was included in analyses. psychological stress was measured by a self - administered 12-item ghq-12, a well - established screening and diagnostic tool to detect nonpsychotic psychiatric disorders and assessing psychological stress. ghq-12 is a consistent and reliable instrument for using in general population studies and medical settings. less than usual, no more than usual, fairly more than usual, or much more than usual in the past few weeks. a participant could score between 0 and 12 points, and a threshold score of 4 or more was used to identify a participant with high - stress level. convergent validity indicated a significant negative correlation between the ghq-12 and global quality of life scores as r = 0.56, p < 0.0001 in iranian population. hospital anxiety and depression scale is a standardized, valid, and reliable self - report rating scale. it was answered using a 4-point likert scale ranging from 0 (not present) to 3 (considerable). the anxiety score is the summation of the particular seven items (ranging from 0 to 21). the ranges of anxiety score for cases are 0 - 7 normal, 8 - 21 mild, moderate or severe disorder. internal consistency as measured by cronbach 's alpha has been found to be 0.78 for hads anxiety sub - scale in iranian population. as earlier indicated the ffm has been increasingly recognized as a comprehensive, robust and parsimonious model of normal personality traits and had strong external empirical support. among the available instruments for measuring five - factors, the neo five - factor inventory (neo - ffi) and the neo personality inventory revised (neo - pi - r) are neo - ffi was a shortened version of the neo - pi - r (240-items). the neo - ffi results in a profile of the personality of the subject and consists of 60 self - descriptive statements about the personality that measuring five dimensions of the normal personality (i.e., neuroticism, extraversion, openness, agreeableness and conscientiousness) and consisting 12 item / dimension. respondents indicate the degree to which they agree or disagree with each of the statement using a five - point likert - type scale (0 = strongly disagree, 4 = strongly agree). evidences suggested that the shortened tool of neo - ffi is exactly compatible with its complete form namely neo - pi - r so that correlations between the neo - ffi and the longer neo pi - r domains were 0.92, 0.90, 0.91, 0.77, and 0.87 for n, e, o, a, and c, respectively. internal consistency coefficients for the neo - ffi scales calculated with cronbach 's alpha coefficient were found 0.86, 0.77, 0.73, 0.68, and 0.81 for n, e, o, a and c, respectively. in iranian population, cronbach 's alpha is shown for neuroticism, extraversion, openness, agreeableness and conscientiousness as 0.76, 0.65, 0.59, 0.48 and 0.75, respectively. self - administered standard questionnaires were distributed to collect information on age (years), gender (male / female), marital status (married, single), self - reported weight (kg), height (cm), smoking (none, former and current smokers). educational attainments categorized into three categories as lower than diploma (12 years formal education), diploma and more than diploma (including bachelor, master and doctorate). self - reported history of major fgids including gastroesophageal acid reflux disease (gerd), functional dyspepsia (fd), functional constipation (fc) and irritable bowel syndrome (ibs) was explored. the rome iii questionnaire in its complete form and additional questions from the talley bowel disease questionnaire were used to diagnose and classify fgids. face validation of this questionnaire indicated that most participants could not discriminate the difference between the rating scales used in rome iii. therefore, rating scales were modified to a 4-item rating scale (never or rarely, sometimes, often, always) for each question. details of some changes in rome iii were described in former publications. in the current study, the number of fgids was considered (ranging from 0 to 4). perceived intensity of stress the questionnaire has 46 items having 11 various dimensions including home life, financial problems, social relation, personal conflicts, job conflicts, educational concerns, job security, loss and separation, sexual life, daily life, and health concerns. each domain was assessed with a specific number of items using a five - point response scale (strongly disagree strongly agree). perceived social support was measured using multidimensional scale of perceived social support (mspss) that consisted of 12 specific questions and 3 sources of support : family, friends, and significant other. in the current study, the rescoring form of mspss has been used ; in which, each item scored from 0 (disagree and neutral) to 1 (agree), led to a total score between 0 and 12. general practice physical activity questionnaire (gppaq) was used to assess an individual 's current physical activity status. it generates simple, 4-level physical activity index categorizing subjects as : active, moderately active, moderately inactive, and inactive. in the current analysis, participants were classified into two categories namely inactive (including inactive and moderately inactive) and active (including moderately active and active as earlier indicates). results were presented as mean standard deviation (sd) for quantitative variables and were summarized by absolute frequencies and percentages for qualitative variables. independent t - student test and one - way analysis of variance or kruskal - wallis test (when assumptions including normality or homogeneity of variance were not hold) were used to compare mean differences of quantitative variables between two and multiple groups, respectively. distribution of study participants in terms of qualitative variables across different categories of other variables was compared using the chi - square test. the associations between anxiety score and quantitative variables were tested by spearman rank correlations coefficient. multivariate generalized linear mixed model was performed for joint modeling of anxiety score (continuous) and psychological stress (dichotomous) as mixed dependent variables and personality traits as independent variables using shared random effect models. adjusted odds ratio (or) and regression coefficients (95% confidence intervals [ci ]) for psychological stress and anxiety score are presented in 5 different models. first, we adjusted for demographic variables including age, sex, marital status, educational levels. we further controlled for lifestyle variables including smoking, bmi, physical activity in the second model. fourth adjusted model was further controlled for perceived intensity of stress. in the final model, the current study is a part of the study on the epidemiology of psychological, alimentary health and nutrition (sepahan). in this cross - sectional study, the studied sample was selected using multistage cluster sampling and convenience sampling in the last stage among 4 million people in 20 cities across isfahan province. in sepahan study, data were collected in two separate phases to increase the accuracy as well as the response rate. in the first phase, all participants were asked to complete a self - administered questionnaire about demographic and lifestyle factors including nutritional habits and dietary intakes. in the second phase, further information on gastrointestinal functions and different aspects of psychological variables were collected using another bunch of self - administered questionnaires (response rate : 86.16%). in the current analysis, we used data from 4,763 adults who had completed data on demographic data, personality traits, perceived intensity of stress, social support, and psychological outcome such as stress and anxiety. the protocol of the study was clarified for all the participants, and a written informed consent was obtained from all participants. finally, the information from 3180 people who provided complete information on all studied variables in the current study was included in analyses. psychological stress was measured by a self - administered 12-item ghq-12, a well - established screening and diagnostic tool to detect nonpsychotic psychiatric disorders and assessing psychological stress. ghq-12 is a consistent and reliable instrument for using in general population studies and medical settings. less than usual, no more than usual, fairly more than usual, or much more than usual in the past few weeks. a participant could score between 0 and 12 points, and a threshold score of 4 or more was used to identify a participant with high - stress level. convergent validity indicated a significant negative correlation between the ghq-12 and global quality of life scores as r = 0.56, p < 0.0001 in iranian population. hospital anxiety and depression scale is a standardized, valid, and reliable self - report rating scale. it was answered using a 4-point likert scale ranging from 0 (not present) to 3 (considerable). the anxiety score is the summation of the particular seven items (ranging from 0 to 21). the ranges of anxiety score for cases are 0 - 7 normal, 8 - 21 mild, moderate or severe disorder. internal consistency as measured by cronbach 's alpha has been found to be 0.78 for hads anxiety sub - scale in iranian population. psychological stress was measured by a self - administered 12-item ghq-12, a well - established screening and diagnostic tool to detect nonpsychotic psychiatric disorders and assessing psychological stress. ghq-12 is a consistent and reliable instrument for using in general population studies and medical settings. less than usual, no more than usual, fairly more than usual, or much more than usual in the past few weeks. a participant could score between 0 and 12 points, and a threshold score of 4 or more was used to identify a participant with high - stress level. convergent validity indicated a significant negative correlation between the ghq-12 and global quality of life scores as r = 0.56, p < 0.0001 in iranian population. hospital anxiety and depression scale is a standardized, valid, and reliable self - report rating scale. it was answered using a 4-point likert scale ranging from 0 (not present) to 3 (considerable). the anxiety score is the summation of the particular seven items (ranging from 0 to 21). the ranges of anxiety score for cases are 0 - 7 normal, 8 - 21 mild, moderate or severe disorder. internal consistency as measured by cronbach 's alpha has been found to be 0.78 for hads anxiety sub - scale in iranian population. as earlier indicated the ffm has been increasingly recognized as a comprehensive, robust and parsimonious model of normal personality traits and had strong external empirical support. among the available instruments for measuring five - factors, the neo five - factor inventory (neo - ffi) and the neo personality inventory revised (neo - pi - r) are the most widely used. neo - ffi was a shortened version of the neo - pi - r (240-items). the neo - ffi results in a profile of the personality of the subject and consists of 60 self - descriptive statements about the personality that measuring five dimensions of the normal personality (i.e., neuroticism, extraversion, openness, agreeableness and conscientiousness) and consisting 12 item / dimension. respondents indicate the degree to which they agree or disagree with each of the statement using a five - point likert - type scale (0 = strongly disagree, 4 = strongly agree). evidences suggested that the shortened tool of neo - ffi is exactly compatible with its complete form namely neo - pi - r so that correlations between the neo - ffi and the longer neo pi - r domains were 0.92, 0.90, 0.91, 0.77, and 0.87 for n, e, o, a, and c, respectively. internal consistency coefficients for the neo - ffi scales calculated with cronbach 's alpha coefficient were found 0.86, 0.77, 0.73, 0.68, and 0.81 for n, e, o, a and c, respectively. in iranian population, cronbach 's alpha is shown for neuroticism, extraversion, openness, agreeableness and conscientiousness as 0.76, 0.65, 0.59, 0.48 and 0.75, respectively. self - administered standard questionnaires were distributed to collect information on age (years), gender (male / female), marital status (married, single), self - reported weight (kg), height (cm), smoking (none, former and current smokers). educational attainments categorized into three categories as lower than diploma (12 years formal education), diploma and more than diploma (including bachelor, master and doctorate). self - reported history of major fgids including gastroesophageal acid reflux disease (gerd), functional dyspepsia (fd), functional constipation (fc) and irritable bowel syndrome (ibs) was explored. the rome iii questionnaire in its complete form and additional questions from the talley bowel disease questionnaire were used to diagnose and classify fgids. face validation of this questionnaire indicated that most participants could not discriminate the difference between the rating scales used in rome iii. therefore, rating scales were modified to a 4-item rating scale (never or rarely, sometimes, often, always) for each question. details of some changes in rome iii were described in former publications. in the current study, the number of fgids was considered (ranging from 0 to 4). perceived intensity of stress the questionnaire has 46 items having 11 various dimensions including home life, financial problems, social relation, personal conflicts, job conflicts, educational concerns, job security, loss and separation, sexual life, daily life, and health concerns. each domain was assessed with a specific number of items using a five - point response scale (strongly disagree strongly agree). perceived social support was measured using multidimensional scale of perceived social support (mspss) that consisted of 12 specific questions and 3 sources of support : family, friends, and significant other. in the current study, the rescoring form of mspss has been used ; in which, each item scored from 0 (disagree and neutral) to 1 (agree), led to a total score between 0 and 12. general practice physical activity questionnaire (gppaq) was used to assess an individual 's current physical activity status. it generates simple, 4-level physical activity index categorizing subjects as : active, moderately active, moderately inactive, and inactive. in the current analysis, participants were classified into two categories namely inactive (including inactive and moderately inactive) and active (including moderately active and active as earlier indicates). results were presented as mean standard deviation (sd) for quantitative variables and were summarized by absolute frequencies and percentages for qualitative variables. independent t - student test and one - way analysis of variance or kruskal - wallis test (when assumptions including normality or homogeneity of variance were not hold) were used to compare mean differences of quantitative variables between two and multiple groups, respectively. distribution of study participants in terms of qualitative variables across different categories of other variables was compared using the chi - square test. the associations between anxiety score and quantitative variables were tested by spearman rank correlations coefficient. multivariate generalized linear mixed model was performed for joint modeling of anxiety score (continuous) and psychological stress (dichotomous) as mixed dependent variables and personality traits as independent variables using shared random effect models. adjusted odds ratio (or) and regression coefficients (95% confidence intervals [ci ]) for psychological stress and anxiety score are presented in 5 different models. first, we adjusted for demographic variables including age, sex, marital status, educational levels. we further controlled for lifestyle variables including smoking, bmi, physical activity in the second model. fourth adjusted model was further controlled for perceived intensity of stress. in the final model, the average (sd) age of the 3180 was 35.91 (7.76) years. 61.4% of the study participants had a college education. about 16% of subjects were current or past smokers. about 45.6% of subjects suffer from overweight or obesity, and approximately 53% of the respondents reported experiencing some fgids including gerd, fd, fc and ibs. altogether 23.9% (n = 761) of participants based on the ghq, had high psychological stress. data on the prevalence psychological stress in terms of gender, marital status, education, ever smoke, physical activity and number of fgids are presented in table 1. the percentage of women with high - stress levels was significantly higher than the percentage of men with high stress level that is, 27.7% versus 18.8% (p < 0.001). the prevalence of ghq 's score 4 and higher was 34.4%, 24.1% and 21.9% in individuals with 0 - 12, 12 and more than 12 years of education, respectively (p < 0.001). in general, in the studied population, 26.5% of inactive and 21.0% of active subjects had ghq score 4 and higher (p < 0.001). suffering from a different number of fgids was associated with an increased prevalence of high psychological stress among study subjects. in the other words, the prevalence of high stress across people suffering from a different number of fgids (0 - 4) was 14% to 48.9%, respectively (p < 0.001). the participants with high stress were more likely to report a lack of social supports and more perceived intensity of stress (p < 0.001). table 1 also showed the anxiety score in different levels of the basic characteristics of study participants. the mean anxiety scores were statistically different in gender and educational levels (p < 0.001). similarly, significant differences were found among people who were in different smoking levels and physical activity groups as well as number of fgids in terms of anxiety scores (all are significant at p < 0.01). there were significant relationship between the social support and perceived intensity of stress with anxiety scores (p < 0.001) but no significant correlations were detected among age and bmi with anxiety score. personality traits (neuroticism, extraversion, openness, agreeableness and conscientiousness) were categorized based on their median scores. the frequencies of personality trait groups in different levels of the basic characteristics of study participants are also presented in table 1. individuals in the high - neuroticism and low extraversion scores were female (p < 0.001) and tended to have lower physical activity (p < 0.001) and education level (p < 0.001), lower social support (p < 0.001), higher perceived intensity of stress (p < 0.001) and were more likely to have more number of fgids (p < 0.001) as compared to those in the low - neuroticism and high extraversion scores. the comparisons of stress level and anxiety score in personality trait groups were provided in table 2. higher significant psychological stress was found among those people who were in the above median category of neuroticism than below median. in contrast, subjects in the high - stress group were significantly more likely to be in the category of below median of extraversion, openness, agreeableness and conscientiousness score compared with subjects in the above median category. furthermore, among participants who were in the category of above median of neuroticism, anxiety score were significantly more than others (5.42 3.99 vs. 1.76 2.09, p < 0.001). as table 2 shows, more participants in the category of below median of extraversion, openness, agreeableness and conscientiousness were also found to be suffering from possible anxiety than those who were in the category of above median of studied traits (all, p < 0.001). joint modeling of anxiety score (continuous) and psychological stress (dichotomous) as the response variables on the different categories of personality traits as the predictor variables in different models were given in table 3. in all fitted models, the category of below median of personality traits (in predictor variables) and low level of psychological stress were defined as the reference category. adding shared random effect to joint modeling of anxiety score (continuous) and psychological stress (dichotomous) is a way to account for correlation and co - morbidity between mixed outcomes. in crude models, we reached a joint significant positive association among stress level and anxiety score with high - neuroticism score (or : 9.21 ; 95% ci : 6.96 - 12.06 and : 3.05 ; 95% ci : 2.80 - 3.29). on the contrary, we found joint inverse associations between stress level and anxiety score with high extraversion score (or : 0.28 ; 95% ci : 0.22 - 0.36 and : 1.04 ; 95% ci : 1.29-0.79). likewise, there were inverse significant relationships between high - stress level and high conscientiousness (or : 0.71 ; 95% ci : 0.56 - 0.91), but no significant association between high conscientiousness and anxiety scores. furthermore, we resulted negative significant relationship between anxiety score and high - agreeableness score (: 0.59 ; 95% ci : 0.83-0.35). after adjusting for a wide range of potential confounding variables such as age, sex, marital status, education level, ever smoke, bmi, physical activity, number of figds, perceived intensity of stress and social supports, the same finding was also found in high - stress level and anxiety score with some personality traits except for conscientiousness and anxiety score. in full adjusted model, there was the inverse significant association between anxiety score and high - conscientiousness score (: 0.23 ; 95% ci : 0.45-0.02). more details on the relationship between psychological stress and anxiety with personality traits in different models can be found in table 3. the comparison of anxiety score, psychological stress and categories of personality traits in different levels of demographic variables the comparison of psychological stress and anxiety score in categories of personality traits crude and adjusted odds ratio (or) and regression coefficients (95% ci for ors and coefficients) resulted from joint modeling of anxiety score and psychological stress as dependent variables and five - factors personality traits as independent variables in this cross - sectional population - based study, association between some personality traits and psychological problems (anxiety and psychological stress) was largely supported by the data in iranian adult population. adding shared random effect to the joint model of anxiety scores (continuous) and psychological stress (dichotomous) is one of the appropriate approaches to accounting for co - morbidity and correlation between mixed outcomes. in fact, high scores of neuroticism compared with low scores, after controlling for all considered confounders such as age, sex, marital status, education level, ever smoke, bmi, physical activity, number of fgids, perceived intensity of stress and social supports (full adjusted model), increased the chance of high psychological stress. likewise, high scores of neuroticism compared with low scores had an additive impact on mean of anxiety score after control for a wide range of potential confounding variables. the association between neuroticism and both psychological stress and anxiety were of course as expected, because there is ample evidence in the literature indicating that people who had high levels of anxiety and stress are characterized by high neuroticism score. also, neuroticism has been regarded as a predisposition to develop all kinds of psychopathology disorders. further, in keeping with previous studies, results indicated that the high scores of extraversion and conscientiousness compared with low scores, after controlling for all confounding variables in the fully adjusted model, was associated with 64% and 35% lower chance of high psychological stress. furthermore, it is expected that the high scores of extraversion, agreeableness and conscientiousness caused to reduce the mean of anxiety score. in the study of newbury - birch and kamali the significant inverse relationships were seen between personality characteristics of neuroticism and both stress and anxiety without adjustment for established confounding variables amongst 109 juniors doctor in the north east of england. the study further revealed that women who had higher neuroticism and lower extraversion scores had higher stress and anxiety scores compared with the rest of the group. in another study, which was performed among 731 community subjects demonstrated that all of the lifetime disorders of interest, including anxiety and depression disorders were associated with high neuroticism and some anxiety disorders were associated with low extraversion. in this study, description of lower - order personality traits, particularly in anxiety disorders were further showed. they mentioned that lower - order dimensions (facets) of agreeableness and conscientiousness were also inversely associated with certain anxiety disorders. in this regard, similar results were observed in the current study. in the study of bienvenu multivariate analysis of variance was used to compare those with particular disorders to those with none of the five disorders of interest (anxiety (including simple phobia, social phobia, agoraphobia, and panic disorder) and major depressive disorders). these results indicated that neuroticism, extraversion, and facets of agreeableness and conscientiousness are important constructs in understanding relationships between personality traits and anxiety and depressive conditions in the general population. neuroticism is broadly associated with social phobia, agoraphobia, panic disorder, and major depression. lower - order dimensions of agreeableness appear relevant to phobias, and those of conscientiousness appear relevant to phobic, panic and major depressive disorders. these results are concordant with our results demonstrating associations between neuroticism, extraversion, agreeableness and conscientiousness with anxiety. in the study of kotov examination of the trait symptom links using hierarchical multiple regression analyses demonstrated that neuroticism and negative emotionality had notable associations with all anxiety symptom disorders and showed an especially strong link to worry. extraversion and positive emotionality accounted for substantial additional variance in social anxiety. in sum, the results of this study confirmed neuroticism as a general factor with all anxiety disorders. however, extraversion and positive emotionality have significant relations to some syndromes but emerged as a unique factor linked only to social anxiety. this study was based entirely on the responses of college students, who generally report relatively low levels of psychopathology. people respond differently to stressful situations, and it appears that those who suffer least from mental problems do so by adopting appropriate coping strategies. the way individuals cope with stressful situations may also be related to their personality characteristics. in the other words, people with different personality traits show different coping methods and different levels of vulnerability in experiencing a stressful situation. this study further established that some participants might be more vulnerable to stress and anxiety as a result of their personality characteristics. used the developed multilevel modeling methodology that can measure responses within individuals, across time, and still test for traditional between - individual differences. they used the dimensions of neuroticism and extraversion for the prediction of between - individual differences in their study. the study revealed that neuroticism predicted lower positive emotionality, higher negative affect and more negative and stressful events. however, extraversion, on the other hand, predicted higher positive effect and more positive events. in addition, negative affectivity itself is related to negative health perceptions in people who were high in neuroticism. individuals scoring high on some aspects of personality, including neuroticism may have a tendency to report more symptoms of medical and mental problems, negatively perceived health status, health worries, frequency of visits to the general physician and poorer mental health. despite their greater health worries, neuroticism is the general trait that is common to all mental disorders and would be broadly associated with the development of mental disorders. extraversion, on the other hand was found to predispose to the experience of most pleasurable events and more positive effects and emotionality. people with a high score on extraversion have been found to report fewer psychological and physical symptoms and was associated with a better - perceived health status, through its influence on well - being and positive affect which lessens health worries. conscientiousness and agreeableness are associated with positive perceptions. in general practice settings, it is likely that understanding of personality aids practitioners in assessing and dealing with people they know reasonably well. however, in a hospital setting, there is often little opportunity for getting to know the personality of a patient in a busy clinic or ward. it is worthwhile that personality traits be taken into consideration when offering support and counseling. most previous research focused on anxiety and stress as single risk indicators, and also characteristics of personality traits as single predictors of mental problems. these negative emotions and personality traits were investigated simultaneously in the present study. to the best of our knowledge, there has not been any report regarding the influence of personality traits on both stress and anxiety the shared random effects model. although the proposed framework obviously needs further explication, it appears to be a useful guide for personality psychopathology research. the strengths of this study include the use of a wide range of likely confounding variables, including sex, age, marital status, education level, bmi, perceived intensity of stress, social support, ever smoke, physical activity and number of fgids, the reasonably comprehensive yet manageable measure of five - factor personality traits, neo questionnaire, large and representative sample, comprehensive statistical method with a focus on correlation between mixed outcomes and considering five personality traits simultaneously in the all models. it is difficult to assess causal relationships between personality traits and mental problems with cross - sectional studies. also, the current results are based entirely on the participants self - ratings, and it obviously is important to consider other types of data as well. in this regard, it would be particularly informative to assess each of the underlying results in this study using multiple methods (e.g., self - ratings, clinicians ratings, and peer - ratings). furthermore, we adopted a simple approach to handling missing data (complete - case), as our data were fairly complete. however, future studies may benefit from more sophisticated methods, such as multiple imputations. investigation of relations between personality traits and high - prevalence mental problems can provide important information on the dimensional measures of psychopathology and screen for psychological factors in the primary care settings. such researches can provide a somewhat clear perspective on the relationship between personality traits and psychopathology and finally will enhance our knowledge about psychological problems and lead to improvement in mental and physical health. according to likely mechanism of genetic and environmental factors on the relationships between personality traits and psychological disorders, it is suggested to perform longitudinal studies focusing on both genetic and environmental factors in iranian population. af contributed in the conception and design of the work, manuscript preparation, drafting and revising the draft, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. ahk contributed in the conception and design of the work, drafting and revising the draft, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. fn contributed in the manuscript preparation, analysis, interpretation of data, drafting and revising the draft, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. hr contributed in the conception and design of the work, drafting and revising the draft, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. pa contributed in the conception and design of the work, drafting and revising the draft, conducting the study, approval of the final version of the manuscript, and agreed for all aspects of the work. | background : previous studies have showed some evidences about the relationship between personality traits particularly neuroticism and extroversion, separately, with psychological stress and anxiety. in the current study, we clarified the magnitude of joint interdependence (co - morbidity) of anxiety (continuous) and psychological stress (dichotomous) as dependent variables of mixed type with five - factor personality traits as independent variables.materials and methods : data from 3180 participants who attended in the cross - sectional population - based study on the epidemiology of psychological, alimentary health and nutrition and completed self - administered questionnaires about demographic and life style, gastrointestinal disorders, personality traits, perceived intensity of stress, social support, and psychological outcome was analyzed using shared random effect approach in r free software.results:the results indicated high scores of neuroticism increase the chance of high psychological stress (odds ratio [or ] = 5.1 ; p < 0.001) and anxiety score (b = 1.73 ; p < 0.001) after adjustment for the probable confounders. in contrast, those who had higher scores of extraversion and conscientiousness experienced lower levels of anxiety score (b = 0.54 and 0.23, respectively, p < 0.001) and psychological stress (or = 0.36 and 0.65, respectively, p < 0.001). furthermore, higher score of agreeableness had significant negative relationship with anxiety (b = 0.32, p < 0.001).conclusion : the present study indicated that the scores of neuroticism, extraversion, agreeableness and conscientiousness strongly predict both anxiety and psychological stress in iranian adult population. due to likely mechanism of genetic and environmental factors on the relationships between personality traits and psychological disorders, it is suggested to perform longitudinal studies focusing on both genetic and environmental factors in iranian population. |
two study designs were explored : a pure poc design with a placebo and an active arm ; a dose - ranging scenario. for simplicity, the comparison between conventional study power and pharmacometric model based power were made at 80% study power in all examples and scenarios ; however, the full power curves are presented in the graphs. in the poc stroke example, using a two - sided t - test to detect a difference in the change from baseline and day 90 national institutes of health stroke scale (nihss) score (using last observation carried forward) between placebo and the active dose group resulted in a study size of 388 patients (194 patients / arm), visualized in figure 3a. using a pharmacometric model based approach, the 80% study power was reached with a study size of 90 patients (45 patients / arm), resulting in a 4.3-fold difference in total study size between the two methods. in the diabetes example, the conventional power calculation resulted in a study size of 84 patients (42 patients / arm) and the pharmacometric approach resulted in a study size of 10 patients (5 patients / arm), presented in figure 3b, corresponding to an 8.4-fold difference between the two methods. the pharmacometric model based 80% study power assessed with monte - carlo mapped power (mcmp, further described in the methods section) was verified by stochastic simulations and estimations (data not shown). both the investigated examples show a several fold reduction in study sizes when employing a model - based analysis. the reasons that the diabetes trial benefits the most are as follows : (i) fpg inherently contain more information (i.e., more sensitive to a drug effect as compared with stroke scores) than stroke scores, and (ii) a more informative study design which included a run - in phase to separate the placebo effect (which contained most of the between patient variability) from the drug effect, and a total of 10 repeated measurements of fpg were obtained. the dose - ranging poc study scenario also resulted in a several fold difference between the two analysis methods for both disease areas, as visualized in figure 4. in the stroke example, the pharmacometric approach resulted in a total study size of 184 patients and the t - test based study size was 776 patients (i.e., a 4.3 factor difference), as displayed in figure 4a. both the investigated study designs resulted in several fold larger study size to ensure similar power between the two analysis methods. however, due to the linear drug effect, the factor difference in study sizes remains the same when adding low and median dose groups. in the diabetic example, using the t - test to detect a significant difference between the placebo and the active treatment resulted in a total study size of 168 patients (42 patients / arm) to reach an 80% power, as shown in figure 4b. the sample size required to reach the same power using the pharmacometric model based approach resulted in a study size of 12 patients (three patients / arm), resulting in a 14 factor difference in study size between the two methods. the reasons for the increased difference between the methods, as compared with the pure poc scenario, are the nonlinear exposure response relation that is more informed by multiple dose groups, and the inclusion of a follow - up observation adding more support to the drug effect. poc studies (phase 2a) are often categorized as the first confirmatory trial in a drug development program, and it is not uncommon that the primary analysis is similar to the analyses used in the phase 3 trials. this is unfortunate because the informativeness of the trial is diluted when, for example, using end of study observations only, discarding all other information. the first example, for each therapeutic area, represents a pure poc scenario in which the objective is to detect a defined drug effect between one active dose and placebo. however, because poc trials are often executed with multiple treatment arms to fulfill secondary objectives such as exploring dose response relations, a dose - ranging poc scenario was also investigated. multiple active doses can contain valuable information to inform the poc decision, as well as support a dose / exposure response relation in a pharmacometric model based approach. in a conventional approach, t - tests are often applied individually on each treatment arm in comparison to placebo which make interpolations between treatment arms difficult and reduce the ability to propagate knowledge about dose / exposure response to future studies. as these results show, the use of a pharmacometric model based approach within drug development has the potential to reduce study sizes of clinical trials. one of the main reasons for this is the use of longitudinal data as the pure poc results show. the poc example contains minimum information about the drug effect, involving only one active treatment arm and placebo, nevertheless by including all data available (i.e., repeated measurements) the pharmacometric approach results in a several fold reduction in study size when addressing the question of poc. mixed - effects modeling is a powerful and flexible method when dealing with unbalanced repeated measurements, which is often the case in clinical trials, and utilization of a pharmacometric model based analysis does not necessarily mean that the design of the trial has to change, just that all available data are used in the primary analysis thereby increasing the information content of the trial, as these examples clearly illustrate. we acknowledge that there are many methods available for the statistical analysis of clinical trials. in this study, we have chosen to compare the t - test and pharmacometric modeling as these two methods can be viewed as the two extremes in terms of statistical power. the statistical power using other methods can be expected to fall somewhere in between the ones from the t - test and the pharmacometric modeling. there are few comparisons of statistical power between pharmacometric model based analyses and other statistical methods ; however, both jonsson and sheiner and hooker. have presented results that indicate that model - based methods lead to a reduction in study sizes. as already mentioned, poc trials and dose - ranging trials are often combined into one single phase 2 study to address both poc and dose - finding questions within the same trial. in a pharmacometric analysis, the aim is to detect a drug effect by establishing a model for the dose / exposure response relation and naturally that will be more informed if multiple levels of doses are included. this is particularly true if the relation is nonlinear, as the results from the diabetes example indicate. in the stroke example, the drug effect was linear with respect to dose which resulted in the same factor difference in study sizes between the poc and dose - range scenarios. however, although not explored in the present investigation, the precision of the drug parameter will most likely increase with the addition of more dose levels. pharmacometric models have other advantages such as mechanistic interpretation of the model parameters and simultaneous analysis of multiple end points, as exemplified with the hba1c model. furthermore, a pharmacometric model based power can be combined with a formal optimal design to pin down the most informative clinical trial design in terms of both study power and parameter precision. the use of pharmacometric models when calculating the study power is of course dependent on the availability of a pharmacometric model. several pharmacometric models exist in the literature for many clinical end points, and table 1 consists of a nonexhaustive list of pharmacometric model candidates in different therapeutic areas. alternatively, a model for placebo treatment can often be generated from data from previous trials, if available to the investigator. if the compound is a follow - up compound, it may be possible to use a model developed for the predecessor, or if the compound is first in class, model developed in preclinical or early phase studies can be used or a selection of hypothesized models can be used to create a however, if the information about a model is very limited, a model - based power calculation may not be sensible. the model - based results in this study rely on the assumptions of no model misspecification and the detection of a drug effect different from zero. it is reasonable to believe that model misspecifications will lead to imprecision in the statistical power and in the case in which the model is so uncertain that further model building needs to be done, the analysis will suffer from uncontrolled type i error rate. although no clinical relevance criterion was applied in the power calculations, a clinically relevant drug effect was used in the simulation of data. in a real - life scenario, the clinical relevance should be evaluated by clinical trial simulations in which you have the option to investigate various outcome measurements, optimal doses, dose regimens, and the impact of possible uncertainties in the model. the study power calculations based on pharmacometric models historically often rely on simulation and estimation exercises which can be very time consuming and, therefore, not extensively used. the newly developed mcmp method for calculating the study power has the advantage of being a much faster method than the traditional simulation and estimation procedures, making a pharmacometric model based power calculation more accessible. the increased speed also enables investigations of multiple pharmacometric models and parameter values to explore the assumptions made in the pharmacometric model the members of the pharmaceutical research and manufacturers of america proof of concept working group recently recommended a more complex poc definition : poc is the earliest point in the drug development process at which the weight of evidence suggests that it is reasonably likely that the key attributes for success are present and the key causes of failure are absent. to obey this definition, it is necessary to combine information about the drug from several sources, not only from a single efficacy study, and a pharmacometric analysis is well suited for including data from several studies and to combine models for both efficacy and safety into a single quantitative poc metric. ideally, one could also include health economic aspects to further inform the poc decision. obvious benefits of reduced study sizes are the reduced costs and that fewer patients / volunteers will be exposed to an experimental drug before efficacy can be confirmed. this together with the increased potential for new drugs to reach the market faster provide strong incentives to consider a pharmacometric approach in the planning of a poc study. in the two example applications, a fixed study design was simulated and the results were analyzed using a pharmacometric model based approach, as described below, and a conventional statistical analysis using a t - test. the pharmacometric based power, in both examples, was assessed by using the mcmp tool implemented in psn version 3.2.7 (psn, uppsala university, uppsala, sweden) and nonmem version 7.1.2 (icon development solutions, ellicott city, md), run on a linux cluster with a red hat 9 operating system using openmosix and a g77 fortran compiler. is based on the hypothesis testing principle of the lrt in nonlinear mixed - effect models. several studies have investigated the performance of the lrt in nonlinear mixed - effects models, and the performance is generally good with type i error rates close to the nominal distribution. the mcmp method is a faster alternative to the multiple simulations and estimations of studies with different study size that constitutes the traditional power / sample size calculation method for lrt in mixed - effect models. with the mcmp method, multiple random samples of individual objective function values (iofv) are used as a substitute for multiple simulated and estimated studies. this substitution is based on the fact that the individual ofv sum up to the overall ofv of a model for a given data set as shown in eq. the hypothesis of a possible drug effect can be tested with the lrt by assessing the difference in the ofv (ofv) between two nested models (i.e., including or not including the hypothesized drug effect). the ofv follows a distribution with degrees of freedom corresponding to the difference in number of parameters between the two competing models. a model that corresponds to the null hypothesis of no drug effect will hereafter be referred to as a reduced model, and a model corresponding to the alternative hypothesis of an existing drug effect will be referred to as a full model. with the mcmp method, iofv values estimated with a single full and single reduced model are used to calculate iofv (eq. the sum of n randomly sampled iofv is used as a surrogate for the ofv of a study with n number of subjects (eq. the single estimation step is performed with a large data set (typically 20 times the sample size needed for 80% power) simulated under the full model to form a large pool of iofvs. the ofv calculation is repeated 10,000 times and the study power is computed as the percentage of ofvs out of 10,000 scenarios that are greater than the significance level criterion defined by the lrt. the procedure is repeated with varying sample size (e.g., in increments of one patient) to map the power vs. sample size relationship up to a defined maximum power of interest. clinical trial design. in both investigated examples, two study scenarios were defined : a pure poc study in which a placebo arm was compared with an active dose group, and a dose - ranging scenario with placebo and three active treatment arms in which the objectives were to address both a poc definition and explore the dose response relationship. data for placebo and three active doses were simulated. in the poc study, only the placebo and the highest dose group were used whereas in the dose - ranging study, all four study arms were used in the pharmacometric approach. the conventional study sizes were based on t - test comparing placebo and the highest dose group, and the size of the dose - ranging study was calculated under the assumption of four equal sized groups, i.e., the conventional dose - ranging study was twice the size of the conventional poc study. a nonlinear mixed - effects model has previously been developed for stroke disease progression after an acute ischemic stroke, assessed by the 42 point nih stroke scale (nihss). the model consists of three submodels for conditional probabilities reflecting the likelihood of disease improvement or deterioration, reaching complete recovery (i.e., nihss = 0 as in no neurological disability) and dropout of the study, in combination with two linear submodels for of the relative magnitude of improvement or deterioration (visualized in figure 1 and model code available in supplementary appendix s1a online). this structure of the model enables several options on where to introduce a drug parameter, depending on the mechanism of the drug. however, in this simulation study, the drug effect was only added linearly on the magnitude of improvement (i.e., relative score change given an improvement in disease state). effect relation was calibrated such that a low, medium, and high dose level would result in 25, 33, and 55% increase in the proportion of fully recovered patients at end of study as compared with placebo (resulting in a drug parameter value of 0.1 and dose levels of 2.5, 3.8, and 5.8). the definition of a fully recovered patient was a nihss score of 0 or 1. fifty - five percent relative proportion of fully recovered patients was a clinically relevant effect, assuming an equal treatment effect as the potential competitor tissue plasminogen activator treatment. the pharmacometric model based study power was defined as the power to detect a drug effect, i.e., the possibility to estimate a drug parameter different from zero with a 5% significance level. for the purpose of the model - based power calculations, a large data set comprising of 2,500 patients / arm were simulated and estimated under the full model. in the poc scenario, placebo and the 5.8 dose arm were used, and in the dose - ranging study, all four treatment arms were kept in the data set. to generate a conventional power curve, calculations were made using a two - sided t - test (p 5.99) and a three degree of freedom difference (two fixed effect and one random effect parameter) in the dose ranging study example (ofv > 7.81). | drug development struggles with high costs and time consuming processes. hence, a need for new strategies has been accentuated by many stakeholders in drug development. this study proposes the use of pharmacometric models to rationalize drug development. two simulated examples, within the therapeutic areas of acute stroke and type 2 diabetes, are utilized to compare a pharmacometric model based analysis to a t - test with respect to study power of proof - of - concept (poc) trials. in all investigated examples and scenarios, the conventional statistical analysis resulted in several fold larger study sizes to achieve 80% power. for a scenario with a parallel design of one placebo group and one active dose arm, the difference between the conventional and pharmacometric approach was 4.3- and 8.4-fold, for the stroke and diabetes example, respectively. although the model - based power depend on the model assumptions, in these scenarios, the pharmacometric model based approach was demonstrated to permit drastic streamlining of poc trials. |
in the natural dentition, the masticatory force is distributed through the periodontal ligament to the alveolar bone. after tooth loss, the lack of physiologic stimulation causes disuse atrophy of the alveolar bone. simultaneously, the distribution of force from the periodontal ligament to the alveolar bone is lost and the masticatory force is loaded directly on the bone surface. moreover, the gingival recession and scar tissue formed after tooth extraction increase the surface tension of the residual bone during complete removable dental prosthesis use. irreversible, persistent resorption results in insufficient residual bone width in the anterior maxilla. in the posterior maxilla, furthermore, the resorption rate of the mandible is four times that of the maxilla.1 the rate and amount of bone loss are influenced by various factors such as gender, hormones, metabolism, and parafunctional habits. in edentulous patients, atrophy of the residual ridge is one of the most important factors affecting support, retention, stability, and masticatory function of dental prostheses.2 - 4 accurate morphologic assessment of the residual ridge and residual bone is crucial for treatment planning with endosteal dental implants. in this regard, panoramic radiography enables visualization of the whole dentition, maxilla and mandible, and temporomandibular joints on a single radiograph. it, to a certain extent, also provides useful information about anatomic structures such as the maxillary sinuses, nasal cavity, inferior alveolar nerves, and mental foramens at low cost.5 since july 1, 2012, treatment with complete removable dental prostheses in edentulous korean patients aged over 75 years has been covered by national health insurance. since july 1, 2013, the cost of partial removable dental prostheses has also been covered, and treatment with two endosteal dental implants will be insured from july 1, 2014. as the number of patients treatable with such prostheses is expected to increase substantially,, there is insufficient information on the residual bone parameters of elderly edentulous patients for endosteal dental implant placement in korea. the aim of this study was to obtain statistical data on the residual bone height at different natural tooth positions by panoramic radiography in edentulous korean patients aged 60 - 90 years. this study was approved by the institutional review board (irb) of the dental hospital of dankook university (irb no. it included the diagnostic panoramic radiographs of 180 randomly selected edentulous patients who had visited the dental hospital between 2008 and 2013. the patients had no history of systemic diseases affecting bone, such as thyroid disease, hyperparathyroidism, diabetes mellitus, chronic renal disease, and osteoporosis. imaging had been performed with a proline pm panoramic x - ray machine (planmeca, helsinki, finland) by using an amplification ratio of 1:1.3. the radiographic selection criteria of this study were as follows : clearly visible nasal septum, anterior nasal spine, and nasopalatine foramenabsence of obvious facial asymmetryno surgical and fracture historyclearly visible lower edges of the piriform aperturesclearly visible maxillary sinusesclearly visible inferior margins of the zygomatic processes of the maxillaclearly visible mental foramensclearly visible superior borders of the mandibular canals clearly visible nasal septum, anterior nasal spine, and nasopalatine foramen absence of obvious facial asymmetry no surgical and fracture history clearly visible lower edges of the piriform apertures clearly visible maxillary sinuses clearly visible inferior margins of the zygomatic processes of the maxilla clearly visible mental foramens clearly visible superior borders of the mandibular canals the panoramic radiographs of 101 patients did not meet these criteria. the coronal width of all the natural teeth except the third molars was measured according to table 1 to determine the horizontal distances of the teeth from the midline. the horizontal distances were then used to measure the residual bone height at the positions of the natural teeth. for example, the horizontal distance of the maxillary second premolar from the midline was determined as the sum of the widths of the maxillary central incisor, lateral incisor, canine, and first premolar, and half the width of the second premolar (e.g., 8.5 + 6.5 + 7.5 + 7 + 3.5 = 33 mm).the actual distance in the panoramic radiographs was 42.9 mm because of the applied amplification ratio. the contours of the facial midline (determined from the nasal septum, anterior nasal spine, and nasopalatine foramen), lower edges of the piriform apertures, maxillary sinuses, most inferior margins of the zygomatic processes of the maxilla, mental foramens, and superior borders of the mandibular canals were traced on digitized panoramic radiographs, saved, and printed. the residual bone height was then measured at 18 maxillary and mandibular sites by using a digimatic caliper (mitutoyo corporation, kawasaki, japan), triangle, and ruler. in particular, bilateral parallel lines were drawn at 5.9 and 42.9 mm from the facial midline and through the most inferior margins of the zygomatic processes of the maxilla in the first molar area on the panoramic radiographs. 1) : u1 : distance from the anterior nasal spine to the residual ridge crest at the midlinecentral incisor sites 1 - 1 and 2 - 1 : distances from the lower edges of the piriform apertures to the residual ridge crest along the parallel lines at 5.9 mm from the midlinesecond premolar sites 1 - 5 and 2 - 5 : distances from the inferior borders of the maxillary sinuses to the residual ridge crest along the parallel lines at 42.9 mm from the midlinefirst molar sites 1 - 6 and 2 - 6 : distances from the most inferior borders of the maxillary sinuses to the residual ridge crest along the parallel lines through the most inferior margins of the zygomatic processes of the maxilla in the first molar area u1 : distance from the anterior nasal spine to the residual ridge crest at the midline central incisor sites 1 - 1 and 2 - 1 : distances from the lower edges of the piriform apertures to the residual ridge crest along the parallel lines at 5.9 mm from the midline second premolar sites 1 - 5 and 2 - 5 : distances from the inferior borders of the maxillary sinuses to the residual ridge crest along the parallel lines at 42.9 mm from the midline first molar sites 1 - 6 and 2 - 6 : distances from the most inferior borders of the maxillary sinuses to the residual ridge crest along the parallel lines through the most inferior margins of the zygomatic processes of the maxilla in the first molar area further, tangents were drawn bilaterally along the lateral border of the mandibular rami and from the most inferior points of the mandibular angles to the most inferior points on the lower border of the mandibular body. bilateral lines were also drawn from the center of the lower border of the mandibular body to the bisecting lines at the intersection of the tangents to the mandibular angle - body and rami (a). then, bilateral parallel lines were drawn at 3.9 mm from the midline, perpendicular to a through the mental foramens, and perpendicular to a at 5.2 mm mesial and 16.3 mm distal to the mental foramens. 1) : l1 : distance from the inferior border of the mandible to the residual ridge crest at the midlinecentral incisor sites 3 - 1 and 4 - 1 : distances from the inferior border of the mandible to the residual ridge crest along the parallel lines at 3.9 mm from the midlinefirst premolar sites 3 - 4 and 4 - 4 : distances from the inferior border of the mandible to the residual ridge crest along the lines perpendicular to a at 5.2 mm mesial to the mental foramenssecond premolar sites 3 - 5 and 4 - 5 : distances from the inferior border of the mandible to the residual ridge crest along the lines perpendicular to a through the mental foramenssecond premolar sites 3 - 5 ' and 4 - 5 ' : distances from the superior border of the mandibular canal to the residual ridge crest along the lines perpendicular to a through the mental foramensfirst molar sites 3 - 6 and 4 - 6 : distances from the superior border of the mandibular canal to the residual ridge crest along the lines perpendicular to a at 16.3 mm distal to the mental foramens l1 : distance from the inferior border of the mandible to the residual ridge crest at the midline central incisor sites 3 - 1 and 4 - 1 : distances from the inferior border of the mandible to the residual ridge crest along the parallel lines at 3.9 mm from the midline first premolar sites 3 - 4 and 4 - 4 : distances from the inferior border of the mandible to the residual ridge crest along the lines perpendicular to a at 5.2 mm mesial to the mental foramens second premolar sites 3 - 5 and 4 - 5 : distances from the inferior border of the mandible to the residual ridge crest along the lines perpendicular to a through the mental foramens second premolar sites 3 - 5 ' and 4 - 5 ' : distances from the superior border of the mandibular canal to the residual ridge crest along the lines perpendicular to a through the mental foramens first molar sites 3 - 6 and 4 - 6 : distances from the superior border of the mandibular canal to the residual ridge crest along the lines perpendicular to a at 16.3 mm distal to the mental foramens the same researcher performed all the procedures, including the screening and observation of the radiographs, measurements, and data recording. spss software (version 18.0, spss inc. the t - test and rank - sum test were used to analyze height differences by gender and age. the patient age ranged from 61 to 86 years, and the mean age was 73 years. the 60s, 70s, and 80s age groups included 24, 40, and 15 patients, respectively. the residual bone height measured at the 18 sites is presented in table 2. in the edentulous maxilla, the height at the midline site (u1) was 16.85 mm and that of central incisor sites 1 - 1 and 2 - 1 was 13.52 and 13.61 mm, respectively. the residual bone was higher in the facial midline than in the central incisor area. in the second premolar (1 - 5, 2 - 5) and first molar (1 - 6, 2 - 6) areas, the height of the residual bone was between 5.53 and 5.85 mm. in the edentulous mandible, the height at the midline site (l1) was 21.82 mm and that of central incisor sites 3 - 1 and 4 - 1 was 21.70 and 21.74 mm, respectively. the midline residual bone was nearly the same height as the residual bone in the central incisor area. in the second premolar (3 - 5 ', 4 - 5 ') and first molar (3 - 6, 4 - 6) areas, the height of the residual bone was between 7.93 and 8.83 mm. the t - test did not reveal significant differences in the measured height of the maxillary residual bone by gender. however, male patients had significantly higher mandibular residual bone than female patients (p<.05)(table 3). the rank - sum test showed no significant differences among the three age groups (table 4). it is widely used for preoperative radiographic examination of edentulous patients and morphologic assessment before complete removable dental prosthesis and endosteal dental implant placement. thorpe7 suggested that it could be used to determine bone density, residual ridge regularity, residual bone height, locations of canals and foramens, and the vertical dimension before and after treatment. its main disadvantage is image distortion : the distortion rate of orthopantomograms is generally between 10% and 30%. the distortion rate attributable to the imaging equipment varies depending on the type of machine and imaged anatomic parts.8 on the other hand, cone - beam computed tomography (cbct), first applied in dentistry in the 1990s, has the advantages of precise imaging, high definition, low radiation exposure, short scan time, ease of use, and three - dimensional image reconstruction. in the present study, panoramic radiographs were used instead of cbct images because fewer than 30 edentulous patients have undergone dental cbct at the dental hospital of dankook university, which would limit the sample size for statistical analysis. however, instrumental errors were minimized by instructing the patients to stay as still as possible and keeping the head position balanced. the error caused by the positional relationship of the equipment, film, and patient the rate of residual bone resorption is not constant : it is rapid between 6 months and 2 years after tooth extraction and tends to stabilize thereafter.1,9 the duration of complete removable dental prosthesis use is an important factor, because the longer the duration of use, the greater is the degree of resorption.10 moreover, in the initial stage of complete removable dental prosthesis use, residual bone resorption is rapid ; with time, the resorption rate tends to slow.9 the average surface area of the maxillary and mandibular periodontium is 45 cm. on the other hand, the maxillary and mandibular prosthetic pressure - bearing areas are 22.96 and 12.25 cm, respectively. as the mandibular residual ridge receives more pressure, the degree of residual bone resorption is more in the mandible than in the maxilla.11 in edentulism, a complete removable dental prosthesis, overdenture, or implant - supported fixed or removable dental prosthesis is needed to restore mastication, esthetics, phonetics, and other functions. in general, if the residual bone height in the posterior maxilla is below 4 mm, the maxillary sinus floor should be elevated before implant surgery. however, if the residual bone height is above 4 mm, subantral augmentation and implant surgery can be performed simultaneously. special care is also required for implant placement if the mandibular residual bone height is under 10 mm.12 in the present study, the average residual bone height in the anterior maxilla was over 13.75 mm. however, the average residual bone height in the posterior maxilla was under 5.85 mm. short dental implants reportedly have a low success rate,13 but several studies showed no significant differences in the success rates of short and long dental implants.14 further, aparicio.15 showed that angulation increases the initial stability of dental implants because of the increased implant - bone interfacial area. during implant surgery in a severely atrophied mandible, implant placement in cases of posterior residual bone height under 10 mm should therefore be performed very carefully.12 a baseline is necessary for accurate height measurement in the posterior mandible. gler.16 used a line tangential to the most inferior points at the mandibular angle and lower border of the mandibular body as the baseline. contrarily, it is better to determine the baseline by first identifying two fixed points in the mandibular angle region and at the midline of the mandibular lower border. in the present study, tangents were drawn bilaterally along the lateral borders of the mandibular rami and lines were drawn from the most inferior points of the mandibular angles to the most inferior points on the lower border of the mandibular body. from the intersection of these lines, a bisecting line was drawn in the mandibular angle region on each side and another perpendicular line was drawn at the midline. the bilateral points where these lines met on the mandible were joined and used as the baseline for the mandibular measurements. by this method, the two fixed points could be accurately located on all the panoramic radiographs, reducing measurement errors. in the mandibular anterior region, however, posteriorly, the average residual bone height was below 8.83 mm, which does not allow placement of implants with adequate length. the mandibular residual ridge can be improved by augmentation techniques such as onlay graft, distraction osteogenesis, or relocation of the mandibular canal. in addition, problems such as poor retention, repeated pain, ulceration, and masticatory dysfunction associated with mandibular complete removable dental prostheses can be effectively resolved with a two - implant - supported overdenture.17 dental implants should be placed between the mental foramens to avoid using the mandibular posterior region when the residual bone height is insufficient. complete removable dental prostheses are a suitable option for patients who are not treatable with dental implants because of financial, medical, or morphologic reasons. this result suggests that residual bone resorption is not affected by age, as previously reported.16 rather, the durations of edentulousness and prosthetic use are more important. although a comparative analysis of the duration of edentulousness is warranted, few patients have such records at the dental hospital of dankook university. this difference could be explained by the lack of female hormones in postmenopausal women, which may hasten residual bone resorption.18 the reason for the lack of a significant difference in the maxilla might lie in the different bone densities between the mandible and the maxilla. trabecular bone is often looser in the edentulous maxilla than in the edentulous mandible.19 furthermore, mandibular bone atrophy and osteoporosis have been found to be correlated and more prevalent in women. in contrast, bone atrophy shows no relationship with osteoporosis in men.5 in addition, according to mercier,20 men have greater facial height and amount of resorbable bone after extraction, so the ratio of the potential units of resorbable bone to the years of resorption act in their favor. he also mentioned that women are more likely to undergo tooth extraction because of pregnancy and other reasons. in the maxillary and mandibular anterior regions of edentulous korean patients, the average residual bone height tends to exceed 13.75 and 20.85 mm, respectively, which would be sufficient for endosteal dental implant placement. however, due to the presence of the maxillary sinuse, the average residual bone height in the posterior maxilla tends to be below 5.85 mm. furthermore, the placement of endosteal dental implants with adequate length would be difficult in the mandibular posterior region because of the average residual bone height of under 8.83 mm. dentists should pay greater attention to female edentulous patients, especially older women, because of their greater susceptibility to rapid residual bone resorption. | purposethe aim of this study was to obtain statistical data on the residual bone height at different natural tooth positions by panoramic radiography in edentulous korean patients aged 60 - 90 years.materials and methodsthe study included the diagnostic panoramic radiographs of 180 randomly selected edentulous patients without systemic diseases affecting bone. the radiographic selection criteria included absence of obvious facial asymmetry, clearly visible anatomic structures, and no surgical and fracture history. the panoramic radiographs of 79 patients met these criteria and were used in the analysis. the same researcher processed all the radiographs by using a standardized method. the height of the residual bone was measured at 18 predetermined sites (7 in the maxilla and 11 in the mandible) on digitized and printed radiographs by using a digimatic caliper, triangle, and ruler. gender- and age - related differences were statistically analyzed by using the t - test and rank - sum test (=0.05).resultsthe maxillary residual bone height did not show significant gender - related differences, but male patients had significantly higher residual bone in the mandible(p<.05). no significant height differences at the measured sites were noted among the 60s, 70s, and 80s age groups.conclusiondentists should pay greater attention to older female edentulous patients because they are more prone to rapid residual bone resorption. residual bone resorption may not be affected by age. |
the obesity prevalence has alarmingly and unprecedentedly increased by more than 3-fold in last three decades, irrespective of socioeconomic status, gender, or age, worldwide. globally, there are more than 1 billion overweight adults which constitute 300 million clinically obese individuals. obesity is the prime risk factor for various morbidities related to cardiovascular system, metabolic system, and endocrine system. however, in the last 50 years there is a consistent accumulation of evidence to suggest that obesity can significantly impair respiratory well being as well. there is substantial evidence to suggest that obesity enhances the risk of having asthma [230 ] antedate development of asthma [3, 4, 6, 20 ] and induces asthma worsening amongst preexisting asthmatics [3033 ]. the current mechanistic understanding of asthma and obesity is a complexity of dietetic factors deficient in antioxidants [3439 ], attributes of reduced physical exercise [40, 41 ], gastroesophageal reflux disease (gerd) [4244 ], components of systemic inflammation released from adipose tissue, and mechanical restriction imparted on lung excursions by thoracoabdominal fat [68 ]. nevertheless, there is a general consensus that obesity increases the metabolic oxygen demand and alongside impairs the lung - diaphragmatic movement. hence, obesity is an intriguing clinical state of virtual respiratory distress without respiratory illness. in this review we will primarily discuss the physiological changes in the lungs caused by obesity, with its potential role in inducing lung physiology conducive to asthma clinical state. obesity has been linked to asthma in various cross - sectional and prospective studies with odds ratio of 1.53.5 and relative risk of 1.13.5 across adult and paediatric populations [3, 8 ]. further, some studies have failed to demonstrate any direct obesity - asthma associations, however, having elucidated positive relation between adipokines (adiposity related inflammatory mediators) and asthma in same populations which indirectly links obesity to asthma. the obesity asthma link is largely attributed to female gender [8, 1215, 17, 4648 ]. however, there is enough evidence to suggest that obesity enhances the risk of asthma in male populations as well [10, 11, 16, 20 ]. weight has also demonstrated a dose response association with asthma symptoms [2, 3, 58 ]. in a retrospective study of 143 adults, akerman. demonstrated linear relationship (r = 0.40, p = 0.0001) between asthma severity and body mass index (bmi). in another study, varraso. had shown that with each 1 kg / m the asthma severity score changes by 0.183. despite the strong link between asthma and adiposity there are few studies which have failed in elucidating any link between asthma and obesity. asthma - obesity studies have some pertinent methodological limitations, particularly over reliance on self - reporting of symptoms age and height, and inadequate sample size issues, which could have contributed to the absent obesity - asthma link in some studies. however, it is also important to mention that asthma and bmi demonstrate a u shaped relation [7, 8 ]. both extreme high and low bmis enhance risk of developing asthma [7, 8 ]. largely many obesity and asthma studies this generates a pertinent risk of also including low bmi high asthma risk population in nonobese bmi comparative groups, which could have negated obesity - asthma associations in some studies. additionally, bmi has potential to overdiagnose obesity. bmi defines size of body structure rather than true obesity, which constitutes fatty mass plus body masculinity. the adiposity impacts negatively on the lung functions, while the masculinity impacts positively on the lung functions [5766 ]. further, bmi in children may not adequately distinguish increased lean tissue mass from increased fat mass. therefore, bmi is not always an appropriate marker to study obesity associated diseases in male gender and paediatric populations. this however ensues requirement of actual measure of body adiposity, such as waist / hip ratio (whr), which reflects central adiposity, subscapular skin - fold thickness, which reflects thoracic adiposity, and skin - fold thickness which reflects general obesity. obesity induced lung restriction is one of the prime factors contributing to deranged respiratory mechanics. therefore, the potential role of body fat distribution in induction of asthma obesity relationship can not be neglected. it is the abdominal and thoracic fat which interdependently imparts mechanical restriction to the excursions of diaphragm and lungs. the fatty tissue deposits on other bodily sites such as the hips and thighs will not affect the lung movements. in a recent study, park. had shown that overall body fat perse does not contribute to low lung volumes in males, while abdominal obesity significantly reduced fev1 and fvc irrespective of gender. it is believed that there is more thoracoabdominal fat deposition in females compared to males. this could also be a reason for small airway calibre in females and relatively more obesity predisposition towards asthma in females compared to males. further it has been shown that asthma is more common amongst obese girls who have achieved puberty and menarche earlier. there is also an evidence to suggest that postmenopausal usage of estrogens enhances risk of asthma [25, 50 ]. also, progesterone which is known to induce smooth muscle relaxation is decreased in obese states [68, 69 ]. such observations cue towards probable role of estrogens - progesterone modulation in obesity in development of asthma in women during puberty. in addition, in a study, gold. followed a group of 9,828 children aged 614 years over median period of five years in six us cities to evaluate asthma incidence in the paediatric population. this study showed that during the entry into the study there was an increased risk of a new asthma diagnosis amongst girls with higher bmi, which was not demonstrated in boys. however, there was an increased risk of asthma amongst both boys and girls with largest annual increase in bmi during follow - up period. this study implies that obesity effects during sensitive period of peak lung growth in human life could enhance risk of asthma in future. hence, the current presence of obesity may not be enough history to demonstrate associations with asthma. it is important to probe historical trends of obesity, particularly obesity in childhood and adolescence, while probing obesity - asthma associations. presence of childhood obesity with current nonobese status could have also contributed to lack of obesity - asthma link. high bmi in adults has been associated with reduced fev1 and fvc [7072 ] ; however, the fev1/fvc ratios are minimally reduced due to equivalent decrease in fev1 and fvc [73, 74 ]. on the other hand, in children, except for moribund obesity state, increasing bmi has been associated with increasing fev1 and fvc, however, with reduction in fev1/fvc ratio [75, 76 ]. nevertheless, results of correlation between spirometric lung volumes and body composition have been diverse in each study. these associational variations resulted in a general consensus, that effect of adiposity on lung volume is modest, and both fev1 and fvc are usually within the normal range in healthy, obese adults and children [77, 78 ]. therefore, bmi does not figure in the normal predicted equation of fev1 and fvc. on the other hand, studies have shown that increasing waist hip ratio, which is a marker of thoracoabdominal obesity, has negative impact on fev1, fvc, and fef25 - 75%, and with every percentage increase in body fat the fev1 and fvc may decline by 1015 ml [67, 79 ]. this suggests that increasing adiposity has potential to induce extra half to three fourth of the normal lung function decline, along with normal lung function decline associated with age and height. this calls for a pertinent consideration of acquisition of body fat mass in development of normal predicted equations of spirometric lung volumes. bronchodilator reversibility and diurnal peak flow (pef) variability are hallmark of asthma diagnosis. there are some studies which show that obesity is associated with bronchodilator reversibility and pefr variations in populations. in a study by castro - rodrguez girls who became obese after age of six had significantly larger height - adjusted postbronchodilator fev1 response and higher prevalence of peak flow variability than children whose bmi level did not change or decreased after age six. in another study, hakala. showed that with decrease in bmi from 37.2 (3.7) to 32.1 (4.2) kg / m the diurnal pef variation declined from 5.5% (2.4) to 4.5% (1.5), and day - to - day variation declined from 5.3% (2.6) to 3.1% (1.3) in adult asthma patients. what is intriguing is that the obesity related asthma lacks eosinophilic inflammation component [81, 82 ] and is poorly responsive to steroids [8385 ] which is unlike allergic asthma. however, there is some evidence to suggest that adipokines can enhance blood ige levels and airway smooth muscle contraction similar to what has been demonstrated in allergic asthma. this generates an inspiratory load and restricting forces on the lungs to optimally inflate and deflate during tidal respiration. the thoracic and subpleural fat may also restrict the ribcage movements imposing additional restrictive forces on the lungs. these alterations in thoracic mechanics cue towards reductions in lung volumes and lung compliance in obese subjects. adiposity elucidates exponential association with reducing lung compliance [8890 ], perhaps due to obesity related increase in pulmonary blood volume, or obesity induced restriction force related closure of collapsible airways and atelectasis, or increased alveolar surface tension (figure 1). on the other hand, vital capacity (vc) and total lung capacity (tlc) are not significantly altered in obesity. a marginal 2030% reduction in tlc has been documented with moribund obesity [78, 9194 ]. over weight and obesity have shown that with each increase in 1 kg body weight can cause an average reduction of frc of 2830 ml, however frc reduction was primarily associated with thoracic and abdominal adiposity, suggesting a plausible interdependent role of fat distribution in two truncal sites in reducing lung volumes. frc is volume of the air in the lung during end tidal expiration during which the inflationary and deflationary forces in the lungs are at equi - pressure point, and there is no movement of air in the respiratory system. it is a sum of expiratory reserve volume (erv) and residual volume (rv). rv is well preserved in obesity, or may be slightly elevated [92, 94, 96, 97 ]. studies have shown increasing bmi can generate an exponential reduction in frc and erv [88, 91, 92 ]. low erv in obesity suggests occurrence of tidal breathing close to rv in distal high resistance airways, such as noncartilaginous small membranous terminal and respiratory bronchioles and alveolar duct, in obese populations (figure 2). there is a pertinent linear direct relationship between frc and airway resistance and inverse linear relation with airway conductance [72, 74, 98, 99 ]. studies have shown that high respiratory resistance in obesity normalizes on correction with lung volumes [72, 74, 98, 99 ].. showed that obese women had significantly lesser frc and higher percentage of tidal volume which encroached on maximal flow loops at rest compared to normal weight individuals. however, the same study also showed that exercise induces dynamic increases in frc which attenuates progressive expiratory flow limitation in obese subject. impulse oscillometry (ios) studies in obese subjects elucidate that obesity enhances frequency dependence in the airway resistance and increases lung reactance, suggesting that obesity states primarily affects the small airways and impart elastic load on lung mechanics [101, 102 ].. showed that excess body weight resulted in enhanced resistance and reactance in the distal airways which reversed after bariatric surgery. high resistance breathing induced by reduced frc could increase the asthma symptoms, cause treatment refractoriness, and induce a difficulty to treat asthma state. the noncartilaginous small membranous, terminal and respiratory bronchioles, and alveolar duct collapse at low frc, suggesting that these airways may close during normal tidal breathing in obesity [90, 103, 104 ]. therefore, obesity can generate a state of cyclic opening and closing of the airway during normal breathing pattern. this recurrent opening and closing of airways is known to trigger epithelial necrosis and sloughing in the membranous and respiratory bronchioles and rupture of alveolar - bronchiolar attachments and increased leucocytes in the alveolar septa in the animal models [106, 107 ]. a chronic presence of low frc could also remodel the airways ; however, there are no studies which have probed direct changes in the airways of obese humans. there is some evidence to show that despite improvements in lung volumes and reduction in asthma symptoms after weight loss, there is no improvements in volume adjusted airway calibre. this cues towards probable obesity induced remnant of remodelling changes in the airways. however, this can be proved only by carefully designed longitudinal studies. studies in normal weight subjects have shown that prevention from deep inspiration manoeuvre can increase airway resistance, which does not revert even after reinstating deep inspiration manoeuvre [108110 ]. this means that due to chronic restriction in lung movements and reduction in deep inspiration sighs associated with obesity, the airway resistance may lose its frc dependent component over a durational period [97, 111 ]. the airway smooth muscle has property to adapt to shorter lengths in order to enhance its force generating ability during low lung volume states. this may occur either by plastic adaptation or changes in metabolism of actin and myosin. the smooth muscle contracture apparatus constitutes actin - myosin interaction which promotes a latched - in state (figure 3). the fluctuation forces of inspiration and expiration imposed by tidal breathing disengages the latched - in state and cause smooth muscle relaxation. severe obesity is usually associated with reduced tidal volumes with rapid and shallow breathing pattern which further enhances with exercise [78, 91, 94 ]. therefore obesity constitutes a state in which the tidal breathing fluctuation forces are inadequate to break the latched - in state of actin and myosin filament. however, it is also important to mention that in mild - moderate obesity tidal volumes and frequency of deep inspiration remain in normal range [100, 113115 ]. therefore there is a possibility that lung functions may not be altered until late obesity in some cases. its absence rules out asthma in clinical practise. unlike obesity and asthma associations, obesity and ahr have not demonstrated any particular epidemiological trends, therefore role of obesity in ahr modulation or vice versa remains largely inconclusive [6, 8 ].. however there are few large population based cross - sectional and prospective studies which largely indicate a positive link between ahr and obesity [16, 116118 ]. there is an evidence to suggest that the incidence and prevalence of ahr increases in obese and underweight population, and its bmi relational graph depicts a u shape association with ahr [16, 117 ]. sharma. demonstrated that each increase in bmi by 1 kg / m is associated with a 3.1% increase in ahr risk (95% ci 1.011.05). there is also some evidence to suggest that obesity may reduce threshold of ahr to potential asthma triggers. the mouse model studies have shown an exaggerated response to methacholine, which enhances further on ozone exposures, independent of lung size, ventilation rates, and satiety hormones, in genetically obese mouse models (ob / ob) [5, 7 ]. in the humans alexeeff. have shown that there is an equal decline in fev1 in obese subjects and subjects with underlying ahr on exposures to ozone. increased ventilation state triggered by increased oxygen demand associated with obesity could cause inhalation of large doses of air pollution in obese versus nonobese individuals. there is also some indirect evidence to suggest that obesity effects on ahr are more prominent prior to asthma development which diminish postasthma development [68 ]. the possibility of this could be linked to a population based study in 1725 adults by sood. which showed that bmi increases ahr in nonasthmatic subjects and not in asthmatic subjects. huang. studied ahr in 1459 subjects and showed positive relationship between ahr and bmi only in girls. evaluated 11,277 european adults and showed that ahr increased with bmi in men but not in women. jang. studied prevalence of methacholine hyperresponsiveness in 677 korean children and showed an increased ahr in obese boys but not in obese girls. however, data from large population based studies suggest equivalent risk between obesity and ahr amongst both genders. there is a possibility of potential involvement of mechanical factors associated with low lung volumes as discussed previously. the animal model studies indicate absence of cellular inflammation in the lungs of unchallenged mice ; however, there is increased pulmonary oxidative stress similar to what is seen in asthma. further, the enhanced ahr in obesity could also be linked to increased production of adipokines such as tnf-, il6, il-8, monocyte chemoattractant protein-1, complement proteins, acute phase moieties, leptins and adiponectins from adipocytes and adipose macrophages. it is now increasingly realised that obesity is a state of low grade systemic inflammation which can activate inflammation at sites distant to adipose tissue. adiponectin is a hormone which is reduced in obesity which has shown to attenuate ahr, eosinophils, and th2 cells in the lungs of the animal models [68 ]. another adiposity related hormone, leptin, in concert with other inflammatory agents, has an ability of enhancing ahr. leptin concentration is 46 times higher in severely obese versus nonobese human subjects [124, 125 ]. however, leptin induces a th1 type of inflammation rather than th2 type allergic asthma response [126, 127 ]. here it is important to mention that 812% of the general population may have underlying ahr. also, there are numerous environmental, genetic, and epigenetic influences on ahr which may conceal any additional effect of obesity [6, 129 ]. this mandates large sample size requirement in order to probe any ahr - determinant associations in epidemiology studies. the overview of obesity ahr studies in humans indicate that most absent - link studies constitute relatively smaller population size compared to the positive link studies [6, 16, 116 ]. further, most negative studies have primarily emerged from australian and south american regions [5255 ]. a study from chile has even demonstrated an opposite link between obesity and ahr in population (or 0.93, 95% ci 0.890.97). this calls for a possible geographical - regional, environmental, dietetic and genetic heterogeneity factors to this link. animal model studies have also shown that obesity - ahr has durational component such that mice with longer duration of obesity have higher risk of developing ahr compared to mice with recent onset obesity [29, 129134 ]. further, fall in fev1 may not be a sensitive measure to study ahr in obesity. studies have reported small airway closure in the lower (dependent) region in the lungs of obese individuals. this could redistribute the tidal volumes to other airways, which would then receive enhanced tidal volume proportions that could induce dilatation in the airways. fev1 may not be an appropriate measure to evaluate the complexity of these heterogeneous alterations in patency of bronchopulmonary tree. on the other hand, markers of small airway flow rates (fef25 - 75) and small airway resistances could be more relevant in this case. both adults and children demonstrate obesity related reductions in fef25 - 75 compared to lean subjects [58 ] ; reduced fef25 - 75/fvc has been regarded as marker of increased hyperresponsiveness. recently, salome. showed that in obese individuals, the only parameter which significantly changed on bronchoprovocation was airway reactance which is a measure of inertive and elastic properties of the lung and has been shown to be the marker of transpulmonary resistance. if asthma control is not achieved by ics, inhaled long - acting b2-agonists (laba) or other medications may be used as add - on therapy. intriguingly obesity impinges a relative refractoriness to asthma therapies, and it imposes a state of uncontrolled asthma despite adequate treatments [83, 84 ]. boulet. had shown that obese asthmatics are less likely than the nonobese asthmatics to achieve asthma control with fluticasone or fluticasone plus salmeterol. further, there is some evidence that treatment unresponsiveness is relatively lesser for leukotriene antagonists in obesity. the reason for poor response to asthma treatment can be associated with increased systemic inflammatory state in obesity, but the evidence suggests that the intensity of lung inflammation obese asthmatic is lesser than that of lean asthmatics. studies have demonstrated an inverse relationship between bmi and pulmonary eosinophils [81, 82 ] data from animal models of allergic asthma have shown less eosinophils and bal lymphocytes in obese mice versus nonobese mice.there is also some evidence to suggest reduced mitogen and cytokine t - cell response in obese subjects [138140 ]. therefore it can be assumed that obesity induces a pauci - immune type of asthma. a recent study has shown that weight reduction with intervention such as bariatric surgery can significantly improve asthma control and treatment responses in asthma, but increase cd4 lymphocytes and their cytokine secreting potential. this suggests that weight reduction can induce an inflammation response in the lungs which may revive steroids responsiveness. larger role of mechanical restriction resulting in altered biophysics of lungs to produce a treatment resistant asthma can not be undermined. the acute and chronic response improvements in asthmatic conditions after weight reduction interventions suggest pertinent role of mechanical restriction forces and altered lung physiology in causing increased treatment refractoriness, poor asthma control, and exacerbation proneness despite adequate treatment in obese populations [142155 ]. the treatment modality of obesity related asthma, therefore, should also include weight reduction strategies along with conventional asthma therapy. treatments which assist in reducing obesity, such as laparoscopic adjustable gastric binding, silastic ring gastric bypass, vertical banded gastroplasty, biliopancreatic diversion with duodenal switch, lap band, weight loss with structured programmes, and low calorie diets have shown to significantly improve quality of life, reduce asthma severity scores, improve asthma symptoms, reduce number of hospitalizations, reduce use of asthma medications, and induce full remissions in obese asthmatic patients [142155 ]. however, therapeutic benefits of weight loss have been somewhat equivocal in regards to improvements in ahr in asthma. along with potential of reducing weight, exercise may generate deep inspiration and tidal volumes impulses to assist in unlatching actin / myosin latch - in phase and reverse bronchoconstrictions. reduced physical activity is known to antedate asthma and broncho - hyperresponsiveness [40, 41 ]. exercise, on the other hand, can reduce expiratory flow limitation in a dose response manner in obese individuals. therefore regular exercises along with anti - inflammatory treatments could be an ideal intervention in obese asthma ; however, longitudinal studies would be more enlightening. obesity associated restricted lung mechanics induces series of biophysical effects in the lungs which are known to alter lung physiology, such as reduce lung volumes, increased small airway resistance, induce bronchodilator reversibility, induce peak flow variability, and enhance broncho - hyperresponsiveness, which are conducive to development of asthma. the obesity related asthma has poor response to treatment and encompasses gambit of poorly controlled asthma phenotype. however, it is still not known that whether these altered lung physiologies are accompanied by structural pathologies of the lungs particularly airway remodelling. properly designed studies are mandated to investigate structural changes in the lungs associated with body fat mass and long - term and short - term beneficial effects on the anatomy and physiology of the lungs with reduction in adiposity. | obesity induces some pertinent physiological changes which are conducive to either development of asthma or cause of poorly controlled asthma state. obesity related mechanical stress forces induced by abdominal and thoracic fat generate stiffening of the lungs and diaphragmatic movements to result in reduction of resting lung volumes such as functional residual capacity (frc). reduced frc is primarily an outcome of decreased expiratory reserve volume, which pushes the tidal breathing more towards smaller high resistance airways, and consequentially results in expiratory flow limitation during normal breathing in obesity. reduced frc also induces plastic alteration in the small collapsible airways, which may generate smooth muscle contraction resulting in increased small airway resistance, which, however, is not picked up by spirometric lung volumes. there is also a possibility that chronically reduced frc may generate permanent adaptation in the very small airways ; therefore, the airway calibres may not change despite weight reduction. obesity may also induce bronchodilator reversibility and diurnal lung functional variability. obesity is also associated with airway hyperresponsiveness ; however, the mechanism of this is not clear. thus, obesity has effects on lung function that can generate respiratory distress similar to asthma and may also exaggerate the effects of preexisting asthma. |
today, cardiovascular disease (cvd) is one of the leading causes of mortality, disability, and morbidity in adults worldwide. to identify persons at an increased risk of cvd the european society of cardiology (esc) has created a systematic coronary risk evaluation (score system) chart based on five well - established risk factors : age, sex, total serum cholesterol (s - cholesterol), systolic blood pressure (sbp), and smoking. in contrast to the framingham risk score, which was based on a single north - american community, the esc model is derived from 12 large european cohort studies. this would make the esc model more reliable and applicable to european conditions. however, the european score model uses only fatal cvd events which may limit the predictive power substantially. in addition, various risk models predict only the 10-year risk for a population aged up to 65 years, whereas the majority of cvd events occur in elderly people which may lead to underestimation of the real importance of these risk factors. finally many risk models focus on both coronary heart disease (chd) and stroke simultaneously, and these two outcomes may differ considerably in predictability. to address these issues, we investigated the differences between the short - term and long - term (10 year and 35 year) cumulative risk of developing either a first time chd or stroke, based on the risk factors used by the esc score model in 7174 middle - aged men from gothenburg in sweden who were followed for 35 years. additionally, we estimated the long - term impact of individual risk factors for both chd and stroke separately. the multifactor primary prevention study was first established in 1970 and was designed as an intervention trial. it included all men in gothenburg born between 1915 and 1925 (with the exception of 1923). a third of the men were randomly selected for the intervention group which comprised 10 000 men, with interventions directed against smoking, hypertension, and hypercholesterolaemia. additionally, two control groups with 10 000 men each were established. for the intervention group that forms the basis for this investigation, a postal questionnaire with an invitation letter was sent to all the men. those who responded (n= 7495) were invited for a first baseline screening in 197073. after 4 and 10 years, re - examinations were performed in a random sample (20%) of both the intervention and control groups. no significant differences were found in risk factor levels [e.g. s - cholesterol, blood pressure (bp), and smoking status ], cardiovascular, cancer, or all - cause mortality between the intervention and control groups. consequently, any changes observed in the intervention group occurred to the same extent as in the general population. thus, the present study group is considered to be representative of the background population in the city. further details of study design and criteria for entering the study have previously been described. the present study uses baseline information from those individuals in the intervention group with no previous history of chd, stroke, or diabetes and with a complete data set, leaving a total of 7174 men aged 4755 years (mean age 51). the study complies with the declaration of helsinki and was approved by the ethics committee for medical research at university of gothenburg. in the current study, cvd is defined as chd (myocardial infarction) and stroke. to estimate the risk of developing a cvd event, the following major risk factors were used : sbp, diastolic blood pressure (dbp), s - cholesterol, hypertension, antihypertensive treatment, and smoking status at baseline. all screening examinations were performed during the afternoon, including weight, height, and bp (taken after 5 min rest with the subject seated). hypertension was defined as sbp > 140 or dbp > 90 or receiving antihypertensive treatment. for the determination of s - cholesterol, samples were taken after 2 h fasting and s - cholesterol concentration was determined according to standard laboratory procedures. information on smoking habits and previous history of chd or stroke was collected from the postal questionnaire. non - smokers were defined as either never or ex - smoker (> 3 months) and the rest as current smokers. the following five risk groups were created based on the esc score chart for men aged 50 using the risk factors sbp, s - cholesterol, and smoking status. all participants were stratified into one of five risk groups based on their number of risk factors at baseline (197073). according to the esc score chart, optimal levels for sbp and s - cholesterol are set to 120 mmhg and 4 mmol / l. however, at the time of baseline investigation, the mean bp (sbp and dbp) were high in comparison with levels of today. to create a sufficiently large group, optimal levels for sbp and s - cholesterol was defined at higher cut - off points than would currently have been the case. optimal risk : sbp 140 or dbp > 90 or receiving antihypertensive treatment. for the determination of s - cholesterol, samples were taken after 2 h fasting and s - cholesterol concentration was determined according to standard laboratory procedures. information on smoking habits and previous history of chd or stroke was collected from the postal questionnaire. non - smokers were defined as either never or ex - smoker (> 3 months) and the rest as current smokers. the following five risk groups were created based on the esc score chart for men aged 50 using the risk factors sbp, s - cholesterol, and smoking status. all participants were stratified into one of five risk groups based on their number of risk factors at baseline (197073). according to the esc score chart, optimal levels for sbp and s - cholesterol are set to 120 mmhg and 4 mmol / l. however, at the time of baseline investigation, the mean bp (sbp and dbp) were high in comparison with levels of today. to create a sufficiently large group, optimal levels for sbp and s - cholesterol was defined at higher cut - off points than would currently have been the case. optimal risk : sbp < 140 mmhg without antihypertensive treatment, s - cholesterol < 5.0 mmol / l and non-smoker.low risk : sbp 140159 mmhg without antihypertensive treatment and/or s - cholesterol 5.05.9 mmol / l and non-smoker.moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker.elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l and/or current smoker.high risk : sbp 160 mmhg or antihypertensive treatment, s - cholesterol 6.0 mmol / l and current smoker.men with low risk were selected as the reference group. 5.0 mmol / l and non - smoker. low risk : sbp 140159 mmhg without antihypertensive treatment and/or s - cholesterol 5.05.9 mmol / l and non - smoker. moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker. elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l and/or current smoker. high risk : sbp 160 mmhg or antihypertensive treatment, s - cholesterol 6.0 mmol / l and current smoker. the follow - up was extended through 2008 with endpoints of first time chd and stroke events registered from several sources. for individuals up to 65 years of age, both chd and stroke events were recorded using criteria from the local chd and stroke registers. case records for all hospital diagnoses were checked manually by one nurse and one medical technician from the start of the study. furthermore, all hospital discharges from gothenburg have been reported to the national register since 1970 (except for 1976 due to legislative changes). a file of all participants of the study was run against the national register of hospital discharges 19702008. in addition, all men in the study were matched against the swedish cause of death register. the international classification of disease (icd) was used to identify chd and stroke events and for this purpose icd version 8 was used until 1986, icd-9 from 1987 to 1996 and the last revision icd-10 was used from 1997. in this present study, the following discharge codes were used : icd-8 and icd-9 code 410 and icd-10 code i21. for stroke : icd-9 codes 431, 433, 434, and 436 and icd-10 codes i61-i64 were used. the individual risk factors were categorized into different levels where the age - adjusted incidence rate ratios (irrs) were calculated for stroke and chd, respectively. in long - term follow - up studies, it is important to apply a statistical model which accounts for competing events (e.g. death as a competing risk) that could potentially end the follow - up for a study subject in such a way that violates the random censoring assumption when calculating risk differences in risk factors. to calculate the risk of stroke and chd, a modified cox regression analysis as described by fine jp and gray rj was used in a competing risk setting. from the competing risk regression analysis the subdistribution hazard ratio (shr) with two - sided 95% confidence intervals (ci) was estimated for individual risk factors and risk groups. all estimates were adjusted for age where each categorized risk level (based on the different levels of the categorized risk factors) was compared with the corresponding reference group. in addition, both the short - term (010 year) and long - term (035 year) cumulative incidence (cuminc) curves were estimated. the r package cmprsk which is publicity available at the r archive network site (http://cran.r-project.org/ was used to calculate the shr and cuminc). among the 7174 men in the study, 2417 (33.7%) experienced a first chd event and 1335 (18.6%) a first stroke over the 35-year follow - up. in total, 3752 (52.3%) of the men experienced a cvd event over the 35-year follow - up. the distribution of risk factors and groups at baseline is outlined in table 1. table 1baseline characteristics of the study populationmean (sd)number of men, n = 7174 (% of total)age (years)51.52.3s - cholesterol levels < 5.0 mmol / l6.51.1703 (9.8) 5.05.9 mmol / l1986 (27.7) 6.06.9 mmol / l2364 (32.9) 7.0 mmol / l2121 (29.6)sbp < 140 mmhg148.521.82552 (35.6) 140159 mmhg2573 (35.9) 160 mmhg2049 (28.6)smoking habits non - smoker3577 (49.9) smoker3597 (50.1)hypertension non - hypertensive2171 (30.3) hypertensive5003 (69.7) antihypertensive medication367 (5.1)risk groups optimal risk130 (1.8) low risk842 (11.7) moderate risk2867 (40.0) elevated risk2645 (36.9) high risk690 (9.6)sd, standard deviation.optimal risk : sbp 140 mmhg without antihypertensive treatment, s - cholesterol < 5.0 mmol and non - smoker ; low risk : sbp = 140159.9 mmhg without antihypertensive treatment, s- cholesterol 5.05.59 mmol, and non - smoker ; moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker ; elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l, and/or current smoker ; high risk : sbp 160 or antihypertensive treatment and s - cholesterol 6.0 optimal risk : sbp 140 mmhg without antihypertensive treatment, s - cholesterol < 5.0 mmol and non - smoker ; low risk : sbp = 140159.9 mmhg without antihypertensive treatment, s- cholesterol 5.05.59 mmol, and non - smoker ; moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker ; elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l, and/or current smoker ; high risk : sbp 160 or antihypertensive treatment and s - cholesterol 6.0 table 2 shows the age - adjusted shr for individual risk factors (sbp, s - cholesterol, hypertension, antihypertensive medication, and smoking status) after 35 years of follow - up. high s - cholesterol (shr : 1.93, 95% ci : 1.652.26) and sbp (shr : 1.68, 95% ci : 1.521.86) at baseline were the two most significant risk factors for chd, followed by antihypertensive medication (shr : 1.55, 95% ci : 1.311.82), hypertension (shr:1.51, 95% ci : 1.381.66) and current smoking at baseline (shr : 1.26, 95% ci : 1.161.36). for stroke, a significant risk increase was found for high sbp (shr : 1.37, 95% ci : 1.201.57), antihypertensive medication (shr : 1.31, with 95% ci : 1.051.64), and hypertension (shr : 1.28, 95% ci : 1.131.44) at baseline. in contrast, high s - cholesterol (shr : 1.06, 95% ci : 0.871.30) was not significantly related to stroke and being a smoker at baseline (shr : 0.86, 95% ci : 0.770.95) was paradoxically associated with a lower risk. table 2a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to individual risk factors at baselinerisk factorsnumber at riskeventstotal observation yearsirr (95% ci)adjusted shr (95% ci)chd (mmol / l) s - cholesterol < 5.070318018 0001 (ref)1 (ref) 5.05.9198654351 090.51.08 (0.911.27)1.10 (0.931.30) 6.06.9236481857 901.91.45 (1.241.71)1.50 (1.281.76) 7.0212187648 7991.86 (1.582.19)1.93 (1.652.26) sbp (mmhg) < 140255269266 570.91 (ref)1 (ref) 140159257387863 3771.31 (1.181.45)1.31 (1.191.45) 160204984745 843.51.72 (1.551.90)1.68 (1.521.86) smoking non - smoker3577111295 528.81 (ref)1 (ref) smoking3597130580 262.61.38 (1.271.49)1.26 (1.161.36)hypertension non - hypertensive217156857 501.21 (ref)1 (ref) hypertensive5003184911 82901.54 (1.401.69)1.51 (1.381.66) antihypertensive medication3671667794.71.56 (1.331.83)1.55 (1.311.82)stroke (mmol / l) s - cholesterol < 5.070312818 031.41 (ref)1 (ref) 5.05.9198635352 106.90.97 (0.791.18)0.99 (0.811.21) 6.06.9236445760 870.41.09 (0.891.32)1.09 (0.901.33) 7.0212139752 590.51.10 (0.901.35)1.06 (0.871.30) sbp (mmhg) < 140255241868 831.81 (ref)1 (ref) 140159257346866 617.51.13 (0.991.29)1.11 (0.971.26) 160204944948 149.91.48 (1.291.69)1.37 (1.201.57) smoking non - smoker357771598 698.11 (ref)1 (ref) smoking359762084 901.10.99 (0.891.11)0.86 (0.770.95) hypertension non - hypertensive217134159 374.11 (ref)1 (ref) hypertensive500399412 42251.35 (1.191.53)1.28 (1.131.44) antihypertensive medication367858131.41.43 (1.151.79)1.31 (1.051.65)first ever occurrence of a chd or stroke.age-adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to individual risk factors at baseline first ever occurrence of a chd or stroke. age - adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). to estimate the cumulative effect of developing a first chd or stroke event, all participants were stratified into one of five risk groups (optimal levels, low risk, moderate risk, elevated risk, and high risk) based on their burden of risk factors at baseline in 197073. table 3 shows the long - term shr with 95% ci and the cumulative effect on chd and stroke separately after 35 years when adjusted for age and competing risk. in general, each additional risk factor at baseline individuals with several risk factors at baseline (s - cholesterol 6.0 mmol / l, sbp 160 mmhg or antihypertensive treatment and being a current smokers at baseline) had a shr of 2.89 (95% ci : 2.413.47) for chd but 1.21 (95% ci : 0.961.53) for stroke compared with low - risk individuals (table 3). table 3a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to risk groupsrisk groupsnumber at riskeventstotal observation yearsirr (95% ci)adjusted shr (95% ci)chd risk groups optimal risk130203855.60.77 (0.491.23)0.69 (0.441.07) low risk84218424 047.71 (ref)1 (ref) moderate risk286787774 1501.54 (1.311.80)1.48 (1.271.73) elevated risk2645100160 530.82.16 (1.842.52)2.01 (1.732.35) high risk69033513 207.33.22 (2.693.86)2.89 (2.413.47)stroke risk groups optimal risk130243760.21.12 (0.721.72)1.10 (0.721.70) low risk84214424 429.21 (ref)1 (ref) moderate risk286753576 677.21.18 (0.981.42)1.10 (0.921.32) elevated risk264549464 1961.30 (1.081.56)1.12 (0.931.35) high risk69013814 536.61.56 (1.241.97)1.21 (0.961.53)first ever occurrence of a chd or stroke.age-adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to risk groups first ever age - adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). in the final analysis, we estimated the short - term and long - term cumulative effect after adjusting for age and competing risk. for the first 10 years, individuals with adverse levels of risk factors at baseline (high risk) had an 18.1% risk of chd compared with 1.3% for those with low risk (reference group). corresponding results for stroke during the first 10 years were 3.2% compared with 0.5% (figure 1). in the second part, the follow - up time was extended to 35 years in order to estimate the long - term effect of multiple risk factors. for chd those with the most adverse levels of risk factors at baseline had a 47.8% risk compared with 19.6% for stroke after 35 years (figure 1). figure 1cumulative incidence curves adjusted for competing risk of death by different risk groups for coronary heart disease and stroke, respectively. the 10-year cumulative risk for (a) coronary heart disease, (b) stroke and the 35-year cumulative risk for (c) coronary heart disease, and (d) stroke. cumulative incidence curves adjusted for competing risk of death by different risk groups for coronary heart disease and stroke, respectively. the 10-year cumulative risk for (a) coronary heart disease, (b) stroke and the 35-year cumulative risk for (c) coronary heart disease, and (d) stroke. among the 7174 men in the study, 2417 (33.7%) experienced a first chd event and 1335 (18.6%) a first stroke over the 35-year follow - up. in total, 3752 (52.3%) of the men experienced a cvd event over the 35-year follow - up. the distribution of risk factors and groups at baseline is outlined in table 1. table 1baseline characteristics of the study populationmean (sd)number of men, n = 7174 (% of total)age (years)51.52.3s - cholesterol levels < 5.0 mmol / l6.51.1703 (9.8) 5.05.9 mmol / l1986 (27.7) 6.06.9 mmol / l2364 (32.9) 7.0 mmol / l2121 (29.6)sbp < 140 mmhg148.521.82552 (35.6) 140159 mmhg2573 (35.9) 160 mmhg2049 (28.6)smoking habits non - smoker3577 (49.9) smoker3597 (50.1)hypertension non - hypertensive2171 (30.3) hypertensive5003 (69.7) antihypertensive medication367 (5.1)risk groups optimal risk130 (1.8) low risk842 (11.7) moderate risk2867 (40.0) elevated risk2645 (36.9) high risk690 (9.6)sd, standard deviation.optimal risk : sbp 140 mmhg without antihypertensive treatment, s - cholesterol < 5.0 mmol and non - smoker ; low risk : sbp = 140159.9 mmhg without antihypertensive treatment, s- cholesterol 5.05.59 mmol, and non - smoker ; moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker ; elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l, and/or current smoker ; high risk : sbp 160 or antihypertensive treatment and s - cholesterol 6.0 optimal risk : sbp 140 mmhg without antihypertensive treatment, s - cholesterol < 5.0 mmol and non - smoker ; low risk : sbp = 140159.9 mmhg without antihypertensive treatment, s- cholesterol 5.05.59 mmol, and non - smoker ; moderate risk : sbp 160 mmhg or antihypertensive treatment or s - cholesterol 6.0 mmol / l or current smoker ; elevated risk : sbp 160 mmhg or antihypertensive treatment and/or s - cholesterol 6.0 mmol / l, and/or current smoker ; high risk : sbp 160 or antihypertensive treatment and s - cholesterol 6.0 table 2 shows the age - adjusted shr for individual risk factors (sbp, s - cholesterol, hypertension, antihypertensive medication, and smoking status) after 35 years of follow - up. high s - cholesterol (shr : 1.93, 95% ci : 1.652.26) and sbp (shr : 1.68, 95% ci : 1.521.86) at baseline were the two most significant risk factors for chd, followed by antihypertensive medication (shr : 1.55, 95% ci : 1.311.82), hypertension (shr:1.51, 95% ci : 1.381.66) and current smoking at baseline (shr : 1.26, 95% ci : 1.161.36). for stroke, a significant risk increase was found for high sbp (shr : 1.37, 95% ci : 1.201.57), antihypertensive medication (shr : 1.31, with 95% ci : 1.051.64), and hypertension (shr : 1.28, 95% ci : 1.131.44) at baseline. in contrast, high s - cholesterol (shr : 1.06, 95% ci : 0.871.30) was not significantly related to stroke and being a smoker at baseline (shr : 0.86, 95% ci : 0.770.95) was paradoxically associated with a lower risk. table 2a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to individual risk factors at baselinerisk factorsnumber at riskeventstotal observation yearsirr (95% ci)adjusted shr (95% ci)chd (mmol / l) s - cholesterol < 5.070318018 0001 (ref)1 (ref) 5.05.9198654351 090.51.08 (0.911.27)1.10 (0.931.30) 6.06.9236481857 901.91.45 (1.241.71)1.50 (1.281.76) 7.0212187648 7991.86 (1.582.19)1.93 (1.652.26) sbp (mmhg) < 140255269266 570.91 (ref)1 (ref) 140159257387863 3771.31 (1.181.45)1.31 (1.191.45) 160204984745 843.51.72 (1.551.90)1.68 (1.521.86) smoking non - smoker3577111295 528.81 (ref)1 (ref) smoking3597130580 262.61.38 (1.271.49)1.26 (1.161.36)hypertension non - hypertensive217156857 501.21 (ref)1 (ref) hypertensive5003184911 82901.54 (1.401.69)1.51 (1.381.66) antihypertensive medication3671667794.71.56 (1.331.83)1.55 (1.311.82)stroke (mmol / l) s - cholesterol < 5.070312818 031.41 (ref)1 (ref) 5.05.9198635352 106.90.97 (0.791.18)0.99 (0.811.21) 6.06.9236445760 870.41.09 (0.891.32)1.09 (0.901.33) 7.0212139752 590.51.10 (0.901.35)1.06 (0.871.30) sbp (mmhg) < 140255241868 831.81 (ref)1 (ref) 140159257346866 617.51.13 (0.991.29)1.11 (0.971.26) 160204944948 149.91.48 (1.291.69)1.37 (1.201.57) smoking non - smoker357771598 698.11 (ref)1 (ref) smoking359762084 901.10.99 (0.891.11)0.86 (0.770.95) hypertension non - hypertensive217134159 374.11 (ref)1 (ref) hypertensive500399412 42251.35 (1.191.53)1.28 (1.131.44) antihypertensive medication367858131.41.43 (1.151.79)1.31 (1.051.65)first ever occurrence of a chd or stroke.age-adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to individual risk factors at baseline first ever occurrence of a chd or stroke. age - adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). to estimate the cumulative effect of developing a first chd or stroke event, all participants were stratified into one of five risk groups (optimal levels, low risk, moderate risk, elevated risk, and high risk) based on their burden of risk factors at baseline in 197073. table 3 shows the long - term shr with 95% ci and the cumulative effect on chd and stroke separately after 35 years when adjusted for age and competing risk. in general, each additional risk factor at baseline increased the risk of developing a chd or stroke. individuals with several risk factors at baseline (s - cholesterol 6.0 mmol / l, sbp 160 mmhg or antihypertensive treatment and being a current smokers at baseline) had a shr of 2.89 (95% ci : 2.413.47) for chd but 1.21 (95% ci : 0.961.53) for stroke compared with low - risk individuals (table 3). table 3a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to risk groupsrisk groupsnumber at riskeventstotal observation yearsirr (95% ci)adjusted shr (95% ci)chd risk groups optimal risk130203855.60.77 (0.491.23)0.69 (0.441.07) low risk84218424 047.71 (ref)1 (ref) moderate risk286787774 1501.54 (1.311.80)1.48 (1.271.73) elevated risk2645100160 530.82.16 (1.842.52)2.01 (1.732.35) high risk69033513 207.33.22 (2.693.86)2.89 (2.413.47)stroke risk groups optimal risk130243760.21.12 (0.721.72)1.10 (0.721.70) low risk84214424 429.21 (ref)1 (ref) moderate risk286753576 677.21.18 (0.981.42)1.10 (0.921.32) elevated risk264549464 1961.30 (1.081.56)1.12 (0.931.35) high risk69013814 536.61.56 (1.241.97)1.21 (0.961.53)first ever occurrence of a chd or stroke.age-adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). a 35-year follow - up with subdistribution hazard ratio (95% ci) adjusted for age for coronary heart disease and stroke with regard to risk groups first ever age - adjusted incidence ratio (irr) and subdistribution hazard ratio (shr). in the final analysis, we estimated the short - term and long - term cumulative effect after adjusting for age and competing risk. for the first 10 years, individuals with adverse levels of risk factors at baseline (high risk) had an 18.1% risk of chd compared with 1.3% for those with low risk (reference group). corresponding results for stroke during the first 10 years were 3.2% compared with 0.5% (figure 1). in the second part, the follow - up time was extended to 35 years in order to estimate the long - term effect of multiple risk factors. for chd those with the most adverse levels of risk factors at baseline had a 47.8% risk compared with 19.6% for stroke after 35 years (figure 1). figure 1cumulative incidence curves adjusted for competing risk of death by different risk groups for coronary heart disease and stroke, respectively. the 10-year cumulative risk for (a) coronary heart disease, (b) stroke and the 35-year cumulative risk for (c) coronary heart disease, and (d) stroke. cumulative incidence curves adjusted for competing risk of death by different risk groups for coronary heart disease and stroke, respectively. the 10-year cumulative risk for (a) coronary heart disease, (b) stroke and the 35-year cumulative risk for (c) coronary heart disease, and (d) stroke. in the present study, we aimed to determine to what extent the use of age, s - cholesterol, sbp, and smoking status at baseline can be used to predict the short - term and long - term risk of both chd and stroke separately among 7174 middle - aged men over an extended follow - up. for the first 10 years, we observed that these risk factors could effectively predict the cumulative risk of chd but not stroke to the same extent. this did not change over time when the follow - up time was extended until old age. as a result, high - risk individuals had a markedly high - cumulative risk for chd but not in a similar manner for stroke after 35 years. we found that the five major risk factors were all related to chd and stroke after 35 years with the exception of s - cholesterol. however, the impact of each factor differed according to both the endpoint under study and the outcome. consistent with previous reports, hypertension, antihypertensive medication, and high sbp at baseline were related to both chd and stroke. for example, some have reported an inverse association of s - cholesterol and haemorrhagic stroke while other suggests that the ratio of hdl cholesterol and ldl cholesterol levels may be a better predictor. however, most epidemiological studies have failed to find a direct association between total cholesterol and overall stroke risk.for the smoking status, we found that being a current smokers at baseline were associated with an increased risk of chd but not for stroke after adjusting for competing risk. however, this result should not be interpreted to mean that smoking has no effect on stroke. on the contrary, previous epidemiological evidences have showed a strong association between smoking and having an increased risk of stroke. in an earlier 28-year follow - up period of this study population by harmsen. smoking was found to be a risk factor for stroke during the first 21 years, but for the final period of 7 years no significant association was found. for example, in gothenburg smoking decreased from 50% in 197073 to < 30% in 1995. accordingly a diminishing number of smokers might have contributed to an underestimation of the true risk of smoking. in a long - term perspective, the shr among high - risk individuals, compared with those with low risk, was approximately twice as high for chd compared with stroke after 35 years when adjusted for age and competing risk (table 3). in the next step, we focused on the short - term and long - term effect on chd and stroke. for the first 10 years, we observed that the predictability of chd and stroke based on the risk factors age, s - cholesterol, sbp, and smoking status differed considerably, with the cumulative risk among high - risk individuals being substantially higher for chd than stroke. the difference between the two conditions is chiefly due to the small number of stroke events, since stroke is uncommon among younger and middle - aged people (in this study only numbering 118 stroke events for the first 10 years). after 35 years, when the follow - up time was extended until old age individuals with adverse levels of risk factors at baseline had a markedly high risk of chd but not for stroke to the same extent. for the individual risk factors, only high sbp had a major impact on stroke. therefore, our findings suggest that the effect of the sum of the individual risk factors differs for chd and stroke. in addition, early deaths from chd occur mainly among high risk individuals and as a result, the number of men with high risk decreases at higher rate over time which in a longer follow - up could have an effect on the risk estimates for stroke. to further improve the risk assessment, it is our belief that stroke should be separated from the general concept of cvd when developing risk models for use in middle - aged populations. adding other major risk factors such as diabetes, obesity, or lack of exercise may be a more effective way to predict the short - term and long - term risk of stroke than focusing on any single - risk factor. however, different methodologies have been used, for instance using the lowest bp reading in a series or measuring in the morning as opposed to in the late afternoon (4:307:00 p.m.). in a separate analysis, a subsample of the men was selected and screened during the morning in a more relaxed environment, resulting in lower mean bp levels, where a cut - off point of 175/115 mmhg measured in the afternoon would correspond to a morning level of 162/101 mmhg. moreover, bp levels have been shown to be generally lower in north america compared with european populations. additionally, bp levels in northern europe have declined, with gothenburg levels not dramatically different to other communities at the time. secondly, s - cholesterol levels were also high ; however, the mean value was lower in the present study than in other populations at the time such as the oslo study and the finrisk study (north karelia and savoy county area in 1972). as a result, the risk factors in the present study are comparable with other communities at the time. in addition, smoking rates were quite high and accordingly the optimal group was very small (1.8% of the total population). to provide meaningful comparisons, the low - risk group was therefore used as the reference group when calculating the shr. thirdly, we used only single measurements for the risk factors and these may have changed during the 35-year follow - up time. even so, and with these limitations in mind, one - single measurement of these main risk factors in midlife was quite predictive for events occurring decades after the baseline investigation. in the present study, we aimed to determine to what extent the use of age, s - cholesterol, sbp, and smoking status at baseline can be used to predict the short - term and long - term risk of both chd and stroke separately among 7174 middle - aged men over an extended follow - up. for the first 10 years, we observed that these risk factors could effectively predict the cumulative risk of chd but not stroke to the same extent. this did not change over time when the follow - up time was extended until old age. as a result, high - risk individuals had a markedly high - cumulative risk for chd but not in a similar manner for stroke after 35 years. we found that the five major risk factors were all related to chd and stroke after 35 years with the exception of s - cholesterol. however, the impact of each factor differed according to both the endpoint under study and the outcome. consistent with previous reports, hypertension, antihypertensive medication, and high sbp at baseline were related to both chd and stroke. for example, some have reported an inverse association of s - cholesterol and haemorrhagic stroke while other suggests that the ratio of hdl cholesterol and ldl cholesterol levels may be a better predictor. however, most epidemiological studies have failed to find a direct association between total cholesterol and overall stroke risk.for the smoking status, we found that being a current smokers at baseline were associated with an increased risk of chd but not for stroke after adjusting for competing risk. however, this result should not be interpreted to mean that smoking has no effect on stroke. on the contrary, previous epidemiological evidences have showed a strong association between smoking and having an increased risk of stroke. in an earlier 28-year follow - up period of this study population by harmsen. smoking was found to be a risk factor for stroke during the first 21 years, but for the final period of 7 years no significant association was found. for example, in gothenburg smoking decreased from 50% in 197073 to < 30% in 1995. accordingly a diminishing number of smokers might have contributed to an underestimation of the true risk of smoking. in a long - term perspective, the shr among high - risk individuals, compared with those with low risk, was approximately twice as high for chd compared with stroke after 35 years when adjusted for age and competing risk (table 3). in the next step, we focused on the short - term and long - term effect on chd and stroke. for the first 10 years, we observed that the predictability of chd and stroke based on the risk factors age, s - cholesterol, sbp, and smoking status differed considerably, with the cumulative risk among high - risk individuals being substantially higher for chd than stroke. the difference between the two conditions is chiefly due to the small number of stroke events, since stroke is uncommon among younger and middle - aged people (in this study only numbering 118 stroke events for the first 10 years). after 35 years, when the follow - up time was extended until old age individuals with adverse levels of risk factors at baseline had a markedly high risk of chd but not for stroke to the same extent. for the individual risk factors, only high sbp had a major impact on stroke. therefore, our findings suggest that the effect of the sum of the individual risk factors differs for chd and stroke. in addition, early deaths from chd occur mainly among high risk individuals and as a result, the number of men with high risk decreases at higher rate over time which in a longer follow - up could have an effect on the risk estimates for stroke. to further improve the risk assessment, it is our belief that stroke should be separated from the general concept of cvd when developing risk models for use in middle - aged populations. adding other major risk factors such as diabetes, obesity, or lack of exercise may be a more effective way to predict the short - term and long - term risk of stroke than focusing on any single - risk factor. however, different methodologies have been used, for instance using the lowest bp reading in a series or measuring in the morning as opposed to in the late afternoon (4:307:00 p.m.). in a separate analysis, a subsample of the men was selected and screened during the morning in a more relaxed environment, resulting in lower mean bp levels, where a cut - off point of 175/115 mmhg measured in the afternoon would correspond to a morning level of 162/101 mmhg. moreover, bp levels have been shown to be generally lower in north america compared with european populations. additionally, bp levels in northern europe have declined, with gothenburg levels not dramatically different to other communities at the time. secondly, s - cholesterol levels were also high ; however, the mean value was lower in the present study than in other populations at the time such as the oslo study and the finrisk study (north karelia and savoy county area in 1972). as a result, the risk factors in the present study are comparable with other communities at the time. in addition, smoking rates were quite high and accordingly the optimal group was very small (1.8% of the total population). to provide meaningful comparisons, the low - risk group was therefore used as the reference group when calculating the shr. thirdly, we used only single measurements for the risk factors and these may have changed during the 35-year follow - up time. even so, and with these limitations in mind, one - single measurement of these main risk factors in midlife was quite predictive for events occurring decades after the baseline investigation. in conclusion, the prediction of chd and of stroke in middle - aged men differs substantially when using the conventional risk factors sbp, s - cholesterol, and smoking. our results indicate that the cumulative risk based on these traditional risk factors can effectively be used to predict both the short - term and long - term risk of chd but not stroke to the same extent. this work was supported by the bank of sweden tercentenary fund ; the swedish research council ; the swedish council for working life and social research and the swedish heart and lung foundation. | aimsthe aim of this study was to examine the short - term and long - term cumulative risk of coronary heart disease (chd) and stroke separately based on age, sex, smoking status, systolic blood pressure, and total serum cholesterol.methods and resultsthe primary prevention study comprising 7174 men aged between 47 and 55 free from a previous history of chd, stroke, and diabetes at baseline examination (197073) was followed up for 35 years. to estimate the cumulative effect of chd and stroke, all participants were stratified into one of five risk groups, defined by their number of risk factors. the estimated 10-year risk for high - risk individuals when adjusted for age and competing risk was 18.1% for chd and 3.2% for stroke which increased to 47.8 and 19.6%, respectively, after 35 years. the estimates based on risk factors performed well throughout the period for chd but less well for stroke.conclusionthe prediction of traditional risk factors (systolic blood pressure, total serum cholesterol, and smoking status) on short - term risk (010 years) and long - term risk (035 years) of chd of stroke differs substantially. this indicates that the cumulative risk in middle - aged men based on these traditional risk factors can effectively be used to predict chd but not stroke to the same extent. |
hemiplegic patients can acquire wheelchair propulsion movements relatively quickly, and therefore those who have ambulatory difficulties or who are receiving training before being able to walk again use wheelchairs. however, hemiplegics are prone to posterior tilting of the pelvis due to factors such as wheelchair depth, hamstring contraction, and sitting for long periods1, and these factors are difficult for many people to change. to date, few studies have investigated the effect of long - term pelvic posterior tilt on wheelchairs2,3,4, and compared with research on therapy that aims to reestablish ambulation, research on wheelchair posture tends to receive less attention. kinose. noted wheelchair problems as a reason for this5 ; that is, most wheelchairs in hospitals and therapeutic facilities are likely to be standard models with dimensions and a seat that can not be adjusted for individuals. less than an optimal posture while propelling a wheelchair can easily aggravate abnormal muscle tension and associated responses, which can then become major clinical problems in themselves6. the dimensions of wheelchairs and their seats have been noted as possible causes of pelvic posterior tilt7, and the use of a wheelchair cushion is therefore recommended8. the effect of using a wheelchair cushion with anchor support6 and notches for the thigh section on the propulsion side9 have been reported for hemiplegic subjects. the importance of heel - ground contact7, footrest height10, and seat height11 in wheelchair propulsion by hemiplegic subjects has been previously reported. however, these reports often use propulsion speed as an evaluation indicator, and there are no reports that have quantitatively evaluated the angle of pelvic posterior tilt. we previously found that pelvic posterior tilt could be suppressed by using a wheelchair cushion in hemiplegics under the conditions of being seated without moving up to initiation of proplusion12. however, this effect of the cushion needs to be examined in more detailed by investigating how the angle of pelvic posterior tilt changes under the conditions of being seated through initiation and continuation of propulsions. thus, in this study, we investigated the continuity of the effect of using a cushion to suppress pelvic posterior tilt through three propulsion cycles. in addition, because hemiplegics use the lower limb on the propulsion side to control both propulsion and steering when propelling a wheelchair7, the wheelchair propulsion movement examined in this study was one - sided leg propulsion. the subjects were 18 hemiplegics (17 men and 1 woman ; age range, 4473) who could propel a wheelchair while in a seated position. subjects were excluded if they had severe spinal deformation, marked sensory impairment, or severe higher brain dysfunction and could not understand an explanation of the study. the physical functions and disease characteristics of the subjects are shown in table 1table 1.physical functions and disease characteristics of the hemiplegic subjectssubjectsexagediagnosisparalyzed sideperiod from onset (days)height (cm)weight (kg)brs scorefim scoreamale51cerebral infarctionleft111168.2 74.0 iv125bfemale72multiple cerebran infarctionleft166156.0 44.8 iv105cmale53cerebral hemorrhageright89173.4 63.0 iv99dmale60cerebral infarctionleft141166.7 64.0 iv113emale61cerebral hemorrhageright106160.3 63.4 iii95fmale62cerebral hemorrhageleft83168.1 50.3 iii66gmale55thalamic hemorrhageleft63161.3 51.0 iii109hmale63cerebral hemorrhageright116168.4 78.0 iv100imale44cerebral hemorrhageright141162.5 51.0 iii114jmale62thalamic hemorrhageright106165.2 65.5 iv122kmale63cerebral hemorrhageleft147165.3 66.9 iii79lmale49cerebral hemorrhageright62167.1 54.3 ii76mmale73thalamic hemorrhageleft95158.0 44.7 iii100nmale67thalamic hemorrhageright140160.4 48.4 ii76omale65putamen hemorrhageright211163.5 50.0 iv66pmale67thalamic hemorrhageright116160.7 52.3 iii113qmale72cerebral infarctionleft91160.3 45.1 iii121rmale69cerebral hemorrhageleft41173.4 68.5 ii99brs : brunnstrom recovery stage ; fim : functional independence measure. nine subjects had right hemiplegia, and 9 had left hemiplegia (112.539.8 days from disease onset to day of measurement). physical function was assessed using the leg brunnstrom recovery stage and the functional independence measure. we assumed that age and sex differences would have a negligible effect on the results. although such effects are a possibility, previous studies that were mixed sex and that considered a broad range of ages have not reported age or sex differences11, 12. brs : brunnstrom recovery stage ; fim : functional independence measure measurements were obtained under two conditions : 1) subjects seated without moving in an adjustable wheelchair and 2) from the seated position through three propulsion cycles of travel in a straight line under one - sided leg propulsion. maximum isometric contraction of the long head of the biceps femoris was measured for 5 s in the prone position. the initial ground contact of the propelling foot through to the next ground contact of the same foot was defined as the initiation of propulsion. the cushion had an anchoring function, and the thigh pad on the propulsion side was removed. the thickness of the cushion was 8 cm (difference in elevation of 2.5 cm). the cushion comprised a polyethylene foam pad underneath a low - rebound, high - density urethane pad and a polyethylene cushion cover. to measure kinematic data, we used a three - dimensional (3d) motion analysis system (vicon mx), consisting of 8 infrared cameras, and an electromyograph (dkh). all patients used the same adjustable wheelchair (nissin medical industries co., ltd.). the camera sampling frequency was 120 hz. the propulsion pathway was 3.6 m, and the measurements were made starting at the 1.8 m mark and continued thereafter. infrared reflective markers were pasted at the following 15 locations : bilateral acromion, spinous process of the second thoracic vertebra, bilateral anterior superior iliac spine (asis), bilateral posterior superior iliac spine (psis), hip joint, knee joint, external malleolus, and head of the fifth metatarsal. to calculate the pelvic angle, the bilateral asis and psis markers were used to define a pelvic coordinate system. electromyography was used to analyze muscle activity during the propulsion movements and was synchronized to the 3d motion analysis system. data were sampled at 1,080 hz and input into a pc after a / d conversion. the waveform of the electromyogram was processed with a 20450 hz band - pass filter and subjected to full - wave rectification to determine the integrated electromyogram (iemg). the muscle measured was the biceps femoris long head, and the electrodes were attached at the positions recommended by aldo. the adjustable wheelchair had 24-inch propulsion wheels and 5-inch casters, and the height difference of the seat from front to back was set at 0 cm. the bottom of the back support was raised so that the markers attached to the pelvis were visible from behind. the five adjustable parameters of the wheelchair were the seat height, depth, and width and the heights of the arm and back supports. adjustment of the wheelchair to patient dimensions was conducted by referring to the wheelchair sig workshop text (2003). the parameters analyzed were the pelvic posterior tilt angle when initiating propulsion through three propulsion cycles, muscle activity of the biceps femoris long head, and propulsion speed. the pelvic posterior tilt angle around the x - axis was calculated using vicon body builder ver. 3.6 after inputting the marker positions measured by the vicon motion analysis system into a pc. as in a previous study14, we used as the measurement point the peak bending moment of the hip (peak bending) on the propulsion side initially when seated without moving and then during each propulsion cycle. the hip joint angle was calculated using the diff gait, wave eyes software from the clinical gait analysis forum of japan. for the muscle activity of the biceps femoris long head, the iemg was determined from the ground contact of the propelling foot to the peak bending moment in each propulsion cycle. as a procedure to normalize the results between subjects, the iemg during the maximum isometric contraction of the biceps femoris long head was taken as 100%, and the results were converted to an iemg proportion (% iemg). maximum isometric contraction was measured for 5 s, but only 3 s were used for the iemg calculation. the value resulting from dividing the amount of movement from the ground contact of the propelling foot through to the next ground contact of the same foot by the time taken to complete the movement was defined as the propulsion speed. the distance was derived from the marker position at the head of the fifth metatarsal and the ankle measured by the vicon system and was calculated from the required time. the pelvic posterior tilt angle, the biceps femoris long head % iemg, and the propulsion speed were investigated by one - way analysis of variance with time as a factor and by the multiple comparison method (dunnett s test). this study was approved by the ethics review committee of the international university of health and welfare (09 - 122) and was conducted after obtaining consent from each subject and his or her attending physician. the pelvic posterior tilt angle from the seated position without moving through three propulsion cycles, the propulsion speed for each propulsion cycle, and the biceps femoris long head % iemg are shown in table 2table 2.measurement values from sitting through three wheelchair propulsion cyclesparameterstationarystart of propulsionsecond propulsion cyclethird propulsion cyclepelvic posterior tilt angle ()11.43.913.54.013.64.313.74.0bflh % iemg (%) 20.28.311.96.78.75.1propulsion speed (m / s)0.290.060.400.080.460.10values indicate the meansd of the 18 subjects.. a significant difference was found in the pelvic posterior tilt angle between being seated without moving and the initiation of propulsion (p<0.05), between being seated without moving and the second propulsion cycle (p<0.05), and between being seated without moving and the third propulsion cycle (p<0.05). significant differences were found in the propulsion speed and biceps femoris long head % iemg between the initiation of propulsion and the second propulsion cycle (p<0.01) and between the initiation of propulsion and the third propulsion cycle (p<0.01). this study revealed significant differences in the pelvic posterior tilt angle and propulsion speed between being seated without moving and initiating propulsion and between being seated without moving and the second and third propulsion cycles. the pelvic posterior tilt angle changed over time, and was 11 when sitting still ; it was later found to be 13. thus, the results of anchoring the cushion and removing the thigh pad from the propulsion side in the present study showed results similar to those of the studies by takeda.6, cron9, and engstrom15. furthermore, the effect of a wheelchair cushion suppressing pelvic posterior tilt when sitting still as investigated by kawada.12 was shown to continue through the third propulsion cycle. we also found that the effect continued through to the third propulsion cycle, and it was possible to quantitatively express the pelvic posterior tilt angle over time. since the pelvis tilted posteriorly from the seated position through to initiation of propulsion and did not change greatly after that, the time from the seated position without moving to initiation of propulsion is important for us to consider when attempting to suppress pelvic posterior tilting in one - sided leg propulsion by a hemiplegic patient. this novel finding is a potential point of focus when observing one - sided leg propulsion movements in the clinical setting. a significant difference in the biceps femoris long head % iemg was found between initiation of propulsion and the second and third propulsion cycles. this suggests that high muscle activity in the biceps femoris long head is necessary for moving the combined mass of the wheelchair and the patient when initiating propulsion, and with the acceleration obtained, the wheelchair could subsequently be moved by exerting a lower amount of force16. so, the patient could move forward using a lower force from the second propulsion cycle onward. as the propulsion speed increased, it is likely that the effect of the wheelchair cushion on suppressing pelvic posterior tilt continued through the third propulsion cycle. to conclude, analysis of one - sided leg propulsion revealed continuity of the effect of a wheelchair cushion on suppressing pelvic posterior tilt from the seated position without moving through three propulsion cycles. future research should compare cushions of differing materials and shapes, verify their long - term effects, and investigate potential application to wheelchair cushion design. | [purpose ] this study sought to ascertain whether, in hemiplegic patients, the effect of a wheelchair cushion to suppress pelvic posterior tilt when initiating wheelchair propulsion would continue in subsequent propulsions. [subjects ] eighteen hemiplegic patients who were able to propel a wheelchair in a seated position participated in this study. [methods ] an adjustable wheelchair was fitted with a cushion that had an anchoring function, and a thigh pad on the propulsion side was removed. propulsion movements from the seated position without moving through three propulsion cycles were measured using a three - dimensional motion analysis system, and electromyography was used to determine the angle of pelvic posterior tilt, muscle activity of the biceps femoris long head, and propulsion speed. [results ] pelvic posterior tilt could be suppressed through the three propulsion cycles, which served to increase propulsion speed. muscle activity of the biceps femoris long head was highest when initiating propulsion and decreased thereafter. [conclusion ] the effect of the wheelchair cushion on suppressing pelvic posterior tilt continued through three propulsion cycles. |
the study was done by following the tenets of declaration of helsinki and as per the protocol of vision research foundation. modern chart construction uses the principles of geometric progression of letter sizes, usage of letters of equal legibility, and normalization of crowding. the 10 sloan letters [c, d, h, v, r, n, s, o, k, and z ] are known to have equal legibility. the early treatment diabetic retinopathy study (etdrs) charts were constructed using these ten sloan letters and logmar construction design. the pocket vision screener reported in this study the task for the subject would be to read the middle five letters in the middle line [fig. 1 ]. the central five letters in each line were created using the letters in the 6/9 line of the etdrs charts. only those combinations that differed in their row legibility values by at most 1% were used for the construction of the chart. row legibility values were calculated by adding up the legibility scores of the individual letters in that line. these calculations were done using the difficulty scores given by sloan. a version of the pocket vision screener. the subject 's task is to read the letter ncvoz from a distance of 3 m. the box is included in this picture for clarity ; it does not appear in the pocket vision screener six versions of the screener were constructed. two of these had the middle line with letters chosen from the etdrs chart 1, two with letters chosen from etdrs chart 2 and two from etdrs chart r. the two charts with the same middle line had their first and third lines interchanged [fig. the left and right screeners have their first and the third lines interchanged each of the 10 sloan letters were constructed separately on a 5 5 grid using the image processing software adobe photoshop 7.0 (adobe systems, inc, california, usa). the size of the letters was calculated to be 6.92 mm 6.92 mm for viewing at 3 m distance corresponding to a logmar visual acuity of 0.2 (or approximately 6/9 snellen acuity). the letters were arranged using the software coreldraw 10 (corel corporation, ontario, canada). the spacing between the rows and the spacing between adjacent letters in a row were set equal to 6.92 mm (the letter size). the white background was extended to one letter size on all the four sides ; beyond this the screener was completely black. the overall size of the screener was 12 cm (width) 6.2 cm (height). it is an externally illuminated chart intended to be used in a standard illumination of 130215 lux. the screeners were printed on a 250 gsm, matt finished paper using a laser printer with the cost of production inr 10. subjects were recruited from the outpatient department of the rural eye hospital, sankara nethralaya, chennai. one hundred consecutive patients who could read english alphabets and who had unaided visual acuity better than or equal to 6/60 so as to exclude people with severe visual impairment. consecutive patients visiting the optometrist room, which was standardized for testing and who met the required criteria were included in the study. after obtaining oral consent from the subjects, unaided visual acuity was tested by a trained optometrist using both the newly constructed pocket vision screener and logmar visual acuity chart. all visual acuity testing was performed by a single examiner. for each subject, right eye was chosen as the testing eye and the other eye was occluded. subjects were seated at a distance of 3 m from the chart. in the case of visual acuity measurement using the logmar chart, the subjects were instructed to read from the top left and stop reading until they were not able to read anymore letters. every correctly read letter was assigned a score of 0.02 and every incorrectly read or unread letter was assigned a score of 0.00. visual acuity (logmar) for each subject was determined using the formula : va (logmar) = 1.10.02 number of correctly read letters in the case of the pocket vision screener, the subjects were instructed to read all the letters in the middle line. correct response of any three letters out of the middle five in the middle line was considered to have passed the screening as more than 50% of the letters were rightly identified. the time taken to measure visual acuity data analysis was done using microsoft office excel 2003 (microsoft) and spss version 12.0 (spss inc.). modern chart construction uses the principles of geometric progression of letter sizes, usage of letters of equal legibility, and normalization of crowding. the 10 sloan letters [c, d, h, v, r, n, s, o, k, and z ] are known to have equal legibility. the early treatment diabetic retinopathy study (etdrs) charts were constructed using these ten sloan letters and logmar construction design. the pocket vision screener reported in this study the task for the subject would be to read the middle five letters in the middle line [fig. 1 ]. the central five letters in each line were created using the letters in the 6/9 line of the etdrs charts. multiple combinations of these seven letter sequences were generated. from these, only those combinations that differed in their row legibility values by at most 1% were used for the construction of the chart. row legibility values were calculated by adding up the legibility scores of the individual letters in that line. the subject 's task is to read the letter ncvoz from a distance of 3 m. the box is included in this picture for clarity ; it does not appear in the pocket vision screener six versions of the screener were constructed. two of these had the middle line with letters chosen from the etdrs chart 1, two with letters chosen from etdrs chart 2 and two from etdrs chart r. the two charts with the same middle line had their first and third lines interchanged [fig, the left and right screeners have their first and the third lines interchanged each of the 10 sloan letters were constructed separately on a 5 5 grid using the image processing software adobe photoshop 7.0 (adobe systems, inc, california, usa). the size of the letters was calculated to be 6.92 mm 6.92 mm for viewing at 3 m distance corresponding to a logmar visual acuity of 0.2 (or approximately 6/9 snellen acuity). the letters were arranged using the software coreldraw 10 (corel corporation, ontario, canada). the spacing between the rows and the spacing between adjacent letters in a row were set equal to 6.92 mm (the letter size). the white background was extended to one letter size on all the four sides ; beyond this the screener was completely black. the overall size of the screener was 12 cm (width) 6.2 cm (height). it is an externally illuminated chart intended to be used in a standard illumination of 130215 lux. the screeners were printed on a 250 gsm, matt finished paper using a laser printer with the cost of production inr 10. subjects were recruited from the outpatient department of the rural eye hospital, sankara nethralaya, chennai. one hundred consecutive patients who could read english alphabets and who had unaided visual acuity better than or equal to 6/60 so as to exclude people with severe visual impairment. consecutive patients visiting the optometrist room, which was standardized for testing and who met the required criteria were included in the study. after obtaining oral consent from the subjects, unaided visual acuity was tested by a trained optometrist using both the newly constructed pocket vision screener and logmar visual acuity chart. all visual acuity testing was performed by a single examiner. for each subject, right eye was chosen as the testing eye and the other eye was occluded. subjects were seated at a distance of 3 m from the chart. in the case of visual acuity measurement using the logmar chart, the subjects were instructed to read from the top left and stop reading until they were not able to read anymore letters. every correctly read letter was assigned a score of 0.02 and every incorrectly read or unread letter was assigned a score of 0.00. visual acuity (logmar) for each subject was determined using the formula : va (logmar) = 1.10.02 number of correctly read letters in the case of the pocket vision screener, the subjects were instructed to read all the letters in the middle line. correct response of any three letters out of the middle five in the middle line was considered to have passed the screening as more than 50% of the letters were rightly identified. the time taken to measure visual acuity data analysis was done using microsoft office excel 2003 (microsoft) and spss version 12.0 (spss inc.). the age of the subjects ranged from 7 to 71 years (43 17 years). we tested the ability of the pocket vision screener to correctly identify visual acuity deficits. anyone who could not read correctly three letters of the middle five in the middle line were considered to have a visual acuity deficit. similarly, for the logmar chart, anyone who had a visual acuity logmar value > 0.24 was considered to a visual acuity deficit. constructing the 2 2 truth table [table 1 ], the sensitivity, specificity, positive and negative predictive values, and likelihood ratios of the pocket vision screener in correctly classifying the subjects were calculated [table 2 ]. the positive and negative predictive values were found to be 91% and 87%, respectively. truth table for the measurement made with the pocket vision screener sensitivity, specificity, positive and negative predictive value, positive and negative likelihood ratio for the pocket vision screener in correctly classifying subjects the time taken by both the methods was compared using wilcoxon signed rank test as recorded times did not fall under a normal distribution. there was a significant difference (p < 0.001) in the time taken to measure visual acuity comparing charts, with the pocket vision screener taking less time [table 3 ]. screening is defined as the systematic application of a test or inquiry, to identify individuals at sufficient risk of a specific disorder to warrant further investigation or direct preventive action, among persons who have not sought medical attention on account of symptoms of that disorder. a screening test is said to be valid depending on the frequency with which the result of the test is confirmed by a gold - standard diagnostic procedure. an ideal test should have the ability to classify persons with disease as positives (sensitivity) and those without the disease as negatives (specificity). sensitivity and specificity can be varied reciprocally, according to the setting, that is, the cut - off value used for further referral. above 90% of specificity are usually used in school vision screening programs in view of the cost involved in confirmatory examinations. the pocket vision screener meets these qualities as it is efficient in detecting those with visual acuity worse than 6/9 (sensitivity) and ruling out those who do not have defective visual acuity (specificity). it is highly acceptable and subject - friendly, as it can be administered with ease, and consumes less time. population - based studies from india show that among children in the age group of 715 years, the prevalence of uncorrected visual acuity of 6/12 or worse in the better eye is 6.4% in the urban population and 2.7% in the rural population, and the prevalence of best - corrected visual acuity worse than 6/12 among the same population was 0.81% and 0.78%, respectively. refractive errors were the leading cause of visual impairment in 61% of eyes in rural population and 81.7% of eyes in urban population with amblyopia being the second major cause in both populations. as estimated by naidoo. when provided with appropriate refractive services and spectacles, 70% of all children in the rural areas who had baseline visual acuity worse than 6/12 and 80% of children from urban population were found to benefit. dandona and dandona 2006 estimated that the total number of persons with visual impairment worldwide, including that due to uncorrected refractive error was 259 million, 61% higher than the who estimate. 115,000 4-year trained optometrists are required to meet the demand of providing comprehensive care to all the people in the country. there is a huge burden of providing eye care services in india, as the number of eye care providers is insufficient for the population. novel initiatives such as training teachers to screen school children have shown to reduce the workload of eye care specialists. however, the false positive rates were found high among those referred by teachers. considering the simplicity of instructions and less time required for administration, the model of training teachers and other volunteers could be tried in future. low cost of production, compact size, ease of use, and the less screening time makes this screener an ideal tool for mass vision screening. the pocket vision screener is highly sensitive and specific and has a good positive and negative predictive value. therefore, this can be used as quick and accurate tool to screen subjects with visual acuity worse than 6/9. the pocket vision screener is a compact and simple tool to use in addition to being very cost effective. | aim : the aim was to construct a visual acuity chart and find its effectiveness at screening visual acuity deficits.materials and methods : two phases were involved in this study. construction of the screener : ten sloan letters (c, d, h, k, n, o, r, s, v, and z) were selected and the letters were constructed and reduced to 0.2 logmar acuity size (6.92 mm) for viewing at 3 m. the screener contains three lines with seven letters in each. few combinations of the seven letter sequences were chosen based on the row legibility scores. three seven letter combinations close to the median of all combinations were selected, such that maximum difficulty score difference between the lines are < 1%. finding the effectiveness of the screener : 100 literate subjects with unaided visual acuity better than or equal to 6/60 were recruited for the study. unaided visual acuity was tested using both the newly constructed pocket vision screener and a logmar visual acuity chart and the time taken to measure the visual acuity using both the charts was noted.results:the mean age of the subjects was 43 17 years. subjects were classified as normal or deficient based on the logmar visual acuity measurement. the screener was found to have 81% sensitivity, 94% specificity. the positive and negative predictive values were found to be 91% and 87%, respectively. a significant difference (p < 0.001) was found in the time taken to record visual acuity using both the charts.conclusion:the pocket vision screener can be used as a quick and accurate tool to screen subjects for visual acuity deficits, being highly sensitive, specific, and cost - effective. |
seaweeds are classified into red algae (rhodophyta), brown algae (ochrophyta, phaephyceae) and green algae (chlorophyta) (1, 2). seaweeds have been used primarily for human consumption either as food or medicine to cope with stomach diseases, eczema, cancer, kidney disorders, asthma, arteriosclerosis, heart disease, and lung disease (3 - 5). it is also being studied in biomedicine due to containing abundant bioactive components, including sulfated polysaccharides, carotenoids, proteins, essential fatty acids, vitamins, minerals, terpenoids, phlorotannin, oxylipins and steroids (6, 7). for example, alginates derived from brown algae are often used as an additive to improve food textures (5). non - steroidal anti - inflammatory drugs (nsaids) are drugs most commonly used to reduce inflammation (8). many studies reported that the therapeutic effects and the side effects of nsaids were targeted at inhibition of cyclooxygenase (cox) (9). an isoform of cox, the cox-1, is used to catalyze the formation of prostaglandins (pg) on platelets, vascular endothelium, mucosa of the stomach, kidney, pancreas, islets of langerhans, seminal vesicles and brain (10, 11). the isoform cox-2 can be induced by various growth factors, proinflammatory agents, endotoxins, mitogens and agents of the tumor, indicating that the isoform has a role in pathological processes (12). the product of cox-1, prostaglandins (pgi2 and pge2), maintains the integrity of the gastrointestinal tract by reducing gastric acid secretion, increasing the thickness of the mucous layer, stimulating bicarbonate secretion and increasing blood flow in the mucosa (11, 13, 14). in addition to preventing the synthesis of cox products, another mechanism of nsaid compounds is through inhibition of leukotriene, prevention of the release of the compound of oxygen radicals and lysosomal enzymes and prevention of aggregation, adhesion and chemotaxis of neutrophils (15, 16). in addition, the stimulation of peroxisome proliferator - activated receptor (ppar) and inhibition of nuclear factor - kappa b (nf-b) and other transcription factors are also involved in the action of nsaids (17). administration of aspirin in low doses (100 mg / day) was reported to inhibit the activity of cox-1 by acetylating ser529 residue, leading to inhibition of the production of thromboxane a2(txa2) and inhibiting txa2-mediated platelet aggregation. aspirin is also found to inhibit cox-1 on gastric and duodenal mucosa, causing a reduction in pge2-mediated cytoprotection against acidic environments (18). studies of nsaids - induced gastric damage gave rise to a notion that inhibition of both cox-1 and cox-2 may occur, given that cox-2 can replace cox-1 in producing prostaglandins (19). the purpose of the present study was to investigate the potential of the active compounds fucoidan and alginate derived from sargassum sp. the component structure of aspirin (cid : 2244), alginate (cid : 91666324) and fucoidan (cid : 10452) was obtained from pubchem open chemistry database, whereas the protein sequence of cox-1 (gi : 3914292) and cox-2 (gi : 2970564) was obtained from sequence database of the national center for biotechnology information (ncbi), the united states national library of medicine (nlm) and the national institute of health (nih) (http://www.ncbi.nlm.nih.gov). the 3d - structure model of cox-1 and cox-2 was predicted using the swiss - model web - server (20, 21) by the homology modeling method. conversion.sdf files into.pdb files of aspirin, fucoidan and alginate was performed using the software openbabel (22). docking simulation among aspirin, fucoidan and alginate on cox-1 and cox-2 was performed using the software hex 8.0 (23). the docking protocol consists of three stages of visualization : rigid - body energy minimization, semi - flexible repair and finishing refinement in explicit solvents. upon completion of each stage, docking conformations were then scored and sorted based the scoring function to facilitate the selection of the best conformation to be used at later stages. docking analysis results were subsequently visualized using the software discovery studio 4.1, ligplot+ (24) and chimera 1.6.2. analysis of protein - protein interactions was carried out to determine the formed bonds, including hydrogen bonding, hydrophobic bonding and van der waals bonding. additionally, pharmacophore analysis was also conducted to determine residues directly involved in the process of interaction, as well as the analysis of energy minimization to improve molecular structure and shape during the interaction. the component structure of aspirin (cid : 2244), alginate (cid : 91666324) and fucoidan (cid : 10452) was obtained from pubchem open chemistry database, whereas the protein sequence of cox-1 (gi : 3914292) and cox-2 (gi : 2970564) was obtained from sequence database of the national center for biotechnology information (ncbi), the united states national library of medicine (nlm) and the national institute of health (nih) (http://www.ncbi.nlm.nih.gov). the 3d - structure model of cox-1 and cox-2 was predicted using the swiss - model web - server (20, 21) by the homology modeling method. conversion.sdf files into.pdb files of aspirin, fucoidan and alginate was performed using the software openbabel (22). docking simulation among aspirin, fucoidan and alginate on cox-1 and cox-2 was performed using the software hex 8.0 (23). the docking protocol consists of three stages of visualization : rigid - body energy minimization, semi - flexible repair and finishing refinement in explicit solvents. upon completion of each stage, docking conformations were then scored and sorted based the scoring function to facilitate the selection of the best conformation to be used at later stages. docking analysis results were subsequently visualized using the software discovery studio 4.1, ligplot+ (24) and chimera 1.6.2. analysis of protein - protein interactions was carried out to determine the formed bonds, including hydrogen bonding, hydrophobic bonding and van der waals bonding. additionally, pharmacophore analysis was also conducted to determine residues directly involved in the process of interaction, as well as the analysis of energy minimization to improve molecular structure and shape during the interaction. aspirin, being one of anti - inflammatory non - steroidal drugs (nsaids), was used as the standard in the present study. aspirin had a higher effectiveness as ab inhibitor for cox-1 than for cox-2, as shown by the binding energy and the types of bond formed from the interaction. aspirin was known to require a lower binding energy to cox-1 (159.68 kj / mol) than to cox-2 (-155.37 kj / mol). in addition, the number of the bond formed also supported these results. aspirin interaction with cox-1 formed two electrostatic interactions (glu142, asp231) and three hydrogen bonds (ser145, arg335, glu142, trp141), while its interaction with cox-2 formed only one hydrogen bond (gln529). the active compounds of sargassum sp. analyzed in this study were alginate and fucoidan. analysis showed that both alginate and fucoidan could act as inhibitors of cox-1 and cox-2. relative to aspirin, alginate and fucoidan were thought to have a better potential as inhibitors of cox-1 and cox-2. it was shown by the fact that the energy required for the interaction between the two compounds on cox was smaller than that required by aspirin to bind to cox (table 1). comparison of possible interactions of the active compounds of sargassum sp. with aspirin on cox-1 and cox-2 analysis of bonding energy indicated that aspirin required energy of -159 kj / mol and -155.37 kj / mol to bind to cox-1 and cox-2, respectively. alginate required less bonding energy of -171.93 kj / mol and -179.19 kj / mol to bind to cox-1 and cox-2, respectively. fucoidan required much smaller energy to interact with cox-1 and cox-2 (-287.96 kj / mol and -272.51 kj / mol) than aspirin or alginate. the bonding energy required by fucoidan was almost half of that required by aspirin to bind to cox-1 and cox-2 ; fucoidan was thought to have a good potential as an inhibitor of cox-1 and cox-2. analysis of residues directly involved in the process of interaction showed that aspirin and alginate competitively bound cox-2, in which the two compounds would bind to the amino acid residue gln529 in their interactions. in the process of competitive binding it was thought that alginate more easily bound than aspirin to cox-2 due to its smaller binding energy ; thus, alginate had an excellent potential as an inhibitor of cox-2. in addition, on the basis of binding energy, the interaction of cox-2/aspirin only formed one hydrogen bond (gln529), while the interaction of cox-2/alginate formed two electrostatic bonds (glu31, asp111) and three hydrogen bonds (arg29, gln529, thr115). the number of alginate - cox-2 bonds formed showed that the bonds between them were strong and stable. aspirin, being one of anti - inflammatory non - steroidal drugs (nsaids), was used as the standard in the present study. aspirin had a higher effectiveness as ab inhibitor for cox-1 than for cox-2, as shown by the binding energy and the types of bond formed from the interaction. aspirin was known to require a lower binding energy to cox-1 (159.68 kj / mol) than to cox-2 (-155.37 kj / mol). in addition, the number of the bond formed also supported these results. aspirin interaction with cox-1 formed two electrostatic interactions (glu142, asp231) and three hydrogen bonds (ser145, arg335, glu142, trp141), while its interaction with cox-2 formed only one hydrogen bond (gln529) the active compounds of sargassum sp. analyzed in this study were alginate and fucoidan. analysis showed that both alginate and fucoidan could act as inhibitors of cox-1 and cox-2. relative to aspirin, alginate and fucoidan were thought to have a better potential as inhibitors of cox-1 and cox-2. it was shown by the fact that the energy required for the interaction between the two compounds on cox was smaller than that required by aspirin to bind to cox (table 1). comparison of possible interactions of the active compounds of sargassum sp. with aspirin on cox-1 and cox-2 analysis of bonding energy indicated that aspirin required energy of -159 kj / mol and -155.37 kj / mol to bind to cox-1 and cox-2, respectively. alginate required less bonding energy of -171.93 kj / mol and -179.19 kj / mol to bind to cox-1 and cox-2, respectively. fucoidan required much smaller energy to interact with cox-1 and cox-2 (-287.96 kj / mol and -272.51 kj / mol) than aspirin or alginate. the bonding energy required by fucoidan was almost half of that required by aspirin to bind to cox-1 and cox-2 ; fucoidan was thought to have a good potential as an inhibitor of cox-1 and cox-2. analysis of residues directly involved in the process of interaction showed that aspirin and alginate competitively bound cox-2, in which the two compounds would bind to the amino acid residue gln529 in their interactions. in the process of competitive binding it was thought that alginate more easily bound than aspirin to cox-2 due to its smaller binding energy ; thus, alginate had an excellent potential as an inhibitor of cox-2. in addition, on the basis of binding energy, the interaction of cox-2/aspirin only formed one hydrogen bond (gln529), while the interaction of cox-2/alginate formed two electrostatic bonds (glu31, asp111) and three hydrogen bonds (arg29, gln529, thr115). the number of alginate - cox-2 bonds formed showed that the bonds between them were strong and stable. of various inflammatory mediators, prostaglandins (pg) are among the most important mediators. a key enzyme of the synthesis of prostaglandin is prostaglandin endoperoxide synthase (pghs) or cyclooxygenase (cox), which has two catalytic sites. the first is the active site of cyclooxygenase that serves to convert arachidonic acid into endoperoxide pgg2. the other was the active site of peroxidase that serves to convert pgg2 into another endoperoxide, pgh2. furthermore, pgh2 will be processed by a specific enzyme to form pg, prostacyclin and thromboxane a2. of all types of pg, pge2 and prostacyclin the active components of algae have been known to have pharmacological actions as antiviral compounds to treat a variety of diseases, including eczema, cancer, kidney disorders, asthma, arteriosclerosis, heart disease and lung disease (3 - 5, 26). but, the present study was the first to report the potential of the components (alginate and fucoidan) of sargassum sp. results of our study showed that alginate and fucoidan were potential inhibitory compounds, either to cox-1 or cox-2, in which alginate was a more potent inhibitor of cox-2 than aspirin. cox-2 is expressed in normal endothelial cells in response to shear stress, in which inhibition of cox-2 is significantly associated with suppression of the synthesis of prostacyclin (27, 28). both cox-1 and cox-2 have been detected in atherosclerotic lesions in humans (29) ; however, the specific effects of cox inhibition in the progression of the lesion remain a matter of controversy. administration of aspirin in low doses and cox-2 inhibitors has been known to improve or otherwise worsen endothelial dysfunction, hypercholesterolemia and hypertension (30, 31). cox-2 has been implicated in plaque destabilization via its increased expression and co - localization with microsomal pge synthase-1 and metalloproteinase-2 (mmp-2) and mmp-9 (32). aspirin is among the cox - inhibiting compounds acting by acetylating the cox binding site, thus preventing the formation of prostaglandins. aspirin bonding to cox-1 can inhibit the production of prostaglandins that are responsible for the formation of platelets, preventing blood from clotting. the present study found that fucoidan and alginate were highly potential as cox-2 inhibitors ; thus, consumption of sargassum sp. is thought to provide an aspirin - like effect. the 3-dimensional structure of cox-1 consists of 3 independent folding units, namely an epidermal growth factor - like domain, a membrane - bound motif and an enzymatic domain. the conformation of the membrane - bound motif strongly suggested the enzyme was integrated to only a layer of the lipid bilayer, thus belonging to the monotopic membrane proteins. the s(-) stereoisomer of flurbiprofen interacts by means of its carboxylic group with arg120, thus putting the second phenyl ring in the van der waal s interaction of tyr385 (25). it was thought that there were other sub - sites for drug compounds to bind to the slanting channel. results of our study indicated that alginate interacted with cox-1 at residues glu545, ser128, gln374, lys534 and ile126, while fucoidan interacted via lys534 and phe373., including fucoidan and alginate, had good potential as inhibitors of cox-1 and cox-2. | introduction : the enzyme cyclooxygenase (cox) is an enzyme that catalyzes the formation of one of the mediators of inflammation, the prostaglandins. inhibition of cox allegedly can improve inflammation - induced pathological conditions.aim:the purpose of the present study was to evaluate the potential of sargassum sp. components, fucoidan and alginate, as cox inhibitors.material and methods : the study was conducted by means of a computational (in silico) method. it was performed in two main stages, the docking between cox-1 and cox-2 with fucoidan, alginate and aspirin (for comparison) and the analysis of the amount of interactions formed and the residues directly involved in the process of interaction.results:our results showed that both fucoidan and alginate had an excellent potential as inhibitors of cox-1 and cox-2. fucoidan had a better potential as an inhibitor of cox than alginate. cox inhibition was expected to provide a more favorable effect on inflammation - related pathological conditions.conclusion:the active compounds fucoidan and alginate derived from sargassum sp. were suspected to possess a good potential as inhibitors of cox-1 and cox-2. |
langerhans cell histiocytosis (lch) is a clonal proliferative disease of langerhans cells (lcs), the primary antigen - presenting cells of the skin. it represents a spectrum of clinical disorders ranging from a highly aggressive and frequently fatal leukemia - like disease affecting infants to an easily cured solitary lesion of bone. it was originally believed to be a reactive proliferative disorder of histiocytes of unknown cause, hence the name histiocytosis x. it has stimulated considerable debate about its categorization and whether it is a reactive disorder or a truly malignant process. recently it has been classified by the world health organization based on the lineage of the specific histiocyte involved : langerhans cell, undifferentiated cell, dendrocyte or macrophage. a 65-year - old man presented after referral by his general dental practitioner with painless swelling in the anterior region of the mandible since 1 year. swelling was small initially and had increased to the present size. on further elicitation, the patient gave a history of swelling in the lower anterior region after he had hurt himself with a pin while cleaning his teeth 9 years ago. swelling subsided after the biopsy and so patient did not get any treatment done for 3.5 years. patient reported to our department with a painless swelling in the anterior region of the mandible since 1 year. clinical examination [figure 1a and b ] showed a painless swelling measuring 4 cm 3.5 cm in size in the left anterior mandibular region lateral to the symphysis. (a) frontal view and (b) lateral view intraoral examination showed missing lower central and lateral incisor teeth with periodontally compromised teeth erythrocyte sedimentation rate, white cell count and flocculation test were within reference ranges and chest radiograph and gamma globulins were within normal limits, which ruled out systemic involvement. radiographs [figure 3 ] orthopantomograph showed extensive bony destruction with radiolucencies involving the anterior part of mandible where the involved teeth had lost their supporting tissue and appeared to be floating in radiolucent lesion. the lesion had invaded the cortical rim giving a scooped out appearance, typical of single system lch. differential diagnosis of ewing sarcoma, lymphoma, leukemia, metastatic disease and osteomyelitis were also considered. we decided to further diagnose the condition by taking an incisional biopsy and examining the tissue histologically. orthopantomogram showed a radiolucent lesion in the anterior part of the mandible hematoxylin and eosin stained sections of the lesion revealed marked chronic inflammation with aggregates of histiocytes that showed features of langerhans cells with their indistinct cell margins and pink cytoplasm. also these cells showed immunoreactivity for s-100 protein [figure 4d ] and cd 1a [figure 4e ] that suggested that the lesional cells were of langerhans cells in origin. this indicated a diagnosis of langerhans cell disease which was compatible with the clinical picture. intraoperative view : incisional biopsy taken at the site of the lesion.(a) low power view of the histological section showed marked cellular infi ltrate in the connective tissue (h&e stain, x40)(b) photomicrograph shows aggregates of histiocytes along with lymphocytes (h&e stain, 100). (c) high power view shows aggregates of histiocytes with indistinct cell borders and pale eosinophilic cytoplasm (h&e stain, 400). (d) the histiocytic cells showing positivity for s-100 protein (ihc stain, 100). (e) the aggregates of histiocytes were positive for cd 1a protein (ihc stain, 400) for the definitive treatment, debulking of the lesion was done under general anesthesia. incision extended from mesial surface of canine on right side on alveolar ridge to mesial surface of canine on the left side. extraction of 33, 34, 35, 36, 37 and 38 was done. follow - up was done at 1 week, 4 weeks, 2 months, 4 months and 6 months intervals and was uneventful figure 6 and figure 7. intraoperative view showing debulking of the lesion postoperative extraoral view : no recurrence of the lesion was noted during the follow - up postoperative intraoral view : no recurrence of the lesion was noted during the follow - up hematoxylin and eosin stained sections of the lesion revealed marked chronic inflammation with aggregates of histiocytes that showed features of langerhans cells with their indistinct cell margins and pink cytoplasm. eosinophils were also detected [figure 4a - c ]. also these cells showed immunoreactivity for s-100 protein [figure 4d ] and cd 1a [figure 4e ] that suggested that the lesional cells were of langerhans cells in origin. this indicated a diagnosis of langerhans cell disease which was compatible with the clinical picture. intraoperative view : incisional biopsy taken at the site of the lesion.(a) low power view of the histological section showed marked cellular infi ltrate in the connective tissue (h&e stain, x40)(b) photomicrograph shows aggregates of histiocytes along with lymphocytes (h&e stain, 100). (c) high power view shows aggregates of histiocytes with indistinct cell borders and pale eosinophilic cytoplasm (h&e stain, 400). (d) the histiocytic cells showing positivity for s-100 protein (ihc stain, 100). (e) the aggregates of histiocytes were positive for cd 1a protein (ihc stain, 400) incision extended from mesial surface of canine on right side on alveolar ridge to mesial surface of canine on the left side. extraction of 33, 34, 35, 36, 37 and 38 was done. follow - up was done at 1 week, 4 weeks, 2 months, 4 months and 6 months intervals and was uneventful figure 6 and figure 7. intraoperative view showing debulking of the lesion postoperative extraoral view : no recurrence of the lesion was noted during the follow - up postoperative intraoral view : no recurrence of the lesion was noted during the follow - up lch is a reactive disorder that is characterized by the infiltration and proliferation of dendritic cells, with the appearance of normal langerhans cells. despite advances in understanding the clinical picture, a group of disorders of the reticuloendothelial system is termed lch in accordance with the 1987 proposal of the writing group of the histiocyte society. these conditions include the so - called hand - schuller - christian disease, eosinophilic granuloma of bone and the letterer - siwe disease which were previously known as histiocytosis x. the current nomenclature emphasizes that most of these disorders have the common feature of infiltration of both bone and soft tissues by abnormal collection of langerhans cells. lch is a rare disorder that occurs at all ages, but predominantly affects children and young adults. it can affect almost any bone, but it commonly involves the mandible when the jaw is affected. mucocutanoeus lesions have been described, usually representing either secondary lesional deposits or extension of the disease process from involved bone to contiguous tissues. cutaneous lesions have been reported to occur in approximately one - third of cases of lch, usually coincidental with bone lesions and rarely as the only manifestation of the disease process. clinically, the skin lesions are described as consisting of either an extensive eruption of crusted papules or of one of several erythematous papules having a tendency towards ulceration. soft tissue involvement of the oral cavity usually manifests as swelling or ulceration of the gingiva overlying destructive lesions of the jaw bone, usually the mandible, that are clearly evident on radiographic examination. differential diagnosis for our patient included lch, ewing sarcoma, lymphoma, leukemia and osteomyelitis. our patient had no other systemic involvement as all his laboratory findings were within normal ranges and his chest radiograph and gamma globulins were within normal limits. burkitt 's lymphoma was also considered, but it usually attacks the maxilla instead of the mandible. both lch and ewing sarcoma cause similar lesions radiologically when flat bones are involved. but ewing sarcoma usually attacks the long bones and it rarely affects the mandible. hematoxylin and eosin stained sections showed features of langerhans cells which include cells with pale eosinophilic cytoplasm with indistinct cell borders and rounded or indented nuclei. varying number of eosinophils and other inflammatory cells like plasma cells, lymphocytes and multinucleated giant cells can also be seen. unique features of these cells include cytoplasmic immunostaining with s-100 antigen that distinguishes them from other histiocytes. the presence of hx bodies or birbeck 's granules (rod - shaped with characteristic periodicity and sometimes with a dilated terminal end called tennis racket appearance, intracellular in location and identified by electron microscopy) and the presence of cd1a antigen on the cell surface and hla - dr positivity confirms the langerhans cell origin of the disease. thirty percent of cases present with lesions that affect the jaws and the diagnosis must be confirmed by biopsy. the condition maybe a single system disease that affects bone, with or without involvement of lymph nodes, or multisystem disease that is disseminated throughout the body. in a recent report from the registry of the histiocyte society for adults, the 5-year survival rate for patients without pulmonary involvement was 100%. since the disease is much more common in children, most studies of treatment relate to data collected from juvenile cases and a definitive treatment regimen is yet to be established. currently single lesions are managed with simple biopsy, excision or curettage ; but chemotherapy is the preferred option for multiple lesions. however, while children respond well to chemotherapy, the disease in adults tends to follow a more chronic pattern with periods of relapse and remission. the use of radiotherapy is reserved for nonresponsive lesions or single lesions that are inaccessible for surgical curettage. it is only through the collation of international data and good cross specialty communication that a definitive and appropriate adult treatment regimen will be established for this unusual disease in adults. involvement of the thyroid, thymus and other sites is also possible but is rare. it is generally believed that patients with isolated lch of the bone require minimal treatment, which usually includes biopsy followed by curettage. however, the disease may recur at the same site or new lesions may appear elsewhere. even, after certain circumstances, surgery is rarely required and there are several alternative therapies. many approaches such as low - dose radiation therapy (between 400 and 800cgy), nonsteroidal anti - inflammatory drugs, intralesional injection of a steroid or systemic cytotoxic agents can be tried. excellent results can be obtained with radiation therapy in the management of localized histiocytosis, which is usually found in bone. when the disease is more widespread, radiation therapy is an effective adjunct to systemic chemotherapy, particularly for the control of local symptoms. doses in the range of 600 - 1,000 rads are effective for achieving local control in most instances. after we confirmed that there are no lesions in other organs, we made a decision that excision of the lesion plus chemotherapy was appropriate, because the disease was localized to the oral cavity. therefore, we conclude by saying that surgical treatment may be best for this type of lch based on the results in the present case. long - term follow - up of these type of patients is required. | langerhans cell histiocytosis (lch) is a disease process characterized by accumulation and infiltration of cells, showing ultrastructural and immunohistochemical similarities to langerhans cell, in the affected tissues. it exhibits extreme clinical heterogeneity. lch was historically divided into 3 clinical entities based on extent of tissue involvement and severity of presentation. these 3 entities were eosinophilic granuloma, hand - schuler - christian disease, letterer - siwe disease. owing to similarities of their histologic appearance, they were grouped together under the term histiocytosis x. it was recently changed to lch, emphasizing the primary cell involved in the disease process. lch is a rare disease with an incidenceestimated to be 4.0 to 5.4 per million population. males are affected twice as frequently as females. the disease may occur at any age with peak incidence in children aged 1 to 3 years. we describe an unusual case of a 65-year - old man who presented with painless swelling in anterior region of mandible. |
although intracranial atherosclerotic stenosis is angiographically more common than extracranial lesions in asians including koreans, the pattern and mechanism of cerebral infarction in partially occluded atherosclerotic cerebral arteries remain unknown (1, 2). a few studies have been conducted on the hemodynamics in small - caliber intracranial vessels, and especially in vessels associated with severe stenosis (3 - 8). the dearth of research in this area is in part due to the limited resolution of stenotic lumens as imaged by the current technologies, and this has precluded the development of realistic geometry for use in finite element modeling and computational fluid dynamics (cfd) analysis. investigating the subject - specific boundary conditions for intracranial arteries and the development of finite element models from stenotic intracranial arteries using clinically applicable imaging modalities depend on the geometry data for the model, the segmenting images to determine the shape of the lumen and the construction of a computational grid for the fluid domain (9, 10). by using the flowchart tool for patient - specific computational grid reconstruction and blood flow numerical simulations, we developed a selected in vivo imaging technique for high - resolution vessel wall studies in conjunction with medical image - based cfd techniques to elucidate the relationship between the local hemodynamics, as a result of atherosclerosis of the small intracranial arteries, and the patient 's symptom presentation. data transfer and reconstruction of the 3d vessel geometry from the 3d angiography, which was obtained using an axiom artis dba (siemens medical solution, erlangen, germany,) were performed using mimics v10.2 software. the complex model was discretized into finite elements or volumes to strike a nontrivial balance between the solution accuracy and the computational effort. three dimensional computational meshes can be readily generated for arbitrarily complex geometries using widely available mesh generation tools such as hypermesh (altair engineering, inc., auckland, new zealand). computational analysis of the blood flow in the blood vessels was performed using the commercial finite element software adina version 8.5 (adina r & d, inc., blood flow was assumed to be laminar, viscous, newtonian and incompressible because of its inherent flow characteristics. no - slip boundary conditions were assumed for the flow viscosity produced between the fluid and the wall surface of the blood vessels. simulations were performed with the following material constants : the blood density was 1,100 kg / m and blood dynamic viscosity was 0.004 poiseuille. to achieve truly patient - specific modeling, the boundary conditions at the inflow boundary the unsteady flows in the internal carotid artery were computed over an interval of 3 cardiac cycles. the results corresponding to the third cycle were considered to be independent of the initial conditions and these were used for flow analysis. the velocity and flow rate of the internal carotid artery were obtained from gated phase contrast angiography (pca) in an age - matched male who did not have any intracranial vascular disease. the parameters for the gated pca synchronized to the heart cycle were the fast field echo sequence (ffe), repetition time (tr)/echo time (te) = 11/69 ms, flip angle = 15, field of view (fov) = 150 150 mm, matrix size = 340 312, sensitivity encoding (sense) factor = 3 and the number of excitations (nex) = 2. we measured the velocity (cm / s) or flow rate (ml / s) using the quantitative - flow software viewforum version r 5.1 (philips medical systems, best, the netherlands). the cfd results were incorporated into the high resolution mri obtained from the left m1. the mri scans were performed using a 3 tesla mri system (philips achieva, best, the netherlands) and a head and neck coil. the mri and mr angiography (mra) protocol included four different scans : three - dimensional time of flight (tof)-mra and the pre- and post - proton - density weighted images (pdwis). tof - mra was obtained in the axial plane and the data was reconstructed using a dedicated online post - processing tool to determine the blood vessel architecture. both the raw tof - mra data and the reconstructed blood vessel data were used for localizing the subsequent pdwis. the imaging parameters for the tof - mra scan were ffe, tr / te = 25/3.4 ms, flip angle = 20, fov = 250 250 mm, matrix size = 624 320, sense factor = 2 and nex = 1. the pd scan parameters were an se sequence, tr / te = 1000/20 ms, fov = 200 200 mm, matrix size = 512 494, sense factor = 2 and nex = 1. the scan time for each pdwi was 5 minutes 30 seconds. the pre- and post - pdwis were reconstructed to form oblique - coronal views through the vessel in order to localize the plaque longitudinally along the vessel. the reason we chose pdwi is to reduce the scan time as well as to see the t1 and t2 effects from one scan sequence because high resolution images are vulnerable to the patient 's motion during the long scan time. our institutional review board approved this study, and we obtained written informed consent from the patient and the patient 's family. we enrolled a 45-year - old male patient who presented with right arm weakness and he revealed an acute ischemic change in the perforator and borderzone types on the diffusion - weighted image (fig. 1a). the man had hypertension, diabetes mellitus and a history of coronary bypass surgery, and he was a smoker and alcohol drinker. 1b, c) in the anteroinferior portion of the left m1, as shown on the sagittal high - resolution 3d mri. 1e). the distribution of wss across the average systolic and diastolic blood pressures permitted construction of a contour map of the velocity in each cardiac cycle (fig. the average velocities at the carotid bifurcation in the systolic and diastolic phases were 0.73 m / s and 0.52 m / s, respectively. the wss obtained during the three phases of a cardiac cycle revealed that the highest wss was present during the peak systolic phase. a combination of the wss map and the mri coronal reconstituted image indicated that the highest wss corresponded to the most severe stenotic segment that included the enhancing plaque (fig. the maximum wsss of the stenotic portion of the vessel during the systolic and diastolic phases were 64 and 31.9 pa, respectively. the combined use of coronal reconstituted high - resolution mri and cfd could be helpful to explore the pathophysiology of cerebral infarction in acute stroke patients with severe middle cerebral artery stenosis. we demonstrated that cfd analysis of a small - caliber intracranial artery was feasible and this could be correlated with the atherosclerotic plaque in the stenotic segment, as was determined by high - resolution mri. the plaque shown on the sagittal high - resolution mri was clearly distinguished in the coronal reconstituted image and this was characterized by enhancement of the plaque 's smooth surface. thus, the mechanism of stroke in the patient studied here with severe m1 stenosis may have been related to erosion of the thick fibrous plaque cap atheroma as well as plaque encroachment on the perforator, rather than being related to plaque rupture. the borderzone infarct in our patient may have corresponded to thromboembolism that developed at the plaque surface under the influence of hypoperfusion. therefore, plaque rupture related to an unstable plaque, as in the carotid bulb plaque, was not a possible stroke mechanism in our study patient (3, 11). our study revealed that the most severe stenotic segment related to the fibrotic enhancement of a plaque in the stenotic intracranial artery showed high wss in the systolic phase of the cardiac cycle. although the high wss was related to the symptom presentation and it corresponded to a carotid plaque study in which the site of rupture was most probably in the wss region, erosion of the thick fibrous cap of the enhancing plaque was the most possible mechanism of stroke, which differed from the rupture of the carotid plaque in the highest wss region. this finding was associated with cfd and this may further elucidate the different pathophysiological mechanisms involved in the stenosis of the extracranial carotid and intracranial arteries. the sagittal high - resolution mris revealed that the most common plaque location was in the anteroinferior direction in our patient (12, 13). however, the sagittal images were limited in their ability to evaluate the entire plaque morphology in the longitudinal arterial lumen. the coronal reconstituted high resolution mri images generated in our study had the advantages of showing the enhanced fibrotic plaque in the most stenotic segment. thus, it was possible to correlate the high - resolution mri with the wss image. first, the exact localization of the cfd data compared to the high resolution mri can not be exactly matched because the coronal reconstituted image is generated obliquely according to the plaque location. second, image transfer from the 3d angiogram to the adina software required multiple steps and repeated time - consuming processes because such image transfer can not always be smoothly performed at the present time. if the 3d angiogram is directly transferred to cfd analysis software such as adina, then the cfd analysis will be more readily applicable. last, development of a stenotic model for cfd analysis is difficult and limited when compared to the aneurysm model because the lumen dimension in the stenotic segment can be lost during cfd data generation due to the limited image resolution in the stenotic segment. | the computational fluid dynamics methods for the limited flow rate and the small dimensions of an intracranial artery stenosis may help demonstrate the stroke mechanism in intracranial atherosclerosis. we have modeled the high wall shear stress (wss) in a severe m1 stenosis. the high wss in the systolic phase of the cardiac cycle was well - correlated with a thick fibrous cap atheroma with enhancement, as was determined using high - resolution plaque imaging techniques in a severe stenosis of the middle cerebral artery. |
acute pericoronitis (ap) is frequently seen in incompletely impacted third molars, and leads to a marked increase in bone resorption, although considerable radiologic changes may occur without notable symptoms, involving inclination of the tooth and the state of impaction after the usual age of eruption.1 moreover, the alveolar bone loss on the distal side of the second molar has been well described in horizontal impacted third molar, regardless of the presence of ap.27 on the other hand, a correlation between the inflammatory infiltrate and histological alveolar bone loss has been observed,8 and endothelial - derived cytokines,9 t cells,1013 mast cells,14 and interleukin-1 (il-1)15,16 may be involved in bone resorption. hou and colleagues17 noted that intact toll - like receptor (tlr) function mediates increased proinflammatory responses and bone destruction in response to mixed anaerobic infections, while there is a reduction of bone destruction in tlr4 - 17 and tlr2-deficient mice.18 moreover, a transient inhibition of bone formation during acute inflammation has also been shown.19 however, it remains to be determined whether the level of bone resorption is associated with the emergence of ap. we postulated that ap in young individuals differed from that in the elderly possibly due to chronic inflammation in aging leading to bone resorption. the objective of the present study was to clarify the relationship between the degree of radiolucency and acute inflammation with aging in mesio - angular incomplete impaction. radiological examination of the following was performed : 12 teeth of 12 young men (mean age sd : 19.8 1.5 years ; range : 1822 years), 32 teeth of 32 older men (mean age sd : 49.5 6.1 years ; range : 4167 years), 15 teeth of 15 young women (mean age sd : 20.0 1.5 years ; range : 1822 years), and 26 teeth of 26 older women (mean age sd : 50.5 8.6 years ; range : 4182 years). on initial examination, these patients had acute inflammation with spontaneous pain, redness, and swelling of the gingiva around incompletely impacted mesio - angular mandibular third molars. thirty - eight teeth of 30 young men (mean age sd, 20.2 1.3 years ; range : 1822 years), 51 teeth of 49 older men (mean age sd, 47.4 6.0 years ; range : 4168 years), 55 teeth of 47 young women (mean age sd, 20.5 1.3 years ; range : 1822 years), and 33 teeth of 30 older women (mean age sd, 47.7 6.2 years ; range : 4169 years) showed no features of inflammation. moreover, the patients did not have any history of acute inflammation of the third molars. these patients were referred to the department of oral and maxillofacial surgery, matsumoto dental university hospital, for diagnosis and treatment between april 1985 and august 2005. all patients with ap on initial examination were selected, and those without ap were classified based on the absence of acute inflammation on initial examination, as well as their response to a questionnaire regarding the absence of acute inflammation. all the participants were japanese, and all of them were covered by the japanese health insurance system. patients with the following conditions at the initial examination were excluded from the study : patients with apical radiolucency of the second or third molar, root fragment of the second or third molar, an unreadable crestal status because of teeth crowding between the second and third molars, restoration ending below the cemento - enamel junction of the second or third molar, cyst in the second and/or third molars, loss of the second molar, complete impaction of the third molar, a vertical third molar, distal inclination of the third molar, third molars with root curvatures angled more than 90 to the long axis of the tooth at the point close to the apex in the cervico - apical direction, and patients with immunosuppressive conditions, including aids. radiographs were obtained with an x - ray machine (morita corp., tokyo or asahi roentgen co., kyoto, japan) and ultra- speed dental film (eastman kodak, rochester, ny, usa) at 70 kvp and 20 ma in 0.32 s or insight dental film (eastman kodak) at 70 kvp and 7 ma in 0.16 s using the parallel technique. the bone crest of the distal aspect of the second molar, that of the proximal aspect of the third molar, and that of the distal aspect of the third molar are shown as points a, b, and c, respectively. the bone crest is shown by the point where the periodontal space becomes parallel to the root surface. resorption of the bone crest was assessed by visual observation using a millimeter ruler and 2 magnification. the radiographs were measured by the linear distance from the cemento - enamel junction to the alveolar crest and the cemento - enamel junction to the apex of both proximal and distal roots, respectively, and evaluated for the ratio of bone crest resorption against the root length from the cemento - enamel junction to the apex in the proximal and distal aspects of the third molar and the distal aspect of the second molar. measurement of radiograms were performed twice by the same oral surgeon ; the second time being performed after a period of few months without seeing the primary data. teeth with bone resorption which could not be measured, and thereby the length, at any point on either measurement were excluded from the study. mean values sd of the age and mean ratios of the bone crest in the distal aspect in the second molar and those in the proximal and distal aspects in the third molar were calculated and analyzed statistically using student t - test among patient groups with and without ap. mean values sd of the age and mean ratios of the bone crest in the distal aspect in the second molar and those in the proximal and distal aspects in the third molar were calculated and analyzed statistically using student t - test among patient groups with and without ap. bone resorption in the distal aspect of the second molar (a), proximal (b) and distal (c) aspects of the third molar in young men with ap was not different from those without ap. bone resorption in young adult women with ap was also not different from those without ap except in the proximal aspect of the third molar (b). bone resorption in older adult men and women with ap was significantly higher than those without ap at the points of a, b, and c, respectively (p < 0.0001, p < 0.001, and p < 0.01 in men, and p < 0.0001, p < 0.001, and p < 0.001 in women) (table 1) (figures 25). the level of bone resorption in the distal aspect of the second molars was 68% in older men, and 67.7% in older women, and significantly higher than those in the proximal surface (25.3%, p < 0.0001 in men, and 16.4%, p < 0.0001 in women, and distal (20%, p < 0.0001 in men, and 17.1%, p < 0.0001 in women) aspect with ap. the findings in older adults were similar to those in young adults with ap. in older adults without ap, bone resorption between the distal aspect of the second molar (42.2% in men, and 38.1% in women) and the proximal aspect of the third molar (9% in men, and 2.8% in women), showed a significant difference (p < the difference between bone resorption in the distal aspect of the second molar and the distal aspect of the third molar (6.3% in men, and 1.3% in women) was also significant (p < 0.0001 in both). no apparent difference was noted between bone resorption in the proximal and distal aspects of the third molar in both men and women. these findings were the same in young adults without ap. in adults with ap, bone resorption at the distal aspect of the second molar showed a significant difference (p < 0.0001 in men and women) between young and older adults, as well as at the proximal aspect of the third molar (p < 0.05). however, no apparent difference was noted between bone resorption at the proximal aspect of the third molar in young and older women. there were no differences in bone resorption at the distal aspect of the third molar between young and older adults (in both of men and women). in adults without ap, bone resorption at the distal aspect of the second molar between young and older adults showed significant difference (p < 0.01 in men and women). there was no difference in bone resorption at the proximal aspect of the third molar between young and older adults. no difference was seen in bone resorption at the distal aspect of the third molar between young and older adults. moreover, sd in these data in older adults was larger than that in young individuals. the present study included patients who had acute inflammation in the mesio - angular, incompletely impacted, mandibular third molars, and those without a history of acute inflammation, as assessed by a questionnaire. a remarkable increase in the mean depth of bone resorption was seen in incompletely impacted third molars at the points of a, b, and c in older adults with ap, unlike in young adults, except in the proximal aspect of the third molar in young women. older adults without ap showed significant bone resorption at point a compared to young adults (p < 0.01), and there were no differences at b and c. there seems to be not much difference compared to participants with ap. thus, increased radiolucency in individuals of middle or advanced age renders bone sensitive to infection. this is supported by the finding that t cells may regulate bone loss during chronic inflammation, as noted by rifas and colleagues.13 bone resorption, which seems to be an etiological factor leading to the emergence of current ap, is likely to be accelerated as a pronounced effect with aging, whereas there is a threshold age of 25 years for improvement of the alveolar bone level, as shown by kugelberg6 and blakey and colleagues.2 rapid progression of infection can be followed by absence of resistance due to loss of periodontal membrane around the crown of incompletely impacted third molars. these indicate that bone defects could allow pathogenic infection through the bone surfaces and/or reduce periodontal tissue defense. on the contrary, steady - state bone may maintain an anti - inflammatory state in older adults without ap, and resistance to ap could be demonstrated by the level of bone resorption. thus, bone resorption might be a factor for the prediction of risk of the emergence of ap in older adults, if pre - existing bone resorption due to chronic inflammation could effect a rise of ap. indeed, age - related decrease of bone of mandible20,21 has been well - known as a physiological consequence of aging, and cao and colleagues22 have shown that aging significantly increases stromal / osteoblastic cell - induced osteoclastogenesis, promotes expansion of the osteoclast precursor pool and alters the relationship between osteoblasts and osteoclasts in cancellous bone. however, the value of these findings for prediction of risk of acute inflammation is limited. bone resorption could be a response to ap, since ap contributes to not only the decrease in bone formation but also aggressive bone resorption. il-123,24 and tumor necrosis factor,23 cytosolic phospholipase a2-,25 prostaglandin e2 (pge2),26 cytokine signaling-1 and -3,27 pge synthases,28 and th129 have been viewed to promote severe bone resorption. the significant increase of bone resorption at all of the distal aspects of the second molar (a), and the proximal (b) and the distal (c) aspects of the third molar in older adults with ap compared with older adults without ap suggest a threshold for an increase of ap in a, b, and c ; with a having the most important association with an increase of ap. no differences were seen at b between young and older women with ap, and at c between young and older adults with ap. an increased bone resorption at a in older adults without ap was seen compared to young adults without ap (p < 0.01 in both men and women), which seems to show no significant difference between them, whereas, there were no differences regarding b in older and young adults without ap, and regarding point c in older and young adults without ap. these suggest that the effects of aging could be appended to a threshold for a rise of ap in a in the older adults. vertical bone resorption seen in a could be characterized by aging as shown in alveolar bone resorption of periodontitis, whereas ventro - dorsal directional bone resorption seen in b and c could not be influenced by aging. naturally, bone resorption in the mandible could not develop along the tooth axis but vertically with aging. thus, the elderly might be expected to develop ap and bone resorption when compared to young adults. various factors might define a threshold for the development of ap as a consequence of aging, since the elderly have latent instability of physiological capacity, and decreased protection from pathogens due to low immunological and neutrophil functions. it was also found that bone resorption at the proximal and distal aspects of the third molar with ap in the older adults showed a larger sd than bone resorption in young adults and bone resorption without ap, indicating a substantial proportion of the marked inter - individual variation in the mean depth of bone resorption in older adults with ap. this finding indicates that responses to chronic pericoronitis could be viewed as an inter - individual variability in immuno - inflammatory mechanism, biological aging as well as the individual s medical history. wide individual variation including other clinical correlations and genetic associations should be studied regarding the development of ap in the elderly, incorporating a longitudinal design to determine the prerequisites for ap. furthermore, the reasons for the significant increase of bone resorption at the proximal aspect (b) in young women with ap than without ap was unclear, although estrogen may exert its bone - sparing effects on periodontal tissues by altering the expression of inflammatory cytokines in human periodontal ligament cells.30 this finding may be the likely result of a temporal phenomenon seen in the young against stimuli of acute inflammation, or due to a statistical problem of a small sample. in conclusion, bone resorption was not related to acute pericoronitis in young individuals but related in older adults. incompletely impacted third molars with significant bone resorption should point to acute inflammation in the elderly, since ap might be associated with bone resorption. | acute pericoronitis (ap) arises frequently in incompletely impacted mandibular third molars, but it remains unknown whether bone resorption in aging is associated with acute inflammation of the third molar. we conducted an experiment to compare the ratio of bone resorption to root length in the distal surface of the second molar (a), the proximal surface (b), and distal surface (c) in mesio - angular, incompletely impacted third molars in 27 young and 58 older adults with ap and 77 young and 79 older adults without a history of ap. bone resorption in a, b, and c in older adults with ap demonstrated a significantly higher ratio when compared to those without ap, whereas there was no difference between those with and without ap in young adults except for b in women. however, there were no differences between bone resorption in b with ap in young and older women, and between bone resorption in c with ap in young and older adults. these indicate that ap and bone resorption are associated with incompletely impacted mandibular third molars in older adults. |
they are solid lesions with skinny or gray - brown color and rough surface with a few millimeters of diameter that are single or multiple. they can join together and form plaque and regular, bold and rough surface shapes. they are usually painless ; however, they are painful when they are cumulative or around the joints and nail or their surface are full of cleft (1). previous studies showed that the prevalence rate of warts is different based on different age groups, population and periods of time. in two studies, the prevalence rate was 0.84% in the us and 12.9% in russia (2, 3). in school children and young adults, the prevalence rate was 12% in the uk (4) and 24% in australia (5). warts are caused by epithelial cells infection with human papilloma virus (hpv) (6). human papillomavirus is a small double - stranded dna virus (55 - 50 millimicron), which can infect squamous epithelial cells and cause cell proliferation. this tumor is created by pleomorphic viruses and can be created in different areas such as hand and feet skin, genitelia skin and mucous, larynx and the mouth mucosa. however, viral replication happened in places where keratinocytes have fully differentiated such as layer cells (spinosum and granulosum) (7). these viruses replicate inside of the cells since they do not have cover, they are resistant to drought, freezing and solvents (8). based on the anatomical distribution, warts are found on the face, hands, nail, foot and genitalia. warts are contact and inoculated lesions and transmitted by an indirect contact with contaminated materials or walking barefoot. by aging resistance against hpv will develop. previous studies have shown that therapeutic methods such as using salicylic acid, cryotherapy, hydroxychloroquine and zinc are effective on warts, but for cimetidine, levamisole or homeopathy consistent evidence was not found (9 - 12). gibbs and harvey in a review study for the topical treatment of warts concluded that only 12 of the 50 studies were of high quality (13). also, several systematic therapeutic methods were used for warts ; however, there are not sufficient evidence - based data on their effectiveness. the local people of baneh city in some areas have used contraceptives such as hd tablets for topical treatment of warts. the hd tablet is containing 50 mcg ethinylestradiol and 250 mcg levonorgestrel (or l - norgestrel or d - norgestrel). estrogens by binding to estrogen receptors in the cytoplasm increase the rates of dna and rna and other proteins construction in target tissues. it has very strong progesteronic effects, weak androgenic effects and very weak mineralocorticoid effects. levonorgestrel is the most widely used progestin in iran and the world (14). estrogen takes into account as mitosis and cell proliferation stimulating factor and in many cells prevents cell death. high dose of estrogen has caused regression of the hormone - dependent breast cancer in the postmenopausal age. in laboratory studies, it has been shown that the apoptotic effect of estrogen is an important factor in reducing the number of some of the cells (15). regarding the above and experiences of local people in topical use of hd tablets to cure warts, this clinical trial study was designed and conducted to investigate the use of this drug for wart treatment scientifically. this study aimed to assess the efficacy of a new method for the treatment of dermal warts. this clinical trial study was conducted on people (older than 10 years) living in baneh city, west of iran, who had warts on their skin in 2012. inclusion criteria included persons who had not received any drugs for their wart treatment in the past two months. a written informed consent was obtained from the subjects or their parents to participate in the study. this study was approved by the ethics committee of kurdistan university of medical sciences (14/3755 date 2011 jul) and had been recorded in iranian registry for clinical trials with registration number : irct138712171750n1. the sample size was 60 patients, 30 people in the estrogen group and 30 in the placebo group. photographs were taken from the warts of the intervention group using a digital camera then horny layer of the dermal wart carved using a scalpel and the hd tablet (ld norgestrel 0.5 mg and ethinylestradiol 0.05 mg) set on it and was covered with adhesive. in the second and third day patients wart status in both groups was examined one week and one month after taking the last tablet by the physician in terms of improvement or lack of improvement. data were analyzed using spss software version 18, chi - square test, fisher s exact test, mann - whitney test and anova for repeated measures. results of this study showed that there was no significant difference between the two groups in terms of gender and location of warts (p > 0.05). in terms of change in the first week after the intervention, results showed that in 93.3% of the patients of the intervention group the warts were changed, but the control group (placebo group) showed no changes. also, in follow - up one month after the intervention, 73.3% of the warts in the intervention group were removed, whereas in the control group, warts were not removed (p = 0.0001). based on anova for the repeated data, the mean number of warts before, one week and one month after the intervention in the intervention group were 6.0 5.1, 1.9 1.2, and 0.4 0.7 and in the control group were 5.3 5.1, 5.4 5.0, and 5.5 4.9, respectively (p = 0.009). also, based on t - test, the mean number of warts in one week and one month after the intervention in both groups were significantly different (p = 0.0001). (%) or mean sd. the values are presented as mean sd (median). the main goal of this study was to determine the therapeutic effect of topical application of hd tablets on dermal warts. in this regard, this method is important because none of the treatment methods used to remove dermal warts had been completely effective. moreover, treatment of dermal warts has more complications, while with hd the treatment would be more cost - effective with less complications. our findings showed that in the first week after the intervention, in 93.3% of the patients in the intervention group, warts changed ; however, there was no change in the warts status in the control group. in the intervention group, 73.3% of warts were removed one month after the use of hd tablets, whereas in the control group no warts disappeared. in addition, in the intervention group, the mean number of warts in one week and one month after the treatment was reduced significantly compared to the placebo group. no side effects were observed in the participants of the study. according to studies about the mechanism of the treatment effect on cell proliferation of breast cancer with estrogen therapy, it seems that in case of creating local concentrations of estrogen in the region, the cells undergo apoptosis. in this study, we observed that in the hd group, by placing hd tablet on sore, some of wart surface tissues became necrotic and finally the entire wart became necrotic and removed without leaving scar ; therefore, we can say that the skin warts have improved by a similar mechanism. limitations of this study include : lack of similar studies about the use of medications such as estrogen and progesterone in the treatment of skin diseases as well as problems of follow - up of the study subjects in the villages, also the less experienced researchers, and demographic data and patients history of treatment duration were not fully recorded. owing the effectiveness of topical treatment of dermal warts using hd tablets, short duration of the treatment and low cost, this method is recommended for the treatment of dermal warts. | backgroundwarts are common dermatological lesion caused by skin epithelial cells infection with human papillomavirus (hpv).objectivesthis study aimed to assess the efficacy of a new method for the treatment of dermal warts.patients and methodsin this clinical trial study, 60 patients (older than 10 years) with dermal warts living in baneh city, west of iran, were allocated into the intervention and control groups using the block randomized method in 2012. in the intervention group, outer layers of the dermal wart carved using scalpel and hd tablet set on it and covered with adhesive. in the second and third days, it was repeated again. all stages in the intervention group were similar to the placebo group. placebo was prepared by a pharmacologist, which was similar to the hd tablet. in both groups, patients were examined one week and one month after taking the last tablet by the physician in terms of improvement or lack of improvement. data were analyzed by spss software version 18 using chi - square test, fisher s exact test, mann - whitney test and anova for repeated measures.resultsin the first week after the intervention, warts were changed in 93.3% of the cases ; however, no changes were recorded in the control group. one month after follow - up, the mean was 0.4 0.7 in the intervention group and 5.5 4.9 in the control group (p = 0.0001). based on anova for repeated measures and t - test, the average number of warts, before, one week and one month after the intervention was statistically significant for both intervention (p = 0.009) and control groups (p = 0.0001).conclusionsthis method is recommended for the treatment of dermal warts, owing to the effectiveness, short duration of treatment, and low cost of topical treatment for dermal warts using hd tablets. |
a 10-year - old child was brought by his parents for a symmetrical thickening and scaling on its hands, feet, and knees. the child had a history suggestive of erythroderma in its first week of birth, which gradually developed into symmetrical lesions that had progressed until the present time. he also had delayed intellectual milestones and had a history of convulsions, which on evaluation, had not been explained sufficiently. we report an unusual case of progressive symmetric erythroderma (psek) with neurological involvement. a 10-year - old boy was brought to this clinic (sv) by his parents who were concerned about the rough, dry, and scaly skin over both his hands and feet, which always seemed worse during winters. the boy was born by normal vaginal delivery, had neonatal jaundice at birth, and was given phototherapy. the parents said that they had noticed scaly, wrinkled, and reddish skin, which the child shed when about a week old, and this was followed by wrinkled, thickened, scaly, and reddish skin in very well - demarcated areas of the hands and feet in a couple of weeks after birth. he also had profuse scaling of the scalp and had no hair at the time of birth. the obstetrician had told the parents that he may be a mongoloid child and that he should be followed up. three weeks after birth the child started shedding skin all over the body and was treated with simple emollients. the hyperkeratotic areas increased gradually for the first two - to - three years of life and then became static. on examination the skin over both his hands and forearms was scaly and thickened in a well - demarcated manner, almost like gloves and socks, with the hyperkeratosis and scaling extending along the medial aspect of the forearm up to the elbows, where it abruptly ended [figures 13 ]. similarly he had thickened scaly skin over the dorsa of both feet, extending about 4 cm above the malleoli in the socks area. erythema was not appreciated in the lesions, except until he was two - to - three years old. the palms and soles were mildly thickened, but there was no fissuring or scaling. he had undergone neuropsychiatric evaluation twice and was found to be two years younger than his chronological age, however, exact documentation was not available and a suggestion to get a re - evaluation done was taken negatively by the parents. he had generalized convulsions for the first time when he was two - and - a - half years of age and was put on sodium valproate. he had convulsions about once a year, and it was invariably when the parents tried to wean him off sodium valproate. a biopsy of the lesion on his hand showed sparse superficial perivascular lymphocytic infiltrate in the dermis, with slight epidermal hyperplasia. the epidermis showed acanthosis in some areas, mild focal spongiosis with an intact granular layer and a moderately thickened stratum corneum showing lamellated hyperkeratosis, with parakeratosis being visible only in some fields [figure 4 ]. on the basis of the clinicopathological correlation, a diagnosis of progressive symmetric erythrokeratoderma (psek) was made. symmetrical hyperkeratosis with scaling over both hands extending medially up to the elbows symmetrical hyperkeratosis with fine scales over both feet, up to the ankle, in the socks area symmetrical hyperkeratosis with accentuated creases over both knees lamellated hyperkeratosis, intact granular layer, acanthosis, and mild spongiosis, with mild perivascular lymphocytic infiltrate he is under treatment with salicylic acid ointment and a urea - based cream, with marginal improvement. taking his young age into consideration the parents did not allow administration of oral retinoids. progressive symmetric erythrokeratoderma is a rare type of erythrokeratodermia inherited in an autosomal dominant fashion in about 50% of the cases. the entity is characterized by non - migratory, erythematous or hyperpigmented, symmetric plaques that are usually distributed on the extremities, buttocks, and sometimes the face. orthokeratosis, orthohyperkeratosis with focal parakeratosis, a well - preserved granular layer, psoriasiform hyperplasia without thinned suprapapillary plates, and a perivascular infiltrate of lymphocytes in the upper part of the dermis, have all been reported.[14 ] associated neurological abnormalities, including deafness, have been described rarely, as seen in this case. progressive symmetric erythrokeratoderma is clinically different from erythrokeratoderma variabilis (ekv) first described by mendes da costa) its closest differential diagnosis, by well - demarcated non - migratory erythematous plaques in contrast to the migratory plaques seen in the latter. the erythema component of the erythrokeratoderma seems not to be relevant to populations with type iv vi skin, as the erythema is not easily appreciated on dark skin, as is evident from many other dermatoses in these populations. the candidate gene for ek - related mutation is connexin (con).[710 ] con mutations result in disturbed cell cell communication due to faulty gap junctions. con mutations have been identified in both the psek and ekv families, including con 31 (gjb3) and con 30.3 (gjb4). on the other hand, a 27-year - old female psek patient from japan and her family were analyzed for loricrin (lor) mutations. indeed, the authors could detect a single - base - pair insertion of a c following nucleotide 709 leading to a frame shift into the missense amino acids and the addition of further 65 amino acids to the molecule. recent investigations suggested that the lor mutation in the case described above might be due to the occurrence of the vohwinkel 's syndrome in the same family, and psek was not associated with the lor mutations at all. we are unable to explain the delayed milestones, learning disability, and convulsions in this case, although there are only scattered reports of neurological involvement in the erythrokeratodermas.[15 ] therefore, the occurrence of neurological symptoms may just be a coincidence. topical emollients and salicylic acid ointment, along with urea, was the recommended treatment, but was only of marginal benefit in the present patient. | progressive symmetric erythrokeratoderma is an uncommon genodermatosis and is thought to arise due to mutations in the connexin gene, however, genetic heterogenicity has been described. very few cases of neurological involvement have been described in this unusual entity. we report a case of progressive symmetric erythrokeratoderma, with convulsions and delayed intellectual milestones. |
we performed a retrospective cohort study using data collected by the palo alto medical foundation toxoplasma serology laboratory (pamf - tsl ; www.pamf.org), palo alto, california, usa, during 19912010. patient blood samples were sent from diverse laboratories from throughout the united states, and testing was conducted at the pamf - tsl. the study was approved by the institutional research board at the pamf research institute. from the pamf - tsl database, we identified families that 1) had an index case - patient with a diagnosis of acute toxoplasmosis and 2) had > 1 additional household / family member who had been tested for t. gondii infection at pamf - tsl. details of the process used to identify additional household / family members are described in the technical appendix. all identified family / household members were categorized as acutely infected (12 months before sample collection time) ; or never infected. these criteria are routinely used in the daily clinical practice at pamf - tsl to estimate the most likely time of the t. gondii infection ; the accuracy of these criteria has been previously validated (711). group 1 consisted of families with an index case - patient who had acute toxoplasmosis and > 1 additionally tested family / household member who had acute or recently acquired t. gondii infection. group 2 consisted of families with an index case - patient who had acute toxoplasmosis ; > 1 additionally tested family / household member who had chronic t. gondii infection ; and no other tested household members who had evidence of acute or recently acquired t. gondii infection. group 3 consisted of families with an index case - patient who had acute toxoplasmosis and in which no additionally tested family / household members showed evidence of t. gondii infection. we defined as prevalence of acute t. gondii infection in > 1 family members (prevalence of group 1 families) the number of group 1 families divided by the total number of study families over the 20-year study period (primary endpoint). as secondary endpoint we also tested whether the igg - dye test titers and igm - elisa titers of the index case - patients were different across the 3 family groups by using the kruskal - wallis test. all analyses were done in stata / se version 12 (statacorp lp, college station, tx, usa). among 97,279 persons serologically tested for t. gondii in the pamf - tsl over the 20 year study period, we identified 107 persons who had > 1 person from their household with a diagnosis of acute toxoplasmosis and > 1 additional household member serologically tested for t. gondii infection. patient demographic and clinical characteristics are shown in table 1 ; serologic test results for members of group 1 families are shown in table 2, appendix, and for members of groups 2 and 3 families in the technical appendix. flowchart for the identification of families with an index case - patient who had acute toxoplasmosis and > 1 family member with acute or recent toxoplasma gondii. data were extracted from the database of the palo alto medical foundation toxoplasma serology laboratory (pamf - tsl ; palo alto, ca, usa), from patient samples sent to pamf - tsl during 19912010 from laboratories throughout the united states. mother - infant pairs were counted as 1 unit / household member ; infection status of these is shown in parenthesis. ic, index case - patient ; ln, lymphadenopathy ; na, not available ; nr, not reported ; af, amniotic fluid ; r / o, rule out ; ct, congenital toxoplasmosis ; csf, cerebrospinal fluid. infant with ct with hydrocephalus, high bilirubin, abnormal liver function tests, low platelets, and positive pcr results on csf. interpretation of results : igg dye test, positive > 16, negative 2.0, equivocal 1.71.9, negative 2.1, equivocal 1.52.0, negative 1.4 ; ige elisa, positive > 1.9, equivocal 1.51.8, negative 30. the categorization of ac / hs test results into acute, equivocal, and nonreactive is available at www.pamf.org/serology/images/achs_grid.html. ac / hs, differential agglutination ; ic, index case - patient ; ln, lymphadenopathy ; nd, not done ; isaga, immunosorbent agglutination assay ; na, not ascertained ; af, amniotic fluid ; ct, congenital toxoplasmosis. serologic test results, despite equivocal ac / hs, were consistent with acute infection in ic4 and ic15 and recent infection in daughter 1 of ic10 and ic16. pregnant woman who was serologically tested for toxoplasmosis because of her husband s toxoplasmic lymphadenitis. the prevalence of group 1 families in our study was 56% (18/32) ; group 2 families, 16% (5/32) ; and group 3 families, 28% (9/32) (figure). the igg - dye test and the igm - elisa titers of the index case - patients were not significantly different across the 3 family groups (p = 0.27 for igg and p = 0.07 for igm) (table 2, appendix ; technical appendix). for group 1 families, all additional family members with acute / recently acquired infection had serologic profiles (titers of igg, igm, and/or iga / ige and avidity) that were similar to those of the index case - patients, indicating that they were infected at about the same time (table 2, appendix). our data provide preliminary evidence that multiple cases of acute t. gondii infection may occur among family / household members. these findings are particularly critical for persons at high risk from t. gondii infection, such as women who are or may become pregnant or immunocompromised persons. interpretation of our study findings would have been clearer had the background prevalence of acute toxoplasmosis in the united states been known. although no such population - level empirical data exist, we have identified at pamf - tsl 889 patients with acute t. gondii infection over the 20-year study period (estimated prevalence 9/1,000 patients screened at pamf - tsl ; unpub. a limitation of our study is that the families tested at pamf - tsl over this study period might represent a group in whom the prevalence of acute t. gondii infection in > 1 family member has been overestimated. only 4% of persons who had acute toxoplasmosis diagnosed at pamf - tsl during the 20-year study period had samples sent from additional household members for t. gondii testing (32 index case - patients with acute toxoplasmosis/889 acute infections). the collection of those additional samples depended solely on the response of the referring physicians to a 1-time written request for testing of additional family members. it is possible that the response of the primary care providers to this request would have been more likely if any of those additional family / household members had symptoms suggestive of acute toxoplasmosis. in addition, the igg - dye test and igm - elisa titers of the index case - patients did not predict which families would have additional household members with acute toxoplasmosis. further replication of the estimated prevalence of acute t. gondii infection in consecutive us families is needed. future studies might also compare the t. gondii serotypes among index case - patients and family members (type ii vs. non type ii) (12), which could help clarify whether certain serotypes are more likely to be associated with family outbreaks. moreover, it would be useful to screen for antibodies to sporozoite - specific antigens (13), which can provide further insight regarding the source of t. gondii infection that is more likely to be associated with acute toxoplasmosis in > 1 family member (e.g., sporozoite - specific, related to contact with cat feces, vs. bradyzoite - specific, related to ingestion of undercooked meat). when a case of acute toxoplasmosis is diagnosed, screening of additional family members should be considered, especially if pregnant women or immunocompromised patients live in those households, so that appropriate preventive strategies and/or therapeutic interventions are applied. these within - family clusters of cases are not easy to predict based solely on clinical or epidemiologic information, except for situations of sharing common meal (i.e., with undercooked meat), because it is unlikely that other risk factors would be different. thus, only routine serologic screening of household members of acutely infected persons might identify such acute t. gondii infections. supplementary methods and results from study of families of persons with acute toxoplasmosis using data collected in the palo alto medical foundation toxoplasma serology laboratory, palo alto, california, usa, from patient samples sent to pamf - tsl during 19912010 from laboratories throughout the united states. | we investigated 32 families of persons with acute toxoplasmosis in which > 1 other family member was tested for toxoplasma gondii infection ; 18 (56%) families had > 1 additional family member with acute infection. family members of persons with acute toxoplasmosis should be screened for infection, especially pregnant women and immunocompromised persons. |
tufted angioma (ta) is a rare vascular tumor most commonly localized to the skin and subcutaneous tissue, characterized by slow angiomatous proliferation. the term ta was coined because of the characteristic dense clumps and lobules of endothelial cells and capillaries observed on histology. it is a variant of capillary hemangioma and supported by the finding of characteristic crystalline lamellae in both of them. it may be evident at birth, but usually develops during late infancy or adolescence. a 2-year - old boy presented with coalescing, red - purple, firm plaques with irregular borders and few superimposed papules extending from the right retroauricular region to his neck and upper trunk. his mother gave a history that the child initially had a small erythematous macule behind the right ear at 9 months of his age, which gradually progressed to multiple plaques, extending on to the neck and front of the chest. on examination, the plaques were deep red in color with few areas of violaceous discoloration and telangiectasia at the margins involving approximately 7 12 cm area from right ear to right anterior chest [figure 1 and 2 ]. routine investigations including hemogram, liver and renal function tests, and chest x - ray were within normal limits. histopathology revealed a normal epidermis with the dermis showing proliferating capillaries forming into nodules lined by endothelial cells [figure 3 and 4 ]. red to purple colored plaque of tufted angioma over the right side of neck tufted angioma involving neck and extending on to chest photomicrograph showing lobules of proliferating capillaries (h and e, 10 10) higher magnification of the proliferating capillaries (h and e, 10 40) ta, also called angioplasty of nagakawa, is a very rare pattern of angioma. some cases have been reported in a familial pattern and a few in pregnancy which resolve after delivery. it usually starts as a small macule, which resembles a port wine stain and progresses to deep red to purple plaques or nodules of 210 cm size. in the present patient, the most common sites of involvement are the neck, shoulder, or upper trunk, and occasionally the proximal limbs. ta is a benign condition, pain and tenderness are common associated symptoms, and hyperhidrosis is a frequent finding that occurs in 30% of patients. in a review of 13 cases of ta, the author observed three different clinical patterns : ta without complications, ta without thrombocytopenia but with chronic coagulopathy, and ta complicated by kasabach - merritt syndrome with thrombocytopenia. when the onset is later, partial spontaneous regression of ta may occur but complete disappearance is extremely rare. pulsed dye laser has been reported as an option for treatment of ta associated with pain. our patient had classic clinical features of indurated red to purple plaques and typical histological picture of nodules of proliferation of capillaries lined by endothelial cells and no mitoses, consistent with a diagnosis of ta. this case of ta involving large areas of skin over the head, neck, and chest is reported for its rarity. | tufted angioma (ta) is a rare, benign, cutaneous angiomatous proliferation. it is more common in children, usually presenting as red - purple painful plaques on the trunk. we describe here a ta observed at nine months of age, appearing initially over the retroauricular area, gradually extending to involve skin of neck and trunk by two years of age. this case of a large ta (7 12 cm) in an indian male child is reported here due to its rare presentation. |
cystic fibrosis (cf) is a genetic disease, with a chronic evolution, that compromises the normal function of various organs and systems. it is characterized by changes in the secretions of the respiratory and gastrointestinal tract. it is most common (at 1/3,500 live births) in the white population. it is a progressive condition in which lung disease is the major determinant of morbidity and mortality. due to advances in the treatment and understanding of cf, there has been a significant increase in life expectancy of individuals suffering from the disease. in europe estimates showed that subjects born after 2000 will have a life expectancy of over 50 years of age. however, the progressive decline in lung function over time appears to be an inevitable characteristic of the disease in nearly all cases. therefore, impaired lung function, as quantified by measuring fev1, expressed as a percentage of the predicted value, is one of the main markers affecting clinical decision making about changing or intensifying the treatment regimens employed in cf patients. in recent decades, the fev1 of subjects with cf has been studied in order to gain a better understanding of the progression of the associated lung disease and to identify risk groups in which more aggressive therapy is indicated. a decline in fev1 has been reported to be a marker of greater risk of hospitalization and death in subjects with chronic obstructive pulmonary diseases, as well as being considered the best single indication for lung transplantation. previous findings have shown that 80% of cf - related deaths are directly or indirectly associated with reduced lung function. the risk factors most commonly associated with a progressive decline in fev1 among cf patients include advanced age, female gender, a f508 mutation in the cf transmembrane conductance regulator, the presence of modifier genes, pancreatic insufficiency, low nutritional status, diabetes mellitus, and colonization of the respiratory tract by pseudomonas aeruginosa or burkholderia cepacia. in addition, daily production of sputum, wheezing, and the number of lung exacerbations treated with intravenous antibiotics also seem to be related to a decline in lung function among cf patients. the significance and magnitude of the effects of these factors seem to depend on patient age. furthermore, recent findings suggest that a reduction in the six - minute walk distance (6mwd) is associated with greater severity of lung disease. although studies have demonstrated that acute exacerbations in cf patients do not modify the coefficient of variation for lung function measured over the course of the same day, other studies have shown that such exacerbations do significantly reduce spirometric values if measured over the course of a year. however, there is still little information on how the variation in lung function over one year can influence the pulmonary and functional decline associated with the disease in subsequent years. it would be useful to identify additional factors that might help predict lung function decline in the early stages of cf, given that, in many cases, fev1 becomes abnormal only in the advanced stages of the disease. therefore, the objective of the present study was to determine whether variation in lung function over the course of one year is associated with worse clinical outcomes and lung function decline in subsequent years. we included subjects with a diagnosis of cf, as confirmed by sweat chloride or genetic testing, who were 4 - 19 years of age and had been treated at the cystic fibrosis outpatient center of the so lucas hospital of the pontifcia universidade catlica do rio grande do sul (pucrs, pontifical catholic university of [the state of ] rio grande do sul), located in the city of porto alegre, brazil. during the period under study, once every three months, each patient underwent clinical evaluation and pulmonary function testing, at which time samples (oropharyngeal swab or sputum samples) were collected for culture. the principal criterion for inclusion was having undergone pulmonary function testing (spirometry) at least three times in the first year (each set of tests having been performed at least three months apart) and at least once in each of the two following years. in addition, we included only individuals for whom the spirometric values were acceptable and reproducible according to international guidelines, including those established for preschool - age children. the variation in fev1 (fev1) in the first year was calculated by the following formula : fev1 = (hifev1 lofev1) / hifev1 where hifev1 is the highest fev1 (% of predicted) and lofev1 is the lowest fev1 (% of predicted). if a subject underwent pulmonary function testing more than once in the second or third year, we selected the best spirometric result obtained, meaning the highest fev1 (in percentage of the predicted value), in each year evaluated. for each subject, we collected demographic data (age, gender, and race) and anthropometric data, as well as information related to chronic infection with p. aeruginosa, number of days using antibiotics (oral. chronic p. aeruginosa infection was defined as persistent p. aeruginosa infection for at least six consecutive months (three consecutive tests), as determined by culture of oropharyngeal swab or sputum samples (depending on age or clinical status). to facilitate further analysis, antibiotic use and hospitalization were evaluated as dichotomous variables (antibiotic use, yes / no ; hospitalization, yes / no). in addition, we collected data on pulmonary function test (spirometry) results and 6mwd. furthermore, we determined the rate of fev1 decline by subtracting the best third - year fev1 from the best first - year fev1. the data were entered into a database, stratified by year (first, second, and third year). pulmonary function tests were performed with a koko spirometer (pds instrumentation, inc., all procedures were performed in accordance with the criteria established by the american thoracic society. the six - minute walk test (6mwt) was performed in accordance with the american thoracic society guidelines. the parameters evaluated in the test included heart rate ; spo2, measured with a pulse oximeter (palmsat 2500 ; nonin medical, plymouth, mn, usa) ; blood pressure, measured with a sphygmomanometer (tycos ce0050 ; welch allyn, skaneateles falls, ny, usa) ; respiratory rate, counted as chest wall excursions per minute ; and the modified borg scale score, to quantify the perceived intensity of dyspnea. subjects were instructed to walk as quickly as possible for six minutes in a 30-m corridor. the 6mwd was calculated by counting the total number of turns made during the test and is expressed in meters. like fev1, the 6mwd was considered normal if 80% of the predicted value. sample size was estimated based on the behavior of the main variables of interest (fev1 and 6mwd). adopting a level of significance of p = 0.05, a power of 80% and a minimum correlation of 0.40, we estimated the minimum sample size to be approximately 32 subjects. the fev1 in the first year was calculated as described above. because fev1 in the first year had a skewed distribution, we applied square root transformation of the data. categorical variables are presented as absolute and relative frequencies. in order to analyze differences in the fev1 in the first year in relation to the main clinical outcomes assessed in the two subsequent years (rate of fev1 decline, hospitalization, 6mwd, absolute fev1, and antibiotic use), we used the student 's t - test for independent samples. we also used a stepwise multiple linear regression model to assess the influence that potential predictor variables (age, gender, body mass index, chronic infection with p. aeruginosa, absolute fev1 at baseline, and fev1 in the first year) had on the rate of fev1 decline. data were processed and analyzed with the ibm spss statistics software package, version 18.0 (ibm corporation, armonk, ny, usa). in all tests, values of p < 0.05 were considered statistically significant. consequently, the final study sample comprised 35 subjects, of whom 19 (54.2%) were male. the majority of patients presented anthropometric values within the normal ranges. in general, the sample presented with mild impairment of lung function. the demographic, anthropometric, and clinical characteristics of the sample are shown in table 1. table 1characteristics of the study sample at baseline. characteristic(n = 35)age (years)11.3 ? 3.8 (4.74 - 19.7)male, n (%) 19 (54.2)white, n (%) 31 (88.5)weight (kg)39.3 ? 13.4 (19.4 - 63.7)height (cm)142.2 ? 19.3 (104.0 - 178.5)bmi (kg / m absolute18.9 ? 2.6 (15.0 - 24.6)percentile57.5 ? 31.5 (9.0 - 99.0)lung function fev1 (l)1.9 ? 0.8 (0.72 - 4.28)fev1 (% of predicted)84.7 ? 22.1 (40.6 - 121.0)fvc (l)2.4 ? 1.0 (0.99 - 4.47)fvc (% of predicted)93.4 ? 17.7 (55.0 - 125.6)fef25 - 75% (l)1.8 ? 1.0 (0.33 - 5.80)fef25 - 75% (% of predicted)70.7 ? 35.2 (14.8 - 150.2)chronic bacterial infection pseudomonas aeruginosa, n (%) 12 (34.2) burkholderia cepacia, n (%) 2 (5.7) staphylococcus aureus, n (%) 17 (48.5)genotype with at least one f508 allele, n (%) 13 (81.2) pancreatic insufficiency, n (%) 30 (85.7) bmi : body mass index. as can be seen in figure 1a, that variation was significantly greater among patients who required hospitalization in the third year than among those who did not (p = 0.03). figure 1b shows that the mean fev1 in the first year was also significantly greater among patients in whom the 6mwd in the third year was below normal than among those in whom it was normal (p = 0.02). in addition, the mean fev1 in the first year was significantly greater among the patients who showed lower fev1 values in the third year (p = 0.03 ; figure 1c). however, regarding the use of antibiotic therapy (figure 1d), the mean fev1 in the first year did not differ significantly between the patients who were treated with antibiotics in the third year and those who were not (p = 0.44). figure 1variation in fev1 (fev1) in the first year, in relation to the following variables in the third year : hospital admission (a) ; six - minute walk distance (b) ; fev1, as a percentage of the predicted value (c) ; and antibiotic use (d). p < 0.05. among the patients who showed a 10% fev1 in the first year, the rate of fev1 decline over the two following years was significantly greater than among those who did not (p = 0.04 ; figure 2). in addition, we identified a significant negative correlation between fev1 in the first year and absolute fev1 (% of predicted) in the third year (r = 0.340, p = 0.04), demonstrating that greater variation in lung function in the first year translated to lower fev1 in the third year (figure 3a). likewise, there was a significant negative correlation between the fev1 in the first year and the rate of fev1 decline over the two following years (r = 0.52, p = 0.001 ; figure 3b). figure 2comparison of the rate of fev1 decline between subjects with low and high variation in fev1 (fev1) in the first year. p = 0.04. figure 3variation in fev1 (fev1) in the first year, correlated with fev1 (% of predicted) in the third year (a) and with the rate of fev1 decline (b). the stepwise multiple linear regression model, which included age, gender, body mass index, chronic infection with p. aeruginosa, fev1 (% of predicted) at baseline, and fev1 in the first year (table 2), revealed that fev1 in the first year was the only significant predictor of the rate of fev1 decline over the two following years (p = 0.001). the model showed that fev1 in the first year explained 27% of the subsequent rate of fev1 decline. table 2multiple linear regression of the rate of fev1 decline over the course of two years (the second and third years of the study period).parameterbstandard error of b95% ci pr minimummaximumconstant12.0146.4151.03625.065 variation in fev1 in the first year (%) 53.49415.32384.66822.3190.0010.27b : unstandardized coefficient ; and r : coefficient of determination. the results of the present study suggest that, in children and adolescents with cf, a greater fev1 over a one - year period is associated with a more pronounced decline in lung function and worse clinical outcomes over the subsequent years. in addition, although the subjects evaluated here showed only mild impairment of lung function and preserved nutritional status, the fev1 was found to be a predictor of progressive pulmonary decline, indicating that, even in the early stages of cf progression, quantification of this parameter can facilitate clinical detection of the disorder. reduced lung function, as identified by the measurement of fev1, seems to be associated with higher mortality in cf. however, in many cases, lung function decreases only in the advanced stages of the disease. the findings of the present study demonstrate that subjects who showed greater variation in fev1 over a one - year period had a greater decline in lung function over the next two years of monitoring. however, the correlation was not strong, which might be explained by the fact that the study sample was composed of young subjects with preserved nutritional status and mild pulmonary impairment. in addition, our findings show that there was a moderate correlation between the fev1 in the first year and the rate of fev1 decline over the two following years, indicating that greater variation in lung function over a one - year period translates to a higher rate of decline in lung function in subsequent years. in a previous study, fev1 variations 13% were found to be predictive of more rapid clinical progression of lung impairment in cf, and lesser changes were attributed to normal fluctuations in the test. however, other studies have suggested that better lung function is associated with greater variability on the test. subjects for whom the fev1 in the first year was greater showed a reduction in lung function over the next two years of monitoring. that finding demonstrates that, although the determination of fev1 is considered a useful tool for monitoring the progression of pulmonary impairment in patients with cf, calculating the fev1 could be a complementary monitoring tool, given that it could be used earlier than can the measurement of fev1 at a single time point, because, in many cases, the latter is associated with increased mortality only in the advanced stages of the disease. in the present study, the subjects who showed a 10% fev1 in the first year presented a more pronounced decline in fev1 over the two following years. as previously mentioned, the multiple linear regression model showed that 27% of the rate of fev1 decline over the next two years of monitoring could be explained by the fev1 during the first year. this result highlights the importance of assessing the variation in lung function over a relatively short period of time, given the observed decrease in lung function thereafter. therefore, we believe that such assessment can represent an additional, useful tool for monitoring disease progression in cf, because an isolated reduction in fev1 is often seen only in the advanced stages of the disease. nevertheless, when analyzing the data on variability, we found that approximately 46% of our subjects had a low baseline fev1, with a consequent increase in fev1 over the first year, showing that this parameter indicates the variability in lung function in general, rather than specifically indicating the progressive decline expected in cf. on the basis of a recent review of the literature, we believe that this is the first study to show that short - term variation in lung function is associated with worse clinical outcomes over time in cf patients. our findings demonstrate that subjects who showed greater fev1 in the first year were more likely to require hospitalization in the third year. these findings corroborate those of previous studies showing that pulmonary exacerbations cause a decline in lung function over time and that a decline in fev1 is associated with the severity of pulmonary exacerbations, requiring hospitalization and intravenous administration of antibiotics. in addition, a decrease in fev1 seems to be a predictor of hospitalization and mortality in cf, and we found that fev1 over a one - year period had a similar relationship with cf outcomes in the present study. previous studies have found an association between the use of antibiotics and a decline in lung function in patients with cf. in the present study, we found no statistically significant correlation between fev1 in the first year and antibiotic use. that might be attributable to the small size of our sample and the short study period. other authors have shown that the use of intravenous antibiotics to treat pulmonary exacerbations is a risk factor for the decline in lung function over time in cf patients. in addition, it has been suggested that consecutive exacerbations over a short period of time contribute to the progression of lung disease. furthermore, one previous study demonstrated that the occurrence of three pulmonary exacerbations per year increases the risk of a decline in fev1 by approximately 5%. the 6mwt is featured as an important tool for the functional assessment of individual responses to exercise, providing a comprehensive analysis of the cardiovascular and pulmonary function, in the general population as well as in individuals with cf. impaired lung function, malnutrition, and muscle weakness have been described as playing major roles in determining the physical performance of cf patients. in addition, a higher respiratory rate, with reduced tidal volume ventilation and hypoxemia, also seems to limit physical activity. recent studies have shown that there is a significant correlation between the 6mwd and other important clinical outcomes, such as fev1, fvc, and disease severity, in cf patients. in our study, subjects who showed a greater fev1 in the first year also presented a below - normal 6mwd in the third year, indicating that the calculation of fev1 can be an important tool for predicting functional worsening in cf patients. although two equations have been devised for standardizing 6mwd values in brazil, we chose to use international reference values, because the latter include the entire age range represented in our sample and were generated from white individuals, which is relevant given that the majority of the patients in our sample were white. our study has certain limitations, primarily those that are inherent to the use of a retrospective design and data collection based on searches of secondary databases. in addition, our sample was quite homogeneous in terms of lung function and nutritional status. in summary, our findings suggest that variation in lung function over a one - year period is associated with a higher rate of fev1 decline and worse clinical outcomes in subsequent years. assessing the fev1 over a relatively short period of time could, in conjunction with routine monitoring of fev1, contribute to the prediction of disease progression. therefore, the calculation of this parameter might become an additional tool for more careful monitoring of the clinical progression of lung disease in patients with cf. determinar se a variao na funo pulmonar em um ano est associada com piores desfechos clnicos e declnio da funo pulmonar nos anos seguintes em pacientes com fibrose cstica (fc). estudo retrospectivo incluindo pacientes com fc (4 - 19 anos de idade), avaliados por um perodo de trs anos. avaliamos caractersticas demogrficas, infeco crnica por pseudomonas aeruginosa, uso de antibiticos, internao hospitalar, distncia percorrida no teste de caminhada de seis minutos (dtc6) e funo pulmonar. os critrios de incluso foram ter sido submetido a testes de funo pulmonar por ao menos trs vezes no primeiro ano e a pelo menos um teste em cada um dos dois anos subsequentes. a variao do vef1 no primeiro ano (vef1) foi maior entre aqueles que, no terceiro ano, apresentaram vef1 reduzido, dtc6 abaixo do normal ou que foram hospitalizados do que entre aqueles que apresentaram vef1 normal, dtc6 normal ou sem hospitalizao naquele mesmo ano (p < 0,05), embora no tenha havido tal diferena em relao ao uso de antibiticos no terceiro ano. os pacientes com vef1 10% tambm apresentaram maior declnio do vef1 ao longo dos dois anos subsequentes (p = 0,04). a vef1 tambm apresentou uma correlao inversa com o vef1 no terceiro ano (r = 0,340 ; p = 0,04) e com a taxa de declnio do vef1 (r = 0,52 ; p = 0,001). a regresso linear identificou vef1 como um preditor da taxa de declnio do vef1 (coeficiente de determinao = 0,27) variaes significativas na funo pulmonar em um ano parecem estar associadas com uma maior taxa de declnio do vef1 e piores desfechos clnicos nos anos subsequentes em pacientes com fc. a vef1 de curto prazo pode ser til como um preditor da progresso da fc na prtica clnica. a fibrose cstica (fc) uma doena gentica, com evoluo crnica, que compromete a funo normal de diversos rgos e sistemas. mais frequente (na proporo de 1/3.500 nascidos vivos) na populao branca. uma condio progressiva em que a doena pulmonar o principal determinante de morbidade e mortalidade. em razo dos avanos no tratamento e compreenso da fc, houve um aumento significativo da expectativa de vida dos indivduos que sofrem da doena. na europa, a sobrevida dos pacientes com fc atingiu uma idade mdia de aproximadamente 35 anos. estimativas mostram que pacientes nascidos aps 2000 tero um expectativa de vida de mais de 50 anos de idade. porm, o declnio progressivo da funo pulmonar ao longo do tempo parece ser uma caracterstica inevitvel da doena em quase todos os casos. portanto, o comprometimento da funo pulmonar, quantificado pela medio do vef1, expresso em porcentagem do previsto, um dos principais marcadores que afetam a tomada de deciso clnica quanto alterao ou intensificao dos esquemas teraputicos empregados em pacientes com fc. nas ltimas dcadas, tem - se estudado o vef1 de pacientes com fc para se obter uma melhor compreenso da progresso da doena pulmonar associada e identificar grupos de risco nos quais seja indicado tratamento mais agressivo. h relatos de declnio do vef1 como um marcador de maior risco de hospitalizao e morte em pacientes com doenas pulmonares obstrutivas crnicas, sendo esse declnio tambm considerado a melhor indicao isolada de transplante pulmonar. achados anteriores mostraram que 80% das mortes relacionadas a fc esto direta ou indiretamente associadas a reduo da funo pulmonar. os fatores de risco mais frequentemente associados ao declnio progressivo do vef1 entre pacientes com fc incluem idade avanada, sexo feminino, uma mutao f508 no regulador da condutncia transmembrana da fc, presena de genes modificadores, insuficincia pancretica, baixo estado nutricional, diabetes mellitus e colonizao do trato respiratrio por pseudomonas aeruginosa ou burkholderia cepacia. alm disso, a produo diria de expectorao, a sibilncia e o nmero de exacerbaes pulmonares tratadas com antibiticos intravenosos tambm parecem estar relacionados a declnio da funo pulmonar entre pacientes com fc. a importncia e magnitude dos efeitos desses fatores parecem depender da idade do paciente. ademais, achados recentes sugerem que a reduo da distncia percorrida no teste de caminhada de seis minutos (dtc6) est associada a maior gravidade da doena pulmonar. embora estudos tenham demonstrado que exacerbaes agudas em pacientes com fc no modificam o coeficiente de variao para a funo pulmonar medida ao longo do mesmo dia, outros estudos mostraram que tais exacerbaes reduzem significativamente os valores espiromtricos se os mesmos forem medidos ao longo de um ano. porm, ainda h pouca informao sobre como a variao da funo pulmonar em um ano pode influenciar o declnio pulmonar e funcional associado doena nos anos subsequentes. seria til identificar fatores adicionais que possam ajudar a prever o declnio da funo pulmonar nos estgios iniciais da fc, j que, em muitos casos, o vef1 torna - se anormal apenas nos estgios avanados da doena. portanto, o objetivo do presente estudo foi determinar se a variao da funo pulmonar ao longo de um ano est associada a piores desfechos clnicos e declnio da funo pulmonar nos anos subsequentes. trata - se de um estudo de coorte retrospectivo realizado por meio da reviso de um banco de dados secundrios. foram includos pacientes com diagnstico de fc, confirmado por dosagem de cloro no suor ou teste gentico, entre 4 - 19 anos de idade, atendidos no ambulatrio de fibrose cstica do hospital so lucas da pontifcia universidade catlica do rio grande do sul (pucrs), localizado na cidade de porto alegre (rs). durante o perodo em estudo, aproximadamente 80 pacientes com fc estavam em acompanhamento no ambulatrio de fibrose cstica. a cada trs meses, cada paciente era submetido a avaliao clnica e testes de funo pulmonar, ocasio na qual eram coletadas amostras (swab de orofaringe ou amostras de escarro) para cultura. o principal critrio para incluso foi ter sido submetido a testes de funo pulmonar (espirometria) ao menos trs vezes no primeiro ano (cada conjunto de testes tendo sido realizado com pelo menos trs meses de intervalo) e a pelo menos um teste em cada um dos dois anos subsequentes. alm disso, inclumos apenas indivduos com valores espiromtricos aceitveis e reprodutveis de acordo com diretrizes internacionais, incluindo aqueles estabelecidos para pr - escolares. a variao do vef1 (vef1) no primeiro ano foi calculada pela seguinte frmula : fev1 = (hifev1 lofev1) / hifev1 onde mavef 1 o maior vef1 (% do previsto) e mevef 1 o menor vef1 (% do previsto). se um paciente foi submetido a testes de funo pulmonar mais de uma vez no segundo ou terceiro ano, selecionamos o melhor resultado espiromtrico obtido, ou seja, o maior vef1 (em porcentagem do previsto), em cada ano avaliado. o estudo foi aprovado pelo comit de tica em pesquisa da pucrs, sob o protocolo n. 08/04102. para cada paciente, foram coletados dados demogrficos (idade, sexo e raa) e dados antropomtricos, assim como informaes relativas a infeco crnica por p. aeruginosa, nmero de dias de uso de antibiticos (orais, intravenosos ou ambos) e hospitalizao. considerou - se como infeco crnica por p. aeruginosa a infeco persistente por p. aeruginosa por pelo menos seis meses consecutivos (trs testes consecutivos), determinada por cultura de swab de orofaringe ou de amostras de escarro (dependendo da idade ou estado clnico). para facilitar anlises posteriores, o uso de antibiticos e a hospitalizao foram avaliados como variveis dicotmicas (uso de antibiticos, sim / no ; hospitalizao, sim / no). alm disso, foram coletados dados sobre resultados de testes de funo pulmonar (espirometria) e a dtc6. ademais, a taxa de declnio do vef1 foi determinada subtraindo - se o melhor vef1 do terceiro ano do melhor vef1 do primeiro ano. os dados foram inseridos em um banco de dados, estratificados por ano (primeiro, segundo e terceiro ano). os testes de funo pulmonar foram realizados com um espirmetro koko (pds instrumentation, inc., louisville, co, eua). todos os procedimentos foram realizados de acordo com os critrios estabelecidos pela american thoracic society. o teste de caminhada de seis minutes (tc6) foi realizado de acordo com as diretrizes da american thoracic society. os parmetros avaliados no teste incluram frequncia cardaca ; spo2, medida com um oxmetro de pulso (palmsat 2500 ; nonin medical, plymouth, mn, eua) ; presso arterial, medida com um esfigmomanmetro (tycos ce0050 ; welch allyn, skaneateles falls, ny, eua) ; frequncia respiratria, contada pela observao das excurses da parede torcica por minuto ; e a pontuao da escala modificada de borg, para quantificar a intensidade da percepo de dispneia. os pacientes foram instrudos a caminhar o mais rpido possvel durante seis minutos em um corredor de 30 m. a dtc6 foi calculada pela contagem do nmero total de voltas executadas durante o teste e foi expressa em metros. a normalizao da dtc6 foi realizada utilizando - se uma equao de referncia. assim como o vef1, a dtc6 foi considerada normal se 80% do previsto. o tamanho da amostra foi estimado com base no comportamento das principais variveis de interesse (vef1 e dtc6). adotando - se um nvel de significncia de p = 0,05, um poder de 80% e uma correlao mnima de 0,40, estimou - se o tamanho mnimo da amostra em aproximadamente 32 pacientes. a normalidade dos dados foi testada pelo teste de kolmogorov - smirnov. como a vef1 no primeiro ano apresentou distribuio assimtrica, foi efetuada a transformao raiz quadrada dos dados. para analisar diferenas na vef1 no primeiro ano em relao aos principais desfechos clnicos avaliados nos dois anos subsequentes (taxa de declnio do vef1, hospitalizao, dtc6, vef1 absoluto e uso de antibiticos), utilizou - se o teste t de student para amostras independentes. as correlaes entre as variveis foram avaliadas utilizando - se o teste de correlao de pearson. tambm foi utilizado um modelo de regresso linear mltipla stepwise para avaliar a influncia de potenciais variveis preditoras (idade, sexo, ndice de massa corporal, infeco crnica por p. aeruginosa, vef1 absoluto basal e vef1 no primeiro ano) sobre a taxa de declnio do vef1. os dados foram processados e analisados utilizando - se o pacote estatstico ibm spss, verso 18.0 (ibm corporation, armonk, ny, eua). para trs pacientes, os dados do banco de dados estavam incompletos, e esses pacientes foram, portanto, excludos. consequentemente, a amostra final do estudo foi composta por 35 pacientes, dos quais 19 (54,2%) eram do sexo masculino. em geral, a amostra apresentava comprometimento leve da funo pulmonar. as caractersticas demogrficas, antropomtricas e clnicas da amostra so apresentadas na tabela 1. tabela 1caractersticas basais da amostra estudada. caractersticas(n = 35)idade (anos)11,3 ? 3,8 (4,74 - 19,7)sexo masculino, n (%) 19 (54,2)raa branca, n (%) 31 (88,5)peso (kg)39,3 ? 13,4 (19,4 - 63,7)altura (cm)142,2 ? 19,3 (104,0 - 178,5)imc (kg / m absoluto18,9 ? 2,6 (15,0 - 24,6)percentil57,5 ? 31,5 (9,0 - 99,0)funo pulmonar vef1 (l)1,9 ? 0,8 (0,72 - 4,28)vef1 (% do previsto)84,7 ? 22,1 (40,6 - 121,0)cvf (l)2,4 ? 1,0 (0,99 - 4,47)cvf (% do previsto)93,4 ? 17,7 (55,0 - 125,6)fef25 - 75% (l)1,8 ? 1,0 (0,33 - 5,80)fef25 - 75% (% do previsto)70,7 ? 35,2 (14,8 - 150,2)infeco bacteriana crnica pseudomonas aeruginosa, n (%) 12 (34,2) burkholderia cepacia, n (%) 2 (5,7) staphylococcus aureus, n (%) 17 (48,5)gentipo com pelo menos um alelo f508, n (%) 13 (81,2) insuficincia pancretica, n (%) 30 (85,7)imc : ndice de massa corprea. na amostra total, a vef1 mdia no primeiro ano foi de 0,39 ? 0,13%. como se pode observar na figura 1a, essa variao foi significativamente maior entre pacientes que necessitaram de hospitalizao do que entre aqueles que no necessitaram de hospitalizao no terceiro ano (p = 0,03). a figura 1b mostra que a vef1 mdia no primeiro ano tambm foi significativamente maior entre pacientes com dtc6 abaixo do normal do que entre aqueles com dtc6 normal no terceiro ano (p = 0,02). alm disso, a vef1 mdia no primeiro ano foi significativamente maior entre os pacientes que apresentaram valores menores de vef1 no terceiro ano (p = 0,03 ; figura 1c). porm, com relao ao uso de antibioticoterapia (figura 1d), a vef1 mdia no primeiro ano no diferiu significativamente entre os pacientes tratados com antibiticos no terceiro ano e aqueles que no o foram (p = 0,44). figura 1variao do vef1 (vef1) no primeiro ano, em relao s seguintes variveis no terceiro ano : hospitalizao (a) ; distncia percorrida no teste de caminhada de seis minutos (b) ; vef1 em porcentagem do previsto (c) ; e uso de antibiticos (d). dtc6 : distncia percorrida no teste de caminhada de seis minutos ; e atb : antibiticos. 0,05. entre os pacientes que apresentaram vef1 no primeiro ano 10%, a taxa de declnio do vef1 ao longo dos dois anos seguintes foi significativamente maior do que entre aqueles que no apresentaram tal variao (p = 0,04 ; figura 2). alm disso, foi identificada uma correlao negativa significativa entre a vef1 no primeiro ano e o vef1 absoluto (% do previsto) no terceiro ano (r = 0,340, p = 0,04), demonstrando que quanto maior a variao da funo pulmonar no primeiro ano, menor o vef1 no terceiro ano (figura 3a). da mesma forma, houve uma correlao negativa significativa entre a vef1 no primeiro ano e a taxa de declnio do vef1 ao longo dos dois anos seguintes (r = 0,52, p = 0,001 ; figura 3b). figura 2comparao da taxa de declnio do vef1 entre pacientes com baixa e alta variao do vef1 (vef1) no primeiro ano. figura 3variao do vef1 (vef1) no primeiro ano, correlacionada com o vef1 (% do previsto) no terceiro ano (a) e com a taxa de declnio do vef1 (b). o modelo de regresso linear mltipla passo a passo, que incluiu idade, sexo, ndice de massa corporal, infeco crnica por p. aeruginosa, vef1 basal (% do previsto) e vef1 no primeiro ano (tabela 2), revelou que a vef1 no primeiro ano foi o nico preditor significativo da taxa de declnio do vef1 ao longo dos dois anos seguintes (p = 0,001). o modelo mostrou que a vef1 no primeiro ano explicou 27% da subsequente taxa de declnio do vef1. tabela 2regresso linear mltipla da taxa de declnio do vef1 ao longo de dois anos (o segundo e terceiro anos do perodo de estudo).parmetrosberro padro de bic95% pr mnimomximoconstante12,0146,4151,03625,065 variao do vef1 no primeiro ano (%) 53,49415,32384,66822,3190,0010,27b : coeficiente no padronizado ; e r : coeficiente de determinao. os resultados do presente estudo sugerem que, em crianas e adolescentes com fc, maiores vef1 ao longo de um ano esto associadas a declnio mais acentuado da funo pulmonar e piores desfechos clnicos ao longo dos anos subsequentes. alm disso, embora os pacientes aqui avaliados tenham apresentado apenas comprometimento leve da funo pulmonar e estado nutricional preservado, a vef1 mostrou ser um preditor de declnio pulmonar progressivo, indicando que, mesmo nos estgios iniciais de progresso da fc, a quantificao desse parmetro pode facilitar a deteco clnica do distrbio. a funo pulmonar reduzida, identificada pela medio do vef1, parece estar associada a maior mortalidade em pacientes com fc. porm, em muitos casos, a funo pulmonar diminui apenas nos estgios avanados da doena. os achados do presente estudo demonstram que os pacientes que apresentaram maior variao do vef1 ao longo de um ano tiveram maior declnio da funo pulmonar ao longo dos dois anos subsequentes de acompanhamento. porm, a correlao no foi forte, o que pode ser explicado pelo fato de a amostra estudada ser composta por pacientes jovens com estado nutricional preservado e comprometimento pulmonar leve. alm disso, nossos achados mostram que houve correlao moderada entre a vef1 no primeiro ano e a taxa de declnio do vef1 ao longo dos dois anos seguintes, indicando que quanto maior a variao da funo pulmonar ao longo de um ano, maior a taxa de declnio da funo pulmonar nos anos subsequentes. em um estudo anterior, variaes do vef1 13% mostraram ser preditivas de progresso clnica mais rpida do comprometimento pulmonar em pacientes com fc, e alteraes menores foram atribudas a flutuaes normais no teste. porm, outros estudos sugeriram que melhor funo pulmonar est associada a maior variabilidade no teste. os pacientes com maior vef1 no primeiro ano apresentaram reduo da funo pulmonar ao longo dos dois anos subsequentes de acompanhamento. esse achado demonstra que, embora a determinao do vef1 seja considerada uma ferramenta til para o acompanhamento da progresso do comprometimento pulmonar em pacientes com fc, o clculo da vef1 pode ser uma ferramenta complementar de acompanhamento, pois pode ser utilizada mais precocemente do que a determinao do vef1 em um nico momento, j que, em muitos casos, essa ltima determinao est associada a maior mortalidade apenas nos estgios avanados da doena. no presente estudo, os pacientes com vef1 10% no primeiro ano apresentaram declnio mais acentuado do vef1 ao longo dos dois anos seguintes. como mencionado anteriormente, o modelo de regresso linear mltipla mostrou que 27% da taxa de declnio do vef1 ao longo dos dois anos subsequentes de acompanhamento podem ser explicados pela vef1 durante o primeiro ano. esse resultado enfatiza a importncia de se avaliar a variao da funo pulmonar ao longo de um perodo de tempo relativamente curto, dada a diminuio da funo pulmonar observada depois desse perodo. portanto, acreditamos que essa avaliao possa representar uma ferramenta adicional til para o acompanhamento da progresso da doena em pacientes com fc, pois a reduo isolada do vef1 frequentemente vista apenas nos estgios avanados da doena. entretanto, ao analisarmos os dados sobre variabilidade, constatamos que aproximadamente 46% dos nossos pacientes apresentaram vef1 basal baixo, com consequente aumento do vef1 ao longo do primeiro ano, mostrando que esse parmetro indica a variabilidade da funo pulmonar em geral, e no especificamente o declnio progressivo esperado em pacientes com fc. com base em uma recente reviso da literatura, acreditamos que este seja o primeiro estudo a mostrar que a variao de curto prazo da funo pulmonar est associada a piores desfechos clnicos ao longo do tempo em pacientes com fc. nossos achados demonstram que os pacientes que apresentaram maior vef1 no primeiro ano foram mais propensos a necessitar de hospitalizao no terceiro ano. esses achados corroboram os de estudos anteriores, que mostraram que exacerbaes pulmonares causam declnio da funo pulmonar ao longo do tempo e que o declnio do vef1 est associado gravidade das exacerbaes pulmonares, havendo necessidade de hospitalizao e administrao intravenosa de antibiticos. alm disso, a diminuio do vef1 parece ser um preditor de hospitalizao e mortalidade em pacientes com fc, e constatamos que a vef1 ao longo de um ano apresentou relao semelhante com desfechos da fc no presente estudo. estudos anteriores constataram uma associao entre o uso de antibiticos e o declnio da funo pulmonar em pacientes com fc. no presente estudo, no foi encontrada nenhuma correlao significativa entre a vef1 no primeiro ano e o uso de antibiticos. isso pode ser atribudo ao pequeno tamanho de nossa amostra e ao curto perodo do estudo. outros autores mostraram que o uso de antibiticos intravenosos para o tratamento de exacerbaes pulmonares um fator de risco para o declnio da funo pulmonar ao longo do tempo em pacientes com fc. alm disso, sugeriu - se que exacerbaes consecutivas ao longo de um curto perodo de tempo contribuem para a progresso da doena pulmonar. ademais, um estudo anterior demonstrou que a ocorrncia de trs exacerbaes pulmonares por ano aumenta o risco de declnio do vef1 em aproximadamente 5%. o tc6 caracterizado como uma ferramenta importante para a avaliao funcional de respostas individuais ao exerccio, proporcionando uma anlise abrangente da funo cardiovascular e pulmonar, na populao em geral assim como em indivduos com fc. o comprometimento da funo pulmonar, a desnutrio e a fraqueza muscular foram descritos como de grande importncia na determinao do desempenho fsico de pacientes com fc. alm disso, o aumento da frequncia respiratria, com ventilao com baixo volume corrente e hipoxemia, tambm parece limitar a capacidade fsica. estudos recentes mostraram que existe uma correlao significativa entre a dtc6 e outros importantes desfechos clnicos, tais como vef1, cvf e gravidade da doena, em pacientes com fc. em nosso estudo, os pacientes com maior vef1 no primeiro ano tambm apresentaram dtc6 abaixo do normal no terceiro ano, indicando que o clculo da vef1 pode ser uma ferramenta importante para a previso de piora funcional em pacientes com fc. embora duas equaes tenham sido desenvolvidas para a padronizao dos valores da dtc6 no brasil, optamos por utilizar valores de referncia internacionais, pois estes ltimos incluem toda a faixa etria representada em nossa amostra e foram gerados a partir de indivduos brancos, o que relevante j que a maioria dos pacientes de nossa amostra era branca. nosso estudo apresenta certas limitaes, principalmente as inerentes a utilizao de um desenho retrospectivo e coleta de dados baseada em pesquisas em bancos de dados secundrios. alm disso, nossa amostra era bastante homognea em termos de funo pulmonar e estado nutricional. em resumo, nossos achados sugerem que a variao da funo pulmonar ao longo de um ano est associada a maior taxa de declnio do vef1 e piores desfechos clnicos nos anos subsequentes. a avaliao da vef1 ao longo de um perodo de tempo relativamente curto pode, em conjunto com o acompanhamento rotineiro do vef1, contribuir para a previso de progresso da doena. portanto, o clculo desse parmetro pode se tornar uma ferramenta adicional para o acompanhamento mais cuidadoso da progresso clnica da doena pulmonar em pacientes com fc. | abstractobjective : to determine whether the variation in lung function over one year is associated with worse clinical outcomes, as well as with a decline in lung function in the following years, in patients with cystic fibrosis (cf). methods : this was a retrospective study involving cf patients (4 - 19 years of age), evaluated over a three - year period. we evaluated demographic characteristics, chronic pseudomonas aeruginosa infection, antibiotic use, hospitalization, six - minute walk distance (6mwd), and lung function. the inclusion criterion was having undergone pulmonary function testing at least three times in the first year and at least once in each of the next two years. results : we evaluated 35 cf patients. the variation in fev1 in the first year (fev1) was greater among those who, in the third year, showed reduced fev1, had a below - average 6mwd, or were hospitalized than among those with normal fev1, normal 6mwd, or no hospital admissions, in that same year (p < 0.05), although no such difference was found for antibiotic use in the third year. subjects showing a fev1 10% also showed a greater decline in fev1 over the two subsequent years (p = 0.04). the fev1 also showed an inverse correlation with absolute fev1 in the third year (r = 0.340, p = 0.04) and with the rate of fev1 decline (r = 0.52, p = 0.001). linear regression identified fev1 as a predictor of fev1 decline (coefficient of determination, 0.27). conclusions : significant variation in lung function over one year seems to be associated with a higher subsequent rate of fev1 decline and worse clinical outcomes in cf patients. short - term fev1 might prove useful as a predictor of cf progression in clinical practice. |
anemia is a typical feature of chronic kidney disease (ckd). in many countries, ckd is the commonest cause of anemia after that accounted for by iron, vitamin b12, and folate deficiencies, overt hemolysis, and ongoing bleeding. although loss of renal erythropoietin production has traditionally been advanced as an explanation, there has been a gradual realization that other forces may be contributory. although this is a nascent field, abnormal oxygen - sensing mechanisms and resistance to erythropoietin may be a predominant issue in a sizeable proportion of patients with advanced ckd. this insight, which, as with many other conditions of relative hormonal deficiency, has been slow to embed itself in clinical consciousness, and has considerable implications. it suggests, for example, that greater efforts are needed to delineate the presence and causes of erythropoietin resistance when ckd and anemia intersect, both within individual patients and as part of the broader agenda for future research initiatives. a practical offshoot of this realization may be that anemia treatment algorithms predicated entirely on ever increasing doses of erythropoiesis - stimulating agents (esas) that ignore the issue of esa resistance may not be optimal. despite a profusion of mechanistic and therapeutic insights, treatment of anemia somewhat tongue in cheek, as bigger and better randomized trials come and go, the notion that optimal indisputable anemia treatment strategies will become clear seems to recede ever further into the distance. without wishing to diminish their potential importance, iron management protocols will not be considered in this article for space reasons and because, to date, randomized trials have focused completely on hemoglobin response, without meaningful consideration of differential effects on conventional hard outcomes, including cardiovascular events, infectious events, and death. similarly, epoetins that are considered biosimilar to epoetin alfa and beta will not be discussed here. the aspects considered in this review include the basic mechanistic constructs that underpin the bulk of current therapeutic development of esas, newer esas, hemoglobin target trials in ckd, and finally, some discussion about the implications of resistance to esas. circulating erythropoietin consists of 165 amino acids in a single strand with two disulfide bonds and four carbohydrate chains, three of which are n - linked and one of which is o - linked.1 plasma levels are inversely related to oxygen content ; the half - life is 213 hours and metabolism takes place in the kidney, liver, and bone marrow. ultimately, less than 10% of circulating erythropoietin is excreted by the kidneys.24 although current understanding is incomplete, it is evident that erythropoietin gene (epo) expression is tightly regulated by stimulators, including hypoxia - inducible transcription factors (hif) and hepatocyte nuclear factor 4, and by inhibitors, including nuclear factor kappa b and gata2.5 hif1, a key regulator of erythropoietin transcription, also regulates transcription of several other genes induced by hypoxia, including those for glycolytic enzymes, platelet - derived growth factor, and vascular endothelial growth factor.6 hif1 binds to a hypoxia - response element residing on the 3-flanking region of epo.7 in the presence of hypoxia, hif1 levels increase and the hypoxia - responsive genes become upregulated. in contrast, in the absence of hypoxia, the oxygen - sensitive hif1 subunit is hydroxylated by prolyl hydroxylase, and degraded in the proteasome ; ultimately, downregulation of epo and other hypoxia - responsive genes occur.8 in this cascade of events, inhibition of prolyl hydroxylase should result in tonic, hypoxia - independent upregulation of epo, and possibly several other hypoxia - responsive genes.9 following translation of the epo gene, three n - linked and one o - linked carbohydrate chains are added to erythropoietin. these chains normally exhibit heterogeneity in terms of the type of carbohydrate moieties incorporated, chain lengths, and branching configuration.10,11 the number of sialic residues also varies between healthy individuals, and up to four residues can be found on each n - linked carbohydrate chain, while up to two residues can be found on the o - linked chain, and variability in sialic acid composition has implications for the overall electrical charge of circulating erythropoietin.12 in turn, overall electrical charge has effects on the circulating half - life of erythropoietin and interactions with the erythropoietin receptor ; in general, greater sialic acid content correlates with longer and greater potency.13 while marrow - based red blood cell - producing cells are thought to express the highest density of erythropoietin receptors, erythropoietin receptors have been found in tissues throughout the body, including the kidney, brain, heart, retina, muscle, and vascular endothelium.1416 ligand - receptor interaction leads to conformational changes in the dimeric transmembrane erythropoietin receptor, conformational changes and phosphorylation of tightly - associated janus kinase 2 molecules, followed by phosphorylation of tyrosine moieties in the cytoplasmic domain of the erythropoietin receptor.17 ultimately, the intracellular portion of the erythropoietin receptor becomes a docking complex for proteins exhibiting src homology 2 (sh2) domains. after docking, sh2-containing proteins are activated by janus kinase 2-mediated tyrosine phosphorylation and rendered capable of activating nuclear genes involved in cell growth and differentiation, and prevention of apoptosis.1822 darbepoetin, with its five amino acid substitutions and two extra carbohydrate chains, can incorporate as many as 22 sialic acid residues, in contrast with native erythropoietin, which can incorporate 14 residues.23 because darbepoetin has a longer half - life than erythropoietin, of approximately one day or more, it was anticipated that darbepoetin could be efficacious with longer dose intervals than with epoetins.24,25 multicenter, randomized, controlled trials have shown that darbepoetin once every 12 weeks is as effective in terms of attained hemoglobin levels as epoetin 23 times per week.2629 while the possibility of extended dose intervals is attractive for a compound requiring parenteral administration, several questions remain. for example, comparisons of costs and savings for optimized dosing schedules of different esas would be very helpful for clinical decision - making. in terms of basic mechanistic biology, it is unknown whether the non - erythroid effects of darbepoetin in humans are similar to those of epoetins. given its non - native chemical composition, there is a surprising lack of clinical information about the immunogenicity of darbepoetin. however, it is noteworthy that pure red cell aplasia has been described with this agent.30 in continuous erythropoietin receptor activator (cera), a methoxypolyethylene glycol polymer chain is added to the erythropoietin molecule via amide bonds between the n - terminal amino group of alanine and the -amino groups of a lysine at position 45 or 52, through a succinimidyl butanoic acid linker. cera has a molecular weight twice that of erythropoietin and a half - life of over five days.31,32 randomized controlled trials in patients with anemia and ckd show that cera, administered every 24 weeks, is not inferior to conventional esa therapy in terms of hemoglobin response.3338 as with darbepoetin, comparative nonerythroid effects and accurate rates of associated pure red cell aplasia have not been quantified in humans. several other synthetic proteins, modified erythropoietin derivatives, and peptide - based erythropoietin receptor activators are also being researched. for example, cnto 528, an antibody fusion protein with a hematopoietic peptide attached to an igg1 base (a mimetibody) has a half - life of approximately six days and shows erythropoietic activity in healthy men.39,40 small erythropoietin - emulating peptides that interact with the erythropoietin receptor are also under active investigation. for example, peginesatide, which consists of two peptide chains linked by a pegylation chain, appears to be distinct from erythropoietin in terms of antigen - antibody cross reactivity.41 in a rat model of antierythropoietin antibody - mediated pure red cell aplasia, peginesatide administration led to correction of anemia.42 similar findings were observed in humans in an open - label, uncontrolled study in which peginesatide was administered subcutaneously to 14 ckd patients with erythropoietin antibody - mediated pure red cell aplasia.43 long - term clinical trials of peginesatide involving approximately 2600 ckd patients have been completed, and detailed study reports are awaited with interest.44 insights into the biological underpinnings of erythropoiesis have led to the identification of several nonpeptide - based (and potentially orally administered) candidates for the treatment of anemia in patients with ckd and other chronic diseases. as described above, while inhibition of prolyl hydroxylase should lead to enhanced erythropoietin production, nonselective inhibition could have pervasive regulatory effects on many genes, both known and unknown. an interesting proof - of - concept study with the orally active prolyl hydroxylase inhibitor, fg-2216, was recently reported.45 a single dose of fg-2216 was administered to six healthy volunteers, six anephric hemodialysis patients receiving conventional esa therapy, and six hemodialysis patients with kidneys receiving esas. erythropoietin levels increased 12.7-fold, 14.5-fold, and 30.8-fold, respectively, in the three groups. even though study numbers are small, the findings in the anephric group are especially notable, and suggest that abnormal oxygen sensing may be at least as important in the pathogenesis of renal anemia as inadequate erythropoietin production. the biological mechanisms described above implicate many gene - based pathways for increasing erythropoietin levels. one notable study in erythropoietin - deficient transgenic mice described an intuitive approach to normalizing hemoglobin levels without incurring polycythemia, ie, use of a vector that adds a hypoxia - response element which, in turn, controls epo transcription.46 this section discusses issues related to methodology and interpretation of the large number of published trials that most heavily influence current treatment. it is not intended to be a systematic review or meta - analysis, in part because several of these have already been published, and in part because of a belief that even the best of the available trials are so intrinsically different that simple aggregation of findings may not be advisable. as shown in table 1, five large (> 500 subjects) clinical trials have been reported to date, ie, us normal hematocrit47 (usnh), canadian european normalization of hemoglobin48 (cenh), cardiovascular risk reduction by early anemia treatment with epoetin beta49 (create), correction of hemoglobin and outcomes in renal insufficiency50 (choir), and trial to reduce cardiovascular events with aranesp therapy51 (treat), targeting comparatively unique subsets of anemic ckd patients with a distinctly heterogeneous array of interventions. they differ profoundly from placebo - controlled trials using identical - looking pills, and these differences can impede interpretation and comparability with other trials. for example, are often not concealed (as with choir, create, usnh), a strategy that may reduce logistical complexity, especially when drugs are administered parenterally in nonfixed doses that are adapted to on - treatment biological analytes like hemoglobin. even trials attempting to hide tend to become unmasked over time for several potential reasons. because patients with ckd typically have other serious comorbid illnesses, they often have hemoglobin levels routinely drawn at other specialty clinics. hence, even the most stringent efforts at masking treatment allocation are unlikely to be completely successful. as a result, outcome comparisons that involve subjectivity on the part of patients and site investigators have to be viewed as less than pristine. nonrandomly assigned treatments, like iron and additional antihypertensive agents, are usually expected following randomization, and highly imbalanced co - interventions can make it difficult to unravel the mechanisms underlying differences in trial outcomes. immediate or delayed intervention (create and treat) is another trial design that systematically adds nonrandom elements. in the delayed intervention or rescue arms, treatment is determined by non - random elements (time or a decrease in hemoglobin below a critical threshold). while the trigger for this intervention may be specified in advance by a well described algorithm, it clearly is not controlled by a notional coin toss. hemoglobin targets and principal treatment strategies for the five large trials are shown in table 1. regarding the critical issue of masked treatment allocation, only treat was placebo - controlled. while concealed treatment allocation is intuitively important for outcomes like quality of life, it may also be important for rating hard clinical events. for example, basic physiological tenets teach us that polycythemia can cause vascular thrombosis and profound anemia can cause cardiac decompensation ; familiarity with the assigned target hemoglobin may influence site investigators when confronted with common diagnostic challenges in advanced ckd, such as distinguishing nonspecific chest pain from angina pectoris and extracellular fluid volume overload from true heart failure. unfortunately, blinded event committees have no control over what is written in case record forms at the site level and can not correct site - level biases. it has been known from the earliest days of treatment that esas can increase blood pressure levels, so active tracking of blood pressure levels, esa doses, and hemoglobin levels would seem to be a reasonable safety requirement in clinical trials of aggressive hemoglobin management strategies.52 the cenh trial incorporated centrally controlled real - time monitoring procedures for hemoglobin, iron, and blood pressure levels, with treatment recommendations returned to study sites within days of measurement. in treat, a point - of - care device was used for rapid measurement of hemoglobin levels, which were entered into an interactive voice - response system to determine the next dose of darbepoetin. table 1, which summarizes the treatment algorithms used to achieve target, shows that heterogeneity between the studies was large, to the extent that no two studies were strictly comparable. although create, choir, and treat all examined patients with ckd not requiring dialysis, create used a strategy of delayed intervention in one treatment arm, while choir used a typical parallel - group design without a time - varying therapeutic intent, and treat used a bit of both, with placebo control and the possibility of delayed intervention if anemia became sufficiently severe. for example, both the active and the control groups in choir received a substantial initial dose of epoetin (10,000 u), and it is doubtful if many practicing clinicians would begin treating epoetin - nave patients with such a large dose, particularly in the 50% of patients for whom the objective was to maintain current hemoglobin levels. with regard to primary outcomes, no two studies were identical, although all but cenh share common elements (table 1). while many trials these days use composite primary outcomes, it is always worthwhile to reflect on the individual components and their implications. in choir, the primary outcome was time to first episode of death, myocardial infarction, heart failure hospitalization (provided dialysis was not employed for treatment), and stroke, with dialysis as a censoring event. with this design, episodes of heart failure that are severe enough to require dialysis are ignored, while less severe episodes are counted ; it is certainly unusual that less severe episodes would be more likely to be included in treatment comparisons than more severe episodes. with the composite outcome designs employed in these studies, the first event is counted, and subsequent outcomes are ignored in situations where individuals experience multiple components of the composite outcome. all things being equal, it seems intuitively obvious to posit that patients who develop all the components of a composite outcome might receive more weight in outcome analysis. composite outcomes can never exclude the possibility that serious but unknown treatment - related effects may exist. as a result, comparisons of death rates, in isolation, need full attention, irrespective of the reported primary outcomes. there has long been concern that very rapid increases in hemoglobin may be detrimental ; first - month hemoglobin increments in the active treatment arms were notably higher in treat and choir. during the maintenance phase, while no study maintained targeted hemoglobin levels, statistical separation was clear. esa doses differed widely between the studies, with much higher doses in choir than in create, and much higher doses in usnh than in cenh. in the nondialysis ckd studies, these differences may be related to study design, because all patients in choir were treated with epoetin alfa 10,000 u / week for three weeks, which was five times the starting dose used in the early intervention arm of create. while blood pressure levels were similar in the other studies, more antihypertensive agents were used in the high - target arm of cenh. on unadjusted analysis, create, treat, and usnh showed no differences in the primary outcome rates, whereas primary outcome rates were higher in the high hemoglobin target arm of choir. not unexpectedly, table 1 shows that significant differences in baseline characteristics were present in each study. given that several of these differences could be clinically important, it seems worthwhile to scrutinize the strategies used to deal with this issue. of the three trials examining cardiovascular outcomes and death, usnh reported a comparison of the primary outcome with adjustment for baseline variables in the original publication, and the findings were very similar with and without covariate adjustment.2 with choir, while the original publication did not report an adjusted comparison of primary outcomes, a regulatory study report filed at clinicaltrials.gov shows adjustment for baseline obviated statistical significance, with a p value of 0.111, as opposed to 0.03 in the unadjusted analysis.53 the contrast between unadjusted significance and adjusted non - significance leads to difficulties with overall interpretation of treatment effects, because it is impossible to reject the hypothesis that imbalanced assignment of factors other than study interventions caused the disparity in primary outcome rates seen on unadjusted analysis. treat also exhibited substantial baseline differences. while classical covariate adjustment was not undertaken, hazards ratios were reported that incorporated the strata used to randomize patients in the study study site, baseline level of proteinuria, and an investigator - designated history of cardiovascular disease. quality of life was a secondary outcome in all of these trials, and although findings in this regard would never be considered definitive by purists, the available sample sizes were large. in addition, only treat attempted to conceal treatment allocation completely from patients, site investigators, and outcome assessors, and of the others, only cenh concealed treatments from study subjects. while four of these trials formally reported quality of life comparisons, no two trials used identical arrays of instruments. three of the trials, including those that incorporated patient blinding, reported quality of life benefits, predominantly in domains related to fatigue and vitality. in contrast, choir showed a potential loss of quality life with the higher hemoglobin target for the emotional subscale of the short form-36 instrument ; findings were likely clouded by important imbalances in baseline characteristics and the nonreporting of timing of study assessments and dropout rates. critically, when it comes to assessing risks and benefits, none of the studies attempted to determine what differences in quality of life scales meant to patients. two of the studies examined left ventricular dimensions and found that hemoglobin targets had no effect. transfusion rates, reported by all studies except choir, were 37%60% lower with higher targets. while no study showed an irrefutable effect on primary study outcomes, several showed differences in important nonprimary event rates or in individual components of the primary composite outcomes. for example, in create, the risk of renal replacement therapy was greater in the immediate intervention arm, in spite of similar rates of change in glomerular filtration rate, vascular access loss was greater with higher targets in usnh, and stroke was greater in cenh. in treat, stroke rates were higher in the darbepoetin arm ; for outcomes not incorporated in the primary outcome, darbepoetin was associated with higher rates of venous and arterial thromboembolism and higher rates of cancer - related death in subjects with cancer at baseline, without being associated with death attributed to cancer in the overall population and overall cancer rates. even though only five trials are examined in detail here, noteworthy differences were present at each level considered, ie, enrollment criteria, interventions, primary outcomes selected, treatment concealment, success of randomization, and study findings. in the presence of such distinct heterogeneity, it is questionable whether attempting to generate aggregate findings is a reasonable approach. it seems apparent that an ideal approach to treating anemia in patients with ckd remains to be identified, and, despite years of research, much more investigation is needed. there is a substantial amount of literature relating declining hemoglobin levels to adverse outcomes, including death, in patients with ckd.54 in addition, resistance to esa, typically defined by high ratios of esa dose to hemoglobin levels, is also associated with adverse outcomes.55,56 two hypotheses are compatible with these observations, and have disturbingly different treatment implications, ie, sicker patients need higher doses to achieve a given hemoglobin target and, assuming for a given patient that a given hemoglobin target can be achieved with different doses of esa, higher esa doses are harmful. in this regard, a recent subgroup analysis of the treat trial provides valuable insights.57 by design, patients receiving esas were excluded and fixed initial darbepoetin doses were employed. this subgroup analysis examined subjects in the active treatment arm, and reported higher rates of both the composite cardiovascular endpoint and death in those with a lesser hemoglobin response. many, including the author of this report, have tended to interpret these findings as raising concern about current target - based strategies for treating anemia in patients with ckd.57 it seems difficult to make claims for dose - related harm, given that doses were fixed, and it is plausible that this is a beautiful demonstration of patient - related factors being responsible for a connection between hemoglobin response and harm, at least in this study. sadly, the quality and quantity of clinical trial information available to guide esa use do not permit confident statements about optimally efficacious, safe, and cost - effective therapeutic strategies. with our ever increasing insight into the biology of erythropoietin, it seems natural to question whether different esas might have different nonerythroid effects at doses and intervals resulting in similar hemoglobin trajectories. if this is the case, the drug evaluation and approval of esas will need to go far beyond the research reported to date. | erythropoiesis is a rapidly evolving research arena and several mechanistic insights show therapeutic promise. in contrast with the rapid advance of mechanistic science, optimal management of anemia in patients with chronic kidney disease remains a difficult and polarizing issue. although several large hemoglobin target trials have been performed, optimal treatment targets remain elusive, because none of the large trials to date have unequivocally identified differences in primary outcome rates or death rates, and because other reported outcomes indicate the potential for harm (rates of stroke, early requirement for dialysis, and vascular access thrombosis) and benefit (reductions in transfusion requirements and fatigue). |
in 2012, the korea internet security agency, kisa, reported that over 50% of the population of korea are using smart phones, which were introduced in 2009, with an average usage of 2.7 hours per day1. there are large numbers of workers employed in tasks involving the use of video display terminals (vdts), which are associated with musculoskeletal and skin problems, eye discomfort, fatigue, and stress2. computer related neck and upper extremity pain has been reported among college and graduate students over the last ten years3. while using a vdt, static sitting postures increase muscle tension, resulting in pain, numbness, loss of function, and a variety of neuromuscular symptoms, most often in the upper body4. a forward head posture (fhp) is commonly adopted by vdt users5, 6, and approximately 60% of individuals with neck pain had fhp or significantly increased fhp as a result of using computer for more than 2 hours a day7, 8. fhp and trunk flexion may gradually develop into a fixed postural habit when workers use a vdt9, and may also affect normal shoulder elevation, as elevation of the upper extremity requires the same amount of cervical spine extension10. support of the cervical segments is provided by the muscular sleeve formed by the longus colli, which has a major postural function in supporting and straightening cervical lordosis ; the longus capitis which attaches to the cranium and anteriorly spans the upper cervical motion segments and the craniocervical (cv) region ; and the semispinalis cervicis and cervical multifidus, subocciptal extensor, semispinalis, and splenius capitis muscles which span the cvregion posteriorly11. weak neck flexors and high density muscle spindles reduce the ability to maintain an upright posture and cervical posture. a computer model showed regions of local segmental instability when the large superficial muscles of the neck were stimulated to produce movement, particularly in the near - upright and neutral postures9, 12. weakness of the scapular retractors, middle - lower trapezius, and rhomboids, causes increased scapular abduction during relaxed standing13. there are various self - correction exercises like chin - tuck, for strengthening the neck flexors and stretching neck extensors, and improving the endurance and tone of the cervical muscles13. thoracic manipulation is also effective at reducing neck pain, improving dysfunction, neck posture, and neck rom of patients with chronic mechanical neck pain14. however, only a few studies have used a swiss ball, which has many benefits such as allowing free weight resistance exercises, neuromuscular demands on the whole body for motor coordination and facilitate on of multi - angle resistance training which elicits greater rom8, 15, for the neck stabilization. moreover, none have compared the effects on neck support of swiss ball and mat exercises. therefore, the purpose of this study was to investigate the effects on shoulder pain and neck mobility of strengthening neck flexors and scapular retractors using a swiss ball to provide useful clinical guidelines for reducing pain or increasing cervical rom, in comparison with mat exercises. one - hundred thirty - seven university students answered 17 questions about vdt syndrome and 20 university students (4 males, 16 females) aged 21 to 23 years participated in this study. the subjects had experienced vdt syndrome but had not received treatment for it and did nt do any regular exercise. all participants signed a written informed consent form approved by the institutional review board of the catholic university of daegu. after selection, the subjects were randomly and equally allocated to one of two groups : a swiss ball group which performed strengthening exercises for the neck flexors and scapular retractors, and a mat group which performed the same exercises on a mat. the study was conducted on college premises and the exercises were performed under the supervision of an instructor. the subjects were asked not to receive any specific intervention for neck - shoulder pain. for strengthening the neck flexors, subjects lay supine with the head up and chin - tuck. the mat group placed a towel on middle of the thorax to reduce abdominal muscle tension. for strengthening the scapular retractors, the subjects lay prone with the shoulders in 90120 abduction, then extended spine by external rotation of the arms with chin - tuck14. both groups performed the same exercises twice a week for 4 weeks, a total of 8 sessions. the training consisted of 10 repetitions 10- second holds in the first two weeks, followed by 15 second holds in the final two weeks. upper trapezius pain was evaluated using the visual analog scale and an algometer (jetch, japan), and a zebris (zebris medical gmbh, cms100, germany) was used to measure neck mobility. measurements were taken at pre- and post test, and a follow - up was also performed a week after the intervention. the independent t - test was used to compare age, heights, and weight between groups. the independent variable in this study was strengthening exercises and the dependent variables were shoulder pain and neck mobility. repeated measures anova was used to find significance of differences in the dependent variables according to time between groups. subjects mean ages, heights, and weights were 21.81.1 years, 167.68.9 cm, 60.014.6 kg in the swiss ball group, and 21.81.9 years, 167.78.3 cm, 58.411.6 kg in the mat group. vas significantly decreased with time (p0.05, table 2table 2.comparison of the pain pressure threshold of the right / left upper trapezius by repeated measures anovarup (meansd)pretestpost testfollow - upsourceball1.740.670.900.391.460.66timemat1.700.411.040.351.360.47timegroupgrouplup (meansd)pretestpost testfollow - upsourceball1.630.431.210.391.470.55timemat1.350.350.890.381.110.20timegroupgroupp<0.05, p<0.01 ; rup : right upper trapezius ; lup : left upper trapezius). neck flexion significantly increased with time too (p<0.05), especially at follow - up (p<0.05). there was no interaction within the groups (p<0.05, table 3 table 3.comparison of neck flexion by repeated measures anova). p<0.05, p<0.01 ; rup : right upper trapezius ; lup : left upper trapezius the purpose of this study was to determine the effects on neck - shoulder pain and mobility of exercises using a swiss ball for strengthening the neck flexors and scapular retractors, and neck and scapular stabilizers performed by young adults who had prolonged daily exposure to vdts. the results for the upper trapazius vas show that the swiss ball group had significantly decreased right upper trapezius pain at the follow - up test (p<0.05), and left upper trapezius pain at the post - test (p<0.05, table 1). in previous studies of neck stabilization exercises using the hold - relax technique for the upper trapezius, levator scapula, scalenus, and suboccipitals, vas decreased significantly from 3.35 to 1.65 (p<0.001) for the neck, and from 4.55 to 2.05 for the shoulder (p<0.001), and the pain pressure threshold (ppt) of the four muscles increased (p<0.001), but rom did not differ17. in core stability programs using a swiss ball, thera - bands, and a mat, the thera - band group showed the most reduced vas followed by the swiss ball group, and the mat group18. chin tucks, chest stretch, wall stretch, on your back chest stretch, axial extension with neck isometrics, wall angels, bruegger exercise, dead bug, quadruped, upper back cat performed 4 times a week for 8 weeks results in significant changes in the cv angle (p<0.001), cervical rom (p<0.001) and ppt (p<0.001)20. there is moderate negative correlation between cv angle and neck disability7. these results show that strengthening the neck flexors and scapular retractors is effective at reducing the pain and changes the cv angle. they also show that swiss ball exercise is more effective at reducing pain than mat exercise. the results of zebris measurements of neck mobility show that there was a significant increase in neck flexion at the follow - up (p<0.05, table 3), and significantly decreased neck lateral flexion and extension, and significantly increased right - left rotation (p<0.05). treatment for poor cervical posture should focus on recovering normal rom of neck flexion and extension. increasing neck flexion reduced the cv angle and that contributed to reduce the fhp for stabilization of the neck22. previous studies have demonstrated that swiss ball exercise elicits greater total core muscle work than mat exercise. petrofsky23 compared core muscle activities in exercises on a swiss ball, 7- inch mini ball, and the floor. in a comparison of exercises on a swiss ball and mat, floor crunches required about two thirds of the work used for the same exercises on a swiss ball. the swiss ball provides greater extension and flexion but the extent of that movement is limited by the diameter of the ball with a larger diameter eliciting less movement. chek24 reported that the size of the ball enables athletes to train certain muscles through a greater rom. while lying with the lower back on the center of the ball, athletes can perform abdominal crunches beginning with the abdominal muscles in the stretched position. this stretched position ca nt be worked while lying on a flat, horizontal surface. it is claimed that the effect of the pre - stretch and potential strength development in the stretched position can enhance the effectiveness of the exercise and make the task more functionally useful to athletes. the present study did nt start exercise in the stretched position which can increase rom on the swiss ball. this study was limited to eight training sessions, and rom was not compared between the swiss ball and mat exercises groups. also, the cv angle was not measured so we could not determine if there was any improvement in fhp. the results of this study show that pain was significantly decreased by exercises on a swiss ball, which also and increased neck flexion for stabilization of the neck. exercises on a swiss ball, which has a small base of support, should be used for reducing pain and stabilization of the neck, and exercises on a mat for increasing rom. the swiss ball and mat could be used selectively either for training or the purpose of the treatment. further study should compare the motions of both swiss ball and mat exercises and investigate the neurophysiological benefits of the former. | [purpose ] this study compared the effects on neck - shoulder pain and mobility of strengthening exercises for the neck flexors and scapular retractors performed on a swiss ball and a mat. [subjects ] twenty student volunteers were the subjects. [methods ] the students were randomly assigned to two groups : mat group (n=10), and swiss ball group (n=10). at pre - test, post - test, and 1-week follow - up pain was assessed using the visual analogue scale (vas), the pain pressure threshold (ppt) of the shoulder was measured with an algometer, and neck mobility was measured with a zebris. [results ] the data analysis revealed that there was a significant decrease in pain and significant increase in neck flexion in both groups, and the swiss ball group showed better results. [conclusion ] strengthening the neck flexors and scapular retractors for stabilization of the neck using exercises on a swiss ball was more effective at reducing the pain and stabilizing the neck than mat exercises. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.