article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
amiodarone is an iodine - rich drug that is a highly effective and widely used as an antiarrhythmic agent for the treatment of symptomatic supraventricular and ventricular tachyarrhythmias. amiodarone is associated with many adverse effects that involve different organs. although these side effects are generally mild, 10~15% of patients require withdrawal of the drug as a result of toxicity. the most prominent adverse effects during long - term therapy include thyroid dysfunction, corneal microdeposits and pulmonary and hepatic toxicity1). transient rises in hepatic enzyme activity have been reported in 40% of the patient who received the antiarrhythmic agent amiodarone2). asymptomatic elevation of serum aminotransferases occurs in 25% of those patients who are treated with aniodarone. however, the prevalence of severe liver injury has been estimated at only 1% to 3%3). micronodular cirrhosis that was clearly due to amiodarone therapy has been confirmed in 12 cases4). muscle weakness and peripheral neuropathy have also been reported in 10% of the patients who were administered the anti - arrhythmic agent amiodarone5, 6). we describe here a case of amiodarone - induced hepatitis and neuropathy after treatment with 400 mg of oral amiodarone for 17.8 months. a 75 year old man was hospitalized in december 2005 due to nausea, vomiting and difficulty in walking and raising his legs to walk up steps for the previous three months. since july 2004, the patient had been given amiodarone 400 mg daily for treating his atrial fibrillation and heart failure. he had a history of pulmonary tuberculosis, which was treated with anti - tuberculosis drugs 30 years prior to this hospitalization. he had drank 40 g of alcohol per day for 20 years before his abstinence from drinking 4 months ago. his other medications at admission were carvediol 12.5 mg twice per day, diltiazem 30 mg twice per day and triflusal 300 mg once per day. the weakness became more diffuse, affecting the proximal muscles more than the distal muscles. iu / l ; serum albumin 2.5 g / dl ; serum bilirubin 0.8 mg / dl ; alkaline phosphatase 99 iu / l;platelets 212,000 cells / ul ; blood hemoglobin 13.1 g / dl ; negative results of tests for hepatitis b surface antigen, hepatitis a antibody, hepatitis c antibody and the vdrl test. the serum antinuclear antibody was positive, but other autoantibodies, including anti - dsdna, anti - sm and anti - ro, anti - la antibody were negative. also, the anti - smooth muscle and anti - mitochondrial antibodies were negative. a pre - enhanced computed tomogram of the abdomen showed diffuse high attenuation of the liver parenchyma (figure 1). liver biopsy showed microvesicular steatosis, foam cells in the hepatic sinusoids and mallory bodies in the periportal hepatocytes, and also features of chronic hepatitis (mild lobular activity, grading score 2 ; minimal porto - peripheral activity, grading score 1 ; portal fibrosis, staging score 1) on the light microscopy (figure 2 - 4). with electron microscopy, the hepatocytes showed pleomorphic mitochondria that had crystalloid inclusions and focal concentric membranous arrays, which suggested membrane - bound lysosomal structures. they suggested sensorimotor polyneuropathy with both axonal degeneration and demyelination (table 1, 2). the neurophysiologic investigations showed slowing of the sensory and motor conduction velocities, delay of the distal latencies and f - wave latencies of the motor nerves, and delay of the h - reflex latency of the tibial nerve. the liver enzyme activity on day 3 after amiodarone withdrawal was as follows : serum aspartate aminotransferase 31 the patient fully recovered from the muscle weakness and nausea at 1 month after the cessation of amiodarone. amiodarone is lipophilic, and so it accumulates in lipid - laden organs such as the liver. amiodarone and its major metabolite, n - desethylamiodarone, accumulate in the lysosomes of the hepatocytes, kupffer cells and bile duct epithelium. the cationic amphophilic amiodarone molecule binds to phospholipids in the lysosomes and forms a nondigestable complex7, 8). the presence of foam cells in the hepatic sinusoids on light microscopy and the membrane - bound lysosomal structures (lamellated inclusions) or the crystalloid inclusions on electron microscopy suggest phospholipidosis3, 7, 9). these finding, such as foam cells in the hepatic sinusoids and crystalloid inclusions were also seen on our studies. it is uncertain whether hepatocellular injury is due to phospholipidosis6) or the metabolic effects of amiodarone and its metabolites3, 9). yet the accumulation of lamellated inclusion bodies suggests a drug - induced disturbance of both lipid metabolism and lysosomal function6). rheumatic diseases were excluded because there were no abnormal clinical findings or autoimmune antibodies except for serum antinuclear antibody. peripheral neuropathy associated with amiodarone was first reported by kaeser in 197410). three types of neuropathy have been reported, that is, axonal by meier), demyelinating by kaeser), and mixed by dudognon). pellissier described that the neuropathy is of a sensorimotor type14). in that study, the daily dose of amiodarone until the onset of neuropathy was 50~1,800 mg, and the treatment duration was 1~168 months14) ; there was no correlation between neuropathy and the daily dose, the total dose or treatment duration. these discrepancies of the dose and treatment duration may suggest interindividual variability of amiodarone metabolism14). in our current case, leg weakness occurred 14 months after starting medication with a daily dose of 400 mg amiodarone, and walking difficulty happened after 16 months. examination of the sural nerves showed characteristic amiodarone - induced lamellated inclusions in many cell types. these inclusions are known to be lysosomal in origin, and they are a characteristic finding of amiodarone - induced neuropathy15). the peripheral neuropathy is generally resolved within 3 days to 3 months of discontinuing amiodarone16). in our case, the patient 's muscle weakness improved after 2 weeks and ambulation was possible at 1 month after the cessation of taking amiodarone. even though we did not perform an electron microscopic exam on the sural nerve, we consider the neurologic findings of our patient to be amiodarone - induced neuropathy for many reasons. not only because of the test results such as the mixed sensorimotor polyneuropathy findings on nerve conduction velocity studies and electromyography, and the demyelination findings on the sural nerve biopsy, but also the clinical findings such as muscle weakness and the improvement after cessation of amiodarone are enough to make the correct diagnosis. that the patients had no other definite cause for neuropathy also supports our diagnosis. careful questioning of past drug exposure is essential for any patient with altered biochemical liver tests and neurologic symptoms. we suggest that amiodarone should be withdrawn if a patient shows neurologic symptoms or if the liver function test results are abnormal. by doing so | amiodarone chlorhydrate is a diiodated benzofuran derivative, and it is used to treat cardiac rhythm abnormalities. hepatotoxicity is a relatively uncommon side effect of amiodarone, and symptomatic hepatic dysfunction occurs in fewer than 1% of the patients taking amiodarone. cirrhosis is a rare complication that 's been confirmed in 12 cases. peripheral neuropathy occurs in 10% of patients taking aminodarone. we report here on an unusual case of amiodarone - induced hepatotoxicity and peripheral neurotoxicity. a 75 year old man with normal liver function was given amiodarone for treating his atrial fibrillation and heart failure. he developed nausea, vomiting, muscle weakness and wasting after 17.8 months therapy with amiodarone (400 mg orally once per day). liver biopsy showed the presence of foam cells in the hepatic sinusoids and mallory bodies in the periportal hepatocytes on light microscopy. sural nerve biopsy showed demyelination, and nerve conduction studies showed mixed sensorimotor polyneuropathy. these observations show the necessity of monitoring the hepatic function and conducting neurologic examination of the patients treated with amiodarone. |
osteochondromas usually arise from the metaphyseal region of the growing skeleton, particularly around the knee and proximal femur.1 solitary synovial osteochondromas are rarely seen. usually arising from the juxta - articular soft tissues without attaching to the bone, these lesions can be large and show clinical and radiological features of a malignant process.2 this report is about a 64-year - old woman with no history of trauma. she had a history of dull pain and a progressive limited range of motion of the right knee that had been ongoing for 3 years. in this report, there is an unusual presentation of an uncommon disease that is not widely known by orthopedic surgeons. a 64-year - old woman came to the authors clinic with pain in the right knee and a limp. the plain radiograph and computed tomography scan showed unexpectedly large and bony (radiodense) structures as loose bodies (a main large one and two small ones) at the lateral compartment of the knee (figure 1a and b). magnetic resonance imaging showed that there were no irregularities or thickening of the cartilaginous cap greater than 1 cm (figure 1c). osteocartilaginous loose bodies were located on the adjacent lateral meniscus and joined with the lateral meniscus at the end. initial diagnostic arthroscopy was performed and no chondral lesion or additional pathology that needed additional microfracture or antegrade drilling were detected. the lateral meniscus was crushed and almost destroyed due to a mass of large osteocartilaginous loose bodies. the joint was washed with saline solution and cleaned from remaining parts of osteocartilaginous loose bodies. following the excision, the patient had a good postoperative period without complications and the knee pain resolved within 3 months following the operation. histopathological examination revealed the characteristic pattern of an osteochondroma which was covered by a thick cartilage cap with fibrous capsules next to fibrocartilaginous meniscus tissue. at the chondro - osseous junction, endochondral ossification, forming bony trabecula, the most important finding of this study is realizing the fact that synovial osteochondromas can mimic a giant loose body of the knee. the name of this disease changes from extraskeletal osteochondroma, extraskeletal cartilaginous tumor, and para - articular extraskeletal osteochondroma to solitary synovial osteochondroma. the term solitary synovial osteochondroma was used in this case because the lesion was adjacent to the lateral meniscus directly located in the joint, and therefore a suitable name for this anatomic location. synovial chondromatosis, trevor s disease, or osteochondritis dissecans are classical causes of loose bodies, while the solitary synovial osteochondroma is not. some cases of infrapatellar fat pads, posterior joint cavity or not protruding into the joint cavity as para - articular, replacing the anterior cruciate ligament at the intercondylar notch, and soft tissue, capsular, or ossifying chondroma have been reported.39 a search of the literature did not produce a previously published case of solitary synovial osteochondroma adjacent to the lateral meniscus directly located in the joint lateral compartment. an aim of this study was to emphasize the possibility of synovial osteochondroma during the differential diagnosis of osteocartilaginous loose bodies in the knee joint. these type of tumors arise from the synovial cells themselves or the primitive cells lying within the synovium.10 these tumors are formed by metaplasia of the synovial cells to chondrocytes, giving rise to the islands of cartilage within the synovium, which can then lead to multiple loose bodies within the joint cavity with secondary mineralization.11 some authors have argued that synovial osteochondroma is a variant of extraskeletal osteochondroma and others have said that synovial osteochondroma is a variant of synovial chondromatosis.7 because of this, there is some controversy about this issue. however, in this case the hypothesis was more reasonable : some of the metaplastic foci or the synovial membrane surface can detach, creating a number of osteocartilaginous loose bodies.10,11 the synovial fluid feeds the loose bodies, which can remain alive and enlarge.5,12,13 there are numerous cases reported in the literature about para - articular located synovial osteochondroma of the knee and a few cases of synovial osteochondroma located on the posterior joint cavity, anterior joint cavity behind the infrapatellar fat pads, and replacing the anterior cruciate ligament at the intercondylar notch. in the current case, the location was intra - articular and adjacent to the lateral meniscus. the classical imaging appearance of synovial chondromatosis is multiple, oval - shaped, well - defined, intra - articular, and homogenous calcified bodies are typically distributed evenly through the joint. these calcifications frequently show a pathognomonic appearance similar to ring - and - popcorn (rice body) or feathery patterns of mineralization.14 in the current case, the osteocartilaginous loose body had a bigger size unlike oval - shaped rice bodies. the plain radiograph and computed tomography scan showed unexpectedly large sized and bony (radiodense) structures as loose bodies (a main large one and two small ones) at the lateral compartment of the knee (figure 1a and b). at magnetic resonance imaging, there were no irregularities or thickening of the cartilaginous cap greater than 2 cm (figure 1c). histopathological examination revealed the characteristic pattern of an osteochondroma which was covered by a thick cartilage cap with fibrous capsules next to fibrocartilaginous meniscus tissue. at the chondro - osseous junction, endochondral ossification, forming bony trabecula, trevor s disease, also known as dysplasia epiphysealis hemimelica, is a rare nonhereditary developmental skeletal disorder which affects epiphyses. it most commonly manifests in the medial half of the epiphysis of children and adolescents, with a male - to - female ratio of 3:1.15,16 this disease usually affects lower extremity joints, especially the ankle or knee.17 it can mimic synovial chondromatosis of the joints.18 in the current case, the age of the patient (64 years), certainly far from adolescence, helped to rule out the possibility of trevor s disease. osteochondritis dissecans, posttraumatic osseous fragments, was ruled out by the anamnesis of the patient, which contained no evidence of previous injury. additionally, magnetic resonance imaging and arthroscopic examination revealed no osteochondral defects at the tibial and femoral side. in the current case, there were no irregular appearances and thickening of the cartilaginous cap was smaller than 1 cm. synovial osteochondroma must be considered as a possibility in the cases of loose bodies in the knee joint. | solitary synovial osteochondromas are rarely seen. usually arising from the juxta - articular soft tissues without attaching to the bone, these lesions can be large and show clinical and radiological features of a malignant process. this report is about a 64-year - old woman with no history of trauma. she had a history of dull pain and a progressive limited range of motion that had been ongoing for 3 years. an unusual presentation of an uncommon disease that is not widely known by orthopedic surgeons is reported. |
nonvariceal upper gastrointestinal (ugi) bleeding is defined as bleeding originating at the level of the distal esophagus, stomach, and the duodenum (proximal to the ligament of treitz). nonvariceal ugi bleeding results in the hospitalization of 30 - 100 patients per 100000 population per year, which is two - to - four times more common than lower gi bleeding (1). the most common causes of ugi bleeding are peptic ulcer disease, benign and malignant tumors, gastritis, arteriovenous malformations (such as dieulafoy lesions), mallory - weiss tears, pancreatitis, and iatrogenic causes (2). when medical and endoscopic treatments fail, surgery or interventional embolotherapy are the treatment options. after the first report of selective arterial embolization of gastroepiploic artery for the control of acute gastric bleeding (3), improvements in interventional devices and embolic materials and wider availability of skilled interventional radiologists have increased the utility of embolization procedures in the management of ugi bleeding. the typical candidate patient presents with the following : 1) massive bleeding (transfusion requirement of at least 4 u blood over 24 hours) or hemodynamic compromise (systolic blood pressure 100 beats per minute or clinical shock), 2) endoscopy - refractory acute ugi bleeding, 3) recurrent bleeding after surgery. in general, the more hemodynamically unstable a patient is, the greater the chance of identifying the source of bleeding. there are no absolute contraindications because angiography and embolization may be needed as lifesaving procedures. for patients with severe reactions to iodinated contrast media, alternative. there is increased risk of gastric or duodenal infarction after embolotherapy in patients with previous extensive ugi surgery or radiotherapy. if the rate of bleeding is massive, surgery may be preferable to angiography, since angiography may not be able to control the bleeding as quickly as surgery (4). screen - film arteriography can demonstrate bleeding at rates as low as 0.5 ml / min in a canine model (5), but in vitro studies suggest that digital subtraction arteriography is five to nine times more sensitive than screen - film arteriography in detecting hemorrhage (6), which seems to be equivalent to detection rates of scintigraphic images (7). the major limitation of angiography relates to the intermittent nature of bleeding, which can result in a negative study if the bleeding has temporarily stopped at the time of contrast injection. glucagon and buscopan may be given before the procedure to decrease bowel motility and motion artifacts during digital subtraction angiography (8). aortograms are usually not performed, since visualization of contrast extravasation into the gi tract requires more selective injection (4). the vessel selected first should be based on the suspicion of the likely source of bleeding according to history, clinical signs, as well as localization provided by scintigraphic images or computed tomography scans. for ugi bleeding, if there is no sign of active bleeding on injection of the main trunks, more selective injection may be needed. for duodenal or gastric fundus bleeding, the gastroduodenal artery (gda), or left gastric arteries, respectively, should be studied (4). obtaining images should be continued until the venous phase has cleared out to help distinguish contrast extravasation from persistent venous opacification. the only direct angiographic sign of ugi bleeding is extravasation of contrast medium into the bowel lumen (2). indirect signs include aneurysms / pseudoaneurysms, vessel irregularity, vessel cutoff and arteriovenous / arterioportal shunting, neovascularity, and increased vascularity from dilated arterioles (as seen in angiodysplasia). when a bleeding source is not identified because gi bleeding is often intermittent, provocative angiography may improve the rate of positive angiographic findings. infusion of tolazoline (vasodilators), heparin, or even thrombolytics like tissue plasminogen activator, stimulate bleeding to allow the pathology to be localized. in one study based on 16 patients with nonlocalized lower gi bleeding from previous endoscopic and angiographic studies, these infusions identified the bleeding site in 37.5% of cases without causing any hemodynamic instability (9). the choice of embolic agent depends on a combination of the vascular anatomy, angiographic findings, the achievable catheter position, and the operator preference (table 1). the most common embolic agents are metallic coils and polyvinyl alcohol (pva) particles (usually 300 - 500 m). use of coils as the only embolic agent is significantly associated with early rebleeding, compared with the use of pva or gelatin sponge with coils (10, 11). use of n - butyl cyanoacrylate (nbca) is advantageous for massive bleeding that requires urgent hemostasis, especially in patients with coagulopathy because of rapid embolization (12). types of embolization can be classified into localized, proximal, and segmental embolizations (fig. proximal embolization is defined when a microcatheter could not enter the bleeding point and embolization is done in its parent artery, while the bleeding point and its distal part are not embolized. segmental embolization is when an adjacent branch artery or arteries are included to be embolized. with proximal embolization, recanalization of the bleeding point can occur due to distal back flow. with excessive segmental embolization, ischemic complications of one of the useful maneuvers in localizing culprit vessels requires clips to be placed around the area of bleeding during pre - embolization endoscopy. the clips remain in position for several hours and allow for an educated guess of the location of the culprit vascular branch (13, 14). if no extravasation is seen despite the injection of contrast, then the branches terminating at the clip are superselected using microcatheter techniques and embolized. rotational angiography can be useful to determine the relationship between the metallic clip and a culprit vessel (14). vasopressin infusion works by constricting the mesenteric vessels and contraction of the smooth muscle in the bowel wall, thus reducing the blood flow to the site of bleeding and inducing the formation of a stable clot at the bleeding site. repeat angiography is performed after 20 minutes to ensure that bleeding has stopped and that the vessels are not overconstricted. it is known to be effective in patients with microcatheter - inaccessible bleeding or diffuse bleeding (such as hemorrhagic gastritis). however, disadvantages include the rate of rebleeding after discontinuation of the infusion, cardiovascular complications, and the difficulty in maintaining a selective catheter position. in one study, the success rate of 52% for vasopressin was inferior than that of 88% for embolization in major gi bleeding (15). a microcatheter is advanced beyond the bleeding site and embolization is done to prevent backflow to the bleeding site. then, the microcatheter is withdrawn, depositing more embolic agent, until the embolization takes place proximal to the bleeding site, using the so - called sandwich technique. likewise, bleeding from the pancreaticoduodenal arcade should be treated by embolizing the arteries both proximal and distal to the lesion. 2). embolization both proximal and distal to the gda stump or stent - graft placement could be an option. although hepatic ischemia or infarction develops in 30 - 40% of patients with embolization of both proximal and distal to the gda stump (fig. 2), patent portal vein and extensive collateral pathways, including the inferior phrenic arteries and gastric arteries, usually serve to protect the liver from ischemic insult (16). stent - graft placement is better than embolization for preserving intrahepatic arterial flow. postembolization ' check ' angiograms from both the celiac axis and sma sides are required to ensure that no collateral supply to the bleeding site is present. packing the sac of the pseudoaneurysm with coils should be avoided because this rebleeding is almost inevitable (16, 17). because the wall of the pseudoaneurysm is weak, the breakdown or rupture of the weaker pseudoaneurysm (than normal adjacent arterial wall) seems to occur after only sac packing with embolic materials. therefore, the sandwich technique of both proximal and distal to the bleeding site should be done. in those cases with microcatheter - inaccessible bleeding point, particulate or liquid embolic agents should be utilized. in cases requiring deeper penetration, screen - film arteriography can demonstrate bleeding at rates as low as 0.5 ml / min in a canine model (5), but in vitro studies suggest that digital subtraction arteriography is five to nine times more sensitive than screen - film arteriography in detecting hemorrhage (6), which seems to be equivalent to detection rates of scintigraphic images (7). the major limitation of angiography relates to the intermittent nature of bleeding, which can result in a negative study if the bleeding has temporarily stopped at the time of contrast injection. glucagon and buscopan may be given before the procedure to decrease bowel motility and motion artifacts during digital subtraction angiography (8). aortograms are usually not performed, since visualization of contrast extravasation into the gi tract requires more selective injection (4). the vessel selected first should be based on the suspicion of the likely source of bleeding according to history, clinical signs, as well as localization provided by scintigraphic images or computed tomography scans. for ugi bleeding, if there is no sign of active bleeding on injection of the main trunks, more selective injection may be needed. for duodenal or gastric fundus bleeding, the gastroduodenal artery (gda), or left gastric arteries, respectively, should be studied (4). obtaining images should be continued until the venous phase has cleared out to help distinguish contrast extravasation from persistent venous opacification. the only direct angiographic sign of ugi bleeding is extravasation of contrast medium into the bowel lumen (2). indirect signs include aneurysms / pseudoaneurysms, vessel irregularity, vessel cutoff and arteriovenous / arterioportal shunting, neovascularity, and increased vascularity from dilated arterioles (as seen in angiodysplasia). when a bleeding source is not identified because gi bleeding is often intermittent, provocative angiography may improve the rate of positive angiographic findings. infusion of tolazoline (vasodilators), heparin, or even thrombolytics like tissue plasminogen activator, stimulate bleeding to allow the pathology to be localized. in one study based on 16 patients with nonlocalized lower gi bleeding from previous endoscopic and angiographic studies, these infusions identified the bleeding site in 37.5% of cases without causing any hemodynamic instability (9). the choice of embolic agent depends on a combination of the vascular anatomy, angiographic findings, the achievable catheter position, and the operator preference (table 1). the most common embolic agents are metallic coils and polyvinyl alcohol (pva) particles (usually 300 - 500 m). use of coils as the only embolic agent is significantly associated with early rebleeding, compared with the use of pva or gelatin sponge with coils (10, 11). use of n - butyl cyanoacrylate (nbca) is advantageous for massive bleeding that requires urgent hemostasis, especially in patients with coagulopathy because of rapid embolization (12). types of embolization can be classified into localized, proximal, and segmental embolizations (fig. proximal embolization is defined when a microcatheter could not enter the bleeding point and embolization is done in its parent artery, while the bleeding point and its distal part are not embolized. segmental embolization is when an adjacent branch artery or arteries are included to be embolized. with proximal embolization, recanalization of the bleeding point can occur due to distal back flow. with excessive segmental embolization one of the useful maneuvers in localizing culprit vessels requires clips to be placed around the area of bleeding during pre - embolization endoscopy. the clips remain in position for several hours and allow for an educated guess of the location of the culprit vascular branch (13, 14). if no extravasation is seen despite the injection of contrast, then the branches terminating at the clip are superselected using microcatheter techniques and embolized. rotational angiography can be useful to determine the relationship between the metallic clip and a culprit vessel (14). vasopressin infusion works by constricting the mesenteric vessels and contraction of the smooth muscle in the bowel wall, thus reducing the blood flow to the site of bleeding and inducing the formation of a stable clot at the bleeding site. repeat angiography is performed after 20 minutes to ensure that bleeding has stopped and that the vessels are not overconstricted. it is known to be effective in patients with microcatheter - inaccessible bleeding or diffuse bleeding (such as hemorrhagic gastritis). however, disadvantages include the rate of rebleeding after discontinuation of the infusion, cardiovascular complications, and the difficulty in maintaining a selective catheter position. in one study, the success rate of 52% for vasopressin was inferior than that of 88% for embolization in major gi bleeding (15). a microcatheter is advanced beyond the bleeding site and embolization is done to prevent backflow to the bleeding site. then, the microcatheter is withdrawn, depositing more embolic agent, until the embolization takes place proximal to the bleeding site, using the so - called sandwich technique. likewise, bleeding from the pancreaticoduodenal arcade should be treated by embolizing the arteries both proximal and distal to the lesion. 2). embolization both proximal and distal to the gda stump or stent - graft placement could be an option. although hepatic ischemia or infarction develops in 30 - 40% of patients with embolization of both proximal and distal to the gda stump (fig. 2), patent portal vein and extensive collateral pathways, including the inferior phrenic arteries and gastric arteries, usually serve to protect the liver from ischemic insult (16). postembolization ' check ' angiograms from both the celiac axis and sma sides are required to ensure that no collateral supply to the bleeding site is present. packing the sac of the pseudoaneurysm with coils should be avoided because this rebleeding is almost inevitable (16, 17). because the wall of the pseudoaneurysm is weak, the breakdown or rupture of the weaker pseudoaneurysm (than normal adjacent arterial wall) seems to occur after only sac packing with embolic materials. therefore, the sandwich technique of both proximal and distal to the bleeding site should be done. in those cases with microcatheter - inaccessible bleeding point, particulate or liquid embolic agents should be utilized. in cases requiring deeper penetration, liquid embolic materials such as nbca six recent representative studies of embolization for nonvariceal ugi bleeding in 299 patients showed technical success rates of 92 - 100% and clinical success rates of 51 - 94% (11, 18 - 22). rebleeding rates were 9 - 47%, rates for surgery were 0 - 35%, and 30-day mortality rates were 3 - 27%. a wide range of clinical success and rebleeding rates, rates for surgery, as well as 30-day mortality rates seem to have originated from different etiologies and clinical severities. major factors associated with rebleeding include coagulopathy, longer time to angiography, massive transfusion, previous surgery, multi - organ system failure, bleeding secondary to trauma, invasive procedures, cancer bleeding (rather than non - cancer bleeding), or use of coils as the only embolic agent (11, 21 - 24). in one study (25), 18 of 32 patients (56%) had a diagnosis of a coagulopathy prior to arrival to the angiographic suite ; the angiographic success rate in this group of patients was 100% and the clinical success rate was 83% in spite of their coagulopathy. for patients with coagulopathy, nbca could be an excellent option because nbca does not depend on the coagulation process (22, 25). in another study (22), coagulopathy was observed in 41% (29/71 patients), and the clinical success rate with and without coagulopathy was not significantly different. because of the intermittent nature of many incidents of ugi bleeding, the incidence of a normal angiogram in a patient with acute upper and lower gi bleeding was 52% (75 out of 143 patients) in one recent report (26). in the latter study, the incidence of an angiographically negative outcome was significantly higher in patients with a stable hemodynamic status, or in patients with lower gi bleeding. during follow - up, most patients (80%, 60/75) with a negative bleeding focus experienced spontaneous resolution of their condition without rebleeding. when no evidence of bleeding is found on angiography, blind or prophylactic embolization (usually with gelatin sponge and/or coils), defined as embolization without angiographic proof of extravasation, could be an alternative and is typically guided by endoscopic information regarding the location of the bleeding vessel (2, 10, 27, 28). although a high rate of clinical success can not be expected with such prophylactic embolization because of possible intermittent nature of the gi bleeding, especially in gastric cancer patients, a significant proportion of such patients will benefit (10, 27, 28). patients with angiographic extravasation show a marked decrease in mortality when embolization is successful, compared with patients requiring surgery after failed embolization (38 vs. 83%) (29). overall, survival is strongly correlated with clinical failure. in one study, patients with a successful embolization had one - sixth of the mortality rate of those with a failed embolization regardless of their clinical condition (11%, 10 of 95 vs. 68%, 44 of 68) (24). coagulopathy, rescue surgery after a failed attempt for embolization, underlying medical problems such as cirrhosis and malignancy, and multisystem organ failure are related with poor survival (2, 10, 24). access site hematoma and pseudoaneurysms, arterial dissection, contrast allergic reactions, and nephrotoxicity can occur with the same frequency as in other endovascular procedures. arterial embolization in the ugi tract above the ligament of treitz is generally considered very safe because of the rich collateral supply to the stomach and duodenum. however, the risk of significant ischemia or stricture could be increased when potential collateral vessels are damaged from previous upper abdominal surgery, radiotherapy, or severe atherosclerosis, or when liquid agents such as nbca, or very small particles advance far into the vascular bed (22, 23, 30) (fig. 4). lang (31) reported a 16% (9/57 patients) incidence rate of duodenal strictures following embolization. if true bowel infarction occurs, surgical resection is generally required. for more chronic ischemic complications such as bowel stricture, balloon dilation may be possible, but surgical resection should be considered if the stricture is resistant to balloon dilation. nontarget embolization involves embolic material inadvertently passing into a vascular bed that was not the intended target. this may result from excessive pressure when injecting flow - directed particles or from buckling of the delivery catheter out of the target vessel during coil deployment. suction with a catheter can be used for some particulate emboli, but errant coils need to be retrieved with snares. a multidisciplinary approach of endoscopists, surgeons, and interventional radiologists is important. with improvements in catheter - based therapy and endovascular device development, angiography and embolization procedures interventional radiologists should also be familiar to several clinical and technical factors which affect the clinical outcome of embolotherapy in certain settings. | nonvariceal upper gastrointestinal (ugi) bleeding is a frequent complication with significant morbidity and mortality. although endoscopic hemostasis remains the initial treatment modality, severe bleeding despite endoscopic management occurs in 5 - 10% of patients, necessitating surgery or interventional embolotherapy. endovascular embolotherapy is now considered the first - line therapy for massive ugi bleeding that is refractory to endoscopic management. interventional radiologists need to be familiar with the choice of embolic materials, technical aspects of embolotherapy, and the factors affecting the favorable or unfavorable outcomes after embolotherapy for ugi bleeding. |
gingivitis and periodontal disease are frequent concomitant phenomena of orthodontic treatment with fixed appliances. it seems that the main factor for an increased accumulation of dental plaque and inflammatory response is the appearance of new retentive places around the components of fixed appliances attached to the teeth. several studies have addressed the impact of fixed, removable, and myofunctional orthodontic / orthopedic appliances or retainers in relation to supragingival plaque accumulation and gingivitis. the quantity, as well as the quality of plaque, is influenced by many factors including surface characteristics, surface roughness and surface free energy and bracket design, frequency of sucrose exposition. the presence of gingival inflammation will further increase plaque growth. because of its outstanding aesthetic preconditions and its growing practicability, lingual orthodontics accounts for an ever - increasing percentage of orthodontic treatments. oral hygiene is even more important for therapy with lingual brackets than for therapy with labial brackets because control is more difficult from the lingual face than from the buccal face, and plaque accumulations, gingivitis, and demineralization are not detected by the patient. most microbiological investigations have been performed during orthodontic treatment but there are no studies dealing with the difference between buccal and lingual brackets. accordingly, the purpose of the present investigation was to evaluate the influence of buccal and lingual orthodontic appliances on microbiological and periodontal parameters of bonded teeth. the null hypothesis of the study was that there is no significant difference in terms of microbiological environment and clinical periodontal parameters between buccal and lingual brackets. twenty dental students (14 females and 6 males, caucasians aged between 20 and 32 years) were involved in the study (table 1). they were given a written explanation of the background of the study and its objectives. after screening for their suitability and after good comprehension of the protocol, they all gave their written informed consent. during the experiment before the study, all students received oral hygiene instructions in order to ensure a healthy periodontal situation. study population with data on gender distribution, previous orthodontic treatment and age sd= standard deviation the initial placement of the brackets was performed via a randomized protocol by means of concealed envelopes. the students were selected to fulfill the following inclusion criteria : no smoking, absence of extensive dental restorations or adhesive - fixed partial dentures, a sulcus bleeding index of 0.05). the upper part displays the means per site ; the lower part the differences between the sites with the corresponding p - values. sd= standard deviation in table 3, the results are separately depicted per day and per material. buccal sites showed no significant differences from lingual sites (p>0.05) for either streptococci, anaerobe or total cfu counts. the mean pocket depth (ppd) measurements in millimeters, displayed per day and per site with the corresponding standard deviations (sd) no significant inter - material differences in ppd were present among the various groups. no significant increase in ppd was recorded (p>0.05) on days 7 and 30 for either buccal or lingual bracket position and for control sites. no significant differences (p>0.05) in bop sites were detected among the different groups at different times. the numbers of streptococci, anaerobic and total cfu in supragingival plaque samples during the experimental period showed no significant differences days combined (table 2). buccal sites in general allowed equal plaque formation than the lingual sites (p>0.05). the upper part displays the means per site ; the lower part the differences between the sites with the corresponding p - values. sd= standard deviation in table 3, the results are separately depicted per day and per material. buccal sites showed no significant differences from lingual sites (p>0.05) for either streptococci, anaerobe or total cfu counts. the mean pocket depth (ppd) measurements in millimeters, displayed per day and per site with the corresponding standard deviations (sd) no significant inter - material differences in ppd were present among the various groups. no significant increase in ppd was recorded (p>0.05) on days 7 and 30 for either buccal or lingual bracket position and for control sites. no significant differences (p>0.05) in bop sites were detected among the different groups at different times. the present experiment with split - mouth design did not detect any significant difference in periodontal and microbiological parameters between the bonded teeth and the non - bonded control teeth or between the groups with brackets bonded onto buccal and lingual sides. a number of studies have investigated the influence of orthodontic therapy and appliances on the oral microbial flora. these changes could potentially have a significant impact on patient oral health, including gingival inflammation and demineralization of teeth. moreover, in literature, orthodontic therapy was associated with 0.03 millimeters of gingival recession, 0.13 mm of alveolar bone loss and 0.23 mm of increased pocket depth when compared with no treatment. the effects of orthodontic therapy on gingivitis and attachment loss are inconsistent across studies. (2002) evaluated microbial profile on metallic and ceramic bracket materials and found that composition of dental plaque formed on each bracket type is very similar between the two bracket types and may be of limited clinical significance. furthermore, the differences detected do not favor one bracket type over another with respect to bacterial accumulation. other authors evaluated influence of bracket design on microbiological and periodontal parameters showing both anaerobe and aerobe colony - forming units significantly higher for self - ligating brackets than for conventional brackets. microbial and periodontal parameters have been evaluated also for orthodontic bands, conventional stainless steel brackets, ceramic attachments, and self - ligating brackets. in literature these brackets have been investigated about their laboratory and clinical processes and for particular recommendations on oral hygiene. those authors showed that special emphasis should be placed on the oral hygiene of patients with lingual brackets and that excellent oral hygiene is possible in patients with lingual devices after instruction and motivation. the results of the present investigation showed no significant differences in total cfu, streptococci cfu and anaerobe cfu counts among buccal, lingual and control sites. this is in agreement with a previous investigation that evaluated cfu of buccal brackets versus control non - bonded sites and showed no significant differences between the two groups. there are also authors that found significant cfu count decrease or increase in bracket sites compared with control sites. this variability is probably due to the different testing conditions and multiple variables correlated with clinical researches. moreover, in the present study, ppd and bop measurements were analyzed and showed no significant differences among buccal, lingual and control sites. this is in agreement with previous studies that evaluated these periodontal parameters using conventional brackets : all of them showed no significant increase of bop and ppd after brackets placement. there are also studies that detected significant increase of ppd and bop after bracket placement. this variability could be due to different orthodontic bracket materials that have dissimilar clinical manifestations. the limits of the present study would be that the population of the present investigation was represented by dental students, who are expected to maintain better oral hygiene than the general population. hygiene regimen of subjects in the trial can be reached also in the general population only if adequately motivated. in fact, even if in recent decades, decreasing prevalence in dental caries has been observed worldwide correct teaching of hygiene protocols is crucial, especially during orthodontic treatment. therefore, even if in the present investigation buccal or lingual bracket position did not have significant impact on ppd and bop periodontal parameters, dental health promotion should be fully integrated into broadly based health - promoting strategies. oral hygiene another issue is represented by the presence of wires used during the regular orthodontic treatment. the wires and brackets work together to limit hygiene and therefore a further development of the present study could include also this aspect. future investigations should be performed to visualize the potentially different periodontal parameters correlated with different orthodontic bracket systems so that brackets can be designed to reduce plaque adhesion. this study demonstrated the following : 1. buccal or lingual bracket position does not have a significant impact on ppd and bop periodontal parameters ; buccal or lingual bracket position does not have significant impact on streptococci, anaerobe and total cfu counts. the authors wish to thank 3 m and forestadent for providing the materials tested in this study. | objectivelingual orthodontics is becoming more popular in dental practice. the purpose of the present investigation was to compare plaque formation on teeth bonded with the same bracket onto buccal or lingual surface, with non - bonded control teeth, via an in vivo growth experiment over a 30-day period. material and methodsa randomized controlled trial with split - mouth design was set up enrolling 20 dental students. within each subject sites with buccal and lingual brackets and control sites were followed. clinical periodontal parameters (periodontal pocket depth : ppd ; bleeding on probing : bop) were recorded at baseline and on days 1, 7 and 30. microbiological samples were taken from the brackets and the teeth on days 1, 7 and 30 to detect colony - forming units (cfu). total cfu, streptococci cfu and anaerobe cfu were measured. resultsno significant differences (p>0.05) were found between buccal and lingual brackets in terms of clinical periodontal parameters and microbiological values. conclusionbracket position does not have significant impact on bacterial load and on periodontal parameters. |
prostate cancer (pc) is the most common male cancer in the united states, with 233,000 new cases in 2014, and is the second most common cause of cancer - related death. in korea, pc is currently the fourth most common male cancer, while age - standardized prevalence rate of pc in korean men is 129.0 per 100,000 in 2011. the annual incidence rate of pc in korean men has shown the most rapid increase among cancer types, except for thyroid cancer, in recent decades (age - standardized incidence rate/100,000, 8.4% at 1999 and 27.0% at 2012). multiple reasons including population aging, westernization of diet and increase of prostate - specific antigen (psa) screening are likely to be implicated in such increase of pc in korea. treatment options for pc vary depending on disease severity and patient characteristics including age, comorbidity, and personal preferences. in addition, sociodemographic characteristics, including race, place of residence, income level, and insurance status [4 - 6 ], as well as clinician factors, may play a role in treatment decisions for pc. pc is a highly prevalent disease and has a public health impact in western countries, therefore many studies regarding trends in treatment patterns, causes of death, and impact of sociodemographic factors on patient outcomes have been reported based on large population - based cohorts [5 - 7 ]. however, despite the aforementioned rapid increase of pc in korea, only a few studies regarding treatment patterns of pc in korean men on the basis of a nationwide representative database have been reported. through a better understanding of treatment patterns in korean pc patients, we will gain insight into the current status of pc in korea. in this study, we investigated changing patterns of primary treatment in korean men with pc and impact of sociodemographic factors on primary treatment choice from a nationwide cohort over 10 years. data were obtained from 2002 to 2013 from the korean national health insurance (knhi) sharing service provided by knhi center. these data contain claims data in 2% of the entire korean population (i.e., more than 1,000,000 people) randomly selected after stratifying the entire population according to socioeconomic parameters (age, sex, residential area, income, etc.). the database includes detailed information regarding disease diagnosed, imaging and laboratory tests, treatments (both medical and surgical) and death outcomes (cause and time) as well as aforementioned socioeconomic parameters. the study protocol was approved by the institutional review board of eulji university hospital and asan medical center. data with the code c61, indicating pc according to the national center for health statistics international classification of diseases, 10th edition (icd-10), were screened. among 4,219 men aged 20 or older with the code c61 during the study period, newly diagnosed pc patients only after 2002 in addition, patients who did not undergo active treatments for pc (n=2,702), including those under watchful waiting or active surveillance, were excluded because they were not properly identifiable from the knhi claims data. thus, a total of 1,382 patients who had undergone active treatments, including radical surgery, radiation therapy (rt), and androgen deprivation therapy (adt), for newly diagnosed pc constituted the study population. we analyzed treatment patterns in terms of primary treatment modality including surgery, rt, and adt. we also assessed the administration and timing of additional treatment before and after primary treatment. neoadjuvant therapy was defined as additional therapy before primary surgery and rt, while adjuvant and salvage therapy was defined as additional therapy within 4 months and after 4 months after surgery, respectively. surgery includes open / laparoscopic radical prostatectomy (rp ; knhi reimbursement code r3950 and r3960) and robot - assisted rp (rarp). because rarp is not reimbursed by knhi, it can not be identified by treatment codes. thus, rarp was operationally defined as the absence of a surgery code despite the presence of general anesthesia (code l1211) and postoperative pathologic examination code (code c5500 or c5504 or c5505 or c5508 or c5918 or although patients underwent additional therapy before and after surgery and rt, they were categorized in terms of their primary treatment modality. medical castration includes luteinizing hormone - releasing hormone (lhrh) agonist only, anti - androgen only, and combined androgen blockade (cab). because chemotherapy is administered to patients who progress after primary treatment and salvage therapy, it was not categorized as primary treatment. patient age at diagnosis was divided into four categories (< 49, 50 - 64, 65 - 74, and 75 years). residential area was divided into three categories (metropolitan, urban, and suburban / rural) based on population density. annual p for trend was determined by wilcoxon - type test for trend across ordered groups. multivariable multinomial logistic regression analysis was used to determine the adjusted odds ratios (or) and 95% confidence intervals (ci) of sociodemographic factors that showed significant association with treatment choices (based on the surgery group). data were obtained from 2002 to 2013 from the korean national health insurance (knhi) sharing service provided by knhi center. these data contain claims data in 2% of the entire korean population (i.e., more than 1,000,000 people) randomly selected after stratifying the entire population according to socioeconomic parameters (age, sex, residential area, income, etc.). the database includes detailed information regarding disease diagnosed, imaging and laboratory tests, treatments (both medical and surgical) and death outcomes (cause and time) as well as aforementioned socioeconomic parameters. the study protocol was approved by the institutional review board of eulji university hospital and asan medical center. data with the code c61, indicating pc according to the national center for health statistics international classification of diseases, 10th edition (icd-10), were screened. among 4,219 men aged 20 or older with the code c61 during the study period, newly diagnosed pc patients only after 2002 in addition, patients who did not undergo active treatments for pc (n=2,702), including those under watchful waiting or active surveillance, were excluded because they were not properly identifiable from the knhi claims data. thus, a total of 1,382 patients who had undergone active treatments, including radical surgery, radiation therapy (rt), and androgen deprivation therapy (adt), for newly diagnosed pc constituted the study population. we analyzed treatment patterns in terms of primary treatment modality including surgery, rt, and adt. we also assessed the administration and timing of additional treatment before and after primary treatment. neoadjuvant therapy was defined as additional therapy before primary surgery and rt, while adjuvant and salvage therapy was defined as additional therapy within 4 months and after 4 months after surgery, respectively. surgery includes open / laparoscopic radical prostatectomy (rp ; knhi reimbursement code r3950 and r3960) and robot - assisted rp (rarp). because rarp is not reimbursed by knhi, it can not be identified by treatment codes. thus, rarp was operationally defined as the absence of a surgery code despite the presence of general anesthesia (code l1211) and postoperative pathologic examination code (code c5500 or c5504 or c5505 or c5508 or rt includes all types of rt including conformal and intensity - modulated rt. although patients underwent additional therapy before and after surgery and rt, they were categorized in terms of their primary treatment modality. medical castration includes luteinizing hormone - releasing hormone (lhrh) agonist only, anti - androgen only, and combined androgen blockade (cab). because chemotherapy is administered to patients who progress after primary treatment and salvage therapy, it was not categorized as primary treatment. patient age at diagnosis was divided into four categories (< 49, 50 - 64, 65 - 74, and 75 years). residential area was divided into three categories (metropolitan, urban, and suburban / rural) based on population density. annual p for trend was determined by wilcoxon - type test for trend across ordered groups. multivariable multinomial logistic regression analysis was used to determine the adjusted odds ratios (or) and 95% confidence intervals (ci) of sociodemographic factors that showed significant association with treatment choices (based on the surgery group). there were 83 patients (15.3%) in the lowest income classes (class 0 - 2), and the greatest percentage (39.1%) was in the highest income classes (class 9 - 10). approximately one fourth of patients lived in a metropolitan area, and over 50% of patients lived in a suburban or rural area. of the entire study population, patients undergoing surgery, adt, and rt were 38.8%, 48.4%, and 12.8%, respectively. overall, the total number of patients undergoing active treatments for pc showed a significant increase. 1, the total number of cases increased from 58 in 2003 to 152 in 2013, corresponding to a 162% increase during 10 years. of the treatment modalities, surgery cases showed the most significant increase, thus relative proportion increased from 22.4% in 2003 to 45.4% in 2013 (p for trend < 0.001). while adt cases have increased, the relative proportion of adt showed a tendency to decrease, from 60.3% in 2003 to 45.4% in 2013 (p for trend=0.020). while rt cases increased slightly over the 10 years, the relative proportion was variable (17.2% in 2003, 18.4% in 2006, 7.2% in 2009, and 9.2% in 2013) and the increment of change was relatively small compared to that of surgery and adt cases (p for trend=0.034). while rp cases have shown a steady increase, rarp cases have shown a more rapid increase, thus rarp cases exceeded rp cases in 2013 (fig. regarding the types of adt, orchiectomy cases showed a remarkable decrease, from over 12% in early 2000s to 1.4% in 2013 (fig. cab was the most commonly used (responsible for more than 62% to 89% of adt), whereas use of lhrh agonists and anti - androgen monotherapy did not show definite trends. treatment patterns differed significantly according to age group (p < 0.001) (fig. 3b), respectively. as expected, surgery was the most common primary treatment in patients younger than 64 years, accounting for 59.0% in < 49 years and 56.1% in 50 - 64 years, respectively (fig. in contrast, surgery was performed in only 7.8% of patients older than 75 years, whereas the majority of those patients (84.4%) underwent adt. patients with higher income showed a tendency for definite therapy including surgery and rt, whereas patients with lower income showed a tendency for adt (fig. while no definite trends were observed, there were differences in primary treatment according to residential area. multivariable multinomial logistic regression analysis was performed to assess independent effects of patient sociodemographic factors on treatment choice. as shown in table 2, patients older than 65 years showed significant association with adt compared to surgery (patients aged 65 - 74 years : adjusted or, 5.72 ; 95% ci, 3.25 to 10.04 ; patients 75 years : adjusted or, 26.59 ; 95% ci, 12.30 to 57.52), while patients older than 75 years showed significant association with rt (adjusted or, 3.01 ; 95% ci, 1.12 to 8.10). patients with higher income levels showed significant association with surgery compared to adt (7 - 8 income class : adjusted or, 0.59 ; 95% ci, 0.38 to 0.90 ; 9 - 10 income class : adjusted or, 0.56 ; 95% ci, 0.38 to 0.82). in addition, patients living in urban areas showed significant association with adt use compared to surgery (adjusted or, 1.47 ; 95% ci, 1.02 to 2.12). as the year increased, the probability of rt use compared to surgery decreased significantly (adjusted or, 0.93 ; 95% ci, 0.87 to 0.99). there were 83 patients (15.3%) in the lowest income classes (class 0 - 2), and the greatest percentage (39.1%) was in the highest income classes (class 9 - 10). approximately one fourth of patients lived in a metropolitan area, and over 50% of patients lived in a suburban or rural area. of the entire study population, patients undergoing surgery, adt, and rt were 38.8%, 48.4%, and 12.8%, respectively. overall, the total number of patients undergoing active treatments for pc showed a significant increase. as shown in fig. 1, the total number of cases increased from 58 in 2003 to 152 in 2013, corresponding to a 162% increase during 10 years. of the treatment modalities, surgery cases showed the most significant increase, thus relative proportion increased from 22.4% in 2003 to 45.4% in 2013 (p for trend < 0.001). while adt cases have increased, the relative proportion of adt showed a tendency to decrease, from 60.3% in 2003 to 45.4% in 2013 (p for trend=0.020). while rt cases increased slightly over the 10 years, the relative proportion was variable (17.2% in 2003, 18.4% in 2006, 7.2% in 2009, and 9.2% in 2013) and the increment of change was relatively small compared to that of surgery and adt cases (p for trend=0.034). while rp cases have shown a steady increase, rarp cases have shown a more rapid increase, thus rarp cases exceeded rp cases in 2013 (fig. 2a). regarding the types of adt, orchiectomy cases showed a remarkable decrease, from over 12% in early 2000s to 1.4% in 2013 (fig. cab was the most commonly used (responsible for more than 62% to 89% of adt), whereas use of lhrh agonists and anti - androgen monotherapy did not show definite trends. treatment patterns differed significantly according to age group (p < 0.001) (fig. 3b), respectively. as expected, surgery was the most common primary treatment in patients younger than 64 years, accounting for 59.0% in < 49 years and 56.1% in 50 - 64 years, respectively (fig. in contrast, surgery was performed in only 7.8% of patients older than 75 years, whereas the majority of those patients (84.4%) underwent adt. patients with higher income showed a tendency for definite therapy including surgery and rt, whereas patients with lower income showed a tendency for adt (fig. while no definite trends were observed, there were differences in primary treatment according to residential area. multivariable multinomial logistic regression analysis was performed to assess independent effects of patient sociodemographic factors on treatment choice. as shown in table 2, patients older than 65 years showed significant association with adt compared to surgery (patients aged 65 - 74 years : adjusted or, 5.72 ; 95% ci, 3.25 to 10.04 ; patients 75 years : adjusted or, 26.59 ; 95% ci, 12.30 to 57.52), while patients older than 75 years showed significant association with rt (adjusted or, 3.01 ; 95% ci, 1.12 to 8.10). patients with higher income levels showed significant association with surgery compared to adt (7 - 8 income class : adjusted or, 0.59 ; 95% ci, 0.38 to 0.90 ; 9 - 10 income class : adjusted or, 0.56 ; 95% ci, 0.38 to 0.82). in addition, patients living in urban areas showed significant association with adt use compared to surgery (adjusted or, 1.47 ; 95% ci, 1.02 to 2.12). as the year increased, the probability of rt use compared to surgery decreased significantly (adjusted or, 0.93 ; 95% ci, 0.87 to 0.99). to the best of our knowledge, this is the first study investigating changing patterns of primary treatment in korean pc patients over 10 years from a nationwide population based cohort. in line with a rapid increase in the incidence and prevalence of pc in korean men, remarkable increase in surgery cases is probably attributable to early detection of pc due to psa screening. although clinical benefit of routine psa screening remains controversial, psa screening in korea has increased with increase of routine health check - up compared to the past. notably, while the number of patients undergoing surgery showed a significant increase, the relative proportion of patients undergoing rt was variable over 10 years (from 7.2% to 18.4%). in western countries, rt is a main treatment modality for radical treatment of pc, thus its use constitutes from 19% to 41% for definite therapy. these findings indicate that the main treatment modality for radical treatment in korean pc patients is surgery, whereas rt is relatively underused. in korea, the majority of pc patients are diagnosed by urologists, therefore dominant use of surgery as primary definite therapy may in part be attributable to clinician factors. in addition, because most private medical insurance in korea reimburses only inpatients but does not reimburse outpatients, such economic factors may affect patients treatment choice. similar to our finding, only 4.9% of patients chose rt as primary treatment for pc in a japanese study. in that study, attitude of japanese patients, who rarely ask for a second opinion from a clinician, was suggested as one possible reason for this finding. regarding surgical modalities, we found that use of rarp has increased since its introduction in 2005, and the number of cases showed a remarkable increase in 2008 because the installation of the da vinci surgical system increased dramatically in 2008, consistent with a recent study which reported an increasing trend of the total number of rarp on the basis of the data from intuitive surgical korea ltd. existing evidence, including ours, has shown comparable or superior oncological and functional outcomes (incontinence and potency) between rarp and rp, although several studies reported conflicting results regarding this issue. in addition, besides the high initial cost of purchasing a robot, rarp is not reimbursed by knhi. thus economic cost of rarp is significantly higher than that of rp. to address the question of whether rarp is more beneficial than rp in terms of cost - effectiveness, further critical assessment of the economics involved in the two surgical modalities is necessary adt is still commonly used for treatment of korean pc patients, accounting for more than 60% in 2003 and 45% in 2013, although its use showed a tendency to decrease. we observed two main findings regarding adt use in korea : surgical castration has seldom been used (less than 1.4%) recently, and the majority (60% to 88.9%) of korean urologists use cab for primary adt. because knhi data do not include information regarding clinical stage, we can not address the proportions of adt use according to clinical stage. considering the aforementioned increase of early pc detection, a significant proportion of patients with localized pc may still undergo adt as primary therapy, which is of uncertain benefit in this setting, due to various reasons including patient anxiety and clinician factors. in a us population - based study using the surveillance, epidemiology, and end results - medicare linked database, urologists with no academic affiliation were significantly more likely to use primary adt for localized pc compared to urologists with a major academic affiliation. some (approximately 10% during the study period) urologists use anti - androgen monotherapy, which is not recommended based on existing evidence. these findings represent variation in adt use that is affected by clinician practice style in addition to tumor or patient characteristics. we confirmed the impact of each sociodemographic factor (i.e., age, income class, and residential area) on treatment choice even after adjusting other parameters (table 2). as expected, older patients showed significant association with adt or rt. this finding may indicate that patients with higher income are more likely to undergo routine health check - up and be diagnosed with early stage pc, thus being more predisposed to surgery. similar finding was observed in other studies that reported an inverse relationship between poverty and surgery rates. 4) and significant association between urban area and adt use compared to surgery (table 2). these regional variations may be attributable to differences in the availability of treatment modalities and consequential discrepancies of information given to patients. we acknowledge several possible limitations of our study. because data regarding clinical and pathologic stage are not available in the knhi database, treatment patterns according to stage and multivariable multinomial logistic regression analysis adjusting for stage could not be analyzed. in addition, the proportion of korean pc patients on watchful waiting or active surveillance, which is a reasonable treatment option in low risk pc patients, could not be determined because those options do not have a knhi reimbursement code. for a similar reason, rarp was operationally defined, thus the estimated number of rarp cases may be somewhat different from the actual number of cases. countering the possible limitations, our results are based on a nationwide, randomly selected population based cohort, thus generalizable to the entire korean pc population. considering that our estimated number of rarp cases is consistent with the recently published result, we believe that our operational definition for rarp appropriately represents an overall increasing trend of rarp in korea. in addition, analysis of time trends over 10 years highlights changing patterns of primary treatment for pc in korea. because our study included only patients who had undergone active treatments for newly diagnosed pc, we believe that confounding effects due to diagnosis coding errors in claims data would be minimal. while total cases of active treatments for pc showed a significant increase, the treatment pattern in korean pc patients has changed remarkably over the last 10 years. the proportion of patients undergoing surgery has increased significantly while the proportion of patients undergoing rt has been relatively constant. our results will be valuable in overviewing changing patterns of primary treatment in korean pc patients and planning future health policy for pc. | purposewe investigated changing patterns of primary treatment in korean men with prostate cancer (pc) and impact of sociodemographic factors on treatment choice from a nationwide cohort over 10 years.materials and methodswe conducted a cohort study of a 2% nationwide random sample of korean national health insurance. a total of 1,382 patients who had undergone active treatments for newly diagnosed pc between 2003 and 2013 were included. time trends in primary treatment of pc, including radical surgery, radiation therapy (rt), and androgen deprivation therapy (adt) were analyzed.resultstotal number of patients undergoing active treatments increased significantly (162%). surgery cases showed the most significant increase, from 22.4% in 2003 to 45.4% in 2013, while the relative proportion of adt showed a tendency to decrease from 60.3% in 2003 to 45.4% in 2013, and the relative proportion of rt was variable over 10 years (from 7.2% to 18.4%). while treatment patterns differed significantly according to age (p < 0.001) and income classes (p=0.014), there were differences in primary treatment according to residential area. in multinomial logistic regression analysis, older patients showed significant association with adt or rt compared to surgery, while patients with higher income showed significant association with surgery.conclusiontreatment pattern in korean pc patients has changed remarkably over the last 10 years. sociodemographic factors do affect the primary treatment choice. our results will be valuable in overviewing changing patterns of primary treatment in korean pc patients and planning future health policy for pc. |
human association studies often involve a large number of genomic markers on different chromosome regions. researchers use these markers to locate candidate regions, and then go through a series of bioinformatic analyses of the regions to find disease - associated candidate genes. frequently, these bioinformatic analyses require the manual gathering of information from many public websites involving several databases. dealing with a huge volume of data from different sources is both time - consuming and error - prone, a problem that is easily magnified when many markers show significant association with a disease. moreover, as genome assemblies and annotations are continually updated, and researchers may collect and download different versions of data over a period of months, there is a risk that some data may be outdated, invalid or inconsistent with others, especially if the major data sources are not primary sources. to alleviate this situation, we have developed genowatch, a real - time batch snp (single nucleotide polymorphism) and strp (short tandem repeat polymorphism) overview system, to effectively extract up - to - date information from public domain websites. up to 100 markers can be processed in a batch so that researchers do not have to repetitively perform tedious information retrieval steps. genowatch utilizes real - time web integration to ensure that researchers obtain the same information as when manual browsing. the system greatly increases the throughput of candidate region analysis, avoids acquiring obsolete data following public database updates and reduces possible errors in manual operations. genowatch is very suitable for disease candidate gene selection from candidate regions that are defined either by markers or by chromosome physical positions plus a flanking region. the system accepts two common types of genomic markers snps and strps, and batch processes snp inputs. an snp marker name can be given in dbsnp rs i d or affymetrix probe i d. each target region may be defined and displayed by a single marker or a group of markers that are close to one another, within 1 mbp range. subsequently, genowatch extracts gene information from major public websites such as ncbi (1), uniprot (2), kegg (3), go (4), etc. the information available includes gene function, tissue specificity, disease, subcellular location, pathway, ontology and related pubmed articles from relevant journals (1). during processing the system integrates extracted information from different databases into a carefully designed result page, which is displayed when all processes have been completed. for a batch task, the system positions all input markers on chromosomes and places these on an overview map called genome view at the top of the result page, providing researchers a clear overall picture of their markers, which are colored according to impact risk (5), and of nearby genes in the whole human genome. when a marker on the genome view is clicked, a summary map, gene view, displays not only the marker and its nearby genes but also the distance between them in the region. markers and gene information including their positions on the current assembly, gene ontology from go (4), pathway from kegg (3), function and disease annotation from uniprot (2) and related articles in pubmed (1), can easily be accessed by a click. all extracted and displayed information can be linked to its original source page for verification. genowatch provides researchers an efficient and convenient way to analyze their markers or candidate regions in batch with associated gene annotation data and to perform downstream assays. genowatch, written in java, takes advantage of jakarta struts framework technology to implement model - view - controller (mvc) architecture. to accommodate most users needs at the genowatch input stage, javascript was used to implement a dynamic form with an interactive graph that provides various query options to designate a genome region. to effectively extract data in real - time from different public sources, an asynchronous process is implemented to offer users a request i d for retrieving results later, or to send email notification when the request is completed. users can opt to define a query region using chromosome positions, markers (snp or strp) or a batch file input. for example, they can use physical positions, a single marker (figure 1), or a pair of markers plus downstream and upstream sequence to describe a chromosome region. when users select a query option, the content of the form will show corresponding fields with a graph illustrating the defined region for that option. the system also allows users to extend regions upstream and downstream by dragging the edges of the graph bar or by entering a specific position number in a text box. in addition, the system also accepts batch marker processing to simplify genome - wide candidate gene selection. a batch file has one marker i d or marker name per line for up to 100 markers in a text file. it should be noted that the maximum allowable length of a single candidate region is 4 mbp, to avoid overloading the source websites. after data submission, the system will inform the user of task progress, and then display a results page after all retrieval processes are completed. figure 1.an example to locate a chromosome region by a single snp with 50 kb flanking sequence. an example to locate a chromosome region by a single snp with 50 kb flanking sequence. the results page is comprised of genome view (figure 2), gene view (figure 3) and table view (figure 4). genome view, at the top of the page, displays an overview of input markers in chromosomes from a batch input. each marker displayed in genome view represents a chromosome region for nearby retrieved gene information. if the marker is a snp, its color represents the risk level of functional impact on a gene. the risk analysis currently based on global snp information therefore does not reveal differences among populations. figure 2.an overview of all queried regions in chromosomes from a batch snp input in genome view. figure 3.gene view displays the distribution of snps and genes in a candidate region with snp functional impact risk level, gene annotation and useful links to other online systems for further analysis or primer design. an overview of all queried regions in chromosomes from a batch snp input in genome view. gene view displays the distribution of snps and genes in a candidate region with snp functional impact risk level, gene annotation and useful links to other online systems for further analysis or primer design. clicking on a marker leads to gene view, showing its physical location on a chromosome, the relative positions of neighboring markers and structured genes and a gene list with different levels of gene annotation information. genes shown in both forward and reverse strands are colored blue for a single isoform and purple for multiple isoforms. in addition, pseudogenes are shown in red (for unknown gene structure). the annotation for each gene is accessed through colored squares listed below the summary map. f square is for gene function and gives a general description of functions of the gene or related proteins. t describes the tissue - specific expression of mrna and protein from the gene. diseases associated with the gene or a deficiency of a protein from the gene. the green o (gene ontology) provides information from the go database (4). these colored squares provide an overview of all gene annotation in a particular region. in front of these colored squares, there is a special cross - reference square that provides links to allow the user to submit gene data directly to other online query systems, such as primerz (6) for primer design of a single gene, crosspath (7) for pathway mapping of a group of genes, visualsnp (http://genepipe.ngc.sinica.edu.tw/visualsnp) for snp prioritization of snp markers or genes, hapmap (8) for haplotype analysis, and other sites for microrna (9), genomic variants (10) searches and so on. furthermore, clicking on any of the markers, genes or squares on the maps will lead to table view for additional detailed information. table view tabulates full descriptions of genes shown in gene view, in categories of function, tissue specificity, disease, subcellular location, pathway, ontology and related articles. these descriptions are extracted and integrated from public domain databases (table 1) including ncbi (dbsnp, unists, gene and pubmed databases for snp, strp, gene and literature information, respectively) (1), uniprot (2), kegg (3) and go (4). in addition, a list of related articles from pubmed (1) for each gene is available in the table view. the article titles or abstracts are searched for the gene name as a keyword in 40 prominent research journals. the journals are first selected according to their research relevance, followed by their impact factor as cited in isi journal citation report. the articles are then ranked by their score, with each gene name appearance in a title scoring 5 points and in an abstract, 1 point. table 1.all external resources used in genowatchreference informationpublic websitesglobal snp marker informationncbi dbsnpstrp marker informationncbi unistsgene location and structurencbi entrez genegene annotationgo, uniprotliterature searchncbi pubmedpathwaykeggsnp risk analysisvisualsnp all external resources used in genowatch all result data can also be conveniently exported in csv (comma - separated value) file format for further editing and analysis by clicking the download icon on the upper right corner of each view. genowatch performs multiple real - time queries of independent public databases, and presents well - organized annotated information, both known and predicted, about many genes at once. it greatly simplifies a traditionally time - consuming task by integrating batch marker input, associated gene annotation collection, snp prioritization and primer design in a pipeline style. future work will focus on improving data extraction efficiency by maintaining main public databases locally so that the restrictions on marker number and region length can be relaxed. we expect this system will substantially facilitate the process of finding and analyzing disease candidate genes. | a human gene association study often involves several genomic markers such as single nucleotide polymorphisms (snps) or short tandem repeat polymorphisms, and many statistically significant markers may be identified during the study. genowatch can efficiently extract up - to - date information about multiple markers and their associated genes in batch mode from many relevant biological databases in real - time. the comprehensive gene information retrieved includes gene ontology, function, pathway, disease, related articles in pubmed and so on. subsequent snp functional impact analysis and primer design of a target gene for re - sequencing can also be done in a few clicks. the presentation of results has been carefully designed to be as intuitive as possible to all users.the genowatch is available at the website http://genepipe.ngc.sinica.edu.tw/genowatch |
in this prospective study, patients had uncomplicated senile cataracts in both eyes from grade iii to iv based on emery s classification.10 exclusion criteria were ocular hypertension (iop > 21 mmhg), glaucoma requiring ocular medication, pseudoexfoliation, uveitis, an endothelial cell count less than 1500 cells / mm, corneal opacity, high myopia, previous ocular surgery, systemic disease affecting the inflammatory response such as diabetes mellitus, collagen disease requiring long - term systemic steroids or antiinflammatory drugs, and severe hypertension. patients whose cataract grades were not symmetrical in both eyes were also excluded in this study. intraoperative exclusion criteria were iatrogenic iris damage, retained cortical matter, and a serious complication such as posterior capsule rupture. all patients received a comprehensive ocular examination before treatment and were followed for periodic examinations after the treatments. after informing the patient of the purpose of this study and the possible outcomes, this study was also approved by the ethics committee for clinical research at ntt east japan tohoku hospital using procedures which conformed to the tenets of the declaration of helsinki. all patients had cataract surgery performed in both eyes within a 1 week interval. before cataract surgery, a topical antimicrobial drug, gatifloxacin hydrate 0.3% ophthalmic solution (gatiflo ; senju pharmaceutical co. ltd., osaka, japan), was administered 4 times / day in both eyes of each patient. the surgical technique used in this study consisted of a continuous curvilinear capsulorrhexis (ccc), phacoemulsification, and implantation of a foldable acrylic iol (acryfold ya-65bb ; hoya medicals, tokyo, japan) into the lens capsule through a 3.0 mm corneoscleral incision. the incision was not sutured. in each patient, cataract surgery in the eye with the worst visual acuity was done first, then surgery in the other eye was completed within a week. if the visual acuity in both eyes was the same, then the right eye was chosen first. the effect of 0.1% diclofenac (diclod ; wakamoto pharmaceutical co. ltd., tokyo, japan), which is a phenylacetic acid derivative, on iop after cataract surgery was compared to that of 0.1% betamethasone sodium phosphate (rindelon, shionogi co. ltd., after the next - day examination (defined as day 1), topical administration of an antiinflammatory drug was started ; 0.1% diclofenac and 0.3% gatifloxacin were topically applied 4 times / day to the left eye, and 0.1% betamethasone and 0.3% gatifloxacin were topically applied 4 times / day to the right eye. the sonication time (seconds) and mean phaco power (percentage) were also noted from the phaco unit s display. the sonication time was defined as the time the foot pedal remained in position 3. the mean phaco power was defined as the power used during sonication time. the effective phaco time (ept) was calculated using the following formula : ept = sonication time x mean phaco power/100. iop and best corrected logmar visual acuity (bcva) in each eye were measured preoperatively and postoperatively at 3 and 7 days, and at 4 and 8 weeks after cataract surgery. statistical differences between follow - up points of the clinical course in the same eyes were assessed using the wilcoxon signed - rank test, and the differences between the right and left eyes were assessed using the mann whitney u test (spss ver. delta iop (iop), defined as a subtraction in iop at 8 weeks postoperatively from iop at the preoperative exam, was calculated in each eye. to investigate the correlation between iop and clinical parameters, pearson s correlation coefficient (r), and a p value since the number of samples was 50, a |r| value of more than 0.3 was considered a statistically significant correlation. in all cases, p 21 mmhg), glaucoma requiring ocular medication, pseudoexfoliation, uveitis, an endothelial cell count less than 1500 cells / mm, corneal opacity, high myopia, previous ocular surgery, systemic disease affecting the inflammatory response such as diabetes mellitus, collagen disease requiring long - term systemic steroids or antiinflammatory drugs, and severe hypertension. patients whose cataract grades were not symmetrical in both eyes were also excluded in this study. intraoperative exclusion criteria were iatrogenic iris damage, retained cortical matter, and a serious complication such as posterior capsule rupture. all patients received a comprehensive ocular examination before treatment and were followed for periodic examinations after the treatments. after informing the patient of the purpose of this study and the possible outcomes, this study was also approved by the ethics committee for clinical research at ntt east japan tohoku hospital using procedures which conformed to the tenets of the declaration of helsinki. all patients had cataract surgery performed in both eyes within a 1 week interval. before cataract surgery, a topical antimicrobial drug, gatifloxacin hydrate 0.3% ophthalmic solution (gatiflo ; senju pharmaceutical co. ltd., osaka, japan), was administered 4 times / day in both eyes of each patient. the surgical technique used in this study consisted of a continuous curvilinear capsulorrhexis (ccc), phacoemulsification, and implantation of a foldable acrylic iol (acryfold ya-65bb ; hoya medicals, tokyo, japan) into the lens capsule through a 3.0 mm corneoscleral incision. the incision was not sutured. in each patient, cataract surgery in the eye with the worst visual acuity was done first, then surgery in the other eye was completed within a week. if the visual acuity in both eyes was the same, then the right eye was chosen first., tokyo, japan), which is a phenylacetic acid derivative, on iop after cataract surgery was compared to that of 0.1% betamethasone sodium phosphate (rindelon, shionogi co. ltd., after the next - day examination (defined as day 1), topical administration of an antiinflammatory drug was started ; 0.1% diclofenac and 0.3% gatifloxacin were topically applied 4 times / day to the left eye, and 0.1% betamethasone and 0.3% gatifloxacin were topically applied 4 times / day to the right eye. the sonication time (seconds) and mean phaco power (percentage) were also noted from the phaco unit s display. the sonication time was defined as the time the foot pedal remained in position 3. the effective phaco time (ept) was calculated using the following formula : ept = sonication time x mean phaco power/100. iop and best corrected logmar visual acuity (bcva) in each eye were measured preoperatively and postoperatively at 3 and 7 days, and at 4 and 8 weeks after cataract surgery. the data are presented as mean standard deviation. statistical differences between follow - up points of the clinical course in the same eyes were assessed using the wilcoxon signed - rank test, and the differences between the right and left eyes were assessed using the mann whitney u test (spss ver. chicago, il, usa). to clarify the change in iop, delta iop (iop), defined as a subtraction in iop at 8 weeks postoperatively from iop at the preoperative exam, was calculated in each eye. to investigate the correlation between iop and clinical parameters, since the number of samples was 50, a |r| value of more than 0.3 was considered a statistically significant correlation. in all cases, p < 0.05 was considered to be significant. to clarify which parameters contribute to iop, multiple regression analysis was performed. from multiple regression analysis, a standard partial regression coefficient (b) and a p value in each clinical factor were calculated. each amount of |b| value reflects a degree of contribution for each factor to the prognosis. to confirm the goodness - of - fit in each multiple regression equation, analysis of variance (anova) was performed and a p value of less than 0.05 was considered a good fit. the ages of the patients ranged from 60 to 83 years with a mean of 74.8 5.4 years. twenty seven of 50 patients underwent cataract surgery in the right eye first, and then 1 week later in the other eye, while the remaining 23 patients underwent cataract surgery first in the left eye and then in the right eye. the surgery was performed by a single surgeon (ms) and took less than 15 minutes, and no complications occurred. before cataract surgery, bcva in the betamethasone - treated (right) eye was logmar 0.348 0.222, and bcva in the diclofenac - treated (left) eye was logmar 0.363 0.233, thus showing no statistically significant difference in bcva (p = 0.785). after the surgery, bcva in all eyes improved, and at the final period of 8 weeks after surgery, bcva in the right eye was logmar 0.026 0.056, and in the left eye logmar 0.028 0.057, so that no statistically significant difference existed between the two groups of eyes 1.992). before cataract surgery, iop in the betamethasone - treated (right) eye was 14.9 3.2 mmhg, and iop in the diclofenac - treated (left) eye was 15.0 3.2 mmhg, thus showing no statistically significant difference between these two groups (p = 0.986). as shown in figure 1, iop in the betamethasone - treated eyes gradually increased to 16.7 4.3 mmhg (p = 0.001). in contrast, iop in the diclofenac - treated eyes gradually decreased to 14.0 3.2 mmhg (p = 0.01). there was a statistically significant difference in iop between each of these groups at 4 (p < 0.001) and 8 weeks (p < 0.001). the total surgery time was 8.58 1.28 min in the betamethasone - treated (right) eyes, and 8.74 1.29 min in the diclofenac - treated (left) eyes, which shows no statistically significant difference between either group of eyes (p = 0.472). to investigate the correlation between iop and total surgery time iop in the betamethasone - treated eyes was closely correlated with the total surgery time (figure 2a ; r = 0.499, p = 0.002) ; in contrast, iop in the diclofenac - treated eyes showed no correlation with the total surgery time (figure 2b ; r = 0.044, p = 0.763). the ept was 52.7 16.6 sec in the betamethasone - treated (right) eyes, and 53.5 14.9 sec in the diclofenac - treated (left) eyes, which shows no statistically significant difference between both groups of eyes (p = 0.206). to investigate the correlation between iop and the ept, pearson s correlation coefficient was calculated from each plot (figure 3). iop in the betamethasone - treated eyes was closely correlated with the ept (r = 0.535, p < 0.001) ; in contrast, the iop in the diclofenac - treated eyes showed no correlation with the ept (r = 0.080, p = 0.584). to investigate which clinical factors contributed to the iop the clinical factors were age, gender, preoperative iop, preoperative bcva, total surgery time, and ept. in the betamethasone - treated (right) eyes, iop was + 1.74 3.41 mmhg, and the standard partial regression |b| of total surgery time (p = 0.019) and ept (p = 0.002) was significantly higher than the other factors, indicating that surgery time and ept contribute to an increase in iop. the exact probability of this multiple regression equation was confirmed by analysis of variance (anova ; p = 0.0001) (table 1). in contrast, in the diclofenac - treated eyes, iop was 0.98 1.89 mmhg, and there was no statistically significant amount of |b| ; therefore, a decrease in iop was not caused by any clinical factors (table 2). before cataract surgery, bcva in the betamethasone - treated (right) eye was logmar 0.348 0.222, and bcva in the diclofenac - treated (left) eye was logmar 0.363 0.233, thus showing no statistically significant difference in bcva (p = 0.785). after the surgery, bcva in all eyes improved, and at the final period of 8 weeks after surgery, bcva in the right eye was logmar 0.026 0.056, and in the left eye logmar 0.028 0.057, so that no statistically significant difference existed between the two groups of eyes 1.992). before cataract surgery, iop in the betamethasone - treated (right) eye was 14.9 3.2 mmhg, and iop in the diclofenac - treated (left) eye was 15.0 3.2 mmhg, thus showing no statistically significant difference between these two groups (p = 0.986). as shown in figure 1, iop in the betamethasone - treated eyes gradually increased to 16.7 4.3 mmhg (p = 0.001). in contrast, iop in the diclofenac - treated eyes gradually decreased to 14.0 3.2 mmhg (p = 0.01). there was a statistically significant difference in iop between each of these groups at 4 (p < 0.001) and 8 weeks (p < 0.001). the total surgery time was 8.58 1.28 min in the betamethasone - treated (right) eyes, and 8.74 1.29 min in the diclofenac - treated (left) eyes, which shows no statistically significant difference between either group of eyes (p = 0.472). to investigate the correlation between iop and total surgery time, pearson s correlation coefficient was calculated from each plot (figure 2). iop in the betamethasone - treated eyes was closely correlated with the total surgery time (figure 2a ; r = 0.499, p = 0.002) ; in contrast, iop in the diclofenac - treated eyes showed no correlation with the total surgery time (figure 2b ; r = 0.044, p = 0.763). the ept was 52.7 16.6 sec in the betamethasone - treated (right) eyes, and 53.5 14.9 sec in the diclofenac - treated (left) eyes, which shows no statistically significant difference between both groups of eyes (p = 0.206). to investigate the correlation between iop and the ept, pearson s correlation coefficient was calculated from each plot (figure 3). iop in the betamethasone - treated eyes was closely correlated with the ept (r = 0.535, p < 0.001) ; in contrast, the iop in the diclofenac - treated eyes showed no correlation with the ept (r = 0.080, p = 0.584). to investigate which clinical factors contributed to the iop, multiple regression analysis was performed. the clinical factors were age, gender, preoperative iop, preoperative bcva, total surgery time, and ept. in the betamethasone - treated (right) eyes, iop was + 1.74 3.41 mmhg, and the standard partial regression |b| of total surgery time (p = 0.019) and ept (p = 0.002) was significantly higher than the other factors, indicating that surgery time and ept contribute to an increase in iop. the exact probability of this multiple regression equation was confirmed by analysis of variance (anova ; p = 0.0001) (table 1). in contrast, in the diclofenac - treated eyes, iop was 0.98 1.89 mmhg, and there was no statistically significant amount of |b| ; therefore, a decrease in iop was not caused by any clinical factors (table 2). this prospective case - control study is unique because each patient had one eye treated with betamethasone and the other eye treated with diclofenac after cataract surgery. in these cases, after uneventful cataract surgery in a normal patient, the major findings of this study are as follows. 1) postoperative iop was slightly increased in eyes treated with betamethasone, which was dependent upon total surgery time and ept. 2) in contrast, postoperative iop in eyes treated with diclofenac was slightly decreased, and was not affected by surgery time or ept. according to a recent study, iop in the nonglaucomatous eye is reduced following uneventful cataract surgery.11 in our study, iop in the diclofenac - treated eyes also showed a significant reduction after cataract surgery. interestingly, within 1 week after the surgery, there was no significant difference in iop between the two groups ; however, at 4 and 8 weeks postoperatively, iop in the corticosteroid (betamethasone)-treated eyes was significantly higher than that in nsaid (diclofenac)-treated eyes. it is well known that topical corticosteroid - induced iop elevation is observed after 3 weeks of administration.12 therefore, iop elevation after surgery in the betamethasone - treated eyes is possibly steroid - induced ocular hypertension. although the pathogenesis of steroid - induced ocular hypertension still remains unknown, corticosteroid affects cytoskeleton, an extracellular matrix in trabecular meshwork cells,13 leading to an increase in the outflow resistance of aqueous humor. previous reports indicated 69% of normal eyes had iop elevations of at least 5 mmhg and were classified as steroid responders.14 in this study 18 of 50 eyes showed more than 5 mmhg of iop ; in contrast, 23 eyes showed less than 0 mmhg of iop, therefore, those 18 patients were considered steroid responders. in these 18 patients, iop in the other (diclofenac - treated) eyes showed less than 2 mmhg (mean 0.67 2.0 mmhg) ; therefore, diclofenac did not induce ocular hypertension even in steroid responders. the most interesting result in this study is that an increase of iop after uneventful cataract surgery in betamethasone - treated eyes was related to surgery time and ept. generally, it takes more time and/or sonication power to perform cataract surgery in complicated cases including those of patients with a hard nucleus and/or small pupils. also, beginning surgeons and older patients need more time for surgery. in these cases, diclofenac seems to have some advantages compared with betamethasone for preventing postoperative increases in iop. | purpose : this study compares the effect of topical diclofenac with that of betamethasone against postoperative increase of intraocular pressure (iop) after cataract surgery in normal patients, and also investigated the risk factors for postoperative increase of iop in each group.methods:fifty consecutive patients without systemic disease who have bilateral and symmetrical cataracts underwent uncomplicated cataract surgery in both eyes (100 eyes in total). postoperatively, topical diclofenac was applied 4 times daily to one eye, and topical betamethasone to the other eye in each patient. iop and best corrected logmar visual acuity (bcva) in each eye were measured up to 8 weeks. total surgery time and effective phacoemulsification time (ept) for each case was recorded.results:bcva in both diclofenac- and betamethasone - treated eyes significantly improved after the cataract surgery ; however, no statistical difference in va was noted between the diclofenac- and betamethasone - treated eyes throughout the observation period. iop in the diclofenac - treated eyes decreased with time, in contrast to the iop in the betamethasone - treated eyes, which showed a slight increase. at 4 and 8 weeks postoperatively, there was significant difference between these two eye groups. multiple regression analysis revealed that postoperative increase in iop at 8 weeks in the betamethasone - treated eyes was closely correlated with total surgery time and ept, but the iop in the diclofenac - treated eyes showed no correlation with any surgical or clinical parameters.conclusions:postoperative increase in iop after cataract surgery was affected by total surgery time and ept in the betamethasone - treated eye. the time for surgery and ept is longer in complicated cases including patients with a hard nucleus or small pupils, and also longer for beginning surgeons and in older patients. in these cases, diclofenac in place of betamethasone as a postoperative topical antiinflammatory drug is recommended for the prevention of postoperative increase in iop. |
the incidences of both thyroid cancer and breast cancer have been rising in recent years ; however, it is very rare to find a single person with both of these cancers. only a few cases of synchronous thyroid and breast cancer have been published, and even fewer cases have been reported in older patients (> 60 years). the current study presents a case of synchronous papillary thyroid carcinoma and breast ductal carcinoma in an elderly patient. the patient first underwent a mastectomy and axillary lymphadenectomy in our department, followed by a total thyroidectomy and lymphadenectomy of the left lateral region of the neck 1 month later. postoperative pathological examination identified invasive ductal carcinoma of the breast and papillary carcinoma of the thyroid. over almost half a year of follow - up, the patient has exhibited no evidence of recurrence or metastasis, as demonstrated by careful ultrasound examinations. herein, we not only report this case but also present a systematic review of the causes, diagnosis, and treatment of synchronous breast and thyroid cancer. although synchronous primary tumors of the thyroid and breast are very rare, they remain a possibility ; therefore, more attention should be paid to these cases. although differentiated thyroid and breast cancer carry a lower risk of death or disease recurrence than other malignancies, their incidences have been steadily increasing for at least 2 decades, and they have become the most common malignancies in females. however, synchronous (diagnosed at the same time) neoplasms of the thyroid and breast are rare in the clinic. the first report on this dual malignancy, these 2 malignancies can be synchronous but should not be metachronous. neither tumor should arise as a metastasis from the other nor the tumors should be separate from each other in terms of their microscopic and morphologic features, which means that they can not have metastasized from another site. according to the guidelines, the incidence of a second primary tumor in cancer patients is approximately 10% ; however, it is rather rare for a patient to have a diagnosis of synchronous neoplasms of the thyroid and breast. herein, we report a rare case of a 61-year - old female who was diagnosed with synchronous primary papillary thyroid carcinoma and breast ductal cancer. we also attempted to elucidate the underlying mechanisms of synchronous primary papillary thyroid carcinoma and breast ductal cancer and to systematically review some unsystematic theories regarding their development, diagnosis, and treatment that have been proposed in previous studies. in march 2015, a 61-year - old, postmenopausal female with a mass in her right breast that was found incidentally underwent a right breast mass excision and biopsy at her local hospital. however, the diagnosis could not be confirmed due to limitations regarding clinician experience and equipment ; therefore, the patient, along with a paraffin - embedded tissue sample, was admitted to the department of pathology at our hospital (west china hospital of sichuan university, chengdu, china). immunohistochemistry revealed that she had primary breast infiltrative ductal carcinoma comprising tumor cells that were p63(), s-100(), cytokeratin (ck) 5/6(), estrogen receptor (er) (+, strong, 90%), progesterone receptor (pr)(+, strong, 90%), human epidermal growth factor receptor (her)-2(0), and ki-67(25%). as a result, the patient elected to undergo radical operative therapy, although there were no signs of tumor recurrence in the right breast or metastasis to the lymph nodes. accordingly, we performed a right mastectomy and right axillary level i lymphadenectomy in our department. preoperative examination, which included a color doppler ultrasound examination of the neck (neck ultrasound was routinely performed to detect neck lymph node metastasis, especially supraclavicular lymph node metastasis), indicated that there were multiple nodes in the middle left lobe of the thyroid with aspect ratios (vertical / transverse diameters) 1, irregular shapes, and unclear boundaries, as well as multiple nodes of hypoechoic intensity, solid nodules, and calcifications. additionally, the ultrasound elasticity imaging score was 5, and the strain ratio was 37.33. the above - mentioned findings were detected in multiple lymph nodes in the left neck area (area iv), and the diameter of the largest mass was 322322 mm (the mass exhibited irregular margins, solid nodules, and calcification). for further diagnosis, preoperative fine needle aspiration (fna) biopsy of a nodule in the left lobe of the thyroid and the left supraclavicular lymph nodes was performed. a follow - up pathology examination demonstrated the following : (gross cystic disease fluid protein) gcdfp15(), calection-3(+), ck19(+), human bone marrow endothelial (hbme)-1(+), thyroglobulin (tg)(+), and thyroid transcription factor (ttf)-1(+), thereby confirming the diagnosis of thyroid papillary carcinoma in the left supraclavicular lymph nodes. the patient then underwent a total thyroidectomy+ a double - sided region vi lymphadenectomy + a lymphadenectomy of the left lateral region of the neck. intraoperatively, a tumor was found to be located in the left lobe of the thyroid and to have invaded the left belt - shaped muscle, and multiple lymph nodes with diameters ranging from 0.3 to 3.5 cm were noted in the left lateral region of the neck. a postoperative histological examination confirmed the diagnosis of thyroid papillary carcinoma with left supraclavicular and left lateral neck region lymph node metastasis. the patient refused any chemotherapy or radiotherapy after surgery, but she accepted tsh suppressive therapy with levothyroxine (100 g, once per day) continuously. for the last 6 months, the patient has been followed with scheduled color doppler ultrasounds, thyroid function tests, and periodic tumor marker monitoring, and no evidence of recurrence or metastasis has been observed thus far. breast carcinoma and thyroid carcinoma are the 2 most common malignancies that occur in women. however, synchronous primary tumors of the thyroid and breast are very rare in clinical practice. previous studies have mainly focused on possible increases in the incidence of contralateral breast carcinoma. however, the risk of concurrent thyroid carcinoma among women with breast cancer has not been explored in recent years. analysis of the usa national cancer institute 's surveillance, epidemiology, and end results data has demonstrated that the incidence of thyroid cancer is higher in patients with a pre - existing malignancy than in patients without a preexisting malignancy and that the incidence of other malignancies is higher in patients with thyroid cancer than in patients without thyroid cancer, findings consistent with the current guidelines. a previous study revealed that a history of any thyroid disorder or subsequent treatment was not associated with an increased risk of developing breast cancer. however, this study revealed that parous females with a history of thyroid cancer exhibited an increased risk of developing breast cancer. it is well known that the use of radiotherapy to treat cancer may increase the risk of developing a second malignancy. for breast carcinoma, the most common risk factor for a second soft tissue sarcoma is postoperative radiotherapy, especially radiotherapy targeting the thyroid, which is very sensitive to radiation. although the breast and thyroid are both endocrine organs, there is no evidence of a relationship between these organs with respect to the development of simultaneous breast and thyroid cancer. liu performed a literature review to elucidate the mechanism underlying the development of synchronous breast and thyroid cancer and focused on thyroid hormones. he proposed mechanisms underlying the activation of associated oncogenes, such as a sodium iodide symporter that acts as a potential co - passageway and facilitates thyroid and breast cancer development. additionally, previous studies have suggested that amplified levels of nuclear protein 1, retinoid - inducible nuclear factor, and nuclear receptor coactivator in the breast served as potential oncogenic coactivators of and biomarkers for thyroid and breast cancers. furthermore, it has been reported that the risk of synchronous thyroid and breast cancer is associated with cowden syndrome and cowden - like syndrome, which usually cause multiple cancers via flavin adenine dinucleotide (fad)/nicotinamide adenine dinucleotide (nad)-dependent destabilization of p53. in chen 's retrospective cohort analysis, it was discovered that females with a history of thyroid carcinoma, particularly premenopausal caucasian females, have an increased risk of developing breast cancer. however, the patient in the present case is a xanthoderm, postmenopausal female. as shown in table 1, most cases of synchronous breast and thyroid cancer occur in xanthoderm, postmenopausal women ; however, there is no clear or accurate evidence indicating whether differences in morbidity according to race or pre- or postmenopausal status exist. accurate diagnosis is a very difficult but important task for clinical surgeons, who must differentiate between the diagnosis of synchronous breast and thyroid cancer and the development of either as a result of metastasis from a primary tumor involving the other, that is, thyroid cancer arising from breast cancer metastasis or breast cancer arising from thyroid cancer metastasis. fna of targets and lymph nodes is the best and first approach for making this diagnosis. van assessed data from the american cancer society and discovered that thyroid cancer in female patients led to a 0.67-fold increase in the subsequent development of breast cancer, but thyroid cancer in males led to a 29-fold increase in the subsequent development of breast cancer. moreover, breast cancer in female patients led to a 2-fold increase in the subsequent diagnosis of thyroid cancer, whereas breast cancer in male patients led to a 19-fold increase in the subsequent diagnosis of thyroid cancer. these data may have important implications for patient follow - up and screening after primary cancer treatment. however, surgeons should be aware of not only a second cancer when following up a primary cancer but also a synchronous cancer, such as a synchronous papillary thyroid carcinoma or breast ductal carcinoma, both of which occurred in our present case. however, regarding the present case, we can not speculate on whether the thyroid or breast cancer developed first based on depth of invasion or tumor size because papillary thyroid carcinoma and breast ductal carcinoma are minimally invasive and grow slowly. however, we can speculate that the papillary thyroid carcinoma was the first cancer to develop and that the breast cancer was the second cancer to develop based on the fact that the thyroid cancer exhibited poorer tnm staging than the breast cancer and left neck lymph node metastasis. if papillary thyroid carcinoma and breast ductal carcinoma are detected synchronously, the breast ductal carcinoma should be resected upon the exclusion of medullary or anaplastic thyroid carcinoma because breast ductal carcinoma is more likely to present with distant metastasis and to have a poorer prognosis. in conclusion, although synchronous primary tumors of the thyroid and breast are very rare, our case presentation and review have reminded us of the possibility that breast and thyroid cancer can occur synchronously. however, more studies in this field are needed to confirm our results. | abstractbackground : the incidences of both thyroid cancer and breast cancer have been rising in recent years ; however, it is very rare to find a single person with both of these cancers. only a few cases of synchronous thyroid and breast cancer have been published, and even fewer cases have been reported in older patients (> 60 years).case summary : the current study presents a case of synchronous papillary thyroid carcinoma and breast ductal carcinoma in an elderly patient. the patient first underwent a mastectomy and axillary lymphadenectomy in our department, followed by a total thyroidectomy and lymphadenectomy of the left lateral region of the neck 1 month later. postoperative pathological examination identified invasive ductal carcinoma of the breast and papillary carcinoma of the thyroid. over almost half a year of follow - up, the patient has exhibited no evidence of recurrence or metastasis, as demonstrated by careful ultrasound examinations. herein, we not only report this case but also present a systematic review of the causes, diagnosis, and treatment of synchronous breast and thyroid cancer.conclusion:although synchronous primary tumors of the thyroid and breast are very rare, they remain a possibility ; therefore, more attention should be paid to these cases. |
the prevalence of childhood obesity and associated comorbidities is high in developed countries and is still increasing in many countries. the german health interview and examination survey for children and adolescents (kiggs) conducted by the robert koch institute revealed that 8.7% of the 3- to 17-year - old children in germany are overweight and an additional 6.3% are already obese. in the united states, the prevalence of obesity and overweight has tripled in the last 30 years. according to the cross - sectional analysis of ogden and colleagues published in 2012, the prevalence of obese children and adolescents in the united states is 16.9%. in some european countries, however, recently, this rise in obesity prevalence appears to be tapering off in several countries including the united states, germany, and greece. pediatric obesity may cause metabolic abnormalities such as hyperlipidemia, hypertension, impaired glucose tolerance, or even type 2 diabetes early in childhood [7, 8 ]. recently, a review from van vliet and coworkers compared cardiometabolic risk factors such as impaired fasting glucose / impaired glucose tolerance, high triglycerides, low hdl - cholesterol, and hypertension in overweight and obese children from different countries. in their investigation, children from turkey, hungary, greece, germany, and poland showed the most unfavourable risk profile. a study conducted in china compared overweight and obese children to normal weight children with respect to their relative risks for dyslipidemia, hypertension, diabetes mellitus, and metabolic syndrome. they estimated that obese children had a 3.3 times higher risk of developing hypertriglyceridemia, a 1.5 times higher risk for low hdl, and a 1.8 times higher risk for dyslipidemia compared to normal weight children in china. in addition to the higher risk of developing comorbidities associated with overweight and obesity, long - term follow - up results indicate that obese children and adolescents tend to become obese adults. as early as 1993, serdula. reviewed 17 studies, which examined the progress of obesity from childhood to adulthood. they found that 26% to 41% of obese preschool children and 42% to 63% of school - age children became obese adults. in addition, a recently published cohort study found that obese adolescents had a 16-fold higher risk of becoming severely obese adults with a bmi above 40 as compared to normal weight or overweight adolescents. a 12-year retrospective cohort study from japan revealed that compared to moderately obese children, obesity, in severely obese children, frequently progresses into adulthood, despite treatment. in addition, this study identified a gender difference ; moderately obese boys had a twofold higher risk of being obese adults compared to girls. while being obese as a child is associated with adverse health consequences as described earlier, continuing to be obese or severely obese in adulthood will lead to a cumulative effect in terms of the negative consequences on health, mortality, and quality of life [1618 ]. apart from the metabolic health problems, psychological and social consequences occur increasingly in overweight and obese children due to discrimination and stigmatisation because of their weight. during the last decade these problems attracted more and more public and public health interest. amongst children, a study of high school students reported that 84% of participants observed that overweight adolescents are being teased at school, both in general and during physical activities. there are indications that stigmatization may lead to psychological effects like mood and anxiety disorders, for example, depression, dysthymia, mania, generalized anxiety disorder, social phobia, and substance use disorders, like nicotine, alcohol or drug abuse, or dependence [22, 23 ], which in turn result in further health problems. in addition, body dissatisfaction and lower self - esteem are related to childhood overweight and obesity. over and above, unhealthy eating, lower physical activity, or stress - induced pathophysiology may result from weight - related stigmatization. in summary, a decrease of overweight and obesity in children and adolescents should reduce comorbidities and negative psychological and social consequences resulting in an overall improvement in the health - related quality of life and well - being. numerous studies have been conducted with the aim of preventing and reducing obesity in children and adolescents. several intervention approaches have been offered, for example, internet - based programs or school - based interventions [2830 ], hospital - based programs [31, 32 ], and community - based programs [3336 ], all with and without family - based intervention. experts recommend that treatment programs for obese children and adolescents require a multidisciplinary approach. several published studies examine the changes occurring between the beginning and the end of an intervention program [3741 ], in some cases supplemented by a follow - up survey with observation periods up to one year [4245 ]. however, the actual impact of obesity prevention or treatment programs would become more apparent if longer time periods could be observed. a well - known study investigating school - based interventions in germany is the kiel obesity prevention study (kops). kops started in 1996 as a cross - sectional and longitudinal 8-year follow - up study. recently, results of the eight - year follow - up have been published. as regards changes in the bmi - sds, the primary outcome of the study, no significant overall intervention effect was observed. only participants with a high socioeconomic status in the intervention group showed a significant reduction of bmi - sds by 0.17, after 8 years. in a controlled trial, a family - based therapeutic education program for obesity after one year, both treatments resulted in a bmi - sds reduction, 0.42 0.8 in the dietetic group and 0.48 0.6 in the therapeutic education group. after 3 years, however, only the therapeutic education program showed a significant reduction of bmi - sds (0.44 0.7), whereas dietetic intervention reached nearly baseline values again (bmi - sds reduced by 0.01 0.5). in italy, a five - year follow - up assessment of the hospital - based program mi piace piacermi combining a lifestyle centred approach, parental involvement, nutrition education, and cognitive - behavioural strategies reported significant reduction of bmi - sds and successful behaviour change. in 2012, an 8-year follow - up study about an outpatient program in belgium has been published. the authors draw the conclusion that a multidisciplinary cognitive - behavioural program helps the children to control their weight over a long time. for germany, scarce long - term follow - up data of such intervention programs exists. a study published by reinehr and colleagues in 2007 described the successful weight reduction three years after the end of intervention of a 1-year outpatient intervention program of obese children and adolescents. the combined dak therapy for obesity in children and adolescents by means of an uncontrolled observational study and showed that the treatment effects in the intervention group differed significantly from those in the untreated (waiting - list) control group. however, these reports had short - term results limited to a period of 6 and 12 months. the aim of the present study is to examine prospectively the long - term effects of this program over a period of 3 and 5 years, which corresponds to 2 and 4 years after the end of treatment, respectively. with the present study firstly, there is a significant lack of follow - up studies which evaluate the long - term outcome of obesity treatment programs. secondly, the objective evidence of the sustainability of this combined inpatient - outpatient treatment program is an important contribution to the german health services. thirdly, well - evaluated treatment programs are urgently needed for developing improved treatment regimens for overweight and obese patients to ultimately improve their well - being and health - related quality of life. our primary hypothesis is that the study participants will show a stabilisation or improvement of all evaluated behavioural parameters as well as the weight parameter (bmi - sds) two and four years after the end of the intervention compared to baseline data. the combined dak therapy for obesity in children and adolescents exists since 2003 and was funded by the deutsche angestellten krankenkasse (dak), which is a large german health insurance company with approximately 6,000,000 members. the program was designed for one year with an initial 6 weeks multidisciplinary inpatient treatment on the island of sylt followed by a 10.5-month outpatient treatment program at the home of the obese children and adolescents. for the outpatient treatment phase, the dak program also included a family treatment program in which the parents were trained separately at home during the 6 weeks inpatient treatment of the children. the german guidelines for the treatment of obese children and a published treatment manual served as the basis for developing this program. a more detailed description of the treatment program is published elsewhere [51, 52 ]. study participants were assessed (a) at the beginning of the treatment - program (baseline), (b) at the end of the 12-month combined inpatient - outpatient treatment, (c) approximately 24 months after the end of treatment, that is, 36 months after the initial start of treatment, as well as (d) 48 months after the end of treatment, that is, 60 months after the baseline measurement (see figure 1). for the three- and five - year follow - up, all children and adolescents who had started with the 12-month program the combined dak therapy for obesity in children and adolescents between january 2004 and june 2005 were eligible for participation. these patients were same study population as for the previously reported 12 months follow - up. for inclusion in this study, candidates had to be at least 10 years old when they started the therapy program. written informed consent by the parents or guardians of the children and adolescents was required for study participation. in order to conduct this three- and five - year follow - up of the uncontrolled observational study, the dak again contacted the participants ' families as well as the local nutritionists and dieticians for follow - up measurement. for the three - year follow - up study, 25 cases (5-year follow - up (5yfu) : 43 cases) and their families were lost to follow - up despite several trials to contact them. after three years, in 51 cases (5yfu : 119 cases), it was not possible to contact the local nutritionist or dietician, who did the supervision and treatment during the 1-year program, anymore. additionally, for the three - year follow - up, 2 local nutritionists / dieticians (5yfu : 12 nutritionists / dieticians) refused to undertake the five - year follow - up ; that is, they did not to want to contact the families because of an insufficient cooperation during the treatment or because they had no time for this job. an alternative person to contact the participants or their families in all these cases could not be found. in addition, for the three - year follow - up, 9 families could not be contacted anymore since they had moved to an unknown address, and for the five - year follow - up, this was the case with 16 families. shifting to another city for vocational training made it impossible to contact another 12 cases for the three - year follow - up (5yfu : 2 cases). finally, on account of changing their health insurance company dak, one family for the three - year follow - up and two families for the five - year follow - up could not be contacted anymore. as a result, data were missing in a total of 100 cases (proportion of the total 604 participants : 16.6%) for the three - year follow - up and 194 cases (proportion of the total 604 participants : 32.1%) for the five - year follow - up all these participants could not be reached anymore (see figure 2). a total of 504 children and adolescents were contacted for participation in the follow - up measurement after three years. of these, 383 candidates attended the three - year follow - up measurement (383 of 604 total participants : follow - up rate 63.4%), while 121 candidates (20.0%) did not agree to participate any more. the most common reasons for not participating in the study were either noncompliance in the family, that is, objection against the survey by the families (14.1%), or noncompliance by the adolescents themselves (5.0%). in 6 cases, the reasons for nonparticipation were not specified (1.0%). for the 5-year follow - up, 410 children and adolescents were contacted ; of these, 255 subjects sent back the questionnaires, and 155 declared that they had no interest in participation any more (255 of 604 total participants : follow - up rate 42.2%). as already described for the three - year follow - up, the main reasons for the participants not agreeing to participate were either objection to participate on behalf of the families (7.0%) or objection by the adolescents themselves (8.6%). also, 10.1% of the participants did not further specify the reason for their nonparticipation at the five - year follow - up. after contact was established, an appointment was organised between the children or adolescents and the local nutritionists and dieticians. during this meeting, the questionnaires were filled out and weight, height, and fitness status of the candidates measured. to enhance motivation to participate, the local nutritionists and dieticians were allowed to offer a little incentive (equivalent to 10 euros, e.g., a cinema voucher) to the families in return for participation. data collection took place from january 2007 to june 2008 for the 3-year follow - up and from january 2009 to june 2010 for the 5-year follow - up measurement. all the other parameters like behavioural characteristics, nutritional habits, physical activity or exercise status, and quality of life were assessed with the help of questionnaires. bmi expressed as a standard deviation score (bmi - sds) was calculated according to age- and sex - specific german reference data. the bmi - sds is a score which sets an individuals ' bmi in context by showing how many standard deviations an individual 's bmi deviates from the corresponding population mean. overweight was defined as a bmi above the 90th percentile, while a bmi value 97th percentile was considered as obese. a weight reduction of at least 5% in one year for adults or a decrease of 0.2 bmi - sds in children is considered as successful ; hence, for this study, we define a reduction of the bmi - sds by 0.2 or more as a successful outcome. four parameters of eating behaviour were assessed : cognitive control / restrained eating including the two subscales flexible and rigid control and disinhibition of control. we used the eating behaviour questionnaire for children which is an adapted and abridged version of the german three - factor eating questionnaire the questionnaire includes 16 questions with 4 possible answer categories it always applies, it often applies, it rarely applies, and it never applies. cognitive control / restrained eating describes the tendency to restrict food intake in order to control body weight or prevent weight gain. flexible control is characterised by a graduated more or less approach to eating and weight control, which is understood as a permanent behaviour. on the contrary, rigid control is characterised by a dichotomous all or nothing approach to eating, where periods of strict dieting alternate with periods characterized by no weight control efforts. disinhibition of control shows the tendency to increase food intake and overeat when exposed to emotional distress or tempting external stimuli. reliability for the eating behaviour questionnaire was measured by cronbach 's alpha. the scale cognitive control / restrained eating (baseline : = 0.731 ; 3yfu : = 0.735 ; 5yfu : = 0.768), its subcomponent flexible control (baseline : = 0.682 ; 3yfu : = 0.679 ; 5yfu : = 0.723), and also the scale disinhibition of control (baseline : = 0.828 ; 3yfu : = 0.819 ; 5yfu : = 0.806) show good reliability at baseline and the follow - up time points. only the scale rigid control (baseline : = 0.404 ; 3yfu : = 0.427 ; 5yfu : = 0.426) shows a low reliability because it has only three items. to assess the children 's food intake both in terms of type and quantity, a food frequency list was used. this questionnaire listed 8 food groups and the children and adolescents had to indicate how many portions of the corresponding food item or group they usually consumed using the 5 answer categories : (i) 35 portions per day, (ii) 1 - 2 portions per day, (iii) 46 portions per week, (iv) 13 portions per week, or (v) never. for the descriptive analysis, foods were grouped into recommended and nonrecommended foods and beverages according to the current german recommendations for children and adolescents [56, 57 ]. the test allows for an estimation of the dynamic endurance capacity. in general, a treadmill is used to test the dynamic endurance capacity, but taking into account the fact that the examined children and adolescents were spread over germany, the test was mostly conducted on a sports field, where a defined track of 400 m was available. since sports fields with a defined 400 m track are found throughout germany, whereas a treadmill was not available at most places, using a sports field seems to be the best alternative to standardise the condition. the children were asked to walk briskly ; they could, however, choose their own walking pace. the heart rate was also measured both before (at rest) and after the walking exercise. in addition, a questionnaire was used to assess the tv watching and pc habits in terms of time spent. the perceived self - competence of the children was measured with the help of the german questionnaire this questionnaire comprises 30 items from which 5 subscales are calculated, that is, attractiveness (physical appearance), self - worth, scholastic competence, social acceptance, and self - confidence. the development of this german questionnaire by wnsche and schneewind is based on the perceived - competence - scale for children (pcs) by harter. the scale attractiveness describes the degree of satisfaction with the own body and appearance ; with the scale self - worth, it is asked whether the child likes her- or himself as she or he is ; scholastic competence describes the children 's scholastic abilities at school ; the scale social acceptance describes the degree how popular a child is and how children deal with each other and the scale self - confidence assesses the confidence in the child 's own behaviour. the items of the questionnaire are presented in a structured alternative format. for each item, two contrasting alternative statements are presented, for example, i like going to school, and i do not like going to school and for both statements the answer alternatives really true for me or all 5 scales of the questionnaire showed a good reliability attractiveness (cronbach 's alpha baseline 0.714 ; 3yfu : 0.852 ; 5yfu : 0.838), self - worth (cronbachs alpha baseline 0.724 ; 3yfu : 0.755 ; 5yfu : 0.771), scholastic competence (cronbachs alpha baseline 0.789 ; 3yfu : 0.820 ; 5yfu : 0.759), social acceptance (cronbachs alpha baseline 0.823 ; 3yfu : 0.846 ; 5yfu : 0.847), and self - esteem in own behaviour (cronbachs alpha baseline 0.715 ; 3yfu : 0.761 ; 5yfu : 0.773). the quality of life was assessed with a questionnaire developed by warschburger and warschburger.. this questionnaire has 11 items which describe physical - functional, emotional, and social aspects of well - being. children and adolescents are asked to answer the items related to their mood and feelings during the last two weeks. always to never which is assigned values from 1 to 5. for analysis and interpretation, an individual mean is computed where higher values are indicative of higher quality of life. this questionnaire has been validated and shows a good reliability. in our study, for all time points, the questionnaire showed a good reliability (cronbachs alpha baseline : 0.779 ; 3yfu : 0.819 ; 5yfu : 0.693). the statistical analysis was based on an intention - to - treat analysis and the results given as mean standard deviation. the missing data of the follow - up measurements were imputed using the baseline values (return - to - baseline or baseline observation carried forward (bocf)). hence, subjects lost to follow - up are considered failures who did not change between baseline and follow - up. it should be noted that in some cases baseline data for certain parameters like weight, height, and fitness status (walking test) were missing. with respect to weight and height for example the baseline data are missing in 8 cases. for these 8 cases, a baseline observation carried forward (bocf) analysis was not possible, and this led to a reduction of the original sample of n = 604 individuals to n = 596, when carrying out the bocf method for analysing the data. we used the wilcoxon - test for testing the statistical significance of pre - post differences in the study group and the mann - whitney u - test for comparing two independent groups. the proportion of girls and boys in our study was 58.0% and 42.0%, respectively. at the beginning of the study, the average age of the children was 12.5 1.35 years (range 1015 years), and at 36 months follow - up the participants had an average age of 15.4 1.31 (range 1318 years). at the beginning of the 5-year follow - up measurement, the participants were 17.4 1.35 years (range 1520 years) old. at the start of treatment, the average bmi was 30.4 4.3 which corresponds to a bmi - sds of 2.45 0.45. in the 3 years since the beginning of the program, the bmi - sds decreased significantly by 0.20 0.49 from baseline (z = 9.09, p < 0.001). after 5 years, the bmi - sds was reduced by 0.05 to 0.15 0.51 (z = 6.07, p < 0.001) compared to baseline. the result of the 1-year evaluation for the bmi - sds reduction was 0.35 0.41 (z = 17.18, p < 0.001) (table 1). although the decrease of bmi - sds during the initial 1-year observation period was higher (0.35 0.41) compared to the 3-year (0.20 0.49) and 5-year (0.15 0.51) observation periods, 34.3% of the children and adolescents still showed successful weight reduction after 3 years, and 21.3% after 5 years, as indicated by a decrease of bmi - sds by 0.2 or more (table 2). a further analysis for assessing the bmi - sds changes in different age groups by sex was undertaken. at the beginning of the therapy in 2004, the participants could be classified into three different age groups(i) 10 - 11 years, (ii) 12 - 13 years, and (iii) 14 - 15 years. as compared to baseline measurements, the highest weight reduction after 3 and 5 years was seen in girls of the 12 - 13 year (at the start of the program) old age group. they reduced their bmi - sds significantly by 0.31 0.51 (z = 6.98, p < 0.001) within the 3 years and still by 0.25 0.59 after 5 years (z = 5.13, p < 0.001). girls who were 10 - 11 years old at the start of the therapy showed the least (nonsignificant) reduction in their bmi - sds for the entire follow - up period of 5 years (table 3). cognitive control / restrained eating and flexible and rigid control of eating behaviour all decreased slightly during the follow - up observation period after the end of the program. yet overall, as measured from baseline, a significant improvement could still be observed for all four scales for both the 3-year follow - up and 5-year follow - up. disinhibition and rigid control decreased significantly during the entire 3- and 5-year observation periods, and cognitive control and flexible control of eating behaviour increased significantly (table 4). a division of food items into recommend foods and non - recommended foods according to the recommendations of the research institute of child nutrition (fke) dortmund [56, 57 ] shows that the intake of several nonrecommended foods and beverages was significantly reduced from baseline to 3-year and 5-year follow - up (table 5). in contrast, the consumption of helpings of calorie - free and recommended beverages like (mineral) water and fruit or herbal teas increased significantly within the 3 years and also over the entire observation period of 5 years (table 5). for other types of recommended food like whole grain products, cereals, rice and noodles, boiled potatoes, fresh fruits and vegetables, salad, and some dairy products, no significant changes could be observed. in addition, the consumption of meat and sausages decreased significantly from the beginning of the therapy until the 3-year and further on until the 5-year follow - up (table 5), although the amount consumed currently is still too high. the consumption of eggs was maintained at the level of the fke recommendations during the 3 and 5 years observation periods. the descriptive analysis shows no improvements for the 6-minutes walking test ; the walking distance did not change significantly between baseline and both follow - ups. however, the heart rates are similar to the heart rates at the end of the therapy, one year after baseline, indicating a better physical fitness (table 6). no significant differences to baseline were observed concerning self - reported activities during leisure time, time spent watching tv or using the pc. a significant reduction of tv or pc time was only seen by the end of the 1-year treatment (during the week (in hours) : 0.24 2.05 (z = 2.99, p < 0.010), and at the weekend (in hours) : 0.23 2.54 (z = 2.38, p < 0.050)). the question on how often the participants indulged in physical activity for at least 20 minutes per week showed a decrease during whole follow - up observation period after the end of the therapy, but compared to the baseline data, an increase could still be observed (baseline 35.6% ; after 1 year / end of therapy 49.1%, 3-year follow - up 43.4%, 5-year follow - up 41.3%). all 5 assessed subscales of self - perception (attractiveness, self - confidence, competence at school, elf - esteem, and social acceptance) improved significantly within the 3 and 5 years. the highest changes could be measured during the 1-year program (therapy phase), while self - perception stabilised or only slightly improved after the end of the therapy phase. in addition, perceived quality of life improved significantly within the 3-year and 5-year observation periods. the highest increase of quality of life could be measured during the inpatient phase of the therapy. therefore, a higher quality of life after 3 and 5 years compared to baseline levels could be documented. at all measured time points, participants who reduced their weight successfully by 0.2 bmi - sds units or more showed a significantly higher quality of life (table 7). the present study reported 3- and 5-year follow - up results from an observational study of an initial one - year combined inpatient - outpatient treatment of obese children and adolescents. given the fact that obesity treatment has to focus on long - term weight reduction and maintenance rather than short - term weight loss, and given the limited number of studies reporting long - term results of obesity treatment, the present study addresses an important gap in current knowledge. the strengths of the present study include the long follow - up duration of up to five years and a moderately large sample of 604 consecutive participants of a multidisciplinary treatment programme over 12 months. however, before highlighting and discussing the main findings of the present study, a number of important limitations need to be pointed out. first of all, this follow - up study reports about the long - term effects of an uncontrolled study. due to legal concerns regarding the indiscriminate access to standard treatment offered by a health insurance company, we were not able to establish a control group for the long observation period of 5 or even 3 years. however, in a previous report, we have ascertained that the short - term effects of this treatment approach over 6 months were significantly better in terms of development of body weight, health behaviour, and quality of life in the treated group as compared to untreated waiting list control group. secondly, as in other long - term follow - up studies of obesity treatment, we have a considerable portion of subjects who were lost to follow - up. the reasons for nonparticipation in the follow - up assessments indicate that attrition is at least partially related to unsuccessful weight and behaviour change. nevertheless, the follow - up rates in our study may be considered as somewhat satisfying compared to other studies in the field. in an observational follow - up study of different treatment programmes in germany, loss to follow - up was already 58.6% one year after the end of treatment and 72.5% after initial inpatient treatment. in an attempt to compensate for our nevertheless large and presumably biased loss to follow - up, we consequently used an intention to treat analysis with baseline values imputed for missing values at follow - up which eventually handles dropouts as a failure. thus, the estimates of treatment effects are considered conservative in the sense that true effects might be slightly better than our estimates. in addition, several evaluated parameters were self - reports and therefore dependent on the self - perception and honesty of the participants and, hence, liable to bias. this particularly concerns the parameters eating behaviour, food intake, perceived self - competence, and quality of life. these limitations were, however, compensated for by an objective measurement of the quantitative parameter body weight, which reflects the actual physical state. moreover, quite a number of behavioural and psychosocial variables were subjected to an exploratory analysis without adjusting significance levels for multiple testing. while this probably increases the number of significant results for our study, these additional results only have an informative role, that is, to explore trends in associated behavioural and psychosocial changes. the primary parameters of interest in our study are the bmi - sds and the description of the initiating and accompanying health - related behaviour. taking these limitations into account, a major finding of our study was that 3 years after the start of treatment, 34.3% of the children and adolescents documented a successful weight reduction of more than 0.2 bmi - sds units, and five years after baseline, still 21.3% of participants show a successful reduction. it should be noted that these proportions are based on all 604 patients that originally were included in the study (intention to treat principle) and that dropouts are included with an assigned bmi - sds reduction of 0. on average, there was a significant mean reduction of bmi - sds by 0.20 0.49 after 3 years and 0.15 0.51 after 5 years. this is probably less than most patients, their families, and their therapists would hope and certainly leaves room for further improvement. nevertheless, a reduction of bmi - sds by 0.2 has been suggested as a criterion for successful weight reduction in children and adolescents. thus, on an average, the patients maintain a successful weight reduction after 3 years even when a conservative intention to treat estimate is used as in the present study. five years after baseline, the weight reduction is further attenuated to 0.15 0.51 bmi - sds units. nevertheless, it has been shown that a weight reduction of this magnitude is already associated with a decrease of hypertension. hypertension in childhood may contribute to a higher risk for cardiovascular diseases in adulthood, and therefore a reduction of hypertension as a result of weight reduction during a obesity treatment program is an important effect. most studies focusing on long - term outcomes of childhood obesity treatment did not publish their results in the form of bmi - sds change, and rather they indicated changes in body weight in kg or bmi. reinehr and colleagues (2003) in a study in germany compared the weight reduction of overweight children after one and two years, among three groups, that is, after the one - year outpatient training after two years (the nearest to our 3-year - follow - up), the children who were trained in the outpatient treatment group showed significant reduction in bmi - sds by 0.30 (2.10 up to + 0.46). another study from italy described an even greater decrease of bmi - sds by 0.44 0.7 within 3 years, for children who had participated in a therapeutic education program. yet the study only included overweight (not obese) children without any evident psychological problems. in addition, from that article, it was not clear whether the authors had used intention - to - treat analyses ; it seems as if they reported a completer analysis, which of course yields more optimistic results. in our study, successful weight reduction clearly showed age- and gender - specific differences. generally, successful long - term weight reduction was considerably more frequent among girls than boys, and girls aged 12 years and older benefited more from the treatment program than younger girls. one reason for the lower success among younger patients could lie in the focus of improving self - control, which was an essential element of the therapy. probably, the control of and responsibility for eating and exercise behaviour is more with the parents than with the children themselves. thus, targeting the parents in the treatment for younger patients could be a useful way to improve treatment effects. moreover, the gender differences found in the older children and adolescents suggest that more research is needed to understand how particularly boys can be supported in the change of eating and exercise behaviour. in addition to weight reduction, a number of other significant improvements were observed. concerning food intake, particularly the consumption of calorie - reduced beverages increased significantly and that of non - recommended foods decreased. however, positive changes in physical activity could not be maintained after the end of the therapy phase. furthermore, our study showed that successful weight reduction is associated with improvements of quality of life. although the group of participants who reduced their weight successfully is decreasing over the observation period, after five years, those patients with successful weight reduction maintained a better quality of life than those who did not reduce their weight successfully. lower health - related quality of life has been associated with obesity in preschoolers already. obesity has been shown to be a cause for teasing and bullying in children, and these in turn can contribute to the development of psychological consequences like a depression. depressive symptoms themselves contribute to lower quality of life, just as obesity itself too. therefore, improvement of health - related quality of life is an important result beyond the mere weight reduction and associated health benefits. in germany, recently doubts were expressed about the effectiveness of childhood obesity treatment programs, the associated cost - effectiveness, given the high costs of many treatment approaches, particularly of long - term treatment. the present study shows that a life - style oriented, multidisciplinary treatment approach can achieve considerable long - term weight reduction and change of relevant health behaviours, although both far from optimum. the effects of obesity treatment on improved quality of life in addition to direct health effects related to weight reduction are worthwhile to support children and adolescents in weight reduction. another important aspect of the present study is related to the combination of inpatient and outpatient treatment of obese children and adolescents. due to the structure of the german health care system, currently one option being a short - term inpatient treatment of less than 3 months duration, usually the duration is 6 weeks and the treatment takes place in a specialised hospital. often, these hospitals are located far away from the residence of the patients. the other available option is an outpatient treatment programme, conducted near the home of the patients. the duration of such programmes are considerably longer, often one year, usually with weekly therapy sessions. results from a national observation study showed that the intensive inpatient treatment results achieve better short - term weight reduction and behaviour change at the end of treatment when compared to long - term outpatient treatment programs [65, 66 ]. however, long - term results one year after the end of treatment are less clear, because follow - up assessments of these inpatient treatments resulted in an enormous lost - to - follow - up rate. thus, the verified long - term rate of successful weight reduction has been considerably lower in these inpatient treatments than outpatient treatments. the average rate of verified successful weight reduction (bmi - sds reduction more than 0.2) one year after the end of outpatient treatments appeared to be approximately 20% (intention to treat). in the present study, two years after the end of treatment, such successful weight reduction could be documented for 34% of all initial patients, and successful weight reduction was maintained over 4 years after the end of treatment for more than 20%. thus, the combination of an initial intensive inpatient treatment followed by long - term outpatient treatments seems to combine the advantages of both approaches : substantial behaviour change during initial intensive therapy and better maintenance of changes during the transfer of behaviour changes in the everyday environment. the extended support after the end of the treatment program could be one approach to achieve better sustainability. the internet with emails, virtual meetings in chat rooms, or interactive blogs could be a promising vehicle, especially since children and adolescents nowadays feel comfortable using the internet with all its possibilities. a recent systematic review concluded that interactive computer - based interventions are effective in supporting weight loss and weight maintenance. another aspect that should be considered is the amount of exercise and intensity of family involvement in obesity treatment. a current review and meta - analysis showed that exercise and family involvement are important components of effective treatment programs. family involvement improves the probability for children and adolescents to be successful in a weight reduction program. an interesting approach to enhance family involvement in physical activity was reported in a 6-month community - based program which showed remarkable postintervention effects. such posttreatment measure that motivates to more exercise maybe combined with a monetary incentives might be sensible and could enhance the sustainability of the effects of weight reduction programs. regarding treatment in our study, in addition, anecdotal reports from staff of the initial inpatient treatment pointed out that the children were often highly motivated to continue exercise. however, back home, it was apparently difficult to maintain this motivation and continue with higher levels of exercise. thus, generating more opportunities for exercise and supporting the motivation to use these opportunities should be addressed for further enhancement. in conclusion, our results indicate that an obesity treatment program which combines an intensive inpatient treatment with an outpatient therapy conducted in the home setting of the patient shows promising and sustainable results, not only directly after completion of the therapy phase but also 2 and 4 years after therapy. however, in the 2 to 4 years following the active 12 months treatment program, some of the achieved changes in body weight and health behaviour were attenuated. this indicates that either longer or more effective interventions are needed to maintain the improved health behaviour trends over a longer time and consequentially to achieve a better long - term quality of life and well - being for the children and adolescents. | aim. the combined dak therapy for obesity in children and adolescents combines a 6-week inpatient with a 10.5-month outpatient treatment. the aim of the study is to evaluate whether the therapeutic achievements are maintained two and four years after intervention. method. all subjects who had participated in the 12-month program in 2004/2005 were included in the follow - up study. body weight, height, and physical fitness were assessed through direct measurements, behaviour, and quality of life by self - report questionnaires. statistical analysis is based on an intention - to - treat analysis. results. the response rate after three years was 63.4% and 42.2% after five years. within three years, participants reduced their bmi - sds significantly by 0.20 (sd 0.49) and by 0.15 (sd 0.51) within five years. significant positive changes could be observed with respect to the participants eating behaviour. similarly, the food intake, particularly the consumption of calorie - reduced beverages, increased significantly while that of nonrecommended foods decreased. improvement was also seen in the subjective quality of life as well as several aspects of self - perception. conclusion. compared to baseline data, significant reduction of bmi - sds and positive changes of health - related behaviours could be observed even three and five years after the start of the initial program. |
in order to be inherited in progeny generations, novel genes should originate in germ cells. available data suggest that the generation of novel genes in germ cells is ongoing process, for example, the promiscuity of gene expression in spermatogenic cells [1, 2 ]. novel genes may originate through different mechanisms (retrogenes, segmental duplicates, chimeric, and de novo emerged genes), but all of them are uniformly expressed in the testis ([38 ] ; reviewed in). these observations led us to suggest that testes may play a tissue catalyst role in the birth and evolution of new genes. previously, we proposed the expression of evolutionarily novel genes in tumors. cancer / testis or cancer / germline antigen genes are a class of genes with predominant expression in testis and in a variety of tumors, with a significant exclusion of some ct antigens also expressed in the brain. here we set forth to test the hypothesis that cancer / testis antigen genes should be composed of evolutionarily new or young gene family. additionally, as an extensive traffic of novel genes has been described for mammalian x chromosome [3, 6, 11 ], we also performed this analysis separately for genes located on this chromosome only. the list of ct antigens gene was retrieved from ct database (http://www.cta.lncc.br) and included 265 genes. among them, there are 105 ct antigens that are encoded by the x chromosome (ct - x genes) and 105 that are located on various autosomes (autosome ct genes, or non - x ct genes). eight ct antigen encoding genes are located on the y chromosome. to assess the evolutionary novelty of the studied group of ct genes by searching orthologues for each of ct genes, the homologene.release 66 (http://www.ncbi.nlm.nih.gov/homologene/) tool from ncbi website was used. homologene is a database of both curated and computed gene orthologs and orthologues and now covers 21 organisms. curated orthologs include gene pairs from the mouse genome database (mgd) at the jackson laboratory, the zebrafish information (zfin) database at the university of oregon, and from published reports. computed orthologs and orthologues, which are considered putative, are identified from blast nucleotide sequence comparisons between all unigene clusters for each pair of organisms. as an input, the program uses gene name and/or taxon name, and the output is clusters of orthologues. for this study, the search was performed in several completely sequenced eukaryotic genomes, including h. sapiens, p. troglodytes, m. mulatta, c. lupus, b. taurus, m. musculus, r. norvegicus, g. gallus, d. rerio, d. melanogaster, a. gambiae, c. elegans, s. cerevisiae, k. lactis, a. gossypii, s. pombe, m. oryzae, n. crassa, a. thaliana, o. sativa, and p. falciparum. according to the origin of their orthologues in different taxa of human phylogeny the differences in distribution of ct genes and all human genes were assessed using the chi square test. sheffe 's s method of multiple estimation ([14, 15 ] ; for counts see also) was applied to define the difference and to show stochastically that the origin of human ct genes is substantially more recent than that for all human genes. the results obtained using homologene tool applied to human ct genes are presented in table 1. the full list of studied ct genes is present in supplementary material (see supplementary material available online at http://dx.doi.org/10.1155/2013/105108. homologene assigned each gene to a certain homology group which includes orthologues from different taxa within human lineage. of 265 genes represented in ct database, 47 did not match any homology group, probably because of the differences in the gene names making matches with homologene database difficult. for example, for one ct - x gene (fam133a), the orthologues were found in all eukaryota, and for two ct - x genes (magec1 and spanxn4), the orthologues were first found in bilateria, and for three ct - x genes (arx, il13ra, and fam46d), the time of origin was placed in euteleostomi. there were substantially larger numbers of ct - x genes with orthologues emerging in eutheria, catarrhini, and homininae and of ct - x genes that were found exclusively in humans. interestingly, there was a eutheria - specific subfamily tspy1 composed of 8 ct genes and located on chromosome y. similarly searches for the orthologues were performed for all ct - x genes, all autosomal ct genes, all human ct genes, and all annotated protein coding genes in human genome (assembly grch37) (table 2 and figure 1). the results show that the proportion of autosomal ct genes that has orthologues originated in euteleostomi and in eutheria (24.8% and 36.2%, accordingly) is greater than that on chromosome x. only a few of autosomal ct genes are exclusive for humans. we found that ct gene poteb (prostate, ovary, testis - expressed protein on chromosome 15, ensembl : ensg00000233917) has a poorly characterized homologue (loc100287399, ensembl : ensg00000230031) that is according to homologene criteria is exclusive to h. sapiens. this newly described homolog (loc100287399, ensembl : ensg00000230031) has not been previously annotated as a gene of ct family. among all annotated human protein coding genes, the proportion of genes specific to humans only is very small (0.85%). the list of these human - specific genes includes 163 entries, 33 of which are ct - x genes. for ct - x genes, the distribution was different : 31.4% of ct - x genes (five ct45a genes, twelve ct47a genes, fifteen gage genes, and four xage genes) are present in humans only, while 39.1% of ct - x genes have orthologues that emerged in catarrhini or homininae. this means that the majority (70.5%) of ct - x genes present in human genome are either novel or relatively recent. at the same time, distribution of all genes located on x chromosome is similar to that for all human genes (see supplementary table iv). the distribution of all human ct genes shows that 30.73% of ct genes have orthologues that originated in eutheria. this proportion is larger than the proportion of all human genes with pan - eutherian orthologues (16.41%). importantly, thus, the majority of human ct genes (72.48%) originated during or after the emergence of eutheria. on the other side, the majority of annotated human genes (75.95%) were older than eutheria. a significance of the difference between distribution of all human genes and all human ct genes according to the origin of their orthologues in different taxa was confirmed bychi square test (p value less than 10). moreover, 95% confidence region for the cumulative distribution function of ct human genes displays that ct genes are stochastically younger as compared to all human genes. in other words, the probability that a gene randomly chosen from all human genes is younger than some fixed time t is less than the probability that a randomly chosen ct gene is younger than t. therefore, there is a significant bias in time of origin for human ct genes as compared to all human genes. if human ct genes would be obtained as a sample from some probabilistic distribution, the probability that ct human genes originated not earlier than catarrhini or eutheria would be significantly higher than the respective probability for census of all human genes (figure 2). cancer / testis antigen genes (cta or ct genes) encode a subgroup of tumor antigens expressed predominantly in testis and various tumors. ct antigens may be also expressed in placenta and in female germ cells [1720 ]. experimentally, human ct genes were discovered by a variety of immunological screening methods, serological identification of antigens by recombinant expression cloning (serex), expression database analysis [24, 25 ], massively parallel signature sequencing, and other approaches. the fact that many ct antigens have been identified using serex suggests that they are highly antigenic [23, 27 ]. the first ct gene discovered was magea1 that encodes for an antigen of human melanoma. this gene belongs to a family of 12 closely related genes clustered at xq28. a second cluster of mage genes, mageb, was discovered at xp21.3, and the third, encoding magec genes, is located at xq26 - 27. the expression of magea - magec genes (mage - i subfamily) is restricted to testis and cancer, whereas more distantly related clusters maged - magel (subfamily mage - ii) are expressed in many normal tissues. mage - i genes are of relatively recent origin, and mage - ii genes are relatively more ancient. one of these genes corresponds to the founder member of the family, and the other mage genes are retrogenes derived from the common ancestral gene [19, 28, 29 ]. to date more than half of them are located on x - chromosome (ct - x genes). the analysis of the dna sequence of the human x chromosome predicts that approximately 10% of the genes on the x chromosome are of the ct antigen type. non - x ct genes are distributed throughout the genome and are represented mainly by single - copy genes [19, 27, 31 ]. in normal testis, non - x ct genes are expressed during later stages of germ - cell differentiation, that is, spermatocytes. among human tumors, ct antigens are expressed in melanoma, bladder cancer, lung cancer, breast cancer, prostate cancer, sarcoma, ovarian cancer, hepatocellular carcinoma, hematologic malignancies, and so forth [21, 27, 31, 32 ]. genome - wide analysis of 153 cancer / testis genes expression has led to their classification into testis - restricted (n = 39), testis / brain - restricted (n = 14) and testis - selective (n = 85) groups of genes, the latter group showing some expression in nongermline tissues. the majority of testis - restricted genes belong to ct - x group (35 of total 39 testis - restricted groups), while non - x ct genes are expressed in a less restrictive way. multiple ct antigens are often coexpressed in tumors suggesting that this expression program is coordinated for entire family [19, 23, 33 ]. ct gene expression is controlled by epigenetic mechanisms which include dna methylation and histone posttranslational modifications. other mechanisms of ct gene regulation include sequence - specific transcription factors and signal transduction pathways such as activated tyrosine kinases. the functions of ct - x genes are largely unknown. on the contrary, more is known about functions of non - x ct genes which are associated with meiosis, gametogenesis, and fertilization. non - x cts are also more conserved during evolution [21, 27, 31, 32 ]. ct - x genes tend to form recently expanded gene families, many with nearly identical gene copies [1720, 26, 32, 35 ]. the prevalence of large, highly homologous inverted repeats (irs) containing testes genes on the x- and y - chromosomes was described in humans and great apes [36, 37 ]. the study of clusters of homologous genes originated by gene duplication roughly after the divergence of the human and rodent lineages discovered several families of ct genes among recent duplicates. in the other paper, the authors also studied recent duplications in the human genome and found that ct genes were represented in this gene set, including the family of prame (preferentially expressed antigen of melanoma) genes located on chromosome 1 and expressed in the testis and in a large number of tumors. duplicated prame genes are hominid specific, having arisen in human genome since the divergence from chimps. chimp and mouse have orthologous prame gene clusters on their chromosomes 1 and 4, respectively [39, 40 ]. in particular, the comparison of human : chimp orthologues of these genes has shown that they diverge faster and undergo stronger positive selection than those on the autosomes or than control genes on either x chromosome or autosomes. spanx - a / d gene subfamily of cancer / testis - specific antigens evolved in the common ancestor of the hominoid lineage after its separation from orangutan. the coding sequences of the spanx genes evolved rapidly, faster than their introns and the 5 untranslated regions, with accelerated rates of substitutions in both synonymous and nonsynonymous codon positions. the mechanism of spanx genes expansion was segmental dna duplications, with evidence of positive selection. spanx - n is the ancestral form, from which the spanx - a / d subfamily evolved in the common ancestor of hominoids approximately 7 mya [35, 42 ]. spanx genes are expressed in cancer cells and highly metastatic cell lines from melanomas, bladder carcinomas, and myelomas. the gage cancer / testis antigen gene family contains at least 16 genes which are encoded by an equal number of tandem repeats. gage genes are highly identical and evolved under positive selection that supports their recent origin [43, 44 ]. the xage family of cancer / testis antigen genes belongs to superfamily of gage - like ct genes. three xage genes are described, as well as several splice variants of xage-1 [45, 46 ]. it includes six highly similar (> 98%) genes that are cluctered in tandem on chromosome xq26.3. ct45 antigen is expressed in hodgkin 's lymphoma and in other human tumors [26, 4749 ]. ct47 cancer / testis gene family is located on chromosome xq24. among normal tissues, it is expressed in the testis and (weakly) in placenta and brain. in tumors, chimp is the only other species in which a gene homologous to ct47 was found by other authors. our work is the first systematic study of the evolutionary novelty of the whole class of ct genes. to assess the evolutionary novelty of ct genes, we applied the homologene tool of ncbi. to construct the clusters of orthologues, the homologene program uses information from blastp, phylogenetic analyses, and syntheny information when it is possible. cutoffs on bits per position and ks values are set to prevent unlikely orthologs from being grouped together. these cutoffs are calculated based on the respective score distribution for the given groups of organisms. we searched for orthologues of each of ct genes among annotated genes in several completely sequenced eukaryotic genomes and built distributions of all ct - x genes, all autosomal ct genes, all human ct genes, and all annotated protein coding genes from human genome according to the origin of their orthologues in 11 taxa of human lineage. we have shown that 31.4% of ct - x genes are exclusive for humans and 39.1% of ct - x genes have orthologues originated in catarrhini or homininae. thereby, the majority of human ct - x genes (70.5%) are novel or recent in its origin. our data are in good correspondence with evidence obtained by other groups on rapid expansion of certain ct - x gene families and high homology of their members which suggest their recent origin. altogether 36.7% of all human ct genes originated in catarrhini, homininae, and humans. this indicates the importance of processes in which tumors and ct antigens were involved during the evolution of eutheria. ct genes originated in catarrhini, homininae, and humans are located predominantly on x chromosome. this difference is probably related to evolution of mammalian x chromosome since the origin of eutheria, especially to the acquisition of its special role in the origin of novel genes. thus, the majority of ct - x genes are either novel or young for humans, and the majority of all human ct genes (72.48%) originated during or after the origin of eutheria. these results suggest that the whole class of human ct genes is relatively evolutionarily new. in its turn, this conclusion confirms our prediction about expression of evolutionary recent and novel genes in tumors. the expression of cancer / testis genes in tumors is then a natural phenomenon, not aberrant process as suggested by many authors (e.g., [19, 27, 32, 34, 40 ]). | in order to be inherited in progeny generations, novel genes should originate in germ cells. here, we suggest that the testes may play a special catalyst role in the birth and evolution of new genes. cancer / testis antigen encoding genes (ct genes) are predominantly expressed both in testes and in a variety of tumors. by the criteria of evolutionary novelty, the ct genes are, indeed, novel genes. we performed homology searches for sequences similar to human ct in various animals and established that most of the ct genes are either found in humans only or are relatively recent in their origin. a majority of all human ct genes originated during or after the origin of eutheria. these results suggest relatively recent origin of human ct genes and align with the hypothesis of the special role of the testes in the evolution of the gene families. |
gout is the most common metabolic disease in human, which results from the purine metabolism disorder. due to loss of uricase in human, purine metabolism in human and apes monosodium urate (msu) crystals formation results from serum uric acid concentrations rise above the physiological saturation, which deposit in joints and soft tissues leading to arthritis, soft tissue masses, nephrolithiasis, and urate nephropathy. the finding of hyperlipidaemia in gout patients is common, including an increase in small dense ldl cholesterol and a reduction in hdl cholesterol. it was shown that metabolic syndrome including high levels of ldl and tg might be an important factor in the cause of chronic kidney disease (ckd) [5, 6 ]. previous study has shown that excess triglyceride - rich lipoproteins are oxidized by oxidative stress in chronic kidney disease. the prevention of hypertriglyceridemia is one of the most important steps for the treatment of chronic kidney disease. il-33 is a member of the il-1 cytokine family, and the intracellular pathway of il-33 signaling is similar to that of il-1 signaling. il-33 signaling occurs by binding to st2, il-1racp, subsequent intracellular signaling pathways including myd88, irak (irak1, irak4), and traf6, leading to the activation of nf-b and mapks (p38, jnk, and erk) pathways [10, 11 ]. il-33 production is upregulated in inflamed tissues and acts as an early inducer of inflammation contributing to the further amplification of inflammatory responses. furthermore, recent studies have demonstrated that il-33 played a critical role in obesity - associated inflammation, atherosclerosis, and metabolic abnormalities through promoting the production of t helper type 2 (th2) cytokines and polarizing macrophages towards a protective alternatively activated phenotype. although the detrimental role for il-33 in the ra and spa has been reported, the role of il-33 in gout arthritis is still unknown. in the present study, we examine serum levels of il-33 by elisa from gout patients, and correlation with clinical markers in patients with gout was analyzed. we found that serum levels of il-33 in gout patients were significantly higher than healthy subjects. previous studies showed that il-33 exacerbates acute kidney injury, whereas il-33 showed a negative correlation with biomarker of kidney injury, such as cre and urea in gout patients. there were no significant differences in the gout patients with tophi or hypertension which can cause kidney damage. however, an inverse correlation of il-33 expression was observed in ldl, and a significantly positive correlation was observed in hdl. these data suggested that il-33 might prevent the kidney injury through regulating the lipid metabolism in gout patients. a total of 41 patients diagnosed with gout (2 women and 39 men, age 2691, mean 58.3 years) were recruited from the outpatient clinic and ward of the department of rheumatology and clinical immunology, the first hospital of xiamen university. the results were compared with a population of 44 healthy volunteers (healthy controls) matched for sex and age. local ethics committee approved the study and informed consent was obtained from patients and control subjects. clinical data and several laboratory parameters, such as cre, urea, hdl, ldl, and ua, of patients were gathered. the number and clinical characteristics of healthy controls and patients with gout were summarized in table 1. four milliliters of blood was collected in sterile coagulant tubes and was then centrifuged at 3,500 rpm for 5 min at ambient temperature to obtain serum, which was immediately frozen and stored at 80c until batch analysis. concentrations of il-33 (peprotech, usa) were determined by elisa kits according to the manufacturers ' protocols. the mann - whitney u test and spearman 's correlation analysis were used to calculate significance. the clinical characteristics of gout patients (see table 1) were summarized for this study. forty - one patients with gout and forty - four healthy controls of southern chinese population were enrolled. the mean age for gout patients was 58.3 years with range (2691) ; there were 39 males and 2 females. the mean course of the disease was for 10.6 years with range of 0.340 years. among these 41 patients, 36 patients (87%) had acute phase, 15 patients (36.5%) had tophi in gout, 27 patients (65.8%) had hyperuricemia, 18 patients (43.9%) had hypercholesteremia, 21 patients (51.2%) had hypertension, 13 patients (31.7%) had gouty kidney damage, 19 patients (46.3%) had osteoporosis, and 4 (9.7%) had fever. however, the role of il-33 in gout patients has not been described until now. currently, compared with healthy controls, the serum il-33 levels in gout patients were significantly increased (p < 0.0001). as shown in figure 1(a), the median level of il-33 in gout patients was 184.6 pg / ml with range of 31.3741.3 pg / ml, while healthy control was 65.6 pg / ml (2.16257.8 pg / ml). furthermore, we observed that the gout patients with renal injury showed lower il-33 levels (median 114.9 pg / ml : 31.3447.8) when compared with gout patients without renal injury (median 299.5 pg / ml : 57.9741.3) (p = 0.027) (figure 1(b)). the renal function in gout patients was often damaged by tophi, hyperlipoidemia, and hypertension. the il-33 expression of gout patients with tophi (median 154.0 pg / ml : 57.9589.1) or not (median 185.7 pg / ml : 31.3741.3) (p = 0.635) and with hypertension (median 150.7 pg / ml : 31.3741.3) or not (median 196.7 pg / ml : 71.7614.0) (p = 0.804) did not show a significant difference (figures 2(a) and 2(b)). interestingly, when compared with low serum hdl levels, the gout patients with high - hdl levels showed an increased il-33 expression (328.9 231.5 versus 154.2 97.35 pg / ml, p = 0.01). in addition, the role of il-33 in the gout patients with kidney injury was analyzed. spearman 's correlation coefficient was used for the assessment of correlation between il-33 levels and cre or urea. as expected, the il-33 levels were negatively correlated with cre (r = 0.57, p < 0.0001) and urea (r = 0.49, p = 0.0008) (figures 3(a) and 3(b)). the above results showed that hdl played a protect role in the development of the kidney injury in gout patients. here furthermore, lipid metabolism disorder often occurred in gout patients, which caused kidney damage (figure 3(c)) in gout patients, and recent study has shown that il-33 plays a protective role in atherosclerosis. we found that a positive correlation between il-33 and hdl (r = 0.41, p = 0.007) was observed (figure 4(a)). consistently, ldl, a critical lipid for the development of atherosclerosis, was in negative correlation with il-33 (r = 0.33, p = 0.03) (figure 4(b)). a negative correlation between il-33 and tg was observed, although there is no significant difference (r = 0.12, p = 0.42) (figure 4(c)). in the present study, we demonstrated the il-33 expression and its potential role in gout patients. serum il-33 levels were significantly elevated in patients with gout patients when compared with healthy control subjects. furthermore, the elevated il-33 levels were considerably reduced in renal impairment when compared with normal renal function in gout patients. there were no significant differences whether the gout patients had tophi or hypertension which can cause kidney damage. however, an inverse correlation of il-33 expression was observed in ldl, and a significantly positive correlation was observed in hdl. these data suggested that il-33 might prevent the kidney injury through regulating the lipid metabolism in gout patients. it was first demonstrated that il-33 activates t helper type 2 (th2) cells and mast cells to secrete th2 cell - associated proinflammatory cytokines and chemokines. additionally, il-33 can also induce proinflammatory effects depending on th1/th17 immune response [14, 15 ]. previous studies have reported that il-33 acts as an endogenous danger signal or alarmin that may alert the immune system in response to inflammatory diseases, such as hypersensitive diseases like asthma, autoimmune diseases like rheumatoid arthritis, allergic rhinitis, and autoimmune conjunctivitis. il-33 from necrotic cells might induce autophagy, which can further balance the effects of increased apoptosis secondary to contrast - induced nephropathy in diabetic kidney disease. in addition, il-33 promotes acute kidney injury through cd4 t cell - mediated production of cxcl1. although the cytokine secretion by macrophage can be enhanced by il-33 [2325 ], in our study il-33 was found increased in gout patients with no kidney injury. the reason for the dual function of il-33 might be the various inflammatory environments in different diseases. it is well known that gout is associated with cardiovascular and metabolic diseases, such as hypertension, hyperlipidaemia, and diabetes mellitus. interestingly, it has been demonstrated that il-33 is a potent inhibitor of macrophage foam cell formation in vivo and in vitro and attenuates atherosclerosis. il-33 blocks foam cell formation by directly regulating the expression of genes for acldl / oxldl uptake and storage of cholesteryl esters and triglycerides and cholesterol efflux / transport and by inducing a phenotypical th1-to - th2 switch. il-33 may play a protective role in the development of atherosclerosis via the induction of il-5 and ox - ldl antibodies. low serum high - density lipoprotein cholesterol level was an independent predictor for gouty flares, while gout patients who had higher high density lipoprotein (hdl) levels with metabolic syndrome were at the lowest risk. in line with above results, we also observed that serum levels of il-33 were positively correlated with hdl from gout patients, and the expressya ion of il-33 was markedly high in the patient without kidney damage. and ua from gout patients. msu has been identified as an endogenous factor for kidney damage. nlrp3 activation induced by msu crystal triggers caspase-1-dependent il-1 and il-18 secretion, which induces a general inflammatory response including recruitment of neutrophils and macrophages to the site of crystal formation. these cytokines and infiltrated immune cells in the kidney interstitial tissue result in the renal tubular epithelial cell damage and interstitial fibrosis, and the inflammation condition is easy to cause the glomerulitis and renal dysfunction. although the cytokine secretion by macrophage can be enhanced by il-33 [2325 ], in our study gout patients with no kidney injury showed a high il-33 expression. a number of epidemiological studies have reported that serum uric acid levels are the high - risk factor in the pathogenesis of hypertension, and high plasma uric acid levels are common in patients with arterial hypertension. hypertension is commonly associated with renal vasoconstriction, which also leads to kidney injury, but no correlation between hypertension and il-33 expression was observed in this study. furthermore, the spectrum of renal diseases in gout patients includes urate stones, acute uric acid nephropathy, and chronic urate nephropathy. chronic urate nephropathy may be associated with a series of complicating factors, rather than simply with excessive depositions of uric acid within renal tissues, such as microvascular damage from untreated hypertension. thus, il-33 might play a protective role in the kidney injury of gout through regulating lipid metabolism. in conclusion, the results presented here suggest that the serum il-33 could be a sensitive marker for kidney function in gout patients. interestingly, it is noted that il-33 was associated with hdl and cre in gout, suggesting that the il-33 may play a beneficial role in the pathogenesis of gout. of course, further studies are required to explore the specific regulation mechanism between il-33 and renal function. | interleukin-33 (il-33), the most recently discovered member of the il-1 superfamily, has been linked to several human pathologies including autoimmune diseases, sepsis, and allergy through its specific il-1 receptor st2. however, there is little information regarding the role of il-33 in gout. in this study, we investigated the potential role of il-33 in gout patients. the serum level of il-33 was measured by elisa, and the clinical and laboratory parameters, serum creatinine, urea, and lipid, were extracted from medical record system. the serum il-33 expression was predominantly increased in gout patients compared to healthy controls, and the il-33 levels were higher in patients without kidney injury. furthermore, il-33 showed a negative correlation with biomarkers of kidney injury, such as cre and urea. the lipid metabolism dysfunction, tophi, and hypertension are the common reasons for kidney injury in gout. interestingly, inverse and positive correlation of il-33 expression was observed in ldl and hdl, respectively. however, there was no significant alteration in the gout patients with hypertension and tophi. these data suggested that il-33 might act as a protective role in kidney injury through regulating the lipid metabolism in gout. |
animals : twenty - three client - owned female dogs admitted between 20112014 to the small animal clinic of the university of goettingen, for diagnosis and subsequent surgical treatment (ovariohysterectomy, ohe) of pyometra were included in this prospective study. inclusion criteria were the presence of pyometra without previous treatment and the absence of further diseases. enrolled patients underwent a detailed anamnesis, physical examination, complete blood cell count (cbc) and serum chemistry. post - surgical gross evaluation of the uterus was carried out to establish the degree of uterine distension, as well as the presence and amount of pus in the uterine lumen. the control group consisted of 12 healthy client - owned dogs admitted for routine health examinations or ohe and 23 healthy dogs from the animal shelter etn tierschutzhof wiesenfeld in bad karlshafen (state of lower saxony). the dogs were confirmed to be healthy based on their medical history, detailed physical examination, cbc and serum chemistry. all samples were acquired with the owner s consent, and the procedure was in accordance with the german protection of animals act and carried out under the supervision of the animal welfare officer of the faculty of agriculture, university of goettingen. dogs with pyometra had a median age of 8.5 years (range 314.6 years), being most of them older than 7 years (n=19). fifteen different breeds were represented in this group. to analyze the behavior of serum cxcl8 in relation to pyometra, the following clinical characteristics were taken into consideration : symptomatology, uterine distension / filling, time of recovery, wbc, neutrophil count and serum crp values. dogs were grouped according to the extent of these characteristics, as listed in table 1table 1.clinical characteristics and grouping of dogs with pyometracharacteristicclinical featuresgroupsn=23symptomatologyapathymild15lethargysevere8polyuriapolydipsiainappetanceemesisdiarrheaabdominal painabdominal distensionvaginal dischargeuterine distensionintrauterine pus amountmoderate filled uterus10massively filled uterus13time for recoverydays of hospitalization2 days9wbc count6,00012,000/lnormal612,00025,000/lmoderate9>25,000/lsevere8neutrophil count3,0009,000/lnormal79,00017,000/lmoderate5>17,000/lsevere11serum crp15 mg / lelevated15. the grouping of dogs according to the intensity of their symptoms was done using the asa physical status classification system. dogs without substantive functional limitations were considered to have a mild symptomatology, whereas patients with severe symptoms showed substantive functional limitations due to systemic disease. yet, it has to be considered that there is no absolute measure of severity, as this is a matter of clinical judgment. the classification of the degree of uterine distension / filling was based on the diameter of the uterus horns in relation to the dogs body weight. for dogs below 15 kg body weight, a uterus horn diameter of 3 cm was set as limit between the two groups. for dogs above 15 kg body weight, the limit was set at 4 cm. healthy dogs had a median age of 4.5 years (range 1.511.5 years), being 10 of them older than 7 years old. seventeen dogs were female (8 neutered) and 18 male (13 neutered). seven breeds were represented, but most dogs were of mixed breed (n=25). blood samples : blood samples were taken from the cephalic vein previous to treatment. blood samples for cbc were collected in polypropylene tubes with 1.6 mg edta / ml blood (sarstedt ag & co, nuembrecht, germany) and immediately analyzed with a celldyn 3500 analyzer (abbott gmbh & co kg, wiesbaden, germany). serum samples required for serum chemistry (including crp) were collected in standard serum tubes (sarstedt ag & co) and centrifuged in an eppendorf centrifuge 5424 (eppendorf ag, hamburg, germany) at 3,000 g for 5 min. serum was extracted from the tube and analyzed according to standardized procedures using a clinical chemistry analyzer (konelab 20i ; thermo fischer scientific inc., cxcl8 was measured in serum, since preliminary results showed a higher reliability than plasma values. serum samples used to determine the cxcl8 concentrations were collected at the same time as the blood for cbc and serum chemistry and were then processed following the commercial elisa kit protocol (r&d systems, minneapolis, mn, u.s.a.). samples were kept at room temperature for two hr to allow clotting and were then centrifuged for 20 min at 1,000 g. serum was immediately aliquoted with a pipetman p100 (gilson, villers le bel, france) and stored at 20c until required for analysis. a storage time of more than three months and repeated freeze - thaw cycles were avoided. assessment of cxcl8 : serum cxcl8 levels were measured in triplicate using a commercially available canine cxcl8 quantitative elisa kit (quantikine, r&d systems) following the manufacturer s instructions. the optical density of each well was determined within 30 min using a tecan microplate reader at an optical density of 450 nm and a wavelength correction of 570 nm. calibration was performed using a standard series of dilutions of recombinant canine cxcl8 provided in the kit. for matters of test accuracy, a canine cxcl8 control of known concentration the cxcl8 concentration (pg / ml) of each sample was calculated through a data analysis software (magellan, tecan austria gmbh, groedig, austria). according to the manufacturer s instructions, the assay measures the natural and recombinant cxcl8 isoforms of 74 and 79 amino acids, and the minimum detectable dose of cxcl8 is 1.26 pg / ml. the assay shows no cross - reactivity with a series of cytokines and growth factors. the manufacturer reported mean intra- and inter - assay coefficients of variation of 5.6 and 5.3%, respectively. statistical analysis : statistical analysis was performed using a commercial software (matlab and statistics toolbox release 2015b, the math works, inc., cxcl8 concentrations were grouped according to goal criteria, and the null - hypothesis was tested using a non parametric mann - whitney - u - test. since clinical characteristics are given in ordinal categorical classes, the relation between the serum cxcl8 concentration and increase in category was analyzed using generalized linear models (glm). for this, cxcl8 values were analyzed log transformed, and both process and observation error were assumed to have gaussian distributions. blood samples : blood samples were taken from the cephalic vein previous to treatment. blood samples for cbc were collected in polypropylene tubes with 1.6 mg edta / ml blood (sarstedt ag & co, nuembrecht, germany) and immediately analyzed with a celldyn 3500 analyzer (abbott gmbh & co kg, wiesbaden, germany). serum samples required for serum chemistry (including crp) were collected in standard serum tubes (sarstedt ag & co) and centrifuged in an eppendorf centrifuge 5424 (eppendorf ag, hamburg, germany) at 3,000 g for 5 min. serum was extracted from the tube and analyzed according to standardized procedures using a clinical chemistry analyzer (konelab 20i ; thermo fischer scientific inc., cxcl8 was measured in serum, since preliminary results showed a higher reliability than plasma values. serum samples used to determine the cxcl8 concentrations were collected at the same time as the blood for cbc and serum chemistry and were then processed following the commercial elisa kit protocol (r&d systems, minneapolis, mn, u.s.a.). samples were kept at room temperature for two hr to allow clotting and were then centrifuged for 20 min at 1,000 g. serum was immediately aliquoted with a pipetman p100 (gilson, villers le bel, france) and stored at 20c until required for analysis. a storage time of more than three months and repeated freeze - thaw cycles were avoided. assessment of cxcl8 : serum cxcl8 levels were measured in triplicate using a commercially available canine cxcl8 quantitative elisa kit (quantikine, r&d systems) following the manufacturer s instructions. the optical density of each well was determined within 30 min using a tecan microplate reader at an optical density of 450 nm and a wavelength correction of 570 nm. calibration was performed using a standard series of dilutions of recombinant canine cxcl8 provided in the kit. for matters of test accuracy, a canine cxcl8 control of known concentration the cxcl8 concentration (pg / ml) of each sample was calculated through a data analysis software (magellan, tecan austria gmbh, groedig, austria). according to the manufacturer s instructions, the assay measures the natural and recombinant cxcl8 isoforms of 74 and 79 amino acids, and the minimum detectable dose of cxcl8 is 1.26 pg / ml. the assay shows no cross - reactivity with a series of cytokines and growth factors. the manufacturer reported mean intra- and inter - assay coefficients of variation of 5.6 and 5.3%, respectively. statistical analysis : statistical analysis was performed using a commercial software (matlab and statistics toolbox release 2015b, the math works, inc., natick, ma, u.s.a.). cxcl8 concentrations were grouped according to goal criteria, and the null - hypothesis was tested using a non parametric mann - whitney - u - test. since clinical characteristics are given in ordinal categorical classes, the relation between the serum cxcl8 concentration and increase in category was analyzed using generalized linear models (glm). for this, cxcl8 values were analyzed log transformed, and both process and observation error were assumed to have gaussian distributions. no influence of the dogs age, gender and reproductive status on serum cxcl8 concentrations was found, validating the use of a mixed age and gender control group (data not shown). the serum cxcl8 levels of dogs with pyometra ranged from 313.43 pg / ml to 5987.80 pg / ml, with a median of 1767.4 pg / ml (interquartile range : 813.352299.68 pg / ml). the average serum cxcl8 level in these patients was significantly higher (p=0.026) than in healthy controls (range : 383.792506.50, median : 1019.50 pg / ml and interquartile range : 868.541239.0 pg / ml) (fig. 1.dogs with pyometra have higher serum cxcl8 values than healthy patients and patients with severe disease. a) comparison of the serum cxcl8 levels among the healthy control group and dogs with pyometra. b) serum cxcl8 concentrations of healthy dogs and dogs with mild and severe symptoms due to pyometra. c) serum cxcl8 concentrations of healty dogs and dogs with a moderate and severe uterine distension. p value 0.05. p value 0.01.). nevertheless, when analyzing serum cxcl8 in relation to the severity of the symptoms, only dogs with mild symptoms had significantly higher values than healthy dogs (p=0.002). patients with severe symptoms had much lower cxcl8 levels than those with mild symptoms (p=0.035) and were statistically indistinguishable from the healthy control group (fig. a relationship between the severity of the symptoms and serum cxcl8 was further sustained by the use of glm (p=0.04). dogs with pyometra have higher serum cxcl8 values than healthy patients and patients with severe disease. a) comparison of the serum cxcl8 levels among the healthy control group and dogs with pyometra. b) serum cxcl8 concentrations of healthy dogs and dogs with mild and severe symptoms due to pyometra. c) serum cxcl8 concentrations of healty dogs and dogs with a moderate and severe uterine distension. similar results were found for the levels of serum cxcl8 in association to the uterine distension due to pus accumulation in the uterine lumen. dogs with a less filled and distended uterus had significantly higher serum cxcl8 values than dogs with a massively filled and distended uterus (p=0.03). instead, dogs with a massively filled uterus had similar values to healthy dogs (fig. using glm, a significant association between the symptomatology and the uterus distension was found (p<0.001), explaining the similarity of the previous results. moreover, patients with a faster and uncomplicated recovery after surgery had higher initial serum cxcl8 values than patients with a delayed recovery, but the difference was not significant (data not shown). the behavior of wbc and neutrophils was equivalent, since an increase in the wbc count during pyometra is mainly caused by a left shift neutrophilia. given that the function of cxcl8 is almost restricted to neutrophils, only statistical results regarding the neutrophil count will be mentioned. an opposed behavior was observed when serum cxcl8 values and the neutrophil count were compared. dogs with pyometra and a normal neutrophil count had significantly higher serum cxcl8 values compared to healthy dogs (p=0.01). in the presence of a moderate neutrophilia, serum cxcl8 was even higher (p=0.001), but the values were significantly lower when neutrophilia was severe. the serum cxcl8 values of dogs with severe neutrophilia were similar to the values of healthy dogs (fig. a) serum cxcl8 concentrations in healthy dogs and dogs with different neutrophil counts. b) comparison of serum cxcl8 among healthy dogs and dogs with normal and increased crp values. p value 0.05. p value 0.01.). although, the neutrophil count tended to be higher in the presence of a more pronounced symptomatology, a marked uterine distension and a slow recovery, these associations were statistically not significant (data not shown). a) serum cxcl8 concentrations in healthy dogs and dogs with different neutrophil counts. b) comparison of serum cxcl8 among healthy dogs and dogs with normal and increased crp values. patients with normal crp values had significantly higher serum cxcl8 concentrations than healthy dogs (p<0.001) and patients with increased crp levels (p<0.01), while the last two groups were statistically indistinguishable (fig. although the neutrophil and crp levels behave in a comparable way, a relationship between both could not be proven. as with the neutrophil count, crp tended to raise with a pronounced symptomatology, a marked uterine distension and a slow recovery, but the results were statistically not significant (data not shown). a graphical representation of the cxcl8, neutrophil count and crp values, and their association to the symptomatology and the uterine distension remarked the opposed behavior of these inflammatory mediators (fig. 3fig. a) normalized values of serum cxcl8, neutrophils and crp in each patient. b) normalized values of serum cxcl8, neutrophils and crp in relationship to the symptoms intensity. c) normalized values of serum cxcl8, neutrophils and crp in relationship and crp in the relationship to the uterine distension.). a) normalized values of serum cxcl8, neutrophils and crp in each patient. b) normalized values of serum cxcl8, neutrophils and crp in relationship to the symptoms intensity. c) normalized values of serum cxcl8, neutrophils and crp in relationship and crp in the relationship to the uterine distension. inflammatory reactions are part of the pathomechanism of multiple diseases, and their exacerbation is associated with a high mortality in human and veterinary medicine. the inflammatory response is an intricate cross - talk between several cytokines, acute phase proteins (apps) and cells, but many of these ongoing interactions remain unclear. the neutrophil chemoattractant cxcl8 is shown to be elevated in various inflammatory diseases, but its precise role in the pathophysiology of imbalanced inflammatory processes needs to be further clarified [2, 13, 17, 22, 23, 25 ]. as a common and well described naturally occurring inflammatory disease, canine pyometra represents a good model to study the behavior of serum cxcl8 and its relation to other inflammatory mediators during inflammation. since pyometra is a disease that affects exclusively females, we first discarded the influence of gender on serum cxcl8 by comparing healthy male and female dogs. a difference between genders, as well as between neutered and unneutered dogs, was statistically discarded. thus, a mixed gender control group was employed in order to increase the groups size and minimize a possible hormonal influence on our results. since cxcl8 is fundamental for the migration and activation of neutrophils, it is expected to be elevated in diseased animals [3, 6, 31 ]. serum cxcl8 levels in dogs with pyometra have seldom been analyzed, but it has been shown that various cell types within the uterus produce cxcl8 in response to diverse stimuli, including pyometra [5, 11, 16, 30 ]. the source of cxcl8 measured in sera is unknown and so, a local as well as a systemic secretion has to be taken into consideration. therefore, local and systemic cxcl8 should be compared in future studies. when analyzing serum cxcl8 in relation to the severity of the symptoms, only dogs with mild symptoms had significantly higher values than healthy dogs. on the other hand, similar results were found by karlsson. in a study about serum cxcl8 canine pyometra and by declue. who analyzed plasma cxcl8 in septic dogs [7, 14 ]. both, patients with sirs or sepsis, had similar values to healthy dogs [7, 14 ]. nonetheless, dogs without sirs had lower values than healthy and sirs positive patients, being contrary to our results. this can be due to grouping criteria, since the clinical signs used to diagnose sirs are different from the symptoms included in our study. there are various possible reasons for the lacking increase of cxcl8 in the group with marked symptoms. first, the raise of serum cxcl8 is transient and can change drastically very fast during the course of disease [1, 8, 15 ]. as the exact moment of this dynamic process at sampling time this theory may be supported by the raise of neutrophils and crp that accompanied the cxcl8 decrease, as this may be part of a physiologically orchestrated response. second, low serum cxcl8 values can be due to a poor or depleted immune response and thus be related to severe symptoms. third, progesterone is an inhibitor of cxcl8 in uteri and makes this organ more susceptible to infection [5, 16, 28, 29, 31 ]. if the cxcl8 in sera stems from the uterus, its decrease may be the result of high progesterone concentrations. whether progesterone has the same effect on systemically produced cxcl8 has not been reported and should be considered for further research. yet, our analysis regarding gender and neutering was statistically irrelevant, making an influence of progesterone on circulating cxcl8 unlikely. consistent with the previous results, dogs with a less filled uterus had higher serum cxcl8 values than the healthy group and dogs with a massively filled uterus, while the last two groups were akin. the similarity to the results regarding the symptomatology is not surprising, as the degree of uterus distension and pus accumulation within the uterine lumen influences the symptoms intensity. although, it is not known if the lacking serum cxcl8 increase is the cause or the result of a more severe disease, it is reasonable that low cxcl8 levels may lead to an impaired neutrophil response within the uterus and consequently a worsening of the disease. furthermore, cxcl8 is strongly involved in cervix ripening [5, 16, 30 ], allowing the expulsion of uterus content. thus, decreased cxcl8 can lead to an impairment of this mechanism favoring the accumulation of pus in the uterine lumen. on the other hand, if the cxcl8 measured in sera is produced in uteri, an increasingly damaged uterus tissue may lead to a decreased cxcl8 production. in this study, serum cxcl8 was not increased in dogs with severe leucocytosis and neutrophilia when compared to dogs with normal and moderately elevated values. although cxcl8 has a strong effect on neutrophils, this is a dynamic process and their concentrations do not change simultaneously and proportionally [1, 8, 9, 21 ]. the raise of cxcl8 is transient, whereas wbcs and neutrophils may stay elevated for a longer period of time. in the presence of pyometra, apoptotic polymorphonuclear (pmn) furthermore, a feedback mechanism is likely, so that when high levels of neutrophils are reached, a cxcl8 decrease is induced. moreover, cxcl8 stimulates neutrophil migration into the tissue, causing a decrease in the amount of circulating cells. thus, an opposed behavior of the cxcl8 and neutrophil concentrations in blood is reasonable. when comparing crp and serum cxcl8, contrary concentrations were found. crp has been found to be elevated along with cxcl8 in severe or complicated cases of various diseases [4, 8, 20 ]. however, although the production of crp and cxcl8 is partly regulated by the same cytokines, namely tumor necrosis factor (tnf) and interleukin-1 (il-1), the stimulation and response of each protein vary depending on the stimulus, the activation pathway and if it is an acute or chronic inflammation. distinct to cxcl8, crp is mainly induced by il-6, and this may determine how crp behaves in relation to cxcl8 [8, 19, 26 ]. contrary to cxcl8, crp leads to an inhibition of chemotaxis and modulation of neutrophil function and may therefore be stimulated at a different point of the disease. furthermore, some of the common apps have recently been shown to share the ability to down - regulate the pro - inflammatory cytokine production and activity in monocytic cells. since monocytes represent an important source of cxcl8, low values may be caused by a crp peak as part of a regulatory mechanism. the opposite behavior of these two parameters may also be explained by the location of their production. while cxcl8 may be produced in uteri and be therefore synthesized very early in the course of the disease, crp is mainly produced in the liver and may require stronger or systemic changes to be stimulated. in conclusion, serum cxcl8 is elevated in dogs with moderate pyometra compared to dogs in a severe state of the disease. low concentrations of serum cxcl8 may be part of a well - orchestrated inflammatory response or the consequence of a depleted immune system. as it is elevated in dogs with moderate pyometra compared to dogs in a severe state of the disease, it is possible that cxcl8 plays a protective role in this disease. however, establishing through blood tests the exact role of this chemokine in the physiopathology of pyometra and inflammation is difficult. its presence in serum can be due to multiple stimuli, and its source and exact functions are unclear. furthermore, the concentrations of serum cxcl8 can change rapidly, and the timing of the assessment is unknown. still, the analysis of serum cxcl8 canine pyometra gives an insight into its behavior in inflammation and its interaction with other components of the immune system. cxcl8 showed to be a good predictor for the clinical characteristics of pyometra and could be a useful complement for existing laboratory tests, such as the wbc, neutrophil and crp levels. due to its relatively short half life in serum and a high response in diseased animals, nonetheless, cxcl8 is only a small part of the complex cross - talk between several cell types and cytokines during inflammation. its analysis is not suitable for establishing a specific diagnosis, but can provide valuable information about the physiopathology and extent of ongoing lesions in individual animals. | interleukin-8 (il-8 or cxcl8) is a highly selective pro - inflammatory chemokine, that is elevated in sera of humans and animals with various inflammatory diseases. cxcl8 is possibly involved in uncontrolled inflammation and the development of a systemic inflammatory response syndrome (sirs) and sepsis. nevertheless, its behavior and precise properties in the course of inflammation are not fully understood. thus, we used naturally occurring canine pyometra as a model of inflammation, in order to examine the behavior of serum cxcl8 in relation to the disease intensity and commonly analyzed inflammatory mediators. using a commercially available canine elisa kit, a significant increase of cxcl8 was determined in the serum of 23 dogs with pyometra compared with 35 healthy dogs. interestingly, serum cxcl8 did not increase in severely diseased patients and behaved contrary to white blood cells (wbc), neutrophils and c - reactive protein (crp). the measurement of serum cxcl8 may provide valuable information about the extent of ongoing lesions and could be a useful complement for existing laboratory tests. |
autism spectrum disorders (asds) are a heterogeneous group of neuro - developmental disorders that are characterized by impaired social interaction and communication, and by restricted and repetitive behaviors. the autistic disorder (ad), asperger syndrome (as) and pervasive developmental disorder not otherwise specified (pdd - nos) are recognized as three subgroups of the asds by the current version of the diagnostic and statistical manual of mental disorders (dsm - iv). the estimated prevalence of the asd is 1/91 among 317 years old and 1/110 among 8 years old children (1,2). asds are highly heritable, as evidenced by twin and family studies suggesting the heritability of autism to be > 90%. autism affects predominantly males, with an overall male - to - female ratio of 4:1. the male predominance is much more pronounced in high - functioning autism and as, and may be as high as 14:1 within these subgroups (3). recent advances in the field of autism genetics have led to the identification of several autism susceptibility genes and the appreciation of both de novo and inherited copy number variants (cnvs) in the etiology of asds (4,5). in contrast to studies of cnv, genetic linkage and genome - wide association studies have been slower to identify susceptibility genes contributing to the heritability of autism, and many association analyses have had inadequate power. it is recognized that each genetic susceptibility locus identified to date accounts for only a small fraction of asd cases (typically 2000 families with simplex autism. this is a collection of cases of sporadic (simplex) autism with unaffected parents and unaffected siblings. on average, probands in the ssc exhibit moderate - to - severe autistic symptoms with relatively little intellectual disability (42). control dnas were obtained from the nimh through the center for collaborative genetic studies on mental disorders. controls were ruled out if they replied 1 (yes) to both a8d and a8e (depression);replied 1 (yes) to both b14 and b15 (generalized anxiety disorder);replied 3, 4 or 5 to g2a or replied 5 to g7a (alcohol dependence);replied 1 to h3 and 3, 4 or 5 to h3a (drug dependence);replied 1 or 1 to any question of section i (obsessive compulsive behavior). replied 1 (yes) to both a8d and a8e (depression) ; replied 1 (yes) to both b14 and b15 (generalized anxiety disorder) ; replied 3, 4 or 5 to g2a or replied 5 to g7a (alcohol dependence) ; replied 1 to h3 and 3, 4 or 5 to h3a (drug dependence) ; replied 1 or 1 to any question of section i (obsessive compulsive behavior). probands and controls were sex matched at a ratio of m : f = 6.8:1. we have designed primers and amplified coding regions and intron / exon junctions of the 21 genes according to standard protocols. polymerase chain reaction (pcr) products were sequenced using traditional sanger fluorescent di - deoxy methods on abi 3730 capillary sequencers. resulting sequences were analyzed and single nucleotide variants and indels detected using snpdetector software (43). all coding non - synonymous variants and coding indels detected in sanger sequencing were assayed with pcr - directed orthogonal sequencing validation. targets were re - amplified, and resulting pcr reactions pooled and sequenced using 454 pyrosequencing. resulting 454 reads were mapped to the human reference sequence using blat and crossmatch alignment software. we required coverage of > 50 at the site and variant allele fraction > 20% to validate a variant. we obtained dna samples (from lymphoblast cell lines) from probands and their family members through the simons simplex collection (ssc), a resource of the simons foundation autism research initiative (sfari). the ssc represents a repository of clinical, neuropsychological, phenotypic and genetic data of > 2000 families with simplex autism. this is a collection of cases of sporadic (simplex) autism with unaffected parents and unaffected siblings. on average, probands in the ssc exhibit moderate - to - severe autistic symptoms with relatively little intellectual disability (42). control dnas were obtained from the nimh through the center for collaborative genetic studies on mental disorders. controls were ruled out if they replied 1 (yes) to both a8d and a8e (depression);replied 1 (yes) to both b14 and b15 (generalized anxiety disorder);replied 3, 4 or 5 to g2a or replied 5 to g7a (alcohol dependence);replied 1 to h3 and 3, 4 or 5 to h3a (drug dependence);replied 1 or 1 to any question of section i (obsessive compulsive behavior). replied 1 (yes) to both a8d and a8e (depression) ; replied 1 (yes) to both b14 and b15 (generalized anxiety disorder) ; replied 3, 4 or 5 to g2a or replied 5 to g7a (alcohol dependence) ; replied 1 to h3 and 3, 4 or 5 to h3a (drug dependence) ; replied 1 or 1 to any question of section i (obsessive compulsive behavior). probands and controls were sex matched at a ratio of m : f = 6.8:1. we have designed primers and amplified coding regions and intron / exon junctions of the 21 genes according to standard protocols. polymerase chain reaction (pcr) products were sequenced using traditional sanger fluorescent di - deoxy methods on abi 3730 capillary sequencers. resulting sequences were analyzed and single nucleotide variants and indels detected using snpdetector software (43). all coding non - synonymous variants and coding indels detected in sanger sequencing were assayed with pcr - directed orthogonal sequencing validation. targets were re - amplified, and resulting pcr reactions pooled and sequenced using 454 pyrosequencing. resulting 454 reads were mapped to the human reference sequence using blat and crossmatch alignment software. we required coverage of > 50 at the site and variant allele fraction > 20% to validate a variant. this work was supported by a grant from the simons foundation (sfari 128234 to h.y.z. and r.a.g.). | autism spectrum disorders (asds) are a heterogeneous group of neuro - developmental disorders. while significant progress has been made in the identification of genes and copy number variants associated with syndromic autism, little is known to date about the etiology of idiopathic non - syndromic autism. sanger sequencing of 21 known autism susceptibility genes in 339 individuals with high - functioning, idiopathic asd revealed de novo mutations in at least one of these genes in 6 of 339 probands (1.8%). additionally, multiple events of oligogenic heterozygosity were seen, affecting 23 of 339 probands (6.8%). screening of a control population for novel coding variants in cacna1c, cdkl5, hoxa1, shank3, tsc1, tsc2 and ube3a by the same sequencing technology revealed that controls were carriers of oligogenic heterozygous events at significantly (p < 0.01) lower rate, suggesting oligogenic heterozygosity as a new potential mechanism in the pathogenesis of asds. |
equal access to essential health care can be considered as a right for human beings and one of the important issues of health equity is equal access to health services for those in need. technically, measuring inequality is more feasible for researchers than measuring inequity and if they found the rationale for unjust and avoidable distribution, it can be labeled as inequity. to assess inequalities in health systems, we need to identify how the health problems such as risks or outcomes or health care utilization are distributed within subgroups or individuals of a population. there are lots of evidence and facts, which shows the presence of unjust and avoidable inequalities between and within countries. commission of social determinants of health provided clear examples of such inequalities based on social and economic determinants. poverty, inappropriate housing, social exclusion and inefficient health systems were considered as the most important factors that influence health of the population. there are different studies in iran that have paid attention to inequalities in health outcomes such as life expectancy or mortality during infancy or maternity or disease incidence health risks, use of protective or preventive measures such as helmet and health care utilization such as access to trained healthcare worker for delivery. in a study done by olyaeemanesh other aspects of health equity such as fairness in financial contribution of people in health costs and catastrophic health expenditures have been mentioned by other researchers. about 2.5% of the iranian patients were exposed to catastrophic health expenditure, which was even more considerable among rural households and those without health insurance coverage. in - patient care shows a more serious side of individual care and patients and their family members perceive a high level of stress and urge. availability and access to these services are not equal in different geographical areas and socio - economic strata ; for instance, tofighi. in their study have reported unequal distributions of intensive care beds in different provinces of iran. they reported that tehran province (capital of iran) possessed the highest proportion of icu beds in relation to the total number of citizens. this can be evaluated through the point of view of people by population - based utilization studies ; two rounds of utilization studies were carried out in iran in 2002 and 2007 by the ministry of health and medical education (mohme). although the official reports described health care utilization in different subgroups of the population, there is not a further analysis to explore inequality in utilization of health services. we conducted this study to determine inequalities of in - patient health care utilization in iranian people and to assess factors that influence utilization. the study was a secondary analysis of data extracted by the survey of health care utilization in iranian population in 2007 ; report of the survey has not been published yet. we explain both a summary of methods of the original survey and specifications of the current study. the national health care utilization survey was performed in 2007 in iranian rural and urban households by mohme. the national survey used provinces and urban / rural areas as the strata at the first step. in each province, the sample was comprised of 380 urban and 380 rural households that were recruited by a systematic random sampling method. in each household, everybody was recruited in the study. tehran province was an exemption ; this province was divided in two parts ; the capital city of tehran was treated separately and the rest of districts of tehran province were sampled separately. approximately 23,560 households, which included around 102,000 individuals were recruited. among them, those who had a need for inpatient services (8827 subjects) were included in this study. in the national survey, a structured questionnaire was designed. the questionnaire included questions with regard to demographic characteristics, socio - economic positions, insurance coverage, need for inpatient and outpatient health services, utilization of inpatient and outpatient health services and expenses related to health services. in our study, we extracted and analyzed those data from the national survey related to need for healthcare hospitalization services, utilization from these services, probable factors that might be related to meet needs for highlight services. we defined a binomial variable named as met admission need (man) which determines whether a need for inpatient services had been met or not. ten data collection teams consisted of a man and a woman were selected as interviewers in each province. an expert supervisor was selected to control the process of data collection in each province. interviewers completed questionnaires based on interviews with the head of the households and then each family member. the national survey had a protocol of quality control ; about 5% of completed questionnaires were re - checked to ensure the accuracy of data. each individual referred to a hospital or recommended for hospital admission by an authorized person, was considered a case of man when she / he eventually admitted in a hospital or dismissed by the hospital physician because of no need for admission. proportions and 95% confidence intervals (95% ci) of man in different subgroups subjects were weighted based on the share of the province (or tehran city) in the sample of original national survey and real share of the province in population of the country. we considered household assets for determining the economic status and constructed an asset index as a surrogate variable for economic status. the following assets were considered : number of rooms in the house per person, having at least one of each mentioned assets for use of household members (not - shared with other households) : kitchen in the house, bath, toilet, freezer, flat screen tv, mobile, washing machine, dishwasher, microwave oven, vacuum cleaner, personal computer, car and home access to internet ; having more than one car for the household members, personal house and personal villa were considered as other assets. using the principle component analysis method, we calculated a quantitative proxy for economic status of each household. this proxy was the sum individual assets, weighted by the elements of the first eigenvector and neither rotation. the subjects were ranked based on their proxy value of their households and classified in five quintiles from the poorest (1 quintile) to the richest (5 quintile). logistic regression analysis was performed to assess the relationship between man as a dependent variable and probable related factors. the national health care utilization survey was performed in 2007 in iranian rural and urban households by mohme. the national survey used provinces and urban / rural areas as the strata at the first step. in each province, the sample was comprised of 380 urban and 380 rural households that were recruited by a systematic random sampling method. in each household, everybody was recruited in the study. tehran province was an exemption ; this province was divided in two parts ; the capital city of tehran was treated separately and the rest of districts of tehran province were sampled separately. approximately 23,560 households, which included around 102,000 individuals were recruited. among them, those who had a need for inpatient services (8827 subjects) were included in this study. the questionnaire included questions with regard to demographic characteristics, socio - economic positions, insurance coverage, need for inpatient and outpatient health services, utilization of inpatient and outpatient health services and expenses related to health services. in our study, we extracted and analyzed those data from the national survey related to need for healthcare hospitalization services, utilization from these services, probable factors that might be related to meet needs for highlight services. we defined a binomial variable named as met admission need (man) which determines whether a need for inpatient services had been met or not. ten data collection teams consisted of a man and a woman were selected as interviewers in each province. an expert supervisor was selected to control the process of data collection in each province. interviewers completed questionnaires based on interviews with the head of the households and then each family member. the national survey had a protocol of quality control ; about 5% of completed questionnaires were re - checked to ensure the accuracy of data. each individual referred to a hospital or recommended for hospital admission by an authorized person, was considered a case of man when she / he eventually admitted in a hospital or dismissed by the hospital physician because of no need for admission. proportions and 95% confidence intervals (95% ci) of man in different subgroups subjects were weighted based on the share of the province (or tehran city) in the sample of original national survey and real share of the province in population of the country. we considered household assets for determining the economic status and constructed an asset index as a surrogate variable for economic status. the following assets were considered : number of rooms in the house per person, having at least one of each mentioned assets for use of household members (not - shared with other households) : kitchen in the house, bath, toilet, freezer, flat screen tv, mobile, washing machine, dishwasher, microwave oven, vacuum cleaner, personal computer, car and home access to internet ; having more than one car for the household members, personal house and personal villa were considered as other assets. using the principle component analysis method, we calculated a quantitative proxy for economic status of each household. this proxy was the sum individual assets, weighted by the elements of the first eigenvector and neither rotation. the subjects were ranked based on their proxy value of their households and classified in five quintiles from the poorest (1 quintile) to the richest (5 quintile). logistic regression analysis was performed to assess the relationship between man as a dependent variable and probable related factors. a total of 8827 individuals had been referred to hospitals or therapeutic centers for admission during 12 months before interview time and 7409 (83.9% ; 95% ci : 83.3 - 84.6%) cases were classified as those with a man. the rates of man for urban and rural areas were 83.0% (95% ci : 81.4 - 84.7%) and 81.3% (79.6 - 83.0%), respectively. the maximum and minimum rates of man were 94.2% and 73.0% in yazd and west - azerbaijan provinces, respectively. the rate of man was relatively similar in men (83.4% ; 95% ci : 82.3 - 84.6%) and women (84.4% ; 95% ci : 83.4 - 85.3%). table 1 summarizes data concerning the man in patients over 15 years old based on marital status. the rates of man in different educational levels in patients over 18 years are shown in table 2. among patients over 18 years olds individuals with educational level of primary school and illiterates had the lowest man and the rate of man was significantly higher in patients with higher educational level (p = 0.0008). regarding occupation, the highest and lowest rate of man belonged to unemployed individuals with income (including those with unearned income or retired people) and jobless individuals seeking a job, respectively [table 3 ] (p = 0.0001). the rate of met admission needs in different provinces in iran distribution of the mans in patients over 15 years - old based on marital status distribution of the mans in different educational levels (> 18 years) distribution of the rate of mans in a different occupation groups patients with primary health insurance coverage had significantly higher rate of man (83.4% ; 95% ci : 82.6 - 85.1) than those without primary insurance (75.8% ; 95% ci : 72.2 - 79.3%). in contrast, the rate of man in patients covered by both primary and complementary health insurance (88.3% ; 95% ci : 85.2 - 91.4%) was significantly higher than those covered only by primary insurance. the lowest man rate was seen in the first quintile and we found a significant increasing trend for man pro - higher quintiles of economic status (p = 0.0075). we used logistic regression analysis to assess the relationship between man as the dependent variable and different co - variances (including quintiles of economic status, age groups, gender, education, primary insurance coverage, complementary insurance coverage and urban / rural residency). adjusted or of the above mentioned relationships there was an obvious gradient for estimates of or by moving from the richest to highest group. furthermore, the highest man was seen in infants and all other age groups had lower or. not - having insurance coverage (both primary and complementary) and being single (vs. married) were among the significant predictors. distribution of the rate of mans based on the quintiles of ses logistic regression analysis for assessing socioeconomic and demographic factors that predict man figure 1b shows the cumulative percentage of man according to cumulative percentage of people ranked from lowest to highest economic status (concentration curve). although there was a fair overlap with line of equality, the rate of man was statistically higher in individuals with higher economic status ; the concentration index (standard error) was 0.0174 (0.0043). the cumulative percent of met admission needs according to economical groups (lowest to highest) we assessed in - patient health care utilization in iran and some of its related factors. in our study, the need for admission was not met for approximately 16% of the participants. we found relationships between man and some demographic (age), socio - economic (education level and economic status), geographical (province of residence) factors and health insurance coverage. we did not find a significant difference between subgroups of gender and residency location (urban or rural) with regards to the man. no significant difference was seen between urban and rural rates of man. similarly henderson. in their study the results of a study from china were in line with our study. in another study from china, however, utilization of health care services was significantly higher in females than males. different health care needs in males and females may lead to differences in health - seeking behavior and consequently different levels of access to health care. nonetheless, among individuals with similar needs for healthcare, difference in utilization rate will result in inequality and injustice. similarly, reported lower hospitalization and healthcare utilization rates among patients who were never married. individuals with higher education levels show better health care seeking behavior and their health care access and utilization is usually better than less educated persons. we found a significant relationship between occupation and man, which is in line with previous reports. the rate of man was significantly higher in patients covered by both primary and complementary health insurance. yip and berman have reported better access to healthcare for individuals with health insurance coverage. the results of another study from china also suggested improved health care utilization after a health insurance reform program. in other words, patients with better economic status had better access to healthcare services. morris. also showed a significant relationship between use of secondary care and income. economic status is an important indicator for access to health services and is one of the major sources of inequality in healthcare utilization. the differences are partly due to inter - provincial differences in important factors such as age, sex ratio, years of schooling and economic status, however it needs to be probed more extensively. there are some evidence regarding the decreasing trend of urban - rural areas in some important health outcomes in the recent decades. higher penetration of primary health care services in a rural area and clearer referral system might compensate the problem of physical access in rural areas. in this study, we did not have enough data to assess other probable sources of health inequalities such as ethnicity or religion. furthermore, we did not assessed disparities between different cities among the provinces. in general, patients have different health needs and differences in healthcare utilization are acceptable and logical if they are only due to differences in patients needs. but inequalities in access to health care are not ethically acceptable if these inequalities are a result of socio - demographic factors including gender, occupation, ethnicity, education, or supplemental educational services. therefore, health policy makers should consider these inequalities in decision making, especially when resource allocation is concerned. among the factors related to unequal access to inpatient services in this study, increasing of the insurance health coverage seems to be the most feasible approach. in the new strategy of family physician program for rural and urban areas of iran, an ambitious universal access to health insurance has been planned ; optimistically, this plan would help to increase man for inpatient services. although interventions such as reducing poverty and increasing years of schooling are fundamental, their modification will not be easy in the near future. meeting admission needs was estimated around 84% in this study and there is considerable opportunity for improvement. it seems that modifying insurance coverage is the most feasible intervention for increasing utilization of health services. | background : health services for those in need. inpatient care shows a more serious side of individual care and patients and their family members perceive a high level of stress and urge. we conducted this study to determine inequalities of in - patient health care utilization in iranian people and to assess factors that influence utilization.methods:in each province, the sample was comprised of 380 urban and 380 rural households that were recruited by a systematic random sampling method. a total of 23,560 households, which included around 102,000 individuals were recruited. we used the questionnaire for data collection. met admission need (man) was the main variable and was considered household assets for determining the economic status. we did all analyses using the stata version 9.1.results:the rates of man for urban and rural areas were 83% and 81.3% respectively. the rate of man was significantly higher in patients with higher educational level. patients with primary health insurance coverage had significantly higher rate of man.conclusions:meeting admission needs was estimated around 84% and it seems that modifying insurance coverage is the most feasible intervention for increasing utilization of health services. |
during 20062009, the 267 samples were collected from 3 groups of patients (table). group 1 comprised patients who had traveled from asia to germany ; location of their permanent residency was unknown. groups 2 and 3 and the control group comprised only persons from northern germany. from group 1, a total of 75 sputum and nasal swab specimens were collected from patients who had unconnected cases of rti and who had recently traveled by air (11). from group 2, a total of 31 bronchoalveolar lavage (bal) samples were collected from patients with chronic obstructive pulmonary disease (defined by a forced expiratory volume in 1 second / forced vital capacity < 70% and forced expiratory volume in 1 second < 80% of the predicted value) who had signs of rti. from group 3, a total of 161 bal and tracheal secretion samples were collected from patients with severe rti and immunosuppression as a result of solid organ or bone marrow transplantation. from the control group, throat swabs were collected from 52 healthy persons and bal samples were collected from 10 healthy volunteers who had no signs of rti and no known underlying disease. xmrv, xenotropic murine leukemia virus ; +, positive for xmrv specific sequences by pcr ; rti, respiratory tract infection ; copd, chronic obstructive pulmonary disease ; bal, bronchoalveolar lavage ; sot, solid organ transplantation ; bmt, bone marrow transplantation ; ts, tracheal secretion. all samples were analyzed by culture for pathogenic bacteria and fungi and by pcr for rhinoviruses, adenoviruses, enteroviruses, influenza viruses a and b, parainfluenza viruses 13, respiratory syncytial virus, cytomegalovirus, epstein - barr virus, and human metapneumovirus. xmrv rna was reverse transcribed from total rna, after which nested pcr or real - time pcr were conducted as recently described (1,12). no serum samples were available from these patients to confirm the results by serologic testing. for group 1, xmrv - specific sequences were detected with relatively low frequency (2.3%). for group 2, xmrv - specific sequences were amplified in 1 bal sample, which was also positive for staphylococcus aureus by routine culture methods. for group 3, xmrv - specific sequences were detected at a frequency of 9.9%, which was significantly higher than that for the healthy control group (3.2%) at the 90% confidence level but not at the 95% level (p = 0.078, 1 sample t - test). the remaining 6 samples showed co - infection with rhinovirus or adenovirus (1 sample each) ; s. aureus (3 samples) ; or mixed infection with pathogenic fungi, candida albicans and asperigillus fumigatus (1 sample). all samples that were positive for xmrv by gag - nested pcr, together with a set of those that were negative for xmrv, were retested by real - time pcr. results showed low xmrv rna concentrations, 10 10/ml of specimen. to confirm the validity of xmrv detection, a subset of 6 specimens (3 xmrv positive and 3 xmrv negative) were tested by using an alternative pcr assay for viral rna (3) and a c - type rt activity kit (cavidi, uppsala, sweden) for type c reverse - transcription activity. xmrv sequences from alternative targets in the gag and env regions were confirmed in 2 of the 3 xmrv - positive samples but in none of the controls. one xmrv - positive bal specimen showed an 8-fold increase above background of specific type c retroviral reverse - transcriptase activity, suggesting presence of active type c retrovirus within this sample. all xmrv gag sequences (390-bp fragment) were 98%99% identical to previously published xmrv sequences from persons with prostate cancer (1,2). xenotropic murine leukemia virus related gammaretrovirus (xmrv) gag sequences derived from respiratory tract secretions. phylogenetic tree comparing the 390-nt gag fragment of all respiratory samples of this study with recently published xmrv sequences from patients with familial prostate cancer (1). the edited sequences were aligned with clustalx version 1.82 (13,14) by using default settings. sequences are labeled as x, xenotropic ; p, polytropic ; mp, modified polytropic ; s, sputum, is, immunosuppression ; ts, tracheal secretion ; and c, control. xmrv, originally identified in rnase l deficient patients with familial prostate cancer, has gained interest since recent work showed its protein expression in as many as 23% of prostate cancer cases (10) and xmrv - specific sequences were detected in pbmcs of 67% patients with chronic fatigue syndrome (5). both studies also detected xmrv protein or sequences in their control cohorts with frequencies of 6% and 4%, respectively. among the most pressing information gaps with regard to xmrv detection of xmrv in pbmcs and plasma of patients with chronic fatigue syndrome raises the possibility of blood - borne transmission ; sexual transmission has also been hypothesized on the basis of indirect evidence (5,9). we detected xmrv in respiratory secretions of immunocompetent patients with and without rti at a frequency of 3.2%, which is in good concordance with the recently reported prevalence in the general population of up to 4% (5). frequency of xmrv detection in group 1 patients (2.25%) was comparable to that of human metapneumovirus and rhinovirus within this group and considerably less frequent than that of parainfluenzavirus (15.5%) or influenza a virus (7.6%) detection (11). our findings indicate that xmrv or virus - infected cells might be carried in and transmitted by the respiratory tract. attempts to isolate infectious virus from xmrv sequence positive respiratory samples failed, possibly because of inadequate storage of samples before virus culturing attempts or relatively low copy numbers of the virus within the samples. thus, whether the respiratory tract serves as a putative transmission route for xmrv can not be determined at this time. the observed increase in prevalence among immunosuppressed patients with rti suggests that xmrv might be reactivated in absence of an efficient antiviral defense. together with earlier observations on increased xmrv replication in rnase l deficient cells (1,12), this finding implies that the immune system plays a role in controlling xmrv replication. it remains unknown whether immunosuppression predisposes a patient to secrete infectious xmrv from the respiratory tract or whether presence of virus might be meaningless for epidemiology in a way similar to hiv-1 (15). future studies should address whether the respiratory tract might serve as a source of xmrv infection or whether immunosuppression might cause an increased risk for primary infection. | xenotropic murine leukemia virus related gammaretrovirus (xmrv) has been recently associated with prostate cancer and chronic fatigue syndrome. to identify nucleic acid sequences, we examined respiratory secretions by using pcr. xmrv - specific sequences were detected in 2%3% of samples from 168 immunocompetent carriers and 10% of samples from 161 immunocompromised patients. |
sporotrichosis is a subacute or chronic mycosis caused by fungi of the genus sporothrix, whose natural reservoir is the soil. it is transmitted through inoculation of the traumatic agent in the skin [1, 2 ]. the peculiar epidemiological situation of the city of rio de janeiro, where an epidemic of cases transmitted by cats is observed, must serve as a warning for the risk of professionals in contact with these animals to acquire the disease. the patient was a 48-year - old caucasian female veterinarian who lived in rio de janeiro. whilst working on the medication of a cat with sporotrichosis, her left hand was scratched. it evolved after 4 weeks with the formation of an erythematous papule on the left thumb. after using various antibiotics without improvement upon examination, she presented edema and significant erythema in the distal phalanx of the left thumb, with a distal crusted ulcer area causing detachment of the nail plate (fig. 1, fig. her ipsilateral forearm showed small nodules, slightly erythematous, painful on palpation, following the lymphatic path, more palpable than visible. bacterioscopy was negative and the culture for common germs showed growth of escherichia coli, considered as a contaminant. bacilloscopy and culture for mycobacteria were negative, whilst fungal culture showed growth of sporothrix schenckii. due to the location of the lesion, the degree of involvement of the phalanx and intense pain, plain radiography revealed involvement of the distal phalanx, with the appearance of osteomyelitis (fig. 3), subsequently confirmed by computed tomography. there were no signs of joint involvement. bone biopsy was performed on the involved phalanx, with the bone fragments sent for culture, and there was recurrent growth of s. schenckii. the conclusion, therefore, was sporotrichosis with bone involvement, and itraconazole 400 mg / day was started for 12 months. the patient progressed well, with complete healing of the lesion and pain relief, remaining in ward attendance. sporotrichosis, whose agent is a fungus of the genus sporothrix, is transmitted especially through traumatic inoculation of its agent into the skin. classically, the transmission occurs after minor trauma with twigs, branches, thorns and other vegetals. the incubation period varies from 3 days to 3 months [1, 2, 3 ]. since 1998, the city of rio de janeiro has been undergoing a peculiar situation, an epidemic of zoonotic sporotrichosis due to infected cats, which is considered rare in other regions of brazil and the world [4, 5 ]. the increased incidence of sporotrichosis in rio de janeiro has been observed for over a decade. from 1998 to 2004, 759 humans and 1,503 cats were diagnosed with sporotrichosis at ipec - fiocruz, a reference institution of rio de janeiro. in the previous period, from 1986 to 1998, the situation worsened between 2005 and 2008, when 804 new cases were reported, already being considered the greatest epidemic by zoonotic transmission. the infection can occur by contiguity or hematogenous diffusion, which may manifest from small granulomas to large lytic lesions, similar to osteomyelitis. only a small number of patients present general symptoms and leukocytosis, whilst the vast majority present increased hemosedimentation rate. sporotrichosis was always considered as an occupational disease [1, 2, 3 ]. in 1926, foerster drew attention to the fact that the majority of sporotrichosis cases were acquired at work, and that many of them could generate sequels that would compromise labor activities and therefore must have their occupational nature emphasized. gardener 's disease and to be primarily related to rose planters, but a range of professionals, especially in rural areas, is subject to acquiring the infection, such as farmers, miners, lumberjacks and others [1, 2 ]. the new epidemiology profile of the disease in the city of rio de janeiro, however, should be a warning to the risk of contamination of other professionals that could acquire the disease, especially veterinarians. it is believed that it is not necessary for a cat to scratch or bite in order to transmit the disease ; thus, professionals should be informed about the risks and the use of personal protective equipment, such as gloves, to manipulate cats that are sick or under suspicion of sporotrichosis. | sporotrichosis is a subacute or chronic mycosis caused by a fungus of the genus sporothrix, which is found in soil. it can be acquired by trauma to the skin. bone and joint lesions are very rare. the city of rio de janeiro is undergoing an epidemic transmitted by cats, and this should be an alert for the risk to professionals in contact with these animals. the patient was a veterinarian who developed occupational sporotrichosis with osteoarticular involvement transmitted by a cat during a consultation. |
in 1970 world health organization defined cerebrovascular accident as a neurological deficit of cerebrovascular cause that persists beyond 24 hours or is interrupted by death within 24 hours (1). according to the world health organization (who) and the statement the global burden of disease, cva is the second leading cause of mortality in the world in 1990 year and the third leading cause of death in developed countries, causing about 4.4 million deaths (2). the latest assessment showed that in 2002, the number of deaths from cva has reached 5.51 million worldwide, and two - thirds of these deaths occur in developing countries (3). according to the institute of public health fbih, considering diagnosis in period from 2008 to 2012 the leading cause of death in this population is stroke (17 % for 2012) from the group of cerebrovascular disease (52.9 % for 2012) (4). cva is the leading cause of disability in the community, and the age category of elderly people is most prone to cerebrovascular accident (5). cva is classified, by etiology of focal brain damage, as ischaemic and hemorrhagic stroke. risk factors that influence appearance of the cva, and ones that could be affected are : hypertension (hta) and diabetes mellitus (dm). (6) persons who have hta have a three times greater risk of stroke, the incidence of stroke increases with an increase in both systolic and diastolic blood pressure, and treatment of hta reduces the risk of stroke by 30 % (7). dm or abnormal glucose regulation (hyperinsulinemia and insulin resistance) denotes elevated values of blood glucose. it has long been known that dm is associated with an increased risk of atherosclerosis, cardiovascular disease and ischaemic cerebrovascular accident, increased mortality in patients with cva (8, 9). the incidence of stroke increases with increasing blood glucose so that it is two times greater in diabetics than in patients with borderline blood glucose values. optimizing of the body weight and glucose metabolism are obviously very important strategies to reduce the risk of stroke. recent studies have identified the endocannabinoid system and the cannabinoid receptor cb1 as important in determining the energy balance and body composition. cb1 receptor is an important target for the blockade in an attempt to reduce body weight and waist circumference (10). consequences after cva may be a major cause of disability, and therefore represent a major public health problem. the aim of this study is to evaluate the results of rehabilitation, to determine the prevalence of major risk factors in cerebrovascular strokes and their consequences, as well as to propose measures and procedures that will affect the better rehabilitation. the study was descriptive - analytical and retrospective prospective type based on the analysis of data from the history of the diseases. the study included a total of 116 patients diagnosed with cva rehabilitated at the department of physical medicine and rehabilitation at kcus in a period of one year. during data acquisition, processing and presentation of the tables, the privacy of the patients was not compromised, first and last names were not mentioned, initials of the target group were not mentioned too. the survey analyzed : age, sex, duration of rehabilitation, assessment of activities in daily life through the barthel index at admission and at discharge, presence of risk factors such as hta and dm. results are displayed numerically and graphically with legends and text explanation of some obtained values and variables. statistical data analysis were performed on the pc programs such as spss v16.0, ms excel 2007. parametric data were analyzed showing the absolute value, calculation of the percentage value, the arithmetic mean with the obligatory calculation of the standard deviation, while non - parametric data were processed with chi- square test. analysis of risk factors of diabetes mellitus and high blood pressure affecting the occurrence of cva. analysis of barthel index at admission and barthel index at discharge and risk factors of hta. analysis of activities of daily living by barthel index at admission and barthel index at discharge and risk factors of diabetes mellitus. cerebrovascular accident or stroke is a neurological deficit of cerebrovascular cause that persists beyond 24 hours or is interrupted by death within 24 hours. first, the early part of the rehabilitation is applied in a stroke unit on neurological clinic. in the further course of treatment it is recommended to continue rehabilitation program in stationary institutions because the best results are achieved immediately after cerebrovascular stroke. in our research we included 116 patients with stroke who are admitted, in a period of one year, for rehabilitation at the clinic of physical medicine and rehabilitation. patients were analyzed by age and found to have predominantly suffered after 60 years of age (77 %), which is one of the risk factors that we can not influence. the results are shown on figure 1, where we can see that 33 % of patients were between 61 - 70 years of age, and 34 % of 71 to 80 years of life. analysis of patients by gender showed that cerebrovascular accident occurred in 49 % of male patients and 51 % of female patients. data from the literature suggest just the opposite, much higher incidence within male population (14, 15). our research conducted earlier showed the same results as we got in this study and it does not match with generally accepted data. the figure 1 shows the time that patients spent in the rehabilitation in the stationary institutions. the majority of patients with cerebrovascular infarction 32 (28 %) spent 31 - 40 days at the rehabilitation and at least over 50 days. today, we strive to shorten period of rehabilitation in stationary institution to prove rehabilitation as efficient and economical. in our previous studies, the rehabilitation period typically lasted longer than in this study (12, 17). study conducted ten years ago shows a longer stationary rehabilitation treatment with worse rehabilitation results. however, other researchers have shown that it is possible to even more shorten stationary rehabilitation period without compromising the results of recovery (18). the analysis of figure 2 shows that in patients suffering from stroke the most common risk factor are hta with 83 % incidence, and dm with 33 % incidence. these two risk factors fall into those factors that can be affected, kept under control and therapeutically minimize their harmful effects. our previous studies showed that hta was represented with 81 % which means 74 % of patients (13). dm was represented with 30 % which means 29 % of patients (19). from these results we can see that there is no significant difference in all the researches that are conducted at different times in our institution. smaller representation of dm as risk factor can be interpreted as a higher and better control of risk factors. however, other studies show lesser prevalence of hta 58 % and 28 % dm than it is present in this study, which is probably consequence of early detection and treatment of these risk factors (14). studies from other areas show the incidence of hta is 65 %, and 22% is dm patients with stroke, which is considerably less than in our study (20). evaluating the results of rehabilitation after stroke, we demonstrated the value of barthel index, which assesses the activities of daily life for all patients who have been involved in a rehabilitation program. the smallest barthel index at admission and at discharge is 0, and the 20 is largest. most of the patients at admission had a barthel index in the range from 0 to 4 (32.7 %), and least in the range 17 - 20 (12.5 %). at discharge most patients had a barthel index in the range of 17 - 20 (36.2 %) and lowest in the range of 0 - 4 (10.6 %). these data show significantly better results of rehabilitation than in our previous studies where 6 % of patients had a barthel index from 0 to 4, and 19 % of patients had a barthel index 17 to 20 (21). studies, conducted by other authors that also evaluated barthel index, showed that the best recovery in functional status of the patients was with those which had intensively monitored rehabilitation program in the first six months after the occurrence of cva. this study showed a smaller mortality rate in patients who had hypertension and dm as risk factors (22). figure 4 show the results of the assessment of rehabilitation according to barthel index in patients who had hypertension (high blood pressure) as risk factor. statistical analysis shows that there is a statistically significant correlation between the barthel index at admission, barthel index at discharge and risk factors of hta. when analyzing the patients at admission using group with and without high blood pressure, we see that there is a statistically significant difference in the results of rehabilitation by barthel index at admission, p < 0.001. analysis of patients with and without the high blood pressure at discharge showed a statistically significant difference by barthel index at discharge as p < 0.001. studies by other authors and our previous studies have shown that the results of rehabilitation by barthel index were lower in patients who had high blood pressure as a risk factor (13, 23). rehabilitation of patients with hta is more complex with frequent complications, especially of this disease (23). we also analyzed the influence of dm as risk factor in assessing the results of rehabilitation and display the results in the table and figure 5. based on the data presented on figures 1 - 5 it has been proved that there is a statistically significant correlation between the barthel index at admission and barthel index at discharge and risk factors of dm because value is p < 0.001 for patients who had not had this risk factor. this data shows that patients who had dm as a risk factor had a statistically significantly lesser results of rehabilitation process than those patients who did not have this risk factor. our previous studies have shown the same results (13, 19). results of other studies have shown that people with dm and cva were getting this disease in younger age than those who did not have the disease. studies have shown that the rehabilitation process after stroke is very difficult and is also linking with age (24). statistical analysis demonstrated that there was a statistically significant correlation between the barthel index at discharge and risk factors such as hta and dm. patients who had dm and hta as risk factors had lower values of barthel index at the beginning of rehabilitation compared to those who did not have these risk factors. they also had worse results at the end of rehabilitation process which speaks of the need for secondary prevention as noted by other authors who have dealt with similar studies (25, 26). research conducted has shown that the rehabilitation results in most patients (36.2%) were in the range of 17 - 20 per barthel index, which is considered good results of rehabilitation. the most important risk factors in patients with cva are very common and in the values of : hta 83%, dm 33%, and directly affect the poor results of rehabilitation. the measures and procedures that will affect the better results of rehabilitation are : energetic fight against risk factors for hypertension and diabetes mellitus which we can influence through primary prevention and patient education about early detection and treatment of these risk factors. after the occurrence of stroke, it is necessary to spend more energetic fight to control risk factors through secondary prevention of possible new cerebrovascular stroke. list of abbreviation : cva- cerebrovascular accidentbi- barthel indexhta- hypertensiondm- diabetes mellitus cva- cerebrovascular accident dm- diabetes mellitus | abstractaim : the aim of this study is to evaluate the results of rehabilitation, to determine the prevalence of major risk factors in cerebrovascular accident and their consequences, as well as to propose measures and procedures that will affect the better rehabilitation.methods:the survey analyzed : age, sex, duration of rehabilitation, activities in daily life through the barthel index at admission and at discharge, presence of risk factors hta and dm. the study included a total of 116 patients, the majority of patients are older than 61 years. we had 49% of male patients and 51% of female patients and they spent 31 - 40 days at the rehabilitation.results:the most common risk factor is hta (83%) and diabetes (33%). most of the patients at admission had a bi from 0 to 4 (32.7%), and at discharge bi in the range 17 - 20 (36.2%). statistical analysis shows that there is a statistically significant correlation between the bi at admission, bi at discharge and risk factors of hta and diabetes mellitus.conclusions:the rehabilitation results in most patients is good results of rehabilitation. the most important risk factors in patients are hta, dm and directly affect on results of rehabilitation. for the better results we should have energetic fight against risk factors for hta and dm through primary and secondary prevention and patient education about early detection and treatment of these risk factors. |
staphylococcus aureus is a spherical bacterium from the gram - positive cocci group, also characterized as being a facultative anaerobe pathogen. this microorganism is easily found on the skin and mucous membranes of human beings, as well as in other mammals and birds. it can cause diseases that range from simple infections (pustules, furuncles and cellulitis) to more serious ones (pneumonia, meningitis, endocarditis, toxic shock syndrome, septicemia, etc.) it is an important etiological agent associated with acquired infections in the community and in hospitals, which became a paradigm of bacterial infections. considered as one of the main human pathogens, it is notable for its high frequency and pathogenicity, which leads to diseases both in immunocompromised individuals and in healthy ones, and also for the easy intra - hospital dissemination associated to resistance to antibiotics (coutinho., 2008, 2009). the appearance of multiresistant s. aureus strains in the last few years, isolated even from hospital materials and equipments, constitutes a major problem to infection control and antimicrobial therapeutics (arajo., 2000). multiresistance in s. aureus results from the presence of plasmids which most frequently allows for multiresistance transfer, among other factors (freitas, 2003). escherichia coli takes the form of a bacillus and belongs to the enterobacteriaceae family, being aerobe and facultative anaerobe (murray, 2004). it normally exists in animals (including humans) intestinal tract, and exert a benefic effect on the organism, suppressing proliferation of harmful bacteria and synthesizing a considerable portion of vitamins. among e. coli strains, however, there is a group which is capable of causing diseases in humans, that is collectively called enteropathogenic e. coli (eec) (silva., 2003). pathogenic lineages of e. coli have been evidenced as a primary cause of urinary tract infections, neonatal meningitis, hospital - acquired septicemia, and enteritis in humans. resistance to at least two different antibiotics classes is very common, which restricts the available therapeutic options (schneider., 2009). pseudomonas aeruginosa is characterized by a gram - negative rod, infecting a wide variety of plant and animal hosts (wu., 2005). in humans, it is responsible for chronic lung infections affecting immunocompromised patients and also patients with cystic fibrosis (lyczak., 2000). p. aeruginosa is the third main cause of nosocomial infections (bonomo and szabo, 2006). widespread and careless use of antibiotics has led to a series of problems, among them, human ecology unbalance and microbial resistance, demanding a search for more efficient drugs to combat them. the development of any new antimicrobial drug is accompanied by microorganisms resistance, and their emergence is a threat to research advances (lyczak., 2000). due to the large raise of pathogenic microorganisms resistance to multiple drugs, there is a concern on finding new therapeutic alternatives (oliveira., 2007). for patients, antimicrobial resistance augments morbidity, while for health institutions it corresponds to higher costs (dancer, 2001). according to montanari (1995), molecular modification is the most used method to obtain new drugs. it consists, basically, in starting with a well characterized molecule, with known biological action, as a model or prototype, from which new compounds will be synthesized. the final product will be structurally similar, homolog, or analog, to the starting substance. thus, the pharmaceutical industry is constantly developing research on the correlation of molecular structure and pharmacological activity of new synthetic products (cechinel filho and yunes, 1998). the synthesis of isolated pure substances has become a tool of great importance to the development of drugs with enhanced pharmacological properties, and nowadays the use of molecular modeling contributes markedly to the discovery of new drugs, which are safer and more efficient. many heterocyclic derivatives of meldrum acid (2,2-dimethyl-1,3-dioxane-4,6-dione) have been prepared and studied from the synthetic and structural point of view (chen, 1991), but, however, its biological properties have not received the same attention. in order to fill this gap, in this study we evaluate the antibacterial and the enhancement of antibiotic effect of 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminomethylene)-1,3-dioxane-4,6-dione (c9h10n4o4) against standard and multiresistant (clinical origin) strains of e. coli, s. aureus and p. aeruginosa. the search for a study to demonstrate the biological activity with 5-aminomethylene meldrums acid derivatives led to a patent in 1965 (sterling drug, 1966). in addition, different heterocyclic rings were condensed to the 5-methoxymethylene meldrum s acid in order to evaluate their potential biological activity as antileishmanicidal, antitrypanosomal and antiviral (silva, 2006). in this paper, we choose to synthesize the of compound 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminomethylene)-1,3-dioxane-4,6-dione, c9h10n4o4, an aminomethylene derivative from meldrum 's acid in order to explore it biological application. the aminomethylene derivative can be obtained by condensation of an arylamine with 5-(metoximethylene)-2,2-dimethyl-1,3-dioxane-4,6-dione generated in situ from a reaction with trimethyl orthoformate (cassis., 1985). a solution of meldrum acid (36 mmol) in thimethyl orthoformate (50 ml) was heated under reflux for 2 h, then the corresponding arylamine (30 mmol) was added. the synthesis can be described by the scheme shown in figure 1(fig. 1). the product of this synthesis was the compound 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminome - thylene)-1,3-dioxane-4,6-dione, c9h10n4o4, a crystalline solid with melting point between 170 c and 172 c (joussef., 2005). standard and multiresistant lineages of e. coli (e. coli atcc 10536 and e. coli 27), s. aureus (s. aureus atcc 25923 and s. aureus 358) and (p. aeruginosa atcc 15442 and p. aeruginosa 03) were assayed ; the resistance profile is shown in table 1(tab. 1). all lineages were kept in hear infusion agar (hia, difco laboratories inc.). before the essays were carried out, lineages were cultivated at 37 c during 18 h in brain hear infusion broth (bhi, difco laboratories inc.). the initial solution was prepared by dissolving 0,01 g of the synthetic compound c9h10n4o4 in 1000 ml of dmso (merck), to result in a stock solution with concentration 10 mg / ml. this was diluted to 1024 g / ml, and successive 1:2 dilutions with distilled water yielded concentrations from 512 to 0.5 g / ml. the compound c9h10n4o4 was dissolved using dymethilsulfoxide (dmso - merck, darmstadt, alemanha) using the following proportions : 0.01 g of compound dissolved in 1 ml of dmso, obtaining a solution with 10 mg / ml. this solution was diluted to 1024 g / ml and sequentially diluted with sterile water in a range varying from 512 to 0.5 g / ml. the microorganisms employed in this study were provided by instituto nacional de controle de qualidade em sade (incqs) from fundao oswaldo cruz, ministrio da sade, brasil. the mic of the synthetic compound c9h10n4o4 was determined by the microdilution in broth method, using concentrations ranging from 512 to 8 g / ml. previously standardized bacterial suspensions were diluted in 1:10 proportion with bhi broth to yield a final concentration of 10 cells / ml (nccls, 2003). this method uses small volumes of medium (bhi 10 %) and sample (c9h10n4o4) distributed in cavities of sterile microplates. sample was prepared in doubled concentration (1024 g / ml) in relation to the defined initial concentration (512 g / ml) with 100 l volume, and then diluted 1:1 serially in bhi 10 %. using 100 l of culture medium per cavity, bacterial suspension negative, positive (medium + microorganism), and inhibition controls were used with the culture medium, in concentrations ranging from 512 to 8 g / ml. the filled plates were incubated at 35 c (2 c) for 24 h (javadpour., 1996).a sodium resazurine indicator solution was prepared with sterile distilled water (0.01 % w / v) in order to determine the mic of solutions toward standard bacterial lineages. after incubation, 20 l of the indicator solution was added to each cavity, and 1 hour later, under room temperature, results were read. a color change from blue to pink is due to resazurine reduction and indicates that bacterial growth has occurred (palomino., 2002). the mic can thus be verified, which is defined as the smallest drug concentration capable of inhibiting bacterial growth, evidenced by the unaltered blue color. the assessment of c9h10n4o4 as a possible modulator of antibiotic action was done by determining the mic of antibiotics from the aminoglycoside group (amikacin, gentamicin e neomycin), with and without that substance, in sterile microplates. aminoglycosides concentrations ranged from 2500 to 2.5 g / ml. the c9h10n4o4 solution was added to bhi 10 % broth with subinhibitory concentrations, obtained after the mic assessment, whereas for the modulation test, an 8 fold concentration reduction (mic/8) was employed. antibiotics solutions were prepared in doubled concentration (5000 g / ml), relative to the initial one, with sterile distilled water. in each cavity of the sterile microplate there were 100 l of the culture medium and the diluted (1:10) bacterial suspension. the controls used for mic assessment of c9h10n4o4 were the same as the ones used for modulation tests (sato., 2004). the filled microplates were incubated at 35 c (2 c) for 24 h, then reading was performed using the resazurine indicator solution, as previously described for the mic assessment. the search for a study to demonstrate the biological activity with 5-aminomethylene meldrums acid derivatives led to a patent in 1965 (sterling drug, 1966). in addition, different heterocyclic rings were condensed to the 5-methoxymethylene meldrum s acid in order to evaluate their potential biological activity as antileishmanicidal, antitrypanosomal and antiviral (silva, 2006). in this paper, we choose to synthesize the of compound 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminomethylene)-1,3-dioxane-4,6-dione, c9h10n4o4, an aminomethylene derivative from meldrum 's acid in order to explore it biological application. the aminomethylene derivative can be obtained by condensation of an arylamine with 5-(metoximethylene)-2,2-dimethyl-1,3-dioxane-4,6-dione generated in situ from a reaction with trimethyl orthoformate (cassis., 1985). a solution of meldrum acid (36 mmol) in thimethyl orthoformate (50 ml) was heated under reflux for 2 h, then the corresponding arylamine (30 mmol) was added. the synthesis can be described by the scheme shown in figure 1(fig. 1). the product of this synthesis was the compound 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminome - thylene)-1,3-dioxane-4,6-dione, c9h10n4o4, a crystalline solid with melting point between 170 c and 172 c (joussef., 2005). standard and multiresistant lineages of e. coli (e. coli atcc 10536 and e. coli 27), s. aureus (s. aureus atcc 25923 and s. aureus 358) and (p. aeruginosa atcc 15442 and p. aeruginosa 03) were assayed ; the resistance profile is shown in table 1(tab. 1). all lineages were kept in hear infusion agar (hia, difco laboratories inc.). before the essays were carried out, lineages were cultivated at 37 c during 18 h in brain hear infusion broth (bhi, difco laboratories inc.). the initial solution was prepared by dissolving 0,01 g of the synthetic compound c9h10n4o4 in 1000 ml of dmso (merck), to result in a stock solution with concentration 10 mg / ml. this was diluted to 1024 g / ml, and successive 1:2 dilutions with distilled water yielded concentrations from 512 to 0.5 g / ml. the compound c9h10n4o4 was dissolved using dymethilsulfoxide (dmso - merck, darmstadt, alemanha) using the following proportions : 0.01 g of compound dissolved in 1 ml of dmso, obtaining a solution with 10 mg / ml. this solution was diluted to 1024 g / ml and sequentially diluted with sterile water in a range varying from 512 to 0.5 g / ml. the microorganisms employed in this study were provided by instituto nacional de controle de qualidade em sade (incqs) from fundao oswaldo cruz, ministrio da sade, brasil. the mic of the synthetic compound c9h10n4o4 was determined by the microdilution in broth method, using concentrations ranging from 512 to 8 g / ml. previously standardized bacterial suspensions were diluted in 1:10 proportion with bhi broth to yield a final concentration of 10 cells / ml (nccls, 2003). this method uses small volumes of medium (bhi 10 %) and sample (c9h10n4o4) distributed in cavities of sterile microplates. sample was prepared in doubled concentration (1024 g / ml) in relation to the defined initial concentration (512 g / ml) with 100 l volume, and then diluted 1:1 serially in bhi 10 %. using 100 l of culture medium per cavity, bacterial suspension was diluted at 1:10 proportion. negative, positive (medium + microorganism), and inhibition controls were used with the culture medium, in concentrations ranging from 512 to 8 g / ml. the filled plates were incubated at 35 c (2 c) for 24 h (javadpour., 1996).a sodium resazurine indicator solution was prepared with sterile distilled water (0.01 % w / v) in order to determine the mic of solutions toward standard bacterial lineages. after incubation, 20 l of the indicator solution was added to each cavity, and 1 hour later, under room temperature, results were read. a color change from blue to pink is due to resazurine reduction and indicates that bacterial growth has occurred (palomino., 2002). the mic can thus be verified, which is defined as the smallest drug concentration capable of inhibiting bacterial growth, evidenced by the unaltered blue color. the assessment of c9h10n4o4 as a possible modulator of antibiotic action was done by determining the mic of antibiotics from the aminoglycoside group (amikacin, gentamicin e neomycin), with and without that substance, in sterile microplates. aminoglycosides concentrations ranged from 2500 to 2.5 g / ml. the c9h10n4o4 solution was added to bhi 10 % broth with subinhibitory concentrations, obtained after the mic assessment, whereas for the modulation test, an 8 fold concentration reduction (mic/8) was employed. antibiotics solutions were prepared in doubled concentration (5000 g / ml), relative to the initial one, with sterile distilled water. in each cavity of the sterile microplate there were 100 l of the culture medium and the diluted (1:10) bacterial suspension. the controls used for mic assessment of c9h10n4o4 were the same as the ones used for modulation tests (sato., 2004). the filled microplates were incubated at 35 c (2 c) for 24 h, then reading was performed using the resazurine indicator solution, as previously described for the mic assessment. antimicrobials association is still studied due to the possibility of suppressing the appearance of resistant mutants, and producing an in vivo synergic effect. an attempt to maintain current antimicrobials active could be successful by combining them with other substances, presenting a therapeutic option to treat infections by s. aureus and other pathogens, regarding the growing cases of multiple resistance (maia., 2009). the mic assessment test using the substance c9h10n4o4 indicated that the mic is higher than 1024 g / ml. according with houghton. (2007), this result indicates that the compound does not present a clinically relevant antibiotic activity. in the modulation of antibiotic - activity test with aminoglycosides it was observed that, in relation to escherichia coli 27, c9h10n4o4 presented a synergism with amikacin, reducing the inhibitory concentration from 19.5 to 4.9 g / ml ; whereas no noticeable effect was observed with gentamicin and neomycin. in relation to staphylococcus aureus 358, c9h10n4o4 presented synergism with amikacin, gentamicin and neomycin, reducing the inhibitory concentration from 19.5 to 2.4 g / ml, 9.8 to 2.4 g / ml and 312.5 to 78.125 g / ml, respectively. with respect to pseudomonas aeruginosa 03, c9h10n4o4 showed synergy only with gentamicin, decreasing the inhibitory concentration from 156.2 to 39.1 g / ml (table 2(tab. (2011), that reports that these synergism is due the interaction with the bacterial cell membrane or with the lipopolysacharide barrier (lps), enhancing the antibiotic influx, increasing by this way the intracellular concentration, or inhibiting the antibiotic efflux due the activity as a blocker of efflux pump (bep). combination of antibiotics with laboratory synthesized isolated substances could serve as a therapeutic option for the treatment of infections caused by s. aureus, e. coli, p. aeruginosa and other pathogens, as well as an important approach to diminish multiple resistance. several compounds, as natural or synthetic, had demonstrated the capacity to modulate the antibiotic activity. phenotiazines, in a general form, are capable to inhibit the bacterial efflux systems, enhancing the antibiotic activity. this activity was demonstrated by chlorpromazine and thioridazine against several multiresistant bacteria (amaral., 2010). as the phenotiazines, natural products can enhance the antibiotic activity inhibiting the bacterial efflux system, but also affecting the fluidity of the plasmatic membrane. natural products as flavonoids (quercetin, isoquercetin, rutin) (veras., 2011 ; araruna., 2012), alkaloids (pilocarpine) (araruna., 2012), terpenes (-bisabolol) (santos., 2011) had demonstrated this activity due the cited mechanisms. both natural or synthetic compounds, modifying the antibiotic activity, can modify also the phenotype of the bacterial strains, reversing the resistant and intermediary phenotype to the sensitivity phenotype, as demonstrated by the compound c9h10n4o4 against the e. coli, s. aureus and p. aeruginosa strains. according to the results obtained, it can be seen that the organic compound studied in this paper presents a modulator effect on antimicrobial activity, fulfilling expectations and providing a possible alternative in future therapeutics. in particular, it was shown that c9h10n4o4 presents antibiotic activity against escherichia coli, staphylococcus aureus and pseudomonas aeruginosa. | the discovery of new substances with proven antimicrobial activity is the current study goal of various researchers. usage of synthetic products has grown considerably in the past few years due to processing agility, and capability of going through previous chemical modifications in order to enhance its biological activity. widespread careless use of antimicrobials has made the number of resistant microorganisms rise significantly, thus demanding more efficient drugs to fight them. one of these synthetic candidates for this purpose is the substance 2,2-dimethyl-5-(4h-1,2,4-triazol-4-ylaminomethylene)-1,3-dioxane-4,6-dione (c9h10n4o4), aminomethylene derivative from meldrum 's acid. this substance, alone and in association with common antibiotics, were evaluated in vitro for antimicrobial activity, and had their minimum inhibitory concentration (mic) towards staphylococcus aureus atcc 25923, escherichia coli atcc 10536 and pseudomonas aeruginosa atcc 15442, as well as multiresistant strains escherichia coli 27, staphylococcus aureus 358 and pseudomonas aeruginosa 03 determined. the antimicrobial modulation action tests of the aminoglycosides with c9h10n4o4 were performed according to the microdilution method, and resulted in observation of a positive synergic effect. |
the myeloproliferative neoplasms (mpn, also known as chronic myeloproliferative disorders or mpd) and myelodysplastic syndromes (mds) are usually distinguished by their clinical presentation, laboratory parameters, and morphological appearance. however, they occasionally demonstrate overlapping features including the coexisting presence of mild hypercellularity, mild / nonspecific dysplasia, and variable bone marrow fibrosis [1, 2 ]. cases with fibrosis may be problematic due to the difficulties associated with obtaining an adequate aspirate smear specimen for optimal microscopic examination, particularly when complete clinical information and/or a peripheral blood smear is not available. in these cases, descriptive diagnoses, such as with features indeterminate for mds versus mpn, are usually given, and follow - up biopsies may be necessary for rendering specific diagnoses. new molecular markers that better discriminate these morphologically similar but biologically distinct entities could significantly improve clinical management and facilitate research studies by providing accurate diagnoses at the time of initial presentation [13 ]. a specific mutation in the janus kinase 2 gene (jak2) was recently shown to be frequently and preferentially identified in the bone marrow and peripheral blood cells of mpn patients [1, 2, 420 ]. the jak2 allele has been detected in the vast majority of polycythemia vera (pv) cases, in the majority of essential thrombocytosis (et) and primary myelofibrosis (pmf) cases, and in many acute leukemias representing transformation from preexisting mpn. however, jak2 is rarely identified in healthy controls or patients with other myeloid disorders. thus, jak2 has general diagnostic value for mpn, but it can not be used to differentiate between pv, et, or pmf [1, 2, 419 ]. the diagnostic utility of jak2 mutation screening in hypercellular bone marrow specimens with fibrosis has not been previously investigated. we retrospectively evaluated the jak2 genotype of 45 fibrotic bone marrow specimens, including 19 cases that were originally diagnosed as with features indeterminate for mds versus mpn using our assay that reliably detects jak2 in archived and paraffin - embedded materials [20, 21 ]. our results demonstrated that the presence or absence of jak2 may have diagnostic implications for these cases. archival pathology and hematology records at our respective institutions were retrospectively reviewed to identify patients with a mildly to markedly fibrotic bone marrow biopsy at initial marrow evaluation. using reticulin and collagen stains, fibrosis was graded on a scale of 0 to 3 as previously described. for pmf cases, grade 1 was considered the early / prefibrotic stage (also termed cellular phase) and grades 23 was considered the fibrotic stage [22, 23 ]. the cohort was limited to nonchronic myelogenous leukemia (bcr / abl fusion gene negative) patients with adequate history and follow - up for clinicopathologic correlation. forty - five specimens were identified as follows : 19 cases initially assigned to with features indeterminate for mds versus mpn because of fibrosis - associated inadequate aspirate and/or lack of complete clinical information, 11 cases with a confirmed mpn (two pmf prefibrotic stage, four pmf fibrotic stage, three pv at spent phase, two et, and four pmf), two cases with acute myelogenous leukemia (aml) transformed from a preexisting pmf, two cases with chronic myelomonocytic leukemia, and 11 cases with other neoplastic myeloid disorders (table 1). none of these cases were tested for jak2 mutation at the time of initial evaluation. this study was approved by the institutional review board of all participating institutions, and samples were obtained in accordance with institutional policies. table 1results of jak2 genotyping in fibrotic bone marrow specimenscase no.specimen type used for molecular testinginitial diagnosis assigned based on first diagnostic evaluationfinal diagnosis following subsequent clinical morphological evaluationsfibrosis (grades 03)jak2 genotype1aspiratefeatures indeterminate for mds versus mpnprefibrotic cimf1mutant2clot sectionfeatures indeterminate for mds versus mpnprefibrotic cimf1mutant3peripheral bloodfeatures indeterminate for mds versus mpnprefibrotic cimf1mutant4clot sectionfeatures indeterminate for mds versus mpncimf, fibrotic stage3mutant5aspiratefeatures indeterminate for mds versus mpncimf, fibrotic stage3mutant6aspiratefeatures indeterminate for mds versus mpnmds - f2wild type7peripheral bloodfeatures indeterminate for mds versus mpnmds - f3wild type8aspiratefeatures indeterminate for mds versus mpnmds - f3wild type9aspiratefeatures indeterminate for mds versus mpnmds - f2wild type10aspiratefeatures indeterminate for mds versus mpnmds - f2wild type11aspiratefeatures indeterminate for mds versus mpnmds - f3wild type12aspiratefeatures indeterminate for mds versus mpnmds - f3wild type13peripheral bloodfeatures indeterminate for mds versus mpnmds - f3wild type14peripheral bloodfeatures indeterminate for mds versus mpnmds - f1wild type15peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type16peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type17peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type18clot sectionfeatures indeterminate for mds versus mpnmds - f2wild type19clot sectionfeatures indeterminate for mds versus mpnmds - f2wild type20aspirateprefibrotic cimfprefibrotic cimf1mutant21clot sectionprefibrotic cimfprefibrotic cimf1mutant22clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant23clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant24clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant25peripheral bloodcimf, fibrotic stagecimf, fibrotic stage3mutant26aspirateaml transformed from cimfaml transformed from cimf3mutant27aspirateaml transformed from cimfaml transformed from cimf2mutant28aspirateet with mild fibrosiset with mild fibrosis1mutant29aspirateet with mild fibrosiset with mild fibrosis1wild type30aspiratepv, ppmmpv / ppmm3mutant31peripheral bloodpv, ppmmpv / ppmm3mutant32peripheral bloodpv, ppmmpv / ppmm3mutant33aspirateall with marked fibrosisall with marked fibrosis3wild type34aspirateall with marked fibrosisall with marked fibrosis3wild type35aspirateall with marked fibrosisall with marked fibrosis3wild type36aspirateaml with mild fibrosisaml with mild fibrosis1wild type37aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type38aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type39aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type40aspiratecll with mild fibrosiscll with mild fibrosis1wild type41aspiratecmml with t(5;12), eosinophilia & fibrosiscmml with t(5;12), eosinophilia & fibrosis2wild type42peripheral bloodcmml with moderate fibrosiscmml with secondary fibrosis2wild type43aspiratelgl leukemia with moderate fibrosislgl leukemia with secondary fibrosis2wild type44aspiratemastocytosis with fibrosismastocytosis with fibrosis3wild type45aspiratetcc with secondary fibrosistcc with secondary fibrosis3wild typecases 119 were originally descriptively diagnosed as with features indeterminate for mds versus mpn due to insufficient clinicopathological evidence for a specific diagnosis, but each was later reclassified, independent of jak2 allele status, as either cimf or mds with myelofibrosis (mds - f) based on the evaluation of subsequent bone marrow specimens and correlation with clinical disease progression. jak2 genotype is reported as wild - type or mutant, and fibrosis is graded on a scale of 03.mds myelodysplastic syndromes, mpn myeloproliferative neoplasms, cimf chronic idiopathic myelofibrosis, aml acute myeloid leukemia, et essential thrombocythemia, pv polycythemia vera, ppmm post - polycythemic myeloid metaplasia, all acute lymphoblastic leukemia, cll chronic lymphocytic leukemia, cmml chronic myelomonocytic leukemia, lgl large granular lymphocyte, tcc transitional cell carcinoma results of jak2 genotyping in fibrotic bone marrow specimens cases 119 were originally descriptively diagnosed as with features indeterminate for mds versus mpn due to insufficient clinicopathological evidence for a specific diagnosis, but each was later reclassified, independent of jak2 allele status, as either cimf or mds with myelofibrosis (mds - f) based on the evaluation of subsequent bone marrow specimens and correlation with clinical disease progression. jak2 genotype is reported as wild - type or mutant, and fibrosis is graded on a scale of 03. mds myelodysplastic syndromes, mpn myeloproliferative neoplasms, cimf chronic idiopathic myelofibrosis, aml acute myeloid leukemia, et essential thrombocythemia, pv polycythemia vera, ppmm post - polycythemic myeloid metaplasia, all acute lymphoblastic leukemia, cll chronic lymphocytic leukemia, cmml chronic myelomonocytic leukemia, lgl large granular lymphocyte, tcc transitional cell carcinoma for each case, dna was extracted from stained or unstained peripheral blood smears, stained or unstained bone marrow aspirate smears, or formalin - fixed paraffin - embedded bone marrow clot sections using the dneasy tissue kit (qiagen, valencia, ca, usa) as previously described [20, 21 ]. there was a relatively even distribution of each specimen type within each disease category (table 1). real - time polymerase chain reaction (pcr) melting curve analysis for the jak2 wild - type and v617f mutant allele was performed on a lightcycler platform (roche applied diagnostics, indianapolis, in, usa) using primers and probes as previously described [20, 21 ]. briefly, pcr primers were designed to flank codon 617 of the jak2 gene, including forward primer jaklcfp 5-aag cag caa gta tga tga gca a-3 and reverse primer jaklcrp 5-agc tgt gat cct gaa act gaa-3. fret probes were designed with the 5 probe overlapping the mutated codon and the 3 probe annealing immediately downstream, including lcrd 5-640-cag aca cat act cca taa ttt-3 and lcfn 5-gta gtt tta ctt act ctc gtc tc - fitc-3. real - time pcr was performed on each specimen using 5.0 l of purified dna extract in a total reaction volume of 20 l that included 4 l of faststart dna masterplus sybr green i 5 reaction master mix (roche applied science), 2.0 l jak2lcfp (final concentration 0.5 m), 2.0 l jak2lcrp (final concentration 0.5 m), 1.0 l lcfn (final concentration 0.5 m), 1.0 l lcrd (final concentration 0.5 m), and 5.0 l nuclease - free water. the pcr cycle parameters were one initial denaturing step of 95c for 10 min and 55 cycles consisting of 95c for 10 s, 60c for 60 s, and 75c for 10 s. the dna melting curve analysis was performed by denaturing at 95c for 10 s, annealing at 29c for 60 s, and melting by a transition rate of 0.20 c / s to 70 c. melting curves were visually analyzed, and the melting temperature (tm) of each sample was electronically recorded. homozygous mutant (jak2/jak2) human erythroleukemia (hel) and homozygous wild - type (jak2/jak2) multiple myeloma (rpmi8226) cell lines were used as positive and negative controls, respectively (fig. 1). melting curves are drawn with df / dt on the y - axis and melting temperature (tm,c) on the x - axis. the homozygous wild - type (jak2/jak2) multiple myeloma control cell line (rpmi 8226) is shown in red with the melting curve peak at approximately 56c (tm = 56c), and the homozygous mutant (jak2/jak2) human erythroleukemia control cell line (hel) is shown in blue with the melting curve peak at approximately 47c (tm = 47c). a representative case of mds - f (jak2 wild type) is shown in yellow with a single tm equivalent to the wild - type jak2 allele. a representative case of prefibrotic pmf (heterozygous jak2/jak2) is shown in green with two tm ; one peak corresponds to the jak2 wild - type allele and the other corresponds to the jak2 mutant allele representative jak2 real - time pcr melting curves. melting curves are drawn with df / dt on the y - axis and melting temperature (tm,c) on the x - axis. the homozygous wild - type (jak2/jak2) multiple myeloma control cell line (rpmi 8226) is shown in red with the melting curve peak at approximately 56c (tm = 56c), and the homozygous mutant (jak2/jak2) human erythroleukemia control cell line (hel) is shown in blue with the melting curve peak at approximately 47c (tm = 47c). a representative case of mds - f (jak2 wild type) is shown in yellow with a single tm equivalent to the wild - type jak2 allele. a representative case of prefibrotic pmf (heterozygous jak2/jak2) is shown in green with two tm ; one peak corresponds to the jak2 wild - type allele and the other corresponds to the jak2 mutant allele archival pathology and hematology records at our respective institutions were retrospectively reviewed to identify patients with a mildly to markedly fibrotic bone marrow biopsy at initial marrow evaluation. using reticulin and collagen stains, fibrosis was graded on a scale of 0 to 3 as previously described. for pmf cases, grade 1 was considered the early / prefibrotic stage (also termed cellular phase) and grades 23 was considered the fibrotic stage [22, 23 ]. the cohort was limited to nonchronic myelogenous leukemia (bcr / abl fusion gene negative) patients with adequate history and follow - up for clinicopathologic correlation. forty - five specimens were identified as follows : 19 cases initially assigned to with features indeterminate for mds versus mpn because of fibrosis - associated inadequate aspirate and/or lack of complete clinical information, 11 cases with a confirmed mpn (two pmf prefibrotic stage, four pmf fibrotic stage, three pv at spent phase, two et, and four pmf), two cases with acute myelogenous leukemia (aml) transformed from a preexisting pmf, two cases with chronic myelomonocytic leukemia, and 11 cases with other neoplastic myeloid disorders (table 1). none of these cases were tested for jak2 mutation at the time of initial evaluation. this study was approved by the institutional review board of all participating institutions, and samples were obtained in accordance with institutional policies. table 1results of jak2 genotyping in fibrotic bone marrow specimenscase no.specimen type used for molecular testinginitial diagnosis assigned based on first diagnostic evaluationfinal diagnosis following subsequent clinical morphological evaluationsfibrosis (grades 03)jak2 genotype1aspiratefeatures indeterminate for mds versus mpnprefibrotic cimf1mutant2clot sectionfeatures indeterminate for mds versus mpnprefibrotic cimf1mutant3peripheral bloodfeatures indeterminate for mds versus mpnprefibrotic cimf1mutant4clot sectionfeatures indeterminate for mds versus mpncimf, fibrotic stage3mutant5aspiratefeatures indeterminate for mds versus mpncimf, fibrotic stage3mutant6aspiratefeatures indeterminate for mds versus mpnmds - f2wild type7peripheral bloodfeatures indeterminate for mds versus mpnmds - f3wild type8aspiratefeatures indeterminate for mds versus mpnmds - f3wild type9aspiratefeatures indeterminate for mds versus mpnmds - f2wild type10aspiratefeatures indeterminate for mds versus mpnmds - f2wild type11aspiratefeatures indeterminate for mds versus mpnmds - f3wild type12aspiratefeatures indeterminate for mds versus mpnmds - f3wild type13peripheral bloodfeatures indeterminate for mds versus mpnmds - f3wild type14peripheral bloodfeatures indeterminate for mds versus mpnmds - f1wild type15peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type16peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type17peripheral bloodfeatures indeterminate for mds versus mpnmds - f2wild type18clot sectionfeatures indeterminate for mds versus mpnmds - f2wild type19clot sectionfeatures indeterminate for mds versus mpnmds - f2wild type20aspirateprefibrotic cimfprefibrotic cimf1mutant21clot sectionprefibrotic cimfprefibrotic cimf1mutant22clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant23clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant24clot sectioncimf, fibrotic stagecimf, fibrotic stage3mutant25peripheral bloodcimf, fibrotic stagecimf, fibrotic stage3mutant26aspirateaml transformed from cimfaml transformed from cimf3mutant27aspirateaml transformed from cimfaml transformed from cimf2mutant28aspirateet with mild fibrosiset with mild fibrosis1mutant29aspirateet with mild fibrosiset with mild fibrosis1wild type30aspiratepv, ppmmpv / ppmm3mutant31peripheral bloodpv, ppmmpv / ppmm3mutant32peripheral bloodpv, ppmmpv / ppmm3mutant33aspirateall with marked fibrosisall with marked fibrosis3wild type34aspirateall with marked fibrosisall with marked fibrosis3wild type35aspirateall with marked fibrosisall with marked fibrosis3wild type36aspirateaml with mild fibrosisaml with mild fibrosis1wild type37aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type38aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type39aspirateaml with moderate fibrosisaml with moderate fibrosis2wild type40aspiratecll with mild fibrosiscll with mild fibrosis1wild type41aspiratecmml with t(5;12), eosinophilia & fibrosiscmml with t(5;12), eosinophilia & fibrosis2wild type42peripheral bloodcmml with moderate fibrosiscmml with secondary fibrosis2wild type43aspiratelgl leukemia with moderate fibrosislgl leukemia with secondary fibrosis2wild type44aspiratemastocytosis with fibrosismastocytosis with fibrosis3wild type45aspiratetcc with secondary fibrosistcc with secondary fibrosis3wild typecases 119 were originally descriptively diagnosed as with features indeterminate for mds versus mpn due to insufficient clinicopathological evidence for a specific diagnosis, but each was later reclassified, independent of jak2 allele status, as either cimf or mds with myelofibrosis (mds - f) based on the evaluation of subsequent bone marrow specimens and correlation with clinical disease progression. jak2 genotype is reported as wild - type or mutant, and fibrosis is graded on a scale of 03.mds myelodysplastic syndromes, mpn myeloproliferative neoplasms, cimf chronic idiopathic myelofibrosis, aml acute myeloid leukemia, et essential thrombocythemia, pv polycythemia vera, ppmm post - polycythemic myeloid metaplasia, all acute lymphoblastic leukemia, cll chronic lymphocytic leukemia, cmml chronic myelomonocytic leukemia, lgl large granular lymphocyte, tcc transitional cell carcinoma results of jak2 genotyping in fibrotic bone marrow specimens cases 119 were originally descriptively diagnosed as with features indeterminate for mds versus mpn due to insufficient clinicopathological evidence for a specific diagnosis, but each was later reclassified, independent of jak2 allele status, as either cimf or mds with myelofibrosis (mds - f) based on the evaluation of subsequent bone marrow specimens and correlation with clinical disease progression. jak2 genotype is reported as wild - type or mutant, and fibrosis is graded on a scale of 03. mds myelodysplastic syndromes, mpn myeloproliferative neoplasms, cimf chronic idiopathic myelofibrosis, aml acute myeloid leukemia, et essential thrombocythemia, pv polycythemia vera, ppmm post - polycythemic myeloid metaplasia, all acute lymphoblastic leukemia, cll chronic lymphocytic leukemia, cmml chronic myelomonocytic leukemia, lgl large granular lymphocyte, tcc transitional cell carcinoma for each case, dna was extracted from stained or unstained peripheral blood smears, stained or unstained bone marrow aspirate smears, or formalin - fixed paraffin - embedded bone marrow clot sections using the dneasy tissue kit (qiagen, valencia, ca, usa) as previously described [20, 21 ]. there was a relatively even distribution of each specimen type within each disease category (table 1). real - time polymerase chain reaction (pcr) melting curve analysis for the jak2 wild - type and v617f mutant allele was performed on a lightcycler platform (roche applied diagnostics, indianapolis, in, usa) using primers and probes as previously described [20, 21 ]. briefly, pcr primers were designed to flank codon 617 of the jak2 gene, including forward primer jaklcfp 5-aag cag caa gta tga tga gca a-3 and reverse primer jaklcrp 5-agc tgt gat cct gaa act gaa-3. fret probes were designed with the 5 probe overlapping the mutated codon and the 3 probe annealing immediately downstream, including lcrd 5-640-cag aca cat act cca taa ttt-3 and lcfn 5-gta gtt tta ctt act ctc gtc tc - fitc-3. real - time pcr was performed on each specimen using 5.0 l of purified dna extract in a total reaction volume of 20 l that included 4 l of faststart dna masterplus sybr green i 5 reaction master mix (roche applied science), 2.0 l jak2lcfp (final concentration 0.5 m), 2.0 l jak2lcrp (final concentration 0.5 m), 1.0 l lcfn (final concentration 0.5 m), 1.0 l lcrd (final concentration 0.5 m), and 5.0 l nuclease - free water. the pcr cycle parameters were one initial denaturing step of 95c for 10 min and 55 cycles consisting of 95c for 10 s, 60c for 60 s, and 75c for 10 s. the dna melting curve analysis was performed by denaturing at 95c for 10 s, annealing at 29c for 60 s, and melting by a transition rate of 0.20 c / s to 70 c. melting curves were visually analyzed, and the melting temperature (tm) of each sample was electronically recorded. homozygous mutant (jak2/jak2) human erythroleukemia (hel) and homozygous wild - type (jak2/jak2) multiple myeloma (rpmi8226) cell lines were used as positive and negative controls, respectively (fig. 1). melting curves are drawn with df / dt on the y - axis and melting temperature (tm,c) on the x - axis. the homozygous wild - type (jak2/jak2) multiple myeloma control cell line (rpmi 8226) is shown in red with the melting curve peak at approximately 56c (tm = 56c), and the homozygous mutant (jak2/jak2) human erythroleukemia control cell line (hel) is shown in blue with the melting curve peak at approximately 47c (tm a representative case of mds - f (jak2 wild type) is shown in yellow with a single tm equivalent to the wild - type jak2 allele. a representative case of prefibrotic pmf (heterozygous jak2/jak2) is shown in green with two tm ; one peak corresponds to the jak2 wild - type allele and the other corresponds to the jak2 mutant allele representative jak2 real - time pcr melting curves. melting curves are drawn with df / dt on the y - axis and melting temperature (tm,c) on the x - axis. the homozygous wild - type (jak2/jak2) multiple myeloma control cell line (rpmi 8226) is shown in red with the melting curve peak at approximately 56c (tm = 56c), and the homozygous mutant (jak2/jak2) human erythroleukemia control cell line (hel) is shown in blue with the melting curve peak at approximately 47c (tm = 47c). a representative case of mds - f (jak2 wild type) is shown in yellow with a single tm equivalent to the wild - type jak2 allele. a representative case of prefibrotic pmf (heterozygous jak2/jak2) is shown in green with two tm ; one peak corresponds to the jak2 wild - type allele and the other corresponds to the jak2 mutant allele medical records and bone marrow specimens obtained at subsequent evaluations were reviewed for all the patients to render final diagnoses using world health organization criteria to the fullest extent possible [1, 2325 ]. of note, the 19 cases initially designated as with features indeterminate for mds versus mpn were ultimately reclassified as either pmf (n = 5) or mds with myelofibrosis (mds - f, n = 14 ; table 1) based on repeat / follow - up biopsies and/or clinical progression. none of these cases fulfilled the criteria for the diagnosis of mds / mpn according to who classification. the blast count in the cases finally diagnosed as mds - f could not be accurately evaluated due to inadequate marrow smear, and thus, a definite subtype of mds could not be assigned accurately. however, the cd34 stain showed an increase of blasts in the majority of these cases, suggesting they were high - grade mds (refractory anemia with excess of blasts). the jak2 gene was successfully amplified by our real - time pcr melting curve assay in all 45 cases (examples shown in fig. 1). the mutant allele was detected in 17 out of 18 (94%) patients with a mpn (according to the final diagnosis in table 1), including five out of five cases of prefibrotic pmf, six out of six cases of pmf in the fibrotic stage, two out of two cases of aml transformed from preexisting pmf, one out of two cases of et with fibrosis, and three out of three cases of pv with fibrosis (also termed post - polycythemic myeloid metaplasia, ppmm ; table 1). only the wild - type allele was detected in 27 out of 27 (100%) patients with other neoplastic myeloid disorders associated with fibrosis, including 14 out of 14 cases of mds - f, three out of three cases of all with marked fibrosis, four out of four cases of aml with mild to moderate fibrosis, two out of two cases of cmml with moderate fibrosis, one out of one case of cll with mild fibrosis, one out of one case of large granular lymphocytic leukemia with moderate fibrosis, one out of one case of mastocytosis with marked fibrosis, and one out of one case of metastatic transitional cell carcinoma with marked fibrosis (table 1). of note, 19 cases (table 1, cases 119) were originally descriptively diagnosed as with features indeterminate for mds versus mpn due to insufficient clinicopathological evidence for definitive categorization. figure 2 illustrates the significant overlapping features of mds and mpn in two representative cases at initial presentation. one (panel a to c) was later determined to be prefibrotic pmf, and the other was reclassified as mds - f with additional data obtained from follow - up biopsies and/or clinical findings. importantly, jak2 mutant alleles were detected in all cases reclassified as pmf (table 1, cases 15), whereas only jak2 wild - type alleles were detected in all cases reclassified as mds - f (table 1, cases 619). representative micrographs of two cases with fibrotic marrow and features indeterminate for mds versus mpn at the time of initial clinical presentation, that were later reclassified as pmf (a c) and mds - f (d f). low power (a and d, respectively), high power (b and e, respectively), and reticulin stains (c and f, respectively) are shown. both cases demonstrate overlapping morphological features including hypercellularity, mild dysplasia and fibrosis, making a definitive diagnosis difficult. b demonstrates the increased bizarre megakaryocytes often observed in pmf, and e demonstrates the mononucleated megakaryocytes often seen in mds. however, the morphologic evaluation alone as shown at initial presentation is not sufficient to render a specific diagnosis without follow - up biopsies and additional clinical findings microscopic evaluation of fibrotic bone marrow specimens. representative micrographs of two cases with fibrotic marrow and features indeterminate for mds versus mpn at the time of initial clinical presentation, that were later reclassified as pmf (a c) and mds - f (d f). low power (a and d, respectively), high power (b and e, respectively), and reticulin stains (c and f, respectively) are shown. both cases demonstrate overlapping morphological features including hypercellularity, mild dysplasia and fibrosis, making a definitive diagnosis difficult. b demonstrates the increased bizarre megakaryocytes often observed in pmf, and e demonstrates the mononucleated megakaryocytes often seen in mds. however, the morphologic evaluation alone as shown at initial presentation is not sufficient to render a specific diagnosis without follow - up biopsies and additional clinical findings our results suggest that jak2 mutation screening is an important ancillary test for distinguishing between mds and other bcr - abl negative mpn with marrow fibrosis. distinction between mpn and mds is important for the appropriate clinical management of hematology patients. however, some cases may occasionally demonstrate overlapping morphological, laboratory, and clinical features that result in considerable diagnostic difficulty, particularly when the marrow aspirate is not optimal for morphologic evaluation due to the associated marrow fibrosis and when clinical data is limited or peripheral blood smears are unavailable for review. our results demonstrated that jak2 was detected in nearly all cases of bcr - abl negative mpn with fibrosis (table 1). this particular patient may carry one of the other more rare jak2 or mpl mutations not detected by our real - time pcr assay [26, 27 ]. in comparison, only wild - type alleles were detected in each case diagnosed as a non - mpn myeloid disorder with marrow fibrosis (table 1). other reports have recently demonstrated the occurrence of jak2 in mds / mpn cases, including chronic myelomonocytic leukemia and atypical chronic myelogenous leukemia [2830 ]. taken together, analysis of the jak2 mutation, in difficult - to - classify cases, will help to clarify the borderline between mds (lacking jak2 mutation) on one hand, and atypical mpn and mds / mpn on the other hand. it would have been interesting to also include cases of autoimmune - associated marrow fibrosis, another setting that may mimic mpn or mds associated with marrow fibrosis. however, no cases were found in our patient databases. additionally, in our series, we found that acute leukemia arising in pmf retain the jak2-positive genotype, whereas no jak2 mutations were found in de novo aml with fibrosis. since aml transformed from a preexisting mpn has a poorer overall prognosis, jak2 genotyping may also have value in stratifying risk groups or predicting therapeutic responses in acute myeloid leukemia patients [31, 32 ]. our observations suggest that jak2 testing is particularly helpful for cases with marrow fibrosis that are difficult to classify into mds or mpn at the initial presentation. among the 19 specimens initially described as with features indeterminate for mds versus mpn, jak2 mutant alleles were detected in each case that was ultimately reclassified as pmf (table 1, cases 15), whereas only wild - type alleles were detected in the cases eventually reclassified as mds - f (table 1, cases 619). although each patient was reclassified based on the evaluation of subsequent morphological and clinical information, jak2 genotyping could have substantially aided diagnosis at the time of initial presentation since the retrospective jak2 studies were concordant with the final disease phenotype. the jak genotyping results, together with other clinical morphological data and follow - up information, will be important for rendering a definitive diagnosis as early as possible during the disease course. this will emerge as an increasingly important capability when specific treatments targeting the jak2 signaling pathway become available. jak2 is not observed in well - defined mds cases with marrow fibrosis in our cohort. this suggests that this mutation must play a minimal role, if any, in the fibrosis that occasionally occurs in mds. initially, a report by ohyashiki., described the presence of jak2 in two of six mds cases with fibrosis, but it was absent in multiple cases of aml, lymphoma, chronic myeloid leukemia with fibrosis, and mds without fibrosis. however, the results of our cohort and another study by kremer. do not support that hypothesis. in agreement with our findings, they also reported that jak2 is exceedingly rare in bona fide mds or de novo aml, regardless of the presence or absence of fibrosis. the optimal assays used to detect jak2 in the setting of marrow fibrosis should be highly sensitive and capable of using formalin - fixed materials as described here. of note, although the markedly hemodiluted marrow smears and clot sections associated with bone marrow fibrosis are suboptimal for morphological evaluation, they contained a sufficient number of clonal hematopoietic cells for successful dna extraction and molecular testing. in our laboratory, this real - time pcr melting curve assay was previously shown to have an analytical sensitivity of 5% (i.e., capable of detecting 5 jak2-positive cells per 100 total cells) [20, 21 ]. this sensitivity may at least partially attribute to the higher percentages of pmf patients carrying jak2 in our cohort than reported in the literature [419 ]. other explanations would include biased sampling in our cohort and different types of samples tested between our study (predominantly archived marrow samples) and other studies (predominantly using fresh blood samples). additionally, the possibility of a case selection bias for jak2 screening in the cited studies can not be excluded. furthermore, at times, when additional marrow aspirate slides are not available, the ability to test for this mutation using formalin - fixed clot sections will eliminate the need for subsequent phlebotomies that can significantly prolong turnaround time. in summary, our results demonstrate that jak is very frequently identified in fibrotic bone marrow specimens associated with bcr / abl negative mpn, but it is not observed in mds with marrow fibrosis. these findings indicate that the evaluation of jak2 mutation status is an important tool that may aid the diagnosis of patients with marrow fibrosis. | the myeloproliferative neoplasms (mpn) and myelodysplastic syndromes (mds) occasionally demonstrate overlapping morphological features including hypercellularity, mild / nonspecific dysplastic changes and variable bone marrow fibrosis. thus, when the associated bone marrow fibrosis results in a suboptimal specimen for morphological evaluation, the descriptive diagnosis fibrotic marrow with features indeterminate for mds versus mpn is often applied. the jak2v617f mutation was recently shown to be frequently identified in mpn, but it is rarely present in other myeloid disorders. however, the diagnostic utility of jak2v617f screening in hypercellular bone marrow specimens with fibrosis has not been previously investigated. using a real - time polymerase chain reaction melting - curve assay capable of detecting jak2v617f in archived fixed materials, we retrospectively studied jak2v617f in 45 cases with fibrotic hypercellular bone marrow at initial presentation, including 19 cases initially described as with features indeterminate for mds versus mpn. these 19 cases were reclassified into more specific categories of mds (n = 14) or mpn (n = 5) based on the availability of subsequent clinical data and/or bone marrow examinations. the jak2v617f allele was identified in 17 out of 18 bcr / abl gene - negative mpn cases with marrow fibrosis, whereas only wild - type alleles were identified in the remaining non - mpn cases. importantly, jak2v617f alleles were seen in all five cases of with features indeterminate for mds versus mpn at initial presentation that were later determined to be mpn, but they were absent in the 14 cases later determined to be mds. our results suggest that jak2v617f allele evaluation can be a useful ancillary test for discriminating mds from mpn in specimens with bone marrow fibrosis. |
in recent years, endoscopic subureteral transurethral injection (sting) has become a first - line therapy for children with vesicoureteral reflux (vur) because of its high success rates and few complications. debate over the ideal bulking agent in endoscopic therapy for children with vur remains controversial, however. the substance should be nontoxic, biocompatible, nonmigratory, and nonantigenic and should cause minimal local inflammation. many bulking agents have been used to treat reflux, including polytetrafluoroethylene, collagen, autologous injectables, polydimethylsiloxane (macroplastique ; uroplasty, minnetonka, usa), and dextranomer / hyaluronic acid copolymer (deflux ; oceana therapeutics, inc, edison, usa). among these agents, macroplastique is one of the most popular bulking agents and is used extensively in medical applications. macroplastique, a nonbiodegradable substance, is reabsorbed and exchanged with a reactive transudate containing fibroblasts that then facilitate its encapsulation. deflux was introduced in 1995 by stenberg and lckgren and was approved by the food and drug administration in 2001 as an acceptable implant for subureteral injection for vur in children. deflux represents a new biocompatible material without immunogenic properties and a lack of distant migration. previous studies indicated high success rates of 68% to 90% with endoscopic injection using macroplastique or deflux [5 - 7 ]. this is the first study by a single surgeon in korea to compare outcomes and complications of these two agents for endoscopic treatment of vur in children. between april 2001 and march 2008, 71 children (29 boys and 42 girls ; 115 ureters) who underwent endoscopic subureteral injection with macroplastique (from april 2001 to february 2004) or deflux (from march 2004 to march 2008) for vur were retrospectively evaluated. all families were counseled regarding the natural history of vur with respect to resolution rates, based on grade of vur, and the risks and benefits of antibiotic use, open surgery, and subureteral injection therapy. all patients underwent preoperative renal and bladder ultrasonography, voiding cystourethrography (vcug), and dimercapto - succinic acid (dmsa) renal scans. reflux grades were evaluated according to the reflux grading system recommended by the international reflux study. the indications for surgery included breakthrough infections during antibiotic prophylaxis, renal scarring, and persistent reflux. exclusion criteria included duplicated refluxing ureters, neurogenic bladder determined by history, and failed surgical reimplantation. the children 's mean age was 6.2 years (range, 1.2 - 10.5 years). the mean period of follow - up was 26 months (range, 12 - 42 months). a single subureteral injection of macroplastique (group i) was performed in 23 children (31 ureters ; grade ii : 4 ; grade iii : 12 ; grade iv : 9 ; grade v : 6), and deflux (group ii) was used in 48 children (84 ureters ; grade ii : 24 ; grade iii : 14 ; grade iv : 25 ; grade v : 21). all procedures were performed by a single operator with the children in the lithotomy position under general anesthesia. the 3.7 fr needle was placed within the submucosa of the ureter at the 6 o'clock position, and macroplastique or deflux was injected inside the lumen of the ureter until an adequate subureteric mound was attained. the mean amount of each substance injected into the ureter was 1.1 ml (range, 0.5 - 1.5 ml) in group i and 1.3 ml (range, 0.5 - 2.0 ml) in group ii. the amount of each substance injected into the ureter was determined according to reflux grade or shape of the ureteral orifice. all patients underwent vcug, ultrasonography, and urine culture from 3 months after discharge. thereafter, basic laboratory studies (complete blood count with differential count, blood urea nitrogen, creatinine, urine analysis, gram stain, and culture) and renal ultrasonography were followed up annually. follow - up vcug was performed in children with recurrent urinary tract infection or newly developed hydronephrosis. successful reflux correction was defined as absent or grade i reflux on follow - up vcug. statistical analysis was performed by using spss statistical software, version 13.0 (spss inc, chicago, usa). no significant difference in baseline characteristics (mean age, gender, reflux grade) were observed between group i and group ii. the overall success rate after a single injection was 80.6% (25 of 31) for group i. vur disappeared in 75.0% (3 of 4) for grade ii, 75.0% (9 of 12) for grade iii, 88.9% (8 of 9) for grade iv, and 83.3% (5 of 6) for grade v. persistent grade i reflux was found in 1 patient. vur disappeared in 87.5% (21/24) for grade ii, 78.6% (11/14) for grade iii, 84.0% (21/25) for grade iv, and 61.9% (13/21) for grade v. persistent grade i reflux was found in 2 patients. there was no significant difference in cure rates between the two groups (p>0.05) (table 1). postoperative ureteral obstruction was found in 2 patients (6.4%) after macroplastique injection and in 3 patients (3.6%) after deflux injection. children with postoperative ureteral obstruction had symptoms that included flank pain, elevated creatinine levels, and aggravated or newly developed hydronephrosis. following deflux injection for bilateral vur, one child required percutaneous ureteral stent placement, due to postoperative ureteral obstruction with serum creatinine level elevation, whereas others required no intervention. following ureteral stent placement, we placed a percutaneous ureteral stent for 12 days and removed it after the hydronephrosis disappeared on follow - up renal ultrasonography. three (9.6%) patients in group i and two (2.4%) patients in group ii had postoperative asymptomatic urinary tract infection during the follow - up period after successful injection therapy. these patients showed no recurrence of reflux on follow - up vcug, nor did they show newly developed renal cortical defects on the dmsa renal scan. bladder calcification due to macroplastique exposure from bladder mucosal necrosis or erosion was found in two patients at the 30- and 36-month follow - ups, and one patient underwent endoscopic removal. the concept of subureteral injection was introduced by o'donnell and puri in the 1980s to create a less invasive treatment for vur. endoscopic treatment is based on the principle of creating a solid support behind the intravesical ureter and elongating the intramural length of the ureter. many studies have reported that endoscopic treatment is effective and safe as a first - line therapy for vur ; however, the ideal agent has not yet been identified. in 2002, oswald reported on a comparison of a single endoscopic sting of macroplastique versus deflux for treatment of vur in children. reflux was corrected in 86.2% of the macroplastique group and in 71.4% of the deflux group at the 3-month follow - up visit. reflux correction was maintained in 80.9% of the macroplastique group and in 67.6% of the deflux group at 1 year of follow - up. our success rate, 80.3% of group i and 78.6% of group ii, is consistent with these data. also, there were no significant differences in cure rate between the grades in the two groups (p>0.05). the success rate for grade v of group ii was lower than that of group i (61.9% vs. 83.3%). however, the success rate was increased up to 67.8% after the second injection in group ii. previous studies have indicated success rates of 70% to 90% by endoscopic injection using macroplastique, and a recent meta - analysis reported a success rate of 76.6%. studies to date have demonstrated single - injection cure rates from 68% to 86.1% with endoscopic injection using deflux ; however, long - term follow - up studies using deflux show that its long - term success rate is less than that of macroplastique. rates of local complications after the injection of endoscopic bulking agents are remarkably low. in particular, ureteral obstruction occurred in less than 1% of injected ureters using macroplastique. in our study, one child (1.2%) required percutaneous ureteral stent placement after deflux injection for bilateral vur. the rate of ureteral obstruction in our study is consistent with published data. in an earlier study, puri and guiney described a series of 11 patients with neurogenic bladder, one of whom developed new hydronephrosis after the injection. a decade later, misra retrospectively reviewed their experiences with 51 children (69 ureters) with neurogenic bladder, one of whom (2%) developed ureteral obstruction requiring reimplantation. al - hunayan observed a single case of symptomatic obstruction following polydimethylsiloxane injection. however, they noted that an " excess amount " of substrate was injected in this case, and the obstruction was attributed to this factor. the injected deflux volume was 3 ml in each ureter in the child with ureteral obstruction. bladder calcification due to macroplastique exposure from bladder mucosal necrosis or erosion was found in 2 patients at 30 and 36 months of follow - up. children with bladder calcification had microscopic hematuria. because macroplastique is a nonbiodegradable substance, the risk of bladder calcification is increased after correction because of the increased pressure and diminished perfusion of the overlying mucosa. on the other hand, animal studies have demonstrated formation of a well - encapsulated foreign body reaction at the injection site, composed of giant cells, fibroblasts, and collagen, with no substantial risk of migration. development of bladder mucosal necrosis from deflux exposure is also a possibility ; however, because of the biodegradable nature of deflux, spontaneous healing may occur. long - term follow - up of patients injected with macroplastique is required because of the risk of bladder mucosal necrosis. to the best of our knowledge, we have reported on the first trial in korea to compare two different bulking agents with regard to success rates and complications. however, several limitations of this study merit discussion. first, this study was not a prospective, randomized trial because of different introduction times for bulking agents in korea. the success rate of sting with each bulking agent may have been affected by surgical technique before achievement of the learning curve because is the procedure was performed by a single surgeon. second, we did not perform additional vcug after successful injection therapy, other than for patients with asymptomatic urinary tract infection and bladder calcification. deflux is a biodegradable material and, in animal studies, hydrolysis of dextranomer microspheres has been identified as the likely cause of decreased implant volume. because microspheres constitute 50% of the volume of deflux however, ingrowth of fibroblasts and production of endogenous collagen between microspheres appeared to occur, thus stabilizing implant volume, and the 12 month volume reduction in rats was 23%. such volume stability undoubtedly has an important role in maintaining the long - term efficacy of deflux in humans. cure rates and complication rates did not differ significantly between macroplastique and deflux after a single endoscopic subureteral injection. both macroplastique and deflux were safe materials for the treatment of vur with few complications. however, long - term follow - up of patients injected with macroplastique and deflux is required because of the risk of bladder mucosal necrosis and substantial decreases in volume after implantation. | purposethe aim of this study was to compare cure rates and complications of polydimethylsiloxane (macroplastique) and dextranomer / hyaluronic acid copolymer (deflux) in the treatment of vesicoureteral reflux (vur).materials and methodsfrom april 2001 to march 2008, 29 boys and 42 girls (total of 115 ureters) with a mean age of 6 years who had undergone endoscopic subureteral transurethral injection for vur were enrolled. a single subureteral injection of macroplastique was performed in 31 ureters in 23 children (group i ; grade ii : 4 ; grade iii : 12 ; grade iv : 9 ; grade v : 6), and a single subureteral injection of deflux was performed in 84 ureters in 48 children (group ii ; grade ii : 24 ; grade iii : 14 ; grade iv : 25 ; grade v : 21). renal ultrasound was done 1 day after injection, and voiding cystourethrography (vcug) was done at 3 months. successful reflux correction was defined as absent or grade i reflux on follow - up vcug.resultsno significant difference in success rates was observed between group i and group ii [80.6% (25/31) vs. 78.6% (66/84), respectively, p>0.05 ]. the following postoperative complications developed : ureteral obstruction in 2 ureters of group i and 3 ureters of group ii, asymptomatic urinary tract infection in 3 patients of group i and 2 patients of group ii, and bladder calcification by erosion or mucosal necrosis in 2 patients of group i.conclusionsdespite differences in material properties, both macroplastique and deflux were safe for the treatment of children with vur. because of the risk of bladder mucosal necrosis and substantial decreases in volume after implantation, long - term follow - up is required. |
diabetes mellitus (dm) and hypertension (htn) have emerged as major medical and public health issues worldwide, and both are important risk factors for coronary artery disease (cad), heart failure, and cerebrovascular disease. dm is increasing in epidemic proportions globally. according to the who, the prevalence of dm in adults worldwide was estimated to be 4.0% in 1995 and is predicted to rise to 5.4% by the year 2025 such that the number of adults with dm in the world would rise from 135 million in 1995 to 300 million in the year 2025. the recent burden of metabolic risk factors of chronic diseases study conducted in 199 countries worldwide to assess the national, regional, and global trends in diabetes reported that the age - standardized adult diabetes prevalence was 98% (8.611.2) in men and 9.2% (8.010.5) in women in 2008, up from 8.3% (6.510.4) and 7.5% (5.89.6) in 1980. the number of people with diabetes increased from 153 (127182) million in 1980 to 347 (314382) million in 2008. the international diabetes federation (idf) has come up with much higher figures in a recent report which estimated that in 2011, 366 million people worldwide had dm and if this trend continues, by 2030, 552 million people, or one in 10 adults, will have dm. in the same report, the western pacific region was shown to have the largest number of people with dm (132 million), followed by southeast asian (sea) region (71.4 million), while the african (afr) region had the smallest number (14.7 million). dm exerts a significant burden resulting in increased morbidity and mortality, decreased life expectancy, and reduced quality of life, as well as individual and national income losses. additionally, htn affects about one billion people worldwide and it is estimated that by 2025, up to 1.56 billion adults worldwide will be hypertensive. raised blood pressure (bp) is estimated to cause 7.5 million deaths, which accounts for 57 million disability - adjusted life years (dalys). the burden of metabolic risk factors of chronic diseases study reported that in 2008, age - standardised mean sbp worldwide was 128.1 mm hg (95% uncertainty interval 126.7129.4) in men and 124.4 mm hg (123.0125.9) in women. globally, between 1980 and 2008, sbp decreased by 0.8 mmhg per decade in men and 1.0 mmhg per decade in women. individuals with htn are known to have a twofold higher risk of developing cad, four times higher risk of congestive heart failure, and seven times higher risk of cerebrovascular disease and stroke compared to normotensive subjects. according to global estimates 62% of stroke, 49% of cad, and 14% of other nonfatal cardiovascular disease (cvd) it has been reported that the highest number of deaths and dalys attributable to high bp occurred in the who western pacific (wp) and sea regions. extensive epidemiological studies conducted in afr region show that htn is one of the commonest cardiovascular ailments and that bp assumes more importance with increasing age, particularly in the sub - saharan africa. dm and htn are also known to coexist in patients. indeed, there is a strong correlation between changing lifestyle factors and increase in both dm and htn. challenges in managing both dm and htn more effectively include factors at the patient, provider, and system levels. epidemiologic studies have an important clinical impact and have led to an increasing appreciation of the value of epidemiology as a scientific basis for clinical and public health practice. as primary health care is the first level of contact of the individuals, the family, and the community with the national health system, there is an urgent need for an integrated approach at primary health care (phc) level for addressing the burden of htn and dm. the aim of this paper is to review the available literature on the burden of dm and htn in the sea and afr regions and to suggest strategies to improve dm and htn prevention and control in primary care in the two regions. according to the world health organization (who), dm, a potentially life threatening disorder, is considered as an apparent epidemic which is strongly related to life style and economic change. type 2 dm comprises 9095% of all cases of dm, and it increases the risk of both macrovascular diseases (which comprise cad and cerebrovascular disease or stroke, and peripheral vascular disease) and microvascular diseases (retinopathy, nephropathy, and neuropathy). diabetes creates a huge economic burden not only due to the direct costs of treatment particularly of its complications, but also in terms of man hours lost due to the debilitating effect the disease has on the individual and his or her family and society as a whole. epidemiological studies have shown that dm is increasing rapidly in people of south asian, african, and african caribbean origins. the who and idf have utilized methods that combine available country data at regular intervals and extrapolated estimates for remaining countries without data. in 2000, according to who, the prevalence of dm among the 46 countries of the who afr region was estimated at 7.02 million people and among the 11 countries of the sea region to be 4.69 million. the number of individuals with dm in the sea region in the year 2011 and the projected figures for the year 2030 are presented in table 1. there are significant differences between and within countries because of the geographical diversity in socioeconomic growth rates, demographic and lifestyle changes, and perhaps differences in ethnic susceptibility to dm. for example, the prevalence of dm in sub - saharan africa ranges from 1% in rural uganda to 12% in urban kenya [13, 14 ] and 8.1% in urban and 2.3% in rural bangladesh. in india, the recent icmr - india diabetes (icmr - indiab) study reported the prevalence of dm (both known and newly diagnosed) in 4 regions of the country : 10.4% in tamilnadu, 8.4% in maharashtra, 5.3% in jharkhand, and 13.6% in chandigarh (union territory). the overall number of people with dm in india in 2011 based on this study was estimated to be 62.4 million, and this was confirmed by the diabetes atlas (5th edition) of the idf, which gave a figure of 61.3 million people with dm in india in the age group of 2079 years. figure 1 presents the trends in age - standardised dm prevalence in the sea region between 1980 and 2008 for men and women as reported in the burden of metabolic risk factors of chronic diseases study. the recent nfhs 3 data, which studied urban and rural residents (all women aged 1549 and all men aged 1554) in 29 states of india during the year 2005 - 2006, reported that more than two percent of men and women had self - reported dm. the number of women who had dm ranged from 282 per 100,000 women in rajasthan to 2,549 per 100,000 women in kerala. in five other states (tamil nadu, goa, tripura, west bengal, and delhi) the number of women with dm was relatively high (above 1,500 per 100,000 women). only five states had dm prevalence levels below 500 per 100,000 men (jammu and kashmir, mizoram, himachal pradesh, rajasthan, and uttar pradesh). it has also been reported that there is a dramatic increase in the prevalence of type 2 dm in the african regions. in studies done between the 1960s and early 1980s, prevalence of type 2 however, currently dm rates are rising in many parts of africa. according to the burden of metabolic risk factors of chronic diseases study, the dm prevalence in 2008 was higher in north africa and was the lowest in sub - saharan africa and the prevalence ranged from 1% in rural uganda to 12% in urban kenya. studies from sub - saharan africa report prevalence rates of 2.58% in rural and urban communities in west africa [2224 ] and 112% in rural and urban communities in east africa [14, 2527 ]. prevalence rates of 310% were noted in urban and rural populations in south africa [28, 29 ], while in central africa the figures ranged from 2.9% to 6.2% in rural and urban communities [30, 31 ] which are comparable with rates in developed countries. in a recent community - based screening for dm conducted simultaneously in four major cameroonian cities, the sex - specific - age - adjusted prevalence of dm (for men and women) had dramatically risen to 10.1% and 11.2%, respectively. the number of individuals with dm in the afr region in the year 2011 and the projected figures for the year 2030 are presented in table 2. one of the unfortunate aspects of dm is that more than half of the people with dm are unaware of the condition. the rate of undiagnosed dm is high in both of the sea and afr regions. in the icmr - indiab study the prevalence of undiagnosed dm among residents of tamil nadu, maharashtra, jharkhand, and chandigarh were 44%, 70%, 51%, and 50%. in developed countries of the world, the prevalence of htn is beginning to stabilize or decrease, thanks to prevention and control measures. parallelly the prevalence rates of cvd (both cad and stroke) are also beginning to fall [34, 35 ]. in contrast, in the developing regions of the world such as sea and afr hypertension and cvd rates continue to rise. extensive epidemiological studies show that htn is one of the commonest cardiovascular ailments in afr and sea regions. approximately one - third of the adult population has high bp and nearly 1.5 million deaths occur due to htn each year in the sea region. studies in india have shown an increasing trend in the prevalence of htn among urban adults : men 30%, women 33% in jaipur (1995) ; men 44%, women 45% in mumbai (1999) ; men 31%, women 36% in thiruvananthapuram (2000) ; men 36%, women 37% in jaipur (2002) ; 21.1% in chennai (2003). among the rural populations, htn prevalence in men was 24% and in women 17% in rajasthan (1994). the cures study reported a prevalence of 23.2% htn among men and 17.1% among women in south india. htn is responsible for 57% of all stroke mortality and 24% of all cad mortality in india. in thailand, the age - adjusted prevalence of htn was 25% in men and 24% in women. in bangladesh, prevalence rates of systolic and diastolic htn were 14.4 and 9.1 percent, respectively, with prevalence of systolic htn significantly higher in rural than in urban participants. in addition, there is an approximately 89% increase in sub - saharan africa from 2000 through 2025 versus a 24% increase in more developed countries. among the who regions, the prevalence of htn was the highest in africa, where it was 46% for both sexes combined. both men and women have high rates of raised bp in the african region, with prevalence rates over 40%. it has been reported that the prevalence of htn is increasing rapidly in sub - saharan africa and occurring in young and active adults. age - adjusted prevalence urban studies have shown that in the adult population of durban, htn was the highest in zulus (25%), intermediate in whites (17.2%), and the lowest in indians (14.2%). however, in contrast, the prevalence of htn in rural areas was lower : 4.1% in ghana, 5.9% in nigeria, 7% in lesotho, and 7.37% in the rural zulu. a recent systematic analysis of health examination surveys and epidemiological studies in 199 countries and territories with 786 country - years and 5.4 million participants has looked at the national, regional, and global trends in systolic bp (sbp) for adults 25 years and older since 1980. the sbp rose in oceania, east africa, and south and southeast asia for both sexes and in west africa for women, with the increases ranging from 0.8 to 1.6 mmhg per decade in men and 1.0 to 2.7 mmhg per decade in women. table 3 shows the trends in age - standardised mean sbp in selected african region between 1980 and 2008 for male and female population as reported in the burden of metabolic risk factors of chronic diseases study. control of htn in sub - saharan africa is poor and target bp < 140/90 mmhg on treatment occurred in < 1% in tanzania and 7% in black males and 15% in black females in south africa. obstacles to adherence include (a) long duration of therapy, (b) complicated regimens, (c) cost of drugs, (d) side effects of medication, (e) lack of specific appointment time, (f) long waiting period at clinic or office, (g) lack of consistent and continuous primary care, (g) instructions not understood, (h) organic brain damage (memory deficit), and (i) medicines not available. the patient and illness characteristics include (a) asymptomatic nature of the condition ; (b) chronic conditions require constant attention ; (c) there are no immediate consequences of stopping treatment for example, one does not feel sick ; (d) social isolation ; (f) disrupted home situation ; and (g) psychiatric illnesses. significant numbers of individuals with htn in both of the sea and afr regions are unaware of their condition and, among those diagnosed with htn, treatment is frequently inadequate. htn was estimated to have caused 46,888 deaths or 9% of all deaths and 390,860 dalys or 2.4% of all dalys in south africa in 2000. overall, 50% of stroke, 42% of ihd, 72% of hypertensive disease, and 22% of other cvd burdens in adult males and females (30 + years) were attributable to high bp. in thailand, burden of diseases defined as total daly loss attributed to htn was 5.5% in both men and women. dm and htn coexist in approximately 40% to 60% of patients with type 2 dm [46, 47 ]. the hypertension in diabetes study (hds)-i conducted to determine the prevalence of htn in newly diagnosed type 2 diabetic patients reported that 39% of the patients were hypertensive at the time of diagnosis of dm. there is considerable evidence for an increased prevalence of htn in diabetic persons from other populations. in a study conducted in american indian and alaska native communities to estimate the prevalence of clinical htn and assess the coexistence with dm, 37% of diabetic individuals were diagnosed with htn. in the same study, the relative risk of htn in the diabetic populations compared with the nondiabetic populations varied from 4.7 to 7.7. it has also been shown that in hypertensive patients agaging 4059 years, of three different ethnic groups living in south london, are more likely to have dm, and, conversely, patients with dm have a greater chance of having htn. in a large prospective cohort study that included 12,550 adults, the development of type 2 dm was almost 2.5 times as likely in persons with htn than in their normotensive counterparts [50, 53 ]. the common denominator of hypertensive / diabetic target organ - disease is the vascular tree. people with coexisting dm and htn are at increased risk of developing atherosclerosis, retinopathy, renal failure, and nontraumatic amputations and cvd. moreover, it has been shown that lowering bp in high risk patients with dm can reduce deaths from strokes, overall mortality, and cvd events and can slow the progression of renal disease in patients with type 2 dm. left ventricular hypertrophy and cad are much more common in diabetic hypertensive patients than in patients suffering from htn or dm alone. htn substantially increases the risk of both macrovascular and microvascular complications in dm. in studies such as the systolic hypertension in the elderly program (shep) and the systolic hypertension in europe study (syst - eur), those with coexisting dm had an approximate doubling in cardiovascular morbidity and mortality [55, 57 ]. however tight htn control appears to be more effective than glycaemic control in reducing microvascular events particularly kidney disease. clinical trials have demonstrated the importance of intensive treatment of htn among patients with dm. the ukpds showed that each 10 mmhg decrease in mean sbp was associated with 12% reduction in the risk for any complication related to dm, 15% reduction in deaths related to dm, 11% reduction in myocardial infarction, and 13% reduction in microvascular complications. the hypertension in diabetes study (hds)-ii, which looked at the degree to which htn is a risk factor for macrovascular and microvascular complications in type 2 dm, reported that hypertensive patients had a greater incidence than normotensive patients of death from diabetes - related, mainly cardiovascular events and a greater incidence of diabetes - related death and major morbidity combined, including myocardial infarctions, angina, strokes, and amputation. studies from sea region have shown that dm and htn coexist in type 2 dm. in india about 50% of diabetic individuals have htn [60, 61 ]. in the screening india 's twin epidemic (site) cross - sectional study conducted in 10 indian states dm and htn were coexistent in 20.6% patients, which demonstrate that the substantial burden of dm and htn is on the rise in india. according to the thailand diabetes registry, the prevalence of htn in adult thai type 2 diabetic patients was 78.4. among 745 subjects with known dm, who participated in the fourth korea national health and nutrition examination survey in 2007 and 2008, the prevalence of htn was reported to be 55.5%. in a study conducted in seven urban populations of nepal, 36.7% of the diabetic subjects had htn, while of all subjects with htn, 29.1% had dm (known or newly diagnosed). african studies have reported high prevalence of htn in dm, although most are clinic based. a high prevalence rate of 66.4% was reported in cameroonian type 2 diabetic population (african blacks). a study conducted in kenya during the year 2005 to determine the proportion of specific cardiovascular risk factors in ambulatory patients with type 2 dm reported that 50% of the patients had htn. in a nigerian clinic population, htn and dm the recent epidiam study conducted in 525 type 2 diabetic individuals in three moroccan regions reported that 70.4% of the individuals had htn. another study conducted in benin city, nigeria, reported that 54.2% of the diabetic individuals had htn. in most developing countries, till recently, the priorities of health care had been the prevention and control of communicable diseases. however now the attention has begun to shift to the control and prevention of noncommunicable diseases (ncds) including dm, htn, cad, and stroke in view of the rising trend of ncds. for this, an integrated approach to the prevention and management, irrespective of cause, is needed in primary health care settings. chronic disease interventions selected for use in primary health care must lead to productive changes in risk status and outcomes, be cost effective, and be financially and logistically feasible, which are available for implementation across a range of resource settings. within this context of restrained economic conditions, in the sea and afr regions, the greatest gains in controlling the dm and htn epidemics lie in their prevention, or at least early detection and adequate control. for most low - income and middle - income countries, the major obstacle to the control of bp - related diseases the commonality of many risk factors for htn and dm justifies an integrated approach to the prevention and control of both. both problems have to be tackled at several levels, that is, primordial, primary, secondary, and tertiary prevention (figure 2). primordial prevention refers to reduction of the risk factors of dm / htn and thereby decreasing the risk of developing dm in the future. refers to prevention (or postponement) of the condition in those in a prediabetes / htn stage. refers to prevention of complications in those who have already developed dm / htn. finally the term tertiary prevention is used to describe limiting physical disability and preventing progression to end stage complications in those who have already developed some associated complications. primordial prevention depends on health policies that create a congenial environment and promote healthy behaviours and population wide education programs, which in turn depends on many factors, including political commitment, advocacy by health professionals, and involvement of community leaders and the mass media. the rule of halves has shown that more than 50% of people with dm or htn remain undiagnosed, among those detected, 50% do not take treatment, and finally among those who take treatment, over 50% are not under control. thus overall only 68% of subjects with dm or htn remain adequately controlled [75, 76 ]. this poses a huge challenge and underscores the need to urgently raise awareness in the community at large. attempts should be made to detect dm / htn early before irreversible organ damage occurs and to provide them with the best possible and yet affordable treatment. beaglehole. have emphasized that management of chronic diseases is fundamentally different from acute care, relying on several features including opportunistic case finding for assessment of risk factors, detection of early disease, identification of high risk status, a combination of pharmacological, and psychosocial interventions, often in a stepped - care fashion, and finally long - term followup with regular monitoring and promotion of adherence to treatment. therefore, efforts should be made for detection through screening and early management at the community level. screening activities are an important component of any prevention / control programme and are particularly important in population at high risk for developing dm / htn (e.g., older individuals, some ethnic groups) and those with limited access to medical care (e.g., some minorities, migrants) (figure 2). luckily, unlike screening for some diseases, for example, cancer, screening for dm / htn or prediabetes / htn is fairly simple. in addition, a standardized algorithm of management can help in the rational use of available resources at the primary care level. the next step after having the high risk group detected is to advise lifestyle modifications (primary prevention). while age and ethnicity are non - modifiable risk factors, physical inactivity and waist circumference, dietary and smoking habits, and so forth can be modified. evidence from high - income settings shows that interventions to reduce risk behaviours (dietary modifications, increase exercise, and stop smoking) in people with serious risk factors or preexisting disease such as htn, dm, and cvd are more successful in achieving reductions in risk factors and, in some circumstances, improving clinical outcomes. the high risk group can be empowered through health education on lifestyle modification (lsm) and their benefits with the help of community health workers. landmark studies like the da qing study in china, finnish diabetes prevention study, and the diabetes prevention programme (dpp) have clearly shown that measures of lsm help in preventing dm. both of the finnish diabetes prevention study and the dpp in the usa showed that lifestyle change can significantly reduce the risk of development of type 2 dm by 58% in individuals with igt and demonstrated that modest weight change and achievable physical activity goals can translate into significant risk reduction [78, 79 ]. the da qing study, conducted in a chinese population, reported that diet, exercise, and diet - plus - exercise interventions were associated with 31%, 46%, and 42% reductions in risk of developing dm, respectively. the indian diabetes prevention programme (idpp) showed that progression to dm from impaired glucose tolerance (igt) can be prevented by 28.5% with lsm and 26.4% with with metformin (met) in individuals who were younger, leaner, and more insulin resistant as compared with the control group. however, there was no added benefit from combining lsm + met (28.2%). there are also several clinical trials exploring the efficacy of lifestyle modifications to reduce bp. a prospective study on 8302 finnish men and 9139 women aged 25 to 64 years without a history of antihypertensive drug use, cad, stroke, and heart failure at baseline showed that subjects with heavy grade of physical activity had lower prevalence of htn. of the three lifestyle changes weight reduction, sodium reduction, and stress management tested in 2182 participants with prehypertension in the trials of hypertension prevention - phase i (tohp - i)weight reduction was the most effective strategy, producing a net weight loss of 3.9 kg and a bp change of 2.3/2.9 mmhg. tohp - ii demonstrated that in overweight adults with high - normal bp, weight loss, and reduction in sodium intake, individually and in combination, were effective in lowering systolic and diastolic bp, especially in the short term (6 months). furthermore, it concluded that the effects on average bp declined over time (48 months) and reductions in htn incidence were achieved. the premier clinical trial reported that individuals with above - optimal bp, including stage 1 htn, can make multiple lifestyle changes that lower bp and reduce their cvd risk. while all efforts must be taken to prevent dm / htn, what about the people who already have these conditions ? unless proper care is provided to these individuals, they could face a huge burden of complications in the future. three landmark studies on glycemic control in dm, namely, the diabetes complications and control trial (dcct), the united kingdom prospective diabetes study (ukpds), and kumamoto study [8688 ], have clearly documented the beneficial effects of glycemic control in preventing microvascular complications in diabetic patients. however, mere glycemia control alone may not be sufficient to prevent cvd as shown in the ukpds study where despite a 16% reduction in mi, it did not reach statistical significance. thus it is clear that a much prolonged approach controlling glucose, blood pressure, and lipids is needed to prevent cvd in diabetic subjects as shown by steno-2 study. indeed a tight dm control may even be harmful in older high risk patients as shown by the action to control cardiovascular risk in diabetes (accord) trial, which showed that aiming for a glycated hemoglobin around 6.0% could result in increased mortality. thus the overall consensus is that a glycated hemoglobin of less than 7% would be adequate. skyler. have suggested that glycemic control may be important before macrovascular disease is well developed but has less impact when vascular disease is advanced. the same group recommends that for primary and secondary cvd risk reduction in diabetic patients, the evidence - based recommendations for blood pressure treatment, including lipid - lowering with statins, aspirin prophylaxis, smoking cessation, and healthy lifestyle behaviors outlined by american heart association (aha) and the american diabetes association (ada) guidelines [91, 93 ] should be followed. it is thus clear that it is important to improve levels of care at several health care settings, namely, primary, secondary, and tertiary. thus at the primary level, the existing primary health centres (phcs) and rural clinics must be strengthened. this includes providing basic training to the doctors and paramedical staff as well as community health workers as well as improving the facilities available at the phcs, for example, essential medicines, glucometers, blood pressure apparatus, and so forth. screening can be successfully done by nonphysicians as shown in the chunampet rural diabetes prevention project (crdpp). large scale screening for dm / htn is possible, but it then becomes an ethical issue to provide basic care, for example, low cost generic drugs and follow - up care. studies in which the effectiveness of professional interventions (postgraduate education of health care) combined with local consensus procedures and/or reminders and/or audit and feedback were compared with usual care have reported an improved diabetes care [95, 96 ]. another study which evaluated education for both health care professionals and patients showed that the intervention improved glycated hemoglobin, body weight, and triglycerides. measures should be taken to increase the adherence to practice guidelines and improve both primary care doctors ' and patients ' knowledge. evaluating and auditing of adherence to the national guidelines and management in primary healthcare should be done regularly to ensure that appropriate care is provided. there is ample evidence from many developed and developing countries to show that type 2 dm and htn are routinely managed by nurses / health workers / pharmacists in primary care centres in conjunction with a physician through patient education, patient and family counseling, and close monitoring of health outcomes [98103 ]. mexico 's veracruz initiative for dm awareness (vida) showed the potential of implementing chronic disease management principles in low - resource primary healthcare settings, where health workers received in - service training on dm management, including foot care, and also learned about principles of effective health care for chronic disease as represented by the chronic care model. a similar approach has been adopted in rural south africa for dm, htn, and asthma and resulted in successful control of the disorders. telemedicine, which is an integration of electronic information and medical technology, could help to bring specialized healthcare to the remotest and underserved areas in developing countries. telemedicine is an exciting new technology which can help in integration of all urban and rural health care centers and improve the quality of medical services in the presently underserved and impoverished sections particularly in remote rural areas of developing countries. the potential of this tool is particularly significant in sea and afr regions where specialists are few and where distances and the quality of the infrastructure hinder the movement of physicians or patients. there is evidence in both of these regions to show that this technology can nullify the gap in providing quality health care where health care professionals can not reach out to people with chronic disease who need their services [94, 105108 ]. the chunampet rural diabetes prevention project (crdpp), which was developed to provide mass screening and dm health care and prevention to rural india through a combination of telemedicine and personalized care and employment of local youth (both men and women), demonstrated that the model is not only suitable for prevention and control of dm but also reduces the burden of other chronic ncds such as htn in low - resource rural settings. thus, novel methods such as this must be developed to provide health care, in general, and, in particular, dm and htn prevention, which is accessible, affordable, and acceptable to rural people in developing countries. in addition, the existing infrastructure at government hospitals, which provide secondary level of care, should be improved to screen and provide basic treatment for dm - related complications or cvd / stroke in addition to some laboratory support, for example, lipid profile, glycated hemoglobin, microalbuminuria, or serum creatinine estimation and ecg. in addition, public private partnerships could be encouraged if the government can not provide all the necessary infrastructure or personnel to accomplish this. providing large scale insurance benefits to those below the poverty line can help to prevent them from getting into a debt trap because of illness - related health care expenditure. a small percentage of individuals (about 5%) will ultimately need tertiary care facilities for management of their advanced stage of complications, for example, laser photocoagulation for diabetic retinopathy, dialysis or transplantation for renal failure, coronary angiography or bypass / angioplasty for cad, or limb salvage procedures or amputations for advanced diabetic foot disease (tertiary prevention). again, costs, quality control, and accountability could be ensured by mutually acceptable terms and some or all of these costs could be defrayed by insurance schemes specifically meant to benefit people. table 4 summarizes some of the action plans to prevent / control dm and htn. according to the united nations joint program on hiv / aids, 33.2 million adults and children are living with these infections worldwide. many low- and middle - income countries, particularly the afr region, face a double burden of disease from infectious diseases such as hiv / aids and ncds. the health systems in such countries are weak and are severely challenged by the weight of a double burden of disease. diagonal approach to hiv / aids and ncd prevention and control as they share many similarities that make them ideal candidates for a coordinated approach [112114 ]. there is paucity of data on the integration of care for hiv, dm, and cvd in several low - income and middle - income countries although they coexist. a review on care delivery models for dm and hiv / aids in sub - saharan africa revealed potential elements for cross - fertilization which includes rapid scale - up approaches through the public health approach by simplification and decentralization ; community involvement, peer support, and self - management strategies ; and strengthening health services. a cambodian study demonstrated the feasibility of integrating care for hiv / aids, dm, and htn within the setting of chronic disease clinics and reported over 70% retention of patients after 24 months. hiv / aids models have a lot of experience with activating community and peer support for patients, which can be followed in prevention of chronic diseases including htn and dm. therefore, lessons from these studies reveal that there is no need to reinvent the wheel, as experiences with hiv programmes can be leveraged to ncd programmes, and vice versa. with appropriate resources and support, both dm and htn present huge challenges in developing countries, particularly in the sea and afr regions. health care systems should be strengthened for early detection and effective treatment of those affected with both dm and htn. strategies to prevent / control htn and dm should be population based, incorporating multilevel, multicomponent, and socioenvironmental approaches and integrating community resources with public health and clinical care. according to the chronic care model put forth by who in 2002, six areas need improvement to facilitate chronic care : community resources ; health systems ; self - management support ; decision support ; delivery system redesign ; and clinical information systems, all of which give greater emphasis to the need for policy changes and empowering the community. based on this, various interventions / strategies have been suggested to improve health care for chronic disease as shown in figure 3. there is an urgent need to improve monitoring and management of risk factors through primary care linked programmes. policy and system changes are essential to reduce risk in populations, including legislation and public education to reduce dietary fat, salt and sugar, food pricing policies, tobacco control, and changes to health care delivery systems to explicitly support prevention / control of dm and htn. ultimately, prevention of dm / htn needs political will, societal and community support, and of course behavioral change on the part of the individuals and their families. | aim. to review the available literature on burden of diabetes mellitus (dm) and hypertension (htn) and its coexistence in southeast asian (sea) and the african (afr) regions and to suggest strategies to improve dm and htn prevention and control in primary health care (phc) in the two regions. methods. a systematic review of the papers published on dm, htn, and prevention / control of chronic diseases in sea and afr regions between 1980 and december 2012 was included. results. in the year 2011, sea region had the second largest number of people with dm (71.4 million), while the afr region had the smallest number (14.7 million). screening studies identified high proportions (> 50%) of individuals with previously undiagnosed htn and dm in both of the sea and afr regions. studies from both regions have shown that dm and htn coexist in type 2 dm ranging from 20.6% in india to 78.4% in thailand in the sea region and ranging from 9.7% in nigeria to 70.4% in morocco in the afr region. there is evidence that by lifestyle modification both dm and htn can be prevented. conclusion. to meet the twin challenge of dm and htn in developing countries, phcs will have to be strengthened with a concerted and multipronged effort to provide promotive, preventive, curative, and rehabilitative services. |
an encephalocele is a developmental disorder in which the bones of the skull do not close completely, creating a gap through which cerebrospinal fluid (csf), brain tissue and meninges can protrude into a sac - like formation. it occurs due to failure of the neural tube to close completely during fetal development, whereas schizencephaly is a developmental disorder of neuronal migration. different theories have been described in the etiology of schizencephaly like genetic or a physical insult, such as infection, infarction, hemorrhage, toxin, or mutation. a 6-year - old female child was brought by her parent with complaints of progressive swelling over her vertex since birth, left sided hemiparesis and intermittent generalized tonic clonic convulsion for last 3 years. she was delivered full - term normally at home, and cried immediately after birth. there was no history of consanguineous marriage, intrauterine infection, or teratogenic drug intake by mother. on examination we found a cheerful child with a large fluctuating swelling over vertex of size approximately 12 10 15 cm. she was having global delay in developmental milestones, left side hemiparesis and left facial palsy of upper motor type. computed tomography (ct) and magnetic resonance imaging (mri) of brain revealed a large calvarial defect with meningoencephalocele and associated schizencephaly (type ii) [figures 1 (a - c) and 2 (a - c) ]. one month later, the sac was opened at its apex, a large bony dural defect was seen down at the level of the cranium, and the cranial contents were found to be protruding out of it. redundant dura were dissected free from the internal wall of the sac and used to close the defect in a two layer fashion. motor power of left limb had improved and seizure was well - controlled with antiepileptic drug. (a) mri of brain - sagittal t2-weighted image showing a large vertex meningoencephalocele. note continuity of cerebrospinal fluid between right lateral ventricle and protruding sac (b) ct scan of brain after 3d reconstruction showing a large calvarial defect over vertex with shunt tube inside (c) ct scan of brain after vp shunt showing, protruding parenchyma with a cleft extending from surface to rt lateral ventricle (schizencephaly) (a) mri of brain axial t1-weighted image showing. blue arrow : agenesis (b) mri of brain axial t1-weighted image in upper cuts showing. red arrow : schizencephaly, note gray matter lined clef extending across the entire cerebral hemisphere (blue arrow). blue arrowhead : heterotropic grey matter (c) mri of brain axial t2-weighted image showing. red arrow : schizencephaly, csf continuity from ventricular surface to pial surface can be marked meningoencephalocele cases usually present immediately after birth and surgery is generally performed during infancy. in developing countries, cases may present late, as in our case. if meningoencephalocele is left unrepaired, the growing brain parenchyma will continue to bulge out of it leading to microcephaly. because of microcephaly, protruding parenchyma may not completely reduce back to cranial cavity, even after pre - operative vp shunt. a delicate judgment is required during dural closure and cranioplasty, as tight closure would increase intracranial tension and fatal complications. in the case presented, the encephalocele was totally covered with skin ; this indicates that neural tube must have closed normally during neurulation. the primary nonseparation of neurectoderm and surface ectoderm has been described as the culprit for such anomalies. this final process of neurulation takes place just after closure of the neural tube in the 4 week of gestation. this case is even more interesting for its association with schizencephaly ; which is a developmental disorder of neuronal migration ; occurring around 8 week of gestation. neuronal migration involves several steps, starting from initial departure of neuroblasts from the ventricular zone to finally arrest of migration at the appropriate layer. depending upon stage of migration defect the latter is characterized by gray matter lined cleft extending across the entire cerebral hemisphere, from the ventricular surface (ependyma) to the periphery (pial surface) of the brain. the clefts may be unilateral or bilateral and may be closed, as in schizencephaly type i, or separated, as in schizencephaly type ii. it is frequently associated with other cerebral anomalies like ventriculomegaly, polymicrogyria, heterotopias, agenesis of the corpus callosum, and absence of the septum pellucidum. outcome is variable and depends upon extent of cortex involved in the defect. a clinical presentation and mri finding of our case fits to a case of schizencephaly. gray matter lined cleft helped in differentiating schizencephaly from porencephaly ; this is best demonstrated on mri. management consists of treatment for seizures, physiotherapy, and in cases that are complicated by hydrocephalus, a vp shunt is needed. encephalocele should be repaired early. while repairing large vertex encephalocele, few critical points are to be taken care of like slow decompression of cerebrospinal fluid (csf) from the swelling and preservation of major veins. initial vp shunt helps in reduction of size and dissection of sac ; it further gives a safe feeling during dural closure and cranioplasty. in case of meningoencephalocele it is not only extent of the herniated mass but the presence of additional anomalies of brain which are considered important factors in the prognosis for the patient. | an encephalocele is a developmental disorder of neural tube closure, where as schizencephaly is a developmental disorder of neuronal migration. there are only few case reports suggesting association of schizencephaly with meningoencephalocele. we report a case of 6-year - old child who was brought by her parent with complaints of progressive swelling over her vertex since birth, left sided hemiparesis and intermittent generalized tonic clonic convulsion for last 3 years. clinical examination, computed tomography (ct) and magnetic resonance imaging (mri) of brain revealed a large calvarial defect with meningoencephalocele and associated schizencephaly. initially, ventriculoperitoneal (vp) shunt was carried out, followed by successful repairing of the defect. this case is interesting for late presentation, management difficulties and associated anomalies schizencephaly, which is a rare developmental disorder. |
diabetes mellitus is a disorder characterized by altered glucose tolerance or impaired lipid and carbohydrate metabolism. type 1 diabetics experience cell destruction of the islets of langerhans of the pancreas, which may lead to an absolute insulin deficiency. type 2 diabetes mellitus patients experience impaired cellular sensitivity to insulin (insulin resistance), with or without insulin deficiency. estimates indicate that 12 to 15 million individuals have diabetes in the united states 1,10,11. prevalence, severity and progression of periodontal disease have been shown to increase in diabetic subjects2,3. loss of periodontal attachment occurs more frequently and more extensively in moderately and poorly controlled diabetic patients than those under proper control14. it has been suggested that several factors may contribute to the development of periodontitis in patients with diabetes mellitus, including defective polymorphonuclear leukocyte function, altered collagen metabolism, pathological vascular change, compromised wound healing potential and microbiological imbalance15. diabetes may also influence the development and the course of periradicular diseases. in diabetic patients, diabetics also had about twice the rate of flare - ups compared to non - diabetics5,7. moreover, when cases with preoperative periradicular lesions were investigated, diabetics had a much lower percentage of successful cases compared with non - diabetics5. all these findings strongly suggest that diabetic patients are more prone to be affected by problems of endodontic origin. thus, the purpose of this study was to radiographically and histologically examine the development of periradicular inflammation in control and in diabetic rats after induction of pulpal infection. approval for the study protocol was obtained from the ethics committee of estcio de s university, rio de janeiro, rj, brazil. forty male 3-month old wistar rats weighing from 200 to 220 g were used for this study. the animals were equally divided into two groups : one composed of 20 normal rats (control group) ; and the other composed of 20 rats with streptozotocin - induced diabetes. for diabetes induction, rats received a single intraperitoneal dosage of streptozotocin (45 mg / kg body weight) dissolved in 50 mm citrate buffer (ph 4.5). streptozotocin is selectively cytotoxic to the islet cells in the pancreas and by using this drug diabetes can be induced in a controlled manner. after 48 hr, glycemia was measured and animals with blood glucose levels higher than 250 mg / dl were selected and this date considered as the first day of disease (diabetes). animals were anesthetized with intraperitoneal injection of pentobarbital (0.08ml/100 g body weight) after 7 days of diabetes evolution and the pulps of the mandibular first molars of all animals (control and diabetic rats) were exposed with a size 1/2 round steel bur in high - speed rotation. ten animals per group were killed by cervical dislocation at 21 and 40 days after pulp exposure. mandibles were then surgically removed, fixed in 10% neutral - buffered formalin solution for 2 days and then radiographed in a standardized position. exposure parameters were as follows : 60kvp and 10 ma, intraoral dental radiographic film (kodak ultra - speed), focus - film distance of 15 cm, exposure time 0.3s and a constant incidence of the central ray perpendicular to the film. the radiographic images of the periradicular lesions were scanned (scan jet 3c - hewlett - packard, dallas, tx, usa), transferred to a personal computer and the total area of the lesions measured using global lab image software (data translation inc., three representative specimens of each group and per evaluation period were randomly selected and prepared for histopathological analysis. mandibles were resected, fixed in neutral buffered formalin solution and decalcified under agitation in 5% buffered edta (ph 7.0), which was renewed every 2 days. blocks containing the experimental roots and surrounding periradicular tissues were embedded in paraffin, and serial longitudinal sections with average thickness of 6 mm were obtained. all sections of each specimen were stained with hematoxylin and eosin, examined under a light microscope and classified according to the intensity of inflammatory infiltrate (absent, discrete, moderate or severe) and width of the periodontal ligament space (normal ; widened but no detectable bone loss ; detectable loss of apical bone ; and severe destruction of apical bone). lesions were also categorized as granuloma or cyst, the latter only when a distinct epithelium - lined cavity was discernible. diabetic rats showed lower body weight than the controls and glycemia was significantly higher in the diabetes group (p<0.05, mann - whitney test) (table 1). radiographic analysis revealed that diabetic rats presented significantly larger periradicular lesions when compared with control rats, regardless of the experimental period (p<0.05, mann - whitney test) (figure 1). there was also a significant difference when comparing the size of periradicular lesions in control rats sacrificed in 21 and 40 days (p<0.05, mann - whitney test) (figure 1). values are expressed as mean standard deviation ; control- 21= normal rats sacrificed at 21 days ; control-40= normal rats sacrificed at 40 days. dm-21= diabetic animals sacrificed at 21 days ; dm-40= diabetic animals sacrificed at 40 days ; body weight and glycemia : a = measurements obtained after 48 hours of disease induction (considered as the first day of disease) ; b = measurements obtained at the sacrifice day.. histopathological examination of representative specimens revealed that periradicular lesions developed in some specimens even before the pulp was totally necrotic. large periradicular lesions and severe inflammatory exudate were observed more frequently in the group of diabetic rats than in controls (figure 2). all examined lesions but one were diagnosed as periradicular granuloma. in one specimen of a diabetic rat sacrificed after 40 days of pulpal exposure, a periradicular cyst was formed (figure 3). in the present study, diabetes was induced by means of streptozotocin, which is selectively cytotoxic to the islet cells in the pancreas. the advantages of using the streptozotocin refer to the fact that diabetes can be induced in a controlled manner in all animals. furthermore, animals in the diabetes and non - diabetes groups can have the same genetic background7. our overall results are in agreement with the study of kohsaka.8(1996), which histologically and histometrically demonstrated that induced periradicular lesions in diabetic rats had larger size than in non - diabetic controls. the radiographic analysis performed in the present study revealed that periradicular lesions were significantly larger in the 40-day period than in the 21-day period, even in nondiabetic animals. in some cases, fouad,.4 (2002) investigated the root canal microbiota of diabetics and non - diabetics using the polymerase chain reaction and reported that there was a positive, yet non - significant, association between diabetes and the presence of porphyromonas endodontalis and porphyromonas gingivalis. the number of different microorganisms detected per specimen was, on average, higher in diabetics than in non - diabetics, but the differences were not statistically significant. in another study6, the same group found that eubacterium infirmum was significantly more found in root canals of diabetic patients than in nondiabetic individuals. based on those studies, one can surmise that there is a potential increased prevalence of some virulent endodontic pathogens in root canals of diabetic patients. such a higher prevalence of endodontic pathogens may be one of the possible reasons why periradicular lesions are more pronounced in diabetics than in non - diabetics. fouad and burleson5 (2003) used a custom - built electronic record system to investigate endodontic diagnostic and treatment outcome data in patients with and without diabetes. a total of 5,494 cases (284 diabetic patients) were treated, and 540 cases (73 diabetic patients) had follow - up data two years or more postoperatively. there was a trend toward increased symptomatic periradicular disease in patients with diabetes who received insulin, as well as flare - ups in all patients with diabetes. they found that patients with diabetes had a reduced likelihood of success of endodontic treatment in cases with preoperative periradicular lesions. diabetes is associated with innumerous complications, and different mechanisms are likely to account for them. nonetheless, current evidence suggests that indirect effects of hyperglycemia, such as the formation of irreversible advanced glycation end - products (age), are implicated in the induction of toxic effects9. the interaction of ages with their receptors (rage) appears to mediate chronic cellular perturbation and disfunction1,12. altered host response to infection occurs in diabetic individuals and may be related to the accumulation of ages and their interaction with rage in tissues. in fact, ages form and accumulate in tissues in different conditions, including aging, renal failure and diabetes. under normal circumstances, rage is present at low levels in a number of cell types, including endothelial cells and monocytes. in perturbed states, such as diabetes, the expression of rage on critical target cells accumulation of ages in tissues and their interaction with rage can significantly alter tissue ability to respond to infection. alterations include increase in the vascular permeability and enhanced expression of adhesion molecules on endothelial cells ; attraction and activation of macrophages, leading to the release of proinflammatory cytokines, such as interleukin (il)-1, il-6 and tumor necrosis factor (tnf)-a, and matrix metalloproteinases ; action on fibroblasts, inducing increased activity of matrix metalloproteinases and impaired collagen synthesis. therefore, interaction of ages with rage expressed on endothelial cells, macrophages and fibroblasts can lead to an exaggerated and sustained response to infection and diminished reparative response. as a consequence, when infection occurs in an age - enriched environment, accelerated and our data lend additional support to the assertion that diabetes mellitus induces reduction in the host defense ability against microbial agents. the results of this study suggest that diabetic patients can be more prone to develop large periradicular lesions. our results and those from the endodontic literature indicate that special care should be taken during endodontic treatment in diabetic patients and all efforts should be directed towards prevention and control of endodontic infection, with proper antimicrobial approaches. | evidence suggests that diabetic patients are more significantly affected by problems of endodontic origin. this study sought to radiographically and histologically examine the development of periradicular inflammation in control and in diabetic rats after induction of pulpal infection. the pulps of the mandibular first molars of normal and streptozotocin - induced diabetic rats were exposed and left in contact with their oral cavities for 21 and 40 days. afterwards, the animals were sacrificed, the mandibles were surgically removed, fixed in formalin and then radiographed in a standardized position. the radiographic images of the periradicular lesions were scanned and computerized images were evaluated for the total area of the lesions using a specific software. representative specimens were also prepared for histopathological analysis. radiographic analysis revealed that diabetic rats presented significantly larger periradicular lesions when compared with control rats, regardless of the experimental period (p<0.05). histopathological examination of representative specimens revealed larger periradicular lesions and more severe inflammatory exudate in the group of diabetic rats when compared with the control group. data from the present study indicated that diabetic rats can be more prone to develop large periradicular lesions, possibly due to reduction in the defense ability against microbial pathogens. |
in a study that was published in a recent issue of critical care and that was conducted in a cohort of 50 patients with severe sepsis at intensive care unit (icu) admission, andaluz - ojeda and colleagues reported that absolute counts and relative concentrations of natural killer (nk) cells were significantly higher in patients who died. in an earlier study, also published in critical care, we characterized the abnormalities of lymphocytes in 52 patients with septic shock during the first 28 days in the icu. the study design was approved by the university hospital ethics committee, and all participants or their next of kin provided written informed consent. table 1 shows the significant differences found in the counts and percentages of lymphocyte subpopulations during the first week of follow - up. like previous investigators, we have found a reduced count of circulating nk cells in patients with septic shock, independently of their outcome. although patients who did not survive exhibited less nk cell depletion than survivors at icu admission, there were no differences in cd56cd3cell counts in blood between survivors and non - survivors. these data are slightly in agreement with those reported by andaluz - ojeda and colleagues, who found that patients with the highest nk cell number had the lowest probability to survive. however, unlike giamarellos - bourboulis and colleagues, we did not find higher percentages of nk cells in patients who did not survive. counts and percentages of lymphocytes and their main subpopulations during the first week of follow - up in patients with septic shock and in healthy controls using cd69 and cd57 surface antigens, we determined the counts and distributions of the activation stage of nk cells (cd3cd56) by flow cytometry. we obtained a significant increase in the counts and percentages of the cd3cd56cd69cells in non - survivors at icu admission and on day 3 (figure 1). the mean fluorescence intensity for cd56cd3cd69cells was also significantly higher in non - survival patients than in survivors or controls (30.6 4.2 versus 20.3 2.6 and 18.3 0.9, respectively ; p < 0.05 for both). cd69 is rapidly induced in nk cells after activation and its role in nk cytotoxicity has been demonstrated in humans. kinetics of circulating blood percentage of total natural killer (nk) cells (a) and counts (b) of cd3cd56cd69nk subset in patients with septic shock during their stay in the intensive care unit. values are expressed as the mean percentage standard deviation (a) or as the mean of cells per microliter standard deviation (b). data from non - survival patients, survivors, and healthy control subjects are shown in red, green, and blue, respectively. the mann - whitney u test for non - parametric data was used to analyze differences between the groups, and analysis of variance followed by wilcoxon signed - rank tests were used for within - group analyses. p < 0.05 for survivors or non - survivors versus controls ; p < 0.05 for survivors versus non - survivors ; p < 0.05 for each follow - up time versus intensive care unit admission. we further found a significantly higher percentage of cd3cd56cd57nk cells in non - survival patients than in survivors and controls at icu admission (70.8% 3.3% versus 57.3% 9.2% and 53.6% 3.7%, respectively ; p < 0.05). non - survivors had a strong but not significant trend toward an increase of cd3cd56cd57nk cell count (94.8 7.3 versus 56.9 12.4 cells per cubic millimeter). the expression of cd57, a long - lived marker and highly differentiated effector of nk cells, is increased in septic shock patients who died. these data demonstrate an important role of nk cells as key participants in the early inflammatory response during septic shock. patients who did not survive exhibited less nk cell depletion than survivors and these cells were very early activated and rapidly differentiated. we propose to asses nk cell phenotype and functions for a better understanding of the physiopathology of sepsis in order to apply new therapies at an early stage. count ' values are presented as cells per cubic millimeter, and ' percentage ' values are presented as percentages. the mann - whitney u test for non - parametric | recently, several studies about the role of natural killer (nk) cells in sepsis have been highlighted. in an earlier study, we characterized the abnormalities of circulating lymphocytes in 52 patients with septic shock during the first 28 days in the intensive care unit. our results confirm and expand some previous reports. we found that patients who did not survive exhibited less nk cell (cd3cd56 +) depletion than survivors and that these nk cells expressed cd69 + and cd57 +. these data demonstrate that nk cells are key participants in septic shock because patients who survived have more depletion and expressed less early activation and differentiation. |
carpal tunnel syndrome is the most common entrapment neuropathy involving the median nerve under the unyielding fibrous transverse carpal ligament. surgical release of carpal tunnel is an effective treatment and in substantial majority, surgery is necessary to relieve the symptoms efficiently. an otherwise healthy 41-year - old patient presented to our orthopaedic clinic with wrist pain. he was secretary of an office with a heavy writing job and a recently sudden increase in his duty without a chance to reduce his heavy working load. he had no important sign and symptom but a localised pain at the volar surface of the wrist of his right dominant hand. three weeks later, he came back with more severe pain at the wrist and we advised him to immobilise the wrist with a volar wrist splint and another two weeks of nsaid therapy. one month later, he returned with a localised swelling on the volar aspect of the wrist, numbness and tingling on the palmar surface of the entire hand and a burning pain radiating proximally to the forearm. electrodiagnostic evaluation revealed moderate to severe median nerve neuropathy at the wrist suggestive of carpal tunnel syndrome. since the symptoms were not typical for carpal tunnel syndrome in order to exclude unusual etiologies, we suggested a wrist mri which revealed median nerve swelling and notable edema in carpal tunnel. we planned open surgical release of the carpal tunnel with a classical incision at the wrist. at the surgery, we were surprised of a wide 25-mm swollen median nerve occupying nearly entire width of the carpal tunnel with tiny surface vessels [figure 1 ]. median nerve is obviously edematous and occupies nearly all width of the carpal tunnel eleven months later, he came back to our clinic with a painful fusiform swelling along the palmar aspect of the middle finger extending to the palm of the left hand. we advised him to give a rest to his hand and a 10 days course of nsaid therapy ; with good response and subsidence of swelling. three weeks later, he was suffering from a severe pain and mild swelling at the volar surface of the left wrist with tingling and numbness on the palmar surface of all digits. the pain was burning in nature and radiating up to the forearm. having previous history in mind, after an electrodiagnostic evaluation suggestive of carpal tunnel syndrome, we planned open surgical release of transverse carpal tunnel ligament as soon as possible. we observed a sizable swollen median nerve about the same size as in the other hand occupying the entire width of the carpal tunnel [figures 2 and 3 ]. thirty - two months after the first surgery and nineteen months after the second surgery, the patient had no pain, no swelling and no neurological symptoms and objective signs of sensory deficits, weakness and/or thenar muscle atrophy. giant swollen median nerve with venous engorgement in left hand notice the size of edematous median nerve in proportion to palmaris longus tendon in left hand high carpal tunnel pressure compromises median nerve electrophysiological functions leading to a package of signs and symptoms recognised as carpal tunnel syndrome. postural factors including non - neutral wrist posture, forceful repetitive hand - work and vibration are some predisposing factors elevating carpal tunnel pressure but in majority, there is no identifiable cause. high carpal tunnel pressure as an external load initiates some internal responses leading to other various responses in the nerve (cascade model). first, high pressure as a compression trauma increases permeability of epineurial vessels leading to epineurial edema. epineurial blood vessels are more vulnerable to trauma but with exceeding pressure, breakdown of blood - nerve barrier in endoneurial microvessels leads to endoneurial edema and high endoneurial pressure. since endoneurial space lacks lymphatics and for selective diffusion barrier formed by epineurial membrane, edema can not be drained out. edema reduces endoneurial microcirculation through occluding openings in perineurial membrane where the anastomosing vessels between epineurium and endoneurium pass obliquely (valve mechanism). increasing pressure compromises arteriolar flow and endoneurial capillary blood flow ; consequently, ischemia occurs. cyclic ischemia and reperfusion as an ischemic stress releases overwhelming free oxygen radicals, malonaldehyde bis (diethyl acetal). continued oxidative stress and resultant free oxygen radicals lead to cellular injury in the nerve and synovial tissue. this product as a potent vasodilator enhances vascular permeability and also sensitises nerve endings to mechanical and chemical stimuli, so that normal stimulus can be painful. tissue levels of pge2 and malonaldehyde bis (diethyl acetal) in patients with carpal tunnel syndrome are significantly higher than normal. cellular damage contributes to production of cytokines (as il6) that originate fibroblast proliferation and fibrosis in connective tissue container of the nerve. it has been demonstrated that tissue levels of il6 in patients with carpal tunnel syndrome is highly elevated. formation of fibrosis decreases excursion of nerve fibers and neural gliding, producing dynamic ischemia. the end result of this sequence of events would be nerve fibers atrophy massive fibrous changes of soft tissue container of the nerve with permanent nerve injury. cross - section area of the median nerve in carpal tunnel in asymptomatic adults has been measured less than 10 mm with sonographic evaluation. although enlargement of median nerve in carpal tunnel syndrome due to edema has been demonstrated by sonography in various studies, to our knowledge, this amount of enlargement (25 mm wide), as defined in our case, has never been reported. this huge amount of edema leaving the nerve under the unyielding pressure may very soon develop to a nerve ischemia and subsequent necrosis leading to a fibrous atrophic median nerve. prompt surgical release of carpal tunnel interrupts the process, alleviates the symptoms and promises good results. | we introduce a middle age healthy man with sequential bilateral carpal tunnel syndrome. at the surgery, we encountered a wide median nerve in both wrists. although enlargement of median nerve in carpal tunnel has been well documented, 25 mm width of the nerve is a rare scene, underscoring that leaving the nerve under the unyielding pressure would lead to a fibrous atrophic median nerve. |
in the myriad interactions between viruses and host cells, there is a constant struggle for survival that causes both sides to adopt strategies counteracting each other 's effect. more often than not, the error - prone replication of viruses offers them an advantage of selective pressure enabling them to accumulate genetic mutations over time that helps evade host immune defense mechanisms. most chronic viruses seem to have an edge in this struggle in that they evolve means to manipulate and exploit host molecular pathways to persist in the hostile cellular environment and remain hidden from immune surveillance. in this regard, retroviruses have succeeded in establishing latent infection and developing drug resistance through escape mutants like very few other chronic viruses. one of the strategies utilized by retroviruses is the modulation of chromatin structure and regulation of the rate at which transcription occurs in the target cell. chromatin remodeling in the context of retroviral infection is being explored as a potent means of long - term persistence. many studies have shown that the exercise of chromatin modulation in retroviral infection begins with the proviral integration into the host genome. the site at which this integration occurs is important as it determines the kind of chromatin remodeling that the virus might cause and the rate at which viral proteins are produced. persistence, as demonstrated by latent viruses, is thus largely dictated by the nature of virally encoded integrase enzyme. it requires the provirus to integrate into a site that is transcriptionally inactive or less active so that there is minimal viral gene expression. conversely, a productive infection is a result of integration into transcriptionally active regions on the host genome resulting in a higher rate of viral protein expression. human t cell leukemia virus 1 (htlv-1), a deltaretrovirus, behaves preferentially in the former fashion by altering chromatin structure to remain latent and thus aid in its survival and persistence. in addition, methylation along the 5 long terminal repeat (ltr) region of the virus contributes to regulation of viral persistence. htlv-1, the first retrovirus to be associated with human malignancies, is the causative agent of adult t cell leukemia (atl) and htlv-1 associated myelopathy / tropical spastic paraparesis (ham / tsp). the virus has a propensity for infecting cd4 t cells with cd8 t cells serving as reservoirs. other secondary cell types such as cd8 t cells, cells of the monocyte - macrophage lineage, and dendritic cells as well as those belonging to the resident cns cell population are also known to be infected. one of the factors to be considered during this observation is that some of the cell types refractile to viral transcription also tend to express lower levels of mirna processing proteins. a number of independent studies have identified integration sites of htlv-1 in the human genome [1013 ]. in 2007, mapped 541 integration sites of the virus in hela cells comparing them to other retroviral integration sites and showed that integration does not correspond merely to transcriptional units and transcriptional start sites. rather, the apparent nonrandom site integration is monoclonal in nature and predominantly reliant on the structure and/or sequence of viral integrase enzyme. a clear demarcation appears to exist between the integration preferences of htlv-1 in carrier cells versus leukemic cells. htlv-1 integrates into nontranscribing heterochromatin alphoid repeats in carrier cells, while in leukemic cells, it preferentially integrates at actively transcribing dna units. once integration has occurred, viral replication and successful infection among other factors depend on tax, the virally encoded transactivator protein largely involved in cellular transformation. a major regulatory function of the retroviral transactivating protein is its ability to interfere with the host cellular mirna machinery [15, 16 ]. altered mirna expression profiles have been observed between retrovirus - infected and uninfected cells that can also be associated with disease progression and development of cancer. in the context of htlv-1 infection, a number of recent studies have identified distinct mirna patterns in infected cells that progress to atl [1820 ]. although results of the individual studies have disparities between them, all of them identified the tumor suppressor gene tp531np1 to be commonly repressed in infected cells. a more detailed analysis of mirna and its differential expression in htlv-1-infected cells will be discussed in a later section of the paper. besides the canonical role of mirnas as translational repressors of mrna expression, emerging evidence indicates a significant modulatory role for mirna at the level of chromatin [22, 23 ]. the mirnas accomplish this either through direct methylation along the promoter region of specific genes or more indirectly through the epigenetic modification of histone proteins surrounding the chromatin of the target region. this phenomenon referred to as rna - induced initiation of transcriptional silencing (rits) [25, 26 ] has been implicated in the regulation of a number of human genes. kim. demonstrated that endogenous mirna recruit argonaute 1 (ago1), ezh2, a pcg member, and h3k27me3 to the promoter region of the target gene and suppress its expression. in case of hiv-1, another human retrovirus, retrovirus - derived mirnas like those generated by processing of the tar element of hiv-1 appear to be involved in rnai - mediated transcriptional gene silencing (rnai - tgs). several small ssrna species cleaved from the tar region by dicer have been implicated in dampening cellular as well as viral gene transcription and promoting viral latency [3032 ]. taken together, it is possible that rnai - tgs keeps viral transcription in check through the recruitment of rits at the viral promoter. a similar mechanism of gene silencing induced by sirna is quite likely in htlv-1-infected cells. from previous studies, it is clear that expression levels of tax responsive mirna in infected cells is to a large extent modified through the nfb pathway. given that tax is associated with a number of other cellular transcription factors like creb, ap-1, myc, nfat, srf, p53, tgf-, and so forth, that also regulate sirna expression levels, its involvement in regulating rits through these pathways can not be ruled out. since tax is predominantly nuclear, one possible mechanism by which it might influence sirna - mediated chromatin remodeling could be through sequestering mature sirna from its target sequence on the chromatin, preventing its regulation. alternatively, tax could also interact with the ribonuclease iii enzyme drosha within the nucleus, modulating its function and preventing it from cleaving out the precursor mirna element from the primary mirna transcript. besides the nucleus, tax occupies a number of subcellular sites in the infected cell. although mechanistically poorly understood, it is known to shuttle to the cytoplasm from the nucleus, a process that was demonstrated through a heterokaryon fusion assay. also, there have been studies questioning the nuclear assembly of tax with its transcriptional activating counterparts cbp / p300 and rela, proposing a possible cytoplasmic assembly [35, 36 ]. in addition, htlv-1 rex protein has been demonstrated to interact with dicer and block it from processing mature mirna from precursor mirna and suppressing its rna silencing activity. the subsequent sections of the paper focus on htlv-1 infection and the role of tax protein in disease progression. further, various small rna pathways and their capacity to influence chromatin remodeling are described. finally, a more detailed description is presented on interaction of viruses with mirna in general and retrovirus and htlv-1 in specific proposing probable points of intersection that can result in mirna - mediated chromatin reorganization as depicted in figure 1. the virus predominantly gets transmitted through cell - cell contact, prompting the formation of a microtubule - organizing center (mtoc) oriented towards the virological synapse. at the synapse, viral rna and gag protein accumulate at the mtoc and get transported into the uninfected cell. tax plays a role in synapse formation, mtoc orientation, and intracellular adhesion molecule 1 although it was previously believed that cell - free htlv-1 is largely noninfectious, there is emerging evidence that htlv-1 can enter nave cells through receptor - mediated endocytosis. the human glucose transporter glut-1 and surface heparin proteoglycan have been identified as possible receptors for cell - free virus. htlv-1 is a relatively complex retrovirus on account of the fact that in addition to the retroviral structural gag, pol, and env genes flanked by 3 and 5 ltr regions, it has a px region located between the 3ltr and env genes encoding tax, rex, and other accessory proteins. tax is encoded by open reading frame (orf) iv of the px region and is principally functional in the nucleus. through dna array studies, expression profiles of more than 300 of the ~2000 cellular genes assayed were found to be significantly altered under the influence of tax acting through several pathways as previously mentioned. as an oncoprotein, the most critical function of tax appears to be cell survival, proliferation, and ultimately transformation of the cell into an atl state. genomic instability in htlv-1-induced leukemia is thought to be caused by tax in two phases : firstly, by inhibition of cellular dna repair pathways and secondly by the loss of cell cycle checkpoint controls [43, 45, 46 ]. the 40-kda tax protein is essentially involved in htlv-1 gene expression from three 21-bp tax responsive elements (tre) located within the u3 region of the viral promoter [47, 48 ]. each tre is composed of domains a, b, and c, but the central b region is a conserved 8-nucleotide (nt) core sequence (tgacgtca) that closely mimics a cyclic amp (camp) responsive element (cre) and is flanked by 5 and 3 g / c - rich sequences. tax activates transcription by recruiting the cellular transcription factors cre binding protein (creb) and serum response factor (srf or p67) to the cre [50, 51 ]. tax interacts with dimeric creb as a homodimer forming a ternary complex that in turn helps to stabilize the creb / tre complex. once stabilized, tax then independently recruits the two cellular coactivators - p300/creb - binding protein (p300/cbp) and p300/cbp - associated factor (p / caf), both of which bind to two distinct regions in the amino - terminus and carboxyl - terminus of tax, respectively, and eventually activates transcription by histone acetylation through chromatin remodeling [5456 ]. in addition, tax has shown to reduce histone protein and transcript levels in htlv-1 infected compared to uninfected t cell lines. the protein also influences transcription of a number of cellular promoters, namely, il-2, il-13, il-15, il-2r, c - fos, gm - csf, and so forth [5863 ]. modulation of cellular gene expression is through several cellular signaling cascades four of these cardinal pathways include creb - atf, nfb, ap-1, and srf. one major outcome is the quelling of the tendency of virus - infected cells to undergo apoptosis and senescence [69, 70 ]. in addition, tax represses dna damage control checkpoints and also activates several proliferative factors that facilitate progression of cell cycle into the replicative phase, enhancing cell division. members of the stimulatory protein (sp1 and sp3) family of transcription factors physically interact with the gc regions within tre-1 repeat iii, and purified sp1 protein competes with purified creb protein for binding to this site, but in the presence of tax purified sp1 can form a protein complex with tax and creb. in cells of the monocytic - macrophage lineage (secondary target cell population), factors belonging to the activator protein (ap-1) family of basic region / leucine zipper (bzip) proteins (fra-1, fra-2, junb, and jund) are shown to be upregulated [73, 74 ] and bind to the tre-1 repeat ii site thereby activating basal - and tax - mediated transactivation of the ltr. however, in the same cell type lineage, another family of bzip factors, ccaat / enhancer binding protein (c / ebp), promotes low level of viral gene expression in the absence of tax (c / ebp, c / ebp, c / ebp), while in the presence of tax it (c / ebp and c / ebp) inhibits high level of viral gene expression. other transcription factors like members of the creb family (creb-2-activating transcription factors atf-1 and atf-2) [77, 78 ] and the histone deacetylase hdac1 have also been identified in the ltr complex. the torc family of transcriptional regulators (viz., torc1, torc2, and torc3) are coactivators of tax protein and the removal of these factors inhibits tax activity. the cofactor p300 further enhances for torc activity [80, 81 ]. however, majority of these investigations highlighting the importance of the cellular transcription factors (creb, sp1, sp3, ap-1, c / ebp, p300/cbp, and p / caf) in htlv-1 tax - mediated ltr activation [50, 8285 ] and the ability of tax protein to interact with these factors independently [54, 86, 87 ] have been carried out using transiently transfected viral reporter plasmids or in cell lines that otherwise are not the primary target for htlv-1 in vivo. studies with hiv-1 have shown that the integrated provirus differs from a transfected viral plasmid both physically and also in the requirement of certain cellular factors especially those belonging to the chromatin - remodeling histone acetyltransferase (hat) family [8890 ] or even in the transcriptional repressor domain. it demonstrates that transient transfection cell systems do not convey the real picture by undermining the crucial role of chromosomal structure in transcriptional regulation. in order to gain a better understanding of viral gene regulation as well as the complex interplay between the integrated provirus, host cellular transcription factors, the viral transcription transactivating protein, and the cellular sirna machinery during the course of infection and reactivation following latency, it would certainly be more realistic and physiologically relevant if such studies are carried out with stably integrated viral ltr in a clinically relevant cell type that is formatted in the context of cellular chromatin. to this end, we generated htlv-1 ltr stable integrants with a reporter luciferase gene (htlv-1 ltr - luc) in the jurkat cell line, representative of the natural target cd4 t - cell population, to characterize realistically the intricacies involved in the interplay between the integrated provirus, cellular transcription factors, and the viral transactivating protein tax (rahman., unpublished data). to investigate the comparative activation / repression of cellular transcription factors between stably integrated and transiently transfected htlv-1 ltr in at least one native target cell phenotype, both in the absence and presence of tax, a high - throughput analysis of such factors was performed using protein - dna array technology. many substrates and factors associated with the two major chromatin - remodeling complexes, swi / snf and hats, were activated in the stably integrated clones following transfection with tax. to explore the observed heightened activation of factors necessary for chromatin remodeling complexes, we explored the upstream mirna regulatory pathway by the microarray approach. a global downregulation in the expression of cellular mirnas in the htlv-1 ltr - luc stably integrated cd4 t - cell clone was observed in the presence of tax, implying the ability of tax to modulate the cellular mirna machinery. when compared to results presented with the transcription factor array, many of the downregulated mirnas were found to target the mrna coding for the p / caf and p300 hat family members, suggesting a role for tax in downregulating the expression of cellular mirnas that are in turn involved in suppressing the expression of transcription factors involved in chromatin remodeling. the results demonstrate that tax can modulate the cellular mirna machinery and downregulate the expression of mirnas identified to be involved in regulating the translation of chromatin - remodeling hat factors (rahman., unpublished data). given the rising importance of sirna - mediated modulation of gene expression in a viral infection context, it would be interesting to explore how htlv-1 alters the sirna / mirna in its primary target cell. small noncoding rna species make up the bulk of cellular rna, and their regulatory potential is increasingly being recognized as significant and proportional to their presence in the cell. their regulatory potential encompasses chromatin reorganization and the following section of the review focuses on giving a brief description of various noncoding small rna molecules and their possible involvement in transcriptional modulation through chromatin. small noncoding rna species are rapidly being recognized as a significant influence on gene expression and functioning of cells. rna silencing pathways have been traditionally classified based on the mechanism of action, intracellular location, and the class of rna molecule involved. there are similarities in the organization of some of the components in these pathways, and an inevitable intersection exists between them in some instances. three major classes of rna have been annotated to be involved in modulating cellular gene expression namely, small interfering rna (sirna), micro - rna (mirna), and piwi - associated rna (pirna). while sirna and pirna have an equally potential role in posttranscriptional as well as transcriptional gene repression, mirna was until recently predominantly descried for its cytoplasmic role of mrna suppression. from current studies, a transcriptional chromatin - modulating role for mirna is emerging and gaining importance especially in the context of a viral infection. small interfering rnas are ~21 nt single - stranded rna molecules cleaved out of larger dsrna that can either be of endogenous or exogenous origin. sirna identify their target through complete and perfect sequence complementarity and silence target mrnas through complementary binding. some organisms have developed mechanisms to amplify their sirna after target recognition through the expression of an rna dependent rna polymerase (rdrp). the rdrp enzyme either by itself produces new single stranded sirna or amplifies ssrna into dsrna that is then cleaved by dicer to generate mature sirna. mirnas are ~1924 nt short non - coding rna that modulate ~60% of all human protein coding cellular genes, successfully modifying the outcome of various microbial infections and disease states. typical mirna biogenesis is initiated with the rna pol ii mediated transcription of long primary mirna (pri - mirna) that contain one or more ~80 nt hairpin (stem - loop) structures. the pri - mirna is processed by an rnase iii enzyme drosha, which, along with its coeffector dgcr8, recognizes and cleaves ~22 bp down the stem yielding a precursor mirna (pre - mirna) approximately 60 nt in length comprising 2-nt 3 overhangs. the pre - mirna is transported into the cytoplasm aided by exportin 5 through the nuclear pore complex. a second rnase iii enzyme dicer in association with tar rna binding protein (trbp) cleaves the terminal loop structure of the pre - mirna, generating a ~22-bp duplex [97, 98 ]. one of the strands of the duplex associates with an rna - induced silencing complex (risc) functioning as a guide to the target mrna seed sequence, while the other passenger strand gets degraded. the risc complex is composed of the argonaute family of proteins (ago), some of which have endonuclease activity and enzymatically cleave the target mrna. in addition, ago proteins guide the complex to the target site and also aid in the degradation of the passenger strand. the following section deals with the involvement of these small non - coding rna in tgs through reorganization of nuclear chromatin. the term refers to the effective shifting of nucleosome core along the length of the dna molecule. this shift in many cases results in the physical disassembly and reassembly of the nucleosome core and requires the involvement of atpase containing complexes. the four known atpase complexes associated with chromatin remodeling are swi2/snf2 (mammalian brm (snf2) and brg1 (snf2)), iswi (imitation switch), mi-2 (chd1), and ino80. during processes such as dna replication and transcription, the state of chromatin organization and the positioning pattern of associated histone proteins are critical rate determining factors. a large number of histone - modifying enzymes and factors get associated with histones and alter their state to affect winding and unwinding of chromatin dna as required by the specific cell. heterochromatin reorganization by mirna is a mechanism that has been generally described to be a result of association of sirna / mirna with the rna - induced initiation of silencing complex, which was first described by verdel. in 2004. rits is a multiprotein complex consisting of components that aid binding with rna and chromatin simultaneously. it has a chromodomain protein, chp1, that is known to interact with centromeres of chromosomes and an argonaute family protein, ago1, with endonuclease activity that can bind small rna. in addition, a recently identified tas3 protein is present in the rits complex that is yet to be functionally characterized. sequences homologous to the dg and dh region of centromeres were found on sirna copurified with rits complexes, indicating plausible complementary base pairing of rits - associated sirna with centromeric regions of the chromosome. also, all three proteins of the complex are essential requirements for h3k9 methylation as well as centromeric chromatin - binding swi6p protein known to cause heterochromatic gene silencing. it has also been proposed that an alternate mode of interaction could be between rits - associated sirna and nascent immature mrna transcribed from the h3k9 centromeric chromatin region. an interesting outcome associated with this phenomenon is that it serves as a self - amplifying mechanism for sirna. the inhibition of mrna from maturing and its subsequent degradation could be the source of new sirna with a sequence complementary to that of the h3k9 region of the centromere, thus augmenting gene silencing. although sirnas with sequences homologous to ltr regions have not been clearly identified, rits - complex - associated silencing of ltr - associated genes can not be ruled out. one reason being that ltr - associated gene silencing requires the presence of ago1 that is generally found in affiliation with other small rna processing protein complexes namely, risc and rits. also, the relative abundance of sirna directed against ltr regions might be lower and less obviously discernable compared to dg and dh regions of centromeres. since virally encoded proteins directly and indirectly get associated with various stages of the rnai biogenesis and functioning pathways, it is reasonable to speculate that viral proteins might influence heterochromatin modeling and expression states. a number of interactive stages and mechanisms have been described and proposed to elucidate the interplay between viruses and sirna pathways. besides cellular mirnas, viruses also encode their own species of mirna that modulate cellular processes favoring efficient viral proliferation and persistence. herpesviruses were among the first to be shown to express mirnas which play significant roles in pathogenesis of the virus. for instance, hsv2 expresses mir1 that is a key modulator of icp34.5 expression and hence progression of neuroinflammatory disease. the idea of retroviruses coding for mirna is in a way counterintuitive in that a cytoplasmic replication will likely yield mirna precursors that would not be available for processing by the nuclear drosha complex. nonetheless, many recent studies revealed retroviral - derived mirna in the context of hiv-1 infection. identified several mirna originating from the nef region that affected transcription from the viral hiv-1 ltr promoter. more recently, it was found that the hiv-1 tar element is processed by dicer to yield viral mirna that could be detected in infected cells and apparently contribute to latency. htlv-1-encoded mirna has been relatively less explored, and there is currently no evidence of the virus expressing any mirna. li., in 2008, performed an extensive computational sequence analysis to identify stem - loop structures resembling those harbored by pri - mirna and pre - mirna that could possibly be cleaved to generate micrornas. ten such sequences were identified and when aligned with the htlv-1 genome, it was predicted that two mirnas could be produced from the plus strand transcript and 4 from the minus strand. upon further bioinformatics - aided searches of all the sequence reads against the htlv-1 genome, both sequences mapped to transcribed regions on the plus strand. more extensive studies will be required to investigate if the htlv-1 genome can act as a source of mirna. viruses have been known to exploit cellular mirnas to induce cell proliferation, suppress apoptosis, influence metabolic pathways, and finally bring about cellular transformation. increased expression of several oncogenic mirna in response to retroviral infection has been previously documented [112114 ]. there are several instances where viral proteins actively interact with rna and alter their functioning in infected cells. the nonstructural (ns-1) protein of human influenza a virus has an rna - binding domain that can associate with a number of rna species causing rna silencing suppressor activity [115, 116 ]. ns1 localizes both in the cytoplasm and the nucleus where it sequesters immature and mature forms of small interfering rna, this activity is more evident in plants and needs to be elucidated further in mammals. the hcv core protein predominantly localizes in the cytoplasm and interacts with dicer through its n - terminal, lowering its mirna processing efficiency. in addition, the hcv envelop protein e2 interacts with argonaute 2 (ago2) inactivating it. ago2 is part of the protein complex essential for generation of mature and active mirna particles. the ebola virus non - structural protein vp35 consists of a dsrna - binding domain similar to the ns1 of influenza a. it is generally found in cytoplasmic inclusion bodies and is proposed to sequester sirna / mirna preventing them from getting loaded on to risc complexes, thus preventing them from directing mrna silencing. adenoviruses use their dsdna genome to encode two non - coding rna molecules apart from viral proteins transcribed by rna polymerase iii. these va1 rna transcripts are produced at high levels in the nucleus of infected cells, saturating the exportin 5 nuclear transport machinery. this in turn prevents precursor mirna from being exported to the cytoplasm and mature into functional mirna. primate foamy virus (pfv) primarily encodes a nuclear transactivator of transcription protein tas that through a yet unknown mechanism suppresses the effector function of mirna. tat protein functions as a transactivator of transcription and is essential for viral replication and is also indicated in suppressing the rnai pathway. while htlv-1 tax protein, which is also a transactivator has not yet been shown to exhibit the similar function. tat directly interacts with the helicase domain of dicer and inactivates it, preventing cytoplasmic processing of mirna [16, 48 ]. however, it is still not clear how the predominantly nuclear protein tat interacts with the mostly cytoplasmic dicer. one explanation could be that small levels of tat could still remain cytoplasmic and interact with the rnai pathway. also, recently small levels of dicer have been shown to be present in the nucleus where it also participates in processing mirna and sirna in association with rna - dependent rna polymerase (rdrp) (figure 2). the dicer processed tar - derived mirna of hiv-1 has been known to suppress rnai through sequestration of treb a dicer cofactor. a similar possibility can be attributed to the tax protein of htlv-1, which is also mostly nuclear but could still interfere with the cytoplasmic phase of mirna processing. there have been independent studies linking the differential expression of mirna profiles in htlv-1-infected t cells with the progression to atl. pichler. (2008) performed rt pcr analysis on htlv-1 transformed cell lines to determine differential expression in cd4 t cells and treg cells. seven mirnas that had been previously shown to be associated with oncogenic transformation, mir-21, mir-24, mir-146a, mir-155, mir-191, mir-214, and mir-223 were considered, for this study as they are specific to treg cells. results demonstrated that mir-21, mir-24, mir-146a, and mir-155 were significantly upregulated in the htlv-1-transformed cell lines, while mir-223 was downregulated. the mirna profiling of pbmcs from acute atl samples and htlv-1 transformed cell lines revealed 6 mirnas that were upregulated in both the atl samples and the transformed cell line (i.e., mir-18a, 9, 17 - 3p, 130b, 20b, and 93), while 9 mirnas were downregulated (i.e., mir-1, 130a, 199a, 126, 144, 335, 337, 338, and 432). further mirna - profiling studies were performed on atl cells versus control pbmcs and cd4 t cells. several mirnas, namely, mir-150, mir-155, mir-223, mir-142 - 3p, and mir142 - 5p were upregulated and mir-181a, mir-132, mir-125a, and mir-146b were downregulated. mirna 27-a controls the f - box protein fbw7/hcdc4-dependent cyclin e degradation by modulating ubiquitylation and turnover of cyclin e during specific stages of the cell cycle progression. not surprisingly, results from the above studies taken together indicate a highly variant mirna profile owing to the cell type specificity of the virus and probably also to the differential expression of mirna - associated cellular proteins. cell longevity in htlv-1 infection is mediated by tax through two major cell - signaling pathways. in the first, the protein directly binds pi3k and promotes phosphorylation of akt, which is a serine / threonine kinase that is involved in maintaining cell proliferation and survival through a series of downstream signaling events involving activating protein 1 (ap-1) that is upregulated in atl cells as well as a large number of other cancer types. the second pathway involves binding of tax to ikk in the cytoplasm that triggers phosphorylation of ikk and ikk and a complex formation between the 3 ikk components. free nfb then migrates to the nucleus, activating the transcription of genes associated with the nfb responsive elements. a number of nfb target genes are known to enhance cell growth and proliferation and implicated in cancer development. in spite of the fact that tax is required for cell transformation and development of atl, it is interesting to note that more than 50% of atls do not show tax transcripts. in fact cells tend to evolve and accumulate mutations in tax that silence its activity. it is believed that the presence of tax is needed for the emergence of atl, but not for its maintenance. since the oncoprotein is a major target of t lymphocytes, silencing it is a mechanism to subvert immune detection and clearance. it is quite possible that the maintenance of an active leukemic cell state is mediated through mirna that are known to be significantly differentially regulated in atl cells. expression profile studies suggest that many of these mirnas are associated with tax levels in early atl developmental stages. chromatin reorganization as previously mentioned is influenced by mirna and hence the rate of active viral transcription and maintenance of productive / latent viral state could be affected by the mirna profile of the infected cell. cell cycle progression is tightly regulated by the interaction between cyclins and cyclin - dependent kinases (cdks). this interaction results in the selective phosphorylation of target proteins involved in regulatory stages of the cell cycle. tax - expressing cells seem to show disruptions in cyclin - cdk complex formation. in general, there appears to be a stronger progression of htlv-1-infected cells through the g1 phase into the s phase. this can be correlated with the upregulation of cyclins d2 and e and the corresponding increase in d2 binding cdk partners, cdk4/6 and cdk2 following tax expression in these cells. interestingly, tax directly binds to cyclin d3, d4, and cdk4 and apparently increases stability of cyclin d / cdk4 complex formation. tax has been reported to activate expression of cdk2 and cdk4 in infected cells and downregulate expression of cdk inhibitors like p18 and p19. the protein also causes repression of cylin a, which is required for cells to exit mitosis after one round of chromosome replication thus promoting enhanced dna replication. an important phosphorylation target of the cyclin - cdk complexes is the retinoblastoma protein (rb) that binds transcription factor e2f in a dephosphorylated state. when phosphorylated by cyclin - cdk complexes, it releases e2f that allows transcription of genes required for the progression from the s to g2 phase. tax disrupts the formation of rb - e2f complexes by physically degrading dephosphorylated rb, promoting its phosphorylation and release of e2f, thus pushing the cell into s phase [132134 ]. there is a close association between mirna expression and alteration in the cell cycle progression. compelling evidence also points at a markedly altered mirna expression profile in htlv-1-infected, atl, and noninfected cells suggesting a probable association between tax - induced mirna expression and rate of cell cycle progression. chromosomal abnormalities associated with tax - expressing htlv-1 infection range from deletions, duplications, translocations, and chromosomal rearrangements to aneuploidy [69, 135140 ]. although tax has not been directly implicated in dna damage [14, 141 ], it has been suggested to indirectly promote dna aberrations through prevention of dna repair mechanisms that would result in accumulation of mutations. like most multistage carcinogenic events, a systematic eight - step genetic event sequence has been described by okamoto. (1989) detailing the progression of an htlv-1-infected cell into a state of cancer. suppression of antiapoptotic and antitumorigenic factors has been extensively associated with tax expression in htlv-1-infected cells. a downregulation of tumor suppressor gene p53 has been observed in 40% of atl patients [144, 145 ]. changes in expression levels of other tumor suppression factors like p15, p16, and rb cell cycle regulators have also been observed in a number of atl cases [146148 ]. this indicates a strong relationship between suppression of dna damage repair mechanisms by tax and transformation of infected cells into leukemia. some of this suppressive activity could probably be in association with the sirna pathway that also interacts with chromosomes preventing dna damage repair. eukaryotic histone proteins assemble across the entire length of dna closely associating with it and packaging it into nucleosomal structures within the nucleus. acetylation, ubiquitylation, methylation, phosphorylation, and sumoylation) in order to assist in processes such as dna transcription, replication, and repair. tax is known to interact with camp response - element - binding protein (creb) at the enhancer region of viral camp response element (cre) that promotes recruitment of coactivators cbp (creb binding protein) and p300. in vitro studies chip analysis of the integrated htlv-1 proviral site in infected slb1 t cells revealed the recruitment of a number of factors namely, creb, creb-2, atf-1, atf-2, c - fos, c - jun, p300, p / caf, cbp, and tax at the promoter region. the authors also observed histone h3 and h4 acetylation within the proviral genome of these cells. interestingly, histone deacetylases (hdacs) were also found to localize at the promoter region and inhibition of the hdacs with specific antagonists - enhanced acetylation states of h4 and an increase in htlv-1 rna transcription (see figure 3). (2004) showed that the hdac-1 directly associated with the inactive tax and not with its transactivated form. biotinylated chromatin pull down assays revealed that tax promoted dissociation of hdac-1 with the promoter region of htlv-1 suggesting modulation of hdac recruitment by tax as a means of transcriptional regulation. tax promotes its own transactivation by associating with brig1 components of the atp - dependent swi / snf chromatin remodeling complex downstream of pol ii. tax, therefore, appears to modulate the transcriptional state of chromatin by strongly associating with histone modifying proteins that effect alterations between euchromatin and heterochromatin during an htlv-1 infection both in vivo and in vitro. in addition to the oncoprotein, other htlv-1 associated proteins can also be associated with the mirna pathway and contribute to chromatin remodeling. animal studies with mutated forms of accessory genes like p12, p30, rex, p13, and htlv-1 basic leucine zipper factor (hbz) using htlv-1 infectious clones revealed that these proteins are required to establish in vivo latency [152155 ]. rex protein appears to interact with dicer preventing it from cleaving sirnafrom shrna and thus acting as a suppressor of rna silencing. although there is a certain degree of sequence similarity between rex and tax proteins, it is not very clear if this confers a similar interaction property with host cellular proteins, like those involved in mirna processing [156, 157 ]. the p30 accessory protein can physically bind tax and rex mrnas and retain both transcripts in the nucleus, preventing their translation in the cytoplasm. this in turn may influence the rate at which viral transcription occurs and could cause a switch from active to dormant states of viral replication. in addition, p30 also interacts with creb - binding protein (cbp) and p300, altering rate of transcription of the long terminal repeat region of htlv-1 as well as cbp and p300-dependent cellular genes. mirna - mediated transcriptional gene silencing is rapidly gaining significance as one of the major modes of chromatin remodeling and alteration of the rate of gene expression in cells. from past and current literature, it is evident that viruses and their proteins actively and effectively utilize the mirna machinery to alter cellular and viral gene expression, ultimately influencing the progression of disease. chronic viruses that integrate their genome into that of the hosts ' exploit small rna pathways for establishing latency or increasing the rate of viral protein expression to ultimately transform cells and maximize survival. although protein families involved in sirna - mediated epigenetic silencing pathways are relatively conserved between species and cell types, there exists a noticeable alteration in the level of these proteins. also, the presence of alternate stages in pathways like rdrp - dependent sirna amplification in saccharomyces cerevisiae and alternate small rna species like piwi - associated rna being predominantly active in some cell types like germline cells needs to be taken into account. as discussed in the paper, a huge variation exists in mirna expression profiles of not only different stages of viral infection but also different cell types. the differential progression of viral infection in primary and nonprimary target cells has always been an intriguing aspect of htlv-1 infection studies. the refractile nature of some cell types in contrast to the ability of others to support viral transcription has been attributed among other factors to the difference in mirna processing proteins that make certain cell types less supportive of mirna expression and hence of chromatin manipulation through the sirna / mirna - mediated pathways. figure 4 represents a schematic outline of inherent differences in mirna expression in primary and secondary target cells of htlv-1 that could contribute to differing outcomes in both. deciphering factors that dictate this cell type preference and specificity can go a long way in the advancement of htlv-1 research and pave the way for developing novel and more effective therapeutic strategies. | cell type specificity of human t cell leukemia virus 1 has been proposed as a possible reason for differential viral outcome in primary target cells versus secondary. through chromatin remodeling, the htlv-1 transactivator protein tax interacts with cellular factors at the chromosomally integrated viral promoter to activate downstream genes and control viral transcription. rna interference is the host innate defense mechanism mediated by short rna species (sirna or mirna) that regulate gene expression. there exists a close collaborative functioning of cellular transcription factors with mirna in order to regulate the expression of a number of eukaryotic genes including those involved in suppression of cell growth, induction of apoptosis, as well as repressing viral replication and propagation. in addition, it has been suggested that retroviral latency is influenced by chromatin alterations brought about by mirna. since tax requires the assembly of transcriptional cofactors to carry out viral gene expression, there might be a close association between mirna influencing chromatin alterations and tax - mediated ltr activation. herein we explore the possible interplay between htlv-1 infection and mirna pathways resulting in chromatin reorganization as one of the mechanisms determining htlv-1 cell specificity and viral fate in different cell types. |
congenital heart disease (chd) is a common congenital malformation found in children, with an incidence of 0.6%0.8% in living infants, among which atrial septal defects (asds) are the most common types, demonstrated by its occurrence of 1/1500 in newborns, contributing to 7%10% of chd reported in children. ostium secundum (os) asd composes 70% of all asds, for which the only treatment is surgery. in 1976, king. the development of occluder and improvement of procedure techniques, especially the clinical application of amplatzer atrial septal occluder (aso) since 1997, closure procedures of os asd has been widely applied in clinical practice, featured with advantages of satisfying efficacy, little trauma, quick recovery after surgery, as well as few complications. however, there have been occasional reports of procedure complications due to inappropriate inclusion of cases, unqualified techniques of operators or lack of experience. arrhythmia is one the most common complications after surgery, which could severely affect the prognosis of children with asd. the size of asd, the diameter of aso as well as the ratio of aso versus atrial septal length (asl) are to some extent associated with the incidence of arrhythmia after closure procedure, although no literature regarding the value of the ratio of aso versus asl for predicting arrhythmia occurrence after closure procedure have been published till now. therefore, the present study aimed to analyze the value of the ratio of aso versus asl for predicting arrhythmia occurrence after the closure procedure of asd, which would provide important reference for the closure procedure of asd in future. six hundred and fifty - one children diagnosed with os asd in department of pediatric cardiology, beijing anzhen hospital between january 2003 and december 2013 were enrolled, among which 261 patients were male (40.1%), 390 were female (59.9%), aged between 1 and 18 years old with mean age of 6.9 4.1 years old. subjects were divided into the case group (presence of arrhythmia after the occlusion) and the control group (no reports of arrhythmia after the occlusion) according to the occurrence of arrhythmia after occlusion procedures, among which 7 cases were defined as the case group (3 males, 4 females, mean age 6.2 4.2 years old), with different types of arrhythmia listed in table 1. there were 644 patients in the control group, among which 258 were males, 386 females, with a mean age of 7.8 4.3 years old. patient 's characteristics and arrhythmia after the procedure asd : atrial septal defect ; aso : atrial septal occlude ; asl : atrial septal length ; av : atrial ventricular ; ecg : electrocardiograph ; iv : intravenous. all patients completed routine examinations such as complete blood counts, blood biochemistry, coagulation time, blood gas analysis, hepatic and renal function, a 12-lead electrocardiograph (ecg), chest x - ray, color doppler echocardiography (the size of asd and asl was measured during the examination) after hospitalization. great artery short axis view, apical four - chamber view, parasternal four chamber view, and subcostal biatrial view were used in measuring the size of the defect. all patients were invited for detailed talk regarding the process, possible risks, complications of the closure procedure, and written informed consent was obtained from all patients or the family members. all patients underwent routine right - heart catheterization via femoral vein approach and appropriate size of the aso for device closure of asd was selected under the guidance of transthoracic echocardiography (tte) and x - ray. the size of the occluder is normally larger than the value detected by tte by 12 mm, approximately equivalent to the longest diameter of asd visible in multiple sections of tte, although in the case of lack of interatrial septal rims in the root of aorta, an occluder with a diameter of more than 46 mm was also plausible. closure procedures were as follows : catheter was first introduced via right femoral vein, and the guidewire was positioned into the upper left pulmonary vein through the sheath. the long sheath was then delivered into the upper left pulmonary vein or left atrium along the guidewire. asd closure occluder was placed in the long sheath and was subsequently positioned in the appropriate place under the continuous monitoring of tte and x - ray. left to right shunt of asd disappeared, function of mitral valve, tricuspid valve, and aortic valve were normal, with normal blood flow from the coronary sinus and pulmonary veins. the occluder device was then released, with the sheath removed and pressure bandaging applied. tte and ecg were reexamined at 3 days, 1, 3, and 6 months after the closure procedure. the follow - up period for the whole group of patients was 12.4 3.3 months. student 's t - test was used for comparing the mean values of different groups. binary logistic regression analysis was used to evaluate the relevance of different factors to the occurrence of postoperative arrhythmia. the dependent variable was the occurrence of postoperative arrhythmia, and the covariates included sex, age, weight, height, the size of asd, the diameter of aso, asl, the ratio of aso versus asd, and the ratio of aso versus asl. the receiver - operating characteristic (roc) analysis was performed to evaluate the value of the ratio of aso versus asl in predicting arrhythmia occurrence after closure procedures in children with os asd. auc at 0.50.7 suggested a low predictive value, 0.70.9 an intermediate predictive value, more than 0.9 a high predictive value. p value at 0.5 not included in the 95% confidence interval (ci) of curve area or p 0.05). in addition, no difference of sexuality, height, weight was found between the case group and the control group (p > 0.05). binary logistic regression analysis was performed to define the relevance of different factors to the occurrence of postoperative arrhythmia, including gender, age, weight, height, the size of asd, the diameter of aso, asl, the ratio of aso versus asd, and the ratio of aso versus asl. according to the results, among all the factors, the ratio of aso versus asl was the relevant factor to predict arrhythmia occurrence with statistically significance and introduced into the equation, which indicated that the ratio of aso / asl was an influence factor to the occurrence of postoperative arrhythmia. while other covariates were not introduced in the equation as p > 0.05. receiver - operating characteristic analysis was performed to evaluate the value of the ratio of the aso versus asl in the prediction of arrhythmia occurrence after closure procedures. as shown in the result of roc curve, a cut - off value of 0.576 in the ratio of aso versus asl provided a sensitivity of 87.5% and a specificity of 76.2%, demonstrating the good predictive effects for arrhythmia [figure 1 ]. and the auc was 0.791 (95% ci : 0.6550.926, p < 0.05), suggesting that the ratio of aso versus asl had an intermediate predictive value in the prediction of arrhythmia occurrence after closure procedures. receiver - operating characteristic curve of value of the ratio of atrial septal occluder (aso) versus atrial septal length (asl) for predicting arrhythmia occurrence after occlusion procedures in children with ostium secundum atrial septal defect. the longitudinal axis represented the sensitivity of different ratio of aso versus asl for the prediction. the 45 green line of this graph stood for reference line, representing the sensitivity being equal to false positive rate. the blue curve was farther from the reference line and nearer the upper left corner of the graph. area under the curve was 0.791 (95% confidence interval 0.6550.926, p = 0.01). atrial septal defect is one of the most common types of chd, and is often treated with surgeries or device closure procedures. compared with surgery closures, device closures demonstrate advantages of little trauma, quick recovery after the procedures as well as less complications. nevertheless, under the situation of inappropriate case inclusion, poor standards of operation, or lack of therapy experience, few complications after device closure procedures might occur, among which arrhythmia is often reported. by far, there have been a few literature reporting the arrhythmia after transcatheter closure procedures in patients with asd. the common types of arrhythmia reported include sinus bradycardia, supraventricular tachycardia, atrial premature beats, atrial ventricular (av) block, and atrial fibrillation. in 2014, komar. conducted a study in 235 asd patients underwent device closure procedures and found that after the device closure procedure, 8 patients (3.4%) had supraventricular tachycardia, 3 patients (1.3%) had bradycardia. in 2013, chantepie. reported a complete av block after the device closure procedure in a 13-year - old patient with asd. knepp. reported in 2010 that in the follow - up study of 94 patients with asd, who underwent asd device closure procedures, 7 patients had onsets of arrhythmia such as supraventricular tachycardia, atrial fibrillation, and ventricular premature beats. moreover, another 23 cases of asd patients with device closure procedures demonstrated that after the procedure, 5 patients had atrial rhythm, 2 patients had atrial premature beats, 1 patient had ventricular premature beats, as reported in 2003 by hessling. a few studies have discussed the causes of arrhythmia after transcatheter closure procedures in patients with asd. in 2014, wang. discovered that risk factors for av block after device closure procedures in children with asd included small age, long diameter of asd as well as long diameter of aso, in addition to d0/ds 0.45. furthermore, komar. published in 2014 that long diameter of occluder and prolonged procedure duration were risk factors for increased incidence of supraventricular arrhythmia after occlusion procedures. in addition, chantepie. discovered in 2013 that placement of large occlusion device in young children was a risk factor for arrhythmia after occlusion procedures. the predisposing factors of arrhythmia after asd closure procedures might be associated with anatomic structures. asd and koch triangle are closely positioned anatomically, while av node is in the endocardium in front of koch triangle, thus the av node might be damaged during the closure procedure or be compromised mechanically by the occluder device. hill. reported asd closure procedure as a predisposing factor for supraventricular ectopic rhythm, in addition to av conduction abnormality, the possible mechanisms of which might involve that occluder disc posed a pressure on av node, resulting in the friction and temporary swelling of av node and the surrounding tissues, which subsequently led to av node dysfunction or decrease in function. to a certain degree, the diameter of aso is decided by the size of asd. and if the ratio of aso versus asl increases, the rim of occluder, especially the inferior rim, might have a higher potential risk in contacting the koch triangle, which might subsequently increase friction between occluder and av node as well as tissues surrounded, resulting in tissue swelling, av node functional disorders, and eventually arrhythmia. the present study demonstrated that among the 651 asd patients underwent device closure procedures, 7 patients had different degrees of arrhythmia, with an incidence of 1.1%. types of arrhythmia include sinus bradycardia, atrial premature beats, bundle block, and different degrees of av block. with active therapies of corticoids, myocardium nutrition, and surgeries, ecg of roc analysis was used to assess the ratio of aso versus asl in predicting arrhythmia occurrence after closure procedures in children with os asd. results suggested that the ratio of aso versus asl showed an intermediate value in predicting arrhythmia occurrence after closure procedures. observed that with the use of amplatzer asd occluder, there were different degrees of av block 17 days after closure, composing an incidence of 6.1%. however, almost all patients with av block after closure had a complete recovery 16 months after the closure. according to the result of our analysis, it is essential that an occluder with the appropriate size is positioned, especially for younger patients, because of their asl is not as long as the teenager of adult patients. and the placement of occluders during the closure procedure have to be gentle, since some inappropriate operation could cause mechanical stretch stimulus or friction to the sinus node and av node, thus triggers the arrhythmia during and after the closure procedure. however, in 2013, al akhfash. reported a case of 7 years old asd patient who underwent device closure procedures and developed second - degree av block immediately after the procedure. ecg with sinus rhythm was obtained 7 days after the closure. in our study, ecg with sinus rhythm was recovered in all arrhythmia patients with active therapies of medications or surgeries, suggesting that early and active therapy intervention is essential for the prognosis of arrhythmia after asd device closure. in conclusion, our study suggested that closure procedures demonstrated good efficiency and safety in patients diagnosed with os asd, with low incidence of arrhythmia. however, patients with ratio of aso versus asl larger than 0.576 might have a higher potential risk of arrhythmia during and after the procedure, but with careful monitoring, timely check - up of ecg, immediate and appropriate treatment, most patients could possess a good prognosis. meanwhile, we found that the ratio of aso versus asl exhibited an intermediate value in predicting arrhythmia occurrence after occlusion procedures. since only 7 of 651 cases had postoperative arrhythmia in our study, with limited number of cases in the case group as well as single - center research, thus a large - sample, multi - center clinical study would facilitate better predictive values. | background : transcatheter occlusion has been applied to treat ostium secundum atrial septal defect (os asd) since 1997. during the clinical practice, several postoperative complications including arrhythmia have been reported. this study aimed to evaluate the value of the ratio of atrial septal occluder (aso) versus atrial septal length (asl) for predicting arrhythmia occurrence after transcatheter closure in children with os asd.methods:six hundred and fifty - one children diagnosed with os asd underwent occlusion procedures after completing routine examinations. the onsets and types of arrhythmia both during and after the occlusion procedures were monitored. treatments were given based on the individual types of arrhythmia. the binary logistic regression analysis and receiver - operating characteristic (roc) curve were used in the analysis of value of the ratio of aso / asl for predicting postoperative arrhythmia occurrence.results:transcather occlusions were conducted in 651 children, among whom 7 children had different types and degrees of arrhythmia, with an incidence of 1.1%. the types of arrhythmia included sinus bradycardia, atrial premature beats, bundle branch block, and different degrees of atrioventricular block. normal electrocardiograph findings were resumed in these 7 patients following active therapies such as corticoids, nutrition, and surgeries. the binary logistic regression and roc analysis suggested that the ratio of aso / asl exhibited an intermediate predictive value for predicting arrhythmia occurrence after occlusion procedures. a cut - off value of 0.576 in the ratio provided a sensitivity of 87.5% and a specificity of 76.2% with an area under the roc curve of 0.791 (95% confidence intervals, 0.6550.926 ; p < 0.05) in predicting arrhythmia occurrence after the closure procedures.conclusions:the ratio of aso / asl might be a useful index for predicting arrhythmia occurrence after closure procedures in children with os asd. |
all consecutive patients with clinical diagnosis of bacterial keratitis from january 1, 2001 through december 31, 2004 at the beijing tong ren eye center were included. the initial corneal smears, cultures, and identification with a routine technique were investigated for all patients. the specimens were sent to the department of ocular microbiology in beijing institute of ophthalmology. corneal scrapings were obtained with a platinum spatula, and then inoculated on blood agar plate at 3537 c for 2472 hrs. bouillon culture - medium was used for special specimens when the quantity of specimens was small before being cultured. initial identification was made according to the characteristics of growing colonies on blood - agar plate and gram - staining. final identification was based on bio - merieux tests with identification medium and biochemical event. antibiotic susceptibility was determined with the kirby - bauer disc diffusion method and interpreted according to clinical and laboratory standards institute. statistical calculation was performed with the spss 11.5 statistical software package (spss inc., during the four - year period from 2001 to 2004, 1985 patients were included. bacterial cultures were positive in 279 patients (14.06%), 151 (54.12%) in male and 128 (46.88%) in female, with a mean age of 45.20 years (range 196). all patients were divided into three age - groups as followed : 14 in the child group (014 yeas old), 193 in the adult group (1559 years old), and 72 in the elderly group (60 years old). among the positive cultures, the number of gram - positive cocci was 119 (42.65%), and staphylococcus epdiermidis. the number of gram - positive bacilli isolates accounted for 58 (20.79%), within which corynebacterium sp. the ratio of gram - positive to gram - negative was 1.74:1 (63.44% : 36.56%). table 1 listed the distribution of isolated organisms in positive culture of isolates. in the adult group, staphylococcus sp., the number of streptococcus sp. in the elderly group was significantly higher than that in the adult group (p 0.05). gram - negative bacilli showed higher resistance to ciprofloxacin than to other three antibiotics (p 0.05). gram - negative bacilli showed higher resistance to ciprofloxacin than to other three antibiotics (p < 0.01). streptococcus sp. had higher resistance to tobramycin (p < 0.01) (table 4). the resistance to ciprofloxacin, levofloxacin, and tobramycin in the elderly group was higher than that in the adult group (p < 0.05). the child group was not compared with other groups as a result of the small number of isolates identified. bacterial keratitis is a devastating ophthalmologic emergency and is the most common reason leading to corneal blindness in developing countries. it is very important for clinical diagnosis and treatment to study the characteristic of distribution and resistance of bacterial isolates. sun and colleagues (2004) reported the distribution and shifting trends of bacterial keratitis (19891998) and presented 22.1% positive culture rate and the trend of increase in gram - positive bacterium (51.0%, of the total positive culture) with the decrease in gram - negative bacterium (39.4%, of the total positive culture). alexandrakis and colleagues (2000) studied the corneal specimens from 1990 to 1998 and reported 50% positive culture rate and the trend of increase in gram - positive keratitis isolates (48.0%, of the total positive culture) with a corresponding decrease in gram - negative organisms (50%, of the total positive culture), and the percentage of pseudomonas sp. the rate of positive culture was 14.15%, with gram - positive cocci 42.65%, gram - negative bacilli 35.12%, and gram - positive bacilli 20.79%. compared with our previous study (sun 2004), gram - negative bacilli and gram - positive cocci were still the main organisms in bacterial keratitis and pseudomonas sp. butler and colleagues (2005) retrospectively analyzed four - year data on bacterial keratitis in older patients. they found that gram - positive cocci was 75.9% and gram - negative bacilli was 25.9%. in this study, the percentage of gram - positive cocci in older patients (48.6%) was slightly higher than that in adult patients (40.4%). was obviously higher than that in adult patients (5.7%). with the extensive application of broad - spectrum antibiotics, sun and colleagues (2003) reported that during 1999 to 2000, the percentage of resistance to ofloxacin, ciprofloxacin, and norfloxacin was 28.5%, 25.9%, and 34.9%, respectively. alexandrakis and colleagues (2000) demonstrated that there was a trend of gradual increase in the resistance for staphylococcus aureus from 1990 to 1998. the resistance to quinolone and aminoglycosides for staphylococcus aureus was 15% and 11%, respectively. goldstein and colleagues (1999) studied the resistance of 1053 bacterial keratitis isolates in vitro from 1993 to 1997 and found that the resistance to ciprofloxacin and ofloxacin was 16.9% and 14.3%, respectively. the previous study in china showed that the percentage of resistance to ofloxacin, ciprofloxacin, levofloxacin, and tobramycin was 23.6%, 35.7%, 4.1%, and 26.0% in 1999. this study showed that the total resistance to ofloxacin (20.8%), ciprofloxacin (35.9%), and tobramycin (29.4%) was similar to the previous studies. but the resistance to levofloxacin (15.5%) of bacterial keratitis isolates has gradually increased. and the resistance of gram - positive cocci to antibiotics was much higher than that of gram - negative bacilli. the resistance to ciprofloxacin, levofloxacin, and tobramycin in older patients was much higher than that in adult patients. the older patients was lower than that in adults, while the percentage of streptococcus sp. | objectiveto study on the distribution of bacterial keratitis isolates and the resistance to antibiotics in china from 2001 to 2004.methods1985 specimens from the bacterial keratitis at the beijing tong ren eye center were cultured and identified. in vitro susceptibility testing of positive isolates to antibiotics was determined by the kirby - bauer disk diffusion method and interpreted according to clinical and laboratory standards institute.resultsout of 1985 specimens, 279 were culture positive. the percentage of positive culture was 14.06%. gram - positive cocci and gram - negative bacilli represented 42.65% (119/270) and 35.13% (98/279) respectively. pseudomonas sp. was the most common organism (20.07%), followed by corynebacterium sp.(16.85%) and staphylococcus epidermidis (13.98%). resistance to ofloxacin, ciprofloxacin, levofloxacin, and tobramycin was 20.2%, 35.9%, 15.5%, and 29.4% respectively. gram - negative bacilli showed higher resistance to ciprofloxacin. staphycoccus sp. revealed significant resistance to ciprofloxacin. streptococcus sp. showed high resistance to tobramycin. the resistance of isolates from older patients (60y) to ciproloxacin, levofloxacin, and tobramycin was higher than that from adult patients (> 14 to 59y).conclusionstaphylococcus sp., pseudomonas sp., and corynebacterium sp. were the most common bacterial keratitis isolates in china. attentions should be paid to the increase of the resistance to levofloxacin. |
early detection and appropriate referral of children with developmental delays or disorders is important in pediatrics. developmental assessment is made by early detection of problems through developmental surveillance and screening, precise evaluation by using standardized and formal diagnostic tools as well as evaluation of the medical, social, family history and physical examination of the child[1, 2 ]. developmental screening must be repeated periodically and incorporated into pediatrics practice [3, 4 ]. developmental screening test is a brief standardized tool that is used for identifying children who need more detailed evaluation and if used appropriately is useful and cost benefit effective. because screening is used for identifying the children who will receive the benefits of more professional evaluation or treatment, it is recommended that all children be screened for developmental delays. denver developmental screening test ii (ddst - ii) and bayley are examples for such formal tools. for having ability to differentiate between abnormal children from those normal children who have slower rate of achieving developmental skills, these developmental screening tools must be reliable and valid, have acceptable sensitivity and specificity, be easy to perform and not expensive[1, 6, 7 ]. ddst - ii is a formal developmental screening tool that assesses children from birth to 6 years of age. first it was standardized on 1036 children (543 boys and 493 girls) from 2 weeks old to 6/4 years of age in denver, colorado as ddst. then in 1992 it is revised and restandardized on 2096 children and is known as ddst - ii. test reliability on test - retest is 90% and its inter - rater reliability is 8095%. the test is valid and there is a strong relationship between classification on the ddst and scores on the stanford - binet intelligence scales and the previous edition of bayley infant scales. ddst - ii is a brief and validated screening tool that many of pediatricians are familiar with it. although there is doubt about its limited specificity (43%) and risks of over referral [5, 11 ], it has high rate of sensitivity (83%) and identifies children with developmental delays[5, 12 ]. ddst - ii assesses child 's development in 4 general areas : 1) personal social (25 items), 2) fine motor- adaptive (29 items), 3) language (39 items), and 4) gross motor (32 items)[9, 13 ]. screening by it produces 3 scores : normal, suspect and untestable (these children refused parti - cipating in some items that 95% of age matched children could pass them). sometimes ddst results are interpreted as normal, suspect, questionable (these children can not pass some items that 7595% of age matched children could pass them) and untestable. a study found sensitivity of 80% if " questionable scores " were included with abnormal scores but specificity of 46%. alternatively, if " questionable scores " were included with normal scores, sensitivity was 46% and specificity 80. by considering the importance of early detection of developmental disabilities and absence of an iranian developmental screening test, this study was planned to determine the validity and reliability of persian version of ddst - ii (by translating to persian and evaluating the cultural adaptation of the items) in iranian children in order to provide an appropriate developmental screening tool for iranian child health workers. this research is an action research that was performed from january to august 2008 in 4 child health care centers located in north, south, east and west regions of tehran city. these are primary health care centers which provide mainly general health services for people including children from different socio - economical classes of general population. usually normal children visit such centers and services for growth monitoring, vaccination, vitamin supplements, etc). these centers are under the supervision of deputy of health, or shahid beheshti medical university. at first test form and guiding sheet was translated precisely by 3 specialists familiar with english. then the research team (4 pediatricians) read all 3 translated versions and for each item in form and sheet we chose the best translation (simple, short, easy to understand and culturally compatible). then we sent them along with original version to 3 other pediatricians who were familiar with developmental domains. the research team discussed their view points and implemented their opinions in the final form. healthy newborns, infants and children, 06 years old, in tehran city could participate in this study. the inclusion criteria were : 1) age between birth to 6 years, 2) iranian nationality, 3) living in tehran city, and 4) parental cooperation. exclusion criteria were : 1) having obvious developmental delay or disability (because including children with gross developmental disorders would lower the cutoff point for each developmental item in iranian children), 2) parental refusal. the study was approved by the research committee and thereafter by the ethical committee of university of social welfare & rehabilitation sciences. convenient sampling was used and 221 children (100 girls and 121 boys) in 13 age groups (0 to 2, 2.1 to 4, 4.1 to 6, 6.1 to 9, 9.1 to 12, 12.1 to 15, 15.1 to 18, 18.1 to 24, 24.1 to 30, 30.1 to 36, 36.1 to 48, 48.1 to 60 and 60.1 to 72 months), each age group containing 17 children, were examined. demographic items included date of birth, sex, birth order, maternal education level, gestational age at birth (preterm or term ; for preterm children up to 2 years we calculated corrected age), and history of disability of the child. eight examiners were trained in a 1 day workshop for performing the ddst - ii. a demographic questionnaire was completed for each child by parents and then ddst - ii was done by the examiners. in order to determine the reliability of ddst - ii, 25% of children in each age group (small children after 3060 minutes, older children up to 23 days later) were re - examined by the same examiners (test - retest). another 25% of children were retested by another examiner (inter - rater reliability). in order to determine agreement coefficient, it is a developmental screening tool. because we had no accessibility to any diagnostic tests we compared these two developmental screening tools to determine their agreement coefficient anyway, by another research team, asq was translated into persian and was standardized on 11000 iranian children. the results have not been published yet, but the general report exists and we have used the translated forms. because asq is designed to use for 460 month - old children and each questionnaire can be used for one month before or after the specific age, children who were out of this range (361 months) were evaluated by developmental pediatricians. also 10% of children of other age groups, after examining by ddst - ii and completing the asq by parents, were evaluated by developmental pediatricians. as mentioned above, test - retest and inter - rater methods were used in order to determine reliability of the test by cronbach 's a and kauder - richardson coefficients. we use cronbach 's a for reliability determining of each test item and kauder - richardson coefficient in 4 developmental domains. in test - retest and inter - rater tests we measured cronbach 's a and kappa measure of agreement for comparison of each developmental domain and final results of each test respectively. content validity of the test was verified by reviewing texts and related articles, and by specialists opinions. in this study 221 children were evaluated by ddst - ii (100 girls and 121 boys) in 13 age groups (appendix). birth order of children were 73% first, 22% second, 3% third and 2% fourth child of family. 95% of children were born at term and 5% of them preterm (for preterm children up to 2 years we calculated and considered corrected age). developmental screening of children by ddst - ii showed that 143(65%) of them developed normally, 75(34%) had developmental delay (suspect) and 3(1%) were untestable according to test scoring method. cautions and delays number in each developmental domains are 13 and 20 in personal - social, 13 and 24 in fine motor - adaptive, 21 and 16 in language and finally 10 and 23 in gross motor areas. as it is seen number of cautions and delays are greater in language and fine motor adaptive domains respectively. children with developmental delays differed in number of affected domains.36 children had delay in 1, 27 children in 2 and 9 children in 3 developmental domains. in this study, the estimated coefficients were 0.74 for personal - social, 0.63 for fine motor - adaptive, 0.63 for language and 0.61 for gross motor domains. test - retest and inter - rater methods were also used as other ways for reliability determination. interclass correlation coefficients for test - retest and inter - rater methods are shown in tables 1 and 2. interclass correlation coefficients for test retest examination by ddst- ii icc : interclass correlation coefficients/ ddst - ii : denver developmental screening test ii interclass correlation coefficients for inter - rater examination by ddst - ii icc : interclass correlation coefficients/ ddst - ii : denver developmental screening test ii table 3 shows comparison between the results of ddst - ii with asq and results of pediatricians evaluation. comparison of ddst - ii and asq results showed that 109 children passed two tests and 21 children failed in both of them. comparison between the results of ddst - ii with asq and pediatricians evaluation ddst - ii : denver developmental screening test ii / asq : ages and stages questionnaires consistency coefficient between ddst - ii and asq was 0.21. thus sensitivity and specificity of ddst - ii could be calculated as shown below : sensitivity = 21 : 35 100 = 60% specificity = 109:158 100 = 69% comparison of ddst - ii and results of pediatricians evaluation showed that 42 children passed and 4 children failed in both evaluations. in our study the content validity of ddst - ii was verified by reviewing books and journals, and by specialists opinions. all of the questions in ddst - ii had appropriate content validity, and there was no need to change them. test - retest and inter - rater methods were also used as other ways for reliability determination. in test - retest examination the cronbach 's coefficients for all developmental domain is very good and kappa measure of agreement is 87% (p<0.001). in inter - rater examination the cronbach 's a coefficients for all developmental domain were very good and kappa measure of agreement was 76% (p<0.001). thus ddst - ii has very good reliability in test - retest and inter - rater examination. sensitivity of ddst - ii in different references ranges from 4083%[14, 15 ] and its specificity is reported from 4080%[16, 17 ]. in this study sensitivity and specificity of ddst - ii by comparing the results of ddst - ii and asq were 60% and 69% respectively. of course this can not be considered as the actual validity of the test, because, as explained before, asq is not a diagnostic gold standard test. we found that children passed the asq (88%) more than ddst - ii (65%) and consistency coefficient of the two tests was poor (0.21). therefore, either asq may be undersensitive and/or ddst - ii oversensitive. which of these is true it has to be investigated by comparing the results of these tests with the results of a developmental diagnostic test. it is possible that in comparison with the denver sample, iranian children have a slower rate of development. one study conducted in shiraz (iran) showed that 36 year - old iranian children have slower rate of development by ddst - ii in fine and gross motor domains. it is worthy to mention that ddst - ii has subgroup standards based on sex, race, maternal education and place of residence that are presented in denver - ii technical manual. some of our other findings revealed no relationships between sex, maternal education and place of residence with children 's developmental status in tehran. in another native study in shiraz city, gross and fine motor performance of 1524 children aged 36 years was evaluated by ddst - ii in 20052008. in this evaluation girls had better performance. yalaz and epir tested 1176 turkish children aged 2 weeks to 6 yr4 mo by ddst in 1984. they found that girls development is better than that of boys. durmazlar and anlar also evaluated 1091 turkish children aged 072 months by ddst - ii in 1998. in their study bryants and stark. evaluated the achievement of test items in the first year of life of cardiff infants by ddst in 1974. they concluded that in the first year of life, there are no developmental differences between boys and girls. in this study maternal education had no effect on children 's developmental status. in south okanogan of canada, barnes and stark evaluated 206 children 2 weeks to 6 yr4 mo old by ddst. in their study, there was no relationship between maternal education and child 's developmental level except in 1012 month - old infants. william 's study in philippine showed that maternal education and her birth place (rural or urban) had relation to ddst results. children of mothers with higher educational level and who were born in urban regions had better results. lejjaraga and co - workers studied 05 year - old children in argentina in 2002. in their research, after first year of life, sex and maternal education were related to children 's developmental status. bryant examined 686 infants aged 2 weeks to 12 months in cardiff by ddst in 1974. they found that children of cardiff in fine and gross motor domains had slower developmental rate. later they standardized ddst on 1574 under 6 year - old children in cardiff in 1976. they showed that cardiff children had slower developmental rate, but under 18 months of age, they were better than denver children in language domain. there was no difference between the two groups in fine motor development and cardiff children had better performance in personal - social domain. oeda in one ddst study on 1171 children showed that children of tokyo had better results in some items of personal - social domain but in infancy they had slower developmental rate in gross and fine motor domains. gross and fine motor performance of 78 healthy swedish children aged 15 to18 months were examined with ddst by lundberg. shapiro and harles in israel examined 2248 children 2 weeks to 6.5 years old with ddst. they found that israeli children in comparison to denver children had slower rate of development in gross and fine motor domains. a review article showed that by using ddst, children of japan, philippine, tokyo, okinawa, netherland and bangkok had slower rate of motor development. first, some parents that their children had to be re - examined by ddst - ii, did not return to clinic. second, developmental screening tools are not diagnostic and their results must be followed by a more intensive evaluation. the sensitivity and specificity of ddst - ii must be determined by comparison of the test results with a developmental diagnostic test. because there was no standardized diagnostic test in iran, we compared the ddst - ii with asq and pediatricians evaluation of children 's development. third, by considering the results of similar researches, and on the base of results of this study, delays in fine and gross motor areas are more than in other developmental domains. it is recommended to design another study on larger samples in order to standardized ddst - ii and determine the norms of iranian children. early detection and intervention of children with developmental delays or disorders is an important issue in pediatrics medicine. early detection and intervention in developmental problems can reduce their impacts on the well - being and functioning of child and his / her family. american academy of pediatrics recommended that pediatricians use standardized developmental screening test regularly at the 9, 18 and 30 (or 24) month visits. this research showed that persian version of ddst - ii has a good validity and reliability, and can be used as a screening tool for developmental screening of children in tehran city. for determining the sensitivity and specificity of the test, it is suggested that the results of each of the two screening tests ddst - ii and asq are compared with a standard diagnostic test in future studies. | objectivethis research was designed to identify the validity and reliability of the persian version of denver developmental screening test ii (ddst - ii) in iranian children, in order to provide an appropriate developmental screening tool for iranian child health workers.methodsat first a precise translation of test was done by three specialists in english literature and then it was revised by three pediatricians familiar with developmental domains. then, ddst - ii was performed on 221 children ranging from 0 to 6 years, in four child health clinics, in north, south, east and west regions of tehran city. in order to determine the agreement coefficient, these children were also evaluated by asq test. because asq is designed to use for 460 month- old children, children who were out of this rang were evaluated by developmental pediatricians. available sampling was used. obtained data was analyzed by spss software.findingsdevelopmental disorders were observed in 34% of children who were examined by ddst - ii, and in 12% of children who were examined by asq test. the estimated consistency coefficient between ddst - ii and asq was 0.21, which is weak, and between ddst - ii and the physicians examination was 0.44. the content validity of ddst - ii was verified by reviewing books and journals, and by specialists opinions. all of the questions in ddst - ii had appropriate content validity, and there was no need to change them. test - retest and inter - rater methods were used in order to determine reliability of the test, by cronbach 's and kauder - richardson coefficients. kauder - richardson coefficient for different developmental domains was between 61% and 74%, which is good. cronbach 's coefficient and kappa measure of agreement for test - retest were 92% and 87% and for inter - rater 90% and 76%, respectively.conclusionthis research showed that persian version of ddst - ii has a good validity and reliability, and can be used as a screening tool for developmental screening of children in tehran city. |
the rotator cuff is formed by the convergence of the supraspinatus, infraspinatus, teres minor, and subscapularis muscles ; therefore, rupture of the rotator cuff implies rupture of these four muscles1, 2. the rotator cuff suture is generally used for repair, and it maximizes the contact area between the bone and tendon, thereby creating normal spaces between anatomical structures3. to provide an efficient rehabilitation program for patients with an impaired rotator cuff and to enable recovery from malfunction of the shoulder joint, management includes muscular strength and endurance management, pain reduction in the shoulders, improvement of the range of motion within which the shoulder joint can move as much as possible, and focusing on recovery of the ability that controls balance among stabilizing muscles4, 5. among many other therapeutic methods for stabilizing the shoulders, sling exercise is a method that can cause an integrated effect on both sense and motion through performance of active movements on an uneven surface and slings attached to a moving rope6. moreover, it also has an effect on soft tissue release, increases joint range of motion, stabilizes muscular tissue, and enhances muscular strength7, 8. the vibration stimuli typically used in training does not cause any particular side effect, and anyone can get used to it easily9. an active vibration stimulus causes simultaneous contraction in stimulated muscle groups and can develop muscular ability and nerve control. in addition, it can restrict abnormal tension of muscle, thereby allowing patients with a muscular imbalance to adapt to it10,11,12. vibration stimuli produced using a flexi - bar enhance muscular strength, coordination, and balance13. however, there is an insufficient amount of research on the effect of the flexi - bar exercise on patients with shoulder problems and on the combination of flexi - bar exercise with active vibration stimuli and stabilization exercise that uses a sling. therefore, this study aimed to find out if complex exercise using slings and a flexi - bar has an effect on muscle activity and pain in patients after rotator cuff repair. in addition, it aimed to provide reasons for any observed effects and basic clinical data. this study included 20 participants who were diagnosed with rupture of the rotator cuff and had undergone joint surgery in the past 6 weeks. the participants who understood the purpose of this study were assigned randomly into groups of 10 as the experimental group and the control group. subjects who had undergone surgery for rupture of the rotator cuff or other indications and who were diagnosed with other conditions such as mental disease or other nerve disorders were excluded. all subjects provided written informed consent prior to participation in the study according to the ethical standards of the declaration of helsinki. the average age, weight, height, and body mass index (bmi) of the experimental group were 44.2 5.4 years, 70.5 10.2 kg, 168.9 7.9 cm, and 24.6 2.1 kg / m, respectively, and those of the control group were 44.1 4.5 years, 64.6 9.2 kg, 167.8 7.5 cm, and 22.8 1.9 kg / m, respectively (table 1table 1.general characteristics of the subjectseg (n=10)cg (n=10)gender (male / female)6/45/5age (years)44.2 5.444.1 4.5weight (kg)70.5 10.264.6 9.2height (cm)168.9 7.9167.8 7.5bmi (kg / m)24.6 2.122.8 1.9mean sd. eg : experimental group ; cg : control group both groups were treated with a transcutaneous electrical nerve stimulator (tens) and continuous passive motion (cpm) for 40 minutes a day, 6 days a week, for 3 weeks. the experimental group was asked to perform the combined exercise using slings and flexi - bar. the sling exercise program consisted of the following movements : scapula setting conducted in a prone position with a sling on the affected arm, shoulder protraction and retraction conducted in a sitting position with a sling on both arms, shoulder flexion conducted in a side - lying position with the sling on the affected arm, shoulder abduction conducted in a supine position with a sling on the affected arm, and shoulder horizontal abduction and horizontal adduction conducted in a sitting position with a sling on the affected arm. the flexi - bar exercise was conducted in a sitting position while the effect of gravity was removed by flexing both shoulders to 90 degrees and strapping them into slings. the flexi - bar exercise program consisted of up - down oscillation exercise of the forearm conducted in pronation and supination positions and left - right oscillation exercise conducted in a neutral position. the experimental group conducted the exercise programs for 50 minutes a day, 3 day a week, for 3 weeks. surface electromyography (emg ; bts freeemg 300, bts s. p. a., milan, italy) was used to measure muscle activity. we attached an electrode to the upper trapezius, lower trapezius, infraspinatus, and serratus anterior. the collected electromyography data were normalized to the percentage of reference voluntary contraction (% rvc) and further processed and expressed as the root mean square (rms). to record the reference voluntary contraction (rvc) value of subjects, the subjects were asked to sit comfortably on a chair with their arms at their sides and to ensure that they sat with an even posture to enable correct measurement. for the voluntary contraction standard, the subjects were asked to sit on a chair with their elbows straight and shoulder joints curved at 90 for measurement. the vas is a 10 cm straight line scale marked with numbers indicating the degree of pain felt. the left - hand side of the scale signifies no pain, and the right - hand side signifies maximum pain. the collected data were statistically processed using ibm spss statistics 22.0 (ibm corp., armonk, ny, usa) for windows. the paired t - test was used to compare groups before and after the experiment. the independent t - test was used to assess the difference in the degree of change between the two groups before and after the experiment. the changes in muscle activity and pain are shown in table 2table 2.comparison of the results of muscle activity and pain between the experimental and control groupsgroupprepostd - valueupper trapeziuseg1,261.1 88.6984.5 79.7276.5 44.8cg1,261.2 77.31,177.3 91.383.8 20.8lower trapeziuseg433.3 30.1581.2 54.8 147.9 41.7cg412.0 50.5451.2 51.0 39.2 16.1infraspinatuseg440.3 28.8581.6 40.5 141.2 41.7cg426.7 48.0454.9 51.9 28.1 15.5serratus anterioreg333.1 22.6520.4 50.5 187.3 37.5cg325.5 37.1359.8 49.9 34.2 23.7paineg7.1 1.22.7 0.64.4 0.7cg7.4 0.74.4 0.93.0 0.6mean sd. p<0.05 (paired t - test), p<0.05 (independent t - test). d - value : difference value ; eg : experimental group ; cg : control group. the subjects in both the experimental group and control group showed significant differences in pain and muscle activity of the upper trapezius, lower trapezius, infraspinatus, and serratus anterior (p<0.05). however, the differences in pain and muscle activity of the upper trapezius, lower trapezius, infraspinatus, and serratus anterior of the experimental group appeared to be significant as compared with those of the control group (p<0.05). p<0.05 (paired t - test), p<0.05 (independent t - test). d - value : difference value ; eg : experimental group ; cg : control group the purpose of this research was to determine the effect of combined exercise with slings and flexi - bar on muscle activity and pain in rotator cuff repair patients. the subjects in both the experimental group and control group showed a significant difference in muscle activity of the upper trapezius, lower trapezius, infraspinatus, and serratus anterior. however, the upper trapezius of the experimental group showed significantly reduced muscle activity compared with the control group, whereas the muscle activity of the lower trapezius, infraspinatus, and serratus anterior increased significantly in the experimental group compared with the control group. in a pilot study, patients with shoulder problems had lower muscle activity in stabilizing muscles such as the serratus anterior or middle and lower trapezius and an over - activated upper trapezius. this caused an imbalance in the shoulder muscles and even caused pain14. according to a study by hong.15, the torque of motion in shoulder joints significantly increased after vibrations were applied their subjects via a vibration platform. according to a study by kirkesola16, when a sling was used for vibration exercise, it was found that incorrect neuromuscular control could be corrected, thereby reducing muscle imbalance. the present study was consistent with the abovementioned pilot study, and it was found that combined exercise using both slings and a flexi - bar has a positive effect on the activation of muscle activity. the subjects of both the experimental group and control group showed a significant difference in pain. in addition, shoulder pain in the experimental group was significantly reduced compared with that in the control group. in a study by bakhtiary.17, it was found that shoulder pain significantly decreased as a result of vibration exercise using a vibrator. in a study by jung18, it was found that pain was significantly reduced after patients with shoulder problems performed shoulder - stabilizing exercise. burkhart.19 found that middle - aged women felt less pain as a result of performing sling exercise. combined exercise with slings and a flexi - bar improved muscle activity and pain in rotator cuff repair patients. this research has a limitation with respect to generalization of the findings to all rotator cuff repair patients, as it was conducted on a small group. furthermore, the experimental period was short due to the period of hospitalization of the patients. in addition, follow - up was not performed ; therefore, the duration of the effect is unknown. in conclusion, combined exercise using slings and a flexi - bar is effective for improving muscular imbalance and decreasing pain in rehabilitation after rotator cuff repair. therefore, combined exercise using slings and flexi - bars will offer clinical guidelines for early return of patients to daily life after rotator cuff repair and will be useful for many patients. | [purpose ] the purpose of this research was to determine the effect of combined exercise with slings and a flexi - bar on muscle activity and pain in rotator cuff repair patients. [subjects and methods ] this research evaluated 20 rotator cuff repair patients divided randomly into groups of 10 as the control group and the experimental group. the experimental group performed combined exercise with slings and a flexi - bar. both the experimental and control groups were treated with a transcutaneous electrical nerve stimulator and continuous passive motion. muscle activity was measured with surface electromyography. pain was measured with the visual analogue scale. the paired t - test was used to compare groups before and after the experiment. the independent t - test was used to assess the differences in the degree of change between the two groups before and after the experiment. [results ] subjects of both the experimental group and control group showed significant differences in muscle activity and pain. however, as compared with the control group, there was significant differences in the muscle activity and pain in the experimental group. [conclusion ] these results indicate that combined exercise with slings and a flexi - bar is effective in improving muscle activity and decreasing pain in rotator cuff repair patients. |
the data used in this study came from a rural area in matlab, where icddr, b maintains the hdss since 1966. one half gets government health services like any other rural areas of bangladesh (called the government services area) and another half gets high - quality icddr, b primary health care services in addition to the government health services (7, 8). analysis of cod includes data of the government services area only, in order to examine the epidemiological transition in last two decades in a typical setup of rural bangladesh. hdss used the one - page death form for all age groups, with particular emphasis on child and maternal deaths since 1966. in 1986, the death form was revised, consisting of three parts ; identification of the deceased, large space for writing signs, and symptoms that led to death and medical consultation prior to death, and space for medical assistant (ma) for writing possible cod and icd-9 code for it. experienced field research assistants (fras) with at least 10 grade education, but no formal training in medicine were trained in two sessions followed by a refresher session after one year later to record precisely timing, duration, and gradation of each of the symptoms preceding death, particularly of children and women of reproductive age in bangla. fras conducted interview in colloquial bangla, and wrote descriptive statements in bangla, preserving local idioms and refraining from approximate translations. they interviewed the caretakers of the deceased ; usually mothers in cases of child death and spouses (or close relatives ; sons and daughters, brothers or sisters in absence of spouses) in cases of adult and elderly deaths. the interview with caretakers lasted for 1020 minutes depending on emotional state of the caretakers and duration of the last illnesses and medication. the interview took place on an average of 22 days after the date of death. this va tool continued till 2003 parallel to the who standard va questionnaires (for neonatal, child, and adult deaths). for this new va procedure, selected fras were given extensive training on who va tools to collect additional va data, which include modular questions on injury, chronic disease, last disease symptoms, life style factors, medication, and hospitalization, apart from the open death history. the differences in va methods used before and after 2003 are summarized in table 1. major features of verbal autopsy methods used in matlab surveillance area in order to restrict the number of persons assigning cod, the responsibility of assigning cod of all ages lies with a full - time medically trained person (i.e. ma). the ma, with three - year training in medicine, was trained to review descriptions of signs and symptoms leading to death and health records, and to assign possible underlying cod and visit deceased family to collect additional information when required to assign cod. the ma uses his own judgment evolved from his experience and training to assign main (or underlying) cod (9, 10). the ma had to select a single three - digit code from a list of 97 possible codes, derived from the basic tabulation list of the who international statistical classification of disease (icd-9), injuries and causes of death (11). many of the codes proposed by the who basic tabulation list were not retained because they would be irrelevant in the context of matlab area and lay reporting. this modified procedure is expected to ensure greater consistency in coding, and ease supervision and offer a greater choice of codes, minimize forced compliance, and allows greater flexibility in classification. matlab hdss has in - built data quality control checks at every stage of the field data collection procedures since 1966. for example, field supervisors during their visits, review record of the family visit card ; inquire about all past events ; and record any missing events onto standard forms (9). supervisors and fras meet fortnightly to review activities and to discuss problems for finding feasible solutions. apart from the surveillance team, a quality control team of two female fras, both the physician and the principal investigator of the hdss project supervised the ma 's work. at regular intervals, death forms are randomly drawn and checked, and difficult cases are reviewed and provided feedback. the same ma was responsible for assigning causes of death for whole period of 19862006, and using a single, trained coder is regarded as effective as two (or multiple) coders that is currently widely accepted (12). though the va coder in matlab hdss is not a physician, despite extensive training and experience in this field, the inter - coder variation found in matlab to be substantially high. this makes comparison of cod difficult across time within the area and hence the use of the same ma throughout the period eliminates inter - coder variation and produce consistent and comparable (not necessarily accurate) cod. however, learning by doing over time may incur some inconsistency in cod, which can not be controlled. hdss longitudinally records all vital events including va, respecting people 's sentiment and maintaining strict confidentiality of the recorded information. hdss annual reports present who age - standardized cause specific mortality fraction (csmf) (13) for this period. for trend analysis, major causes of deaths were grouped into broad causes as follows : communicable diseases (cds) : diarrhea, dysentery, tuberculosis (tb), and respiratory diseases ; other communicable includes expanded program on immunization (epi) related diseases, jaundice, meningitis, hepatitis, skin, and veneral diseases.ncds : malignant neoplasm ; diseases of circulatory diseases (cardiovascular diseases and stroke) ; digestive diseases including liver diseases ; and chronic obstructive pulmonary disease (copd) including chronic bronchitis and asthma.accident/injury : accident, drowning, suicide, murder, and homicide. communicable diseases (cds) : diarrhea, dysentery, tuberculosis (tb), and respiratory diseases ; other communicable includes expanded program on immunization (epi) related diseases, jaundice, meningitis, hepatitis, skin, and veneral diseases. ncds : malignant neoplasm ; diseases of circulatory diseases (cardiovascular diseases and stroke) ; digestive diseases including liver diseases ; and chronic obstructive pulmonary disease (copd) including chronic bronchitis and asthma. accident / injury : accident, drowning, suicide, murder, and homicide. in this study, above broad causes of death were focused and for further analyses, other causes like maternal and perinatal condition (including nutritional cause), miscellaneous, and unknown causes were not used. exponential models were fitted on the mortality data available for 19862003 and future scenarios upto 2025 were forecasted on the basis of exponential models. the exponential regression model used for analyzing trends of major causes of death is : f(x)=y = aebx. in order to estimate the parameters of above exponential model, the following linear regression model is fitted using the available age - standardized mortality rates for selected causes of death over 19862006:in(y)=in(a)+bx. the parameter estimates, including respective standard errors and test of significance, were obtained using microsoft excel 's data analysis and solver tool packs (14, 15). the data used in this study came from a rural area in matlab, where icddr, b maintains the hdss since 1966. one half gets government health services like any other rural areas of bangladesh (called the government services area) and another half gets high - quality icddr, b primary health care services in addition to the government health services (7, 8). analysis of cod includes data of the government services area only, in order to examine the epidemiological transition in last two decades in a typical setup of rural bangladesh. hdss used the one - page death form for all age groups, with particular emphasis on child and maternal deaths since 1966. in 1986, the death form was revised, consisting of three parts ; identification of the deceased, large space for writing signs, and symptoms that led to death and medical consultation prior to death, and space for medical assistant (ma) for writing possible cod and icd-9 code for it. experienced field research assistants (fras) with at least 10 grade education, but no formal training in medicine were trained in two sessions followed by a refresher session after one year later to record precisely timing, duration, and gradation of each of the symptoms preceding death, particularly of children and women of reproductive age in bangla. fras conducted interview in colloquial bangla, and wrote descriptive statements in bangla, preserving local idioms and refraining from approximate translations. they interviewed the caretakers of the deceased ; usually mothers in cases of child death and spouses (or close relatives ; sons and daughters, brothers or sisters in absence of spouses) in cases of adult and elderly deaths. the interview with caretakers lasted for 1020 minutes depending on emotional state of the caretakers and duration of the last illnesses and medication. the interview took place on an average of 22 days after the date of death. this va tool continued till 2003 parallel to the who standard va questionnaires (for neonatal, child, and adult deaths). for this new va procedure, selected fras were given extensive training on who va tools to collect additional va data, which include modular questions on injury, chronic disease, last disease symptoms, life style factors, medication, and hospitalization, apart from the open death history. the differences in va methods used before and after 2003 are summarized in table 1. major features of verbal autopsy methods used in matlab surveillance area in order to restrict the number of persons assigning cod, the responsibility of assigning cod of all ages lies with a full - time medically trained person (i.e. ma). the ma, with three - year training in medicine, was trained to review descriptions of signs and symptoms leading to death and health records, and to assign possible underlying cod and visit deceased family to collect additional information when required to assign cod. the ma uses his own judgment evolved from his experience and training to assign main (or underlying) cod (9, 10). the ma had to select a single three - digit code from a list of 97 possible codes, derived from the basic tabulation list of the who international statistical classification of disease (icd-9), injuries and causes of death (11). many of the codes proposed by the who basic tabulation list were not retained because they would be irrelevant in the context of matlab area and lay reporting. this modified procedure is expected to ensure greater consistency in coding, and ease supervision and offer a greater choice of codes, minimize forced compliance, and allows greater flexibility in classification. matlab hdss has in - built data quality control checks at every stage of the field data collection procedures since 1966. for example, field supervisors during their visits, review record of the family visit card ; inquire about all past events ; and record any missing events onto standard forms (9). supervisors and fras meet fortnightly to review activities and to discuss problems for finding feasible solutions. apart from the surveillance team, a quality control team of two female fras, both the physician and the principal investigator of the hdss project supervised the ma 's work. at regular intervals, death forms are randomly drawn and checked, and difficult cases are reviewed and provided feedback. the same ma was responsible for assigning causes of death for whole period of 19862006, and using a single, trained coder is regarded as effective as two (or multiple) coders that is currently widely accepted (12). though the va coder in matlab hdss is not a physician, despite extensive training and experience in this field, the inter - coder variation found in matlab to be substantially high. this makes comparison of cod difficult across time within the area and hence the use of the same ma throughout the period eliminates inter - coder variation and produce consistent and comparable (not necessarily accurate) cod. however, learning by doing over time may incur some inconsistency in cod, which can not be controlled. hdss longitudinally records all vital events including va, respecting people 's sentiment and maintaining strict confidentiality of the recorded information. in order to restrict the number of persons assigning cod, the responsibility of assigning cod of all ages lies with a full - time medically trained person (i.e. ma). the ma, with three - year training in medicine, was trained to review descriptions of signs and symptoms leading to death and health records, and to assign possible underlying cod and visit deceased family to collect additional information when required to assign cod. the ma uses his own judgment evolved from his experience and training to assign main (or underlying) cod (9, 10). the ma had to select a single three - digit code from a list of 97 possible codes, derived from the basic tabulation list of the who international statistical classification of disease (icd-9), injuries and causes of death (11). many of the codes proposed by the who basic tabulation list were not retained because they would be irrelevant in the context of matlab area and lay reporting. this modified procedure is expected to ensure greater consistency in coding, and ease supervision and offer a greater choice of codes, minimize forced compliance, and allows greater flexibility in classification. matlab hdss has in - built data quality control checks at every stage of the field data collection procedures since 1966. for example, field supervisors during their visits, review record of the family visit card ; inquire about all past events ; and record any missing events onto standard forms (9). supervisors and fras meet fortnightly to review activities and to discuss problems for finding feasible solutions. apart from the surveillance team, a quality control team of two female fras, both the physician and the principal investigator of the hdss project supervised the ma 's work. at regular intervals, death forms are randomly drawn and checked, and difficult cases are reviewed and provided feedback. the same ma was responsible for assigning causes of death for whole period of 19862006, and using a single, trained coder is regarded as effective as two (or multiple) coders that is currently widely accepted (12). though the va coder in matlab hdss is not a physician, despite extensive training and experience in this field, the inter - coder variation found in matlab to be substantially high. this makes comparison of cod difficult across time within the area and hence the use of the same ma throughout the period eliminates inter - coder variation and produce consistent and comparable (not necessarily accurate) cod. however, learning by doing over time may incur some inconsistency in cod, which can not be controlled. hdss longitudinally records all vital events including va, respecting people 's sentiment and maintaining strict confidentiality of the recorded information. hdss annual reports present who age - standardized cause specific mortality fraction (csmf) (13) for this period. for trend analysis, major causes of deaths were grouped into broad causes as follows : communicable diseases (cds) : diarrhea, dysentery, tuberculosis (tb), and respiratory diseases ; other communicable includes expanded program on immunization (epi) related diseases, jaundice, meningitis, hepatitis, skin, and veneral diseases.ncds : malignant neoplasm ; diseases of circulatory diseases (cardiovascular diseases and stroke) ; digestive diseases including liver diseases ; and chronic obstructive pulmonary disease (copd) including chronic bronchitis and asthma.accident/injury : accident, drowning, suicide, murder, and homicide. communicable diseases (cds) : diarrhea, dysentery, tuberculosis (tb), and respiratory diseases ; other communicable includes expanded program on immunization (epi) related diseases, jaundice, meningitis, hepatitis, skin, and veneral diseases. ncds : malignant neoplasm ; diseases of circulatory diseases (cardiovascular diseases and stroke) ; digestive diseases including liver diseases ; and chronic obstructive pulmonary disease (copd) including chronic bronchitis and asthma. accident / injury : accident, drowning, suicide, murder, and homicide. in this study, above broad causes of death were focused and for further analyses, other causes like maternal and perinatal condition (including nutritional cause), miscellaneous, and unknown causes were not used. exponential models were fitted on the mortality data available for 19862003 and future scenarios upto 2025 were forecasted on the basis of exponential models. the exponential regression model used for analyzing trends of major causes of death is : f(x)=y = aebx. in order to estimate the parameters of above exponential model, the following linear regression model is fitted using the available age - standardized mortality rates for selected causes of death over 19862006:in(y)=in(a)+bx. the parameter estimates, including respective standard errors and test of significance, were obtained using microsoft excel 's data analysis and solver tool packs (14, 15). the pattern of cause of mortality experienced a massive change from acute, infectious, and parasitic diseases to non - communicable, degenerative, and chronic diseases during the last 20 years. it may be mentioned that proportion of miscellaneous decreased gradually from 20% in 1986 to 5% in 2006. malignant neoplasm, cardiovascular and cerebrovascular diseases (cvd), digestive diseases, and copd, etc.) comprised only 8% of total deaths in 1986 (fig. diarrhea, dysentery, tb, and respiratory infections, etc.). in 1996, proportion of deaths due to ncds increased to 41% and deaths due to cds declined to 31%. later in 2006, ncds comprised of a massive 68% of all deaths, whereas deaths due to cds decreased to 11% of total deaths. matlab hdss data suggested that over 19862006, proportion of deaths due to ncds increased by nearly nine - fold, whereas during this period, deaths due to injuries (including suicide and homicide) remained stable around 7%, maternal and neonatal (including nutritional) deaths declined from 7 to 4%, and deaths due to unknown / unspecified causes declined from 7 to 5%. change in broad causes of death for both sexes in matlab government service area, 19862006 2) demonstrates that in 1986, death rates due to dysentery and respiratory diseases among males was around 150 deaths per 100,000 population. dysentery fell substantially just after 1988 and now remained under three deaths per 100,000 population in 2006, while deaths due to respiratory infections among males remained stable around 80 deaths per 100,000 population till 2000, and declined to 26 deaths per 100,000 in 2006. diarrheal deaths increased from 78 deaths per 100,000 population to 135 deaths per 100,000 in 1992, and then dramatically declined by 89% to reach the level under 15 deaths per 100,000 in 2006. among the cds among males, only tb remained at the same level (around 30 deaths per 100,000) over the period 19882006 and showed a slight upward trend over time. initially, deaths among females due to diarrhea and dysentery were higher than that of males the age - standardized mortality rates for the aforementioned causes started from a level of 100 and 200 deaths per 100,000 population, respectively, in 1986. in the later years, the mortality rates declines following a similar pattern of males and by 2006, reached similar level in 2006. the deaths due to tb among females were considerably lower than males, which remained stable over the period 19902006. 3) demonstrate an opposite scenario compared with the cds. among males, cardiovascular diseases (including diseases of circulatory system, viz. hypertension, ischemic heart disease (ihd), stroke, and other cardiovascular) increased by 30-folds (from 16 deaths per 100,000 population in 1986 to 483 deaths per 100,000 in 2006). cancer) also increased massively by 640% (14 103 deaths per 100,000 population) over the period 19862006. compared with cvd and malignant neoplasms, deaths due to digestive diseases and copd among males remained somewhat stable (increased by 21 and 27%, respectively) over the aforementioned period. deaths due to major non - communicable diseases, matlab government service area, 19862006. among females, the age - standardized mortality rates due to cvd (and diseases of circulatory system) also increased massively from seven deaths to 330 deaths per 100,000 population during 19862006. deaths due to copd among females remained flat around 50 deaths per 100,000 population during 19942001 and reduced to a level of 34 deaths per 100,000 population since 2003, whereas deaths due to digestive diseases among females doubled and malignant neoplasms quadrupled (from 10 to 40 deaths per 100,000) during last 20 years. in contrast to males, mortality levels due to selected ncds among females remain considerably lower throughout the period 19862006. deaths due to accidents and injuries (including homicide and suicide) among males and females remained similar over the period 19862006. drowning remained a major cod under this category for both males and females, which considerably declined from a level around 40 deaths per 100,000 in 2000 to under 20 deaths per 100,000 in 2006. mortality due to accidents among males is slightly higher than that of females and accidental deaths among males show an upward trend since 1999. in 2005, a marine vessel accident in nearby gomti river was the reason for peaks (fig. the current level of mortality due to suicide and murder / homicide is higher among females in matlab government service area. deaths due to accident / injury, matlab government service area, 19862006. in order fit trends to existing causes of death data from 19862003 period and project future scenarios, exponential models were used. analysis of existing trends using exponential models (see table 1) demonstrates that in next 20 years, the government service area under matlab surveillance will witness statistically significant decline in deaths due to cds except tb. on the contrary, matlab will experience a significantly massive increase in deaths due to ncds like cvd, malignant neoplasm, and digestive diseases over next two decades. the trend analysis also demonstrates that except accidental deaths, mortality due to drowning and suicides will also gradually, though not significantly, decline in the next 20 years. the parameter estimates for exponential models on mortality due to selected causes of death in table 1 showed that the exponential regression models for selected causes of death fitted well, in terms of r value and significance of the exponential coefficient, except for tb, copd, accident, drowning, and suicide and homicide. year - to - year variation and flat nature of progression for aforementioned causes of death could be the main reason for not fitting the models well. assuming that there will be no major change or disruption in the existing mortality trends in the future, the parameter estimates for the fitted exponential models on mortality from table 2 were used for projecting scenarios for selected causes of deaths and are summarized in table 3. parameter estimate of fitted exponential regression models on age - standardized mortality rates of selected causes of death, matlab government service area, 19862003 by using the parameter estimates from table 1, age - standardized mortality rates for selected causes of death were projected up to 2025 in table 3. the fitted exponential trends demonstrated that dysentery (r = 76%), followed by diarrhea (r = 41%), will decrease considerably in the coming years. the models forecasted that by 2015, deaths due to dysentery and diarrhea would come down to 1 and 59 deaths per 100,000 population, respectively, and by 2025, 0 and 35 deaths per 100,000 population, respectively. the exponential model fitted (r = 49%) for deaths due to respiratory diseases forecasts that age - standard mortality rate due to respiratory diseases will be 67 per 100,000 population in 2015 and 47 deaths per 100,000 population by 2025. exponential model to tb mortality, with low goodness of fit (r = 17%) and loosely significant exponential coefficient (p=0.10), projected that mortality level due to tb would gradually increase to 83 deaths per 100,000 population in 2015 and to 111 deaths per 100,000 population in 2025. the fitted exponential models to age - standardized mortality due to selected ncds (see table 3) forecasted that deaths due to digestive diseases (r = 25%) would rise steadily over the next two decades, with levels of 114 deaths per 100,000 in 2015 and 134 deaths per 100,000 in 2025. the projected scenarios for the other major ncds also projected that deaths due to cvd will increase (r = 68%) up to 3,029 deaths per 100,000 by 2015 and to a massive 10,075 deaths by 2025 in matlab government service area, whereas deaths due to malignant neoplasm will also increase (r = 82%) to 426 deaths per 100,000 by 2015 and 1,150 deaths per 100,000 by 2025. the fitted model showed that only death due to copd (r = 11%) will remain stable at the level of around 200 deaths per 100,000 over next two decades. current and forecasted mortality rates due to selected causes of death, matlab government service area, 20062025 exponential models on selected causes of deaths under accidents / injuries category projected that (see table 3) accidental deaths (r < 1%) and drowning (r < 1%) will remain stable around 34 and 10 deaths per 100,000, respectively, over the next two decades. deaths due to suicide and homicide (r = 5%) will gradually decrease to 11 deaths per 100,000 by 2015 and nine deaths per 100,000 population by 2025. in general, the goodness of fit for the exponential models fitted to accident / injury data are relatively poor compared with other major communicable and ncds, except tb and copd. the study is based on cod derived from open - ended death history reported by lay respondents and recorded by lay (non - medically trained) field workers. the center 's emphasis on maternal and child - health issues may have resulted in inadequate information on adult and elderly deaths that led to a high proportion of deaths classified as however, uniformity in recording va and assessment of cod during 19862003 is the strength to examine changes in the pattern of csmfs over the years. moreover, va cod is reasonably accurate in broader cause categories in india, china, and south africa (1618). earlier it was documented that physicians had the highest rates of disagreement between them in assigning causes of death from reported complications of premature or small - for - date neonates in matlab (19). va on less common disease symptoms could also be less accurate as both lay interviewers and lay respondents can be less aware of signs and symptoms of less common infectious diseases. while neoplasm and cardiovascular diseases were the leading causes of death of older adults (age 4559 years), senility was reported as a major cod of elderly (aged 60 years and over) people. structured modular questionnaire and intensive training of lay field staff may improve assessment of cod and reduce percentage of deaths attributed to senility and other unspecified causes. the demographic transition that took place over last 40 years in the matlab surveillance area resulted in a stable low growth rate due to lowering of both births and deaths compared with 1966 level, and demographic data indicate that matlab has apparently entered to third stage of demographic transition (20). despite considerable decline in overall mortality in terms of crude death rate from 12.2 to 6.4 per 1,000 population in matlab government service area (7, 20), epidemiological transition is also well advanced in a typical rural setup like matlab. historically matlab was a cholera endemic area, a significant proportion of deaths, particularly infant and child deaths was due to diarrheal diseases followed by acute respiratory infections. results show that over the period 19862006, mortality rate due to diarrhea and dysentery reduced by 86% and respiratory infections by 79%. improvement in primary health care services ; wide use of oral rehydration solution, high epi coverage and improvement in water and sanitation conditions, and maternal education may have contributed to the reductions of infant and child mortality in the study area (21). this paper demonstrated that over the period 19862006, age - standardized mortality rate (for both sexes) due to diarrhea and dysentery reduced by 86%, respiratory infections by 79%, except for tb which increased by 173%. on the other hand, during 19862006, mortality due to cvd increased by a massive 3,527% and malignant neoplasms by 495%, whereas mortality due to copd and injury remained in the similar level (1213% increase). rate of increase was not uniform, male mortality due to cvd increased by nearly 30-folds and malignant neoplasm by 6.4 folds compared to female mortality due to cvd and malignant neoplasm increased by 46-folds and 3-folds, respectively. mortality due to other major ncds like digestive diseases stably increased by 1% each year among males and was doubled among females. copd remained stable for both the sexes, with a much higher level among males than females. there may be some misclassification of cod, but most misclassification occurs within ncd category itself (22). in this study, va coder could not assign specific cause (ill - defined) to 520% of the deaths. in china, va misclassified a few deaths due to cerebrovascular disease, ihd, copd, and diabetes as ill - defined causes (16). if this is true for this study, some of the deaths with ill - defined cause were due to ncd, and va had underestimated, to an extent, incidence of ncd deaths, which bring catastrophic economic consequences for the family members. in this study very few deaths were attributed to the diabetes, which is believed to be a major non - communicable cause in elderly in bangladesh. although very few studies were conducted on epidemiological transition in bangladesh, the massive shift in mortality from cds to non - communicable ones over the last 20 years demonstrated in this paper was in agreement with earlier studies. a recent study demonstrated that (23) over the period 19872002, the prevalence of morbidity due to communicable diseases (cds) declined from 58 to 35%, while ncd morbidity increased from 33 to 57%. the study also found that the specific ncds causing substantially high number of disability or death during this period were : asthma, rheumatic fever, chronic pulmonary disease, and strokes. the estimates of mortality levels for selected chronic and ncds and their projections in matlab surveillance area could be biased due to introduction of who standard va in 2003. this cod assessment error, however, occurred more during the later part of the period. the massive increase in mortality due to ncd, particularly cvd in the study period is a reality suggesting that some changes had happened in diet and lifestyle in this rural population. an earlier study found that intakes of carbohydrate, animal protein, and smoking were significantly positively associated with the prevalence of general hypertension, even after controlling for body - mass index and other nutrients (24). the study also found that the animal protein pattern was strongly positively associated with markers of socio - economic status and the prevalence of cigarette smoking, which indicated to the conception that an epidemic of hypertension leading to cvds first affected members of the higher socio - economic status, then toward the general population, who are changing from a lower risk to a higher risk lifestyle characterized by diets rich in fat, a sedentary lifestyle, and smoking (24). outside bangladesh, several studies documented the on - going epidemiologic transition in a number of asian countries china and urban areas of india already found to be in advanced stage of transition with predominant ncds, with the highest mortality caused by cvd at ages below 50 years (25, 26). prevalence of diabetes was also found to be increased steeply over last two decades in south - asian countries, including china, india, and pakistan (27, 28). studies found out that urbanization, high - calorie diet, higher socio - economic status, and sedentary lifestyle are the major determinants for increase in ncds in the asian communities (2528). the study area like any other rural parts of bangladesh, experienced advanced epidemiologic transition and the health sector should be preparing itself to cater to the health need of the growing ncd patients. it can be possible through establishing proper diagnostic facilities and referral system by incorporating such provisions in the next strategic investment plan and updating the health policy accordingly. allocation of more budgets to the health sector and facilitation of the non - traditional financing mechanism like community health insurance scheme could play an important role in easing access to health services. the policy makers should also devise provisions of behavior change activities to prevent major ncds (viz. diet, exercise, periodic screening of risk factors) and treatment of selected ncds into the essential services package (esp), in addition to the existing services. | backgroundfor understanding epidemiological transition, health and demographic surveillance system plays an important role in developing and resource - constraint setup where accurate information on vital events (e.g. births, deaths) and cause of death is not available.methodsthis study aimed to assess existing level and trend of causes of 18,917 deaths in matlab, a rural area of bangladesh, during 19862006 and to project future scenarios for selected major causes of death.resultsthe results demonstrated that matlab experienced a massive change in the mortality profile from acute, infectious, and parasitic diseases to non - communicable, degenerative, and chronic diseases during the last 20 years. it also showed that over the period 19862006, age - standardized mortality rate (for both sexes) due to diarrhea and dysentery reduced by 86%, respiratory infections by 79%, except for tuberculosis which increased by 173%. on the other hand, during the same period, mortality due to cardiovascular and cerebrovascular diseases increased by a massive 3,527% and malignant neoplasms by 495%, whereas mortality due to chronic obstructive pulmonary disease and injury remained in the similar level (1213% increase).conclusionthe trend of selected causes of death demonstrates that in next two decades, deaths due to communicable diseases will decline substantially and the mortality due to non - communicable diseases (ncds) will increase at massive proportions. despite matlab 's significant advances in socio - demographic indicators, emergence of ncds and mortality associated with it would be the major cause for concern in the coming years. |
the american cancer society estimates that 11.3 million cases of nonmelanoma skin cancer (nmsc) will be detected annually. cutaneous scc accounts for nearly 20% of all skin cancers, and excluding melanoma, 75% of all deaths attributed to skin cancers. unlike the more prevalent basal cell carcinoma (bcc), scc is an aggressive tumor that metastasizes with a frequency as high as 12.5%. prevalence is common in fair complexion caucasians with lower reported rates in individuals with darker complexions including asians and africans. cutaneous scc of the face often metastasizes to parotid lymph nodes, which can be detrimental to the facial nerve during treatment and nodes in the neck, as the head and neck are rich in lymphatic networks. treatment for nmsc may include cryotherapy, electrosurgery, topical 5-fluorouracil, photodynamic therapy, imiquimod, and radiation therapy ; however, surgical intervention is the primary treatment modality. when treated early, the five - year cure rate is greater than 90%. nmsc recurrence varies from 816%, second lesion recurrence rates are as high as 75% within the first two years and 95% within five years. this suggests a window of opportunity for chemopreventive agents to delay or prevent a recurrence or metastatic spread. lymph node metastasis in nmsc varies from 0.1 to 28%, with a resulting mortality from 5075%. overall five - year survival rates for regional lymph node metastasis are 2535% [3, 57 ] and less than 20% at ten years early stage skin cancer has a high cure rate, whereas advanced stage cutaneous scc often develops resistance to chemotherapy. therefore, research has focused on developing these novel chemopreventive agents to delay or prevent cutaneous scc formation. curcumin, an extract from the indian spice turmeric, has been investigated in a variety of human cancers including pancreatic, prostate, breast, and head and neck cancer. the first published report demonstrating the topical use of curcumin in cancer reported a sustainable reduction in lesion size and pain. curcumin has antioxidant, anti - inflammatory, antiangiogenic and anticarcinogenic activity, although its clinical use is limited by low bioavailability. additionally, numerous reports have identified signaling pathways related to epidermal growth factor receptor (egfr) that are essential to formation and progression of cutaneous malignancy. the mtor and mek / erk signaling cascades are two of the most well - studied pathways. in a prior study by our group we subcutaneously injected immunodeficient mice with srb12-p9 skin scc and demonstrated that curcumin administered by oral gavage significantly inhibited tumor growth and downregulated ps6, a well - established downstream biomarker of the mtor and mek / erk pathways. curcumin 's anti - carcinogenic effects have been linked to inhibition of the mek / erk signaling pathway in breast carcinogenesis, and researchers continue to explore these potential biomarkers in other cancers. however, erks activity in cutaneous malignancy is not well defined in the literature. hence, we wanted to determine if topical curcumin was as efficacious as oral curcumin in a scc skin xenograft model and elucidate the pathways downregulated by curcumin as potential biomarkers for future chemopreventive studies with our topical curcumin cream. in addition, we wanted to observe the potentially additive effects of topical application and oral dosing. we also wished to explore whether the mek / erk pathway is overexpressed in human cutaneous scc and bcc in the hope of identifying a novel intracellular target at which curcumin may act to inhibit tumorigenesis. we hypothesized that perk and its downstream target ps6 would be overexpressed in cutaneous skin cancers given its role in promoting cellular proliferation in aggressive malignancy. identifying intermediate endpoints is necessary to assess intervention results for primary cancer prevention and address problems with feasibility posed by large patient numbers, length of study, and cost when cancer occurrence or recurrence is an endpoint. curcumin c3 complex (> 98% pure) was obtained from sabinsa corp. in vivo studies were conducted with curcumin (15 mg) suspended in vehicle (100 l corn oil) for oral gavage feeding or suspended in a vanishing cream paste (15 mg/100 l cream) for topical administration provided by our study compounding pharmacist (db). the human skin scc cell line srb12-p9 was derived by single - cell cloning from aggressive skin scc srb12 cells (a gift from dr. reuben lotan, department of thoracic head and neck medical oncology, university of texas m.d. this cell line was chosen due to its sensitivity to curcumin as evidenced in cell culture studies. dna was isolated from the cell lines using a commercially available dna purification kit (qiagen). dna sample was sent to genetica (cincinnati, oh, usa), and the cell line was validated by dna profiling. 2,000 srb12-p9 cells per well were seeded in triplicate onto 96 well plates in complete media at 37c with 5% co2. after adherence, cells were treated with curcumin (040 m) for 072 hours. studies were conducted in accordance with the declaration of helsinki (1964) and in compliance with louisiana state university health sciences center institutional animal care and use committee guidelines. forty 68-week - old severe combined immunodeficiency (scid) mice were shaved and pretreated with either 0 mg (corn oil), 15 mg curcumin by oral gavage, 15 mg curcumin topical paste, or combined 15 mg oral gavage and 15 mg curcumin topical paste once daily for 3 days prior to squamous cell carcinoma xenograft injection (n = 10 per group). mice were then injected subcutaneously with 1 10 srb12-p9 cells suspended in sterile pbs (day 0). all mice continued daily treatment with either 0 mg or 15 mg curcumin by gavage, topical, or both, and tumors were measured daily with digital calipers. xenograft tumors did not form in one animal per group and were excluded (n = 9 per group). tumor volume (mm) was calculated using the following formula : (0.52 length width). body weight was measured daily, and mice were monitored for adverse effects from the experiment. daily oral gavage and tumor volume measurement continued through day 29, at which time tumors were harvested after the mice were anesthetized with isoflurane and sacrificed. ex vivo tumor volume was calculated using the following formula : (4/30.5 length 0.5 width 0.5 height). the study pathologist (fa) measured maximum skin thickness, including the stratum corneum but not the granular layer. pooled serum from mice (n = 3/group) was analyzed by enzyme - linked immunosorbent assay (elisa, bd bioscience) according to the manufacturer 's instructions, to assess expression of human and murine il6. tumors harvested on day 29 were embedded in paraffin, sectioned, and h&e stained for confirmation of squamous cell carcinoma presence by our study pathologist (fa). tumors (n = 3 per group) were then stained with phospho - erk (cell signaling, thr202/tyr204 ; 1 : 600) and phospho - stat3 (cell signaling, tyr705 ; 1 : 200) as previously described [15, 16 ]. paraffin sections of tumors with overlying mouse skin were probed with perk1/2 and pstat3 antibodies (cell signaling) followed by an alexa-546-labeled secondary antibody. human actinic keratosis, skin scc, and bcc paraffin - embedded blocks were sectioned and stained with phospho - p44/42 mapk (erk 1/2) rabbit monoclonal antibody (thr202/tyr204, 1 : 600) and phospho - s6 ribosomal protein rabbit monoclonal antibody (ser235/236, 1 : 100) as previously described [1719 ] and read by our study pathologist (fa). specimens were scored based on the intensity of antibody nuclear and cytoplasmic staining in each slide, with absence of staining scored as a, weak or focal staining scored as a [+ ], and strong staining with a [+ + ]. soluble proteins extracted from srb12-p9 cell lysates treated with 0 m or 20 m curcumin for 24 hours or xenograft tumors were analyzed by western blot as previously described. proteins were detected using enhanced chemiluminescence (amersham pharmacia biotech, piscataway, nj, usa) and analyzed with imagequant tl7.0 (ge healthcare) software (n = 6/group). the following antibodies from cell signaling were used : akt (1 : 200), phospho - akt (ser ; 1 : 100), s6 ribosomal protein (1 : 500), phospho - s6 ribosomal protein (ser ; 1 : 500), stat3 (1 : 200), phospho - stat3 (tyr705 ; 1 : 200), 4ebp1 (1 : 200), phospho-4ebp1 (ser ; 1 : 200), erk1/2 (1 : 200), phospho - erk1/2 (thr / tyr ; 1 : 200), and actin (1 : 3500). all bcc and scc tissue samples were obtained from patients recently diagnosed with nonmelanoma skin cancer of the face or neck, after obtaining approval by the institutional review board and obtaining informed consent from all subjects. patients were treated primarily with surgical resection at louisiana state university health shreveport and the overton brooks veterans administration hospital from 2009 to 2011. formalin - fixed, paraffin - embedded tissue blocks were obtained from 27 bcc tissue samples, 4 actinic keratosis (ak) tissue samples, and 17 scc tissue samples (from 16 scc patients). normal human skin samples were surgically obtained from uninvolved adjacent skin in patients undergoing resection for skin cancer. several 5 m slides were cut from each tissue block, and one slide was stained with hematoxylin and eosin (h&e) and reviewed by a pathologist to confirm pathologic findings and assess surgical margins. proliferating cell percentages were compared using one - way analysis of variance (anova). one - way anova was also used to determine significant differences in skin thickness and the differences between individual treatment groups. a tukey 's multiple comparison as a post hoc test was performed to evaluate differences between treatment groups. tukey 's post - hoc testing, chi - square test for independence, or fisher 's exact probability test was used to determine the ability of perk and ps6 expression to correlate with cutaneous scc, differentiate tumor types from normal skin and bcc, and determine if there was a significant difference between perk and ps6 staining and the different types of histologic cutaneous lesions. paired t - test was used to determine significant difference in biomarker expression by western blot analysis. to determine whether a skin scc cell line is sensitive to curcumin, a cell proliferation assay was performed on srb12-p9 scc cell line. curcumin 's growth inhibitory effects in the aggressive skin cancer cell line (srb12-p9) were noted as early as day 2 at 20 m (p < 0.05) curcumin compared to control. curcumin treatment at doses 20 m and 40 m was significantly effective in inhibiting the proliferation of srb12-p9 cells compared to control on days 2 and 3 (p < 0.05 ; figure 1(a)). curcumin appears to inhibit growth compared to control in srb12-p9 xenograft tumors after tumor cells had a chance to engraft (figure 1(b)). there was a significant effect for curcumin treatment (f(3, 96) = 11.58, p < 0.001) in suppressing growth of the srb12-p9 xenograft tumors. tukey 's post hoc comparisons of the four groups indicate tumor volume from the gavage group (m = 44.55, 95% ci [35.77, 53.77 ]) and the combined group (m = 88.81 ci [71.73, 105.89 ]) was significantly smaller than the control group tumor volume (m = 191.35, 95% ci [127.12, 255.59 ]), p < 0.001. the topical group (m = 130.66, 95% ci [95.29, 166.04 ]) tumor volume was also statistically smaller than the control group tumor volume (p = 0.02). there was no difference between the gavage group tumor volume and the topical group tumor volume (p = 0.19). because invasive tumors could give inaccurate measurements and overlying skin could influence in vivo tumor measurements, we also measured tumors ex vivo and measured skin thickness (figure 1(c)). there was a significant effect of curcumin on ex vivo tumor volume (f(3, 32) = 5.49, p = 0.004). tukey 's post hoc comparisons of the four groups indicate that the tumor volumes from the gavage group (m = 72.06, 95% ci [37.78, 106.35 ]), topical group (m = 195.82, 95% ci [71.59, 320.05 ]), and combined group (m = 152.32, 95% ci [101.048, 203.60 ]) were significantly smaller than the control (m = 416.77, 95% ci [161.48, 672.06 ]), p < 0.001, p = 0.006 and 0.02, respectively. there was a significant effect for curcumin treatment on tumor mass (f(3,32) = 5.79, p = 0.003), where the gavage group (m = 0.043, 95% ci [0.02, 0.07 ]), topical group (m = 0.112, 95% ci [0.041, 0.184 ]), and combined treatment group tumors (m = 0.076, 95% ci [m = 0.050, 0.101 ]) were significantly smaller than that of the control group (m = 0.244, 95% ci [0.09, 0.39 ]) tumors, p < 0.001, p = 0.02, and 0.003, respectively. there was no difference in skin thickness in mice treated with curcumin by gavage, topical, and combined groups compared to the control group (p = 0.73). we next evaluated curcumin 's effects on signaling pathways in the aggressive skin cancer cell line (srb12-p9) in vitro. using a concentration that significantly inhibited cell growth (20 m), there was significant inhibition of pakt, ps6, p-4ebp1, pstat3, and perk1/2 (figure 2). as can be seen in figure 2 there was about twofold inhibition in the phosphorylation of the aforementioned markers in srb12-p9 cells after curcumin treatment. we next evaluated curcumin 's effects on signaling pathways in xenograft tumors using western blot analysis (figure 3). among the tested biomarkers an inhibition of perk1/2 was noted in the curcumin - treated groups, whereas inhibition of pstat3 was only noted in the combined curcumin group (figure 3(a)). as western blot analysis involves homogenization of total tumor tissue, such as stroma and infiltrating host inflammatory cells, we also evaluated curcumin 's effects on signaling pathways by immunohistochemistry, which can distinguish nonviable and nontumor components, such as stroma, that are not included in the scoring of the biomarker analyzed. ihc results revealed strong positive perk staining throughout tumors in the control group and weaker, focal staining in the curcumin - treated tumors (figure 3(b)). immunofluorescence confirmed curcumin 's effects on perk and a shift in the subcellular localization of the activated state of stat3 in the topical group compared to the control group (figure 3(c)). therefore, we evaluated its effects on the inflammatory marker il6 in all curcumin treatment groups using pooled serum samples. the levels of soluble il6 were the lowest in the topical curcumin group, while curcumin did not affect il6 levels in the gavage or combined groups (figure 3(d)). age ranged from 39 to 93 with a mean age of 66 14 years. there was no difference in age between the groups by anova (f = 1.272, p = 0.29). the large majority of patients were white, except for one african american patient with albinism. nonmelanoma skin cancers analyzed were excised from the external nasal skin (14), cheeks (14), ears (9), scalp and forehead (13), neck, chin, and lip (6). no skin site was overrepresented in analysis. the presence and intensity of perk and ps6 staining in all scc, bcc, and normal tissue samples were compared (table 2). all scc specimens (n = 17, 100%) stained positive for phosphorylated erk, while only 10 of 27 (37%) bcc samples stained positive. although all the normal skin samples stained weakly positive (grade 1 +) for activated perk in the stroma, palisading cells, and epithelium (n = 24, 100%), significantly more scc specimens showed strong staining with perk (grade 2 +) than normal skin (p = 0.0028, table 2 and figure 4). however, the majority of bcc specimens (17/27, 63%) showed no perk staining (p < 0.0001 compared to normal skin). most specimens containing scc (n = 13, 81%) and bcc (n = 16 ; 64%) showed strong staining (grade 2 +) for activated ps6, while all the analyzed normal skin specimens (n = 8 ; 100%) demonstrated negative ps6 staining. tumor specimens expressed significantly more activated ps6 than normal skin samples (1 + score and above ; p < 0.0001 ; figure 4). skin cancer type significantly predicted intensity of perk staining, as scc tumors stained more intensely for perk than the background stroma in normal skin and bcc tumor cells (p < 0.0001 ; figure 4). when perk expression was analyzed and compared to other demographic factors, the variance in perk expression scores correlated significantly with tumor type, r = 0.25, p = 0.0007. patient age (p = 0.85) and gender (p = 0.35) did not explain the variance in perk staining. identifying consistent intracellular biomarkers at which a potential chemopreventive may act is essential prior to initiating clinical trials. as curcumin acts on many different biomolecular targets in a variety of different cell types it is important to determine if curcumin directly affects either a few major downstream biomarkers or a multiplicity of downstream targets which may serve to explain curcumin 's varying effects in different cell types. aberrant signaling through the epidermal growth factor receptor (egfr) plays a major role in cutaneous skin cancer progression. egfr inhibitors have been used for scc therapy to downregulate aberrant egfr signaling with little change in overall survival, possibly due to compensating mutations downstream of egfr. one of these signaling pathways is pi3 k / akt that plays a role in skin carcinogenesis and in chemotherapy resistance. activated ras / raf signaling has also been implicated in a small percentage of scc and can lead to activation of the mapk pathway. ras / raf gain - of - function can occur through activation of erk1 and erk2, which are constitutively active in 70% of malignant melanoma due to ras or braf activating mutations. activated erk1/2 is rarely seen in normal skin specimens but is shown in all cases of scc with a positive association with the degree of malignancy and proliferative activity of scc. in this study, zhang another study looked at activated erk in 101 human head and neck squamous carcinoma specimens. therefore, inhibiting erk may be a promising approach in targeted cutaneous skin scc therapy. having previously determined curcumin 's growth inhibitory effects in skin scc, we sought to determine whether these effects were similar to our observations in upper aerodigestive head and neck scc (hnscc) where curcumin inhibited the akt / mtor pathway through rapid curcumin - dependent inhibition of mtor 's downstream target ps6 and 4ebp1 phoshorylation. in this study we found significant and complete inhibition of srb12-p9 cell proliferation after treatment with curcumin at a dose 20 m or higher (figure 1(a)) suggesting a highly potent anticarcinogenic effect of curcumin in skin cancer. additionally, we found that the inhibitory effect of curcumin on skin cancer proliferation was associated with inhibition of akt / mtor and erk signaling (figure 2). in our in vivo study, however, given the thin nature of mouse skin, topical curcumin penetration was much greater such that curcumin possibly did not remain in the epidermis for a prolonged period, leading to prolonged contact with the cancer cells. the irritant nature of the cream caused the skin overlying the tumor to thicken, although this was not statistically significantly different from control (p = 0.73). the srb12-p9 cell line is invasive in this model, producing inaccurate tumor caliper measurements due to the inability to account for the portion of the tumor that invaded into the abdominal wall. therefore, the ex vivo tumor weight provided a more accurate tumor size endpoint. in human skin, scc emerges directly from the epidermal layer, unlike in our xenograft model, where tumor is encapsulated under the epidermis. we therefore anticipate a more pronounced tumor - suppressive effect of topical curcumin in humans. the srb12-p9 xenograft cells were more sensitive to curcumin - induced cell death and apoptosis than the surrounding normal mouse skin and grew at a much slower rate in the presence of curcumin, whether topical or systemic, compared to control. because il-6 may contribute to angiogenesis and metastasis, inhibition of il-6 with topical curcumin suggests a mechanism of chemoprevention. although curcumin has previously been shown to inhibit il-6 in hnscc cell lines, this is the first skin cancer model investigating curcumin 's inhibition of systemic il-6. the present study demonstrates that topical curcumin reduces skin scc tumor growth, and this effect might be explained, by the inhibition of il-6. in this study we demonstrated significant inhibition of several biomarkers of the akt / mtor pathway as well as stat3 and erk1/2 in srb12-p9 cells after treatment with 20 m of curcumin. in our in vivo experimentation, we observed inhibition of perk in the curcumin - treated tumors and inhibition of pstat3 in the combined curcumin group. however, tumor heterogeneity and degree of dysplasia can often confound immunohistochemistry results, depending on where in the lesion the biopsy was taken. therefore, it is important to develop serum biomarkers that can be obtained with a simple blood draw. as curcumin is a well - known anti - inflammatory agent, we measured its effects on pooled serum of treated mice and noted a decrease in il-6 in the topical group compared to the control group. however, only three mice in each group were analyzed, and it is possible that statistically significant differences in il6 levels could be detected upon analysis of greater numbers of mice in the topical and combined curcumin - treated groups compared to control mice. as curcumin slowed progression of aggressive skin scc xenografts and inhibited perk expression, the erk pathway may prove to be a key biomarker in developing topical pharmaceutical agents that prevent skin scc tumor growth or recurrence. we observed that the overall reduction in perk staining in the curcumin - treated tumors was not cell autonomous but rather manifested as an expansion in areas of very low or no expression, such that focal regions of intense staining remained. alternatively, control tumors had smaller regions of low staining and a higher number of intensely staining areas. this indicates that a global reduction of perk staining was achieved with curcumin treatment, rather than a complete shutdown. confirmed that phosphorylated erk is overexpressed in patient skin scc in a caucasian population, which further supports our findings and suggests that perk may be a useful chemoprevention biomarker. the anti - inflammatory properties of curcumin may contribute to its potential as an effective chemopreventive agent. however, curcumin 's systemic anti - inflammatory effects (reduced serum il-6 levels) were more pronounced in topical curcumin group compared to gavage. given these findings, it was unexpected that tumor growth was inhibited more effectively in the gavage group than in the topical group. however, there was no statistically significant difference in tumor volume between the two treatment groups. despite this data, we speculate that local anti - inflammatory activity of topically applied curcumin contributes significantly to its chemopreventive activity, circumventing its poor systemic bioavailability. as curcumin continues to be explored as a chemopreventive and therapeutic agent for skin cancer treatment, establishing defined biomarkers the erk pathway is an important protein kinase signaling cascade involved in cellular proliferation and is activated in carcinogenesis. in this study, activated perk expression significantly increased in scc compared to the less aggressive bcc and ak. as curcumin has been shown to inhibit activated erks in carcinogenesis, the present data suggests that components of the erk pathway may prove to be key biomarkers for curcumin chemopreventive efficacy in cutaneous scc. | skin squamous cell carcinoma (scc), the most common cancer in the usa, is a growing problem with the use of tanning booths causing sun - damaged skin. antiproliferative effects of curcumin were demonstrated in an aggressive skin cancer cell line srb12-p9 (p < 0.05 compared to control). topical formulation was as effective as oral curcumin at suppressing tumor growth in a mouse skin cancer model. curcumin at 15 mg administered by oral, topical, or combined formulation significantly reduced tumor growth compared to control (p = 0.004). inhibition of pakt, ps6, p-4ebp1, pstat3, and perk1/2 was noted in srb12-p9 cells post - curcumin treatment compared to control (p < 0.05). inhibition of pstat3 and perk1/2 was also noted in curcumin - treated groups in vivo. ihc analysis revealed human tumor specimens that expressed significantly more activated perk (p = 0.006) and ps6 (p < 0.0001) than normal skin samples. this is the first study to compare topical curcumin to oral curcumin. our data supports the use of curcumin as a chemopreventive for skin scc where condemned skin is a significant problem. prevention strategies offer the best hope of future health care costs in a disease that is increasing in incidence due to increased sun exposure. |
metastatic spinal tumors are the most common tumors of the spine, accounting for 98% of all spine lesions. the commonest malignancies that metastasize to the spine include breast (21%), lung (14%), prostate (7.5%), renal (5%), gastrointestinal (5%) and thyroid (2.5%). among the thyroid malignancies, follicular thyroid carcinoma represents less than 10%. this tumor is usually well encapsulated and often demonstrate vascular invasion and spread via vascular channel. bone is the second most common site of metastasis resulting from thyroid cancer, after the lung. in contrast, follicular thyroid carcinoma is the most common histological origin of bone metastasis with an incidence ranging from 7% to 28%. metastasis to the bone, specifically to the vertebral column, may present as bone pain, pathological fracture, or cord compression and is frequently a surgical issue. however, the spinal cord compression, as a complication of thyroid carcinoma, is uncommon. the literature review showed most of the metastatic follicular carcinoma had obvious thyroid swelling and many cases had previous thyroid surgery. but, spinal metastasis of occult follicular carcinoma without any thyroid enlargement or without any thyroid related symptoms is unusual and relatively rare and because of this rarity of the disease, this case was reported. metastatic thyroid carcinoma should be considered in the differential diagnosis of every patient with new onset spinal cord compression. a 35-years - old female patient presented with the complaints of the pain on the middle part of her back for eight months. initially, the pain was exacerbated by standing or walking and subsided by rest but later, the patient took some medications to get relief of the pain. about five months ago, she noticed a small swelling on the middle part of the right side of her back but there was no associated pain or discharge or any skin change over the area. then she noticed weakness and heaviness of both legs along with gradual wasting of leg muscles and some extent of difficulties on walking for the last four months. but for the last two months, the patient was totally unable to stand or walk. the patient had no history of hypertension, diabetes mellitus, bronchial asthma, tuberculosis, jaundice or any neck swelling. the patient had no history of smoking, betel nut chewing or alcohol intake. on physical examination, she was mildly anemic, normotensive and wasting of calf muscles. there was an ill defined, non tender and firm lump on the right paravertebral region at the level of d11-l1 [figure 1 ]. on neurological examination, there was a marked loss of muscle function with grades 1/5 strength in both lower extremity muscles with increased the muscle tone. the x - ray of dorso - lumber region showed bony destruction of transverse process of l1 and pedicles of d12 and l1 [figure 2 ]. a magnetic resonance imaging (mri) scan showed a huge mass involving the right para spinal area and spinal cannel at d11-l1, compressing the spinal cord (d11-d12) and destroyed the posterior arches of the vertebra (d12-l1) [figure 3a and b ]. arrows indicating right paravertebral swelling x - ray of dorsal spine showed (arrow marks) transverse process of l1 (rt.) and pedicles of d12 and l1 nonvisualized (destroyed) a magnetic resonance imaging scant1w images a - coronal and b - axial section showed a huge mass involving the right para spinal area and spinal cannel at d11-l1, compressing the spinal cord (d11-d12) and destroyed the posterior arches of the vertebra (d12-l1) decompression of spinal cord by laminectomy of d11- l1 with excision of tumor from both intra - spinal and para - spinal region was done. on histopathological examination, the specimen microscopically appears to be thyroid tissue showing follicular adenoma. as it is taken from the vertebra, it is regarded as metastatic follicular carcinoma [figure 4b and c ]. (b - c) microphotograph of histopathological section showed follicular carcinoma of thyroid then again the clinical examination of thyroid gland was done which was found not enlarged and biochemical thyroid profile (t3, t4 and tsh) was found normal. fine needle aspiration cytology (fnac) of thyroid gland suggested in favor of nodular goiter. the patient then underwent a near total thyroidectomy, but macroscopically no tumor was found in the extirpated issue. the histopathological examination of the tissue also revealed in favor of a normal thyroid tissue. the patient gradually improved her neurological functions. on the follow - up visit after six months between 5% and 10% of all cancer patients develop spinal metastases during the course of their disease. the commonest malignancies that metastasize to the spine include breast (21%), lung (14%), prostate (7.5%), renal (5%), gastrointestinal (5%) and thyroid (2.5%). among the thyroid cancer only 5% of patients have metastases beyond the cervical or mediastinal area on initial presentation and a spinal metastasis as the presenting feature of thyroid cancer is unusual. however, spinal cord compression as an initial manifestation of newly diagnosed thyroid carcinoma is a rare event. available data indicate that only a few sporadic cases of spinal cord compression presenting as the initial manifestation of occult thyroid carcinoma have been reported by fone - ching hsiao,. of all thyroid cancer subtypes, follicular carcinoma is the most likely to present with distant metastasis or to do so as a late event in a long - standing disease. fornasier and horne reviewed a series of autopsy and found, out of 374 specimens from patients with malignancies, 140 of whom had metastatic spread to the vertebral bodies. barron. reviewed 127 autopsies of patients with spinal cord compression resulting from metastatic neoplasms, and found only three of the tumors were of thyroid origin. reported a case of follicular thyroid carcinoma who presented with paraplegia and urinary incontinence also commented that follicular thyroid carcinoma with metastasis rarely presents with clinical picture of spinal cord compression. tumor metastasizing to the spinal column is a common clinical occurrence but asymptomatic thyroid malignancy presenting, as paraplegia is uncommon. the most common presenting symptom of patients with symptomatic spinal metastases is pain, which occurs in 83 - 95% of patients, and may precede the development of other neurological symptoms by weeks or months. motor dysfunction is the next most common symptom of patients with metastatic disease of the spine. weakness in one or more muscle groups is found in 60 - 85% of patients with metastatic spinal cord compression. sensory disturbances including anesthesia, hyperesthesia, and paresthesia usually occur in concert with motor dysfunction and pain in the corresponding dermatomal distributions. for detecting spinal metastases, bone scan (99mtc - mdp) is more sensitive than plain radiographs. until mri became widely available, myelogram and ct scan were the best diagnostic modalities for assessing acute spinal cord compression. fluorine-18 fludeoxyglucose (fdg) positron emission tomography (pet) is a well established method to differentiate malignant from benign lesions in the spine or to demonstrate the viability of previously treated spinal tumor metastasis. in thyroid cancer, pet is useful in patients with metastatic poorly differentiated tumors with high thyroglobulin (tg) levels and negative 131i whole - body scan results. early diagnosis of metastatic spinal disease is important because functional outcome depends on neurologic condition at the time of presentation. therapeutic intervention can alleviate pain, preserve or improve neurologic function, achieve mechanical stability, optimize local tumor control, and improve quality of life. treatment options available for metastatic spine tumors include radiation therapy (rt), surgery, and chemotherapy. although some patients underwent only surgical treatment and/or external irradiation for the relief of symptoms, an appropriate and intensive treatment of both the metastatic and primary thyroid tumors is required to achieve long - term survival and a good quality of life for the patients. to prevent further neurological deficits, it is usually advisable to initially and promptly stabilize the spine, especially in the context of potential long - term survival. traditionally, corticosteroids, local radiation treatment, and surgery to the vertebrae were all thought to be important for most patients with spinal cord compression. stojadinovic. recommended surgery as the preferred method for resectable, locoregional recurrence, followed by radioactive iodine (rai) therapy for iodide - concentrating thyroid cancer, or external - beam radiation for tumors that lack rai avidity. those investigators also found that complete palliative debulking of the localized metastatic lesions of follicular thyroid carcinoma may be associated with an improvement in the patient 's survival and quality of life. solitary distant metastases of follicular thyroid carcinoma are very rarely amenable to complete resection and thus some local procedures to delay tumor progression and for symptom palliation are used, such as embolization, radio frequency, or cement injection and treatment with bisphosphonates. however, both the locoregional recurrence rate and the mortality rate were reduced to about 25% in patients treated with rai. a recent review of the literature indicated that although external radiotherapy in association with rai therapy has an effect on cancer recurrence, pain relief, and the recalcification of osteolytic lesions, external radiotherapy per se can not improve the survival rate. instead, complete removal of any tumoral bone tissue in patients less than 45 years of age and a cumulative dose of rai therapy appeared to improved survival in patients with bone metastases originating from follicular thyroid carcinoma. the prognosis of occult thyroid carcinoma with distant metastasis also remains a source of contention. demonstrated that follicular carcinoma is usually less life threatening, and that early diagnosis and appropriate treatment for distant metastases can significantly prolong the life span and improve life quality. shaha. also reported that total thyroidectomy followed by rai therapy and thyroxine suppressive treatment extended long - term survival (10 - 15 years) in 44% of patients with metastatic follicular thyroid carcinoma. however, pittas. reported that the 10- year survival of patients diagnosed with bone metastasis was only 13%. the patient 's refusal of further treatment and the inevitable significant co - morbidities probably have a major adverse effect on survival. prompt management of the primary carcinoma and the metastatic lesion, ongoing maintenance of thyroid suppression, and consideration of the patient 's age, response to therapies, and co - morbidities, may extend long - term survival and allow a favorable prognosis. finally, it is recommended that thyroid carcinoma should be considered in the differential diagnosis of every patient with new onset spinal cord compression. | metastatic tumors are the most common tumors of the spine, accounting for 98% of all spine lesions. but spinal cord compression as the initial presentation of metastatic occult follicular carcinoma without any thyroid enlargement is unusual and relatively rare. this report describes a 35-years - old female patient presenting with paraplegia and urinary incontinence for the last two months. she had no thyroid enlargement ; no thyroid related symptoms and her biochemical thyroid profile was normal. magnetic resonance imaging (mri) of spine shows a huge mass compressing the spinal cord at d11-d12 involving both the spinal and paraspinal areas. the patient was treated by surgery and radioiodine ablation as the histopathology showed metastatic follicular thyroid carcinoma. this case was reported because of the rarity of the disease. early diagnosis and initiation of the treatment should promise a good prognosis for a patient with metastatic spinal cord compression. |
disseminated intravascular coagulation (dic) is the most frequent coagulation disorder in patients with prostate cancer.1 dic occasionally occurs as a presenting sign of metastatic prostate cancer.2,3 clinical symptoms of dic associated with prostate cancer range from a subclinical marker of disease to overt bleeding after trauma or surgical procedures.3,4 despite its frequent occurrence, little is known about the clinical presentation of dic in prostate cancer. specifically, renal involvement in dic as a presenting sign has not been reported in the literature. in the present article, we describe an autopsy case of metastatic prostate cancer presenting with progressive renal dysfunction, which was augmented by dic. we have described this case with emphasis on the renal histopathology characteristic of dic, and include a brief review of the literature. this unusual case presentation demonstrates that dic should be considered when prostate cancer patients present with renal dysfunction due to unknown etiology and therefore a comprehensive work up for dic should be performed even in the absence of apparent hemorrhagic tendency. an 80-year - old japanese man was found to have increased serum prostate specific antigen levels of 231.5 ng / ml (normal : < 1.0 ng / ml) on a routine medical checkup. he had a long - standing history of hypertension and underwent a needle biopsy of the prostate gland that showed gleason 4 + 5 = 9 adenocarcinoma. a computed tomography scan revealed that the tumor had invaded the bladder, and multiple metastatic lesions were found in the lumbar regions. he was started on a luteinizing hormone releasing hormone agonist (leuprolide) and androgen antagonist (flutamide), and was followed at an outpatient clinic. his serum creatinine levels were within a normal range (0.81.4 mg / dl) at this time. the patient s prostate specific antigen level increased to 1530 ng / ml 4 months later. a computed tomography scan revealed an increasing number of metastatic lesions in the lumbar bones. at this time after 1 month, his dyspnea worsened as the renal failure progressed with a creatinine level of 2.89 mg / dl. a urine test showed strong presence of protein (+ + +) and occult blood (+ +). g / dl), and his albumin was 2.3 g / dl (normal : 3.55.5 g / dl). laboratory evaluation performed on the first day of intensive care unit admission revealed the following results : hemoglobin level, 10.2 g / dl ; platelet count, 60 10/l (normal : 150400 10/l) ; and total leukocyte count, 18.2 10/mm (normal : 4.011 10/mm). his prothrombin time was 16.3 seconds (normal : 11.515.5 seconds), and his prothrombin time and international normalized ratio was 1.8 (normal : 11.25). the activated partial prothrombin time was 38.5 seconds (normal : 25.236 seconds) ; the serum fibrinogen level, 168 mg / dl (normal : 170410 mg / dl) ; and d - dimer level, 28.8 g / ml (normal : < 1.0 g / ml). his fibrin degradation product level was 93.9 g / ml (normal : < 10 g / ml). although a bleeding tendency was not clinically evident, he was diagnosed with dic based on the laboratory data. treatment with antithrombin - iii and blood transfusion was initiated. on the second day at the intensive care unit, he had oliguria associated with a serum creatinine level of 5.19 mg / dl, for which hemodialysis was started. his serum total protein was 5.1 g / dl, and his albumin level was 1.9 g / dl. chest x - ray revealed pulmonary infiltrates in both lungs, which was suggestive of alveolar hemorrhage. on day 14, he experienced cardiac arrest and expired. an autopsy was conducted after obtaining permission from family members to elucidate the mechanisms of renal failure (rf). gross examination of the kidney revealed an irregular and roughly granular cortical surface, and there was marked congestive changes mainly involving the medulla. the arcuate and interlobular arteriolar walls showed moderate to severe thickening due to intimal fibrosis. these chronic glomerular and vascular alterations are reflective of hypertensive nephrosclerosis related to the patient s long standing hypertension. the vast majority of the remaining glomeruli showed numerous thrombi formation mainly involving peripheral glomerular capillaries and afferent arterioles, reflective of severe coagulation disorder (figure 1a and b). some glomerular capillaries were distended by thrombi with features of thrombotic microangiopathic injury. a phosphotungstic acid hematoxylin stain identified dark blue fibrin strands constituting the thrombi (figure 1c). cd41 immunostaining showed the presence of sparsely scattered platelets within the thrombi (figure 1d). we believe that the formation of these thrombi under the condition of reduced nephrons due to nephrosclerosis highly contributed to progressive rf in this case. in addition, focal segmental glomerulosclerosis (fsgs) was identified in 1% of nonglobally sclerotic glomeruli. the fsgs was characterized by segmental sclerosis of capillary architecture associated with attachment to bowman s capsule, accompanied by the prominence of overlying epithelial cells (figure 1e). another glomerulus exhibited the segmental obliteration of a few capillaries by infiltration of mononuclear leukocytes and foam cells, and attachment to bowman s capsules near the urinary pole (figure 1f). active lesions or thrombi formation were not evident in the interlobular or arcuate arteries. in the lung, multiple foci of intra - alveolar hemorrhage in the background of diffuse edema with occasional thrombin formation were observed in the small to medium sized arteries. adenocarcinoma was identified in the prostate with direct invasion into the bladder and multiple metastatic lesions involving the thoracic and lumbar vertebrae. dic has been one of the most common complications of prostate cancer since the first report in 1953.5 clinical signs of dic are noted in only 0.4%1.65% of patients with prostate cancer, including a bleeding tendency.6 in these patients, dic can be triggered by surgical procedures like prostate biopsy causing hemorrhage in multiple sites, such as the skin, genitourinary organs, gastrointestinal tracts and the brain.3,7,8 to our knowledge, the occurrence rate of rf associated with dic, as seen in our case, has not been previously documented. the incidence of dic depends on the tumor stage, and it is enhanced in metastatic hormone refractory disease.8,9 hyman recently reported that more than half of the patients with prostate cancer who develop dic had high grade disease (gleason scores of eight, nine, or ten).8 in our case, the patient had prostate cancer with a gleason score of nine and metastatic hormone refractory disease, consistent with previous reports. dic represents the result of a widespread activation of the coagulation pathway.10 dic proceeds from the simultaneous occurrence of systemic fibrin formation resulting from an increased generation of thrombi, impaired physiological anticoagulation mechanism, and inadequate fibrinolysis. the combination of increased formation and impaired removal of fibrin results in thrombotic occlusion of small and medium sized vessels. in cancer patients, tumor cells express a variety of procoagulant molecules including tissue factor and cancer procoagulant, which activate the host s hemostatic system.11,12 tumor cells also express fibrinolytic inhibitors such as plasminogen activator type 1, creating the hypofibrinolytic state that is characteristic of dic.13 proinflammatory cytokines, such as tumor necrosis factor and interleukin-6, are also involved in dic development.14,15 unfortunately, the underlying mechanism of dic in prostate cancer has not been fully investigated and further studies are still needed. we expect that elucidation of the detailed mechanisms would enable us to invent new therapies and drugs to prevent the development of coagulation disorders in prostate cancer patients. in our case, the most prominent histological furthermore, many afferent arterioles were occluded by thrombi, resulting in the collapse of the glomerular tufts, which is often called bloodless glomeruli. these vascular lesions are very similar to those of thrombocytopenic thrombotic purpura (ttp)/hemolytic uremic syndrome (hus), which also occurs in prostate cancer.1619 despite the histological resemblance, major difference exists in the vascular lesions between dic and ttp / hus. in dic, thrombi are fibrin rich, whereas ttp / hus presents with platelet - rich thrombi.2022 clinically, ttp / hus patients have normal platelet counts and prothrombin and d - dimer levels. this is in contrast to dic, in which coagulation disorders are evident.23 in our case, the dic diagnosis was established on the basis of abnormal laboratory data, such as low platelet count, prolonged prothrombin, and increased d - dimer and fibrin degradation product levels. this diagnosis was confirmed histologically by the presence of fibrin rich thrombi revealed by the phosphotungstic acid hematoxylin stain. additionally, ttp / hus can be reversible when properly treated whereas dic is refractory to treatment and has a poor prognosis, which is consistent with the present case. fsgs is a pattern of glomerular injury that occurs as a primary form or as secondary to many conditions.24 the cause of primary fsgs is usually unknown, and patients often present with significant nephrotic syndrome, which was not identified in our case. in contrast, secondary forms of fsgs may be associated with a variety of conditions, including chronic hypertension, pyelonephritis, morbid obesity, and renal transplantation.2528 a possible mechanism of secondary fsgs is a reduced number of nephrons, which increases glomerular pressure within remnant glomeruli and results in glomerular podocyte and/or endothelial injury.25 in our case, the patient appeared to have a reduced number of nephrons due to hypertensive nephrosclerosis before the onset of dic. we therefore speculate that the occurrence of dic to the kidney with reduced nephrons may have augmented podocyte and/or endothelial injury of glomeruli, resulting in fsgs. in summary, we have reported an autopsied patient who died of dic associated with metastatic prostate cancer. we described clinicopathological aspects of dic in prostate cancer and renal pathology of dic along with a brief review of the literature. we propose that a differential diagnosis of dic should be considered when a patient with prostate cancer presents with renal dysfunction and that complete physical and laboratory tests, including coagulation study, should be performed to detect a cause of renal dysfunction even in the absence of hemorrhagic tendency. | disseminated intravascular coagulation (dic) is the most frequent coagulation disorder in patients with prostate cancer. however, renal involvement in dic associated with prostate cancer has rarely been documented. herein, we present a case of metastatic prostate cancer presenting with acute renal failure (rf) triggered by dic. an 80 year old man with metastatic prostate cancer was treated with antihormone therapy at an outpatient clinic. he was admitted to our hospital because of severe dyspnea and progressive rf. a hemorrhagic tendency was not clinically evident. laboratory tests exhibited a significant coagulation disorder, suggestive of dic. despite treatment, his rf and dyspnea worsened, and he eventually passed away. an autopsy study revealed hypertensive nephrosclerosis superimposed by fibrin rich thrombi formation involving glomerular capillaries and arterioles characteristic of dic. additionally, focal segmental glomerulosclerosis was identified, which was presumably secondary to the glomerular endothelial and/or podocyte injury augmented by dic. those findings showed that glomerular injury, which was induced and subsequently exacerbated by dic associated with prostate cancer, highly contributed to the progression of rf in our case. a differential diagnosis of dic should be considered when a patient with prostate cancer presents with renal dysfunction. |
congenital anomalies affect a remarkable proportion of newborn population and contribute significantly to the childhood mortality and hospital admissions. every year an estimated 7.9 million children are born with a serious birth defect, 3.3 million children (under five years) die from birth defects, and 3.2 million who survive may develop a disability later in the life. they are the leading cause of prenatal mortality and childhood morbidity and disability in many countries. the wide range of causes of birth defects means that a portfolio of prevention approaches is needed. the prevention of these disorders is available in 60% of cases [3, 4 ]. prevalence studies of congenital anomalies are useful to establish baseline rates, to document changes over time, and to identify clues to the etiology. many of developed countries monitor the prevalence of birth defects through registration or surveillance system of fetuses and infants. in addition, international organizations have been established to conduct worldwide surveillance and research into the occurrence and possible causes of congenital anomalies and to establish prevention strategies. congenital anomalies are the most common causes of death in children (159 months) in iran. studies reporting birth defects prevalence in iran, however, are mostly limited to particular type of defects [711 ]. without comprehensive data on congenital anomalies, it is difficult to evaluate possible teratogens and to implement effective prevention and care services. this information is also important for planning and performing antenatal screening for congenital anomalies, particularly in high risk populations. nevertheless, published comprehensive data about the prevalence of birth defects are scarce in developing countries including iran. the aim of this study was to determine the epidemiological features of congenital anomalies in rural areas of tabriz, a major city in the northwest of iran. rural iran benefits from a well - established primary health care (phc) network. the network is well organized and is credited with the improvements in health outcomes that have been observed since the 1980s in rural areas. the health houses are the first level of contact between the rural community and the health network in the country covering one or several villages in a region. each health house is staffed by one or more behvarzes who recruited permanently by the ministry of health and usually come from the health houses catchment area. before behvarzes start working in health houses, they attend a special two - year training program. some of the important tasks of behvarzes are annual census of the population covered, prenatal, natal and postnatal care, care of children under 5 years of age, care of school age children, family planning services, immunization, case finding and referral, and home visits for followup of drop - out cases. they also serve as an important component of the health information system of the phc network. the system gathers all health related data and provides health information in health houses catchment area. since each behvarz covers about 1500 people and s / he is well anchored in her / his community, the risk for missing data is very low. they support and supervise the activities of the rural health houses in the catchment area. this study was carried out in the district of tabriz, a major city in the northwest of iran. the study population comprised live births born between 2004 and 2012 in rural areas of tabriz district. rural population in the region is about 158731 people receiving their primary health care from 47 health houses and 17 health centers. congenital anomalies were defined as structural defects, chromosomal abnormalities, inborn errors of metabolism, and hereditary disease diagnosed before, at, or after birth. all 22500 health records of the children (live births) under 8 years of age in the health houses were assessed by 10 expert health workers, and the children with confirmed congenital anomalies were identified. the coverage for recorded information is nearly complete for those under 8 years of age. the definition of the congenital anomalies was based on the standard coding system of the international classification of diseases (10th edition) according to the primary diagnosis of anomaly. for each case, basic demographic information and a detailed clinical description of the birth defect(s) were collected. for inclusion in the study, a live birth (being alive or deceased) must have been born between 2004 and 2012 and have had health records in the health houses of the rural areas of tabriz at the time of the study. total prevalence was calculated by dividing the numerator (registered cases of congenital anomalies) by the relevant denominator (total live births) for the same period of time. a child with the study obtained ethics approval from the committee of ethics in tabriz university of medical sciences. out of 22500 live births in rural tabriz, 254 were diagnosed as having congenital anomalies giving a total prevalence rate of 112.89 per 10 000 live births (95% ci : 99.08 to 126.69). baseline demographic characteristics of cases including gender, life status, mother age at pregnancy, and birth order are presented in table 1. gender distribution of the birth defects was 59% (150 cases) in male, 41% in female (104 cases) representing a sex ratio (m / f) of 1.44. of 254 children diagnosed with birth defects, 82 had died due to different reasons and 172 survived. table 2 shows the prevalence of the main categories of congenital anomalies in the area. anomalies of nervous system, congenital heart diseases, and ear / eye defects accounted proportionally for more than 55% of anomalies in the region. by contrast, categories of digestive system anomalies, genitourinary tract, and defects of respiratory system accounted all for less than 10% of anomalies. table 3 and figure 1 show the time trends for selected groups of anomalies. the prevalence of anomalies of nervous system increased from 19 per 10 000 births (95% ci : 8.729.5) in 20042006 to 31.9 (95% ci : 19.943.9) in 20102012. ear and eye defects also showed an upward trend from 9 per 10 000 births (95% ci : 8.729.5) in 20042006 to 15.3 (95% ci : 723.7) in 20102012. of 22 children with defects of the neural system, 12 had microcephaly, eight had hydrocephaly, and two had macrocephaly. the highest prevalence rate for birth defects was observed in the south - western region with 386 per 10 000 births (95% ci : 215 to 556), and the lowest rate was observed in the north - western region with 15 per 10 000 births (95% ci : 14 to 45). this study was an epidemiological investigation to estimate the prevalence of congenital anomalies in the northwest of iran. we found that the total prevalence of birth defects was 113 per 10 000 births while some other studies reported a prevalence rate ranging from 49 to 283 inside the country [1418 ], and from 213 to 389 was reported by european registry of congenital anomalies and twins (eurocat) and international clearinghouse for birth defects surveillance and research (icbdsr) for other countries [19, 20 ]. in this study the most common anomaly was nervous system which is consistent with the similar report from urmia, a city in the northwest country, while congenital heart diseases were reported as the most commonly system affected in eurocat region. a study in yasuj, southwest of iran, reported a high prevalence of neural tube defects (48 per 10 000 births) in the region. although musculoskeletal system was the first leading affected system according to a research in gorgan, northern of iran, it was the fourth one in our study. the low prevalence of congenital anomalies in this study may be a result of the problems in recording and documentation of the country referral system for primary health care in the rural areas. while in the current study the prevalence of anomalies of nervous system increased from 19 per 10 000 births in 20042007 to 32 in 20102012, there was a decline in the prevalence of this category in some registries of eurocat countries for the years 20002009. unlike ours, eurocat statistics reported a downwarding pattern for ear and eye defects in 20002009. the differences between studies might be the effect of different racial, ethnic, and social factors in various parts of the world. other explanations for these variations in birth defects prevalence could come from study methods (i.e., sampling, criteria for diagnosis, recording, etc.). moreover, the accessibility and utilization of advanced techniques in developed countries (i.e., fetal visualization using ultrasound screening and chromosome microarray testing at birth) have improved the early detection of anomalies in those countries. we found considerable geographic disparities in the prevalence of birth defects in the area ranging between 15 and 386 (per 10 000 births). this may be due to highly polluted industrial zone in the district with high prevalence rates. the southwest of tabriz district is the most contaminated area in terms of environmental pollution. tabriz petrol refinery, tabriz petrochemical refinery, and thermal power plant as well as shahid rajaei industrial town are all located in this zone which could be considered as the main sources of pollution in the region. first, data came from live births only while in estimating the prevalence of congenital anomalies in population, stillbirths, and pregnancy terminations should be taken into account as well. it means that we did not have access to the health files of families who used to live in rural tabriz and moved away from this area. we conclude that despite the low prevalence of birth defects in the northwest of iran, the considerable geographic disparities in the prevalence of birth defects in the region might be attributed to highly polluted industrial zone (including air, water pollution, etc.). | background. congenital anomalies are responsible for a remarkable proportion of mortality and morbidity in newborns. the aim of this study was to document the epidemiological features of congenital anomalies in rural areas, northwest of iran. method. the study population included live births born between 2004 and 2012 in rural areas of tabriz district. all health records of the children under 8 years were assessed retrospectively. results. of 22500 live births, 254 cases were identified with a primary diagnosis of congenital anomalies giving a prevalence rate of 112.89 per 10 000 births (95% ci : 99.08 to 126.69). anomalies of the nervous system were the most common defects, accounting for 24% of birth defects followed by the heart diseases anomalies. the highest prevalence rate for birth defects was observed in the south - western region with 386 per 10 000 births (95% ci : 215 to 556) compared to the similar rate in the north - western region with 15 per 10 000 births (95% ci : 14 to 45). conclusion. the considerable geographic disparities in the prevalence of congenital anomalies in the region might be attributed to the highly polluted industrial zone in the area (including air and water pollution, etc.). this needs further etiological investigations in the region. |
mucormycosis is a fungal infection caused by fungi in the order mucorales. among the mucoraceae, rhizopus oryzae (rhizopus arrhizus) is by far the most common, inhabiting soil, animal feces and decaying vegetative matter. other less frequently isolated species of the mucoraceae family that cause a similar spectrum of infections include rhizopus microsporus var. the present case report is about a 54-year - old male patient, with well - controlled diabetes mellitus, hypertension, ischemic heart disease with poor ejection fraction (35%), decompensated congestive heart failure, anasarca and chronic kidney disease. he presented with 2 days history of passage of black tarry stool, progressive abdominal distention and new york heart association class iii - iv dyspnea. he denied history of alcohol intake and did not have history of diabetic ketoacidosis over the past 3 years. the patient did not use proton pump inhibitors, h2 blockers, non - steroidal anti - inflammatory drugs, or broad spectrum antibiotics in the past 6 months. on clinical examination mmol / l ; hba1c 6.2 ; sodium 124 mmol / l ; potassium 6.1 mmol / l ; bicarbonate 10.8 ; creatinine 388 mol / l ; urea 42.3 mmol / l ; pro - brain natriuretic peptide 1498 pmol / l ; white blood cells 9.3 10/l, hb 6.3 g / dl ; c - reactive protein 3.5 mg / l ; hepatitis b, c and hiv serology were negative. the patient continued to have massive hematemesis and melena with drop in hemoglobin, requiring more than 4 units of packed red blood cells. he was resuscitated after cardiac arrest, but continued to have upper gastrointestinal bleeding with abdominal distention and signs of peritonitis. abdominal computed tomography (ct) with contrast was requested to rule out bowel ischemia. ct showed free air in the abdomen posterior to the fundus of the stomach representing perforation of posterior wall and acute infarction of spleen. an emergency laparotomy revealed a large posterior gastric wall perforation at cardio - fundal area with abscess formation, trimming of the necrotic edge with two layers, closure of the gastric wall and splenectomy were performed. post - operatively, the patient developed disseminated intravascular coagulopathy and died in the early post - operative period. histopathology of the edge of the posterior gastric wall ulcer and spleen showed branching non - septated fungal hyphae with an extensive necrosis [figure 1 ]. deep sections showed non - septated fungal hyphae and spores invading blood vessel and spleen parenchyma with extensive tissue necrosis. (a) periodic acid schiff (pas) after diastase digestion (40) : non - septated fungal hyphae with branching (arrow). (b) pas after diastase digestion (40) revealing non - septated fungal hyphae with branching and extensive necrosis (arrow) spleen a diagnosis of spontaneous gastric perforation due to invasive gastric mucormycosis with acute spleen infarction was made. as the diagnosis was not suspected during the surgery, no specimen was submitted for fungal culture. cases have been identified associated with leukemia, aplastic anemia, organ or bone marrow transplantation, diabetes mellitus, renal disease, iron overload, asthma, gastric cancer, burns and prednisone therapy. diabetes mellitus was seen as the major risk factor for developing rhinocerebral zygomycosis. in the original publication by gregory., two out of the three patients reported had presented with diabetic ketoacidosis and the third patient was thought to have an undiagnosed case of diabetes. in another report, a 17-year - old woman with diabetic ketoacidosis and severe epigastric pain due to an extensive stomach ulcer ; found to have invasive mucormycosis. treatment with amphotericin b was initiated, but severe persistent gastrointestinal bleeding resulted in the patient 's death. mucormucosis of the gastrointestinal tract is an unusual form of the disease, accounting for only 7% of all reported cases. only 25% of cases of gastrointestinal mucormycosis are diagnosed ante - mortem ; mortality is high, primarily due to bowel perforation. the ingestion of fermented milk with dried bread products or fermented porridges and alcoholic drinks derived from corn may play a role in promoting gastric zygomycosis. the stomach is the most common site of gastrointestinal mucormycosis, followed by the colon and ileum. non - specific abdominal pain and distention associated with nausea and vomiting are the most common symptoms. emphysematous gastritis associated with invasive gastric mucormycosis is an extremely rare condition associated with heavy alcohol abuse and diabetes mellitus. fungal elements are frequently noted overlying the base of chronic peptic ulcers of the stomach and it has been suggested that the fungi enhance the degree of necrosis and that these cases have protracted disease and deeper ulcers with more perforations. a study by al - rikabi., described a very rare case of invasive mucormycosis occurring in the base of a chronic gastric ulcer in a diabetic male which was clinically and radiologically been mistaken for a gastric carcinoma. the ulcer was complicated by perforation and fungal septicemia with subsequent fatal outcome. in a series of 20 patients, thomson., classified gastrointestinal mucormycosis into 3 histological categories : colonization, infiltration and vascular invasion. in 10 patients, mucormycosis complicated peptic ulcer disease (pud), 3 with colonization, with 5 infiltration and 2 with vascular invasion. mucormycosis had a less aggressive course when complicating pud than when it occurred in association with other gut diseases. none of the patients with pud died compared to the other 10 patients who had infection associated with other gastrointestinal diseases : post - traumatic peritonitis (4 patients), transmural amoebiasis (2 patients), tuberculosis (1 patient), gastroenteritis (1 patient), gastric carcinoma (1 patient) and diabetes (1 patient). clinical diagnosis is difficult as symptoms are nonspecific, however gastrointestinal mucormycosis can be diagnosed with endoscopic biopsy of the lesions, with histopathologic demonstration of the characteristic broad non - septated hyphae in the affected tissues. treatment of zygomycosis involves a combination of surgical debridement of involved tissues in conjunction with liposomal amphotericin b which is considered the drug of choice. our patient had isolated invasive gastric mucormycosis with contiguous spread through vascular invasion and thrombosis involving splenic artery, which resulted in infarction and necrosis of the spleen. the natural history of the disease and the multiple co - morbidities with cardiac and renal dysfunction has contributed for our patient early mortality. as the patient died in the early post - operative period, the diagnosis was verified histologically after his death and therefore anti - fungal treatment was not started. perforated gastric ulcer is a very rare presentation of gastric mucormycosis which can be complicated by angio - invasion, thrombosis and infarction of the spleen. high index of clinical suspicion along with endoscopic biopsy, fungal culture and ct to rule out other causes of the acute abdomen can lead to early diagnosis. | mucormycosis is a rare life - threatening fungal infection mostly affecting immunocompromised hosts. the main categories of human disease with the mucorales are sinusitis / rhinocerebral, pulmonary, cutaneous / subcutaneous, gastrointestinal and disseminated disease. other disease states occur with a much lower frequency and include cystitis, vaginitis ; external otitis and allergic disease. we report a diabetic patient with comorbidities, who developed gastric perforation clinically indistinguishable from perforated peptic ulcer due to invasive gastric mucormycosis complicated by spleen infarction. |
nicotinic acetylcholine receptors (nachrs) are a family of ligand gated ion channels that are involved in a variety of central and peripheral nervous systems functions including memory, cognition, and reward. neuronal nachrs are composed of a pentameric complex of closely related, yet functionally distinct protein subunits arranged around a central cation - conducting pore. in the cns, nachrs may consist exclusively of -subunits (homomeric) or contain combinations of - and -subunits (heteromeric). this gives rise to a large number of different receptor subtypes, each of which exhibits distinct pharmacological functions and may be involved in various neuropathological states. neuronal nachrs that are present in mesocorticolimbic reward pathways are important targets for studying nicotine addiction and in the development of smoking cessation therapeutics. for example, the 42 nachr is the most predominant nachr subtype found in the central nervous system and, as such, is a target for varenicline, a currently approved smoking cessation medication. however, the 34 nachr expressed in the medial habenula has also been found to play a significant role in nicotine addiction. for example, 18-methoxycoronaridine (18-mc) and -conotoxin auib were shown to block the 34 nachr in the medial habenula in rats, thus reducing nicotine self - administration. more recently, at-1001, a potent and relatively selective 34 nachr antagonist, was shown to block nicotine self - administration in rats following systemic administration. on the other hand, varenicline also exhibits 34 nachr agonist activity, which may account for several observed peripheral and central side effects, including nausea, gastrointestinal symptoms, and suicidal ideation. therefore, novel antagonists that potently and selectively block the 34 nachr are valuable tools for probing the role that this receptor plays in nicotine addiction and could lead to the development of safer smoking cessation therapeutics. -conotoxins are a family of small, disulfide - rich peptides isolated from the venoms of carnivorous marine cone snails. the remarkable nachr selectivity of -conotoxins provides a unique structural template for designing novel nachr antagonists with increased inhibitory potencies. typically, -conotoxins consist of 1220 amino acids and contain two highly conserved disulfide bonds. in native -conotoxins, the disulfide bonds are linked via the cys1-cys3 and cys2-cys4 (globular) connectivity, although two additional misfolded isomers are also possible with connectivity between cys1-cys4 and cys2-cys3 (ribbon) and between cys1-cys2 and cys3-cys4 (beads). native -conotoxins exhibit a well - defined structural framework that projects two loops of intervening amino acid residues between cys2-cys3 and cys3-cys4 that are denoted as the m- and n - loops, respectively (figure 1). the amino acids contained within these loops are highly variable across the -conotoxin family, with subtle modifications of these residues often having a profound influence on the potency and selectivity toward different nachr subtypes. therefore, the relative ease of chemical synthesis and conserved structural characteristics of -conotoxins allow further optimization of their nachr selectivity and antagonist potency. design of the mixture - based ps - scl based on the 4/4-conotoxin framework. the conserved cysteine framework and native (globular) disulfide bond connectivity are indicated. on is a single defined position, and x is an equimolar mixture of 22 natural and non - natural l - amino acids. several -conotoxins are known to target the 34 nachr with varying degrees of potency and selectivity (table 1). for example, -conotoxin auib has been used as a probe to study the role of the 34 nachr in the medial habenula, although such studies are limited by its relatively low inhibitory potency. recently, -conotoxin txid was characterized as being the most potent and selective 34 nachr -conotoxin antagonist, thus making it a valuable probe for studying this receptor. on the other hand, -conotoxin buia is a potent 34 nachr antagonist, but it also targets a broad range of subtypes, including 32, 6/323, and 6/34 nachrs. significantly, buia exhibits a unique 4/4 loop framework that is not commonly found in other known -conotoxins (figure 1). the inhibitory function and binding kinetics of buia buia blocks several 2- and 4-containing heteromeric nachrs, with the highest potency against 3- and chimeric 6-containing receptors. significantly, nachr with 4-containing subunits exhibited slower off - rates when compared to the corresponding 2-containing nachr. similar results were found in both human and mouse 32 nachrs and their 34 counterparts, suggesting that -subunit selectivity is conserved across species. notably, pro6 of buia is a critical determinant for distinguishing between 2 and 4 subunits, where substitution with 4-hydroxyproline (hyp) (i.e., buia[p6o ]) exhibited significant selectivity for 64 over 62 nachr. z is norvaline (nva). with continued interest in developing novel nachr ligands as probes for studying the role that these receptors play in nicotine addiction, we have utilized a synthetic combinatorial strategy to develop a potent and highly selective 34 nachr antagonist using the unique 4/4-conotoxin framework exhibited by buia. a positional scanning synthetic combinatorial library (ps - scl) based on the variable positions within the 4/4-conotoxin framework was synthesized and screened for 34 nachr inhibitory activity to identify novel amino acid residues in each variable position within this framework. this led to the design and synthesis of a second generation library of individual buia derivatives, of which one analogue was identified as being among the most potent and selective of -conotoxins targeting the 34 nachr characterized to date. a ps - scl based on the 4/4-conotoxin loop framework was prepared to facilitate the identification of amino acid substitutions at key positions within the m- and n - loops that give rise to 34 nachr antagonistic activity (figure 1). in native -conotoxins targeting neuronal nachrs, the four cysteine residues, together with gly1, ser4, and pro6, are generally conserved. however, the remaining six positions are highly variable and were used as diversity positions within the framework. as such, six sublibraries were prepared, where on is a single defined position, and x is an equimolar mixture of 22 natural and non - natural l - amino acids (see x - axes in figure 2). all proteinogenic amino acids were used, with the exceptions of cys and met, which were omitted from the sample mixtures to avoid the formation of oxidation byproducts. as such, 2-aminobutyric acid (abu) and norleucine (nle) were included as isosteric replacements of cys and met, respectively, in the x and on positions. norvaline (nva) was also included to complete the series of side chains containing hydrophobic alkyl groups. moreover, hyp is a commonly occurring post - translational modification found in several -conotoxins that was also included in the construction of the library. initial screening of the 4/4-conotoxin buia ps - scl for 34 nachr inhibition using the fluorescent membrane potential assay. the library was screened in triplicate at 100 m, and the percentages of inhibition were calculated by comparing the potency of 10 m mecamylamine (mca), which was defined as 100% inhibition. residues that were selected for the synthesis of a second generation library of individual analogues are marked with an asterisk. amino acids indicated with a cross - hatch pattern correspond to native -conotoxin buia residues. the ps - scl was composed of 132 mixture samples, each of which contained 5 153 632 compounds across six sublibraries, with a total of 113 379 904 possible individual amino acid combinations in the entire library. the library was assembled using the tea bag method with boc - spps chemistry, followed by a two - step low high hf cleavage procedure.x - positions were coupled as a cocktail of amino acids using adjusted predetermined ratios to compensate for the differences in reactivity between different amino acid resides in competitive couplings. the formation of disulfide bonds was achieved by cosolvent assisted oxidative folding (50% isopropanol in aqueous ammonium bicarbonate buffer at ph 8.2), which was previously shown to maximize the accumulation of the native globular isomer of -conotoxin buia. a simplified desalting procedure that employed disposable solid - phase extraction (spe) columns was used for the rapid and efficient preparation of library samples in parallel prior to initial pharmacological screening. note that the globular and ribbon isomers of selected second generation individual analogues were later synthesized separately to confirm their identity and were purified by rp - hplc prior to formal functional characterization. the 132 ps - scl mixture samples were each screened for inhibition of rat 34, 32, and 42 nachrs in the fluorescent membrane potential assay, using hek293 cell lines stably expressing each nachr subtype. each sample was screened at 100, 10, and 1 m, based on the total concentration of -conotoxin contained within the mixture. screening of the ps - scl for 34 nachr inhibition indicated a dose - dependent inhibitory activity, with a concentration of 100 m allowing discrete active mixtures corresponding to specific amino acid substitutions to be identified in each position within the 4/4-conotoxin buia framework (figure 2). however, no significant preference for amino acids was apparent at each position for 32 and 42 nachrs at 100 m, with a majority of the ps - scl mixtures exhibiting > 80% inhibition. because no discrete active hits could be identified from 32 and 42 nachr screening, individual second generation analogues were designed based on the 34 nachr screen. as such, the two amino acid residues identified in each position as exhibiting the highest antagonistic activity for the 34 nachr subtype were selected for the design of a second generation library of individual -conotoxin analogues (table 2). at the o1 position, his was clearly identified as the most potent, exhibiting 100% inhibition of the 34 nachr subtype, and was selected for the synthesis of a second generation library. nle, which exhibited 80% inhibition of the 34 nachr, was also selected. thr, which is the native amino acid in buia, exhibited 60% inhibition of 34 nachr and was not selected for the second generation library. at the o2 position, the native pro residue in buia exhibited a 90% inhibitory potency for the 34 nachr subtype, indicating that the structure of two consecutive pro residues in the m - loop is important for sustaining conformational integrity and thus was selected for the synthesis of the second generation library. abu exhibited a similar inhibitory potency to pro (90%) and was also selected for the second generation library synthesis. furthermore, the hydrophobic amino acids leu and val each exhibited > 80% inhibition of 34 nachr. at the o3 position, the hydrophobic amino acids phe and ile were selected for the second generation library. notably, ala, which is the native residue at this position in buia, together with nle also exhibited greater than 80% of inhibitory activity for the 34 nachr subtype. at the o4 position, trp and abu clearly produced the greatest inhibitory potency for the 34 nachrs (approximately 100%) and were selected for the synthesis of the second generation library. at the o5 position, the unbranched hydrophobic amino acids nva and nle were selected for the second generation library. leu, which is the native residue at this position in buia, also produced 90% inhibition. at the o6 position, the native tyr residue in buia exhibited a 100% inhibitory potency for the 34 nachr subtype and was selected for the second generation library. interestingly, a constrained pro residue at this position that would be expected to induce a structural distortion also gave rise to high inhibitory activity (90%). a second generation library (tp-2212) was synthesized and consisted of 64 individual -conotoxin sequences that were constructed from systematic combinations of selected amino acid residues identified from ps - scl screening against the 34 nachr at 100 m (table 3). following assembly and cleavage, each -conotoxin analogue was oxidized using 50% isopropanol in aqueous ammonium bicarbonate buffer at ph 8.2 as used to prepare the ps - scl. a majority of samples indicated efficient folding to one predominant isomer as determined by analytical lc ms (figure 3). for the initial screen of the second generation library, all samples were desalted in parallel using spe columns and screened as crude samples (figure 3), which allowed any side products including misfolded disulfide bond isomers that were present in the preparation of the ps - scl to be retained during the synthesis of individual analogues. samples were analyzed using a c18 column (50 mm 4.6 mm i.d.) with a gradient of 060% acetonitrile containing 0.1% formic acid over 12 min at a flow rate of 0.5 ml / min and monitored at 214 nm. crude samples (bottom) were desalted in parallel using spe cartridges prior to initial library screening. globular and ribbon isomers for further pharmacological characterization (center and top, respectively) were synthesized using a two - step regioselective folding approach and purified to > 95% homogeneity as described in the experimental section. the final mass was calculated from the observed [m + 2h ] ion : calculated mass, 1382.9 ; expected mass, 1382.5. the canonical sequence for each individual compound is gly - cys - cys - ser - o1-pro - o2-cys - o3-o4-o5-o6-cys. the second generation library compounds were screened for inhibition of the 34 nachr at 10 m using the fluorescent membrane potential assay (figure 4 and table 3). of the 64 individual -conotoxin samples screened, 11 exhibited greater than 80% inhibition and were defined as active hits. of these 11 active hits, the substitution of his in the o1 position (compounds 35, 41, 43, 47, 57, 59, and 63) and nle (compounds 42, 44, 58, and 60) exhibited more than 80% inhibition. the native pro residue (compounds 41, 42, 57, and 58) along with abu (compounds 35, 43, 44, 47, 59, 60, and 63) were compatible at the o2 position. for the o3 position, the substitution of phe (compounds 35, 41, 42, 43, 44, and 57 - 60) and ile (compounds 47 and 63) also produced > 80% inhibitory activity. of the 11 active hits, 10 (compounds 4144, 47, 5760, and 63) contain abu at the o4 position, with compound 35 being the only compound containing trp at this position. compounds containing two selected amino acids at the o5 position (nle in compounds 35, 41, 42, 43, 44, and 47 ; nva in compounds 5760 and 63) were also identified as active hits. notably, a distinct trend was observed at the o6 position between pro (compounds 132) tyr (compounds 3364), where the substitution of pro significantly decreased inhibitory activity, while the native tyr residue of -conotoxin buia at this position retained its potency for 34 nachr. fluorescent membrane potential assay screening of the second generation individual library at 10 m. compounds that exhibited > 80% inhibition at 10 m (indicated with a solid line and asterisk) were selected for further chemical and pharmacological characterization. the 11 active hits were selected for further characterization and assessment of nachr antagonistic activity. first, both the globular and ribbon isomers of each -conotoxin analogue were synthesized to confirm the identity of the active component from second generation library screening. each pair of cys residues was differentially protected using mebzl and acm protecting groups followed by a two - step oxidation procedure and purified using rp - hplc to obtain each isomer in > 95% purity (figure 3). ms and co - injected with the major products obtained from the second generation library, which confirmed that the globular isomer was the major product in each of the selected second generation library samples. however, the ribbon isomer was also present as a minor isomer when nle was substituted in the o1 position. to confirm the identity of the active component of each of the 11 active hits from the second generation library, both globular and ribbon isomers were tested for 34 nachr inhibitory activity using the fluorescent membrane potential assay (table 4 and figure 5). for each compound, the globular isomer potently inhibited the 34 nachr while the ribbon isomer of each compound exhibited no inhibitory activity up to 10 m, thus confirming that the globular isomer was the active component of each of the selected second generation library screening samples. functional characterization of selected individual 4/4-conotoxins for 34 nachr inhibition using the fluorescent membrane potential assay. with the exception of compounds 35 and 63, all of the selected compounds exhibited inhibitory potencies for the 34 nachr subtype that were comparable to that of buia in the fluorescent membrane potential assay (table 4 and figure 5). to further test for selectivity, each of the 11 active hits was also tested for 32 and 42 nachr inhibitory activity. significantly, all of compounds exhibited increased selectivity for the 34 nachr when compared to -conotoxin buia, with no antagonist activity observed for the 32 and 42 nachr subtypes up to 10 m (table 4). compounds 57, 58, 59, and 60 were further tested for competitive inhibition of [h]epibatidine binding to 34 and 42 nachrs expressed in hek293 cell membranes (figure 6 and table 5). the binding data correlate with results obtained from fluorescent membrane potential assay, with compound 59 exhibiting moderately increased potency toward 34 nachr when compared to buia. furthermore, no significant binding to the 42 nachr was observed for any compound up to 10 m (data not shown). these results provided further evidence that these compounds selectively bind to the endogenous 34 nachr binding site. radioligand binding assays of buia and compounds 5760 bound to the 34 nachr subtype. [h]epibatidine was used as a hot ligand in the 34 nachr ligand receptor binding assay. compounds 57, 58, 59, and 60 were further tested for 7 nachr inhibitory activity by recording ach - evoked currents in xenopus oocytes. while compound 57 inhibited the response by 49.8% 3.2% at 10 m, no inhibition of the 7 nachr was observed for compounds 58, 59, and 60 up to 10 m. tp-2212 - 59 (compound 59) was selected for further functional characterization by recording ach - evoked currents mediated by 34 and 32 nachr subtypes heterologously expressed in xenopus oocytes. however, tp-2212 - 59 exhibited very slow washout kinetics, with 90120 min required to reach steady - state equilibrium that prohibited the accurate measurement of inhibition at concentrations below 10 nm (figure 7a). despite the slow washout kinetics at the 34 nachr, tp-2212 - 59 clearly exhibited dose - dependent inhibition to a concentration of 10 nm (figure 7b). in order to calculate an ic50 value for tp-2212 - 59 at the 34 nachr, the top and bottom of the curve were constrained to 100% and 0% responses, respectively. this allowed determination of an ic50 value for tp-2212 - 59, which was calculated to be 2.3 nm. in contrast, no inhibition of the 32 nachr was observed up to 10 m, thus confirming a > 1000-fold selectivity for the 34 subtype (figure 7c). together, these results suggest that tp-2212 - 59 is among the most potent and selective -conotoxins that target the 34 nachr subtype to be characterized thus far. functional characterization of tp-2212 - 59 for 34 and 32 ach (300 m) was applied as a 1 s pulse once per minute to xenopus oocytes expressing rat nachrs. (a) tp-2212 - 59 (10 nm) was perfusion applied to oocytes expressing 34 nachrs until steady - state block of the ach current was achieved. the top and bottom of the curve were constrained to 100 and 0, respectively. (c) tp-2212 - 59 was applied as a 10 m static bath for 5 min to oocytes expressing rat 32 nachrs (1000 times higher peptide concentration than that used for 34 nachrs). venomous marine cone snails utilize natural combinatorial libraries of peptide neurotoxins that target an array of receptors in the central and peripheral nervous systems to immobilize and capture their more agile prey. among these are the -conotoxins, which exhibit exquisite selectivity against different nachr subtypes and thus are important research tools for studying a variety of neuropathological conditions, including pain, memory, cognition, and tobacco addiction. their highly conserved three - dimensional structure and relative ease of synthesis by solid - phase peptide synthesis mean that -conotoxins represent excellent structural scaffolds for developing large synthetic combinatorial libraries for functional screening. genomic and pharmacologic data have suggested the 34 nachr subtype as a novel target for studying tobacco dependence and drug abuse. furthermore, 3-containing nachrs have been implicated in neuropathic pain. however, to determine the precise role of the 34 nachr subtype in nicotine addiction and pain, potent and selective ligands for this receptor are rare. as a result, novel subtype - selective nachr antagonists are crucial for the fundamental understanding of reward and pain pathways and may pave the way for the development of clinically effective smoking cessation drugs and analgesics that circumvent unwanted side effects. in this study, we have utilized the unique 4/4-conotoxin framework as a template for constructing a high diversity mixture - based synthetic -conotoxin combinatorial library for functional screening of the 34 nachr subtype. buia is among only a few -conotoxins identified so far that possesses the 4/4 framework, with a vast majority of neuronally active -conotoxins possessing the more ubiquitous 4/7 framework. buia is a potent antagonist of a broad range of nachrs, including 32 and 34 nachrs. importantly, it is able to kinetically discriminate between 2- and 4-containing nachr subtypes. modifications to key amino acid residues within the m- and n - loop allow its kinetics and selectivity to be fine - tuned. however, the design of functionally active and selective compounds remains a challenging task due to the conserved binding site of different nachr subtypes that play an important role in the allosteric binding of ligands. previously, we reported the use of ps - scls based on -conotoxin and small molecule frameworks for identifying pharmacologically active compounds that target nachrs. here, we have extended our synthetic combinatorial approach using the 4/4-conotoxin framework as a template for synthesizing and screening a mixture - based ps - scl for the discovery of potent and selective antagonists of the 34 nachr. the ps - scl consisted of a total of 113 379 904 -conotoxin sequences, which expands immensely upon the diversity of conotoxin libraries previously reported by our group. the fluorescent membrane potential assay was used to screen the ps - scl mixtures for 34, 32, and 42 antagonistic activity. though previous data suggest that inhibitory potencies obtained by this assay are significantly lower than those obtained from electrophysiological recordings, the assay has the advantage of allowing screening in a high - throughput manner and has proven to be useful for determining relative inhibitory potencies and selectivity of -conotoxins for various nachr subtypes and was used for initial screening and characterization of compounds. screening of the 132 ps - scl mixture samples for inhibition of rat 34 nachr expressed in hek293 cells using the fluorescent membrane potential assay allowed discrete active hits to be rapidly identified for this receptor. however, complementary counterscreening against 32 and 42 nachrs could not readily identify active hits for these subtypes, suggesting that the unique 4/4-conotoxin framework may be in an optimized conformation to interact within the 34 nachr binding site. significantly, novel amino acid residues were identified at each position, although each of the native residues of buia was also found to exhibit a moderate to high inhibitory potency for 34 nachr. notably, mixtures corresponding to native -conotoxin buia residues were identified as the most active samples in the o2 and o6 positions (i.e., pro and tyr, respectively). a second generation library of individual analogues was designed based exclusively on the screening of 34 nachr. from the initial screening of the 64 individual second generation 4/4-conotoxin sequences that were synthesized, 11 compounds exhibited > 80% inhibition of 34 nachr and were selected for further chemical and pharmacological characterization. despite extensive mutation of key residues within the 4/4-conotoxin framework, each of these 11 analogues spontaneously formed the correct folded globular isomer upon oxidative folding, although the misfolded ribbon isomer was also present when nle was substituted in the o1 position. for all analogues, the globular isomer was confirmed as the active component of the second generation library samples. his and nle were identified at the o1 position, suggesting a possible hydrogen bond acceptor within a hydrophobic pocket of the endogenous binding site. of significance, his is present in the o1 position in several conotoxins targeting 34 nachr, including -conotoxins txid, gic, peia, and regiia (see table 1). therefore, it is important that his was clearly defined as an active hit from initial ps - scl screening among all other residues, which strongly suggests that the o1 is a major determinant for selectively targeting the 34 nachr. the substitution of abu was tolerated at the o2 position and indicates that conformationally relaxed -conotoxin buia analogues may have a positive effect on the binding kinetics and thus are able to improve both binding affinity and specificity. the result correlates with a nmr structural study where the active globular isomer was found to be structurally relaxed while the inactive ribbon isomer exhibited a well - defined conformation. the substitution of phe at the o3 position appears to play a crucial role in the increasing of activity. when compared to -conotoxin buia, it is apparent that bulkier and smaller amino acids are preferred at the o4 and o5 positions, respectively. significantly, all of the active sequences contained tyrosine at the o6 position, which is the native amino acid residue found in buia. though pro was selected at the o6 position based on ps - scl screening, none of the individual sequences containing pro at this position were identified as active hits. this was not surprising, since substitution with proline would be expected to introduce detrimental structural distortion into the well - defined -conotoxin framework. interestingly, the eight of the canonical 4/4-conotoxin sequences, defined as gly - cys - cys - ser-(his or nle)-pro-(abu or pro)-cys - phe - abu - nle - tyr - cys - nh2 (compounds 4144 and 57 - 60), exhibited the most potent inhibition of 34 nachr. significantly, of the 11 compounds selected for further functional characterization in the fluorescent membrane potential assay, each was highly selective for 34 nachr, with no inhibitory activity for the 32 and 42 subtypes observed up to 10 m. in contrast, -conotoxin buia was shown to be 10-fold more selective for the 32 in the fluorescent membrane potential assay, which directly correlates with previously reported data obtained from electrophysiological recordings. of the four analogues selected for further characterization in the radioligand binding assay, each compound displayed potent inhibition of [h]epibatidine binding to 34 nachr expressed in hek293 cell membranes, which indicates competitive binding to the endogenous ligand binding site as exhibited by other -conotoxins. by contrast, other ligands that potently block the 34 nachr in functional assays, such as 18-mc and mecamylamine, do not inhibit [h]epibatidine binding because these compounds bind to the central lumen of the receptor. notably, compound 59 (tp-2212 - 59) was shown to exhibit moderately increased inhibition of [h]epibatidine binding when compared to the other conotoxin analogues tested, including native -conotoxin buia, and was thus selected for further functional characterization. tp-2212 - 59 was tested for inhibition of ach - evoked currents in 34, 32, and 7 nachrs expressed in xenopus oocytes. though the slow washout kinetics prohibited measurements at concentrations lower than 10 nm, compound 59 inhibited 34 nachr activity by 75% at this concentration, with a calculated ic50 value of 2.3 nm. -conotoxin buia also exhibits slow off - rates for 4-containing subtypes, which may contribute to the higher binding affinity and thus increased potency. however, while the off - rates for 4-containing receptors are in general slower, buia exhibits an approximately 5-fold greater selectivity for 32 over 34 nachr subtypes, with ic50 values of 5.72 and 27.7 nm, respectively. in contrast, tp-2212 - 59 displayed a > 1000-fold selectivity for 34 nachr, with no inhibition of the 32 and 7 nachr observed up to 10 m. these data confirm that tp-2212 - 59 exhibits increased potency and selectivity for the 34 nachr compared to -conotoxin buia and is therefore among the most potent and selective -conotoxin derivatives that target the 34 nachr characterized to date. this work demonstrates that a synthetic mixture - based combinatorial approach using the 4/4-conotoxin framework provides an excellent template for the identification of selective 34 nachr antagonists. moreover, tp-2212 - 59 is among the most potent and selective -conotoxin antagonists that target the 34 nachr and therefore is a valuable probe to elucidate the function of this receptor in a wide range of experimental paradigms that require 34 nachr activation. for example, the effects of tp-2212 - 59 on nicotine self - administration and associated side effects in rodents are currently being examined by our group. such studies may lead to the development of 34 nachr antagonists as novel smoking cessation drugs with fewer side effects than presently available options. the ps - scl and individual 4/4-conotoxin analogues were assembled by solid - phase peptide synthesis using 4 cm 4 cm polypropylene tea bags, each containing 100 mg of 4-methylbenzhydrylamine resin (chemimpex, wood dale, il). couplings were performed using tert - butyloxycarbonyl (boc)/2-(1h - benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (hbtu) chemistry with in situ neutralization. for the ps - scl, x - positions were coupled as a cocktail of n - boc protected amino acids using adjusted concentration ratios to compensate for the relative reaction rates in competitive couplings. the following amino acid side chain protecting groups were used for each respective amino acid : arg, 4-toluenesulfonyl (tos) ; asn, 1-xanthanyl (xan) ; asp, o - cyclohexyl (ochxl) ; cys, 4-methylbenzyl (mebzl) or n - acetomidomethyl (acm) ; glu, ochxl ; his, tos ; hyp, benzyl (bzl) ; ser, bzl ; trp, formyl (for) ; tyr, 2-bromobenzyloxycarbonyl (brz). following assembly, the tea bags were treated with 30% piperidine to remove the formyl protecting group from trp ; the n - terminal boc protecting group was removed with trifluoroacetic acid (tfa), neutralized, and then pretreated with low hf (25% hf, 60% dimethylsulfide, 10% p - cresol, 5% 1,2-ethanedithiol) for 2 h at 0 c. finally, the peptides were cleaved from the resin using hf / p - cresol (9:1) for 2 h at 0 c. the peptide was precipitated with cold diethyl ether, centrifuged, washed again with additional ether, centrifuged, and lyophilized from 50% acetonitrile/0.1% tfa. the purity and molecular mass of individually synthesized peptides were confirmed using analytical lc ms (shimadzu, kyoto, japan). crude samples were individually oxidized by rigorously agitating each sample in a solution of 0.1 m ammonium bicarbonate, 50% isopropyl alcohol, ph 8.2, for 3 days at room temperature in an open vessel on an orbital shaker platform. following evaporation of the isopropyl alcohol in vaccuo (genevac rocket, ipswich, u.k.), samples were isolated in parallel with solid - phase extraction (spe) cartridges using a 24-sample vacuum manifold. for spe cartridge semipurification, the sample was loaded by passing through an oasis ; 3 cc, 540 mg spe cartridge (waters) pre - equilibrated with buffer a and washed with a further 10 ml of buffer a to remove hydrophilic impurities (i.e., buffer salts). the -conotoxin product was then eluted with 65% aqueous acetonitrile/0.1% tfa (buffer e, 10 ml), collected in a clean tube, and lyophilized. selected compounds for further pharmacological characterization were purified to > 95% homogeneity by preparative rp - hplc using a c18 luna column (phenomenex) using a linear gradient of 045% buffer b (95% aqueous acetonitrile/0.1% tfa) over 60 min at a flow rate of 20 ml / min. regioselective synthesis of selected compounds for further characterization (i.e., globular and ribbon isomers) was achieved by stirring reduced / s - acetomidomethyl - protected peptides in 0.1 m ammonium acetate containing 30% dmso, ph 5.8, for 2 days, followed by isolation by preparative rp - hplc. partially protected purified peptides (10 mg) were dissolved in 80% methanol (25 ml), and 0.1 m hcl was added (1 ml), followed by 0.1 m i2 in methanol (2.5 ml). the solution was stirred for 10 min before quenching with 0.1 m sodium thiosulfate. finally, fully oxidized peptides were purified to > 95% homogeneity using preparative rp - hplc as described above. the fluorescent plate reader membrane potential blue assay was used for initial library screening and to determine inhibition of rat 34, 32, and 42 nachrs by individual -conotoxins. briefly, yingxian xiao and kenneth kellar, georgetown university, washington, dc) were cultured in a humidified 5% co2 incubator and maintained in dulbecco s modified eagle medium (dmem) supplemented with 10% fetal bovine serum (fbs), penicillin / streptomycin (100 units / ml), and g-418 (0.5 mg / ml). the cells were split into poly - d - lysine coated clear bottom 96-well plates 24 h prior to the assay and grown to 80% confluency. the culture medium was aspirated, and the cells were washed twice with hank s buffered salt solution (hbss). after washing, 75 l of hbss was added to each well, followed by 25 l of ps - scl mixtures or -conotoxin test samples. finally, membrane potential blue dye (100 l) was added and the cells were incubated for a further 30 min at 37 c prior to the assay with the flexstation 3 microplate reader (molecular devices) measuring emission at 530 nm caused by excitation at 565 nm (cutoff 550 nm) before and up to 60 s after addition of epibatidine agonist solution to a concentration of 0.1 m in assay buffer. response for antagonists was measured on the basis of the maximal responses at different concentrations of the respective ligands to determine ic50 values, which were calculated using graphpad prism software (la jolla, ca). kx34r2 and kx42r2 hek293 cells were cultured on 150 mm dishes as described above. cells were harvested when confluent by scraping the plates with a rubber policeman, suspended in 50 mm tris buffer, ph 7.4, homogenized using a polytron homogenizer, and washed twice by centrifugation at 20000 g (13 500 rpm) for 20 min. for binding, the cell membranes were incubated with the test compounds or mixtures in the presence of 0.31 nm [h]epibatidine. after 2h of incubation at room temperature, samples were filtered using a tomtec cell harvester through glass fiber filters presoaked in 0.05% polyethyleneimine. ki values were calculated using the cheng prusoff transformation : ki = ic50/(1 + l / kd), where l is radioligand concentration and kd is the binding affinity of the radioligand, as determined previously by saturation analysis. capped crna for the various subunits was made using the mmessage mmachine in vitro transcription kit (ambion, austin, tx) following plasmid linearization. crna of the 3 chimera was combined with crna of high expressing 2 and 4 subunits or homomeric 7 subunits (in the pgemhe vector) to give 200500 ng/l of each subunit crna. an amount of 50 nl of this mixture was injected into xenopus oocytes, and the sample was incubated at 17 c. oocytes were injected within 1 day of harvesting, and recordings were made 24 days after injection. oocytes were voltage - clamped and exposed to a 1 s pulse of 300 m ach and peptide as described previously. for screening of receptor subtypes and for toxin concentrations of 1 m and higher, once a stable agonist - response baseline was achieved, either nd-96 alone or nd-96 containing varying buia analogue concentrations was manually preapplied for 5 min under static bath conditions prior to agonist addition. for toxin concentrations of < 1 m, toxin was perfusion applied and responses to 1 s pulses of ach were measured every 1 min. | -conotoxins are disulfide - rich peptide neurotoxins that selectively inhibit neuronal nicotinic acetylcholine receptors (nachrs). the 34 nachr subtype has been identified as a novel target for managing nicotine addiction. using a mixture - based positional - scanning synthetic combinatorial library (ps - scl) with the 4/4-conotoxin buia framework, we discovered a highly potent and selective 34 nachr antagonist. the initial ps - scl consisted of a total of 113 379 904 sequences that were screened for 34 nachr inhibition, which facilitated the design and synthesis of a second generation library of 64 individual -conotoxin derivatives. eleven analogues were identified as 34 nachr antagonists, with tp-2212 - 59 exhibiting the most potent antagonistic activity and selectivity over the 32 and 42 nachr subtypes. final electrophysiological characterization demonstrated that tp-2212 - 59 inhibited acetylcholine evoked currents in 34 nachrs heterogeneously expressed in xenopus laevis oocytes with a calculated ic50 of 2.3 nm and exhibited more than 1000-fold selectivity over the 32 and 7 nachr subtypes. as such, tp-2212 - 59 is among the most potent 34 nachrs antagonists identified to date and further demonstrates the utility of mixture - based combinatorial libraries in the discovery of novel -conotoxin derivatives with refined pharmacological activity. |
japan s rapidly aging society has become a major issue in recent years1. in 2000, a universal long - term care insurance system was established in japan2, 3, allowing access to publicly insured services such as home - visit rehabilitation. home - visit rehabilitation encompasses exercise, training, and advice for users, as well as family education, provided in the home by physical therapists, occupational therapists, and speech - language therapists. sharing of functional goals of home - visit rehabilitation among all parties involved is critical in determining the course of rehabilitation4. to improve the quality of care, care providers should pay close attention to client - centered views with respect to issues that are relevant to clients5. geriatric care assessment has been developed to be comprehensive and efficient8, and care providers understand the importance of individual needs of elderly people9. while some studies have found that care providers and recipients differ in their views of care10,11,12,13, little understanding the perception of each patient (client or user) is important in care settings5. care providers listen to the needs of care recipients and their families and then provide explanations regarding rehabilitation goals and plans using various documents created for this purpose. specific rehabilitation goals and programs should be explained according to the level of each user s understanding. our previous study found differences between users and providers in their understanding of home - visit rehabilitation programs14. however, whether user families understand what home - visit rehabilitation entails and whether the awareness of user families is equal to that of care providers have yet to be determined. in this study, we examined differences in understanding and subjective effects of home - visit rehabilitation between user families and care providers. previously, six home - visit rehabilitation practitioners (three physical therapists and three occupational therapists) and one researcher (occupational therapist with home - visit rehabilitation experience) created a questionnaire consisting of 18 items pertaining to the content of home - visit rehabilitation and 17 items pertaining to its subjective effects in the areas of physical and mental function, basic movement, applied movement, and environmental improvements, as well as other items such as difficulties before home - visit rehabilitation14. as this questionnaire targets users and home - visit rehabilitation providers, we modified the items to target user families in this study. in this study, the families were asked about subjective care burden and subjective time of care giving time and free time15. all families received an explanation specifying that their responses would not be revealed to those in charge of home - visit rehabilitation and that traceable anonymity was provided for families as well as users. we focused on differences between user families and care providers with regard to (1) understanding of home - visit rehabilitation content and (2) its subjective effects. to evaluate (1), we asked each user family and provider to please choose the level of implementation of the home - visit rehabilitation content within approximately the last month. possible answer choices included implemented, not implemented, and do not know. in the analysis, the responses of those who had engaged in home - visit rehabilitation within the past one month were labeled as implemented, while responses of those who had not engaged in home - visit rehabilitation or had chosen do not know were labeled as not implemented / unclear. to evaluate (2), we asked each user family, how has the user s condition changed since beginning home - visit rehabilitation ? we also asked each provider, have you noticed a difference in the condition of your user as compared with that when you began home - visit rehabilitation ? it has gotten better, no change, and it has gotten worse. in the analysis, changes occurring after initiation of home - visit rehabilitation were labeled as maintenance / improvement for it has gotten better and no change and as deterioration for it has gotten worse. among 155 user families making use of five home - visit rehabilitation centers for over a month, the self - administered questionnaire was distributed to 90, while paying due attention to issues such as mental and psychological burden and sudden deterioration of cognitive function. in terms of basic information about users, data were collected on gender, age, medical condition, cognitive function (the revised version of hasegawa s dementia scale16), activities of daily living (barthel index17), instrumental activities of daily living (tokyo metropolitan institute of gerontology index of competence18), and user services. in addition, characteristics of user families (e.g., age, gender, living conditions, and care burden) were collected by each questionnaire. twelve home - visit rehabilitation providers from 5 centers answered the questionnaire for 155 users. for the analysis, the inclusion criteria were families of users who were over 40 years of age, no missing data on family characteristics, and < 10 items answered for the 18 items pertaining to content or 17 items pertaining to subjective effects. we analyzed responses to the 18 items pertaining to home - visit rehabilitation content and 17 items pertaining to subjective effects from families and linked them to the responses of their care providers. responses with missing data (i.e., characteristic data, 10 items on content or subjective effect) were excluded from the analysis. the mcnemar s test19 was used to compare proportional differences between user families and care providers, with statistical significance set at p < 0.05. the study protocol was approved by the research ethics committee of seijoh university (2011c0007). the director of each center approved the study, since none of the five participating home - visit rehabilitation centers had an ethics committee. we provided an explanation of the protocol concerning data management as well as study objectives on the cover of the questionnaire. specifically, it stated that the questionnaire envelope would be opened only by the researcher (i.e., not by the home - visit rehabilitation provider), and that not participating in the study would not in any manner confer a disadvantage in service use. no identifiable information of any user (name, medical record number, etc.) was taken out of the centers. responses were received from 81 pairs of user families and providers of five home - visit rehabilitation centers. of these 1.participant selection processninety pairs of home - visit rehabilitation providers and user families were given self - administered questionnaires. the final analysis utilized data from 50 pairs that met the inclusion criteria.). providers provided an explanation of the home - visit rehabilitation planning document concerning rehabilitation goals and programs for 46 (92.0%) of the 50 user families. the mean user age was 77.7 10.2 years, 48.0% (24/50) were female, and 62.0% (31/50) were living with their spouse. the main medical condition was cerebrovascular disease in 32.0% (16/50) of users, and the mean frequency of use during the month the survey was conducted was 5.8 2.7 times. the mean age of user family members was 65.0 11.2 years, and 84.0% (42/50) were living with the users (table 1table 1.characteristics of users and user familiesusers (n=50)user families (n=50)n%mean sdn%mean sdgenderfemale2448.0 3570.0 living conditionsalone 48.0 with spouse 3162.0 with children s family 1224.0 other 36.0 living together4284.0 living apart816.0 main diseasecerebrovascular 1632.0 bone and joint 1020.0 neuromuscular 1122.0 disuse syndrome 24.0 dementia36.0 other 714.0 unknown12.0 age77.710.265.011.2frequency of going out (number of times / week)2.01.8barthel index 52.632.5 hds - r (n=30)20.18.6tmig 3.53.9 times of hr / month5.82.7relationship with userspouse2958.0 son714.0 daughter1326.0 daughter - in - law12.0 care burden (current)fair1122.0 little2856.0 some816.0 no burden 36.0 including day care, day service, going to hospital, etc.hds-r : revised version of hasegawa s dementia scale, tmig : tokyo metropolitan institute of gerontology index of competence, hr : home - visit rehabilitation). participant selection process ninety pairs of home - visit rehabilitation providers and user families were given self - administered questionnaires. the final analysis utilized data from 50 pairs that met the inclusion criteria. including day care, day service, going to hospital, etc. hds - r : revised version of hasegawa s dementia scale, tmig : tokyo metropolitan institute of gerontology index of competence, hr : home - visit rehabilitation with regard to the content of home - visit rehabilitation, user families tended to think that the following three items were being implemented to a significantly greater degree than did providers (p<0.05) : paralysis improvement exercise, massage, and self - care activities (table 2table 2.contents of home - visit rehabilitation within the past one monthanalyzing pairsuser familiesprovidersnn%n%stretching and exercise of range of motion474391.5 3983.0 muscle and physical strength443784.1 3272.7 paralysis improvement exercise403075.0 717.5 massage432660.5 1023.3 how to move473574.5 3063.8 floor sitting and standing471225.5 612.8 self - care activities 461226.1 48.7 indoor movement 493469.4 3061.2 outdoor movement 482041.7 1837.5 climbing stairs and entranceway461634.8 1328.3 breathing 421228.6 819.0 choking and swallowing 43511.6 37.0 speaking, reading, and writing441125.0 818.2 self - training and advice453271.1 2862.2 housing repair and devices 461839.1 1226.1 consultation for anxiety and worries 462350.0 1634.8 housework and leisure activities45511.1 511.1 working4912.0 00.0 an analyzing pair consisted of a user family response and a provider response. incomplete pairs were excluded from the analyzing pairs in each item.mcnemars test (binomial distribution) was used with statistical significance set at p < 0.05. p<0.05). with regard to the subjective effects of home - visit rehabilitation, a higher proportion of user families were aware of maintenance / improvement effects on symptoms and sequelae, as well as on pain and suffering, compared with care providers (p<0.05 ; table 3table 3.maintenance or improvement of users condition since beginning home - visit rehabilitationanalyzing pairsuser familiesprovidersnn%n%symptoms and sequelae484593.8 3368.8 pain and suffering474493.6 3676.6 risk of falling504794.0 4386.0 decline of physical strength and fatigue504182.0 3978.0 muscle weakness494285.7 3979.6 decreased frequency of going out453782.2 4293.3 choking and swallowing484593.8 4593.8 forgetfulness494693.9 4489.8 walking and moving494285.7 3877.6 climbing stairs473880.9 4187.2 use of public transportation433683.7 43100.0 self - care activities494387.8 4489.8 housework373081.1 3697.3 work and hobbies433888.4 43100.0 family relationships4848100.0 48100.0 friendship444295.5 44100.0 anxiety about the future484593.8 4491.7 an analyzing pair consisted of a user family response and a provider response. incomplete pairs were excluded from the analyzing pairs in each item.mcnemars test (binomial distribution) was used with statistical significance set at p < 0.05. p<0.05). an analyzing pair consisted of a user family response and a provider response. mcnemar s test (binomial distribution) was used with statistical significance set at p < 0.05. p<0.05 an analyzing pair consisted of a user family response and a provider response. mcnemar s test (binomial distribution) was used with statistical significance set at p < 0.05. p<0.05 the present study analyzed responses from 50 pairs of user families and care providers who met the inclusion criteria, and found that user families tended to think that home - visit rehabilitation comprised paralysis improvement exercise, massage, and self - care activities to a greater degree than did providers. on the other hand, a higher proportion of user families thought that home - visit rehabilitation was effective for the maintenance / improvement of symptoms and sequelae, as well as pain and suffering, compared with providers. we also found differences between user families and care providers in their awareness of subjective effects regarding maintenance / improvement of symptoms and pain. these findings suggest the need for providers to better explain the aims of home - visit rehabilitation to user families and to incorporate the aims based on an understanding of the family s awareness. in japan, where care is significantly influenced by the family, thorough explanations regarding care are required for both care receivers and their families. thus, there is a need for the development of strategies to improve and promote communication between rehabilitation providers and user families. hagino m. pointed out that users expect items related to functional training, basic operations, and movement to be incorporated into home - visit rehabilitation20. previously, we reported differences between reasons for service use and daily life goals in the same study population21. in addition, from the family s perspective, personally meaningful activities were included among users daily life goals22. for instance, other regions may have different numbers of home - visit rehabilitation centers and manpower, and regional cultures and characteristics of local residents are also likely to be different. however, the present study targeted five different home - visit rehabilitation centers that remained anonymous, and the analysis was performed by matching the providers with each user and his / her family. therefore, our results will likely provide insight that will be helpful in clinical practice. in conclusion, the present study suggests that user families may overestimate the role of home - visit rehabilitation (e.g., physical function improvement, massage), as well as the effects of rehabilitation on symptoms and pain, more than providers do. therefore, providers should pay attention when providing explanations regarding the content and aims of rehabilitation to each user as well as his / her family. | [purpose ] this study aimed to clarify differences in understanding and subjective effects of home - visit rehabilitation between user families and rehabilitation providers. [subjects ] the subjects were home - visit rehabilitation providers and user families. [methods ] home - visit rehabilitation providers and user families completed a self - administered questionnaire regarding the content and subjective effects of home - visit rehabilitation. for statistical analysis, the mcnemar s test was used. [results ] fifty pairs of responses met the inclusion criteria. the mean age of user families was 65.0 11.2 years, and 58.0% (29/50) were spouses of users (user mean age, 77.7 10.2 years ; 48.0% (24/50) female). with regard to home - visit rehabilitation content, user families thought that paralysis improvement exercise, massage, and self - care activities were implemented to a greater degree than did rehabilitation providers. with regard to the subjective effects of home - visit rehabilitation, a higher proportion of user families noticed maintenance / improvement effects on symptoms and sequelae, as well as pain and suffering, compared with providers. [conclusion ] user families believed that rehabilitation would also improve users symptoms and pain. care providers should explain the aims of home - visit rehabilitation to users and their families, both of which require a strong understanding of home - visit rehabilitation in order to achieve rehabilitation goals. |
to explore the needs and expectations of diabetic patients and healthcare professionals in the canton of vaud. we conducted one focus group (fg) with diabetic patients and one with healthcare professionals (general practitioners, diabetologists, pharmacists, home healthcare managers, podologists) in each of the four health regions of the canton (n=8 fg). participants describe a lack of collaboration and communication between professionals, problems linked to self - management education, and a lack of information on diabetes for the general population. they propose to improve the quality of care by strengthening existing structures, by developing centralization of care and information, and by reinforcing teamwork and self - management education. diabetics and healthcare professionals express the need to develop a cantonal program at a local level and adapted to patients needs. for patients, such a program would represent an opportunity to have access to comprehensive care. for healthcare professionals, it would favor the development of teamwork and of local networks. these results should help the development and implementation of a program adapted to the patients and professionals needs. | purposeto explore the needs and expectations of diabetic patients and healthcare professionals in the canton of vaud.contextdevelopment and implementation of a diabetes cantonal program.methodswe conducted one focus group (fg) with diabetic patients and one with healthcare professionals (general practitioners, diabetologists, pharmacists, home healthcare managers, podologists) in each of the four health regions of the canton (n=8 fg). fgs were audio - taped and transcribed verbatim, and content analysis performed.results and conclusionperceived quality of diabetes care varies, depending on participants and regions considered. participants describe a lack of collaboration and communication between professionals, problems linked to self - management education, and a lack of information on diabetes for the general population.they propose to improve the quality of care by strengthening existing structures, by developing centralization of care and information, and by reinforcing teamwork and self - management education. they also suggest implementing information and prevention campaigns for the general population.diabetics and healthcare professionals express the need to develop a cantonal program at a local level and adapted to patients needs. for patients, such a program would represent an opportunity to have access to comprehensive care. for healthcare professionals, it would favor the development of teamwork and of local networks.participants point out similar problems and solutions, even if not similarly expressed. these results should help the development and implementation of a program adapted to the patients and professionals needs. |
recombinant proteins produced in insect cell systems are useful for fundamental research in cell and molecular biology. in addition, they are important for commercial production of reagents, therapeutics, and vaccines for agriculture and human health applications. to produce recombinant protein in insect cells, baculovirus expression vector system (bevs) is a suitable and widely used eukaryotic system [25 ] for high - level expression of heterogonous proteins. however, for production and purification of proteins, this system has a number of disadvantages including the transience of virus - based expression and the considerable effort required for scale - up and maintenance of virus stocks. in addition, viral proteases and cell lysates can cause degradation of the desired proteins and it is difficult to separate recombinant protein from recombinant virus particles [2, 6 ]. in order to resolve these problems, an alternative approach using a nonlytic, virus - free expression system has been adopted [7, 8 ] that uses early baculovirus promoters in either transiently or stably transformed cells from drosophila melanogaster, mosquito, as well as spodoptera cells [811 ]. in contrast to baculovirus infected cells, stable insect cells are able to continuously produce soluble recombinant proteins, which facilitate protein purification and the proteins are also properly modified. however, the rate of protein expression in stably transformed cells is often lower than that of a conventional baculoviral system. in this study human il-7 is a single - chain 25 kda protein first identified in bone marrow cultures through its pre - b cell growth factor properties ; it was later described as a potent t - lymphocyte growth factor [1214 ]. it is produced locally by intestinal epithelial and epithelial goblet cells and may serve as a regulatory factor for intestinal mucosal lymphocytes. il-7 develops and activates lymphocytes ; it also stimulates lymphopoiesis in lymphopenic mice [15, 16 ]. these findings suggest a possible clinical application of il-7 for accelerating lymphoid reconstitution in lymphopenic patients. a number of preclinical studies have demonstrated possible functioning of il-7 in antitumor clinical applications and gene therapy for metastatic diseases. il-7 can also promote engraftment of stem cells in mice receiving bone marrow transplants, leading to a possible use of hil-7 in patients receiving bone marrow or peripheral blood stem cell transplants. to examine the expression and production of hil-7 in a nonlytic, baculovirus - free expression system, we used a stably transfected insect cell system cotransfected with an expression vector containing a silk moth - bombyx mori promoter and a resistance plasmid carrying a selectable marker puromycin gene [7, 17, 18 ]. for comparison purposes, we used another plasmid containing opie2 promoter for high - level, constitutive expression of the gene of interest containing a zeocin resistance gene for selection of stable cell lines [19, 20 ]. spodoptera frugiperda, sf9 cells (invitrogen, carlsbad, calif, usa) were cultured in sf-900 ii medium (invitrogen, carlsbad, calif, usa) and incubated in a shaker incubator at a temperature of 27c and 115 rpm. the cells were maintained by passaging 1 to 2 times weekly at an initial cell density of 4 - 5 10 cellsml. during this process, the total and viable cell densities and the cell size were measured using the automated trypan blue exclusion method (cedex, innovatis, bielfeld, germany). nonlytic triple express insect expression system : pie1/153a (v4) (cytostore, calgary, alberta, canada) and plasmid pbmapac (cytostore, calgary, alberta, canada) carrying a selectable marker puromycin gene were used. for comparison the basic vector piz / v5-his (invitrogen, carlsbad, calif, usa) the hil-7 gene was amplified by pcr from porf9-hil07 transfer vector (invivogen, hornby, ontario, canada) using oligonucleotide primers : forward : gcctacctgggatccggtcaac and reverse : tcatcaatgtatgcggccgccttatcatgtcgag and vent polymerase (new england biolabs, ipswich, mass, usa). the pcr product was subcloned into the bamhii and noti site of pie1/153a (v4) vector. the recombinant plasmids containing hil-7 cassette in frame were confirmed by restriction endonuclease digestion and dna sequencing. sf9 cells were seeded into six - well plates at a density of 5 10 cellsml (2 ml per well). cells were cotransfected with the plasmids pie1/153a.hil-7 and pbmapac or piz / v5-his.hil-7 using cellfectin (invitrogen, carlsbad, calif, usa). the mixture was incubated for 45 minutes then added to the cells and incubated for 5 hours at 27c. the medium was then replaced with fresh medium (sf900 ii) and the cultures further incubated at 27c. one week later, transfected cells were transferred to a medium containing puromycin (gibco brl) at a final concentration of 5 gml in the case of pie1/153a.hil-7 (or 500 gml zeocin in the case of piz / v5-his.hil-7 transfection) and incubated for 3 weeks. to allow selection of resistant cells, transfected cells were propagated for a further 2 weeks in sf900ii supplemented with appropriate antibiotics. after this initial selection, cell cultures were maintained in media lacking any antibiotics. to establish clonal cell lines, the cells were harvested by gentle scraping, aliquots were transferred to 24-well plates and the plates were incubated for seven days at 27c. the media were changed every 2 days with fresh media supplemented with an appropriate antibiotic. after 57 days, cells were amplified in sf900ii until sufficient cell concentrations were present for analysis. ten to twelve well - isolated antibiotic - resistant colonies from a 96-well plate were selected, and the hil-7 expression levels from the supernatant of each stable polyclone were examined by western blot analysis. cells were maintained in antibiotic - free medium for 20 passages and the stability of the transfected cells was monitored using western blots analysis. for the expression of recombinant proteins, a pool of stably transfected sf9 cloned cells was grown in serum - free medium (sf900-ii) in shaker flasks. the cells were seeded at a density of 5 10 cellsml and their growth was monitored by taking samples. the total and viable cell densities as well as cell size were measured (using the automated trypan blue exclusion method, cedex, innovatis, bielfeld, germany). the experiment was performed in triplicate and samples were taken at regular intervals. the cell lines were frozen using freezing media (10% fbs, 10% dmso, and 80% sf900 ii) and stored in liquid nitrogen for further analysis. plasmid construction, bacmid preparation, insect cell transfection, and baculovirus stock preparation have been described elsewhere. for comparison assays, recombinant baculovirus containing human interleukin-7 (rbac / hil-7) was used at a multiplicity of infection (moi) between 5 to 0.5 to infect sf9 cells. the cells were cultured in shaker flasks and were incubated at 27c with agitation at 115 rpm. samples were taken at regular intervals of 24, 48, 72, and 96 hours post - infection (hpi). total and viable cell densities and cell size were measured using the automated trypan blue exclusion method (cedex, innovatis, bielfeld, germany) during the infection process. the amount of hil-7 in supernatants was measured by sandwich elisa using rabbit antihuman il-7 antibody (rdi, mass, usa) as the capture antibody and a biotinylated monoclonal antihuman il-7 (r&d systems, ontario, canada) as the detection antibody. streptavidin - horseradish peroxidase (r&d systems, ontario, canada) was used for conversion of a substrate mixture containing stabilized hydrogen peroxide and stabilized tetramethylbenzidine (r&d systems, ontario, canada). the reactions were terminated by adding h2so4, and the absorbance was measured at 450 nm using 570 nm as the reference wavelength. commercially available purified human il-7(r&d systems, ontario, canada) was used as a standard. the expression of human interleukin-7 was determined using sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page). 15 l of samples were loaded to the gel and detected using a polyclonal rabbit antihuman il-7 (rdi, flanders, nj, usa) as the primary antibody. the blots were developed using the chemiluminescence kit (boehringer mannheim, mannheim, germany) and visualized with the kodak manager system. recombinant hil-7 proteins produced in 2 different clones were tested for their bioactivity using induction of in vitro proliferation of an il-7-dependent murine immature b lymphocyte cell line 2e8 (atcc : tib 239) as a measure of activity. 2e8 cells were maintained at 37c in a 5% co2 atmosphere in isocove 's modified dulbecco 's medium (atcc, manassas, va, usa) supplemented with 0.05 mm 2-mercaptoethanol, 2 mm glutamine, 50 iu / ml penicillin, 50 mg / ml streptomycin, 5 ng / ml il-7, and 5% fetal bovine serum (sigma - aldrich, oakville, ontario, canada). il-7 was found to remain biologically active in the presence of 0.05 mm 2-mercaptoethanol. cell proliferation was detected by tetrazolium compound [3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium, inner salt ; mts ] and an electron coupling reagent (phenazine methosulfate : pms) (promega, madison, wis). for proliferation assays, 2e8 cells were washed three times and seeded at a density of 1 10 cells / well in 96-well plates in 50 l of medium containing no il-7. a 50 l aliquot of crude protein was added to each well to give a range of concentrations from 0.01 to 100 ng / ml in a final volume of 100 l. after 72-hours incubation, a 20-l aliquot of mts - pms (according to the manufacturer 's protocol) was added to each well and incubated at 37c for 4 hours. mts is bioreduced by cells into a formazan product that is soluble in tissue culture medium. the absorbance of the formazan at 490 nm can be measured directly from 96-well assay plates without additional processing. medium alone served as a negative control, and each sample was assayed in triplicate. the hil-7 gene was obtained by pcr reaction and digestion with noti and bamhi enzymes from porf9-hil07 transfer vector, which were used to facilitate the insertion of the gene into the cut pie1/153a (v4) or piz / v5-his expression vector plasmids. cloned plasmids were then transferred to competent e.coli cells, purified according to the manufacturer 's protocol, and used for transfection of sf9 cells. figure 1 illustrates the construction of pie1/153a (v4) expression plasmid carrying hil-7 gene (pie1/153a.hil-7) and the transfection procedure of the constructed plasmid into the sf9 insect cells. for transfection, pie1/153a.hil-7 plasmid was cotransfected with plasmid pbma.pac containing puromycin resistance gene into the insect cells. the expression characteristics of the recombinant hil-7 protein were analyzed by western blotting using hil-7 specific antibody, as presented in figure 2, which shows preliminary results for screening of positive clones. in sf9 insect cells, production and processing of hil-7 proceeded normally, resulting in a protein with molecular weight similar to that produced in mammalian cells. stable expression was verified by maintaining the sf9hil-7a1 polyclone in puromycin - free medium after the selection. the expression of hil-7 remained stable during more than 15 cell passages and cells could be maintained further in selection - free media without any decrease in their production. the cell lines were successfully frozen and retrieved from liquid nitrogen using the same procedures used for sf9 cells. figure 3 shows a growth curve over an 11-day period in sf900 ii for sf9hil-7a1 compared to nontransfected sf9 insect cells. as shown in figure 3(a), cell densities increased exponentially over the first six days and then appeared to plateau between days six to eight, reaching maximum densities of approximately 8 10 cellsml. culture viabilities remained high (above 95%) until day seven but then dropped to below 70% by day eleven. culture viabilities ranged from 95% to 99.5%, with most determinations above 97% during the exponential stage, which was similar to nontransfected sf9 insect cells (figure 3(b)). for comparison, we cloned the nucleotide sequences corresponding to the hil-7 protein into the piz / v5-his expression vector and constructed the piz / v5-his.hil-7 vector. this plasmid is an immediate early expression plasmid where the coding sequence for hil-7 is positioned under the transcription control of the opie2 promoter. the promoter is derived from a second immediate early regulatory gene of the baculovirus orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (opmnpv) which was identified in 1992 [20, 22 ]. insect cells were then transfected with piz / v5-his.hil-7 and stable transfectants were selected with zeocin, a glycopeptide antibiotic of the bleomycin family, which is active in vivo against most bacteria (including e. coli), eukaryotic microorganisms (i.e., yeasts), plant cells, and animal cells. the most productive polyclonals, grown with sf900ii medium in shake flasks at 27c and 120 rpm from an initial concentration of 5 10 cellml, reached a maximum cell density of approximately 8 10 cell / ml on the fourth day of culture with a cell viability of 93% (figure 4(a)). this demonstrated that stable transfection of piz / v5-his.hil-7 into sf9 cells did not cause significant changes in the growth of the transfected sf9-hil-7 cells nor in the cell viability, when compared to growth curves of wild - type sf9 cells obtained under the same conditions (figure 4(b)). secreted protein was measured in cell culture supernatants collected every 24 hours for 111 days (figure 5) and its concentration was determined by elisa. the quantity of hil-7 in supernatants attained a maximum accumulation of 1.7 gl of cell culture supernatant. as shown in figure 5, production of hil-7 was generally still increasing in the supernatant on day 11. in case of the cells transfected with piz / v5-his.hil-7, production of the recombinant hil-7 recombinant hil-7 produced in both systems was assayed for biological activity by measuring the stimulation of il-7-dependent 2e8 cell proliferation in vitro. maximal stimulation of proliferation occurred in the presence of hil-7 and no difference was seen in the ability of recombinant hil-7 to induce the proliferation of cell populations compared with that of the commercially available purified hil-7. as shown in figure 6, incubation with hil-7 concentrations above 1 ng / ml resulted in an increase in the a490 nm of 2e8 cell cultures, with no activity seen at lower hil-7 concentrations. we compared productivity of hil-7 in sf9 cells using bevs. to infect cells, different multiplicity of infection was used. as shown in figure 7, the final viable cell density of the uninfected cells (control) was much higher than those of cells infected by recombinant virus. the number of viable cells increased to more than 10 10 cells / ml by 96 hours in the control and decreased to less than 1 10 cells / ml in cells infected with the virus. in addition, the viability of infected cells decreased after 48 hpi, to less than 60%. there was no significant difference in viability between control cells over a period of 96 hpi. the western blot data shown in figure 8 indicate that hil-7 is produced and processed normally in the bevs system to generate a protein with a similar molecular weight to that produced in mammalian cells. the protein was found in both the supernatant and the cell lysates, however, the intracellular protein was found to have multiple molecular weights. these different molecular forms are likely a result of incomplete glycosylation which may occur in this system. in general bevs produced higher amounts of recombinant hil-7, as elisa revealed that the expression level was almost 10 times greater in bevs than in the stably transfected insect cells. for production of hil-7 in bevs, a strong polyhedrin (ph) promoter for high - level protein expression was used. in this case, the baculovirus can synthesize recombinant protein in infected cells, polyhedrin eventually constitutes up to 50% of the total protein in the cell. this promoter has been used to construct expression vectors to allow high level of expression of the gene of interest under the influence of this promoter. in contrast, in the case of stably transfected insect cells, the silk moth - bombyx mori promoter was used. this promoter is a region of the genome of bombyx mori nuclear polyhedrosis virus (bm - npv) containing the homologous region 3 (hr3), which acts as an enhancer for the promoter of a nonviral gene, the cytoplasmic actin gene of the silkmoth. on the other hand, stable cultures, initiated with a lower cell density at 5 10 cell / ml, grew until they reached a maximal viable cell density of 13.3 10 cell / ml ; whereas, the cells infected at 2 10 cell / ml cell density in case of bevs reached a viable cell density of only 3.5 10 cell / ml. viability of bevs cells dropped to 1020% at 96 hours post infection while in stably transfected insect cells, viability was maintained at 8099% for 240 hours incubation. generally, bevs has been used for the high - level expression of eukaryotic genes in insect cells, as it is a rapid and convenient system for production of many different foreign proteins. the simplicity and rapidity of the vector system are two of its most important characters [2, 23 ], which make bevs a powerful system for high - level, recombinant protein expression in insect cells. on the other hand, stable insect expression systems have advantages of both baculovirus and mammalian expression systems. they are also simple to use, with uncomplicated techniques for transfection and selection similar to those used with mammalian expression systems. stable insect systems often reach higher levels of expression than do mammalian systems and are especially useful for production of secreted proteins. in this study, we successfully established stably transfected insect cell lines for the production of recombinant hil-7. we have demonstrated that these stably transfected cells can be used as an alternative to bevs for large scale production of recombinant hil-7. the levels of secreted human interleukin-7 in our small scale study reached 1.7 gl under serum - free cell culture conditions (in the case of the piz / v5-his.hil-7 plasmid we obtained 1 gl). in particular, the stable system using the expression vector pie1/153a (v4) constitutes an advance for the expression of hil-7 and possibly other glycoproteins in insect cells. this expression plasmid contains a silk moth - bombyx mori promoter for high - level expression of the recombinant protein and a resistance plasmid which carries a selectable marker puromycin gene for selection of the transfected cells. [7, 18 ] for continuous high - level expression of secreted glycoproteins by transformed lepidopteran insect cells and was developed as an alternative to baculovirus and mammalian cell expression systems. the expression cassette has the promoter of the silkmoth cytoplasmic actin gene, to drive expression of foreign gene sequences and also contains a transactivator gene and enhancer region of bmnpv, to stimulate gene expression. since it is a nonlytic system, the glycoproteins obtained are probably more suitable for structural and functional studies. | human interleukin-7 (hil-7) is a cytokine secreted by the stromal cells of the red marrow. it is important for proliferation during certain stages of b - cell maturation and for t and nk cell survival, development, and homeostasis. it is a critical growth factor for enhancement and recovery of the immune t - cell. because of its strong immunomodulatory effects, hil-7 may become a valuable supplementary agent for immunotherapeutical treatments in patients with hiv infection or immunodeficiency. human il-7 has previously been produced in various protein expression systems. in this paper, we present an alternative expression system, in spodoptera frugiperda cells, for the production of hil-7 using nonlytic vector systems. this system allows generation of correctly translated and accurately processed heterologous proteins as soluble recombinant proteins. here we report plasmid construction, transfection, and consequent expression of hil-7 using this nonlytic insect cell expression system. the levels of secreted hil-7 in a small scale experiment reached a level of 1.7 g11 under serum - free cell culture conditions. |
the importance of legumes in agriculture, human consumption, and animal nutrition is increasing exponentially due to the increasing world population and its need for proteins. food legumes are considered the best substitute for meat in many parts of the world, where there is a demand for alternate, nonanimal protein sources. legume crops have two distinctive traits : (1) their high protein content, and (2) their unique symbiotic ability to fix atmospheric nitrogen in the soil. faba bean (vicia faba l.) is an important member of the legume family with highly useful characteristics. faba bean is the second most important legume crop in europe, which accounts for 14% of the world area and about 25% of the world production. it is widely grown and consumed, especially in egypt, mediterranean region, china, north african countries and parts of europe, and south america, and is served in a great variety of forms, mostly based on the immature or mature seed. for both humans and livestock, it provides high - quality, lysine - rich proteins, carbohydrates, and fibers. it is also rich in carotenoids, vitamins [2, 3 ], and essential minerals including iron, magnesium, potassium, zinc, copper, and selenium. faba beans have also lipid - lowering effects and may also be a good source of antioxidants and chemopreventive factors. in common with numerous crop legumes, faba bean produces various antinutritional factors including raffinose series oligosaccharides, lectins and protease inhibitors, phytate, and tannins. almost unique to faba bean are vicine and convicine, the causative agents of favism in many human populations. these antinutritional factors have limited its worldwide acceptance as a competitive food crop. as an effective nitrogen - fixing species, it is regarded as an excellent crop for soil amendment, which also provides high - quality fodder and silage. elsewhere around the world, the crop is very widely distributed in the mediterranean region, the nile valley, ethiopia, central asia, and northern europe. faba bean is grown as a seed crop mostly along the west coast of the united states. in south america, faba bean is also of importance as a food crop especially in the andean region. ray and georges detected convicilin, oleosin, fabatin, and defensin in faba beans seeds. on the other hand, bicakci reported blood in the urine, headache, dizziness, fatigue, loss of appetite, and jaundice in the eyes 24 hours after eating large amounts of fresh faba beans seeds. he detected that approximately 0.5% of fava bean seeds have 2 pyrimidine beta - glycosides called vicine and convicine. faba bean has 0.73% vicine, 0.08% convicine, and 0.53% beta - cyanoalanine glycosides. furthermore, gutierrez. used two cleavage amplified polymorphism (cap) markers in faba beans breeding to track the introgression of the vicine and convicine allele to develop cultivars with low vicine and convicine contents and improved crop nutritional value. vicine is a glycoside that is found primarily in faba beans (vicia faba l.) which is one of the most important pulse crops in the world, being consumed in large quantities in the middle east and north africa particularly egypt. vicine is a compound which is hydrolysed by intestinal microflora to high reactive free radical generating compound divicine. divicine has been strongly implicated as the causative agent in favism (vicia faba anemia), a hemolytic disease in humans particularly young males that have deficiency of erythrocytic glucose-6-phosphate dehydrogenase (g6-pd) activity. these free radical generators may also cause other adverse effects including lipid peroxidation and altered fat. in broiler chicken, reduction of vicine and convicine moreover, farran. stated that high levels of vicine or convicine or both might have shortened birds ' survival time by enhancing the neurotoxicity induced by lower levels of total beta - cyanoalanine (bca). neomycin sulphate is a broad spectrum and poorly absorbed antibiotic which inhibits the growth of anaerobic microorganisms in gastrointestinal tract. in addition to its antibiotic effect, it has other effects, for example, inhibition of rat glioma growth, and it has a significantly higher rate of wound closure. on the other hand, sun. this inhibitory effect of neomycin was more pronounced (75% reduction in maximum fluorescence) for osteoblasts seeded on notched cortical bone. moreover, neomycin in conjugation with polyhexanid and propamidinisoethionat used for treatment of acanthamoeba keratitis disease and acanthamoeba keratitis patient often heals appropriately. furthermore, neomycin blocks aminoacyl - transfer rna (aa - trna) selection and translocation as well as ribosome recycling by binding to helix 69 (h69) of 23s ribosomal rna within the large subunit of the escherichia coli ribosome. the purpose of this study was providing evidence to the effect of orally administered antibiotic neomycin on the toxicity of vicine. male albino rats (100 5 g) were obtained from the animal house of the national research centre (dokki, giza, egypt) and were kept in special plastic cages. the experiments were performed after approval from the ethics committee of the national research centre and in accordance with recommendations for the proper care and use laboratory animals (nih publication no 85:23 revised 1985). neomycin sulphate tablets (500 mg each) were purchased from memphis co. (cairo, egypt). all diagnostic kits used were of analytical grade and were obtained from gamma trade co., egypt. a total number of 50 rats were used in this experiment and the rats were divided into 5 equal groups (10 rats / group) and treated as follows : control : injected intraperitoneally (ip) with 1 ml physiological saline, groups 2, 3 and 4 : injected ip with vicine in a dose of 100, 200 and 400 mg / kg bwt, respectively, group 5 : administered orally 4 times with neomycin (250 mg / kg bwt) a day prior to the administration of 400 mg / kg bwt vicine ip. control : injected intraperitoneally (ip) with 1 ml physiological saline, groups 2, 3 and 4 : injected ip with vicine in a dose of 100, 200 and 400 mg / kg bwt, respectively, group 5 : administered orally 4 times with neomycin (250 mg / kg bwt) a day prior to the administration of 400 mg / kg bwt vicine ip. then, throughout 48 hours experimental period, the total number of died and survived rats was recorded. based on the result of the first experiment, a total number of 24 rats were used in the second study and the animals were divided into 3 equal groups each of 8 animals as follows : control group : injected ip with 1 ml physiological saline once a day over 7 days period, vicine group : injected ip with vicine in a dose of 400 mg / kg bwt once a day over 7 days period, neomycin + vicine group : administered orally 4 times 250 mg / kg bwt neomycin a day prior to the administration of vicine (400 mg / kg bwt, ip) once a day over 7-day period. control group : injected ip with 1 ml physiological saline once a day over 7 days period, vicine group : injected ip with vicine in a dose of 400 mg / kg bwt once a day over 7 days period, neomycin + vicine group : administered orally 4 times 250 mg / kg bwt neomycin a day prior to the administration of vicine (400 mg / kg bwt, ip) once a day over 7-day period. at the end of 7 days experimental study, the blood samples were collected before rats being scarified from retroorbital plexus of rats using capillary tubes into clean centrifuge tubes. part of blood samples was collected using edta as an anticoagulant for hematological parameters and erythrocyte glutathione. the other part of the blood sample was allowed to coagulate and centrifuged at 4000 rpm for 15 min to separate blood serum. separated serum was stored at 20c for the determination of the other parameters and the following parameters were done. red blood cells (rbcs), white blood cells (wbcs) count, and hematocrit, value were carried out according to the method of rodak. hemoglobin (hb) concentration was determined by the method described by van kampen and zijlstra. erythrocyte glutathione concentration was determined by the method described by beutler.. serum globulin content was calculated by subtracting the individual data of serum albumin from individual data of serum total protein. aspartate and alanine transaminases (ast & alt) activities in serum and liver tissue were estimated colorimetrically according to the method described by reitman and frankel. lipid peroxidation is estimated in serum according to the method described by yoshioka.. after collection of the blood, the animals were decapitated and then dissected, whereby the liver was obtained, washed in cold saline, and dried between filter papers. the liver was weighed, homogenized, and kept at 20c for further investigation ; 0.5 gm of liver tissue was dissolved in 2.5 ml of tris buffer solution, then homogenized in the homogenizer for exactly 30 min. then, it was centrifuged for exactly 20 min at 7000 rpm, which separated the supernatant, which proceeded in the same manner of blood serum for the determination of liver transaminases and protein. specimens of liver were fixed at 10% neutral formalin solution and then processed for routine embedding in paraffin. blocks were sectioned at a thickness of 5 m and stained with hematoxylin and eosin for histopathological examination. differences between groups were assessed by anova using the spss 13 software package for windows. post hoc testing was performed for intergroup comparisons using the least significant difference (tukey) test, significance at p values 0.05. the first experiment demonstrated that vicine alone at dose of 100 mg / kg body weight (bwt) did not cause any mortality. mortality started at the dose of 200 mg / kg bwt and all the rats died at the dose of 400 mg / kg bwt. in the fifth group which is administered neomycin 250 mg / kg bwt 4 times a day prior to administration of vicine (400 mg / kg bwt), only one from 10 rats died (table 1 and figure 1). the results of the second experiment demonstrated that there were significant decrease in hb concentration in vicine - induced group as compared to control group meanwhile the rats treated with neomycin prior to vicine showed improvement in hb. concerning hct value (%), the results indicated that the vicine group exhibited a significant decrease as compared with control group. rbcs count exhibited similar behavior as hb concentration and hct value which showed a very highly significant decrease in vicine group and marked improvement was observed in the group receiving neomycin prior to vicine as compared to the mean control value. on the other hand, rats that received neomycin prior to vicine showed an increase in wbcs count (table 2). table 3 showed that the mean level of serum glucose significantly decreased in vicine group but in the group that received neomycin prior to vicine the results were almost around the control values. concerning the concentration of gsh in blood, results revealed a highly significant decrease in vicine group. the decrease in blood gsh concentration in blood was improved in the group that received neomycin prior to vicine. tbars level in liver tissue exhibited a very highly significant increase in the group treated with vicine but in the group treated with neomycin prior to vicine the tbars level approaches the normal level. the mean value of the activity of g6-pd in serum is illustrated in table 3. the results showed a highly significant decrease in g6-pd activity in vicine group compared to the control value. this decrease was restored to be almost near the control value in rats treated with neomycin prior to vicine. in table 4, serum total protein content showed a significant decrease in vicine compared to control and in neomycin treated groups the globulin and protein tend to be normal values. the serum albumin showed a trend almost around the control level in vicine group and in the group received neomycin prior to vicine. concerning serum globulin results showed a highly significant decrease in vicine group and this will be improved in the group receiving neomycin prior to vicine. total protein content in liver tissue showed significant decrease in vicine group while when neomycin administered prior to vicine an increase in liver total protein content was observed compared to vicine group. the effects of vicine and neomycin prior to vicine on ast and alt activities in serum of male albino rats were done ; the results were demonstrated in table 5. in vicine group, there was very highly significant decrease in serum ast activity meanwhile in the group treated with neomycin prior to vicine the results showed an increase in serum ast if compared with vicine group. serum alt showed significant decrease in serum alt activity meanwhile in the group treated with neomycin prior to vicine the results showed an increase in serum ast compared with vicine group. alt activity in liver tissue exhibited a similar behavior as that observed in liver ast as compared to the control group and neomycin prior to vicine decreased liver alt to approach the control value. the structure of the control liver showed normal hepatocytes, vascular sinusoids, and centrolobular vein (figure 2(a)). injection of vicine to rats showed losses of hepatic lobular architecture, with large areas of hemorrhages in the fibrous strands between hepatic nodules and liver cirrhosis (figure 2(b)). examination of liver sections of rats pretreated with neomycin prior to vicine showed preserved hepatic lobular architecture. the glycoside vicine that is found in the faba beans (vicia faba l.) when administered intraperitoneally at relatively large amounts resulted in a rapid decrease in the concentration of blood gsh followed by death of the animals, where 400 mg / kg vicine was responsible for 80% mortality rate after 48 hours and no more deathes were observed in rats when administrated vicine for 7 days while 500 mg / kg vicine gives mortality rate of 100% during 7-day treatment. these results can be attributed to the rapid uptake and hydrolysis of this glycoside by the intestinal microflora [9, 30 ], to highly reactivate free radical generating compound divicine which has been strongly suggested to be the causative agent in favism. divicine when absorbed in sufficient quantity into the blood provides evidence that this compound is toxic. vicine must be chosen in high concentration because vicine first converted to its aglycone (divicine) to become biologically active and this conversion needs high vicine quantities or alternatively the process is sufficiently slow so that the animal is able to neutralize most of the products of divicine that are formed following the hydrolysis of vicine. single injection of vicine caused a decrease in blood glutathione concentration followed by hemolysis and hemoglobin changed from oxyhemoglobin to methemoglobin so that animals appeared to die of asphyxiation. the mechanism of neomycin protection was based on the hypothesis that vicine was hydrolysed by intestinal microflora to produce divicine, where neomycin produced morphological changes in intestinal microflora to prevent the hydrolysis of vicine to its aglycone (divicine) which is the causative agent of favism (vicia faba anemia). this study conducted the previous preliminary study of arbid., which demonstrated that neomycin reduced the rate at which vicine and convicine were hydrolysed in the gastrointestinal tract, and the neomycin reduced toxicity of both, while this study investigated that neomycin prevents the hydrolysis of vicine to its aglycone (divicine) and protects against the oxidative effect of vicine and this antioxidant effect of neomycin was confirmed by measuring hematological parameters, serum, and liver proteins and transaminases, in addition to liver histopathology and this can be useful in protection in case of favism and hemolytic anemia. in the present study, the effect of neomycin on the anaerobic microflora which hydrolyses the vicine to its aglycon divicine and consequently the toxic and lethal effect was established. the present study demonstrated that the increase doses of vicine resulted in an increase in the percentage of mortality in rats ; this effect may be attributed to the decrease in the concentration of gsh in blood which is associated with increase in mortality. they reported that ip administration of vicine glycoside and its subsequent hydrolytic product in the gastrointestinal tract above the critical level required to produce a lethal effect. pretreatment with the poorly absorbed broad spectrum neomycin reduced the percentage of mortality caused by the vicine doses. this result may be attributed to the reduction of the hydrolysis of vicine and consequently the depletion of gsh. this result was in agreement with that obtained by arbid. where their observations provide for the first time direct evidence that hydrolysis of the glycosides by the microorganisms in the gastrointestinal tract occurred before this compound becomes toxic. concerning the effect on some blood parameters, the present investigation revealed that hb concentration, hct value, and rbcs count were significantly decreased after the experimental injection of vicine to male albino rats. the reduction in the three blood parameters may be attributed to the hemotoxicity of vicine which resulted in the premature removal of damaged red cells by the spleen. this reduction is also reported by yannai and marquardt. regarding the effect of the neomycin, the results showed increase in the hematological parameters in the rats pretreated by neomycin and this may be due to its bactericidal effect on the microorganisms which hydrolyzes vicine to its toxic aglycon divicine. concerning the effect on white blood cells count, the present results showed a decrease in wbcs count in vicine group which may be attributed mainly to the decrease in lymphocytes as a sign of direct action of the glycoside vicine on the lymphatic tissue or a sign of a continuation of the depressing effect of corticosteroids upon mitosis in the lymphatic tissue as reported by kaneko. the reduction in wbcs count was observed after injection of vicine in male albino rats was also reported by yannai and marquardt and arbid and marquardt. with respect to the rats pretreated by neomycin, the results showed an increase in wbcs count compared to control rats ; this may be due to the decrease of hydrolysis of the glycoside to its toxic divicine. the decrease in the level of protein and albumin may be explained by the fact that toxic liver injury is usually associated with decreased albumin level secondary to decreased protein synthesis and decrease in globulin level due to deteriorated hepatic activity as reported by comporti. the decline in serum albumin concentration was also recorded by abbady who attributed this decline in the level of serum albumin to enhanced degradation as well as enhanced loss of albumin through the gastrointestinal tract ; on the other hand, neomycin treated group showed a trend almost around control group and this may be due to the effect on the microorganisms in the gastrointestinal tract and the decrease of the toxicity of the glycoside vicine. the significant decrease in glucose was recorded in vicine group with in accordance with arbid and marquardt. authors attributed the reduction in glucose level to the impairment of liver function which resulted in decrease production of glucose, altered production of glucogenic hormones including insulin, glucagons, and adrenocorticoid steroids or damage to the kidney tubules resulting in reducing the recovery of glucose from blood during glomerular filtration. the pretreatment with the antibiotic neomycin modulated the oxidative stress caused by injection of vicine was due to decrease its hydrolysis to its toxic aglycon divicine and the level of glucose increased to reach the normal range. the decrease in the level of gsh and increase in the level of lipid peroxidation and product malondialdehyde (mda) or thiobarbituric acid reactive substance (tbars) in serum in the groups injected by vicine are due to the production of free radicals which did not react only with erythrocytes but also with other membranes and tissues to cause tissue damage and loss of functional properties. the present study reported a highly significant decrease in the activity of serum g6-pd in vicine group as compared to control group ; this reduction may be attributed to a compensatory response to oxidative stress where the consumption of g6-pd enzyme was to maintain sufficient levels of nadph in response to the oxidative stress. all the effects of vicine on gsh, tbars, and g6-pd rendered to almost normal value in the group treated with neomycin which decreased the toxic effect of vicine by preventing its hydrolysis to its aglycon divicine. with regard to serum levels of liver enzymes, data of the present work showed that serum ast and alt were significantly decreased and liver ast and alt consequently increased due to accumulation in the liver tissue in vicine treated group. the decrease in the levels of serum ast and alt that was observed in vicine group may be correlated with the decrease in the level of serum total protein observed in the present study as the biosynthesis of protein in vicine group was decreased. the decrease in the level of serum ast and alt was explained by being protein in nature ; these enzymes were exposed to oxidative denaturation, decreased protein synthesis by hepatic cells. the increase in the activities of ast and alt that was recorded in rats pretreated with neomycin may be attributed to its effect on the toxicity of vicine and decreasing its oxidative stress on the tissues of the rats. the results of this study showed that pretreatment with neomycin to vicine - injected rats returned the hepatic structure almost to normal patterns and this is due to the effect of neomycin on the microorganisms in the gastrointestinal tract and the decrease of the toxicity of the glycoside vicine. we concluded that the pretreatment with the broad spectrum antibiotic neomycin to rats injected with glycoside vicine decreased to a great extent of its toxic and mortality effects in albino rats, and this study needs further clinical investigations because this proposed model, although providing interesting results, is not representative of the clinical situation observed in g6-pd - deficient subjects after fava bean injection. | vicine is hydrolyzed by microflora to highly reactive free radical generating compound divicine which causes mortality and other adverse effects. this study in the rats established the effect of a broad spectrum and poorly absorbed antibiotic, neomycin sulfate on the toxicity of vicine. the results showed extremely decrease in mortality rate in the group pretreated with neomycin. hemoglobin (hb) concentration, hematocrit (hct) value, and red blood cells (rbcs) count were significantly decreased after injection of vicine and the improvement of these values in the group pretreated with neomycin. the same results were observed in white blood cells (wbcs). the results showed a significant decrease in glucose level and returned to normal in group pretreated with neomycin. glutathione (gsh) was significantly decreased in the vicine group and returned to normal value in the group pretreated with neomycin. lipid peroxide (tbars) was significantly increased in the group treated with vicine and neomycin pretreated group decreased to the normal level. glucose-6-phosphate dehydrogenase (g6-pd) activity was significantly decreased and returned to normal level in rats pretreated with neomycin. serum protein and globulin were significantly decreased but serum albumin showed insignificant decrease in vicine and neomycin groups compared to control. alanine aminotransferase (alt) and aspartate aminotransferase (ast) were significantly decreased in the vicine group. the group pretreated with neomycin showed significantly increased activities of ast and alt compared with vicine group. in conclusion, neomycin pretreatment of rats injected with glycoside vicine decreased to a great extent of its toxic and mortality effects and is useful in favism and hemolytic anemia. |
inflammatory responses of the skin are largely due to infections with various bacteria and fungi, chemical irritation such as from sodium lauryl sulfate 2,4-dinitrophenol (dnp), and exposure of ultraviolet (uv) light, which lead to skin rash [14 ]. when such immunogens or irritants stimulate epithelial cells, macrophages, keratinocytes, mast cells, and langerhans cells of the skin layer, various inflammatory mediators, including interferon-(ifn-), tumor - necrosis - factor-(tnf-), interleukin-(il-) 6, cyclooxygenase-(cox-) 2, and matrix metalloproteinases (mmp), are produced and evoke the symptoms of inflammation [57 ]. activation of inflammatory cells and consequent expression of numerous inflammatory genes [811 ] result from toll - like - receptor-(tlr-) dependent [12, 13 ] or - independent stimulation of intracellular signaling cascades, which are composed of nonreceptor protein tyrosine kinases and serine - threonine protein kinases such as mitogen - activated protein kinases (e.g., p38, extracellular signal - regulated kinase [erk ], c - jun n - terminal kinase [jnk ]), as well as the activation and upregulation of nuclear factor (nf)-b and activator protein (ap)-1 transcription factors [14, 15 ]. lutein (figure 1) is one of naturally occurring carotenoids with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties [1619 ]. previous reports have suggested that this compound is able to ameliorate in vitro and in vivo inflammatory responses by suppressing nf-b activation [20, 21 ]. these findings strongly suggest a role of lutein in modulating inflammatory processes by regulating cellular redox potential. however, despite numerous studies, the mechanism underlying the anti - inflammatory activity of lutein remains unclear. because understanding skin inflammation is of interest to numerous cosmetic and pharmaceutical companies that develop skin - targeted biomaterials, exploring the effect of lutein on skin inflammation and its anti - inflammatory mechanism the effect of lutein treatment on the expression of proinflammatory mediators in macrophages and keratinocytes treated with lps, ifn-/tnf-, and uv, and the action mechanism of lutein were carefully investigated. lutein (95% purity), -carotene (figure 1), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt), sodium nitroprusside (snp), 27-dichlorodihydrofluorescein diacetate (dcf - da), and lipopolysaccharide (lps ; e. coli 0111:b4) were purchased from sigma chemical co. (st. louis, mo, usa). u0126 (u0), sb203580 (sb), and sp600125 (sp) were obtained from calbiochem (la jolla, ca, usa). fetal bovine serum and rpmi 1640 phosphospecific or total antibodies to ap-1 family proteins (c - fos, c - jun, and fra-1), ib, erk, p38, jnk, mkk3/6, mkk4/7, tak1, lamin a / c, and -actin were obtained from cell signaling (beverly, ma, usa). raw264.7 and hacat cells were cultured in rpmi 1640 medium supplemented with 10% heat - inactivated fetal bovine serum (fbs ; gibco, grand island, ny, usa), glutamine, and antibiotics (penicillin and streptomycin) at 37c under 5% co2. for each experiment, when the cells were cultured for the experiments at 2 10 cells / ml, the proportion of dead cells was less than 1% as determined by trypan blue dye exclusion. raw264.7 and hacat cells (1 10 cells / ml) were cultured for 18 h, after which lutein (0 to 50 m) was added to the cells for the final 24 h of culture. the cytotoxic effect of lutein was then evaluated by a conventional mtt assay, as reported previously [22, 23 ]. for the final 3 h of culture, 10 l mtt solution (10 mg / ml in phosphate - buffered saline, ph 7.4) was added to each well. the incubation was halted by the addition of 15% sodium dodecyl sulfate (sds) into each well, which solubilized the formazan. absorbance at 570 nm (od570630) was measured using a spectramax 250 microplate reader (biotex, bad friedrichshall, germany). raw264.7 and hacat cells (1 10 cells / ml) were cultured for 18 h, then pretreated with lutein (0 to 40 m) for 30 min, and further cultured with lps (1 g / ml) or ifn- (20 ng / ml)/tnf- (20 ng / ml) for 6 h or uv - irradiated for 27.5 s. the inhibitory effect of lutein on the expression of il-6 and cox-2 was determined by semiquantitative and real - time quantitative rt - pcr [25, 26 ]. to determine cytokine mrna expression levels, total rna was isolated from lps - treated raw264.7 cells using trizol reagent (gibco brl), according to the manufacturer 's instructions. semiquantitative (sq) or real - time quantitative (q) rt - pcr reactions were conducted as reported previously [27, 28 ]. the primers (bioneer, daejeon, korea) used in these reactions are listed in table 1. raw264.7 or hacat cells (5 10 cells / ml) were washed three times in cold pbs with 1 mm sodium orthovanadate, resuspended in lysis buffer (20 mm tris - hcl, ph 7.4, 2 mm edta, 2 mm ethylene glycol tetraacetic acid, 50 mm -glycerophosphate, 1 mm sodium orthovanadate, 1 mm dithiothreitol, 1% triton x-100, 10% glycerol, 10 g / ml aprotinin, 10 g / ml pepstatin, 1 mm benzamide, and 2 mm pmsf), and lysed by sonication with rotation for 30 min at 4c. the lysates were clarified by centrifugation at 16,000 g for 10 min at 4c and stored at 20c until use. after treatment, cells were collected with a rubber policeman, washed with pbs, and lysed on ice for 4 min in 500 l lysis buffer containing 50 mm kcl, 0.5% nonidet p-40, 25 mm hepes (ph 7.8), 1 mm phenylmethylsulfonyl fluoride, 10 g / ml leupeptin, 20 g / ml aprotinin, and 100 m 1,4-dithiothreitol (dtt). for the second step, the nuclear fraction pellet was washed once in the washing buffer (identical to the lysis buffer described above, except without nonidet p-40). in the final step, the nuclei were treated with an extraction buffer containing 500 mm kcl, 10% glycerol, and the other reagents listed for the lysis buffer above. the nuclei / extraction buffer mixture was frozen at 80c, then thawed on ice, and centrifuged at 19,326 g for 5 min. for immunoprecipitation, cell lysates containing equal amounts of protein (500 g) from raw264.7 cells (1 10 cells / ml) treated with or without lps (1 g / ml) for 2.5 min were precleared with 10 l protein a - coupled sepharose beads (50% v / v) (amersham, little chalfont, buckinghamshire, uk) for 1 h at 4c. pre - cleared samples were incubated with 5 l anti - p38 or jnk antibodies overnight at 4c. immune complexes were then mixed with 10 l protein a - coupled sepharose beads (50% v / v) and rotated for 3 h at 4c. to determine the effect of lutein on lps - activated p38 activity, immunoprecipitated p38 (prepared from raw264.7 cells (5 10 cells / ml) that had been treated with lps for 30 min in the presence or absence of lutein) the p38 kinase activity was determined using an anti - phospho - atf-2 antibody after immunoblotting analysis, as reported previously. lutein radicals scavenging activity was determined by measuring neutralizing activity of nitric oxide (no) released with snp (20 mm) by spontaneous decomposition. percent inhibition of no generation was measured by comparing the absorbance values of negative controls (10 mm sodium nitroprusside and vehicle) to assay preparations. for detection of reactive oxygen species (ros) production, hacat cells were incubated with 50 m dcf - da in culture medium for 30 min in a co2 incubator. the cells were then rinsed with pbs to eliminate non - incorporated dcf - da and treated with lutein, ()-carotene, or vitamin c during uv - b exposure. the cells were imaged with a confocal laser - scanning microscope (carl zeiss, lsm510). data (figures 2(a), 2(d), and 4(a)) were expressed as the mean standard deviation (sd) as calculated from one (n = 6) of two independent experiments. other data were representative of three different experiments with similar results. for statistical comparisons, results were analyzed using analysis of variance / scheffe 's post hoc test and the kruskal - wallis / mann - whitney test. all statistical tests were conducted using spss (spss inc., chicago, il, usa). lutein is one of spontaneously generating carotenoids with anti - oxidative, anti - tumorigenic, anti - angiogenic, photoprotective, hepatoprotective, and neuroprotective properties [1619 ]. although the anti - inflammatory property of lutein has been suggested, the mechanism of lutein - mediated anti - inflammatory action in various skin inflammatory responses remains largely unclear. therefore, in the present study, we aimed to elucidate the anti - inflammatory activity of lutein and its inhibitory mechanism by mimicking skin inflammatory conditions. first, the ability of lutein to attenuate inflammatory responses in macrophages and skin - derived keratinocytic (hacat) cells during various pro - inflammatory conditions induced by lps, ifn-/tnf-, and uv - irradiation [7, 32 ] was examined. interestingly, this compound significantly suppressed the expression of il-6 mrna, a major cytokine involved in skin inflammation, as determined by quantitative (figure 2(a), left panel) or semiquantitative (figure 2(a), right panel) rt - pcr. under the conditions, however, up to 30 m of lutein exhibited no cytotoxic activity in raw264.7 cells (figure 2(d) left panel). in addition, lutein suppressed the expression of cox-2 induced by cotreatment with ifn- and tnf- (figure 2(b)), indicating that this compound is able to block the production of inflammatory mediators in the skin. moreover, this compound also suppressed mmp-9 expression triggered by uv irradiation (figure 2(c)) without altering the viability of hacat cells (figure 2(d) right panel), indicating that lutein is also able to protect against uv irradiation - mediated skin irritation. it has been previously reported that lutein can decrease the edematous cutaneous response as illustrated by the reduction of the uvb - induced increase of ear bifold thickening, that aromatic carotenoids can prevent uv - induced dna damage in human skin fibroblasts, and that lutein can suppress melanogenesis. in agreement with these studies, our data further confirm that lutein can be used as a skin protective agent with anti - inflammatory functions. furthermore, to evaluate the inhibitory activity of lutein on the expression of pro - inflammatory genes, we examined the inflammatory signaling pathways and corresponding transcription factors activated in response to pro - inflammatory stimuli (e.g., lps). interestingly, we determined that the inhibition of il-6 mrna expression by lutein was a result of the suppression of nuclear translocation of p - fra and c - fos (figure 3(a)), major components of ap-1 family. although nf-b has been previously reported to be a major target transcription factor [21, 38 ], we did not observe a strong inhibitory pattern of p65/p50 translocation in response to lps (data not shown), and the degradation level of ib was not restored by lutein treatment (figure 3(b)). because the activation of ap-1 is known to be mediated by the phosphorylation of mapk (p38, erk, and jnk), we next examined whether lutein is capable of reducing the levels of the phosphoproteins. intriguingly, this compound was found to clearly suppress the phosphorylation of p38 and jnk at 15 to 30 m (figure 3(b)). furthermore, the phosphorylation of mkk3/6 and mkk4/7 but not tak1 at 30 min and mkk4/7 at 60 min was strongly diminished by 30 m of lutein (figure 3(c)). the formation of signaling complex composed of jnk and c - fos or p38 and c - jun (figure 3(d)) and kinase activity of p38 upregulated by lps (figure 3(e)) were also remarkably reduced by this compound, implying that suppression of p38 and jnk phosphorylation pathways might negatively affect the molecular interaction between mapk (p38 and jnk) and ap-1 family proteins. in agreement with this finding, the inhibitors (sp600125 (sp) and sb203580 (sb)) of jnk and p38, as well as lutein (10 and 30 m), strongly reduced the expression of il-6 (figure 3(f)), suggesting a role of jnk- and p38-mediated signaling cascade in il-6 expression. although lutein has not been reported to modulate ap-1 activation signaling, structural derivatives, such as lycopene, -carotene, or -cryptoxanthin, were considered as ap-1 regulatory compounds [4042 ]. thus, these data strongly indicate a role of lutein in negative regulation of ap-1-mediated inflammatory gene expression. how this compound can interrupt p38/ap-1 pathway activated by lps is not clear yet in this study. however, because ap-1 pathway is an important inflammatory signaling pathway activated by intracellular ros, we next evaluated the antioxidative activity of lutein in blocking ap-1 activation by suppressing ros generation as an approach of mechanistic understandings. as predicted, this compound strongly neutralized snp - induced radical generation (figure 4(a)). similarly, noncytotoxic concentrations of lutein (figure 2(d)) also dramatically scavenged the elevated ros generated by uv irradiation (figure 4(b)), indicating that uv irradiation - mediated cellular responses can be reverted by lutein treatment. indeed, this compound strongly suppressed the expression of mmp-9 (figure 2(c)), a marker of acute inflammation, implying that lutein is capable of modulating uv - mediated inflammatory and cellular damage by suppressing radical generation. in addition, lutein has been reported to reduce oxidative stress induced by benzo(a)pyrene, hypercholesterolemic diet, h2o2, and d - galactose. taken together, these prior reports and our new data suggest that the radical scavenging activity of lutein is a common feature observed in lutein pharmacology. in summary, our findings demonstrate that lutein strongly inhibits several skin inflammatory responses such as expression of il-6, cox-2, and mmp-9 from lps - treated macrophages, ifn-/tnf--stimulated hacat cells, and uv - irradiated keratinocytes. by examining the intracellular signaling cascade and the nuclear levels of transcription factor, we demonstrate that lutein can suppress the activation of redox - sensitive ap-1 pathway. based on the radical and ros scavenging activity of lutein, it was concluded that the ap-1-targeted anti - inflammatory activity of lutein was due to its anti - oxidative activity. therefore, our results strongly suggest that due to its anti - oxidative properties, lutein can be used as an anti - inflammatory and cosmetic remedy for inflammatory diseases of the skin. | lutein is a naturally occurring carotenoid with antioxidative, antitumorigenic, antiangiogenic, photoprotective, hepatoprotective, and neuroprotective properties. although the anti - inflammatory effects of lutein have previously been described, the mechanism of its anti - inflammatory action has not been fully elucidated. therefore, in the present study, we aimed to investigate the regulatory activity of lutein in the inflammatory responses of skin - derived keratinocytes or macrophages and to elucidate the mechanism of its inhibitory action. lutein significantly reduced several skin inflammatory responses, including increased expression of interleukin-(il-) 6 from lps - treated macrophages, upregulation of cyclooxygenase-(cox-) 2 from interferon-/tumor necrosis - factor-(tnf-) -treated hacat cells, and the enhancement of matrix - metallopeptidase-(mmp-) 9 level in uv - irradiated keratinocytes. by evaluating the intracellular signaling pathway and the nuclear transcription factor levels, we determined that lutein inhibited the activation of redox - sensitive ap-1 pathway by suppressing the activation of p38 and c - jun - n - terminal kinase (jnk). evaluation of the radical and ros scavenging activities further revealed that lutein was able to act as a strong anti - oxidant. taken together, our findings strongly suggest that lutein - mediated ap-1 suppression and anti - inflammatory activity are the result of its strong antioxidative and p38/jnk inhibitory activities. these findings can be applied for the preparation of anti - inflammatory and cosmetic remedies for inflammatory diseases of the skin. |
dermatomyositis (dm) is an idiopathic inflammatory myositis characterized by muscle ache, muscle weakness, and skin rash. activation and deposition of complements cause lysis of endomysial capillaries, which leads to muscle ischemia described as microangiopathy affecting the skin and muscles. the incidence of cancer in dm patients aged over 50 years is as high as 50%. the associated cancers include cancers of the ovary, lung, breast, pancreas, stomach, colon, and prostate as well as non - hodgkin lymphomas and others. dm is regarded as a part of paraneoplastic syndrome, which is mediated by cancer - associated secretions and antibodies. paraneoplastic syndromes are generally associated with particular cancer types, such as lambert - eaton myasthenic syndrome which is associated with small - cell carcinoma of the lung ; thus, dm can also be associated with various types of cancer. here, we report a case of colon cancer found upon the diagnosis of dm. the symptoms and signs of dm in the patient disappeared after surgery. the serum creatinine kinase (ck) level of the patient was highest at the peak of muscle weakness and returned to normal within 3 weeks after surgery. a 76-year - old japanese woman with muscle ache, weakness of the upper and lower extremities, and skin rash was referred to a rheumatologist at our hospital. she had first noticed a skin rash on her right elbow approximately 1 month previously. she had a past medical history of hypertension, diabetes mellitus, chronic bronchitis, angina pectoris, and cerebral lacunar infarctions. her operative history included resection of the ovary and the uterus for ovarian cysts and uterine myoma at the age of 44 years. on physical examination, she had a marked periorbital swelling on her face. she had a purple rash on her arms, chest, lumbar back, and hip. in summary, she had a heliotrope eruption (a blue - purple discoloration on the upper eyelids ; fig. 1a), gottron 's sign (a raised violaceous rash or papules on the knuckles prominent in the metacarpophalangeal and interphalangeal joints), a skin eruption on the extensor surfaces of the extremities, and a shawl sign / v - sign skin rash around the neck (fig. iu / l), complement c3 (174 mg / l), and c - reactive protein (2.6 mg / dl). electromyogram showed myogenic changes, and a muscle biopsy from the upper arm revealed myositis. her presentations and the results of the examinations were consistent with a diagnosis of dm. tumor markers were elevated, including carcinoembryonic antigen (18.6 ng / ml) and ca 19 - 9 (103 u / ml), and a fecal occult blood test was positive. a systemic survey of malignancy, including esophagogastroduodenoscopy, colonoscopy, and whole - body computed tomography (ct), was conducted and led to the diagnosis of advanced carcinoma of the ascending colon (fig. the drastic improvement of the redness of the skin lesions was observed on the first postoperative day (pod). during the postoperative course, she encountered mild respiratory dysfunction and mild heart failure on pod 18, which required strict control of infusion. she also had a candida infection, supposedly related to the central vein catheter placed in her right internal jugular vein on the day of the surgery. histologically, the tumor of the ascending colon was a mucinous adenocarcinoma which had invaded the subserosa without vein and lymph ductal invasion. the patient has been free from both diseases for 2 years under watchful observation without any adjuvant therapy. dm is an idiopathic inflammatory myositis with characteristic cutaneous manifestations, whereas cases without cutaneous manifestations are diagnosed as polymyositis (pm). the incidence of dm is 60 per million in japan, which is much higher than 510 per million in the united states. there is a major peak of onset of dm at the age of 4060 years and a minor peak at 515 years. the organs commonly affected by cancer in japanese dm patients are the stomach, lung, and breast. most of the malignancies in dm patients are diagnosed within 1 year before and after the diagnosis of dm. there is a higher incidence of cancer in dm than in pm, and the severity of the cutaneous presentations could be related to the malignancy. for example, vesicle forms in the skin lesions are related to a higher incidence of concomitant malignancy in dm. dm / pm patients who are anti - jo-1 antigen positive are more likely to develop polyarthritis and ip. dm patients who are anti - jo-1 antigen negative are more prone to have cancer than those who are anti - jo-1 antigen positive. clinical symptoms and signs of dm are attenuated by treatment of the malignancy and reappear if the malignancy recurs. one third of the dm / pm patients with cancer are cured by successful treatment of cancer such as resection of the tumor. thirty percent of dm / pm patients present with ip, and ip related to dm / pm also disappears after successful treatment of cancer. the peak of the serum ck level in the present patient was paralleled by the peak of muscle weakness (fig. 3). although she had not begun any treatment for dm, the ck level began to decrease before surgery. the reason for this early decrease in the ck level is unknown. considering the short half - life of ck (315 h, varying in isozymes), the myositis might have reached a plateau for some reasons, and the ck started draining away. eventually, the ck returned to normal ranges after surgery. the pulmonary dysfunction and acute heart failure in the postoperative course might be due to dm or surgical stress. dm rarely involves myocardial muscle fibers ; however, cardiac involvement such as congestive heart failure is well described. hypoventilation due to a weakness of the respiratory muscles could cause pulmonary dysfunction even in dm without ip. finally, it is essential to perform a systemic survey of malignancy in dm patients, since there is a high incidence of cancer in dm. therapy of the malignancy has to precede therapy of dm, because dm will possibly be cured by a successful treatment of the malignancy. | a 76-year - old woman with muscle ache, weakness of the extremities, and skin rash was diagnosed with dermatomyositis (dm). upon the diagnosis of dm, a systemic survey of malignancy revealed an advanced carcinoma of the ascending colon. the patient underwent right hemicolectomy approximately 2 months after the onset of dm. the symptoms and signs of dm disappeared after the surgery without additional therapy. dm is an idiopathic systemic inflammatory disease characterized by muscle ache, muscle weakness, and skin rash. in some cases, dm develops as paraneoplastic syndrome, and it is assumed that 30% of dm patients have cancer. symptoms and signs of dm can be attenuated by treatment of the malignancy, and they reappear if the malignancy recurs. it is essential to perform a systemic survey of malignancy in dm patients, and treatment of the malignancy has to precede treatment of dm. |
heart failure is the final common pathway and end stage of cardiovascular disease. in patients with heart failure, prolonged cardiac sympathetic activation, however, contributes directly to cardiac myocyte deterioration and progressive failure. some age - related cardiovascular changes are pertinent to heart failure. in healthy individuals, some changes in the aging process result in an aging heart, which ultimately leads to disability and death.1 an aging heart exhibits some of the characteristic changes in autonomic control that are observed with heart failure. in addition, in elderly heart failure patients, neurohormonal imbalance accompanying aging may underlie and contribute to pathophysiological changes in heart failure. beta - adrenergic blockade therapy in heart failure patients increases heart rate variability (hrv), which reflects the normalizing autonomic function and correlates with improved hemodynamics.2,3 although beta - adrenergic blockade therapy has been shown to provide mortality and morbidity benefits in non - elderly patients, relevant data specific to the elderly are lacking. the present study aimed to examine the effects of aging on the responsiveness of hrv and ventricular remodeling to beta - adrenergic blockade therapy in patients with heart failure and reduced ejection fraction (hfref). this retrospective study investigated 28 patients (19 men and 9 women ; mean age, 59.7 14.6 years) with sinus rhythm and stable new york heart association class ii systolic heart failure who visited our department between 2006 and 2010. for all patients, more than one cardiologist was asked to agree on diagnosis and severity according to the framingham criteria and new york heart association class. this investigation conformed to the principles outlined in the declaration of helsinki and was approved by the ethics committee of tokyo women s medical university. systolic heart failure was determined on the basis of symptoms, signs, radiography findings, and ultrasonic echocardiographic criteria (ejection fraction, 50 milliseconds). a major component of sdnn or sdann is attributable to the day night difference in nn intervals, also known as circadian rhythm, and its decrease is associated with increased mortality. in the presence of normal sinus rhythm and normal atrioventricular nodal function, pnn50 and rmssd quantify parasympathetic modulation of normal cardiac interbeat intervals driven by ventilation and approximately correspond to the hf component.5 the hf component is regarded as a specific marker of parasympathetic activity. the lf component is a parameter that includes both sympathetic and parasympathetic influences, but the sympathetic influence predominates. lf has been reported to reflect the baroreflex function, not cardiac sympathetic innervation.6 the exact physiological mechanism responsible for vlf and ulf components is in dispute, but both measurements are powerful predictors of cardiovascular disease risk. in addition, the vlf component is reduced by ace inhibition, reflects thermoregulation or vasomotor activity, and is affected by physical activity and disordered breathing during sleep. night difference in nn intervals.5 power - law scaling of nn interval variability was calculated over the frequency range of 1010 hz. the long - term fractal component was plotted in a log - power vs. log - frequency plane (fplot), with the spectral exponent estimated to be the slope of the linear regression of the plot. the 1/f signal properties (exponent value = 1) have been shown to be fractal like, an organizing principle of physiological structure or function, and modestly correlated with the stability of sympathovagal balance. all subjects underwent standard two - dimensional echocardiography performed by using a commercially available system (sonos 5500, philips medical systems and vivid 7, ge medical systems) with a multifrequency mhz transducer. cardiac function was evaluated by m - mode echocardiography guided by two - dimensional imaging ; left atrial diameter (lad), interventricular septal thickness, posterior wall thickness, left ventricular end - diastolic diameter (lvedd), lvesd, and left ventricular ejection fraction (lvef) were measured. normally distributed data were presented as means standard deviations and analyzed using one - factor analysis of variance (anova) to determine the baseline characteristics. smirnov test was used to analyze goodness of fit between sample distributions (the normal distribution). the chi - square test for independence or fisher s exact probability test was used to analyze differences between age groups as described by categorical variables. with regard to changes in hrv and echocardiographic parameters, the paired t - test was used for comparison of pre- and post - carvedilol therapeutic values. with regard to changes in echocardiographic and hrv parameters, one - factor anova was used for intergroup comparisons of the three age groups, followed by the tukey simple linear regression analyses were performed to correlate changes in hrv with changes in lvesd. this retrospective study investigated 28 patients (19 men and 9 women ; mean age, 59.7 14.6 years) with sinus rhythm and stable new york heart association class ii systolic heart failure who visited our department between 2006 and 2010. for all patients, more than one cardiologist was asked to agree on diagnosis and severity according to the framingham criteria and new york heart association class. this investigation conformed to the principles outlined in the declaration of helsinki and was approved by the ethics committee of tokyo women s medical university. systolic heart failure was determined on the basis of symptoms, signs, radiography findings, and ultrasonic echocardiographic criteria (ejection fraction, 50 milliseconds). a major component of sdnn or sdann is attributable to the day night difference in nn intervals, also known as circadian rhythm, and its decrease is associated with increased mortality. in the presence of normal sinus rhythm and normal atrioventricular nodal function, pnn50 and rmssd quantify parasympathetic modulation of normal cardiac interbeat intervals driven by ventilation and approximately correspond to the hf component.5 the hf component is regarded as a specific marker of parasympathetic activity. the lf component is a parameter that includes both sympathetic and parasympathetic influences, but the sympathetic influence predominates. lf has been reported to reflect the baroreflex function, not cardiac sympathetic innervation.6 the exact physiological mechanism responsible for vlf and ulf components is in dispute, but both measurements are powerful predictors of cardiovascular disease risk. in addition, the vlf component is reduced by ace inhibition, reflects thermoregulation or vasomotor activity, and is affected by physical activity and disordered breathing during sleep. night difference in nn intervals.5 power - law scaling of nn interval variability was calculated over the frequency range of 1010 hz. the long - term fractal component was plotted in a log - power vs. log - frequency plane (fplot), with the spectral exponent estimated to be the slope of the linear regression of the plot. the 1/f signal properties (exponent value = 1) have been shown to be fractal like, an organizing principle of physiological structure or function, and modestly correlated with the stability of sympathovagal balance. all subjects underwent standard two - dimensional echocardiography performed by using a commercially available system (sonos 5500, philips medical systems and vivid 7, ge medical systems) with a multifrequency mhz transducer. cardiac function was evaluated by m - mode echocardiography guided by two - dimensional imaging ; left atrial diameter (lad), interventricular septal thickness, posterior wall thickness, left ventricular end - diastolic diameter (lvedd), lvesd, and left ventricular ejection fraction (lvef) were measured. normally distributed data were presented as means standard deviations and analyzed using one - factor analysis of variance (anova) to determine the baseline characteristics. the kolmogorov smirnov test was used to analyze goodness of fit between sample distributions (the normal distribution). the chi - square test for independence or fisher s exact probability test was used to analyze differences between age groups as described by categorical variables. with regard to changes in hrv and echocardiographic parameters, the paired t - test was used for comparison of pre- and post - carvedilol therapeutic values. with regard to changes in echocardiographic and hrv parameters, one - factor anova was used for intergroup comparisons of the three age groups, followed by the tukey simple linear regression analyses were performed to correlate changes in hrv with changes in lvesd. table 1 demonstrates the clinical and echocardiographic variables for the entire patient population and each age group. comprehensive statistics summarized for all of the examined variables at baseline revealed statistically negligible differences between the compared age groups, with the exception of history of diabetes mellitus and spironolactone use. the effects of carvedilol on hrv are listed in table 2. before carvedilol therapy, most hrv measures of vagal modulation had low values. carvedilol therapy resulted in a significant improvement in all hrv measures except lf / hf and fractal exponent b. there was a significant improvement in sdnn (p < 0.0001), sdann5 (p = 0.0005), and sdann30 (p = 0.0021). carvedilol therapy was associated with statistically significant increases in rmssd (p = 0.0009), pnn50 (p = 0.0214), and power spectral density of hf (p = 0.0030) and lf (p = 0.0066). there was an overall increase in other spectral parameters of hrv, namely, tf (p = 0.0008), ulf (p = 0.0005), and vlf (p = 0.0334). deviations in the power - law regression slopes from the 1/f curve were not observed. the effects of aging on hrv indices before and after carvedilol therapy are shown in table 2. the mean nn interval showed a large decrease in the youngest group, even though the same treatment doses were used. the effects of carvedilol on sdnn (p = 0.0090), sdann5 (p = 0.0136), and sdann30 (p = 0.0165) decreased significantly with increasing age (fig. 1). effects on frequency domain variables showed a decreasing trend with increasing age, but the decreases were not significant. there were no differences in lf / hf and fractal exponent among the three age groups after carvedilol therapy. the effects of carvedilol on ultrasound echocardiography parameters in all groups and each age group are listed in table 3. there was a significant improvement in lad (p = 0.0069), lvedd (p = 0.0024), lvesd (p = 0.0001), and lvef (p = 0.0004). the effects of carvedilol on lvedd (p = 0.0063), lvesd (p = 0.0015), and lvef (p = 0.0229) decreased significantly with increasing age (fig. bnp levels decreased significantly after carvedilol therapy (mean difference, 399.3 588.5 ; p = 0.0036), but there was no difference in bnp levels (p = 0.3117 ; range a, 584.3 602.9 ; range b, 313.3 676.9 ; range c, 112.1 315.1) among the three age groups. the correlations between the changes in hrv and lvesd are presented in table 4. as illustrated in figure 2, an intermediate inverse correlation was detected between the changes in sdnn and lvesd (= 0.560, p = 0.0019), particularly in the youngest group (= 0.704, p = 0.0155). this study indicates that beta - adrenergic blockade therapy improves autonomic function and ventricular remodeling in hfref patients. the increase in hrv seems to be more pronounced with additional beta - adrenergic blockade therapy with acei or arb. in addition, we found that autonomic responsiveness to beta - adrenergic blockade therapy decreased with increasing age in heart failure patients for the first time. furthermore, changes in hrv were correlated with ventricular dimension (ie, ventricular reverse remodeling) and its effects were attenuated with increasing age. although hrv is a reliable measure of parasympathetic function, it is considered to be a flawed index of sympathetic activity.7,8 the mechanism by which beta - adrenergic blockade directly influences the parasympathetic system remains unclear. parasympathetic activity certainly appears to be decreased in chronic heart failure patients, but the number of cardiac muscarinic receptors is not altered.9 in ischemic animal models, the sensory endings of both vagal and sympathetic afferent fibers are mechanoreceptors and fire with cardiac ischemia.10,11 in addition, this cardiac sympathetic afferent activity produces a tonic and reflex inhibition of cardiac vagal efferent activity, namely, the cardiocardiac sympathetic reflex.12 this mechanism can be applied to autonomic dysfunction in patients with other heart disease accompanied by cardiac dilatation and can be antagonized or limited by beta - adrenergic blockade. in the elderly, autonomic changes are similar to those in heart failure patients, but there are some differences between the two. the decrease in parasympathetic activity with increasing age can be explained by several mechanisms, such as the decrease in sinus node responsiveness and disturbance in the central oscillation of parasympathetic outflow, ultimately leading to the onset and progression of cardiovascular disease.1315 unlike those in the failing heart, the number and responsiveness of muscarinic receptors seem to be decreased in the aging human heart. the release of acetylcholine from atrial tissue, which is stimulated electrically, decreases in the elderly.16 the frequency of occurrence of autoantibodies to the muscarinic m2 receptor in healthy individuals significantly increases with age.17 in chronic heart failure patients, activated sympathetic nerves and elevated plasma noradrenaline levels persist in stimulating beta - adrenoreceptors (ie, cardiac noradrenaline spillover), which results in alterations of downstream mechanisms. for example, upregulation of the g - protein - coupled receptor kinase (grk) and downregulation of the beta-1-adrenoreceptor induce a decrease in beta-1-adrenoreceptor function. in elderly patients and those with heart failure, the sympathetic activity is also enhanced and plasma noradrenaline levels increase. functional responsiveness of beta - adrenoreceptors appears to decrease in the aging human heart. whether the number of beta - adrenoreceptors may be affected by age in contrast to the failing human heart, grk activity also appears to have an insignificant role in beta - adrenoreceptor desensitization in the aging human heart.18,19 one of the reasons for the different behaviors of autonomic regulation between aging and failing hearts may be the differences in the time course and intensity of changes in autonomic regulation.20 in the failing heart, the autonomic receptor systems are altered toward attenuation of beta - adrenoreceptor responses to oversympathetic activation. in the aging heart, however, the autonomic receptor systems are altered in a direction that prepares for a decrease in beta - adrenoreceptor responsiveness.20 age - related cardiac changes (ie, aging heart) pertinent to heart failure include cardiac fibrosis, enhanced intracellular generation of oxidative stress, increase in advanced glycation end products and angiotensin and endothelin levels, and telomeric shortening.1 the adult heart has a significant capacity for myocyte regeneration, which is markedly enhanced in heart failure.21 even in the normal heart, the rate of cell death increases with age and is not balanced by a concomitant increase in new myocyte formation after middle age. recently, the poor clinical outcome of aging patients with cardiovascular disease was reported to be recapitulated at the cellular level ; specifically, aging is characterized by impaired cardiomyocyte division, cardiac stem cell senescence, decreased efficiency in autophagy, activation of apoptosis, and cardiac fibroblast dysfunction.22 it is conceivable that these factors influence responsiveness to beta - adrenergic blockade therapy in elderly heart failure patients. heart failure reaches epidemic proportions in the elderly, and the clinical manifestations and prognosis worsen with increasing age. this study was designed to test age - related differences in response to beta - blocker therapy. it was considered inappropriate to use a placebo - controlled study design because the use of beta - blockers is standard in heart failure therapy. in this study, the etiology of heart failure varied, which may have affected the improvement in cardiac function. hrv is affected by various factors, such as diabetes mellitus, and the use of some drugs, such as arb, acei, and digoxin. there was a statistically significant difference in the prevalence of diabetes mellitus among the three groups ; this may have affected hrv responsiveness. drugs such as arb, acei, digitalis, and spironolactone restore the autonomic nervous system and cardiac function toward normal, and their use or dose difference may have affected our result because of the small sample size. in this study, we used lvesd as a surrogate parameter to assess the therapeutic effects on left ventricular remodeling. the 24-hour ambulatory holter monitor recordings were not obtained under strict control of external conditions ; however, they were useful for risk stratification in a variety of pathological entities and for clinical quantification of autonomic dysfunction. beta - adrenergic blockade therapy in addition to acei or arb may improve hrv measures in heart failure patients, although the response may be decreased in the elderly. pharmacotherapy of heart failure in the elderly needs to be individualized, and age - related changes should be considered. | objectiveheart rate variability (hrv) has been reported to be an independent predictor of all - cause and sudden cardiac death in patients with heart failure. in the aging heart, however, both autonomic and cardiac functions appear to be altered. we assessed the relationship between aging and responsiveness of hrv and ventricular remodeling to beta - adrenergic blockade therapy in patients with heart failure and reduced ejection fraction (hfref).methodstwenty - eight clinically stable patients with chronic heart failure, sinus rhythm, and left ventricular ejection fraction < 50% as confirmed by echocardiography were included. at baseline and after carvedilol treatment, 24-hour ambulatory holter monitor recording was used to analyze hrv indices by the maximum entropy method. changes in these parameters were compared among three age groups.resultshr decreased in all groups after carvedilol treatment, but was still highest in the youngest group despite the same treatment doses. time and frequency domain variables improved. the response of time domain variables (the standard deviation of all normal sinus to normal sinus [nn ] intervals and the standard deviation of the averages of nn intervals in all 5-minute or 30-minute segments) to carvedilol therapy significantly decreased with increasing age. ventricular reverse remodeling induced by carvedilol therapy significantly decreased with increasing age. increases in time domain variables and a low - frequency domain moderately correlated with left ventricular reverse remodeling.conclusionbeta-adrenergic blockade therapy improved hrv variables and ventricular remodeling in hfref patients ; however, the response tended to be milder in the elderly. hrv improvement was associated with ventricular reverse remodeling. |
in the usa, the burden of injury is neither equally nor equitably distributed.17 in particular, it follows a social gradient, whereby risk increases with each decrease in socioeconomic position or status (ses).8 those in the lowest ses classes are particularly at risk.9 both canadian and us studies have shown that 4048% of the population - attributable risk of injury can be accounted for by socioeconomic inequalities.10 11 apart from national surveys,12 13 demonstrating either a relationship with or a gradient across ses classes using hospitalisation data is primarily accomplished using us census data. through geocoding, patient address information from billing records can be linked to census - based geographical and socioeconomic records for their neighbourhood, zip code, and county of residence. this requirement is a compromise to account for the lack of individual or household ses data in the registries. hospital registries, for example, contain little socioeconomic information other than categorical data on patient race / ethnicity and insurance status, both of which are tenuous if not substantiated with additional ses measures.14 there are four inherent advantages to using the census to ascertain disparities in injury risk. first, its data categories and geographies are commonly used in health policy and health promotion.1517 another is that the decennial questionnaire remains fairly consistent between cycles, which allows for consistency in measurement over time.18 another is that census geographies capture information about place - based influences on health, something that individual - level data do not.19 lastly, unlike national population health surveys, census - derived data can be readily produced and corroborated with hospitalisation records through geocoding. notwithstanding these advantages, a primary and methodological limitation is that unlike in the uk and new zealand,20 21 there is no standard set of census variables in the usa for monitoring health outcomes. although higher ses tends to predict lower injury risk, however measured, the pattern is not always consistent.22 23 conceptual differences in how ses is defined may contribute to this problem. for example, that not all ses constructs are equally associated with health inequalities is a topic rarely broached in the injury literature.24 just as monitoring the quality of trauma care requires evidence - based tools, monitoring socioeconomic inequalities in injury risk requires constructs that are theoretically justified and supported by evidence. however, it is unclear if the ses constructs currently in use meet either criterion. exacerbating this issue is the lack of national reporting on ses and injury. as of yet, neither the national center for injury prevention and control nor the national trauma data bank produce annual reports of injury statistics by ses, despite evidence that that social inequalities in health are increasing.25 26 the purpose of this review is to add to the knowledge base concerning the use of census ses data to quantify injury risk, particularly by identifying opportunities for greater consistency in how registry and census data are used for healthcare policy and injury prevention. relevant articles were identified from seven electronic databases, including : biomed central, cinahl, the cochrane database, medline, psychinfo, sociological abstracts and web of science. to increase the sensitivity of our review, we also handsearched the journal of the american college of surgeons, injury prevention, and the journal of trauma and acute care surgery using the keywords census and socioeconomic to identify additional us studies measuring injury risk using socioeconomic variables derived from the census. search terms were developed to reflect the three research domains relevant to the study objectives : (1) injury, (2) socioeconomic conditions and (3) census - based measurement. from the literature, we identified medical subject headings (mesh) and keywords associated with each domain of knowledge. the following mesh were used to identify articles within the injury domain : wounds and injuries, accidents and trauma centers. mesh terms and key words used to identify articles within the socioeconomic conditions domain included : demography, educational status, population dynamics, urban population, occupations, social class, socioeconomic factors, socioeconomic, deprivation, health status disparities, poverty, poverty areas, deprivation index, and health status indicators. the first search strategy was developed for the medline reference database, with subsequent searchers of the remaining databases derived using this taxonomy. we selected for full - text review all articles that were derived using numerator data from us hospital discharge summaries, trauma registries or vital statistics records. this resulted in the exclusion of studies that derived their measure of ses from national or prospective surveys, or occupational health and safety databases. a second exclusion criterion was that patient race / ethnicity or insurance status was not the primary construct of ses. lastly, we included only articles that either reported a statistical association between injury and ses (eg, -coefficient) or reported rates across ses classes (eg, histograms, ors). our rationale for first criteria was to identify studies that most likely classified injury using standard inclusion rules. our rationale for the second criteria was based on the predominant evidence that socioeconomic differences between racial groups are largely responsible for observed patterns of racial disparities in health status.27 our rationale for the last exclusion criteria was to enable a comparison of constructs that have been applied in practice. we did not specify criteria in which injury cases were excluded by severity, hospital length of stay, age or injury type. first, all authors reviewed manuscript abstracts of retrieved publications, selecting for further review those articles that were most likely derived through linking registry and census records. next, two authors (nb and aa) independently evaluated manuscripts selected for further review. this included documenting the census variables used, how it was they were constructed, and whether statistical associations were derived from composite (eg, principal component analysis) or pairwise (eg, regression coefficient) comparisons. we also documented whether a social gradient was assessed, the theoretical methods that were discussed, the rationale for the variable selection, and recommendations for prevention. lastly, articles were classified and collated by cause of injury and ses. for all studies, we counted each variable association in the event that a study reported multiple comparisons with different injury causes, age or race / ethnic groups. relevant articles were identified from seven electronic databases, including : biomed central, cinahl, the cochrane database, medline, psychinfo, sociological abstracts and web of science. to increase the sensitivity of our review, we also handsearched the journal of the american college of surgeons, injury prevention, and the journal of trauma and acute care surgery using the keywords census and socioeconomic to identify additional us studies measuring injury risk using socioeconomic variables derived from the census. search terms were developed to reflect the three research domains relevant to the study objectives : (1) injury, (2) socioeconomic conditions and (3) census - based measurement. from the literature, we identified medical subject headings (mesh) and keywords associated with each domain of knowledge. the following mesh were used to identify articles within the injury domain : wounds and injuries, accidents and trauma centers. mesh terms and key words used to identify articles within the socioeconomic conditions domain included : demography, educational status, population dynamics, urban population, occupations, social class, socioeconomic factors, socioeconomic, deprivation, health status disparities, poverty, poverty areas, deprivation index, and health status indicators. the first search strategy was developed for the medline reference database, with subsequent searchers of the remaining databases derived using this taxonomy. we selected for full - text review all articles that were derived using numerator data from us hospital discharge summaries, trauma registries or vital statistics records. this resulted in the exclusion of studies that derived their measure of ses from national or prospective surveys, or occupational health and safety databases. a second exclusion criterion was that patient race / ethnicity or insurance status was not the primary construct of ses. lastly, we included only articles that either reported a statistical association between injury and ses (eg, -coefficient) or reported rates across ses classes (eg, histograms, ors). our rationale for first criteria was to identify studies that most likely classified injury using standard inclusion rules. our rationale for the second criteria was based on the predominant evidence that socioeconomic differences between racial groups are largely responsible for observed patterns of racial disparities in health status.27 our rationale for the last exclusion criteria was to enable a comparison of constructs that have been applied in practice. we did not specify criteria in which injury cases were excluded by severity, hospital length of stay, age or injury type. first, all authors reviewed manuscript abstracts of retrieved publications, selecting for further review those articles that were most likely derived through linking registry and census records. next, two authors (nb and aa) independently evaluated manuscripts selected for further review. this included documenting the census variables used, how it was they were constructed, and whether statistical associations were derived from composite (eg, principal component analysis) or pairwise (eg, regression coefficient) comparisons. we also documented whether a social gradient was assessed, the theoretical methods that were discussed, the rationale for the variable selection, and recommendations for prevention. lastly, articles were classified and collated by cause of injury and ses. for all studies, we counted each variable association in the event that a study reported multiple comparisons with different injury causes, age or race / ethnic groups. the literature search resulted in 1392 articles that had the potential to meet our search criteria. after removing duplicates a review of titles and abstracts led to the retrieval of 76 articles for further review., 29 articles were identified from our search criteria, 2 from article references, and 2 from hand searching journal websites. table 1 lists the manuscript ids and reference information for all original studies that were reviewed. table 2 summarises the conceptual and methodological approaches and principal findings comparing the ses constructs to injury risk. reference key of original research articles reviewed characteristics of articles selecting socioeconomic status (ses) constructs from the census to estimate socioeconomic differences in injury risk / outcome percentages may not equal 100% due to rounding. percentages drawn from the number of instances effect was observed from all ses indicators classified within its domain. percentages drawn from the number of instances the criterion was observed from all manuscripts reviewed (n=33). percentages drawn from the number of instances the injury cause was evaluated against a measure of ses. in total, we identified 70 different ses constructs from the literature. as a method of organisation, we classified each construct into one of eight domains. the demographics domain contains variables that described the household in terms of composition, mobility, age or abilities. the education domain contains variables that were used to define primary, secondary or postgraduate education. the domain housing contains variables that described the dwelling category, as well as housing types and structures and household size. the income domain contains variables that defined permanent wealth (eg, home value) as well as distributed or central tendency measures of annual income. the population domain contains constructs that defined an area 's population size or its administrative designation, such as urban or rural. overall, 82% of the constructs either produced a statistically significant relationship with an injury cause or demonstrated a social gradient across ses classes. ranking the domains based on the number of instances where its constructs produced either of these effects places the demographics domain first at 100% of attempts, followed by the occupation (98%), ethnicity (86%), income (80%), cultural (80%), education (78%), population (78%) and housing (50%) domains. when stratified by a methodological approach, 74% of all pairwise comparisons demonstrated either a statistically significant association with an injury cause or produced a social gradient across ses classes. in contrast, 98% of all studies that aggregated census constructs into a composite index produced this effect. we identified nine different constructs used to capture the extent of deprivation in terms of secondary or post - secondary education and training in a local area. of these, six constructs were specific to high school educational attainment.11 2832 overall, each education construct was attributed to an increased risk of injury with the exception of when an area 's proportion of high school attainment was stratified by percentage male or percentage female or by total years of maternal education. the predominant construct was the percentage of black population per census area3336 and the percentage of non - white population.30 32 37 38 all constructs were statistically significantly associated with rates of injury in at least one study. the least representative measure of ses was the proportion of an area 's hispanic population.39 five different constructs relevant to an area 's demographic make - up were identified in the literature. two measures were variations on an area 's proportion of lone parent families.11 29 30 32 39 40 other constructs included the proportion of men,37 the proportion of population ages 59 years or older40 and the proportion of population having moved in the past 5 years.31 each measure was statistically significantly associated with injury when evaluated in pairwise comparisons or when aggregated into a composite index., four different measures were identified that addressed household overcrowding, such as the proportion of households with more than one person per room.29 34 39 41 42 the remaining constructs were either specific to housing structure34 36 39 43 or zoning / rental status.40 42 44 when evaluated, only 3 of the 14 pairwise (21%) evaluations of household overcrowding were associated with either injury risk or a social gradient in injury risk. a total of 20 different constructs were used to measure the relationship between income and injury. the majority of constructs reflected either measures of central tendency (eg, median income) or distributed income (eg, below poverty). in total, median / mean income was constructed in eight different ways.11 28 3032 34 35 37 38 40 42 4553 distributive measures of income were represented in seven different ways, such as concentrated poverty,36 ratios of income distribution,42 44 or using various percentages of populations or population groups below the poverty line.11 28 32 34 37 4042 52 54 55 other frequently used constructs were measures of permanent income or wealth, such as car ownership or housing value.11 42 when compared with rates of injury, distributive measures of income were significant in 22 of 26 comparisons, whereas measures of central tendency were significant indicators of injury risk in 23 of all 37 tests. of these, four were various measures of an area 's unemployment rate, such as the percentage of unemployed males, the overall unemployment rate, or the proportion of mothers not employed.11 29 32 35 42 47 56 other constructs included the proportion of white collar occupations, the proportion of working class occupations, and the duncan ses index.11 42 57 with the exception of the duncan ses index, which is a measure of occupational prestige, all constructs were significant indicators of injury risk. both the cultural and population domains contained constructs that were evaluated less frequently than constructs included in the other six domains, though each domain contained indicators that were statistically significantly associated with injury risk overall. online supplementary appendix 1 tables a1-a8 summarise the frequency of statistically significant associations observed when each ses construct was assessed singularly or as a composite indicator for each cause of injury. overall, the proportion of publications producing a reference or justification for the ses variables included in their approach was low. for example, a reference or supporting claim as to why the ses variable was chosen was missing in nearly half (42%) of all studies. less fewer than half of the studies (45%) we reviewed provided a complete description on how the variables were constructed, such as listing the census category where the variable originated, or how its numerator and denominator proportions were calculated. in our review of literature, we identified 70 different census constructs that have previously been used to characterise socioeconomic determinants of injury risk. of these, fewer than half were replicated by other studies or against other causes, making the majority of studies non - comparable. it is also attributed to inconsistency in how researchers conceptualise the purpose of ses for injury prevention. for example, should emphasis be placed on changing behaviour by targeting the most vulnerable,29 31 32 3840 45 50 51 54 55 5860 mitigating the effects of social inequalities,30 36 46 47 53 56 or both?11 37 43 44 48 over the past two decades, there has been significant discussion over the use of the census for monitoring social determinants in health.6163 previous reviews from the injury literature have similarly discussed some of the inherent weaknesses in how ses is conceptualised.64 building on these discussions, we recommend four priority areas in efforts to facilitate a more unified approach towards the use of registry and census data for injury prevention and control. first, there is a need for greater conceptual and methodological agreement for selecting census constructs to characterise injury risk. we found that the likelihood of injury was more strongly associated with measures of relative poverty when measured in conjunction with the level of education,31 32 40 but not when measured using median income.32 40 employment - related variables were more indicative of unintentional rather than intentional injury.42 permanent income or wealth - related constructs produce narrower irrs than measures of average or relative income,42 which run in contrast to previous evidence.65 nor are all indicators of ses specifically relevant to injury risk. for example, household overcrowding and mean household income were inconsistent measures of injury risk compared to other constructs within their domains. in contrast, factors including the unemployment rate, the proportion of female lone parent families, and the percentage of the population below the poverty line were consistently more indicative of injury risk for all injury causes. it is worth emphasising that the income constructs were less consistent indicators of injury risk, on average, than demographic and occupational constructs. one recommendation proposed by krieger and subsequently either directly55 or indirectly40 44 52 supported by trauma researchers is to monitor health inequalities using a single indicator : the percentage of persons below the federally defined poverty line. poverty measures are one of the strongest measures of health inequities as they take into account the number of adults and children dependent on family income. similarly, poverty is strongly correlated with a host of other factors, including lack of amenities, poor education, unsafe working conditions, unemployment, neighbourhood crime, and its consequential effect on family life. the studies we reviewed support this position as distributive measures of income were more consistently related to injury risk than measures of central tendency. an important distinction in krieger 's42 recommendation is that area poverty rates should be expressed in percentages to emphasise the proportion of population within its bounds as opposed to being used as a dichotomous marker. the distinction is that the latter method emphasises those populations that fall into the tailings of a distribution, while the former emphasises the incremental impact of inequities across all populations. if in fact there were a threshold in relationship between injury and income (which no study found), it would still require looking further along the gradient to determine when its effect weakens. however, our review suggests that no single census construct exists that reflects the complexities of social inequalities in injury risk. rather, social advantages and disadvantages are attributable to multiple, interrelated causes, including income distribution, occupation type and working conditions, racial tensions, family demographics, and accessibility to educational opportunities, among others. the fact that composite indicators of ses were statistically significantly related to injury in 98% of all analyses supports the premise that the most consistent markers of injury risk appear when constructs are combined. while there is value in selecting a single indicator to represent social inequities in health, particularly for policy - related directives, there is also value in understanding the combined effect of its determinants. in this vein, we recommend testing the utility of the health disparities calculator to facilitate comparisons of multiple determinants of injury, as well as support comparisons with other health outcomes using a common metric.66 second, greater emphasis needs to be placed on measuring the interactions between race / ethnicity and insurance status with ses. a prevailing trend in the trauma literature is the use of patient race as an indicator of ses.6770 this practice is multifaceted, as race is a mandated data field for federal statistical reporting agencies. its use is also by necessity as hospital and trauma registries typically lack other individual - level ses identifiers. however, previous studies have shown that differences in ses are largely responsible for racial disparities in injury risk.71 72 some studies we reviewed corroborated these findings. for example, pomerantz found that patient race was no longer a significant childhood injury indicator after adjustment for poverty and for educational and unemployment factors. similarly, ladha,51 adjusting for neighbourhood income, removed the significance of patient race as a determinant of re - presentation to the emergency department following discharge. however, we also found that adjustment for ses reduced but did not eliminate racial disparities in injury. for example, fabio observed that race remained a significant individual - level determinant of violent injury after adjusting for county - level segregation, though the authors also demonstrated that when stratified by race, segregation was a significant indicator for both white and non - white trauma. hinton found that an area 's percentage of black populations remained an independent predictor of childhood trauma after adjustment for ses. insurance status, often treated as a surrogate for ses, is susceptible to similar nuances as race / ethnicity when considered an independent (and individual) predictor of injury risk. numerous studies we reviewed included insurance type as a covariate in the regression analysis.37 46 4851 55 while some studies we reviewed found that insurance status was associated with neighbourhood ses,51 other studies failed to find this association.48 variability in the relationship between insurance status and ses is further complicated by the confounding effect of inadequate coverage on pre - injury health, particularly among minority trauma patients.9 these findings emphasise the importance of testing for interactions between race, insurance status, ses and injury. without this, we risk reinforcing prejudices and perpetuating racial stereotypes.27 we also risk misinterpreting the significance of which populations are most impacted by social inequities. for example, almgren found that joblessness and family disruption, while being significant indicators of violent injury, were far more predictive of injury among black than non - black populations. what was fundamentally clear from the literature is that injury risk regardless of cause follows a social gradient.11 30 42 46 55 58 60 thus, it is not specifically the poor or ethnic minorities who are the most vulnerable, but also those with higher incomes. central to this thesis is that social disparities affect all population classes, not simply those without the resources to escape poverty.73 lastly, we recommend that hospital and trauma registries expand the level of socioeconomic information collected on injured patients. a challenge inherent in the use of census or any area - level variable is the uncertainty as to whether these constructs are representative proxies for individual or household data. in part, this is an underlying rationale for using multilevel modeling to measure the association between area - level determinants after adjusting for individual - level characteristics. multilevel frameworks help to disentangle the multitude of factors that influence individual behaviour, family and social networks, to community, and wider social and structural causes,7476 concepts that were articulated in articles we reviewed pertaining to effects of racial segregation,37 social cohesion41 or social disorganisation.44 expanding individual - level data collected by registries would improve knowledge of the characteristics of individuals that either protect or expose one to injury. while multilevel models help tease out influences of multiple determinants of health, researchers have stressed that the individual - level characteristics are shaped by, as opposed to independent from, macrolevel determinants.76 these are compelling reasons to research which census constructs are the most representative of characteristics of individuals that are determinants of injury. similarly, if data for both individual - level and area - level ses on all trauma patients were available, we could more meaningfully depict how rates of injury by race / ethnicity change as ses changes. presently, such evaluations are primarily possible using national survey data, but these information sources can not be as readily produced as registry data, nor can any relationship be corroborated with hospitalisation records. limitations of this review include the focus on published, peer - review literature and on studies where numerators were derived from hospital / trauma registries. we excluded studies that were derived using police or fire databases, as well as national cross - sectional or longitudinal studies. despite this focus, this study is the first attempt to systematically review how us census ses constructs are used for measuring injury risk. through geocoding, patient address information from billing records can be linked to census - based geographical and socioeconomic records. this ensures that in the absence of having access to additional information on individual or household ses, there are readily available data to draw linkages between ses, or position, and health. a benefit of this approach is that the evidence is consonant with reporting practices among those engaged in health policy and health promotion. another is that census data illustrate the profound impact that the social environment has on health. our review of the injury literature, however, suggests that we are not yet fully exploiting these opportunities. many studies use ses as a means to target interventions towards populations that are most vulnerable. in contrast, few studies use ses as a means to ask why injury risk continues as socioeconomic position increases. variation in how we conceptualise the purpose of these data to support injury prevention is conflated by the various ways in which ses is measured. in our view, there is thus far little justification for using 70 different ses constructs to explain the link between social status or position and injury. based on our review, census constructs that require closer and more frequent examination include the percentage of lone parent families, the percentage of population below the poverty line, area unemployment rate, and the percentage of non - high school graduates. what is already known on this subjectthe importance of social determinants of injury inequalities is well established.there is increasing emphasis to use census socioeconomic data to direct injury prevention towards the most vulnerable as well as advocate for inequities in access to resources known to be determinants of health.however, there is no standard set of census variables to monitor inequalities in injury risk nor is there a common conceptual or methodological framework to structure evaluations. what this study addsthis study synthesises the census variables thus far used to measure socioeconomic determinants of injury risk through classifying each construct into specific domains, thus identifying where there is variability in measurement as a result of defining similar constructs differently.this study summarises which census constructs have thus far proven to be significant indicators of injury risk as well as those that remain inconsistent or non - significant indicators, thereby suggesting which measures may have the most impact on addressing injury inequalities.evidence of a social gradient in injury risk is evident across all causes of injury, yet the majority of studies focus on the relationship between low social class and injury ; nor is there a common conceptual or methodological approach in how these variables should be used for prevention, suggesting the need for a more organised approach for using the census for injury prevention. firearm - related hospitalisationsa retrospective study at the university of washington compared the risk for subsequent violent injury, death, or crime among patients with a firearm hospitalisation, hospitalisations for non - injury reasons, and the general population. the results show that hospitalisation for a firearm - related injury is associated with a much greater risk for subsequent violent victimisation or crime. more research is needed at the intersection of clinical care, the criminal justice system and public health. comment : too often we overlook the role of the justice system - noted by ibp. action on fake motorcycle helmetspreviously we reported on the growing number of cheap novelty helmet imports linked to motorcycle crash deaths. the risk of serious head injury from the novelty helmets is almost triple. to reduce the number of such helmets and make it easier for state law enforcement officials to identify them, it is proposed that distributors must comply with existing standards and limit their ability to insulate themselves from legal liability. comment : there is increasing emphasis to use census socioeconomic data to direct injury prevention towards the most vulnerable as well as advocate for inequities in access to resources known to be determinants of health. however, there is no standard set of census variables to monitor inequalities in injury risk nor is there a common conceptual or methodological framework to structure evaluations. this study synthesises the census variables thus far used to measure socioeconomic determinants of injury risk through classifying each construct into specific domains, thus identifying where there is variability in measurement as a result of defining similar constructs differently. this study summarises which census constructs have thus far proven to be significant indicators of injury risk as well as those that remain inconsistent or non - significant indicators, thereby suggesting which measures may have the most impact on addressing injury inequalities. evidence of a social gradient in injury risk is evident across all causes of injury, yet the majority of studies focus on the relationship between low social class and injury ; nor is there a common conceptual or methodological approach in how these variables should be used for prevention, suggesting the need for a more organised approach for using the census for injury prevention. a retrospective study at the university of washington compared the risk for subsequent violent injury, death, or crime among patients with a firearm hospitalisation, hospitalisations for non - injury reasons, and the general population. the results show that hospitalisation for a firearm - related injury is associated with a much greater risk for subsequent violent victimisation or crime. more research is needed at the intersection of clinical care, the criminal justice system and public health. comment : too often we overlook the role of the justice system - noted by ibp. previously we reported on the growing number of cheap novelty helmet imports linked to motorcycle crash deaths. the risk of serious head injury from the novelty helmets is almost triple. to reduce the number of such helmets and make it easier for state law enforcement officials to identify them, it is proposed that distributors must comply with existing standards and limit their ability to insulate themselves from legal liability. comment : | backgroundunlike the uk or new zealand, there is no standard set of census variables in the usa for characterising socioeconomic (ses, socioeconomic status) inequalities in health outcomes, including injury. we systematically reviewed existing us studies to identify conceptual and methodological strengths and limitations of current approaches to determine those most suitable for research and surveillance.methodswe searched seven electronic databases to identify census variables proposed in the peer - reviewed literature to monitor injury risk. inclusion criteria were that numerator data were derived from hospital, trauma or vital statistics registries and that exposure variables included census ses constructs.resultsfrom 33 eligible studies, we identified 70 different census constructs for monitoring injury risk. of these, fewer than half were replicated by other studies or against other causes, making the majority of studies non - comparable. when evaluated for a statistically significant relationship with a cause of injury, 74% of all constructs were predictive of injury risk when assessed in pairwise comparisons, whereas 98% of all constructs were significant when aggregated into composite indices. fewer than 30% of studies selected ses constructs based on known associations with injury risk.conclusionsthere is heterogeneity in the conceptual and methodological approaches for using census data for monitoring injury risk as well as in the recommendations as to how these constructs can be used for injury prevention. we recommend four priority areas for research to facilitate a more unified approach towards use of the census for monitoring socioeconomic inequalities in injury risk. |
methotrexate is one of the most effective and durable disease - modifying antirheumatic drugs (dmards) for the treatment of rheumatoid arthritis (ra).1 it was initially designed in the late 1940s as a stable derivative of aminopterin for the treatment of childhood leukemia.1 over the last 30 years, methotrexate has been used extensively for ra either as monotherapy or in combination therapy, with high efficacy.15 however, our understanding of the mechanism of action of methotrexate continues to evolve. methotrexate exerts much of its anti - inflammatory effects in ra by increasing local levels of adenosine in inflamed tissues611 via inhibition of dihydrofolate reductase and 5-aminoimidazole-4-carboxamide ribonucleotide transformylase.10,11 more specifically, inhibition of these enzymes involved in folate metabolism and purine synthesis ultimately leads to inhibition of adenosine deaminase (ada), thereby increasing the levels of adenosine.10 the increase in adenosine should follow a reciprocal decrease in xanthine and uric acid (ua ; supplementary fig. the clinical response to methotrexate may take several weeks in early ra (era) treatment, and early prediction of who will respond to methotrexate is imprecise. in addition, the clinically effective dose of methotrexate and the route of administration are often debated.1214 easy methods for early prediction of methotrexate response would aid in personalized medicine. some studies have suggested measuring intracellular methotrexate polyglutamates as a biomarker, but cost and lack of wide availability have been barriers for routine use.15,16 changes in serum ua may be useful as a surrogate for the intracellular function of methotrexate. the purpose of this study was to compare changes in serum ua levels in patients with era who were treated with methotrexate to those who were not treated with methotrexate and to correlate these changes with clinical outcomes. subjects were enrolled from the canadian early arthritis cohort (catch) study, a multicenter, observational, prospective cohort of patients with era. the inclusion criteria for the catch study are patients who are > 16 years of age, between six weeks and 12 months of persistent synovitis, and two or more swollen joints or one swollen metacarpophalangeal or proximal inter - phalangeal joint with one or more of the following : positive rheumatoid factor (rf), positive anticyclic citrullinated peptide 2, morning stiffness for > 45 minutes, response to nonsteroidal anti - inflammatory drugs, or painful metatarsophalangeal squeeze test. patients are followed up every three months where case report forms are completed for the first year and twice a year thereafter. during these standard visits, serum ua levels are measured in some patients during study visits as part of optional laboratory tests, as per study cohort protocol, at the discretion of their physician. based on the physician s discretion, treatment is intensive and mostly aligns with canadian practice recommendations. all sites had the approval of research ethics boards, and all patients with era provided signed consent. our research complied with the principles of the declaration of helsinki. all patients who met the 2010 acr / eular criteria for ra17 were included if they had serum ua levels performed before and after starting dmards and available disease activity score of 28 joints and esr (das(esr)28) and swollen joint count using 28 joints (sjc28). ua could have been remeasured at any point, while the patient was on a dmard. patients were excluded if they were taking oral methotrexate concurrently with oral sulfasalazine, as some data in the literature suggest that a significant drug drug interaction may lead to poor methotrexate absorption.18 simultaneous use of subcutaneous methotrexate and oral sulfasalazine was allowed. data were exploratory, so outcomes included clinical and radiographic outcomes between groups (methotrexate users vs. nonusers and methotrexate users who decreased ua vs. those who did not). patients were also excluded if they were taking allopurinol or had a history of gout. patients who were taking an average of 14 mg of methotrexate a week were excluded. an average methotrexate dose between 14 mg and 15 mg was allowed to include patients who up - titrated to a stable dose of 15 mg per week. patients with era who did not receive any methotrexate were used as controls (fig. 1), recognizing that the treatment was at the discretion of each enrolling rheumatologist. the following demographic data were obtained : age, sex, the duration of symptoms, the number of dmards used, and biological and steroid exposure. erosions in the catch study were determined using the radiographs of the hands and feet performed at baseline, 6 months, and 12 months and then annually, as reported by the local radiologist and/or reviewed by the rheumatologist. all statistical analyses were performed using the sas software version 9.3 (sas institute). continuous variables were reported as mean values, and the changes in serum ua, das(esr)28, and sjc were compared using the student s t - test (p 16 years of age, between six weeks and 12 months of persistent synovitis, and two or more swollen joints or one swollen metacarpophalangeal or proximal inter - phalangeal joint with one or more of the following : positive rheumatoid factor (rf), positive anticyclic citrullinated peptide 2, morning stiffness for > 45 minutes, response to nonsteroidal anti - inflammatory drugs, or painful metatarsophalangeal squeeze test. patients are followed up every three months where case report forms are completed for the first year and twice a year thereafter. during these standard visits, serum ua levels are measured in some patients during study visits as part of optional laboratory tests, as per study cohort protocol, at the discretion of their physician. based on the physician s discretion, treatment is intensive and mostly aligns with canadian practice recommendations. all sites had the approval of research ethics boards, and all patients with era provided signed consent. our research complied with the principles of the declaration of helsinki. all patients who met the 2010 acr / eular criteria for ra17 were included if they had serum ua levels performed before and after starting dmards and available disease activity score of 28 joints and esr (das(esr)28) and swollen joint count using 28 joints (sjc28). ua could have been remeasured at any point, while the patient was on a dmard. patients were excluded if they were taking oral methotrexate concurrently with oral sulfasalazine, as some data in the literature suggest that a significant drug drug interaction may lead to poor methotrexate absorption.18 simultaneous use of subcutaneous methotrexate and oral sulfasalazine was allowed. data were exploratory, so outcomes included clinical and radiographic outcomes between groups (methotrexate users vs. nonusers and methotrexate users who decreased ua vs. those who did not). patients were also excluded if they were taking allopurinol or had a history of gout. patients who were taking an average of 14 mg of methotrexate a week were excluded. an average methotrexate dose between 14 mg and 15 mg was allowed to include patients who up - titrated to a stable dose of 15 mg per week. patients with era who did not receive any methotrexate were used as controls (fig. 1), recognizing that the treatment was at the discretion of each enrolling rheumatologist. the following demographic data were obtained : age, sex, the duration of symptoms, the number of dmards used, and biological and steroid exposure. erosions in the catch study were determined using the radiographs of the hands and feet performed at baseline, 6 months, and 12 months and then annually, as reported by the local radiologist and/or reviewed by the rheumatologist. all statistical analyses were performed using the sas software version 9.3 (sas institute). continuous variables were reported as mean values, and the changes in serum ua, das(esr)28, and sjc were compared using the student s t - test (p 14 mg per week and were not taking oral methotrexate and sulfasalazine or allopurinol simultaneously. forty - nine of the methotrexate users had two or more ua results before and during methotrexate treatment and were appropriate for data analyses. the majority of ua levels before methotrexate exposure were taken at baseline, and a large proportion of ua levels after initiation of methotrexate were repeated at 12 months. methotrexate users vs. nonusers (controls) were similar with respect to age, proportion of females, baseline, das28, sjc, and erosions, whereas the duration of symptoms for methotrexate users was longer than for the control group (197 days vs. 144 days) and the number of dmard medications also differed (3 vs. 1). methotrexate users and controls did not have significantly different baseline ua levels (p = 0.23). between methotrexate users and controls, the mean follow - up ua levels did not differ significantly owing to high variability within each group. within each group, the controls had a baseline ua level of 280 mol / l and follow - up level of 282 mol / l, providing a net difference of + 2 mol / l (p = 0.448, one - tailed t - test). mol / l prior to methotrexate and a follow - up level of 273 mol / l, with a mean difference of 27 mol / l (p = 0.035, one - tailed t - test). this statistically significant difference was lost when recalculated with patients taking concurrent sulfasalazine and oral methotrexate. of the 49 methotrexate users, 32 (65%) had a decrease in ua compared to 18 (45%) of the 40 controls. the mean score of das(esr)28 was 2.4 for the 32 methotrexate users who experienced a decrease in ua, while the control group had a higher score of 3.3 (t - test, p = 0.042), as shown in table 1. in the former group, the sjc at 18 months was 0.9 compared to the 17 patients on methotrexate who did not experience a decrease in ua where the sjc at 18 months was 4.5 (t - test, p = 0.035). the values of das(esr)28 and sjc were not statistically different between the groups at 12 months or 24 months. this study of era patients participating in a large multicenter canadian prospective cohort showed that those treated with methotrexate experienced a decrease in their serum ua levels that correlated with their response to this therapy. these findings support the postulated mechanism of action of methotrexate whereby inhibition of purine synthesis enzymes increases adenosine levels, while it reciprocally decreases ua. although this mechanism requires further validation, our analysis also revealed that patients were found to have a decrease in their serum ua while receiving methotrexate therapy and were also found to have better clinical outcomes at 18 months by achieving a das(esr)28 defined remission and an sjc28 score of < 1. our finding that serum ua decreases with methotrexate therapy is in contrast to a previously published work.19 a study published in 2000 by emery and the multinational leflunomide study group compared leflunomide versus methotrexate in the treatment of ra. here however, these increases in serum ua levels were also associated with a statistically significant increase in serum creatinine levels. as ua is mainly eliminated via renal excretion, their ua increases may have been subject to confounding. to date, there are no other published reports that examine the effects of methotrexate on serum ua levels. however, major advances in research over the last 30 years indicate that increase in adenosine is a key mechanism in how methotrexate exerts its anti - inflammatory effects. sub sequently, this has led to further research of adenosine signaling pathways with further therapeutic implications.20 increased adenosine levels, theoretically, result from decreased xanthine and ua synthesis.911 our outcomes lend further support to this postulated mechanism of action. furthermore, if the decrease in serum ua levels is from this mechanism of action, it stands to reason that serum ua levels may serve as a surrogate marker for methotrexate therapeutic monitoring. in our cohort, we were able to differentiate patients who respond clinically to methotrexate therapy versus those who do not based on their ua status. optimal methotrexate dosing, frequency, and route of administration in ra have been debated.1,1214 ideally, for optimal use, all of the abovementioned variables in medication administration would be personalized according to the pharmacodynamic response. in fact, if our hypothesis is that the adenosine ua pathway is directly linked to the inherent mechanism of action of methotrexate, it is conceivable that serum ua levels may be used to guide the dosing, frequency, and route of administration. a change in ua levels hoekstra in 2006 suggested that splitting of methotrexate doses may increase the area under the curve and the intracellular uptake of methotrexate.13 the ua - lowering effect after a single dose of methotrexate lasted only a few days with return to baseline by one week, but steady - state dosing was not done in this study.7 serial serum ua levels could potentially inform whether splitting of methotrexate dosing could be more effective within an individual, but this has not been studied. perhaps early lowering of ua with methotrexate may predict clinical outcomes at 18 months, and a lack of ua reduction could determine a need for methotrexate dose adjustment to obtain optimal pharmacokinetics. it is conceivable that patients tolerating only lower doses of methotrexate have innate enzyme variants that will still increase adenosine levels via this pathway. this study was a post hoc exploratory analysis of a subset of catch patients with a small sample size, and it may have been underpowered, as ua is not routinely performed, especially serially, in the management of era. the earliest follow - up ua levels were usually done at 12 months, which was many months following methotrexate initiation. despite this, we were able to show a significant change in serum ua levels in patients taking methotrexate. in addition, due to limited data, we were not able to perform complex analyses to adjust for potential confounding, such as alcohol consumption, diet, or antihypertensive medications, such as diuretics or angiotensin receptor blockers. using these prospectively collected data across multiple centers throughout canada, clinical outcomes were predicted by lowering ua from methotrexate therapy. baseline characteristics such as antibody status, percentage of patients meeting the 2010 acr / eular classification criteria for ra, the number of dmards used, and clinical measures, such as sjc28 and das28, did differ between groups. these statistical confounders are likely reflected in certain differences such as that seen between the rf positive group compared to the anti - ccp antibody positive group. therefore, beyond the primary outcome measure of change in ua in response to methotrexate, these results can not be generalized. however, within the methotrexate user group, baseline characteristics were very similar between patients who experienced a decrease in ua levels vs. those who did not. due to small numbers and side effects being uncommon, we did not study ua response and adverse drug reactions to methotrexate. methotrexate may be effective in ra via an increase in adenosine levels. in accordance with our hypothesis that this is directly linked to xanthine metabolism, ua levels were shown to be reciprocally decreased in a clinical setting for patients taking methotrexate for era. those who decreased serum ua levels with methotrexate had improved clinical responses compared to controls. methotrexate therapy for the treatment of era was associated with a decrease in serum ua levels. monitoring of serum ua levels in response to methotrexate therapy may allow an early prediction of clinical outcomes. further research is needed to elucidate the predictive power of serum ua levels in response to methotrexate therapy in ra. | objectivesthe mechanism of action of methotrexate in rheumatoid arthritis (ra) is complex. it may increase adenosine levels by blocking its conversion to uric acid (ua). this study was done to determine if methotrexate lowers ua in early ra (era).methodsdata were obtained from canadian early arthritis cohort, an incident era cohort. all era patients with serial ua measurements were included, comparing those with methotrexate use vs. no methotrexate exposure (controls). analyses were exploratory. patients with concomitant gout or taking ua - lowering therapies were excluded.resultsin total, 49 of the 2,524 era patients were identified with data available for both pre - methotrexate ua levels and post - methotrexate ua levels (300 mol / l and 273 mol / l, respectively ; p = 0.035). the control group not taking methotrexate had a mean baseline ua level of 280 mol / l and a follow - up level of 282 mol / l (p = 0.448) ; mean change in ua with methotrexate was 26.8 mol / l vs. 2.3 mol / l in the no methotrexate group (p = 0.042). methotrexate users with a decrease in ua had a disease activity score of 2.37 for 28 joints when compared with the controls (3.26) at 18 months (p = 0.042). methotrexate users with decreased ua had a lower swollen joint count (sjc) of 0.9 at 18 months, whereas methotrexate users without lowering of ua had an sjc of 4.5 (p = 0.035). other analyses were not significant.conclusionsmethotrexate response is associated with lowering of serum ua in era compared to nonusers. this may be due to changes in adenosine levels. methotrexate response is associated with lower ua and fewer swollen joints compared to nonresponders. |
pregnancy rate among iranian adolescents below 20 years of age is increasing. according to the world health organization (who), 10% of the girls from low- and medium - income countries become pregnant at the age of 16 and mothers aged between 10 and 19 years account for 11% of all births worldwide. the who figures also show that nearly 23% of childbirth - related diseases in the world occur in adolescent mothers. given the characteristics of adolescence, pregnancy during the period is basically different from other age groups and creates different feelings in women. pregnancy during adolescence is considered a social issue associated with medical, emotional, and social outcomes for the mother, child, and family. studies have shown that childbirth during adolescence is associated with the risk of negative outcomes for the mother and child. adolescent mothers are more likely to have poor prenatal health behaviors and poorer health status. over the past decades, many studies have been conducted on pregnancy among women below 20 years of age. most of the studies were quantitative, while a few assessed the experience of women below 20 years of age. the researches usually address the physiological results of pregnancy during this period, the risks of pregnancy, and ways to control them. so, what adolescents experience during the period has been studied to a lesser extent. furthermore, the studies have been conducted mainly in countries where adolescent pregnancies occur outside marriage and their culture is totally different from that of iran. in iran it is necessary to assess the adolescent pregnancy under such circumstances to see if it is different from pregnancy at a higher age. furthermore, nurses, particularly those working at the health and prenatal department for women below 20 years of age, play a key role in this regard. gaining an insight into pregnancy of women below 20 years of age, particularly the experience of pregnant women, can boost the knowledge of nurses who give healthcare services to the women. perception of adolescent pregnancy may provide basic knowledge for healthcare workers, so that they can take care of the mothers below 20 years of age at this transitional stage. this can help the service providers develop their special interventions so that they would satisfy the needs of young women in the best possible way and correct the childbirth outcomes for them. considering the significance of the matter and lack of any information about the experience of pregnant women below 20 years of age the interviews conducted with 14 participants yielded no new categories or subcategories in addition to the previous ones. deep and semi - structured interviews with open - ended questions were used to collect data. this type of interview is suitable for qualitative research because it is flexible and deep. the interview began with open - ended questions like : how did you feel when you realized that you were pregnant ? all the interviews were recorded and then typed verbatim for analysis. in qualitative studies, hence, the researcher listened to the interviews several times and reviewed the transcriptions many times. instead, he allows the categories and their titles to be extracted. in the present study, the analysis of data involved three stages : encoding, re - creating the categories, and abstracting. to assess the validity and reliability of the data, lincoln and guba criteria were used. one of the best techniques to validate the data is to have a long engagement with the subject. in the present study, the researcher was involved in the topic of the research, the data collected, and the pregnant women for a year. since the author worked as an instructor at healthcare centers before starting the study, she established a good relationship with the subjects before and throughout the research. thus, a summary of the researcher 's interpretation of the key points was given as feedback to the participants so as to ensure their validity. some parts of the interview along with the related codes and categories were sent to the supervisors so that they would examine the process of analysis and express their opinion on their validity. to determine transferability of the data, to this end, expecting women below 20 years of age who had planned or unplanned the pregnancies were studied at different gestational ages. for confirmability and dependability of the research, the author accurately recorded and reported all stages of the study so as to make it possible for others to check out the research. all the participants said their mothers and sisters or both had a history of becoming pregnant under the age of 18. most of them had got married because they were not interested in higher education [table 1 ]. psychological reactions including three subthemes of feelings, concerns, and fears ; 2. physical reactions including the subthemes of symptoms and feelings ; and 3. spiritual reactions including religious beliefs and faith. characteristics of participants (n=14) the theme involved the subthemes of feelings, concerns, and fears. as for the good feelings about pregnancy, the participants whose marriage and pregnancy were consensual referred to such feelings as life, happiness and feeling great, leaving behind childhood, sense of responsibility, enthusiastic for early pregnancy, sense of being a mother, a beautiful feeling, increased happiness, enthusiasm for a growing belly, waiting anxiously for the end of the pregnancy, and sweetness of pregnancy despite difficulties. but when you are pregnant, you feel that there is someone else in your abdomen ; you feel that someone else is growing ; you try to be careful much more ; and you care about that someone. i try hard to learn how moms behave so i will be the same. some participants who considered their age to be low for pregnancy had different feelings compared to other mothers. they also said they had bad feelings when they were alone, or they felt frightened or thought they were in danger, or felt that pregnancy was difficult and they were suffering or worried. i said i do nt want this child at all ; i mean it was sort of being unthankful, you know ; i said i want abortion and stuff. i was feeling terrible. as for the child, most participants who had consensual marriage or preplanned pregnancy expressed good feelings. the feelings included life being sweet with a child, being in a hurry to give birth, feeling that someone else exists within oneself, speaking to the fetus out of happiness, and loving the child. one participant said : i feel great ; the sense of becoming a mother and that i should shoulder the responsibility ; someone else is within me. what a nice feeling ! the participants who had got married non - consensually or become pregnant in a unplanned way had bad feelings about the child. the feelings included inability to shoulder the responsibilities, lack of confidence about the ability of a mom who is a child to raise another child, the difficulty of thinking about how to raise the child, and not being interested in having a baby immediately after marriage. but more because of ovary cyst (doctors said i must nt become pregnant) i was afraid. most participants had good feelings about their husbands such as the feeling that their spouses understood them well and that their husbands cared more about them during pregnancy. he says hopefully both you and the child will be all right. one of the participants whose marriage was not consensual expressed feelings such as hatred for her husband, and also the feeling that her husband was not treating her well, the feeling that she disliked her husband from the bottom of her heart, the feeling that her husband was cheating on her, and the feeling that the father of the child was bad. the subthemes of worries were worry about labor, premature childbirth, baby 's health, its condition, and abortion. then, you think that because there is a history (of such cases) in your family, god forbid, your child may not be healthy. however, this may not be genetic. it is god 's will. as for the subtheme of fears, the participants mentioned things such as being afraid of pregnancy due to young age, being afraid of childbirth, fearing people 's jinx because of pregnancy at young age, being concerned about how to raise the child alone, being worried of not having menstruations, being afraid of what the doctors would say about baby 's health, fearing that the baby may be strangled to death, and fear of harming the child by lying on their side. i was worried that the child in my stomach might be strangled if i put my hand on it ; i feared that i would deal a blow to the child when i was sleeping on my side. and now i m worried about giving birth. as for the physical reactions, participants reported symptoms such as dropping of the blood pressure, nausea, backache, headache, feeling pain in legs, edema, and feelings such as piercing spasm in the stomach, feeling that one 's belly is being torn apart, feeling flatulence after eating something, and feeling that something was moving in the belly. one participant said : i feel that my stomach is being torn apart. as for the religious beliefs, participants spoke of cases like the child in the stomach being a miracle, reading the quran for the child 's health, and believing that having a baby at a young age was providence. regarding the subtheme of faith, they referred to things such as supplicating god for a healthy pregnancy, praying god for a healthy child, husband 's prayers for the health of the mother and the child, supplicating god and being satisfied with what god ordains no matter what it is. a participant whose pregnancy was preplanned and whose marriage was consensual said : i ca nt get any sleep at nights. as for the good feelings about pregnancy, the participants whose marriage and pregnancy were consensual referred to such feelings as life, happiness and feeling great, leaving behind childhood, sense of responsibility, enthusiastic for early pregnancy, sense of being a mother, a beautiful feeling, increased happiness, enthusiasm for a growing belly, waiting anxiously for the end of the pregnancy, and sweetness of pregnancy despite difficulties. but when you are pregnant, you feel that there is someone else in your abdomen ; you feel that someone else is growing ; you try to be careful much more ; and you care about that someone. i try hard to learn how moms behave so i will be the same. some participants who considered their age to be low for pregnancy had different feelings compared to other mothers. they also said they had bad feelings when they were alone, or they felt frightened or thought they were in danger, or felt that pregnancy was difficult and they were suffering or worried. i said i do nt want this child at all ; i mean it was sort of being unthankful, you know ; i said i want abortion and stuff. i was feeling terrible. as for the child, most participants who had consensual marriage or preplanned pregnancy expressed good feelings. the feelings included life being sweet with a child, being in a hurry to give birth, feeling that someone else exists within oneself, speaking to the fetus out of happiness, and loving the child. one participant said : i feel great ; the sense of becoming a mother and that i should shoulder the responsibility ; someone else is within me. what a nice feeling ! the participants who had got married non - consensually or become pregnant in a unplanned way had bad feelings about the child. the feelings included inability to shoulder the responsibilities, lack of confidence about the ability of a mom who is a child to raise another child, the difficulty of thinking about how to raise the child, and not being interested in having a baby immediately after marriage. but more because of ovary cyst (doctors said i must nt become pregnant) i was afraid. most participants had good feelings about their husbands such as the feeling that their spouses understood them well and that their husbands cared more about them during pregnancy. he says hopefully both you and the child will be all right. one of the participants whose marriage was not consensual expressed feelings such as hatred for her husband, and also the feeling that her husband was not treating her well, the feeling that she disliked her husband from the bottom of her heart, the feeling that her husband was cheating on her, and the feeling that the father of the child was bad. the subthemes of worries were worry about labor, premature childbirth, baby 's health, its condition, and abortion. then, you think that because there is a history (of such cases) in your family, god forbid, your child may not be healthy. however, this may not be genetic. it is god 's will. as for the subtheme of fears, the participants mentioned things such as being afraid of pregnancy due to young age, being afraid of childbirth, fearing people 's jinx because of pregnancy at young age, being concerned about how to raise the child alone, being worried of not having menstruations, being afraid of what the doctors would say about baby 's health, fearing that the baby may be strangled to death, and fear of harming the child by lying on their side. i was worried that the child in my stomach might be strangled if i put my hand on it ; i feared that i would deal a blow to the child when i was sleeping on my side. as for the physical reactions, participants reported symptoms such as dropping of the blood pressure, nausea, backache, headache, feeling pain in legs, edema, and feelings such as piercing spasm in the stomach, feeling that one 's belly is being torn apart, feeling flatulence after eating something, and feeling that something was moving in the belly. one participant said : i feel that my stomach is being torn apart. as for the religious beliefs, participants spoke of cases like the child in the stomach being a miracle, reading the quran for the child 's health, and believing that having a baby at a young age was providence. regarding the subtheme of faith, they referred to things such as supplicating god for a healthy pregnancy, praying god for a healthy child, husband 's prayers for the health of the mother and the child, supplicating god and being satisfied with what god ordains no matter what it is. a participant whose pregnancy was preplanned and whose marriage was consensual said : i ca nt get any sleep at nights. the findings of the study showed that some reactions of the adolescents to pregnancy were different compared to other age groups. pregnancy is a multi - dimensional phenomenon in which the expecting adolescent, her husband, relatives, and fetus must be monitored. the findings of the study also showed that the expecting adolescent reacts psychologically, physically, and spiritually to the phenomenon and its dimensions. most participants who had married consensually and become pregnant in a preplanned way had good feelings about pregnancy and having a baby. the findings of ebanks showed that expecting adolescents who had planned pregnancy described it as a positive experience in their lives. found that having a positive view of becoming a mother during adolescence causes the adolescents view having a baby a motive for setting their targets in life and loving someone who reciprocates their love and a sign of maturity. montgomery 's study on preplanned pregnancy of adolescents referred to themes such as being good for further growing up along with a sense of responsibility, independence, maturity, a long history of the usefulness of pregnancy, and being a mother and pregnancy being the next natural step in one 's life. in the present study, one participant who had got married non - consensually had bad feelings about pregnancy and her husband. other studies in different countries have shown that anxiety and stress during unwanted pregnancy is associated with few positive feelings about being a mother and much difficulty in becoming a mother, as well as with symptoms of depression. paskiewicz found that the experience of pregnancy among adolescents was associated with things such as conflict, role change, and social isolation. also, meadows - oliver found that participants with unwanted pregnancies considered it as fast aging and a loss of their adolescent period. the results showed that becoming a mother means transition from adolescence to adulthood faster than peers. under such circumstances, adolescents can not do activities that they enjoy doing. in the present study, as for the feelings toward husband, the participants spoke of things ranging from ability and making plans to look after the infant with the help of the husband, succeeding in adapting oneself with pregnancy with the help of the husband, feeling that one is understood by her husband, and feeling that husband cares more about his wife during pregnancy. a phenomenological study by spear showed that eight expecting adolescents had a good feeling about becoming a mother alone, completing one 's educational goals and maintaining the protective relationship with the child 's father. some other findings of the study are compatible with the results of the present research. most participants referred to their husband 's consent besides their willingness regarding their planning for pregnancy. siegel (2001) showed that pregnant adolescent 's husband and community are the most important factors in decision - making for planning pregnancy. however, it is necessary that the inexperienced pregnant adolescent 's relatives and husband support her and inform her of how to deal with these reactions. in the study titled, nursing for expecting adolescents, montgomery reported that looking after the pregnant adolescents physically is similar to that of adults, but the adolescents have unique needs. this reduces their ability to adapt themselves to life changes they experience during pregnancy and labor. the participants said, it was god 's providence that we had a baby so early and trusting in god for the health of the child. some studies referred to the role of faith and religious belief in shaping one 's attitude toward pregnancy. tanner. showed that resorting to religious messages by participants often provides the logic for conception. as the adolescents participating in their study said, unwanted pregnancy can be god 's will. one of the minor findings of the present study was that most pregnancies occurred among those adolescents who conceived just for the sake of avoiding continuing their studies to higher levels. also said one of the factors concerning pregnancy during adolescence was attitude toward school (reluctance to go to school any more). in the present study, all the expecting adolescents, including those who had married consensually and non - consensually and those who had planned or unplanned pregnancies, reported a history of their relatives (mother or sister) marrying and giving birth while they were too young. reported that factors such as marriage during the period of adolescent, high school, or lower education and having sisters with a history of conception during adolescence had a relationship with pregnancy among adolescents. east. also showed that there was a relationship between pregnancy during adolescence and the history of conception during the period among family members. according to the study, adolescents whose mothers or sisters or both had experienced pregnancy during adolescence had most probably experienced the same thing. the present study showed that for the purpose of assessing pregnancy in adolescents, one should consider the context and culture in which the adolescent lives. this is because factors such as preplanned or unwanted pregnancy and imposed or consensual marriage within or outside the family may draw different reactions from adolescents. hence, all those factors need to be considered in order to plan health education during pregnancy for this age group. therefore, one of the basic limitations is inability to generalize the findings to a target population. therefore, one of the basic limitations is inability to generalize the findings to a target population. | background : pregnancy rate among iranian adolescents below 20 years of age is increasing. pregnancy during adolescence is considered a social issue associated with medical, emotional, and social outcomes for the mother, child, and family. the current research examines the experience of pregnancy among iranian adolescents.materials and methods : the qualitative content analysis method was used. a purposive sample of 14 pregnant adolescents was enrolled in the study. deep interviews were carried out with them.results:three themes were came up after analyzing the interviews : 1. psychological reactions including three subthemes of feelings, concerns, and fears ; 2. physical reactions including the subthemes of symptoms and feelings ; and 3. spiritual reactions including religious beliefs and faith.conclusions:the present study showed that for the purpose of assessing pregnancy in adolescents, one should consider the context and culture in which the adolescent lives. this is because factors such as preplanned or unwanted pregnancy and imposed or consensual marriage within or outside the family may draw different reactions from adolescents. hence, all those factors need to be considered in order to plan health education during pregnancy for this age group. |
measurement of umbilical cord ph is an objective measure for perinatal morbidity at birth and can be used for audit on prenatal care and manangement of labour (vandenbussche., 1999). umbilical artery ph < 7,05 is a marker for neonatal acidosis and is associated with an increased risk for neonatal complications, as compared to normal cord blood ph. mmol / l, is less severe than metabolic acidosis with a deviating base - excess (uzan., 2003). the incidence of serious neonatal morbidity and post - asphyctic encephalopathy increases significantly with umbilical artery cord ph < 7,00 (gilstrap., 1989 ; goldaber., 1991 ; malin., 2010). in the criteria for the diagnosis of intrapartum hypoxia related neonatal brain damage, a base excess of -12 mmol / l is set as the cut - off value for definition of asphyxia (acog committee opinion, 2006 ; andres., 1999 ; goodwin. as labour is the time span in which there is a substantial risk for asphyxia and asphyxia related mortality and morbidity, it is often questioned which particular aspects of labour management might enhance or prevent birth asphyxia. some typical examples generally well known are uterine hyperactivity following adminstration of oxytocine, or hypotension related cardiotocographic fetal distress at installation of epidural anestesia (verspyck., 2008). this study is a single center 1-year perinatal audit on the relevance of systematic screening for neonatal metabolic acidosis at birth with postnatal follow up of neonatal outcome, in order to identify preventable aspects of labour management which are associated with birth- related neonatal morbidity. at birth of each baby, born in ziekenhuis oost limburg genk belgium between 1/1/2010 and 31/12/2010, umbilical cord blood was sampled for blood gas analysis according to reported methodology (sundstrm., 2000). the sundstrm criteria for metabolic acidosis are more stringent than the criteria for perinatal asphyxia, as defined by the american college of obstetricians and gynecologists (acog, 2006) and allow for identification of a higher number of index cases with potential suboptimal care. the samples were collected within minutes after birth and sent to the lab instantly for analysis. criteria for established metabolic acidosis were arterial ph < 7,05 or venous ph < 7,17, in association with base excess -10 mmol / l. in cases of sampling- or analysis - error, neonates with persistently low apgar score of 6 after 5 minutes were considered clinically at risk for metabolic acidosis (sundstrm., 2000 ; for all cases of neonatal metabolic acidosis or persistently low apgar score, patient s labour ward notes, fetal monitoring traces and neonatologist s records were evaluated retrospectively by three independent observers for identification of indicators of suboptimal peripartal care. after this, all cases were discussed with a group of obstetricians and neonatologists of ziekenhuis oost limburg genk to obtain overall consent for classification into 1 of five categories : (a) failure to detect or misinterpretation of signs of fetal distress was labelled as non - conformity with guidelines for fetal monitoring (sundstrm., 2000), (b) abstaining from or overdosage of oxytocin for augmentation of uterine contractility was labeled as non - conformity with the protocol for active management of labour (boylan., 2004), (c) early second stage intervention with instrumental vaginal delivery for fetal distress within 2h after full dilatation, (d) complications from non - obstetric interventions, such as anesthesia, and (e) preterm births or accidental and unavoidable cases at term such as placental abruption, chorio - amnionitis, at birth of each baby, born in ziekenhuis oost limburg genk belgium between 1/1/2010 and 31/12/2010, umbilical cord blood was sampled for blood gas analysis according to reported methodology (sundstrm., 2000). the sundstrm criteria for metabolic acidosis are more stringent than the criteria for perinatal asphyxia, as defined by the american college of obstetricians and gynecologists (acog, 2006) and allow for identification of a higher number of index cases with potential suboptimal care. the samples were collected within minutes after birth and sent to the lab instantly for analysis. all cases of metabolic acidosis were identified by blood gas analysis. criteria for established metabolic acidosis were arterial ph < 7,05 or venous ph < 7,17, in association with base excess -10 mmol / l. in cases of sampling- or analysis - error, neonates with persistently low apgar score of 6 after 5 minutes were considered clinically at risk for metabolic acidosis (sundstrm., 2000 ; uzan., 2003 ; zupan, 2008) and for all cases of neonatal metabolic acidosis or persistently low apgar score, patient s labour ward notes, fetal monitoring traces and neonatologist s records were evaluated retrospectively by three independent observers for identification of indicators of suboptimal peripartal care. after this, all cases were discussed with a group of obstetricians and neonatologists of ziekenhuis oost limburg genk to obtain overall consent for classification into 1 of five categories : (a) failure to detect or misinterpretation of signs of fetal distress was labelled as non - conformity with guidelines for fetal monitoring (sundstrm., 2000), (b) abstaining from or overdosage of oxytocin for augmentation of uterine contractility was labeled as non - conformity with the protocol for active management of labour (boylan., 2004), (c) early second stage intervention with instrumental vaginal delivery for fetal distress within 2h after full dilatation, (d) complications from non - obstetric interventions, such as anesthesia, and (e) preterm births or accidental and unavoidable cases at term such as placental abruption, chorio - amnionitis, there was a total of 2056 deliveries with birth of 2117 babies. in this population, there were 11 cases of in utero fetal demise, 1 intrapartum death and 3 early neonatal deaths, bringing the total rate of early perinatal mortality to 7.1 per thousand births (15/2117). as shown in figure 1, 92.5% (1959/2117) of babies had normal ph values, whereas 3.5% (74/2117) were born with acidosis. of these, 23 (1.1%) babies suffered metabolic adicosis and 51 (2.4%) had respiratory acidosis. there were 73 (3.3%) babies with unknown ph values, of which one showed a persistently low apgar score of 6 after 5 minutes. figure 2 shows the clinical classification of 23 babies with metabolic acidosis or persistently low apgar score, excluding 1 intrapartum death following maternal incompliance to labour support. for thirteen (54%) babies, no recognizable pattern of preventable measures during labour was identified, whereas ten others were classified as follows : 4 (16.7%) cases of violation of fetal monitoring guidelines, 1 (4.2%) case of violation of the protocol for active management of labour, 1 (4.2%) total spinal block after epidural anesthesia and 5 (20.8%) cases of instrumental vaginal delivery for fetal distress within 2 h of second stage. apart from the premature births (n = 5), all babies left hospital within a week after birth, and 21 babies (91.3%) were in good clinical condition at discharge. two babies (0.9 of the total population) showed persistence of neurologic symptoms for at least 6 months after birth and therefore were in long term neonatal follow up. both babies were classified in the group of instrumental vaginal delivery for fetal distress within 2 h of second stage. one of these neonates had umbilical artery ph less than 7.0 with base - excess < mmol / l and the other one had 5 minute apgar score 6, for which both had criteria of perinatal asphyxia fulfilled. reported incidence of neonatal metabolic acidosis and birth asphyxia depends on the definitions used. an umbilical artery ph < 7.05 combined with base - excess -10 mmol / l is recorded in approximately 2.5% of the population (sundstrm., 2000). perinatal asphyxia with ph < 7.0 and base - excess -12 mmol / l is observed in approximately 0.5 - 1% of term deliveries (richardson., 2005 ; neonatal metabolic acidosis and perinatal asphyxia was found in 1.1% (24/2105) and 0.9 (2/2105) of live births respectively. two babies born with metabolic acidosis showed signs of persistent neurologic symptoms after birth, and met criteria of birth asphyxia. both babies were born with instrumental vaginal delivery for fetal distress within 2 h of second stage. guidelines on management of second stage of labour show increased rates of spontaneous vaginal delivery in prolonged second stage with delayed pushing, as compared with early pushing at diagnosis of full dilatation, without associated differences in other parameters of maternal or neonatal outcome (berghella, 2007 ; roberts., 2004). fetal distress after full dilatation is often anticipated with assisted birth techniques, such as instrumental vaginal delivery (de jonge, 1991). however, in case of insufficient descend or incomplete adaptation of the fetal head to the shape of the birth canal, cesarean section is to be preferred over difficult instrumental delivery, specifically for an already compromised baby. intra - uterine resuscitation in the early second stage of labour can be considered an alternative for immediate operative delivery, on the condition that fetal monitoring shows complete and reassuring recovery. obstetric interventions with succesful effect on intra - uterine fetal recovery from distress include interruption of iv administration of oxytocin, acute tocolysis in case of uterine hypertonia, maternal repositioning and amnio - infusion for oligo - amnion (verspyck., 2008). maternal oxygen administration is not recommended since it has been associated with lower cord blood ph values compared to controls (fawole., 2007). the use of betamimetics in the second stage has been linked to increased rate of forceps deliveries (campbell., 1978). increased risk for postpartum hemorrhage and for urinary incontinence 3 months postpartum (brown., 2011) after prolonged second stage have also been reported. from the audit results presented in this paper, we have introduced in our local protocol for management of labour the consideration of intra - uterine resuscitation in the second stage of labour as an alternative to operative delivery for fetal distress, after discussing harms and benefits with the parents. results of this adaptation of our protocol are to be assessed prospectively in forthcoming years. programs of perinatal audit usually include data on maternal mortality, near - miss maternal morbidity, stillbirths and neonatal mortality (drife, 2006). in belgium and other well - developed countries, low rates of < 1/10.000 for maternal mortality and < 1% for perinatal mortality are reported (study centre for perinatal epidemiology, brussels). even with low maternal and neonatal mortality rates, guidelines towards further improvement of perinatal care are reported (flenady., 2011), however, changing obstetric and perinatal management based on mortality rates only, without using figures on morbidity, may overlook those strategies causing a paradoxical shift from mortality to severe morbidity (wilson. currently, registration of neonatal near - miss cases based on abnormal cord blood gass analysis, are usually not part of any audit program and no accepted definition of neonatal near - miss currently exists (avenant, 2009). it has been shown that the neonatal near - miss approach provides data useful to evaluate and improve the quality of perinatal care (pileggi., 2010). assessment of cord blood ph is enlisted in the rcog recommendations towards improvement of patient safety (rcog, 2009). our study illustrates that the assessment of neonatal metabolic status at birth has been helpful to identify indicators of care with increased risk for persistent perinatal morbidiy and to define strategies towards improvement of perinatal outcome. in our audit, by adding the cases of neonatal metabolic acidosis to those of perinatal mortality, the number of events eligible for analysing quality of perinatal care increased from 15 to 38, or from 0.7% of all births to 1.8%, which reflects a 2.5 fold increase. the near - miss principle of perinatal audit thus adds cases to evaluate and optimize intrapartum care. from this, we recommend that programs of perinatal audit should include figures on perinatal morbidity next to those of perinatal mortality, maternal morbidity and maternal mortality. we conclude from our data that systematic screening for neonatal metabolic acidosis at birth helps to identify indicators of prenatal and obstetric management with potentially increased risk for adverse outcome, in addition to those identified with audit of perinatal mortality. therefore, we suggest that audit programs towards improvement of perinatal care should include data on perinatal near - miss morbidity, next to those on perinatal mortality, maternal morbidity and maternal mortality. | aims : to evaluate the relevance of systematic screening for neonatal metabolic acidosis at birth as part of perinatal audit.methods : for every baby, born in ziekenhuis oost limburg, genk belgium between 1/1/2010 and 31/12/2010, cord blood was analysed to diagnose metabolic acidosis, defined as arterial or venous ph 7.05 or 7.17 respectively, in association with base excess of -10 mmol / l. three observers identified indicators for suboptimal peripartal care with likely contribution to metabolic acidosis. in a multidisciplinary consensus meeting, these indicators were classified into 5 categories : (a) fetal monitoring error (b) labour management error, (c) instrumental vaginal delivery for fetal distress within 2 h of second stage, (d) non - obstetric medical complications, (e) preterm births or accidental cases at term.results : in a total of 2117 neonates, there were 11 intra - uterine, 1 intrapartum and 3 early neonatal deaths, bringing early perinatal mortality rate at 7.1. metabolic acidosis was identified in 23 (1.1%) babies, of which 21 (91.3%) left hospital in good clinical condition. two babies (0.9), born in category c, had chronic neurologic symptoms.discussion : systematic screening for neonatal metabolic acidosis caused a 2.5-fold increase of case identifications eligible for perinatal audit and opened perspectives towards rationalised improvement of perinatal care, in addition to the information obtained from cases of perinatal mortality. next to indicators of perinatal mortality, perinatal audit programs should include neonatal metabolic acidosis as an extra parameter for quality assessment of perinatal care.conclusion : adding cases of near - miss neonatal morbidity to perinatal mortalities in perinatal audit programs increases opportunities for improvement of perinatal care. |
transcription factors (tfs) bind to short dna sequences where they combine with other co - factors to regulate the expression of target genes in specific epigenetic and nuclear contexts. some of the most dramatic effects a tf can have are those related to cellular differentiation. for instance, myod alone is capable of trans - differentiating fibroblasts to myoblasts, and a combination of only four tfs (oct4, sox2, klf4, and c - myc) is sufficient to reprogram terminally differentiated fibroblasts into ips cells that display an embryonic stem cell - like phenotype. fibroblasts can also be transformed into tripotent neural precursor cells with a defined cocktail of tfs (brn2, sox2, and foxg1). clearly a tf s ability to recognize some sort of code contained in the dna region it binds to is essential for the successful execution of gene expression programs. however, the analysis of the dna sequence preferences of tfs using a variety of high - throughput methods have underlined the general binding degeneracy of tf families, indicating that there is no simple relationship between the dna sequence a tf binds to and the biological program it executes. therefore, mechanisms other than the mere binding of a tf to dna must be involved in determining the cell type - specific functions of tfs. complex models describing the interplay between groups of tfs, as well as the influence of the epigenetic environment on transcription, have been proposed to explain the functional specificity of tfs. however, none of these models are entirely satisfactory or comprehensive, and no broadly applicable rules have been described to explain the mechanisms whereby tfs discriminate and select specific binding sites genome - wide to perform specific functions. the diversity of cells and tissues where a tf is expressed can serve as an approximation to infer its functional diversity. we may thus classify tfs into one of three categories : (1) tfs whose expression is restricted to a single cell - type (e.g., oct4 [pou5f1 ] is primarily expressed in embryonic stem cells) ; (2) tfs restricted to a single germ lineage, such as the soxb1 subfamily of tfs (ectodermal) and stat4 (primarily mesodermal) ; and (3) tfs that are ubiquitously expressed, such as most members of the stat family of tfs (fig. 1). it is this latter category of widely expressed tfs that presents the greatest intellectual challenge as they normally display a large variety of functions (pleiotropy), including opposing functions in distinct cell types, and sometimes within the same cell type too. the functional diversity of a tf can be inferred from its expression pattern throughout the body. for instance, the expression of oct4 (pou5f1) is primarily restricted to escs, whereas most stat family members are widely expressed in multiple mouse tissues except stat4, which is primarily mesodermal. sox2 and sox3, like stat4, are also restricted to a single developmental lineage, the ectoderm. rna - seq data was extracted from the geo database accessions : gse20851, gse20898, gse29209, gse29278, gse31530, gse33024, gse34550, gse36026, gse39524, gse39656, gse39756, gse40350, gse40463, gse42207, gse42443, and gse42880. in this review we explore the general problem of understanding the regulatory mechanisms of multi - functional tfs by taking stat3 as a prime example of a pleiotropic tf. recent work that integrates high - throughput genomics and detailed computational analyses has shed new light into the mechanisms employed by stat3 to perform completely different biological functions in distinct cell types. these models are specific to stat3, but the concepts and tools involved in the analyses are applicable to other tfs, thus opening the door to a more thorough mechanistic understanding of tfs with complex functions. stat3 is constitutively expressed and its genetic deletion is embryonic lethal, possibly due to an essential role in maintaining pluripotency. this early severe phenotype therefore masks many other functional defects associated with the loss of the stat3 gene and which have been painstakingly teased apart using cell type - specific knockouts and carefully designed cell culture experiments. for instance, the roles of stat3 in metabolism are many and varied, including links to obesity and glucose tolerance, as shown by the deletion of stat3 in the neural system, hypothalamus, pancreatic islets, and adipose cells where it leads to a general impairment of metabolism due to the critical role that stat3 plays downstream of leptin signaling. stat3 mice, which have reduced levels of stat3 transcriptional activity, present growth retardation and a reduction in thymocyte numbers as well as defects in insulin growth factor-1 (igf-1) and growth hormone (gh). this suggests that stat3 might be indirectly responsible for promoting their expression, and hints at a positive feedback loop controlling growth as both igf-1 and gh can activate stat3. for example, in keratinocytes stat3 is required for hair production, cell migration, and wound repair, whereas the genetic ablation of stat3 in cardiomyocytes results in cardiac dysfunction as well as an increased sensitivity to inflammatory stimuli. moreover, a liver - specific knockout resulted in the suppression of liver regeneration after a partial hepatectomy. the hematopoietic system is perhaps where stat3 functions have been most intensely studied, although its role in hematopoietic progenitors remains controversial. the genetic deletion of stat3 in blood progenitors leads to a higher rate of myeloid cell production, particularly macrophages and neutrophils. in this context stat3 is also required later in hematopoiesis in flt3l - dependent dendritic cell development, as well as for controlling the apoptosis of conventional dendritic cells. in b lymphocytes, stat3 is required for the differentiation of igg b cells ; whereas in cytokine - stimulated (il-6, il-21, and il-23) cd4 t cells stat3 specifies the differentiation of th17 cells by binding at multiple sites in the vicinity of key genes, including il17a and il17f. stat3 is also important for the immune - suppressive treg cells through a direct action on foxp3 expression. besides its involvement in development, stat3 plays central roles in cellular responses to environmental stimuli. on the whole - organ level, an interferon - inducible conditional stat3 knockout in liver cells results in a loss of correct inflammatory function in the liver. the stimulation of myeloid cells with il-10 activates stat3 and has an anti - inflammatory effect, whereas stat3 synergizes with glucocorticoid receptor signaling to regulate inflammation in the pituitary. likewise, in fibroblasts il-6 synergizes with il-17a / nfb signaling to engage an inflammatory response. opposing effects of stat3 have also been described within the same cell type : in dcs, the il-6-mediated pro - inflammatory activity of stat3 appears to be rapidly induced, followed by a decline, whereas the il-10-mediated anti - inflammatory response is encoded in the sustained activity of stat3. this change in duration of stat3 activity is controlled by socs3, which binds to the phospho - y759 residue of the il-6 receptor (specifically the gp130 subunit) to inhibit downstream signaling through stat3, and so blocks il-6 activity. however socs3 does not bind to any analogous residue in the il-10 receptor, and so il-10 can continue to sustain the activation of stat3. in addition to the opposing effects of il-6 and il-10, complicating this picture further is the action of il-21 on conventional dcs (a subtype of dcs) where it activates stat3 to engage apoptosis. these observations in dcs highlight the complexity of stat3 function : three different cytokines signal through stat3 to produce three entirely distinct cellular responses in the same cell type. given its vast functional diversity it is not surprising that mutations in stat3 are responsible for a plethora of diseases. these include the hyper - ige syndrome, a condition characterized by recurrent colds, pneumonia, eczema, scoliosis, and extreme elevation of ige. the underlying cause of the hyper - ige syndrome remains unclear, and the phenotype is complex with various abnormalities throughout the immune system, particularly in t cell development as these patients present impaired t follicular helper cells and lack both cd4 and cd8 t memory cells. interestingly many of the mutations identified in hyper - ige syndrome patients are located in the dna binding domain of stat3, and they impair but do not abolish stat3 s dna - binding ability. in contrast, gain - of - function mutations in stat3 are rare but they do occur and are linked with cancer. for instance, several different mutations in stat3 (primarily within the sh2 domain) are associated with inflammatory hepatocellular adenoma and activate transcription in the absence of a cytokine. stat3 is associated with a wide array of cancers, especially for its role in promoting inflammation within and around the tumor as many tumors show excessive stat3-mediated inflammation in combination with nfb signaling. although the exact relationship between stat3 and the various types of cancer continues to be actively researched (is stat3 a cause or a consequence ?), at the very least in the case of pancreatic ductal adenocarcinoma stat3 is essential for both tumor initiation and progression where it cooperates with sox2 to transform foregut basal progenitor cells. moreover, stat3 has been widely implicated in inflammatory diseases, such as crohn disease : the il-10 knockout mouse is the prototypical mouse model for crohn disease and when stat3 is knocked out during hematopoiesis the resulting mice display crohn disease - like symptoms. finally, an epithelial cell - specific knockout mouse was developed to study sjgren syndrome, a systemic autoimmune disease where immune cells target exocrine glands, and which is characterized by the lack of nfkbiz, a universal stat3 target gene. the involvement of stat3 in so many pathologies makes it a promising target molecule for anti - cancer treatment despite the general difficulty of inhibiting tfs with small molecules. in addition to stat3 s role as a cytokine - activated tf, stat3 has also been found inside mitochondria in multiple cell types. here stat3 does not bind mitochondrial dna as might be expected, but instead forms a complex with grim-19 to bind to the electron transport chain, modulate reactive oxygen species production and confer a protective effect against ischemia. these fascinating roles of stat3 are independent of its ability to bind dna and highlight the functional diversity of stat3 to act not just as a tf but also as an adaptor protein. besides its large number of documented functions, one important aspect of stat3 that makes it an ideal system for dissecting the working mechanisms of pleiotropic tfs is its two - step mode of activation upon cytokine stimulation, which results in directly measurable effects. therefore, the activity of stat3 can be controlled as a natural switch, and with careful manipulation of the culture environment its activity can be regulated. this is a very important advantage over many other tfs where elaborate experiments using artificial switches need to be performed to modulate their activity. stat3 is known to exist in two isoforms, and. the former represents the standard version of the molecule, whereas the isoform is characterized by a c - terminal truncation of the transactivation domain. the isoform was originally suspected to have dominant - negative effects, but it is actually capable of rescuing stat3 embryonic function, and mice survive until birth. however, stat3 knockout mice die rapidly after birth, indicating that the post - natal functions of stat3 require the isoform. stat3 knockout mice also show a complex difference in effecting an inflammatory response in tissue - specific knockouts. crucially the dna - binding domain of stat3 is identical to that of the isoform, and can activate the same sets of target genes in most situations. it has long been suspected that stat3 regulates different target genes in distinct cell types as previously illustrated for a limited number of genes (summarized by levy and lee). the application of chip sequencing (chip - seq) has underlined the highly divergent cell type - specific binding patterns of stat3 in various cell types, which in turn reflect the distinct functions of stat3 in the body. cell type - specific binding patterns have also been described for other tfs and to different degrees. for instance, out of ~20 000 sox2 binding sites in embryonic stem cells (escs) and neural progenitor cells, only 1200 such sites overlap, while in a more extreme example, only three smad3 binding sites overlap between pro - b cells, escs and myotubes. most members of the stat family bind to a sequence known as the gas motif (ttccnggaa), a notable exception being stat6 which has a preference for ttccnnggaa. the analysis of thousands of in vivo stat3-binding sites from chip - seq studies performed in escs, att-20 cells (pituitary - like), cd4 t cells, and macrophages showed that variations of the gas motif alone are incapable of identifying specific functions in these cell types. moreover, these divergent binding preferences are indistinguishable from those of other stat family members, a characteristic shared with many other tf families. therefore, alternative stat3 binding sequences (particularly tgcnnngaa and ttannngaa) probably represent surrogate methods for stat3 recruitment. additional complexity comes from the ability of stat3 to heterodimerize with other stat family members, thereby displaying preferences for distinct consensus binding sites, or presenting novel surfaces for co - factors to bind to. indeed, it has long been known that stat3 and stat5 can form heterodimers with a binding preference for distinct dna sequences, and the heterodimerization of stats has been suggested to explain the vast functional diversity of stat family members. unfortunately no systematic analysis has yet been performed on heterodimeric stat complexes, while other examples exist where two stats engage in competitive binding. for example, stat3 and stat5 have opposing roles in th17 cells and mutually compete for the same binding sites. so, if variations of the canonical gas motif can not broadly account for the functional specificity of stat3 in distinct cell types, what are the mechanisms responsible for stat3 s widely divergent binding patterns and functions in these cells ? besides the widely divergent genomic binding patterns of stat3 in escs, att-20 cells, cd4 t cells, and macrophages, our analysis also unveiled a shared overlap of 35 non - random in vivo binding sites in these four cell types. what makes this set of 35 (evolutionarily conserved) binding sites so relevant is that the genes that stat3 appears to be regulating are essential for stat3 signaling. therefore we describe two distinct modes of stat3 binding : one that is universal to all cells (universal or cell type - independent), and various cell type - specific binding modes whereby stat3 mediates diverse functions in distinct cells by operating cell type - specific regulatory networks. within the universal core of 35 stat3 binding sites we found that stat3 binds to its own transcription start site (tss) in all four cell types to promote its own transcription (fig. 2a), and that it also regulates genes important for functions downstream of itself. 2b), which blocks the il-6 pro - inflammatory response in macrophages by binding to the il-6 receptor. socs3 similarly moderates the pro - inflammatory response in dcs and is also upregulated by stat3 in mammary cells. in escs, socs3 regulates lif / stat3 signaling and is thought to be a stat3 target in many other settings. additionally, stat3 binds to bcl3 in all four cell types : in interleukin 10-stimulated macrophages bcl3 suppresses tnf- expression, whereas in a myeloma cell line bcl3 has a pro - apoptotic effect downstream of il-6. the protein tyrosine phosphatase ptpn1, a well - known negative regulator of jak - stat signaling, is likewise regulated by stat3. stat3 is also recruited to several other tf genes, including nfkbiz, junb, fos, irf2, and bcl6. these findings suggest that the universal core of 35 stat3 binding sites dictates the self - regulation of stat3 signaling by : (1) perpetuating stat3 s transcription ; (2) functioning as a master regulator of other tfs working downstream of stat3 ; (3) stimulating the transcription of cytoplasmic enzymes that control stat3 s activity ; and (4) ensuring a robust cellular division program and the maintenance of a stable cell type. stat3 binds to a universal core of 35 binding sites to regulate a specific gene set that engages a self - regulatory loop for stat3 signaling. the examples shown here include : (a) stat3 binding to its own promoter in all cell types examined ; and (b) stat3 being recruited to the socs3 promoter. stat3-binding data sets were obtained from the following chip - seq libraries : gse27161, gse37235, gse21669, gse19198, gse11431, and gse31531. the vast majority of stat3-binding sites are cell type - specific, and therefore it is reasonable to assume that distinct regulatory networks are responsible for the various functions of stat3. one attractive model to explain these cell type - specific binding patterns is the local assembly of groups of tfs and co - factors around stat3 to form distinct transcriptional regulatory modules (trms) that provide cell type - specific activity. this model has been shown to work in several biological systems, including escs, where the trm centers on the core tfs pou5f1 (oct4), sox2, and nanog but also contains klf4, smad1, esrrb, and stat3. in macrophages, pu.1 partners with cebpa, cebpg, and ap-1, while in b cells pu.1 forms a regulatory network with e2a, ebf1, and foxo1 to define a core trm that determines the b cell phenotype. the identification of trms is a difficult task since extensive prior information is required to prioritize candidates for experimental validation. a typical cell may express several hundreds of the ~1400 sequence - specific tfs, all of which can potentially form stable interactions with important co - factors such as histone epigenetic regulators (this is particularly true in the enhanceosome and tf - collective models). we have developed a computational method for the systematic identification of trms that works by integrating tf genome - wide locations (from chip - seq experiments) with analysis of tf motif enrichment, cell type - specific expression data and protein - protein interactions. we applied our method, called rtrm, to identify the trms that endow stat3 with both universal and cell type - specific functions. we found that in the universal stat3 trm, stat3 forms a specific network with myc and e2f1, and experimentally showed that e2f1 not only co - localizes with stat3 in macrophages in over a dozen genomic sites but that it is also prebound at these sites in the absence of cytokine stimulation. this suggests a temporal regulatory code that might help stat3 locate specific binding sites in the genome (fig. the trms reconstructed for the cell type - specific binding patterns of stat3 suggest that stat3 specifically combines with different factors to perform different functions in distinct cell types (fig. 3). stat3 always recognizes the gas motif in dna (or slight variations thereof), but co - operates with other tfs and co - factors in what are called transcriptional regulatory modules (trms). trms include both cell type - specific and general tfs, and are largely responsible for the various functions of stat3 in different cell types. stat3 itself is the subject of a large number of post - translational modifications, and specific residues have been implicated in regulating stat3 homodimer formation as well as in selecting the partner tfs and therefore the trms that stat3 assembles into. for example, in addition to activatory phosphorylations, particularly y705 and s727, the p300-mediated acetylation of k685 is required to form stable homodimers and for dnmt1 recruitment. k140 is also methylated and appears to negatively regulate a specific subset of genes, presumably by influencing the trm that assembles around stat3., unphosphorylated stat3 can bind to p65/rela and is recruited to nfb elements in the dna to activate gene expression in the absence of cytokine signals. the exact role of these post - translational modifications in the context of specific cell types will be an important field of future study. unfortunately, genome - wide chip - seq experiments to detect stat3 binding have so far used either a pan - stat3 antibody, a combination of pan - stat3 and antiphospho - y705 antibodies, or an antiphospho - s727 stat3 antibody. as such the genome - wide roles of stat3 acetylation, methylation and other post - translational modifications remain enigmatic. reconstructing trms is extremely valuable when access to experimental data sets is limited, or when no regulatory proteins have been identified. one specific advantage of rtrm over other methods is that rtrm integrates protein - protein interaction data sets, which not only provide an additional filtering step but also encapsulate the well - known biological fact that proteins need to physically interact with other proteins to perform specific tasks. moreover, since protein - protein interfaces evolve faster than protein folds, it is not surprising that the combinatorial potential of proteins into specific modules (trms) underlies the functional repertoire displayed by pleiotropic tfs like stat3. computational predictions in the mouse genome have thrown a bewildering 1.3 million putative stat3 binding sites. still, using a conservative approach by considering only canonical stat3 binding sites (ttccnggaa) yields ~130 000 putative binding sites, a figure much larger than the thousands of genomic sites that stat3 occupies in vivo as informed by chip - seq experiments. our view is that stat3 is recruited to sites that are not only in an open chromatin state, but which possibly are also primed specifically for stat3. for instance we have reported that e2f1 is already bound at genomic sites of future stat3 recruitment, both in untreated and in il-10 stimulated macrophages. this observation and the rapid activation of many stat3 target genes (sometimes taking as little as tens of minutes to maximal mrna production) suggest that stat3 is not a pioneer factor in the same way as the foxa family members, but instead is taking advantage of pre - defined cell type - specific modules already present at specific enhancers. however, in other biological systems stat3 can also modulate the local epigenetic environment directly by recruiting the histone acetyl transferase p300 and thus promote gene expression, or through sin3a, a transcriptional repressor that recruits histone deacetylases to remove acetyl groups from histones. stat3 can also recruit the dna methyltransferase dnmt1 to bring about dna methylation and so silence gene expression. for these reasons, we conclude that it would be fair to categorize stat3 as an opportunistic pioneer tf, i.e., one that initially takes advantage of pre - existing enhancers, but which is also capable of establishing its own transcriptional network by modifying the local chromatin environment with the help of accessory enzymes. the ability of stat3 to bind to pre - existing enhancers is reminiscent of key genomic studies of the macrophage pro - inflammatory response where it has been shown that the macrophage developmental factor pu.1 remains bound in activated macrophages to provide a spectrum of possible transcriptional responses. lipopolysaccharide (lps) stimulation of macrophages leads to the recruitment of p300 to sites where pu.1 is already pre - bound to activate pro - inflammatory genes, indicating that pu.1 is thus maintaining the local chromatin in a permissive state to allow the rapid induction of gene expression. however, this model has recently been challenged by the identification of the new class of latent enhancers, which lack any epigenetic marks typical of enhancers (particularly h3k4me1, h3k4me3, and h3k27ac ; specific combinations of histone epigenetic marks are better predictors of enhancers than individual marks) before activation and only recruit lineage - specific tfs in the presence of a triggering stimulus. one possible explanation for the working mechanism of latent enhancers is that early - responding genes are pre - bound by cell type - determining tfs such as pu.1, and that upon lps activation nfb binds to these sites to rapidly induce gene transcription. in a second series of events, nfb may establish its own regulatory network by remodeling the cell s epigenetic landscape and activating a distinct set of genes. it will be fascinating to see if this mechanism also applies to stat3 and pu.1 is actually marking sites for subsequent stat3 occupancy during il-10 stimulation. indeed, preliminary work in our laboratory suggests that in macrophages pu.1 co - localizes with stat3 in ~25% (400/1723) of the stat3 binding sites in macrophages. understanding the multiple regulatory mechanisms of a pleiotropic tf like stat3, and how these generate the vast spectrum of functions across the body is a problem of byzantine complexity. although many models have been proposed to explain the cell type - specific binding of tfs, no single, general, model can yet explain how the many functions of pleiotropic tfs are accomplished. here we have reviewed the case of stat3, whose genomic binding patterns are predominantly cell type - specific. however, stat3 also binds to a small, non - random, set of 35 binding sites shared across multiple cell types and which appear to encode a mode of auto - regulation for stat3 signaling. therefore we propose two distinct modes for stat3 binding : one that is universal to all cells, and various cell type - specific binding modes whereby stat3 mediates diverse functions in distinct cells by operating cell type - specific regulatory networks. the models described here (fig. 3) are specific to stat3, but the concepts and tools involved in the analyses can be applied to dissect the regulatory mechanisms of other tfs, thus opening the door to a more thorough mechanistic understanding of tfs with complex functions. as more chip - seq data accumulate for specific tfs in multiple cell types, coupled with functional genomic analysis, it is likely that a set of models will emerge to explain the regulatory mechanisms of pleiotropic tfs. stat3 is a fascinating tf to study as well as an excellent model system, not only because it works as a natural biological switch but also because of its involvement in such a wide array of essential biological processes. furthermore, since stat3 is implicated in many diseases, particularly cancer and inflammation, achieving a detailed mechanistic understanding of how stat3 regulates its transcriptional programs will have important consequences for the design of disease - specific therapies. | stat3 is the quintessential pleiotropic transcription factor with many biological roles throughout development as well as in multiple adult tissues. its functional heterogeneity is encoded in the range of genome - wide binding patterns that specify different regulatory networks in distinct cell types. however, stat3 does not display remarkable dna binding preferences that may help correlate specific motifs with individual biological functions or cell types. therefore, achieving a detailed understanding of the regulatory mechanisms that endow stat3 (or any other pleiotropic transcription factor) with such a rainbow of functions is not only a central problem in biology but also a fiendishly difficult one. here we describe key genomic and computational approaches that have shed light into this question, and present the two current models of stat3 binding (universal and cell type - specific). we also discuss the role that the local epigenetic environment plays in the selection of stat3 binding sites. |
breast cancer (bc) diagnosed in women less than 45 years of age is still a significant challenge in terms of molecular, genetic and psychological studies, and qualifications to oncologic treatment. diagnostic procedures and treatment algorithms of young bc patients differ considerably in comparison with these dedicated to women who are 45 years old or over. breast cancer in young women are commonly more aggressive, associated with poor prognosis and are diagnosed at the advanced clinical stage. in many cases mammography in young women is not sufficient to identify cancer lesions because of high breast density. according to estimated data presented by estimated cancer incidence, mortality and prevalence worldwide (globocan), there were 1 676 633 cases of malignant breast tumors registered worldwide in 2012, 350 126 of new bc cases were diagnosed in women under 44. standardized incidence ratios in selected age groups were as follows : for the population of women aged from 15 to 39 was 14.1/100 000, and in the age group 4044 was 67.2/100 000. for european population these values were 20.4/100 000 and 102.6/100 000, respectively. breast cancer is the first leading cause of death of malignant cancer in young europeans 28.8%, ant the incidence increases. in united states the invasive bc is diagnosed in approximately 11 000 females under 40, which stands for 4.74.9% of all patients with the diagnosis of breast cancer [3, 4 ]. data presented by the central cancer registry in korea showed that in 2011 breast cancer was diagnosed in 13.2% of patients under 40, and 4.7% of patients were younger than 35. the incidence differs up to 4-fold depending on the region of the world and is associated with the ethnic origin of patients. afro - american females under 35 are twice as more endangered by invasive breast cancer as white females, and the clinical course of the disease is aggressive. the highest incidence ratios were denoted in australia, north america and europe, and the lowest in asia and in the near east (table 1). the estimated incidence of breast cancer in women in the world in 2012 in poland, 14 649 new cases of breast cancer were registered in females aged between 15 and 44 years in decade 20012011. during the analyzed period of time the increase was confirmed by crude and standardized incidence ratios analysis : in 2002 the respective numbers were 12.5/100 000 and 9.0/100 000, while in 2011 15.5/100 000 and 10.8/100 000 (table 2). incidence of breast cancer in poland in the years 20022011 in women under 45 years of age the aim of the study is the retrospective analysis of the incidence of malignant breast cancer in young women (under 44 year of life) in podkarpackie province in 20022011. in the presented study the population of young patients involved women diagnosed with breast cancer before 44 year of life. there is no clear - cut definition of the term young patient in the available scientific literature. most commonly the term young was used for females before 35 years of age or for women before menopause. 614 cases of malignant cancer and 26 cases of cancer in situ diagnosed in young women (up to 44 year of age) from podkarpackie province in the years 20022011 were analysed. the crude and the standardized cancer incidence rates were estimated, the percentage of histopathologically confirmed cancer cases and the percentage share of registered malignant breast tumors in women under 45 years of age compared to all registered malignant bc cases were calculated. the analysis of incidence in individual counties was also presented, as well as the stages of clinical advancement at diagnosis and the methods of treatment. the crude ratios were calculated on the basis of the data describing actual polish population published by the central statistical office (gus). for standardized ratios the standardized world population was analyzed, as proposed by segi and modified by doll. for statistical analyses the number of registered cases at 2011 was 73, and it was 37.7% higher as compared with the year 2002. during the analyzed period of time similarly, the standardized incidence ratio in 2002 was 6.0/100 000 versus 8.4/100 000 in 2011. in general, malignant breast cancer cases stood up for 17.9% (and 3.4% in situ bcs) of all malignant cancers diagnosed in female inhabitants of podkarpackie during the years 20012011. the average percentage share of breast cancer in women under 45 years of life, in all diagnosed malignant breast cancer cases during the analyzed decade was 10.4% in invasive stage and 13.1 in in situ stage (table 3). incidence of breast cancer in podkarpackie province in the years 20022011, in women under 45 years of age the incidence of bc in women younger than 45 years in different counties of podkarpackie province was analyzed. in the years 20022011 significant differences in the studied values were observed. the highest incidence ratios were observed in przemyski county 16.9/100 000, in rzeszow 16.6/100 000 and in przemysl these ratios significantly exceeded the ratio for the whole province, which was 12.9/100 000. the lowest incidence was denoted in lubaczowski county 7.8/100 000 and przeworski county 9.2/100 000 (fig. the geographical distribution of the incidence of breast cancer in women under 45 years of age, in the podkarpackie province in the years 20022011 during the studied decade, breast cancer most commonly was diagnosed in locally advanced stage 45.8% and in regional 29.1%. most of the patients (70.3%) were treated radically, 20.0% received palliative treatment and 4.0% symptomatic treatment (fig. stage breast cancer in women 44 years of age at the time of diagnosis, in the years 20022011 the type of treatment for breast cancer in women up to 44 years of age at the time of diagnosis, in the years 20022011 in young women in the studied period the highest percent of cases was invasive ductal carcinoma 69.1%, 4). percentage of histopathological form of breast cancer in women under 45 years of age, in the podkarpackie province, in the years 20022011 additionally, 26 cases of in situ carcinoma were analyzed, which was 4.2% of malignant cancer cases registered in the years 20012011 in young women. in this study group (1544 years of age), like in the case of invasive cancer, the increase in crude and standardized incidence ratios. in 2002 similarly, the standardized incidence ratio in 2002 was 0.2/100 000, and in 2011 0.7/100 000 (table 2, fig. 5). standardized incidence ratio for invasive breast cancers and preinvasive bc, in women under 45 years of age, with the subcarpathian in 20022011 the percentage share of preinvasive breast cancer cases in all malignant cancers in the studied age group have increased by 1.4% in 2011, as compared with 2002 (table 2). breast cancer is diagnosed most commonly in females from age group of 5069 years, which is associated with the natural course of the disease (most cases occur after menopause) and the active diagnostic screening of this group. podkarpackie province is characterized by relatively low risk of bc in 2011 its incidence was the lowest in poland (standardized incidence ratio was 39.9/100 000). the highest ratios were denoted in western poland, especially in kujawsko - pomorskie province the average ratio for poland was 51.7/100 000 at that time [6, 11 ]. in poland, the highest increase of breast cancer incidence was observed during the last two decades (19902010), mainly in women after 50 years of life. similar tendency is observed in grown - up women before menopause (2049 years of age), in this age group during the last three decades the incidence of bc has increased of about 1.7 times. in the years 20022011 the increase in the number of new malignant breast cancer cases in women before 45 years of life was observed in poland and in podkarpackie province (16.6% vs. 37.7%). standardized incidence ratio during the studied decade was lower in podkarpackie province than in poland (7.2/100 000 vs. 9.4/100 000, respectively). the decrease in the number of diagnosed breast cancer in young women within the total number of registered breast cancer for poland by 1.8% was observed, and for podkarpackie province this value increased by 0.8%. during the discussed decade the cumulative risk for poland increased by 0.2%, and for podkarpackie province by 0.1%. bleyer states, that approximately 7.0% of american women with breast cancer is diagnosed before 40 ; bc stands for over than 40.0% of all cancers in this age group. survival ratios are lower as compared to older women, and multivariate analysis showed that patients younger age is an independent poor prognostic factor. in the study presented by anders and coworkers, which was focused on gene expression in two age groups (females younger than 45 and over 65 years of age), 367 genes were identified, which might differentiate tumors of young women with lesions found in women older than 65. the results confirm that breast cancer in patients before 45 is biologically different when compared to tumor diagnosed in females over 65 years of age. during the discussed period of time, 11.0% of malignant cancers were diagnosed in females older than 45. the increase in the incidence in the study group may be directly associated with changes which have occurred in female age structure between years 2001 and 2011. in 2011 in podkarpackie the increase of average 10.6 thousand in the number of women aged 25 to 39 was observed, as compared with 2002. similar situation was in poland as a whole, where the increase was of 227.6 thousand. women born during the population boom (19701989) are now at increased risk of breast cancer (figs. 6, 7). the population of the polish women < 45 years of age, in 2002 and 2011 the population of the subcarpathian women < 45 years of age, in 2002 and 2011 there is significant variation in incidence of malignant breast cancer in young women in poland. in the years 20022011 the highest incidence was denoted in wielkopolskie (11.6/100 000), zachodniopomorskie (10.3/100 000) and kujawsko - pomorskie (10.2/100 000) voivodeships. the lowest incidence was observed in podkarpackie (7.2/100 000), opolskie (7.8/100 000) and lubelskie (8.6/100 0000). there is also regional variation observed the highest incidence is typical for women residents of big towns and bieszczady region, and the lowest charcterizes population inhabiting northeast part of the voivodeship., published in the report zdrowie kobiet w polsce, the threat to life of women aged 1549 in poland after 1991 is over than 10% higher in these living in towns when compared to females living in the country. there is no data available, concerning life threats of women from podkarpackie. in podkarpackie province the percentage of cancer lesions identified at this stage was 9.8% higher in 2011 than in 2002. the increase in the number of cases diagnosed as in situ (1.2%) and disseminated disease (1.3%) was observed. it is alarming, that in young women only 4.1% of breast cancer cases is diagnosed at in situ stage, and for approximately 9% of females the first contact with the oncologist occurs when the disease is at metastatic stage. low number of cancer cases diagnosed in the preinvasive stadium may be associated with low oncologic watchfulness of both women and primary care physicians. starting from 2012 in podkarpackie province the conference it is addressed to primary care physicians and aimed on the increase of oncologic watchfulness. the belief that cancer is preserved for older people results with late diagnosis, when the tumor burden is substantial and the disease has spread to lymph nodes or to distant locations [14, 15 ]. very important for breast cancer diagnostics is physical examination (palpably), because 80% of all lesions and 37% of malignant lesions are diagnosed this way. state, that regular self - examine of breast doubles the number of biopsies not influencing the reduction of morbidity of breast cancer, so one can not unambiguously state that it is useful in the early detection of cancer lesions. screening towards breast cancer in young women is not indicated, especially by the use of mammography. who clearly points the risk associated with mammography. the high density of breast tissue with the glandular component hinders the diagnostics of breast cancer in patients before 45 years of life. in genetically predisposed woman the specialists recommend annual physical examination and diagnostic imaging of breast (sonography in young women) starting from 2025 year of life, mammography and sonography after 35, and mammography every second year for women older than 50. polish society of oncology recommends magnetic resonance imaging (mri) as the most accurate diagnostic imaging method for young women from the increased risk group. it was shown that mri has significantly better resolution as compared to sonography and mammography, but as the expensive method it is nowadays used mainly for the exclusion of breast cancer suspicion. the almost 10% increase in diagnoses at the locally advanced stage, observed in podkarpackie province, may be associated with increasing awareness of young habitants of podkarpackie and by actions carried by some local authorities which have invited all women over 20 years of age for breast sonography free of charge. in the years the number of women who participated in this program during this period of time increased of 248,3%. this confirms the enthusiasm of beneficiaries and the necessity of such prevention programs. in total, for 9 years 1010 pathologic lesions including 15 malignant cancers were identified in young women from rzeszow. the amount of financial measures expended from town budged for this purpose was equal 211 833,2 pln (table 4). data on the implementation of the prevention of breast cancer breast ultrasound, in rzeszow, in the years 20062014 bac needle aspiration biopsy while analysing the data concerning the incidence of breast cancer in podkarpackie province and in poland the substantial share of preinvasive cancers was found in young women during the discussed decade. the number of bc cases diagnosed at in situ stage in podkarpackie province was higher than in poland (13.2 vs. 10.1, respectively). there were no differences in case of invasive cancer. during the analyzed period of time in podkarpackie 70.3% of women have shown that in women before 35 years of age, in whom breast conserving therapy was applied, nine times higher risk of relapse was observed, as compared with patients after 60. yet young patients treated with radical mastectomy had no increased risk of relapse, contrary to women after 60 years of age. studies performed by bharat. confirm that the risk of breast cancer relapse in women diagnosed before 40 is 1.5 times higher than in patients diagnosed after that age. risk of relapse in women of 35 in whom breast - conserving therapy was applied is 9.2 times higher than in patients aged 65 +. in young women treated because of breast cancer there in an increased risk of the second breast cancer development. retrospective cohort studies performed in denmark on 10 356 females with breast cancer confirmed that in women younger than 35 at diagnosis there was the highest risk of developing metastases to lymph nodes (51%, p = 0.02), as compared to patients aged between 35 and 50. danish studies have also shown that in young women diagnosed at the early stage of the disease, who were not treated with cytotoxic drugs, there was higher risk of death as compared with patients from older age groups. yet patients who did not menstruate as the result of chemotherapy and ovary hormone activity suppression had better prognosis than patients menstruating normally. however, this type of the therapy is controversial because of its influence on patients fertility. the independent study, performed on 732 patients with non - metastatic breast cancer from mount sinai medical center in new york have shown that tumors in females younger than 36 years of age were characterized by longer diameter. despite the substantial progress observed in medicine, improvement in access to diagnostic procedures and increasing awareness, which among others resulted from prophylactic actions, 5-years survival rates of young polish women with breast cancer are the lowest in europe (table 5) [25, 26 ]. survival rates relative 5-year breast cancer, young women in selected european countries (20002007) the study performed in institute curie in france have shown that even if the tumor burden, lymph node status, histological grade, hormone receptor status, local treatment procedure and systemic adjuvant treatment were considered, still the relative survival ratios were the lowest in young age group. in the available bibliography there are controversial information concerning the role of oral contraception (oc) in breast cancer development induction in young patients. more than 45 millions of american women have used oc, and 10.7 millions uses this method nowadays. the study performed by hunter. in 19892001, on the group of 116 608 nurses aged 2542 showed only slightly increased risk of cancer development in oc users 1.33%. the increase of relative risk of 3.1% was observed only in females receiving triphase preparation of levonorgestrel, which includes high doses estrogen or progesterone. the incidence of breast cancer is also observed in pregnant women, occuring in 1/3000 1/10 000 cases, which is approximately 3% of all breast cancer cases. the physiologic changes within breast during gestation result in diagnosis delay of 57 months. however, the probability of metastases identification increases, it is approximately 2.5 times higher in pregnant woman as compared to the whole female population, and the presence of metastases to regional lymph nodes manifests in as many as 60% of cases. genetic predispositions, involving germinal mutations within highly penetrant genes like brca1 and brca2, is associated with the increased incidence of breast cancer in young women. it is thought that in 5.912.4% patients younger than 35 and in 11.617% patients before 40 years of age, there is a mutation of brca1 or brca2. in females over 40 mutations are found in 1.2% to 6.1%. in selected ethnic groups, i.e. ashkenazi jews, malone and coworkers state that breast cancer diagnosed before 35 years of age with high probability indicates brca1/2 mutations and tp53 mutations. in control studies they estimated, that 9.4% of breast cancer patients diagnosed before 35 were the carriers of brca1/2 mutation. the numbers are even higher in the case of familial predisposition to breast and ovarian cancer, and in women of ashkenazi jewish origin. no matter the age of a patient and the reason of malignant cancer, such diagnosis is always a great shock for women, and carries serious medical, social, psychic and sxual consequences. for young women the aim of this organization is to increase awareness and to guarantee financial measures for treatment of females younger than 40 years of age. with the help of coalition young patients may track the local support groups and participate in programs aimed on the reduction of sense of isolation and alienation from the society. in conclusion, the incidence of malignant breast cancer in podkarpackie still increases, albeit voivodeship is the region characterized by the lowest risk of developing breast cancer. despite the progress in diagnostics and treatment it is relevant to carry the information actions among women and health professionals to let them know that breast cancer may affect young women. the interest in preventive medical examination towards breast cancer was observed in young women from podkarpackie province. intensified clinical analysis of young women with breast cancer high incidence ratios among young women may reflect the lack of routine screening in this age group, which is not enrolled into breast screening plan. | introductionbreast cancer (bc) in young women of podkarpackie province accounts for approximately 11.0% of all diagnosed breast tumors.aim of the studyaim of the study was to assess the trends in incidence of bc among women younger than 44 from podkarpackie in the years 20022011.material and methods614 cases of malignant bc and 26 cases of cancer in situ were analyzed. the crude and the standardized incidence ratios were estimated ; the percentage of histopathologically confirmed cancer cases and the percentage share of registered malignant breast tumors were calculated. the analysis of incidence in individual counties was also presented, as well as the stages of clinical advancement at diagnosis and the methods of treatment.resultsthe number of registered cases at 2011 was 73, and it was 37.7% higher as compared to 2002. during the period analyzed, the increase in the crude and the standardized cancer incidence ratios was observed. the percentage share of bc in the examined group increased of 5.4% in 2011. significant variation in incidence among different counties was observed. the incidence ratios ranged from 65.8 to 93.1/100 000. bc in young women most commonly was diagnosed as locally advanced and over 70% of patients were radically treated.conclusionseven though the progress in diagnostics and treatment has been made, bc in young women is diagnosed later than it should be and at considerably advanced stage. it is relevant to propagate the knowledge among women and health professionals to emphasize that bc may affect young women. |
monomeric human topoisomerase 1b (top1) regulates dna topology throughout key cellular events such as dna replication and gene transcription. eukaryotic top1 relaxes both positively and negatively supercoiled dna and is an established anticancer drug target (its inhibition initiates apoptosis and hence tumor regression). recent single - molecule nanomanipulation and molecular dynamics studies of top1 in the presence and absence of inhibitors and the originally proposed catalytic cycle of top1 may be used to construct a current view of the enzyme s four - step cycle (figure 1). drugs that block top1 fall into two distinct classes : (1) well - characterized interfacial poisons (ifps) and (2) less common catalytic inhibitor compounds (cics). currently, all dna - intercalating ifps arrest dna strand religation by non - covalent binding at the nick site of the top1dna cleavage complex, poisoning the enzyme midcycle. known ifps include camptothecin (cpt) and its analogues and synthetic compounds, e.g., indolocarbazoles, indenoisoquinolines, dibenzonaphthyridones, and aromathecins. some minor - groove binders that engage top1 s dna substrate below the nick site, e.g., hoechst 33258 and 33342, prevent strand religation and are non - interfacial top1 poisons. the rational design of new ifps and conceptual understanding of how established ifps work is underpinned by x - ray data for the dna cics may operate by blocking two key steps in the enzyme s catalytic cycle : substrate binding or covalent cleavage complex formation. compounds inhibiting the first step (cic1) are either conventional competitive inhibitors (binding to top1) or unconventional competitive inhibitors (binding to dna). examples of the former are unknown, but unconventional competitive inhibitors exist and are either dna intercalators or minor groove binders or both. step 2 catalytic inhibitors (cic2) are currently rather obscure ; one recently described indolizinoquinoline-5,12-dione derivative, cy13i, possibly fits this descriptor. of relevance to this study, dna - binding au porphyrins were classified as top1 catalytic inhibitors, while other au complexes were initially misassigned as top1 ifps and hence reclassified as catalytic inhibitors. the correct assignment of a compound s mechanism of action (moa) with top1 is not straightforward. the inherent problem is that inhibition of supercoiled dna relaxation by top1 alone does not distinguish between the actions of cics and ifps nor does it distinguish between conventional and unconventional competitive inhibition. since cic s do not trap top1-nicked dna, dna damage by this class of compounds is likely to be lower than that caused by ifps. the paucity of top1 cics coupled with their anticipated reduced genotoxicity relative to ifps creates significant opportunities for drug discovery. here we report on a new class of cytotoxic macrocyclic au top1 cics (figure 1) and precise delineation of the moa of the lead compound, 3. (a) illustration of key events in the catalytic cycle of human top1. step 1 : top1 binds supercoiled dna (scdna ; 5-ta-3 dinucleotide pair as target). step 2 : nucleophilic attack of the 3-phosphate linking the ta pair (scissile strand) by y723 (catalytic tyrosine residue) affords a covalent dna step 3 : the intrinsic torque stored in scdna drives ratchet - like rotation about the non - scissile strand until strand religation occurs with concomitant release of y723. the relaxed dna (rdna) is then released by the enzyme in step 4. interfacial poisons (ifps) such as camptothecin (cpt) bind the nick site via 5-ta-3 intercalation and h - bonding to top1 to form a ternary drugscdna cics operate differently by either blocking substrate recognition by top1 (type 1 competitive inhibitor, cic1) or, in principle, preventing the formation of the covalent cleavage complex by blocking the nucleophilic attack of the scissile strand by y723 (type 2 competitive inhibitor, cic2). (b) structures of new cytotoxic pyrrole - based au macrocycles 15, free base macrocycle 6, and the ni analogue of 1, compound 7. compounds 15 reflect a design evolution over our recently patented class of cytotoxic bis(pyrrolide - imine) au chelates. specifically, we have employed macrocycles to enhance the redox and chemical stability of the metal ion in conjunction with a quinoxaline ring to augment dna intercalation. direct metalation of the macrocycle (route a, figure s2) was only successful for 1 and 5 (i.e., those macrocycles bridged by a propyl chain). for compounds 24 with slightly more elaborate alkyl groups linking the imine nitrogen atoms, a metal - templated cyclization had to be employed (route b). more specifically, the diamine bridge required to effect cyclization of the macrocycle was added after au - binding by the bis(pyrrole - aldehyde) precursor. (although uncommon, au ions reportedly template aldehyde and amine condensations.) we were able to elucidate the structures of compounds 1, 2b, and 3 by single crystal x - ray diffraction (table s1) despite the ordinarily challenging morphology of the crystals (fine, brick - red needles). because of the high degree of similitude in the structures of 13, particularly the au ion coordination geometry and macrocycle conformation and the appreciable cytotoxicity of 3 (vide infra), the following discussion is illustrated with selected, typical ion pairs from the asymmetric unit of 3 (figure 2). the au ions in salts 1, 2b, and 3 are nominally square planar with au the au npyrrole distances average 1.98(3) for all nine cations and are 1.5% shorter than the au nimine bonds, which average 2.01(6) (table s2). this reflects the fact that the pyrrole groups are anionic -donors with more acute c n c angles than the corresponding c = n c angles of the imine donors. the coordination group distances are comparable to those of other au complexes (au n : 1.9282.216). the average npyrrole au npyrrole and nimine au nimine bond angles for the propyl - bridged systems 1 and 2b are 99.6(8) and 96.5(5), respectively. for the six independent cations of 3, these angles average 97.1(9) and 99.2(6). the larger seven - membered chelate ring of 3 accounts for the somewhat more obtuse mean nimine au nimine bond angle. the cation conformations of 13 deviate mildly from planarity mainly in response to crystal packing constraints. in each structure, the cations form -stacked dimers with head - to - tail (figure 2) or oblique geometries (figures s8s14) characterized by interplanar spacings of 3.4, as found in other -stacked polyaromatic compounds. there are no aurophilic auau contacts between cations (auau distances > 5). the au macrocycle pairs within dimers of 13 exhibit overlaps ranging from 74% in 3 to 89% in 1. importantly, the -stacking proclivity of the cations highlights their potential as dna intercalators. view of the x - ray structure (100 k) of two of six independent ion pairs from salt 3 (50% thermal ellipsoids for non - h atoms ; h atoms are shown as capped cylinders). atom color code : gray, c ; lilac, n ; orange, p ; green, f ; gold, au ; pale blue, h. crystallographic details for 1, 2b, and 3 are given in the supporting information. selected mean bond distances () and angles () for all six independent cations of 3 : au npyrrole, 1.98(1) ; au nimine, 2.02(2) ; c = nimine, 1.30(3) ; npyrrole au the mean plane separation (3.4) reflects notable -stacking for both the head - to - tail and oblique dimers of 3. the affinity constants, ka, for non - covalent binding of 15 to calf - thymus dna (ctdna) were determined by fluorometric titrations involving the displacement of intercalated ethidium bromide (eb, figure 3a). from the loss of eb fluorescence (614 nm) with increasing concentration of 15, ka values ranging from 2 10 to 4 10 m bp were obtained and are similar in magnitude to that reported for a gold(iii) porphyrin (3 10 m bp). the ka values for 15 showed no independent linear correlation with either the steric bulk of the macrocycle s alkyl bridge or the lipophilicity of the cation. however, analysis of ka as a function of both variables concurrently (figure 3b) gives a significant three - dimensional bivariate linear correlation and confirms that cations with a small alkyl bridge and high lipophilicity, e.g. 5, exhibit the highest ka values. the correlation itself suggests that 15 are dna intercalators since not only are the ka values determined by competitive displacement of a known dna intercalator (eb) but also the monotonic increase in ka with increasing lipophilicity of the compounds clearly reflects binding principally within the relatively non - polar intrahelical space of the duplex dna target (i.e., between -stacked bases). to confirm the intercalation data and examine possible roles for the metal ion, electrophoretic mobility shift assays (emsas), thermal denaturation, and dna unwinding experiments were carried out. regarding the first of these tests, figure 3c shows that 1 induces a greater mobility shift for a plasmid substrate (phot1, lanes 59) than the archetypal reference compound for dna intercalation (eb, lanes 24), despite the comparable ctdna affinity constants for the two compounds (eb, ka = 5(1) 10 m bp ; compound 1, ka = 4.0(4) 10 m bp). the large mobility shift induced by 1 note that supercoiled plasmid dna is affected most upon binding of 1 (figure 3d), as evidenced by the 11% mobility shift relative to nicked - open circular dna (noc dna, 5% shift) and very marked band broadening apparent at a concentration of only 5 m (lane 7). in the case of a negatively supercoiled plasmid with intact double strands, the linking number describing the dna topology, lk, must remain constant irrespective of the extent of local unwinding (i.e., change in twist, tw) induced by the intercalator. to keep lk constant, wr, which reflects supercoiling of the plasmid, must adjust according to eq 1:1for au macrocycle 1, intercalation of negatively supercoiled phot1 is expected to reduce the number of supercoils and thus the macromolecule s supercoil density, thereby significantly impeding its mobility in the gel matrix (as observed). the three - dimensional plot displayed in figure 3d further highlights the dna distribution with increasing in lanes 58 and specifically emphasizes the appearance of a third, non - migratory form of dna (form iii, lanes 7 and 8). two possible explanations for the appearance of this immobile dna species at higher concentrations of 1 are : (i) aggregation of the dna1 adduct(s) occurs, trapping the dna in the well, or (ii) full charge - neutralization of the dna takes place. however, the latter explanation seems unlikely since each adjacent dinucleotide pair in dsdna is bridged by two phosphate groups, each with a formal charge of 1. intercalation of a monocationic intercalator can thus only neutralize 50% of the total charge on the dna duplex even if every adjacent dinucleotide pair non - covalently binds to one au macrocycle, which is improbable. finally, the apparent disappearance of the dna in lane 9 (= 50 m) signals either reverse migration of all dna1 adducts or complete saturation of the eb binding sites by 1 so that staining of the gel for dna visualization is ineffective. the latter explanation is the more likely given that formation of a cationic dna1 adduct (as would be required for reverse migration of the dna) is physically highly improbable. (a) displacement of intercalated eb from ctdna by 3 studied by emission spectroscopy (298 k, ph 7.0, 15% dmso - tris / hcl buffer, 15 m ctdna, 15 m eb). inset : determination of at 50% loss of eb fluorescence (c50) ; c50 is used to determine the ctdna affinity constant, ka, of 3. (b) graph of ka for 1, 2a, and 35 as a function of the steric bulk of the macrocycle s alkyl bridge and the hydrophobicity of the au complex, log(po / w) (table s3). the surface is the best - fit bivariate linear regression function to the data. (c) emsa of selected compounds with supercoiled (sc, form i) phot1 plasmid dna (dna, 31.3 ng / well ; tbe buffer, ph 7.8) ; some nicked - open circular (noc, form ii) dna is present. the lanes contain phot1 plasmid dna (lane 1), increasing concentrations of eb (lanes 24), 1 (lanes 59), 6 (lanes 1012), and 7 (lanes 1315). (d) two- and three - dimensional deconvolution of the dna bands in lanes 58 of the emsa gel shown in part (c). collectively, the emsa data for 1 reflect intercalative binding of dsdna by the au macrocycle. this conclusion was further tested by concurrent analysis of the metal - free macrocycle (compound 6) and the ni analogue of 1 (compound 7) ; neither induces a dna mobility shift nor in fact displaces eb from dna in solution. the au ion is thus obligatory for dna intercalation by 15. that association depends on the presence of au reflects electrostatic binding of the intercalator to the dna (as neither 6 nor 7 are charged) and a pivotal iondipole interaction formed between the au ion and a carbonyl oxygen atom of thymine (vide infra). because the mode of interaction of the au macrocycles with dna has to be established unambiguously to determine the mechanism of action underpinning the cytotoxicity of 2a and 3 (vide infra), we performed two additional tests that unequivocally support an intercalative dna binding mode for the compounds (figure 4). in the first experiment, thermal denaturation (melting) of a linear 291-bp dna duplex (an amplicon from exon 15 of the human actn3 gene) was studied as a function of the identity and concentration of the added compound (table s12). from figure 4a, b, the melting point, tm, increased in sigmoidal fashion with increasing concentration of 13, consistent with the enhanced thermal stability that is expected to accompany uptake of an intercalator. significantly, no change in tm was observed for 6 over the full concentration range. the values of tm (the change in melting point relative to the control) were + 4.65, + 3.90, and + 4.40 c for compounds 13, respectively, when measured at their highest concentrations (50 m). from figure 4b, the dose response function for 1 gives the saturating value of the melting point increase, tm = + 5.1(4) c. the tm values determined here are in good agreement with those reported for the metallointercalators [co(pic)2(dppz) ] (+ 4.4 c), where pic = picolinate and dppz = dipyrido[3,2-a:2,3-c]phenazine, and [ru(nh3)4(dppz) ] (+ 5.2 c) as well as organic protoberberine derivatives (+ 2.9 to + 6.4 c). other dppz - based metallointercalators, however, exhibit tm values as large as + 14 c. (a) hrm curves for a linear 291-bp dsdna fragment (ph 8.4) derived from the human actn3 gene as a function of the concentration of 1. the plot reflects the negative first derivative of the fluorescence intensity (df / dt, 510 nm) from the dna - intercalating reporter dye (cybr green) used to monitor strand separation. (b) plot of the melting temperatures, tm, against the concentrations of three au macrocycles and the metal - free macrocycle 6. the zero - slope fit for 6 has an intercept, tm, of 83.0(1) c and reflects the mean value of tm for the amplicon (since 6 does not interact with the dna). the dose response function for 1 is : tm = tm + (tm tm)/(1 + (c / ec50)), where c is the molar concentration of 1. the fit parameters were : tm = 82.95(9) c ; tm = 88.1(4) c ; ec50 = 9(2) 10 m ; p = 0.9(1) ; = 0.013 ; r = 0.996. lane 1, supercoiled phot1 plasmid dna ; lane 2, relaxed phot1 plasmid (effected by incubation with 10 units of top1 for 30 min at 37 c) ; lanes 35, increasing concentrations of the intercalator control m - amsa added to relaxed phot1 ; lanes 614, increasing concentrations of compounds 1, 7, and 6 added to relaxed phot1 as indicated. abbreviations : noc, nicked - open circular dna ; sc, supercoiled dna ; rx, relaxed ; ti, dna topoisomer bands ; m - amsa, 4-(9-acridinylamino)methanesulfon - m - anisidide. several factors will determine the measured value of tm (beyond the identity of the primary intercalating group). these include the nature of the ancillary ligands, the base sequence of the dsdna substrate (since this governs the density of binding sites for base pair - specific intercalators), the solution conditions (ph, buffers, salts), and the experimental method. the method used here evidently affords reliable data over a wide concentration range, permitting measurement of tm. however, as shown in figure 4a, some caution in evaluating the data is required at higher compound concentrations when the signal is weak (df / dt 160 s) was obtained. after flushing the chip with buffer, a solution of mtop1 and 3 (50 nm) was passed over the chip as before. no spr response was detected (baseline signal in figure 10c), consistent with fast uptake of 3 by the dna and inhibition of enzyme binding by the immobilized dna3 intercalation adduct. finally, we garnered experimental proof that 3 binds to the ta sites of the 20-bp oligonucleotide. specifically, a solution of 3 passed over the dna - embellished spr chip afforded three stepwise association response functions prior to discrete desorption of 3 (figure s50). the data reflect the presence of the three 5-ta-3 sites along the synthetic 20-bp dna duplex and the fact that each has a unique microscopic affinity constant for 3. the macroscopic kd values for 1 and 3 (table s4 and figure s53) were 2.8 and 3.4 m, respectively, broadly in accord with their ctdna affinity constants (figure 3a). importantly, 3 did not bind to mtop1 (figure s52), indicating that the enzyme is neither a primary nor a secondary target for the compound. based on the above spr data, dna binding experiments, and enzyme targeting assays, the lead compound of this study may be confidently assigned as an unconventional type 1 catalytic inhibitor of top1. going forward, it will be interesting to ascertain whether the in vitro mechanism of action for 3 applies in vivo (i.e., in a chromatin setting). although such assays exist for ifps of top1, non - emissive top1 cics such as 15, which are unsuitable for confocal microscopy, currently present several unmet challenges regarding detection of endogenous top1 inhibition within cell nuclei. in summary, we have synthesized and characterized a new class of nominally planar cationic au macrocycles that incorporate two pyrrole - imine units linked to a quinoxaline moiety on one side and an alkyl chain bridge on the opposite side. from inception, physical measurements of dna binding by the compounds indicate that they are intercalators with high affinity constants (ka > 10 m bp) for ctdna that correlate interdependently with the lipophilicity of the salt and the steric bulk of the alkyl chain bridge within the macrocycle. hierarchical cluster analysis of nci-60 cytotoxicity data for the most active compound (salt 3) indicated that 3 correlates most closely with the topoisomerase ib (top1) poison camptothecin. several topical enzyme inhibition assays were used to prove that 3 is a catalytic inhibitor (and not a poison) of top1. since catalytic inhibition of human topoisomerase ii (top2) by 3 was 2 orders of magnitude weaker than its inhibition of top1, compound 3 is a type i - specific agent. new mm parameters were developed for the sp4 force field for macromolecular simulations from the nine independent x - ray structures of the au macrocycles determined herein for parametrization. a conformational search strategy was devised to locate the lowest energy intercalation site (adjacent nucleobase pair) within a 22-bp dna duplex commonly used as a top1 substrate. the simulations showed that 3 intercalates dna at the enzyme s 5-ta-3 dinucleotide target sequence via major groove entry (the minor groove adduct being > 45 kj mol higher in energy) and that a crucial auo electrostatic interaction accounts for the observed base pair specificity. macromolecular simulations of a ternary non - covalent 3dnatop1 complex suggested that the molecular mechanism of action of dna - bound 3 is to block substrate recognition by the enzyme through steric repulsion. surface plasmon resonance studies confirmed (1) that top1 fails to bind its dna substrate in the presence of 3, (2) that 3 does not bind to top1 itself, and (3) that the base specificity of 3 deduced by the macromolecular simulations (ta) is correct. the overarching conclusion of this multifaceted study is that the most cytotoxic au macrocycle, lead compound 3, is an unconventional type 1 catalytic inhibitor of human top1. | topoisomerase ib (top1) is a key eukaryotic nuclear enzyme that regulates the topology of dna during replication and gene transcription. anticancer drugs that block top1 are either well - characterized interfacial poisons or lesser - known catalytic inhibitor compounds. here we describe a new class of cytotoxic redox - stable cationic au3 + macrocycles which, through hierarchical cluster analysis of cytotoxicity data for the lead compound, 3, were identified as either poisons or inhibitors of top1. two pivotal enzyme inhibition assays prove that the compounds are true catalytic inhibitors of top1. inhibition of human topoisomerase ii (top2) by 3 was 2 orders of magnitude weaker than its inhibition of top1, confirming that 3 is a type i - specific catalytic inhibitor. importantly, au3 + is essential for both dna intercalation and enzyme inhibition. macromolecular simulations show that 3 intercalates directly at the 5-ta-3 dinucleotide sequence targeted by top1 via crucial electrostatic interactions, which include stacking and an auo contact involving a thymine carbonyl group, resolving the ambiguity of conventional (drug binds protein) vs unconventional (drug binds substrate) catalytic inhibition of the enzyme. surface plasmon resonance studies confirm the molecular mechanism of action elucidated by the simulations. |
the physical and chemical properties of low - dimensional solid - state systems draw considerable attention, in the previous years, because of their technological importance. in particular, the properties of nanocrystals (ncs) differ from that of the corresponding bulk materials, mainly due to the additional energetic term of 0a, i.e. the product of the surface excess free energy 0 and the surface area a. this term becomes significant to change the physical and chemical properties of the ncs (with respect to the bulk material) due to the large surface / volume ratio of such systems. so, the properties of ncs bridge those of bulk materials and atomic scale systems. also, the thermodynamic properties of ncs are different from that of the corresponding bulk materials and the study of such properties acquired a fundamental relevance in the last decades [4 - 34 ] because of their applications in the field of microelectronics, solar energy utilization and nonlinear optics. for example, nowhere is the interest in the thermodynamics of materials at small dimensions than in the microelectronics industry, where transistors and metal interconnects will have tolerances of only several nanometres. one particular phenomenon of interest is, for example, the size - dependent melting point of ncs with respect to the corresponding bulk materials [4 - 11 ] : this phenomenon received considerable attention since takagi in 1954 experimentally demonstrated that ultrafine metallic ncs melt below their corresponding melting temperature. it is now known that the melting temperature of all low - dimensional solid - state systems (ncs, nanowires and nanosheets), including metallic [5 - 8 ], organic and semiconductor depends on their size. for free standing ncs, the melting temperature decreases as its size decreases, while for ncs supported on or embedded in a matrix, they can melt below or above the melting point of the corresponding bulk crystal depending on the interface structure between the ncs and the surrounding environment (the substrate or the matrix) [12 - 18 ]. if the interfaces are coherent or semi - coherent, an enhancement of the melting point is present : this phenomenon is called superheating [12 - 14,16,18 ]. otherwise, there is a depression of the melting point [16 - 18 ]. not only the melting temperature but also several thermodynamic parameters, such as cohesive energy (the energy needed to divide the crystal into isolated atoms) and vacancy formation energy (the energy to form a vacancy in the nc in thermodynamic equilibrium) of ncs have been the subject of several experimental and theoretical [18,20 - 28 ] studies. several methods have been developed and used to measure the thermodynamic properties of nanosystems (nanocalorimetry, scanning probe microscopy, transmission electron microscopy, x - ray diffraction) and different models were developed to describe the size - dependent thermodynamic properties of such systems (bols model, latent heat model, liquid drop model, surface - area - difference (sad) model, bond energy). so, the importance of the combination of experimental and theoretical works towards a complete understanding of the thermodynamic properties of free - standing, supported and embedded nano - systems is clear. in a previous experimental work, we fabricated supported / embedded au ncs on / in sio2. using high - resolution transmission electron microscopy (hr - tem) and by the inverse wulff construction, we were able to obtain the angular - dependent surface energy 0 () of the supported and embedded ncs as a function of their size. the main result of that work was that growing ncs surrounded by an isotropic environment (au in sio2) exhibit an angular and radial symmetrical surface free energy function 0 () making the surface stress tensor fij of the nc rotationally and translationally invariant : this situation determines a symmetrical equilibrium shape of the ncs. growing ncs in a non - isotropic environment (au on sio2) exhibit a surface energy 0(), that lost its angular and radial symmetry for sufficiently large sizes, determining the loss of the rotational and translational invariance of the fij and, as a consequence, a loss of symmetry in the equilibrium shape of the nc and the formation of internal defects. in the present paper, we cross our experimental data concerning the surface free energy of the au ncs supported on sio2 and embedded in sio2 with the sad theoretical model of qi for the description of the size - dependent thermodynamic properties of metallic ncs, to simulate (and so to predict) the cohesive energy, the melting temperature and the vacancy formation energy for the au ncs supported on and embedded in sio2. in particular, we compare such quantities for au ncs with the same size but supported or embedded on / in the sio2 layer finding significant differences derived from the different effects of the surrounding environment. we believe that our theoretical results can improve the understanding of the thermodynamic properties of ncs and can guide future experimental investigations. cz- silicon substrates (with resistivity) were etched in a 10% aqueous hf solution to remove the native oxide, and subsequently annealed at 1,223 k for 15 min in o2 in order to grow an uniform, 10 nm thick, amorphous sio2 layer. a 2-nm thick au film was deposited (at room temperature) by sputtering on the sio2 layer using an emitech k550x sputter coater apparatus (ar plasma, 10 pa pressure). in some samples, the au layer was covered by a 3-nm thick sio2 layer deposited (at room temperature) by sputtering using an aja rf magnetron sputtering apparatus (ar plasma, 1.3 10 pa pressure). then, the au / sio2 and sio2/au / sio2 samples were contemporary annealed in ar ambient in the 8731073 k temperature range and in the 560 min time range to obtain the growth of ncs. the samples were analyzed by hr - tem (after mechanical polishing and final ar ion milling) using a jeol 2010f energy - filtered transmission microscope (ef - tem), operating at 200 kv and equipped with a gatan image filtering apparatus. before the cross - sectional tem analyses of the samples with au on sio2, a thin sio2cap - layer (~3 nm) was deposited (by sputtering with the aja rf magnetron apparatus) on the samples in order to protect the ncs during the samples preparation. from the hr - tem images of the au ncs embedded in sio2, with diameter in the range 2 nm < d < 7 nm it is clear that they conserve an equilibrium shape symmetry (single icosahedral crystal) increasing the size. differently, the au ncs growing on sio2, belong to three different groups on the basis of their equilibrium shape and internal atomic structure, as a function of their diameterd(in the range 2 nm < d < 7 nm for our case) : group 1 : formed by ncs with a diameterd < 3 nm. they have a structure such as the au ncs in sio2, i.e. single icosahedral crystal ; group 2 : formed by ncs with a diameter 3 nm < d < 4 nm. they have an icosahedral structure characterized by twins of the (111) atomic planes ; group 3 : formed by the ncs with a radius 4 nm < d < 14 nm. they have a complicated decahedral multi - twinned (and lamellar) structure. we extracted quantitative information on the surface free energy from these ncs shape via the inverse wulff construction that gives the dependence of the step free energy on the orientation starting from the nc equilibrium shape. in fact, it is possible to construct the inverse of the free energy as the minimal surface of the wulff - construction to the shape of 1/r() : first, we identified the wulff point of the nc as the intersection point between the perpendicular bisectors of two { 111 } facets. this point was taken as the centre of a polar plot, with angular and radial coordinates and r. for each given ray projecting from the origin of the polar plot in the angle i (measured with a 5 spacing), we searched for the perpendicular which is a tangent to the equilibrium shape. then we measured the distance ri between the wulff point and this tangent. according to the wulff relation, the value of the surface free energy for the ncs 0(i) for those orientation was obtained and the 0() plot was determined. 1 were the obtained 0(i), and are reported as normalized to the surface free energy of the (111) plane of the au (1.363 j / m,). figure 1a shows the obtained 0 () (each averaged on 10 ncs) for ncs on sio2 for different average ncs diameter : black for a nc on sio2 with mean diameter of 2.5 nm, red with mean diameter of 3.5 nm and green of 7 nm. figure 1b shows 0 () (each averaged on 10 ncs) for ncs in sio2 with the same mean size : black for a mean diameter of 2.5 nm, red with mean diameter of 3.5 nm and green of 7 nm. the nc - to - nc variation in 0() for a given orientation 1b, it is clear that growing ncs in sio2 maintain the angular dependence of their surface energy unchanged. instead, from fig. 1a, it is clear that growing ncs on sio2 undergo an evident modification of their surface free energy. the differences in 0() for ncs with same diameter but supported and embedded in sio2 are explained in terms of the angular and radial symmetry / asymmetry of the nc surface free energy corresponding to a symmetrical / asymmetrical spatial situation of the environment surrounding the nc correlated with the rotational / translational invariance of the surface stress tensor fij of the nc. in particular, in the continuation of the present work, 1. in fact, crossing such values with the theoretical model of qi for the description of the size - dependent thermodynamic properties of ncs, we are able to predict the cohesive energy, melting temperature and vacancy formation energy for the au ncs supported and embedded on / in sio2. first to continue, a comparison between our results on the surface energy of supported / embedded au ncs with respect to the work of nanda. on the surface energy of free ag nanoparticles is meaningful : they investigated the size - dependent evaporation of free ag nanoparticles by online heat treatment of size - classified aerosols at different temperatures for a particular time period. the linear relation between the evaporation temperature and the inverse of the particle size verifies the kelvin effect, and from the slope, a constant value of 7.2 j / m is obtained for the surface energy of free ag nanoparticles, higher than that of the bulk one (1.0651.54 j / m). free ag nanoparticles of diameter ~1416 nm and, for such a system, a constant value of surface energy between 5 and 6 times higher than the bulk value was inferred. in our case, the au nanoparticles have a diameter in the range of 114 nm and they are supported on a substrate (sio2) or embedded in a matrix (sio2). and, as recognized also by nanda, the nanoparticle surrounding environment interaction strongly affects the surface energy value. as expected, also for the au nanoparticles supported or embedded on / in sio2 a higher value of the surface energy with respect to the bulk one was evaluated, but only between 1 and 1.18 times higher (see fig. 1). in particular, for the same size, higher values were found for the nanoparticles embedded in sio2 (11.18 times higher than the bulk value, fig. 1b) with respect to the nanoparticles supported on sio2 (11.16 times higher than the bulk value, fig. (a) experimental wulff plot (0()) for the au ncs on sio2 : black, red and green points refer to nc with diameter of d = 2.5, 3.5, 7 nm, respectively ; (b) experimental wulff plot (0()) for the au ncs in sio2 : black, red and green points refer to nc with diameter ofd = 2.5, 3.5, 7 nm, respectively qi. developed a sad model to describe the thermodynamic properties of metallic ncs and several experimental confirmations of the model were presented. this model is based on the knowledge of the surface (or interface) free energy of the nc to simulate size - dependent thermodynamic properties of the nc such as cohesive energy, melting temperature and vacancy energy formation. the cohesive energy is an important physical quantity that accounts for the bond strength of a solid, which equals the energy needed to divide the solid into isolated atoms by breaking all the bonds. it is also a fundamental quantity in determining other important thermodynamic properties such as the melting temperature of the solid and the vacancy formation energy. the cohesive energy of a bulk crystal is constant at a given temperature, because of the small surface to volume ratio. but the experimental size - dependence of the cohesive energy for low - dimensional systems for mo and w ncs was reported for the first time in 2002, while the size - dependence of the melting temperature has been known already for a long time. also, the vacancy formation energy is size - dependent in low - dimensional systems. vacancies are very important defects in materials, and have a remarkable effect on the physics of materials, such as electrical resistance and heat capacity. therefore, the importance of knowing its dependence on the ncs size is clear. the sad model developed by qi. describes the size - dependent cohesive energy, melting temperature and vacancy energy formation for low - dimensional systems in an excellent way. therefore, our aim is to implement such a model with our experimental data on the surface free energy of supported and embedded au ncs on / in sio2 to simulate (i.e. to predict) their cohesive energy, melting temperature and vacancy formation energy as a function of the surface free energy and size. to this aim, we recall briefly the results of the model, whose extensive description can be found in. we name ecb, tmb, evb the cohesive energy, the melting temperature and the vacancy formation energy, respectively, of the bulk solid. ecnc, tmnc, evnc those of the nc (0-dimensional system), which depend on the diameter d by the formulas:(1)(2)(3) in these formulas, we have and. 0 is the surface free energy of the crystal per unit area (j / m) at 0 k. i is the interface energy (per unit area) between the crystal and the surrounding matrix. m is the surface energy (per unit area) of the surrounding matrix at 0 k. is a parameter that describes the coherence between the crystal and the matrix. q = 1 describes the case of a completely coherent interface, q = 0.5 a semi - coherent interface, q = 0 the non - coherent interface (is the same as that of the crystal with the free surface). the parameter is a shape factor : it accounts for the shape difference between spherical and non - spherical ncs. it is defined as the ratio of surface area between non - spherical and spherical ncs in an identical volume. for spherical ncs, a = 1. equations 13 with the appropriate values of describe very well the size - dependent cohesive energy, melting temperature and vacancy formation energy of ncs and they are used to predict such thermodynamic quantities for several low - dimensional solid - state systems. 13 in this work in connection with the experimental data on the surface free energy of au ncs on and in sio2 (fig. 1) to simulate ecnc, tmnc, evnc as a function of 0 (i) and d for the supported and embedded ncs. for the simulation routines, we fix in eqs. 13 three different ncs sizes : d = 2.5, 3.5, 7 nm both for the au ncs on and in sio2. the shape factor for regular polyhedral ncs ranges from 1 to 1.49, so that for the present calculations the mean value of 1.245 is chosen. is computed for a cubic crystal (au has a fcc structure) as with as the au lattice parameter. it is known that the surface energy of small index of the surface plane may be lower than that of the large index of the surface plane, and as a result the surface with small index may have low total energy, which means that the crystal with the small index plane may be more stable. this is surely true for the au ncs on and in sio2 that are surrounded by { 100 } crystal planes. it is known that the au ncs on sio2 are of a strong non - wetting nature, with a very high contact angle ; therefore the au / sio2 interface is surely a very small fraction of the entire au surface. as a consequence, for the specific calculations, we assume q = 0.1 for the case of au ncs on sio2, while for the case of au in sio2, we assume q = 1(coherent interface). finally, about the au bulk values we fix :,,. using these values, and the eqs. 13, for each values of 0(i) the resulting values of ecnctmncevnc were obtained for the au ncs on and in sio2 for the fixed values of sizes. black, red and green points refer to the calculated values of the cohesive energy (as a function of 0 ()) for au ncs on sio2 with diameter ofd = 2.5, 3.5, 7 nm, respectively. blue, cyan and magenta points refer to the calculated values of the cohesive energy (as a function of0()) for au ncs in sio2with diameter ofd = 2.5, 3.5, 7 nm, respectively. the calculations are performed using,,, q = 0.1 for the au ncs on sio2 and q = 1 for the au ncs in sio2 figure 2 reports the results for the cohesive energy simulations : black, red and green points indicate the calculations for the cohesive energy, as a function of the surface free energy 0(), for au ncs supported on sio2 with diameter ofd = 2.5 nm, d = 3.5 nm, d = 7 nm, respectively ; blue, cyan and magenta points indicate the calculated values for au ncs embedded in sio2with diameter ofd = 2.5, 3.5, 7 nm, respectively. figure 3reports the results for the melting temperature simulations : black, red and green points indicate the calculations for the melting temperature, as a function of the surface free energy 0(), for au ncs supported on sio2 with diameter ofd = 2.5, 3.5, 7 nm, respectively ; blue, cyan and magenta points indicate the calculated values for au ncs embedded in sio2 with diameter ofd = 2.5, 3.5, 7 nm, respectively. black, red and green points refer to the calculated values of the melting temperature (as a function of 0()) for au ncs on sio2with diameter ofd = 2.5, 3.5, 7 nm, respectively. blue, cyan and magenta points refer to the calculated values of the melting temperature (as a function of 0()) for au ncs in sio2with diameter ofd = 2.5, 3.5, 7 nm, respectively. the calculations are performed using,,, q = 0.1 for the au ncs on sio2 and q = 1 for the au ncs in sio2 figure 4 reports the results for the vacancy formation energy simulations : black, red and green points indicate the calculations for the vacancy formation energy, as a function of the surface free energy 0(), for au ncs supported on sio2 with diameter of d = 2.5, 3.5, 7 nm, respectively ; blue, cyan and magenta points indicate the calculated values for au ncs embedded in sio2 with diameter of d = 2.5, 3.5, 7 nm, respectively. our calculations predict higher cohesive energy, melting temperature and vacancy formation energy, at equal sizes, for the au ncs embedded in sio2 with respect to those supported on sio2. furthermore, while the cohesive energy, melting temperature and vacancy formation energy are almost constant for the au ncs on sio2 (the value increases by increasing the ncs size, tending to the melting temperature of the bulk au) as a function of 0(), they show a slightly decrease for the au in sio2. furthermore, it is worth to observe that for the smaller au ncs embedded in sio2 exist a range of 0() values for which ecnctmncevnc assume values greater than that of the respective bulk values. this phenomenon is due to the coherent interface between the ncs and the matrix. in the case of the melting temperature, this phenomenon is known as superheating and it is experimentally verified for some embedded small metallic ncs [12 - 14,16,18 ]. in addiction, our calculations show that the cohesive energy, melting temperature and vacancy formation energy for embedded ncs, not only depend on ncs size d on the index { hkl } of the interface plane, but also on the direction by the direction dependent interface energy 0(). this means that, for example, embedded ncs melt preferentially along specific directions (i.e. specific crystal planes) or, also, that it is easier to generate vacancy in the ncs along specific atomic planes with respect to the other planes. black, red and green points refer to the calculated values of the vacancy formation energy (as a function of0()) for au ncs on sio2 with diameter of d = 2.5, 3.5, 7 nm, respectively. blue, cyan and magenta points refer to the calculated values of the vacancy formation energy (as a function of 0()) for au ncs in sio2with diameter ofd = 2.5, 3.5, 7 nm, respectively. the calculations are performed using,,, q = 0.1 for the au ncs on sio2 and q = 1 for the au ncs in sio2 in this paper, we reported the calculations of the cohesive energy, melting temperature and vacancy formation energy for au ncs supported on sio2 and embedded in sio2 for different diameters (d = 2.5, 3.5, 7 nm) as a function of the ncs surface (interface) free energy. the calculations were performed by implementing our experimental data concerning the surface (interface) free energy 0 () in the sad model developed by qi. for the description of the size - dependent thermodynamic properties of low - dimensional solid - state systems. some differences in the thermodynamic behaviour of au ncs supported and embedded on / in sio2 are found : (1) for the au ncs on sio2, the cohesive energy, melting temperature and vacancy formation energy are almost constant with 0 () ; (2) the constant values of the cohesive energy, melting temperature and vacancy formation energy for the au ncs on sio2 increase when the ncs size increases, tending to the values of the bulk au ; (3) for the au ncs in sio2, the cohesive energy, melting temperature and vacancy formation energy decrease when 0 () increases ; (4) the constant values of the cohesive energy, melting temperature and vacancy formation energy for the au ncs in sio2 increase when the ncs size increases ; (5) for the smaller ncs in sio2, in correspondence of opportune small values of 0(), the values of the cohesive energy, melting temperature and vacancy formation energy are greater than the bulk values. | we report on the calculations of the cohesive energy, melting temperature and vacancy formation energy for au nanocrystals with different size supported on and embedded in sio2. the calculations are performed crossing our previous data on the surface free energy of the supported and embedded nanocrystals with the theoretical surface - area - difference model developed by w. h. qi for the description of the size - dependent thermodynamics properties of low - dimensional solid - state systems. such calculations are employed as a function of the nanocrystals size and surface energy. for nanocrystals supported on sio2, as results of the calculations, we obtain, for a fixed nanocrystal size, an almost constant cohesive energy, melting temperature and vacancy formation energy as a function of their surface energy ; instead, for those embedded in sio2, they decreases when the nanocrystal surface free energy increases. furthermore, the cohesive energy, melting temperature and vacancy formation energy increase when the nanocrystal size increases : for the nanocrystals on sio2, they tend to the values of the bulk au ; for the nanocrystals in sio2 in correspondence to sufficiently small values of their surface energy, they are greater than the bulk values. in the case of the melting temperature, this phenomenon corresponds to the experimentally well - known superheating process. |
five subjects who were diagnosed with csc were recruited for this study at the medical college of wisconsin (milwaukee, wi, usa). informed consent was obtained from all subjects after explanation of the nature and possible consequences of the study. the study protocol was approved by the institutional review board at the medical college of wisconsin and was conducted in accordance with the tenets of the declaration of helsinki. patients were diagnosed by clinical examination, fluorescein angiography, autofluorescence imaging, and sd - oct. axial length measurements were obtained on all subjects (zeiss iol master ; carl zeiss meditec, dublin, ca, usa) to determine the scale of retinal images. images were obtained using a bioptigen sd - oct (bioptigen, research triangle park, nc, usa). horizontal and vertical line scan sets were acquired (640 a - scans / b - scan ; 120 repeated b - scans) through the foveal center with a nominal scan length of 7 mm. scans were registered and averaged as described previously to increase the signal - to - noise ratio. volume scans (640 a - scans / b - scan ; 400 b - scans / volume) were acquired over a nominal 3 3 mm area with horizontal and vertical b - scans. each b - scan within the volume scan was aligned and manually segmented to create en face views as described previously. en face oct images were generated for the onl, elm, and ez, each using a thin contour to avoid contamination from other layers of the retina and create the highest - contrast image. active csc was defined as the presence of subretinal fluid on oct, while resolved csc was defined as the resolution of fluid and reattachment of the retina. a custom aoslo system was used for this study, which was modified to simultaneously acquire confocal and split - detector images. imaging sequences consisted of 150 frames, which were processed to remove distortions from the sinusoidal scanning motion and then registered using a strip registration method described previously. up to 40 registered frames with the highest normalized cross - correlation then were averaged to increase the signal - to - noise ratio. because the confocal and split - detector images were collected in synchrony, the same registration transforms were applied to both, resulting in perfect spatial registration. these images then were montaged using adobe photoshop (adobe systems, san jose, ca, usa). at each imaging session, the main region of interest was captured with a set of at least nine images, each with a 1.0 field of view. temporal and superior strips also were acquired, which extended 5 to 10 peripherally from the region of interest using images with a 1.5 or 2.0 field of view. cluster location was determined after manual coregistration of the aoslo montage and en face oct images using adobe photoshop. the greatest linear dimension of each hyperreflective cluster was measured manually on the aoslo image. clusters located in the outer retina were included for analysis if they were in focus on confocal aoslo and corresponded to the location of hyperreflective foci in the onl on en face oct. in the inner retina, clusters were included for analysis if they were in focus in the plane of the retinal capillaries. five subjects who were diagnosed with csc were recruited for this study at the medical college of wisconsin (milwaukee, wi, usa). informed consent was obtained from all subjects after explanation of the nature and possible consequences of the study. the study protocol was approved by the institutional review board at the medical college of wisconsin and was conducted in accordance with the tenets of the declaration of helsinki. patients were diagnosed by clinical examination, fluorescein angiography, autofluorescence imaging, and sd - oct. axial length measurements were obtained on all subjects (zeiss iol master ; carl zeiss meditec, dublin, ca, usa) to determine the scale of retinal images. images were obtained using a bioptigen sd - oct (bioptigen, research triangle park, nc, usa). horizontal and vertical line scan sets were acquired (640 a - scans / b - scan ; 120 repeated b - scans) through the foveal center with a nominal scan length of 7 mm. scans were registered and averaged as described previously to increase the signal - to - noise ratio. volume scans (640 a - scans / b - scan ; 400 b - scans / volume) were acquired over a nominal 3 3 mm area with horizontal and vertical b - scans. each b - scan within the volume scan was aligned and manually segmented to create en face views as described previously. en face oct images were generated for the onl, elm, and ez, each using a thin contour to avoid contamination from other layers of the retina and create the highest - contrast image. active csc was defined as the presence of subretinal fluid on oct, while resolved csc was defined as the resolution of fluid and reattachment of the retina. a custom aoslo system was used for this study, which was modified to simultaneously acquire confocal and split - detector images. imaging sequences consisted of 150 frames, which were processed to remove distortions from the sinusoidal scanning motion and then registered using a strip registration method described previously. up to 40 registered frames with the highest normalized cross - correlation then were averaged to increase the signal - to - noise ratio. because the confocal and split - detector images were collected in synchrony, the same registration transforms were applied to both, resulting in perfect spatial registration. these images then were montaged using adobe photoshop (adobe systems, san jose, ca, usa). at each imaging session, the main region of interest was captured with a set of at least nine images, each with a 1.0 field of view. temporal and superior strips also were acquired, which extended 5 to 10 peripherally from the region of interest using images with a 1.5 or 2.0 field of view. cluster location was determined after manual coregistration of the aoslo montage and en face oct images using adobe photoshop. the greatest linear dimension of each hyperreflective cluster was measured manually on the aoslo image. clusters located in the outer retina were included for analysis if they were in focus on confocal aoslo and corresponded to the location of hyperreflective foci in the onl on en face oct. in the inner retina, clusters were included for analysis if they were in focus in the plane of the retinal capillaries. the first two sessions took place during active csc, and the final two sessions took place during resolved csc. the first imaging session took place 1 month after diagnosis, and the final imaging session took place 13 months after diagnosis. this subject also underwent inner retinal imaging during all sessions and split - detector aoslo imaging during the final session. the first imaging session took place 9 months after diagnosis during active but improving disease, and the final imaging session took place 14 months after diagnosis during resolved csc.. subjects dw_1175 and dw_1178 each underwent one imaging session with active and resolved csc, respectively. clusters found in active csc over areas of subretinal fluid were located primarily in the onl, but also were seen within the elm and ez (fig. these clusters were surrounded by dark areas or defects in the photoreceptor mosaic, which corresponded with hyporeflectivity of the ez on oct (fig. the mean size of the clusters (n = 170) within the detached retina, as measured by greatest linear dimension, was 24.7 7.6 m. multimodal imaging of active csc in subjects jk_1190 (top row), dw_1227 (middle row), and dw_1175 (bottom row). optical coherence tomography line scans show hyperreflective foci (arrows) primarily in the onl. (b13) en face oct images of the onl show numerous hyperreflective foci within that layer. (c13) enlarged en face oct images corresponding to the location of the rectangles in (b13). (d13) confocal aoslo at the location of (c13) shows type-1 hyperreflective clusters with associated dark areas in the photoreceptor mosaic. the clusters seen with aoslo correspond to the location of the hyperreflective foci on en face oct. scale bars : 150 m (a13) and 50 m (c13, d13) colored boxes are added to compare given regions between different imaging modalities and retinal layers. (a) confocal aoslo montage overlaid onto an infrared reflectance slo image shows type-1 hyperreflective clusters with associated dark areas in the photoreceptor mosaic. (b) optical coherence tomography line scan at the location of the horizontal line in (a) with manual segmentation of the onl (yellow), elm (magenta), and ez (cyan). (c d) en face oct images of the onl (c), elm (d), and ez (e) corresponding to the location of the colored bands in (b). the horizontal lines represent the location of the oct line scan in (b). many of the hyperreflective clusters in (a) are seen as hyperreflective foci in the onl (c), as well as the elm (d) and ez (e). the dark areas associated with the clusters in (a) are seen as areas of ez disruption (e). clusters within areas of the retina that had reattached also were located primarily in the onl (fig. 3). many of these clusters remained stable in location throughout an 8-month follow - up period (fig. the mean size of these clusters, as measured by greatest linear dimension, was 19.9 6.0 m (n = 28). these clusters also were associated with dark areas in the photoreceptor mosaic that correspond to areas of ez disruption ; however, the dark areas were smaller than those associated with clusters within detached retina. split - detector images were collected during the final imaging session with subject jk_1190 during resolved csc. this imaging modality showed that the dark areas seen with confocal aoslo contain photoreceptor inner segments (fig. multimodal imaging of resolved csc in subjects jk_1190 (top row) and dw_1227 (bottom row). (b12) en face oct images of the onl show hyperreflective foci within that layer. (c12) enlarged en face oct images corresponding to the location of the rectangles in (b12). (d12) confocal aoslo at the location of (c12) shows type-2 hyperreflective clusters (d1) or the corresponding dark areas in the photoreceptor mosaic (d2), depending on the level of focus. scale bars : 150 m (a12) and 50 m (c12, d12). longitudinal imaging of subject jk_1190 showing oct line scans (top row) with vertical lines representing the boundaries of the en face oct images of the onl (bottom row). imaging took place during active csc (a12) and during resolved csc 4 (b12) and 12 (c12) months later. many of the hyperreflective foci are stable in location between time points (b) and (c). (a) confocal aoslo montage of subject jk-1190 during resolved csc overlaid onto an infrared reflectance slo image with rectangles (1) and (2) corresponding to the location of insets (b1, c1) and (b2, c2), respectively. (b1 - 2) confocal aoslo shows dark areas in the photoreceptor mosaic, which correspond to the location of type-2 hyperreflective clusters (not shown). (c1 - 2) split - detector aoslo at the location of (b1 - 2) shows cone inner segments within the areas that appear dark on confocal aoslo (dashed rectangles). these clusters were smaller than the other two types of clusters with the mean greatest linear dimension being 15.3 4.1 m (n = 28). they also differed markedly from clusters in the outer retina in appearance with split - detector imaging, with the former having clearly demarcated borders (fig. the clusters along the retinal capillaries seemed more prevalent during the imaging session of active csc, compared to the two imaging sessions of resolved disease. (a) confocal aoslo image during active csc in subject jk_1190 shows type-3 clusters along the retinal capillaries (arrowheads). larger type-1 clusters in the outer retina also are visible (arrows), but are out of focus. the same area 2 (b) and 10 (c) months later, both during resolved disease, shows persistent but less prevalent clusters. (d) perivascular clusters that are faintly seen in (c) are clearly demarcated with split - detector aoslo (arrowheads). we observed multiple intraretinal hyperreflective clusters in subjects with csc using confocal and split - detector aoslo. by comparing different imaging modalities, we classified these clusters into three distinct types, which we termed type-1, type-2, and type-3 (table). types of intraretinal hyperreflective clusters and characteristics clusters in the areas of detached retina were labeled type-1 and were located primarily in the onl as demonstrated using en face oct (fig. 1). some of the hyperreflective clusters seen in the aoslo images did not have a corresponding hyperreflective focus on en face oct. these represented structures that are located outside of the contour used to generate the en face oct of the onl. moreover, the aoslo has a large depth of focus (30 m), but can not necessarily capture the entire width of the onl when the level of focus is set on the photoreceptor mosaic. this explains why some structures seen on en face oct of the onl were not visible on aoslo. it also should be noted that small distortions are present in the aoslo and en face oct images due to the scanning nature of the imaging systems and the fact that the eye moves during image acquisition. nevertheless, the overall concordance between the two imaging modalities was excellent, as demonstrated in figures 1 and 3. adaptive optics slo showed that type-1 hyperreflective clusters are associated with dark areas or defects of the photoreceptor mosaic that surrounded the individual clusters. dark areas in the photoreceptor mosaic in csc have been described previously by ooto. using aoslo and were attributed to lost or damaged cones. our study demonstrated that the dark areas tend to correspond to the areas of hyporeflectivity within the ez and also often are associated with hyperreflective clusters in the onl (fig. 1). the elm between the ez and the hyperreflective clusters did not show signs of disruption on en face oct (fig. one possibility for this finding is that the clusters cause displacement of the photoreceptor cell bodies, which is transmitted to the photoreceptor os, thereby altering the os alignment. light reflected off the retina is directionally sensitive as described by the optical stiles - crawford effect, and this effect is thought to be due to the waveguiding properties and angular tuning of individual cones. split - detector aoslo detects multiple - scattered light from photoreceptor inner segments, and enables visualization of these structures regardless of the wave - guiding status of the os. with split - detector, we have shown that some of the dark areas on confocal imaging contain cone photoreceptors (fig. the explanation for the darker areas on the split - detector images themselves is not well - established, but may be due to the subtraction of the left from right halves of the recorded nonconfocal signal in areas of small undulations of the photoreceptor inner segments. these clusters also were associated with dark areas in the photoreceptor mosaic, though they were smaller than the dark areas associated with type-1 clusters. the presence of hyperreflective clusters / foci in resolved csc contrasts with several studies, which described these structures on oct as being confined to areas of serous retinal detachment. it is likely that these studies were describing the more numerous and slightly larger type-1 clusters. unlike type-1 clusters, which seem to be transient, type-2 clusters remained stable in location. the duration of their stability will require further follow - up, but in subject jk_1190, these structures remained in the same location for 8 months (fig. 4). given this stability, these structures are less likely to be migratory cells, but could represent residual cellular debris. type-3 clusters are those that are located along the retinal capillaries in the inner retina (fig. 6). these clusters are not seen clearly on oct and to our knowledge have not been described previously in csc, likely due to their small size. shen. described increased macrophages that lined the retinal vessels and wrapped around the smaller vessels in ischemic retinas. other studies also have determined that macrophages, as well as microglia, have a role in vascular growth and regression, but with a larger contribution from macrophages. the identity and significance of the intraretinal hyperreflective clusters are currently unknown, though it is clear that type-1 and possibly type-2 hyperreflective clusters represent the intraretinal hyperreflective foci previously described on oct. others have hypothesized that intraretinal hyperreflective foci are an accumulation of proteins or lipids, activated microglia, or macrophages with phagocytized os. during retinal detachment, the microglial cell response also was highly localized to the detached areas of the retina. the aoslo features support the hypothesis that the hyperreflective foci are cellular in nature, rather than deposits of material given their discrete, granular, and demarcated appearance and consistent size. we observed multiple hyperreflective clusters in the inner and outer retina in eyes with active and resolved csc using aoslo. confocal and split - detector aoslo provides information about these structures that could not be obtained with oct alone, such as their granular appearance, size, association with retinal vessels, and relationship with the photoreceptor mosaic. this allowed us to categorize the clusters into three distinct types and provided evidence that the clusters may be cellular in nature. the combined use of en face oct with aoslo allows for precise axial and lateral localization. larger studies with longitudinal follow - up using aoslo are needed to determine the clinical significance of these clusters and their relationship to the pathogenesis and resolution of csc. | purposeto improve our understanding of central serous chorioretinopathy (csc), we performed an analysis of noninvasive, high - resolution retinal imaging in patients with active and resolved csc.methodsadaptive optics scanning light ophthalmoscopy (aoslo) and spectral - domain optical coherence tomography (sd - oct) were performed on five subjects with csc. a custom aoslo system was used to simultaneously collect confocal and split - detector images. spectral domain oct volume scans were used to create en face views of various retinal layers, which then were compared to montaged aoslo images after coregistration.resultsthree distinct types of intraretinal hyperreflective clusters were seen with aoslo. these clusters had a well - demarcated, round, and granular appearance. clusters in active csc over areas of serous retinal detachment were termed type-1. they were found primarily in the outer nuclear layer (onl) and were associated with large defects in the photoreceptor mosaic and ellipsoid zone. clusters in areas where the retina had reattached were termed type-2. they also were located primarily in the onl but showed stability in location over a period of at least 8 months. smaller clusters in the inner retina along retinal capillaries were termed type-3.conclusionsretinal imaging in csc using en face oct and aoslo allows precise localization of intraretinal structures and detection of features that can not be seen with sd - oct alone. these findings may provide greater insight into the pathophysiology of the active and resolved phases of the disease, and support the hypothesis that intraretinal hyperreflective foci on oct in csc are cellular in nature. |
hepatitis b virus (hbv) infection is one of the most important causes of death worldwide ; these infections induce chronic liver disease (1), and 400 million chronic infections have been documented (2). annually, more than a million deaths are attributed to end - stage hbv liver disease, such as decompensated liver cirrhosis and hepatocellular carcinoma (hcc). the main goal of therapy in chronic hepatitis b (chb) patients is to drive viral replication to the lowest possible level in order to halt the progression of chronic hepatitis and prevent liver failure, which occurs due to subsequent liver cirrhosis and the emergence of hcc. lamivudine (lam) and adefovir dipivoxil (adv) were among the first approved oral nucleoside analogues (na) that suppress viral replication to be used extensively due to their convenient administration and favorable tolerability (3, 4). they enhance hepatitis b e antigen (hbeag) seroconversion and can markedly reduce hbv dna levels as much as possible, ideally below the lower limit of detection of molecular assays, followed by biochemical remission, decreased necroinflammatory activity, and prevention of complications (46). to prevent recurrence of the disease, long - term polymerase inhibitor maintenance therapy often is required (7). despite the initial effect of na in suppressing hbv replication and reducing alanine aminotransferase activity being promising, the emergence of drug - resistant variants conferring reduced susceptibility to the inhibitory action of these drugs leads to a gradual loss of the benefits of antiviral treatment (8). the prevalence of resistance is in the range of 1420% annually, and it reaches as high as 70% after four years of treatment for lamivudine (9, 10). while the resistance is 0% in the first year of therapy, the resistance to adefovir increases to 29% after five years of therapy (11). therefore, adv has a favorable resistance profile and could be effective for treatment especially as a standard therapy in lam - resistant patients (12, 13). although switching from one nucleoside analogue to another that does not share the same pattern of antiviral resistance can reestablish clinical benefit, sequential monotherapy predisposes patients to multidrug resistance (14, 15), and lam - resistant patients treated short - term with adv or without overlapping lam have shown high incidence of adv resistance (1619). in many asian countries, occurrences of multidrug - resistant hbv during treatment with lam and adv have increased (15). while mutations related to lam and adv resistance are not present within the same viral genome, combining the two antiviral agents may be enough to suppress dual - resistant hbv (20). however, data are still limited concerning the long - term efficacy of adv rescue therapy, either in combination with lam or switching treatment in lam - resistant chb patients. according to the guidelines of clinical practice, a decrease in hbv dna of more than 1 log10 iu / ml from the baseline pre - treatment previous studies have been conducted using different protocols for alternate cross regimen in partially - responsive patients based on new na drugs (2225). the study group consisted of 186 chronic hbv carriers who were admitted to the tehran hepatitis network. we retrospectively selected 86 patients who partially responded to a regimen of different nucleoside analogues after 48 weeks of therapy ; we had 100 controls (no therapy). eighty - six adult patients with chronic hepatitis b with hbv dna levels above 10 copies / ml and high serum aminotransferase levels were eligible for enrollment, irrespective of their hepatitis b e antigen (hbeag) status. inclusion criteria were as follows : persistence of serum hepatitis b surface antigen for more than six months prior to antiviral therapy and experienced partial viral breakthrough, which was defined as the reappearance of serum hbv - dna using real time pcr - based assays on two or more occasions after its initial disappearance. the exclusion criteria were patients with autoimmune hepatitis, alcoholic liver disease, hepatitis c virus, hepatitis d virus or hiv markers, decompensated liver disease, organ transplantation, immunosuppressive therapy, and active use of alcoholic beverages. group i consisted of eight patients who had received lam mono therapy for an average of 48 months. group ii was composed of 30 patients who had been receiving adf mono therapy for 48 months. group iii consisted of 16 patients who previously had received lam, and, subsequently after resistance, received add - on therapy with adf for > 48 months. group iv consisted of 32 carriers who had received lam and adv in combination for > 48 months. group v was composed of 100 patients who had not received any antiviral treatments (control group). the dosage for lamivudine and adefovir dipivoxil were 100 and 10 mg per day orally, respectively. all patients were followed up every 12 weeks during their treatment with lam or adv, according to european society for the study of liver (esal) guidelines (21). the decrease in hbv dna of more than 1 log10 iu / ml was defined as partial virological response. all patients provided written, informed consent for enrollment in the study, which was approved by the institutional review board of the local ethics committee. hbv dna was extracted from 200 l of sera using a qiagen mini blood kit (purelink 96 viral rna / dna qiagen, hilden, germany) by automated extractor following the manufacturer s instructions. dna was eluted using 100 l of elution buffer and stored at 20 c. for the amplification of rt and surgafe genes, nested polymerase chain reactions were conducted in 100 and 50 l, respectively, of a mixture that contained 5 l of the extracted dna using appropriate primers as described previously (26, 27). direct sequencing of polymerase chain reaction (pcr) products was conducted in a dna sequencer (perkin elmer abi-3130xl dna sequencer, foster city, ca, usa) using 0.5 l of internal specific primers (22). genotyping was done for all sequences according to amino acid variants specifying hbv genotypes a to h within overlapped surface proteins. amino acid variations within polymerase protein were compared with reference sequences obtained from different hbv genotype and sequences from iranian isolates obtained from gen bank and ncbi. comparing to the former, any amino acid changes were defined as variants. regarding the iranian database sequences, amino acid differences were defined as the amino acid mutation frequencies were obtained by drug - resistance mutation found in individual rt domains (f, a, b, c, d and e) divided by the number of amino acid residues in that particular domain. the study group consisted of 186 chronic hbv carriers who were admitted to the tehran hepatitis network. we retrospectively selected 86 patients who partially responded to a regimen of different nucleoside analogues after 48 weeks of therapy ; we had 100 controls (no therapy). eighty - six adult patients with chronic hepatitis b with hbv dna levels above 10 copies / ml and high serum aminotransferase levels were eligible for enrollment, irrespective of their hepatitis b e antigen (hbeag) status. inclusion criteria were as follows : persistence of serum hepatitis b surface antigen for more than six months prior to antiviral therapy and experienced partial viral breakthrough, which was defined as the reappearance of serum hbv - dna using real time pcr - based assays on two or more occasions after its initial disappearance. the exclusion criteria were patients with autoimmune hepatitis, alcoholic liver disease, hepatitis c virus, hepatitis d virus or hiv markers, decompensated liver disease, organ transplantation, immunosuppressive therapy, and active use of alcoholic beverages. group i consisted of eight patients who had received lam mono therapy for an average of 48 months. group ii was composed of 30 patients who had been receiving adf mono therapy for 48 months. group iii consisted of 16 patients who previously had received lam, and, subsequently after resistance, received add - on therapy with adf for > 48 months. group iv consisted of 32 carriers who had received lam and adv in combination for > 48 months. group v was composed of 100 patients who had not received any antiviral treatments (control group). the dosage for lamivudine and adefovir dipivoxil were 100 and 10 mg per day orally, respectively. all patients were followed up every 12 weeks during their treatment with lam or adv, according to european society for the study of liver (esal) guidelines (21). the decrease in hbv dna of more than 1 log10 iu / ml was defined as partial virological response. all patients provided written, informed consent for enrollment in the study, which was approved by the institutional review board of the local ethics committee. hbv dna was extracted from 200 l of sera using a qiagen mini blood kit (purelink 96 viral rna / dna qiagen, hilden, germany) by automated extractor following the manufacturer s instructions. dna was eluted using 100 l of elution buffer and stored at 20 c. for the amplification of rt and surgafe genes, nested polymerase chain reactions were conducted in 100 and 50 l, respectively, of a mixture that contained 5 l of the extracted dna using appropriate primers as described previously (26, 27). direct sequencing of polymerase chain reaction (pcr) products was conducted in a dna sequencer (perkin elmer abi-3130xl dna sequencer, foster city, ca, usa) using 0.5 l of internal specific primers (22). genotyping was done for all sequences according to amino acid variants specifying hbv genotypes a to h within overlapped surface proteins. amino acid variations within polymerase protein were compared with reference sequences obtained from different hbv genotype and sequences from iranian isolates obtained from gen bank and ncbi. comparing to the former, any amino acid changes were defined as variants. regarding the iranian database sequences, amino acid differences were defined as the amino acid mutation frequencies were obtained by drug - resistance mutation found in individual rt domains (f, a, b, c, d and e) divided by the number of amino acid residues in that particular domain. the demographic and baseline characteristics and the mean changes of serum alt, ast, and hbv loads are shown in table 1. 64 were males (74.4%), and 22 (25.6%) were females. in the control group, 70 (70%) were males, and 30 (30%) were females. as shown in table 1, the group - i patients were older than the patients in the other groups. significant associations were found between hbv dna and ast levels among all of the groups (p 0.05). the distribution of amino acid substitutions within the main functional domain of rt (including a to e) showed significant differences between the five groups (p a > b > e > d ; group ii (adv only) : c > a > e > b > d ; group iii (adv add on) : c > a > b > e > d ; group iv (adv+lam) : c > a > d > b > e ; and group v (control) : a > c > b > d > e (p value for all domains between groups ranged from 20% (table 3). the demographic and baseline characteristics and the mean changes of serum alt, ast, and hbv loads are shown in table 1. 64 were males (74.4%), and 22 (25.6%) were females. in the control group, 70 (70%) were males, and 30 (30%) were females. as shown in table 1, the group - i patients were older than the patients in the other groups. significant associations were found between hbv dna and ast levels among all of the groups (p 0.05). the distribution of amino acid substitutions within the main functional domain of rt (including a to e) showed significant differences between the five groups (p a > b > e > d ; group ii (adv only) : c > a > e > b > d ; group iii (adv add on) : c > a > b > e > d ; group iv (adv+lam) : c > a > d > b > e ; and group v (control) : a > c > b > d > e (p value for all domains between groups ranged from 20% (table 3). this is the first report on the mutational profile of viral reverse transcriptase and overlapped surface proteins from chb patients with incomplete response who were on different treatment regimens and, subsequently, acquired viral breakthrough. in this study, in addition to lam- and adv - resistant polymerase gene mutations, a proportion of patients had new amino acid changes in the rt domains. whereas there was no consistent pattern in their distribution of unknown amino acid changes, moreover, mutations related to a specific na monotherapy were found in multi - drug groups (iii and iv) and vice versa. in the present study, multi - drug - resistant mutations were detected in patients on monotherapy with either lam or adv. multi - drug - resistant hbv has been reported in patients who received sequential treatment with nucleoside / tide analogue monotherapies (14, 28, 29). it is interesting to note that mutants l180 m and m204i that were detected during lam and adv breakthrough showed a high prevalence in the lam - only group (25 and 50%, respectively), followed by a low frequency in the adv - only group (9.9 and 23%, respectively), whereas they showed a very high frequency in group iii in which the patients received adv after lam breakthrough (43.75 and 68.75%, respectively). however, group iv, in which the patients who were started with both drugs, showed an intermediate frequency of such mutations (16 and 22.5%, respectively). collectively, these results suggest that prolonged lam and/or adv monotherapy may be associated with cross - resistance to combination of lam and adv (14, 29, 30), and individual resistant mutations to lamivudine and adefovir monotherapy have a marked reduction in sensitivity to the combination of lamivudine and adefovir (28, 29). these results also showed that pre - existing lam - related variants (groups i and iii) confer higher mutation profiles compared with adv - only (group ii) or adding adv at the beginning of combination therapy (group iv), highlighting the previous finding that combination therapy may have heightened antiviral effects and that combining agents that do not share cross resistance has the potential to prevent resistance (29, 31). the distribution of mutations in groups i to iv showed that the rt domain c contained the highest number of primary amino acid substitutions, followed by domain a. studies showed that the failure of therapy due to m204i / v could be related to the upstream substitutions in domains a and b. this hypothesis might be emphasized to a greater extent in the treatment - nave group in which domain a showed the highest number of variations, followed by domain c. in this study, the mean hbv dna and alt levels were higher in the lam - only group (group i) than in the adv - only group (group ii) or the combination therapy group (group iv) (table 1). interestingly, the mutation frequency patterns in these groups were comparable, i.e., 10 and 60% (group i) compared with 3 to 22% (groups ii and iv). given the high rate of resistance in the former and the low antiviral potency of the latter, which was similar to the findings in other studies, this study showed that neither lamivudine nor adefovir should be used as monotherapy because of the low barrier of resistance (4, 6, 11, 12, 32, 33). concerning the results obtained from the patients in group v, who did not receive any treatment and due to the quasispecies nature of hbv, the resistant viral populations could have pre - existed in a subset of the hbv - infected patients, which could have occurred randomly as a result of sustaining viral replication (26). similarly, some substitutions could have occurred during the few months of therapy in those patients who partially responded to the therapy after reduction in previously - high hbv replication levels. therefore, we could hypothesize that, for those individuals who did not respond to therapy, there would have been a probability of the emergence of more random substitutions getting higher if prolonged therapy had been continued ; the more viral replication sustains the higher number of mutations could be emerged. this observation could be supported by the view that the mere detection of resistance associated substitutions during therapy does not mean that a clinically relevant viral breakthrough will occur (34). such detection indicates that a complete breakthrough might subsequently occur in partially - responded patients with moderate to high levels of viral load. however, because we did not use sequential samples in the current study to investigate either the complete response or non - responsiveness of the patients, further research should be conducted to determine whether treatment should be altered in situations in which partial response occurs in order to prevent viral breakthrough. previous studies have shown that various mutational patterns were associated with drug resistance in relation to hbv genotypes (3538). versatile, unusual mutational patterns were found in this study (like finding of lam - related mutations in group ii and new, yet unreported mutations) that might be related to the nature of pure genotype d among the iranian population. moreover, the patients in both groups iii and iv, who received lam and adv in combination, showed the highest rate of mutation frequency between all groups studied (2.28 and 2%, respectively). iranian population is the only ethnic group that harbored 100% of genotype d (26). therefore, the impact of such a pure genotypic pattern on the evolution of specific mutational patterns can not be ruled out. drug - resistance variants have been found to be present along with the surface protein substitutions (as compensatory mutations, in the distal part) with other nucleos(t)ide analogue antiviral agents (3942). it was a retrospective, observational study of a relatively heterogeneous patient population, representing the mutational outcomes of patients who responded partially to the sequential administration of lam and adv, lam and adv in combination, and monotherapy treatment regimens. however, since we did not use sequential samples, the effect of such mutations on the relative viral breakthrough and the level of drug resistancy between different groups were not explored. the results of amino acid distribution in the present study clearly showed that lam+adv combination therapy was superior to either lam / adv monotherapy or adv add - on in preventing drug resistance. in addition, those patients who failed to respond in the first 48 weeks, irrespective of whether they were undergoing mono or combination therapy, should be tested genotypically for partial response, and, if confirmed, early modification of their treatment should be considered, such as using highly potent drugs with high genetic barriers of resistance. | introductionthe mutational pattern of chronic hepatitis b virus (hbv) is unclear in patients who show incomplete response to antiviral therapy. the aims of this study were 1) to determine the benefit of combination therapy with adefovir dipivoxil (adv) and lamivudine (lam) versus adv or lam alone in maintaining virological, biochemical and histological responses and 2) to investigate the patterns of mutations in the reverse transcriptase and surface proteins of hbv with lam and/or adf - resistant in partially - responded chronic hepatitis b (chb) patients.methodsthe study group consisted of 186 chronic hbv carriers who were admitted to the tehran hepatitis network from 2010 to 2013. we retrospectively selected 86 patients who partially responded to different nucleoside analogue regimens. after 48 weeks of therapy, five groups of patients were defined including eight lamivudine (lam) group (i), 30 adefovir (adv) group (ii), 16 adv add on lam group (iii), 32 adv+lam group (iv), and 100 controls (no therapy). reverse transcriptase (rt) and surface genes were amplified and sequenced for mutational analysis.resultsall groups showed differences between mean values for age, gender, alanine transaminase (alt), aspartate transaminase (ast), and hbv dna levels groups showed significant differences than other groups (p < 0.05). the mutation frequencies for groups were i (1.7%), ii (1.39%), iii (2.28%), iv (2.0%), and v (0.38%). t54n, l80i / v, i91l / v, l180 m, m204i / v, q215p / s, and f221y / s showed the highest number of mutations in all groups with different frequencies. four new, unreported mutations were found.conclusionthose patients who failed to respond in the first 48 weeks, whether they were receiving mono or combination therapy, should be tested genotypically, for the early modification of treatment. |
improvements in health - related quality of life (hrqol) in patients of 13 countries who were prescribed betahistine for recurrent peripheral vestibular vertigo have been reported from the osvald study (a three - month observational study in patients suffering from recurrent peripheral vestibular vertigo to assess the effect of betahistine 48 mg / day on quality of life and dizziness symptoms).1,2 one of the largest single - country contingents of osvald was recruited in russia, and there is interest among physicians in russia in having detailed information about their national contingent. in response to that interest, the methods used in osvald have been described in detail in other papers.1,2 readers should consult those sources for information about the statistical principles that shaped the study and the statistical methods used to analyze the data, including prospectively defined arrangements for dealing with missing data. summarized in brief, osvald was a post - marketing surveillance study of open - label betahistine ; the study was scheduled to last 12 weeks. participating patients were recruited at multiple primary care centers in 13 countries, including russia. inclusion criteria were simple, comprising a history (5 years) of vertigo attacks of peripheral vestibular origin and a baseline total score 40 on the dizziness handicap inventory (dhi). the only exclusion condition specified in the study protocol was if a patient satisfied one or more of the officially acknowledged contraindications to the use of betahistine. participating physicians were instructed to prescribe betahistine at a dose of 48 mg / day ; this was to be given in two or three equal divided doses according to local regulations and practice. individual investigators were free to decide whether to continue or discontinue drugs that were being prescribed before the start of the study. patients were to attend three clinic visits for assessment of their response to betahistine : a baseline visit, and two follow - up visits at months 1 and 3. if a patient discontinued the trial before any scheduled visit, an end - of - treatment visit was arranged. endpoints included hrqol, quantified using scores on the dhi, the medical outcomes study short - form 36, version 2 (sf-36v2) and the hospital anxiety and depression scale (hads) ; these data were recorded at each visit. the primary efficacy outcomes defined in the protocol was the change in total dhi score between baseline and 12 weeks (or end of study if earlier). all these instruments are widely used and documented for measuring hrqol.312 reports of adverse drug reactions were accrued from the safety population. data management and statistical analysis was undertaken by the fovea group (rueil malmaison, france). microsoft access version 9.0 was used for data entry, and sas version 8.2 was used for quality control and statistical analysis. sf health outcomes scoring software (qualitymetric incorporated, lincoln, ri, usa) was used for some statistical analyses. the design and conduct of osvald conformed to international principles of good clinical practice and the declaration of helsinki, and included independent institutional review of the protocol and securing advance informed consent from all patients where required by local laws. pre - enrolment advice to patients included informing them that they could leave the study at any time without giving a reason and with no detriment to their care. data management and statistical analysis was undertaken by the fovea group (rueil malmaison, france). microsoft access version 9.0 was used for data entry, and sas version 8.2 was used for quality control and statistical analysis. sf health outcomes scoring software (qualitymetric incorporated, lincoln, ri, usa) was used for some statistical analyses. the design and conduct of osvald conformed to international principles of good clinical practice and the declaration of helsinki, and included independent institutional review of the protocol and securing advance informed consent from all patients where required by local laws. pre - enrolment advice to patients included informing them that they could leave the study at any time without giving a reason and with no detriment to their care. in russia, a total of 204 patients were recruited at 34 centers (see acknowledgments section for details of participating practitioners). all 204 patients were included in both the efficacy population (patients who were prescribed betahistine at baseline, attended at least one clinic visit after baseline, and recorded at least one score for at least one endpoint at baseline and during at least one later visit) and the safety population (all patients who were prescribed betahistine at baseline and attended at least one later clinic visit). table 1 summarizes the demographic profile of the russian cohort, which was almost entirely white / caucasian (98%) and predominantly female. insufficient efficacy of existing therapy was recorded as the reason for prescribing betahistine in 119 cases (58.3%) in the russian contingent ; new diagnosis (n=85, 41.7%) accounted for the remainder. betahistine was mostly prescribed in a 16 mg three times daily regimen throughout the study (85%90% of patients). this subset of osvald patients had extensive comorbidity, with pre - existing cerebrovascular or cardiovascular diseases identified in > 50% and > 25% of patients, respectively, and metabolic disturbances (including diabetes) and psychosomatic / psychiatric disorders (including panic disorder) present in 5%7% of patients. however, no patient was recorded as having a history of drug or alcohol abuse. among the single - diagnosis categories, combination therapy was noted in a higher percentage of patients with mnire s disease (57%) than those with peripheral vestibular vertigo of unknown pathophysiology (pvvup) or benign paroxysmal positional vertigo (bppv ; both 30%). piracetam was prescribed for between 40% and 50% of patients with pvvup (48.9%) or bppv (41.7%), but was not used in the small number of patients with a sole diagnosis of mnire s disease (n=7) ; in contrast, gingko biloba was prescribed for approximately 25% of patients with pvvup or mnire s disease but in only one patient with a sole diagnosis of bppv. net mean changes (improvements) in total dhi score and all its dimensions are depicted in figure 1 (p<0.0001 for all comparisons versus baseline). the dhi response was consistent in men and women, and across the diagnostic categories of pvvup, bppv, and mnire s disease (data not shown). the mean change in total dhi score was numerically smaller in patients prescribed betahistine alone (n=127) than in those prescribed combination therapy (n=77 ; 36.518.3 versus 43.615.3), but comparisons versus baseline for the total dhi scores and for dimension - specific dhi scores were highly statistically significant (p<0.0001) and indicative of improved hrqol. significant improvements from baseline were noted in the mean scores for both the physical component summary (pcs) and the mental component summary (mcs) subscales of the sf-36v2 (table 2). also as shown in table 2, pcs and mcs scores improved to a similar extent in all major diagnostic categories. similarly, there were improvements in all domains of the sf-36v2 (figure 2, p<0.0001). numerical differences were noted in the responses of men and women in some domains but these were small ; statistical comparisons were not performed. patients with pvvup were more likely than those with bppv or mnire s disease to assess treatment as excellent (43.2% versus 33.3% and 28.6%, respectively) but almost all patients in every category assessed betahistine therapy as excellent or good (figure 3). there was a good correlation between patients impression of the treatment and the assessments of physicians (r=0.725, p<0.0001). the only suspected adverse drug reaction recorded in the russian contingent was a report of nausea in a 37-year - old female patient. this event was recorded as possibly related to use of the study medication but was not classified as either severe or serious. in the study as a whole, more patients experienced a suspected adverse drug reaction at a betahistine dose of 24 mg twice daily than at a dose of 16 mg three times daily (25 versus 7 ; dosage data not recorded for 28 suspected adverse drug reactions). mean standard deviation change in weight between the baseline and final visits in the efficacy population was 0.43.2 kg ; change in body weight was almost identical in men and women. patients with pvvup (n=139 ; 0.53.4 kg) lost more body weight, on average, than those with bppv (n=36 ; 0.23.3 kg) or mnire s disease (n=7 ; 0.30.5 kg). net mean changes (improvements) in total dhi score and all its dimensions are depicted in figure 1 (p<0.0001 for all comparisons versus baseline). the dhi response was consistent in men and women, and across the diagnostic categories of pvvup, bppv, and mnire s disease (data not shown). the mean change in total dhi score was numerically smaller in patients prescribed betahistine alone (n=127) than in those prescribed combination therapy (n=77 ; 36.518.3 versus 43.615.3), but comparisons versus baseline for the total dhi scores and for dimension - specific dhi scores were highly statistically significant (p<0.0001) and indicative of improved hrqol. significant improvements from baseline were noted in the mean scores for both the physical component summary (pcs) and the mental component summary (mcs) subscales of the sf-36v2 (table 2). also as shown in table 2, pcs and mcs scores improved to a similar extent in all major diagnostic categories. similarly, there were improvements in all domains of the sf-36v2 (figure 2, p<0.0001). numerical differences were noted in the responses of men and women in some domains but these were small ; statistical comparisons were not performed. patients with pvvup were more likely than those with bppv or mnire s disease to assess treatment as (43.2% versus 33.3% and 28.6%, respectively) but almost all patients in every category assessed betahistine therapy as excellent or good there was a good correlation between patients impression of the treatment and the assessments of physicians (r=0.725, p<0.0001). net mean changes (improvements) in total dhi score and all its dimensions are depicted in figure 1 (p<0.0001 for all comparisons versus baseline). the dhi response was consistent in men and women, and across the diagnostic categories of pvvup, bppv, and mnire s disease (data not shown). the mean change in total dhi score was numerically smaller in patients prescribed betahistine alone (n=127) than in those prescribed combination therapy (n=77 ; 36.518.3 versus 43.615.3), but comparisons versus baseline for the total dhi scores and for dimension - specific dhi scores were highly statistically significant (p<0.0001) and indicative of improved hrqol. significant improvements from baseline were noted in the mean scores for both the physical component summary (pcs) and the mental component summary (mcs) subscales of the sf-36v2 (table 2). also as shown in table 2, pcs and mcs scores improved to a similar extent in all major diagnostic categories. similarly, there were improvements in all domains of the sf-36v2 (figure 2, p<0.0001). numerical differences were noted in the responses of men and women in some domains but these were small ; statistical comparisons were not performed. patients with pvvup were more likely than those with bppv or mnire s disease to assess treatment as excellent (43.2% versus 33.3% and 28.6%, respectively) but almost all patients in every category assessed betahistine therapy as excellent or good there was a good correlation between patients impression of the treatment and the assessments of physicians (r=0.725, p<0.0001). the only suspected adverse drug reaction recorded in the russian contingent was a report of nausea in a 37-year - old female patient. this event was recorded as possibly related to use of the study medication but was not classified as either severe or serious. in the study as a whole, more patients experienced a suspected adverse drug reaction at a betahistine dose of 24 mg twice daily than at a dose of 16 mg three times daily (25 versus 7 ; dosage data not recorded for 28 suspected adverse drug reactions). mean standard deviation change in weight between the baseline and final visits in the efficacy population was 0.43.2 kg ; change in body weight was almost identical in men and women. patients with pvvup (n=139 ; 0.53.4 kg) lost more body weight, on average, than those with bppv (n=36 ; 0.23.3 kg) or mnire s disease (n=7 ; 0.30.5 kg). this exploratory analysis of the russian contingent of the osvald population replicates the demonstration of improved hrqol with betahistine reported in the overall study.1 hrqol data collected with three separate instruments in our russian contingent of osvald corroborate the premise that diseases of the peripheral vestibular system can have significant adverse impact on the lives of patients.13 conversely, the improvements in all three indices recorded during the study indicate the possibility of intervening effectively to improve subjective perceptions of health and hrqol. substantial improvements were seen in the primary efficacy criterion (absolute change from baseline in mean total dhi score between the baseline and final [3-month ] visits), with a 39-point reduction in the mean total score, and mean reductions of 12.6, 12.2, and 14.4 points, respectively, in the physical, emotional, and functional domains of the dhi. further, the improvement in total dhi score substantially exceeded the threshold for a minimally important change.14,15 statistically significant (p<0.0001) and clinically meaningful improvements were also recorded with the hads questionnaire and the sf-36v2. this consistency of effect across scales gives us confidence that the responses seen are authentic, although the exploratory nature of the analysis must be borne in mind. it should be considered also that this russian subgroup is characterized by patients with a diagnosis of pvvup and that any conclusions drawn about the efficacy of betahistine are likely to be most resilient for that diagnosis. nevertheless, our findings are consistent with evidence from a meta - analysis of the beneficial effects of betahistine in mnire s disease and vestibular vertigo16 and with local reports on the use of betahistine.1719 successful use of betahistine in the management of vertigo after a stroke has also been documented by russian investigators,20 making it perhaps noteworthy that about half of the russian osvald contingent had a history of cerebrovascular disease. this may be pertinent to the analysis of our findings because it has been suggested that betahistine is more effective in bppv when given to patients in whom the condition has not been apparent for long.21 we have been unable to investigate this possibility in the russian contingent of osvald and would identify this as a limitation of our research. also untested in osvald it is widely considered that a betahistine dose of 48 mg three times daily should be used in individuals with this condition,22 which is three times higher than the dose examined in osvald (48 mg / day) ; doses of up to 480 mg / day have reportedly been used successfully in severe cases.23 it is possible, therefore, that the beneficial effects of betahistine on hrqol in our database are not a full representation of the effects that might be achieved. connected with this is the question of whether long - term use of betahistine is appropriate and beneficial. for mnire s disease, the answer appears to be yes,24,25 but in bppv the principal benefit of the drug may be to provide accelerated symptom relief during the first months of treatment.26 we consider it likely that the 3-month duration of osvald was sufficient to explore and reveal much of the likely achievable change in hrqol, and we consider that most or all of the changes seen may reasonably be attributed to betahistine use. however, reported rates of spontaneous complete resolution of bppv can be high27 and, with small numbers and in the absence of a control group, the changes in hrqol in the russian contingent of osvald are associated with betahistine use, not firm proof of cause and effect. consideration must also be given to the absence of formal methods for monitoring patient adherence to prescribed therapies. the open - label observational model of clinical research has limitations,28 notably the absence of a reference group, but it provided a pragmatic and reasonably robust methodology for a multinational trial performed in the setting of routine care and was compliant with the general principles of the strengthening the reporting of observational studies in epidemiology methodology.29 overall, the safety experience with betahistine in osvald was satisfactory, with adverse drug reactions affecting < 2.5% of the study population.1 the predominant safety findings were gastrointestinal and nervous system disorders, as has been reported in earlier studies of betahistine;30 it has been reported that betahistine exhibits good tolerability in mnire s disease even at ten times the dose used in our patients.23 there was notable national variation in the reporting of the rates of suspected adverse drug reactions in osvald, with only one serious adverse drug reaction being recorded in the russian contingent compared with 20 patients in brazil. some weight gain is a usual experience with betahistine, but in our russian patients there was a small reduction in average weight. we are unable to say if this is a chance finding or a reflection of specific but unidentified local factors. in 204 russian patients diagnosed with recurrent peripheral vestibular vertigo, betahistine 48 mg / day for 3 months was associated with sustained and statistically significant improvements in multiple indices of hrqol. the safety and tolerability of the treatment were good in this cohort, with only one reported serious adverse drug reaction. | backgroundwe report here data from the > 200 patients recruited in russia to take part in osvald, a 12-week, open - label, post - marketing surveillance study of the response to betahistine 48 mg / day in vertigo of peripheral vestibular origin carried out in a total of 13 countries.methodsthe primary efficacy endpoint was change in the dizziness handicap inventory (dhi ; 100-point scale). changes in hospital anxiety and depression scale (hads) and medical outcomes study short - form 36, version 2 (sf-36v2) scores were a priori secondary outcomes.resultstotal dhi score improved by 43 points during betahistine treatment. this aggregate improvement was equally distributed across the three domains of the dhi (physical, emotional, and functional ; p<0.0001 for main and subscore changes from baseline). statistically significant improvements versus baseline were also observed in mean hads scores for anxiety and depression (both p<0.0001), and in the physical component summary and mental component summary scores of the sf-36v2 (both p<0.0001 versus baseline). only one suspected adverse drug reaction was recorded in the russian safety population (n=204), indicating that betahistine was well tolerated in those patients.conclusionbetahistine 48 mg / day was associated with clear improvements in well - configured and widely validated measures of health - related quality of life and an encouraging tolerability profile in patients in russia who took part in osvald. |
spontaneous rupture of the ureter is a rare urological occurence with only a small number of cases reported in the literature. it is defined as extravasation of urine from the ureter which occurs without trauma or iatrogenic manipulation of the ureter. it often occurs secondary to uretrolithiasis with urinary tract obstruction and resultant increased intraluminal pressure and subsequent rupture. it may also be secondary to a tear of the ureter during passage of the stone. peritoneal irritation by urine results in presentation with an acute abdomen, sometimes without any urinary tract symptoms or urinalysis abnormalities. rupture may occur anywhere along the urinary tract, with the commonest sites being the fornices and upper ureter. it may lead to urinoma, infection with sepsis, acute kidney injury and abscess formation if left untreated. a 37-year - old previously healthy lady, presented at the accident and emergency department complaining of severe colicky left sided flank pain associated with two episodes of vomiting and chills and rigors. she was found to be tender in the left flank with a positive renal punch. a non - contrast computed tomography of the kidney ureter and bladder (ct kub) was performed which showed a 23 mm stone in the distal part of the left ureter (fig. figure 1:a non - contrast ct kub was performed which showed a 23 mm stone in pelvic part of the left ureter. a non - contrast ct kub was performed which showed a 23 mm stone in pelvic part of the left ureter. despite the very small stone size and distal position in the ureter making her a good candidate for conservative treatment, she was admitted to the urology department for further care due to her unremitting severe pain. she was prescribed intravenous hartmann 's solution at 125 ml / hr and given appropriate analgesia. she was also advised to start oral tamsulosin as part of metabolic expulsive therapy, but she refused this as it is only licensed for use in men for treatment of lower urinary tract symptoms secondary to benign prostatic hypertrophy. two days later she was still complaining of severe pain, and had increasing tenderness in the left flank and abdomen. a contrast computed tomography (ct) of the abdomen was thus performed and she was found to have free fluid in the left retroperitoneum associated with obstruction of the left kidney and ureter by a small calculus distally, suggestive of a perforation of the left collecting system. in view of these findings, a delayed scan was performed to achieve a ct intra - venous urogram (ivu). this confirmed extravasation of contrast medium around the left kidney and ureter, the rupture being at the level of the puj. a diagnosis of spontaneous left proximal ureteric perforation secondary to urolithiasis was made (figs 2 and 3). figure 2:ct ivu- confirmed extravasation of contrast medium around the left kidney and ureter, the rupture being at the level of the puj. figure 3:coronal view reconstructions using maximum intensity projection, showing proximal ureteric leak of contrast. ct ivu- confirmed extravasation of contrast medium around the left kidney and ureter, the rupture being at the level of the puj. blood tests, clinical parameters and temperature were still well within normal limits, despite the severity of symptoms and clinical examination. the patient was also started on intravenous ciprofloxacin and piperacillin / tazobactam post operatively. on day 9 since presentation this showed the stent in the left ureter to be in situ with no further leakage from the known rupture. on day 10 the patient underwent a successful trial without urinary catheter and was discharged home with an appointment for removal of stent and retrograde pyelography in 3 months. this confirmed an intact left collecting system and ureter. a very mild reduction in calibre of the upper ureter was noted. the post - operative period was unremarkable and the patient was discharged with a follow - up ultrasound of the kidneys in 4 months to exclude hydronephrosis. it is by definition non - traumatic in origin, and can be difficult to diagnose unless a high index of suspicion for this condition is maintained. other reported rarer causes include tumour, retroperitoneal fibrosis, pregnancy, connective tissue disorder and acute urinary retention. the condition should be suspected in cases of ureteric colic which develop significant acute worsening of symptoms, with increased areas of tenderness, with or without a reactive peritonitis. imaging is required to confirm the diagnosis. whilst ultrasound can be helpful in identifying a perinephric or retroperitoneal fluid collection, this modality will confirm a urinary leak and can accurately define the site of rupture [5, 6 ]. the use of a delayed film post iv contrast is also very useful in differentiating a ureteral rupture from an infective perinephric abscess that can also arise from obstructing calculi. due to the rarity of this clinical condition, there are no guidelines or recommendation on its management. we managed our patient with retrograde insertion of a double - j ureteral stent which was then removed after 12 weeks. on reviewing case reports of patients with this condition, the majority were also managed with a double - j ureteral stent. percutaneous drainage with or without nephrostomy / antegrade stent is another reported option [8, 9 ]. development of fever or haemodynamic changes may indicate an infective process of the resulting urinoma and antimicrobial therapy drainage needs to be considered. a high serum creatinine removal, we performed an on table retrograde pyelogram to confirm there is no residual leakage and also to exclude significant stricturing. a ct ivu after stent removal may also be considered as an alternative to this approach. | we present the case of a 37-year - old lady who presented with severe colicky left sided flank pain associated with vomiting, chills and rigors. a non - contrast computed tomography of the kidney ureter and bladder was performed which showed a 23 mm stone in the pelvic part of the left ureter. following 2 days of conservative treatment she was still complaining of increasingly severe pain. a contrast computed tomography of the abdomen was performed which was suggestive of a perforation of the left collecting system. a diagnosis of spontaneous left proximal ureteric perforation secondary to urolithiasis was made. we opted to treat her with retrograde endoscopic ureteric stent insertion. spontaneous rupture of the ureter is a relatively rare urological occurrence with only a small number of cases reported in the literature. although there are no recommendations, ureteric double - j stenting is the most commonly used management option with good results reported. |
cancer cells differ from normal ones due to a plethora of oncogenes - driven biochemical changes designed to sustain an high rate of growth and proliferation. the first tumor - specific alteration in metabolism was reported at the beginning of the 20th century by warburg. his observations demonstrated that cancer cell metabolism relies on an increased glycolytic flux maintained even in the presence of oxygen (aerobic glycolysis or the switch from respiration to glycolysis has usually been considered a consequence, rather than a cause, of cancer. however, in the last decade, the discovery that inherited and acquired alterations in some enzymes of tricarboxylic acid (tca) cycle have a causal role in carcinogenesis has changed this viewpoint, pointing towards altered metabolism as the underlying hallmark of neoplastic transformation. these alterations consist of germline defects in genes encoding subunits of sdh and fh, as well as somatic mutations in coding sequence for idh. together with metabolomics studies documenting the alteration of hif - dependent signaling pathway and epigenetic dynamics as main tumor - promoting effects of these mutations, a mounting body of evidence also supports how alterations in the tca cycle enzymes may favor tumorigenesis by impacting on cellular redox state. therefore, in this paper, we summarize the prooncogenic defects in the tca cycle enzymes discussing their involvement in the tuning of redox environment and the engagement of redox - dependent tumorigenic signaling. the tca cycle is a core pathway for the metabolism of sugars, lipids, and amino acids. it is usually presented in a naive perspective of a cyclic mitochondrial route constantly oxidizing the acetyl moiety of acetyl - coenzyme a to co2, generating nadh and fadh2, whose electrons fuel the mitochondrial respiratory chain for atp generation. the tca cycle begins with the condensation of acetyl - coa with oxaloacetate to form citrate, catalyzed by citrate synthase. citrate can be exported to the cytoplasm, where it is used as precursor for lipid biosynthesis or remains in the mitochondria, where it is converted to isocitrate by aconitase. in the next step, -ketoglutarate (-kg), formed by the oxidative decarboxylation of isocitrate catalyzed by idh, is converted to succinyl - coa by a further decarboxylation by the -kg dehydrogenase complex. fumarate, produced by succinate oxidation catalyzed by the sdh complex, is hydrated to malate by fh. oxidation of malate, catalyzed by malate dehydrogenase, finally regenerates oxaloacetate, thus ensuring the completion of the cycle (figure 1). on the mere biochemical viewpoint, the tca cycle in nontumor cells has been divided into two stages : (i) decarboxylating, in which citrate is converted to succinyl - coa releasing two co2 molecules ; (ii) reductive, which comprises the successive oxidations of succinate to oxaloacetate. interestingly, emerging findings from the last year support the hypothesis that, in several cell systems such as (i) cancer cells containing mutations in complex i or complex iii of the electron transport chain (etc), (ii) patient - derived renal carcinoma cells with mutations in fh, (iii) cells with normal mitochondria subjected to acute pharmacological etc, inhibition, as well as (iv) tumor cells exposed to hypoxia, the first stage of the cycle can proceed in the opposite direction through the reductive carboxylation of -kg to form citrate. this allows cells to produce acetyl - coenzyme a to support de novo lipogenesis and their viability [46 ]. although in physiological and resting conditions mitochondria are necessary and sufficient to perform the cycle, isoforms of some of its enzymes have been also found in the cytosol. this ensures a dual compartmentalization (cytosolic and mitochondrial) of reactions and metabolites which, being free to diffuse through the outer and the inner mitochondrial membranes by channels and active carriers, respectively, allows the cycle to respond to environmental and developmental signals, thus sustaining anabolic reactions as well as fueling the atp - producing machinery. the tca cycle is also a major pathway for interconversion of metabolites arising from transamination and deamination of amino acids and provides the substrates for amino acids synthesis by transamination, as well as for gluconeogenesis and fatty acid synthesis. regulation of the tca cycle depends primarily on a supply of oxidized cofactors : in tissues where its primary role is energy production, a respiratory control mediated by respiratory chain and oxidative phosphorylation is operative. this activity relies on availability of nad and adp, which in turn depends on the rate of utilization of atp in chemical and physical work. genetic defects affecting the tca cycle enzymes have been known for more than two decades. until recently, only recessive mutations were documented whose clinical consequences were similar to alterations in the electron transport chain (etc) and oxidative phosphorylation. these defects were associated with multisystem disorders and severe neurological damage, but no cancer predisposition, as a result of very considerably impaired atp formation in the central nervous system. in the last ten years, dominant defects associated with oncogenesis were described in cytoplasmic and mitochondrial isoforms of three nuclear - encoded enzymes, sdh, fh, and idh, allowing to investigate the extrametabolic roles of the tca cycle metabolites and their signaling to tumor formation. the sdh complex (also known as succinate : ubiquinone oxidoreductase or mitochondrial complex ii) is a highly conserved heterotetrameric tumor suppressor, composed by two catalytic subunits (sdha and sdhb), which protrude into the mitochondrial matrix, and two hydrophobic subunits (sdhc and sdhd), which anchor the catalytic components to the inner mitochondrial membrane and provide the binding site for the ubiquinone, as well. all the subunits are encoded by nuclear genome and, unlike most of the tca cycle enzymes, have no cytosolic counterparts. sdh catalyzes the oxidation of succinate to fumarate in the tca cycle with the simultaneously reduction of ubiquinone to ubiquinol in the etc. a decade ago, mutations in sdhb, sdhc, and sdhd subunits were identified in patients with hereditary paragangliomas (hpgls) and pheochromocytomas (pccs), a rare neuroendocrine neoplasm of the chromaffin tissue of the adrenal medulla or derived from the parasympathetic tissue of the head and neck paraganglioma, respectively [912 ]. more recently, mutations in sdha and the sdh assembly factor 2 (sdhaf2), required for flavination of sdh [13, 14 ], have been associated with hpgl / pcc syndrome. the genetic defects in the sdh genes predisposing to the hpgl as well as pcc are heterozygous germline mutations, inducing the inactivation of the protein and the neoplastic transformation develops as result of loss of heterozygosity, caused by the complete loss of the enzyme function by a second mutagenic hit (usually deletion). in addition to hpgl and pcc, a number of other neoplasms have been associated with mutations in sdh genes, including gastrointestinal stromal tumors, renal cell cancers, thyroid tumors, neuroblastomas, and testicular seminoma. fh is homotetrameric tca cycle enzyme which catalyzes the stereospecific and reversible hydration of fumarate to l - malate. homozygous fh deficiencies result in fumaric aciduria, characterized by early onset of severe encephalopathy and psychomotor retardation ; on the contrary, heterozygous fh mutations predispose to multiple cutaneous and uterine leiomyomas (mcul), as well as to hereditary leiomyomatosis and renal cell cancer (hlrcc) [18, 19 ]. in particular, the kidney tumors in hlrcc, whose morphological spectrum include papillary type ii, tubulopapilar, tubular, collecting duct, and clear cell carcinoma, are particularly aggressive. growing evidence suggests that fh mutations may also be involved in the pathogenesis of breast, bladder, as well as leydig cell tumors [20, 21 ]. the most common types of tumor predisposing genetic defects are missense mutations (57%), followed by frameshift and nonsense mutations (27%), as well as large - scale deletions, insertions, and duplications. like sdh, enzymatic activity of fh is completely absent in hlrcc as result of the loss of the wild - type allele in the transformed cell. idh is a member of the -decarboxylating dehydrogenase family of enzymes and catalyzes the oxidative decarboxylation of isocitrate to produce 2-oxoglutarate (-kg) and co2 in the tca cycle. nuclear genome encodes three isoforms of idh : idh1 and idh2 are nadp - dependent homodimers, whereas idh3 is a nad - reliant heterotetrameric enzyme. whereas idh1 is found into cytoplasm and peroxisomes, idh2 and idh3 are exclusively localized into the mitochondrial matrix, and, although all three isoforms are able to decarboxylate isocitrate, idh3 is the main form of idh functioning in the tca cycle under physiological conditions whereas idh1 and idh2 are mainly involved in the reductive glutamine metabolism, under hypoxia and etc alterations [4, 5, 23 ]. though it plays a central role in energy production, to date there have been no reports of cancer - associated mutations in any of the idh3 subunits. conversely, genomewide mutation analyses and high - throughput deep sequencing revealed the presence of mutations in either idh1 or its mitochondrial counterpart idh2 in 70% of grade ii - iii gliomas and secondary glioblastomas [24, 25 ]. since these initial reports, mutations in idh1 and idh2 have been identified in 16 - 17% of patients with acute myeloid leukemia, in 20% of angioimmunoblastic t - cell lymphomas, and spotted in a variety of other malignancies at lower frequencies [27, 28 ] such as b - acute lymphoblastic leukemias, thyroid, colorectal, and prostate cancer [29, 30 ]. unlike sdh and fh mutations in hpgl and hlrcc, respectively, idh1 and idh2 mutations are somatic and monoallelic. moreover, whereas mutations in sdh and fh occur throughout the gene, the majority of idh mutations identified in gliomas and aml are changes in the amino acid residues r132 in idh1 and either r172 or r140 in idh2. as result of these alterations, mutated idhs are unable to efficiently catalyze the oxidative decarboxylation of isocitrate and acquire a neomorphic catalytic activity that allows a nadph - dependent reduction of -kg into the oncometabolite (r)-2-hydroxyglutaric acid ((r)-2hg) [31, 32 ]. the finding that many tumors arousing from mutations in both sdh and fh genes are characterized by hypoxic features has suggested that the activation of the hypoxia - inducible transcription factor-1 (hif-1) could play a supportive role in the tumorigenic processes induced by tca cycle dysfunctions. indeed, hif-1 is known to coordinate the biochemical reprogramming of cancer cells aimed to sustain their growth and proliferation as well as tumor vascularization [3335 ]. the causal link between tca cycle dysfunction and hif-1 activation was initially suggested by selak and coworkers demonstrating that the accumulation of succinate in sdh - deficient cells causes the inhibition of prolyl 4-hydroxylases (phds), a negative regulators of the stability of the subunit of hif. the phds are members of the superfamily of -kg - dependent hydroxylases, which couple the hydroxylation of the substrates with the oxidation of -kg to succinate in reactions that are dependent on o2 and fe. in normoxic conditions, phds hydroxylate two proline residues in the oxygen - dependent degradation domain of hif-1, allowing it to be polyubiquitinated and degraded via proteasome. the accumulated succinate in sdh - deficient or sdh - inactive cells impairs phds activity leading to hif-1 stabilization under normoxic conditions (pseudohypoxia). similarly to succinate, also fumarate, which accumulates in tumors harboring loss of fh function, has been demonstrated to be potent inhibitors of phds. interestingly, fumarate - mediated stabilization of hif was observed to induce the upregulation of several hif - target genes, including those that stimulate cell growth and angiogenesis, allowing to hypothesize pseudohypoxia response as a plausible mechanism for hlrcc onset. despite that this large body of evidence showed a direct link between hif-1 expression and tumorigenesis, recent findings have raised some questions about the protumorigenic role of pseudohypoxic adaptation in all types of tumors arousing from tca cycle defects. they demonstrated that neither the presence of hif nor the absence of phds is required for hyperplastic renal cysts formation (typical hallmark of hlrcc) in a kidney - specific fh1 (the ortholog of human fh) knockout mice that recapitulates many features of the human disease, suggesting that alternative oncogenic actions of fumarate could be responsible for hlrcc generation (see next paragraph). in addition to this study, depicting hif as a sort of bystander player in the onset of tumors harboring fh mutations, another report indicated this transcription factor as a tumor - suppressor protein in tumors carrying idh1/2 mutations. indeed, as demonstrated by koivunen and colleagues, contrarily to succinate and fumarate, (r)-2hg stimulates phds activity, driving, in such a way, hif-1 for proteasome - mediated degradation. moreover, they pointed out that hif-1 downregulation enhances the proliferation of human astrocytes and promotes their transformation, providing a justification for exploring phds inhibition as a potential treatment strategy for tumors harboring idh1/2 mutations. as member of the -kg - dependent hydroxylases, phds catalyze the hydroxylation of a wide range of substrates, besides hif-1. therefore, the reduced hydroxylation of phd targets may contribute to tumorigenesis regardless of hif-1 activity and the acquisition of a hypoxic signature. for instance, it has been proposed that sdh deficiency could impair phd - dependent programmed cell death of neurons, therefore setting the stage for neoplastic transformation of neuronal cells. this hypothesis finds support in the recent studies demonstrating that the proapoptotic activity of the prolyl hydroxylase egln3 requires a functional sdh, being feedback inhibited by succinate [41, 42 ]. since egln3 is required during development to allow the programmed cell death of some sympathetic neuronal precursor cells, its inhibition, elicited by the elevation of succinate levels, could play a role in the pathogenesis of tumors arousing from a defective developmental apoptosis, such as pheochromocytomas. highlighting the hif-1-independent tumorigenic mechanisms, growing body of evidence clearly places the alteration of tca flux upstream of the epigenetic dynamics as well. histone methylation is an important epigenetic modification which has been demonstrated to regulate gene expression by modifying chromatin structure and, thereby, fine - tuning the binding of transcription factors [43, 44 ]. one of the most studied enzymes regulating histone methylation signature are the jumonji c - terminal domain (jmjc) family of histone demethylases. as they remove the methyl groups on the arginine and lysine residues of histones after performing an -kg- and oxygen - dependent hydroxylation, they have been included in the -kg - dependent hydroxylases family. it was shown that succinate accumulation, in sdh - deficient cells, negatively affects the activity of many members of such class of histone demethylase. for instance, succinate - mediated jmjd3 inhibition leads to changes in the methylation mark of histone h3 on arginine. furthermore, in a yeast model of paraganglioma, the histone demethylase, jhd1, was found to be inhibited by succinate accumulation in an -kg - competitive manner. similarly, recent studies demonstrate that, besides sdh alterations, also idh1/2 defects are associated with hypermethylated phenotype. indeed, in cells harboring idh1/2 mutations, intracellular (r)-2-hg levels can reach the value of 10 mm. these concentrations promote the competitive inhibition of the -kg - dependent histone n - lysine demethylase jmjd2a, and the ten - eleven translocation (tet) family of 5-methylcytosine (5mc) hydroxylases, a class of protein mediating the -kg - dependent removal of methyl mark from 5-methylcytosines, resulting in an enhanced histone and dna methylation, respectively [48, 49 ]. interestingly, although fumarate is able to inhibit hif - regulating phds similarly to succinate, no evidence attesting its putative capability to mirror its cognate metabolite succinate in affecting histone methylation has been documented so far. in addition, as tet enzymes are members of the -kg - dependent hydroxylases family, a putative ability of both succinate and fumarate in their inhibition can be reasonably argued. on the basis of the ability of the epigenetic alterations to affect lineage - specific differentiation and to result in the activation of oncogenes or silencing of tumor suppressors [44, 50, 51 ], the competitive inhibition of histone and dna demethylases elicited by defects in fluxes of tca cycle metabolites may drive tumorigenesis by promoting cell transformation and uncontrolled proliferation. apart from the mere metabolic viewpoint, compelling evidence suggests that the reactive oxygen species (ros), produced by a deregulated mitochondrial functioning, might trigger the oncogenic signal or, at least, participate in the progression of tumors characterized by defects in the tca cycle enzymes (figure 1). this assumption finds support in the observation that, compared with their normal counterparts, many types of cancer cells have increased levels of ros generated by a defective mitochondrial electron - transport chain [5254 ]. by exploiting their chemical reactiveness with biomolecules, such as nucleic acids, ros are known to induce several types of dna damages, including depurination and depyrimidination, single- and double - stranded dna breaks, base and sugar modifications, and dna - protein crosslinks. in such a way, permanent modifications of dna, resulting from sustained prooxidant conditions, drive the mutagenic events underlying carcinogenesis. the observation that specific sdhc mutant (mev-1) of the c. elegans nematode was able to generate superoxide o2 [55, 56 ] suggested the possibility that ros could have a causal role in the pathogenesis of tumors bearing defects in the tca cycle. this hypothesis was further strengthened by the evidence that mouse fibroblasts transfected with a murine equivalent of the mev-1 mutant were featured by a sustained ros production and a significantly higher dna mutation frequency than wild - type counterparts. although these lines of evidence supported the mutagenic role of ros generated by defective sdh complex, no detectable dna damages, despite an increased production of ros and protein oxidation, was described in a s. cerevisiae strain lacking sdh2 (the yeast ortholog of mammalian sdhb). to link the prooxidant state elicited by sdh dysfunctions to tumorigenesis, guzy and colleagues proposed that the ros could play a supportive role in the oncogenic process by contributing to the activation of hif-1. indeed, relying on a previously characterized role of respiratory chain - derived ros as signals for hif-1 stabilization under hypoxia [59, 60 ], it has been shown that cells expressing mutant sdhb, but not mutant sdha, are characterized by significant mitochondrial ros production required, together with succinate, for a complete inactivation of phds and hif-1 stabilization. therefore, these results reinforce the role of ros as amplifier of the pseudohypoxic response, observed in all cells carrying sdh defects, providing a biochemical rationale for the severity of sdhb mutations which are usually associated with aggressive pcc. the capabilities of the tca cycle defects in the tuning of cellular redox state have been supported by the evidence that also oncogenic mutations in idh1/2 genes are associated with the oxidation of intracellular milieu. normally, in aerobic organisms, the control of cellular redox state is ensured by the balance between the prooxidant species, mainly produced by mitochondria, nadph oxidases or as byproduct of the intermediate metabolism, and their clearance through the synergistic action of the antioxidant enzymes and the thiol - containing antioxidants. among the latter, the tripeptide glutathione (gsh) plays a pivotal role in determining the steady - state value of the intracellular redox potential. indeed, its intracellular abundance (110 mm) allows gsh to participate, as electron donor, in the enzymatic reduction of hydrogen peroxide and lipid peroxides and in the generation of reversible s - glutathionylated adducts with protein thiols, preventing them to undergo irreversible forms of oxidation. the capability of idh mutations to induce oxidative intracellular conditions is linked to a decrease in gsh levels, observed both in idh1-r132h and idh2-r172k expressing glioma cells with respect to their wt counterparts. gsh is synthesized in two atp - dependent steps : (i) synthesis of -glutamylcysteine, from l - glutamate and cysteine via the rate - limiting enzyme glutamate - cysteine ligase (gcl) ; (ii) addition of glycine to the c - terminal of -glutamylcysteine via the enzyme glutathione synthetase. intracellular glutamate, required for the first reaction of gsh biosynthesis, is mainly produced by the oxidative deamination of glutamine catalyzed by the enzyme glutaminase. as idh1/2 mutant cells are characterized by lower levels of glutamate with respect to their wt matching parts, it is possible that oncogenic defects in idh result in impaired gsh synthesis due to a lower glutamate availability, thus phenocopying the prooxidant conditions observed in glutaminase deficient cells. the dampened glutamate levels could be the result of an enhanced -kg demand of idh1/2 mutant cells allowing the biosynthesis of the oncometabolite (r)-2-hg. this assumption is supported by the evidence that treatment of glioma cells with (r)-2-hg does not deplete neither glutamate nor glutathione levels, suggesting that many metabolic changes observed in idh - mutated cells are not due to the direct action of (r)-2-hg but a consequence of its oncogenic production. the involvement of idh1/2 mutations in the generation of prooxidant conditions is not only related to the alteration of intracellular gsh content. indeed, the oxidative decarboxylation of isocitrate, which is impaired in all mutants of idh1 and idh2 proteins, is coupled to a reduced ability to generate nadph. moreover, the failure to sustain intracellular nadph production is associated with an increased nadph oxidation, necessary to allow the reductive biosynthesis of (r)-2-hg [31, 32, 65 ]. as gsh and the thiol - based antioxidant protein thioredoxin require nadph as a source of reducing equivalents for their own regeneration, the altered equilibrium of nadp / nadph elicited by idh1/2 mutations could contribute to the shift of the intracellular redox state towards more oxidizing conditions. although, these lines of evidence bring about the ability of mutant idh1/2 to elicit prooxidant conditions independently on the direct action of (r)-2-hg on human redox metabolome, it has been proposed that this oncometabolite could contribute itself to oxidize intracellular environment. indeed, some reports demonstrate its ability to induce oxidative damages in cerebral cortex of young rats and to elicit ros generation through the stimulation of nmda receptor. although these findings support prooxidant capability of (r)-2-hg, to date no striking evidence has been provided attesting its mutagenic role. whereas accumulating pieces of evidence support the capability of oncogenic mutations in sdh as well as idh genes to oxidize intracellular milieu, conflicting findings do not allow for defining a clear role of fh deficiency in cellular redox state modulation. the most convincing evidence showing the capability of fh - deficient cells to promote intracellular ros accumulation comes from the work of sudarshan and colleagues. this study demonstrated that inactivating mutations of fh in an hlrcc - derived cell line result in glucose - induced nadph oxidases - mediated generation of o2 and ros - dependent hif-1 stabilization. on the contrary, o'flaherty and colleagues provided clear evidence that accumulation of fumarate, due to the absence of a functional fh, is the sole mechanism responsible for the inhibition of hif-1 prolyl hydroxylation, independently on defect in mitochondrial oxidative metabolism. indeed, the complete correction of hif-1 pathway activation in fh1 mefs by extra - mitochondrial fh expression suggests that, at least in tumors harboring fh defects, neither impaired mitochondrial function nor the consequent dependence of energy metabolism on glycolysis contributes significantly to hif-1 engagement. the most substantial pieces of evidence, depicting the elevation of fumarate levels as a condition linked to the reduction of intracellular redox state, came from two recent studies demonstrating that fh loss results in the activation of nuclear factor erythroid 2-related factor 2 (nrf2) [39, 70 ], the pivotal transcription factor responsible for the induction of the antioxidant - responsive - element- (are-) driven genes, which codify for phase ii detoxification enzymes and antioxidant proteins such as glutathione s - transferases and gcl. both studies demonstrated that reconstitution of fh - deficient cells with wild - type fh or an extra - mitochondrial fh decreased fumarate levels and restored nrf2 regulation [39, 70 ]. in addition, elevation of intracellular fumarate content by a membrane - permeable fumarate ester was found sufficient to induce nrf2 and its orchestrated antioxidant program. according to the current view, in resting conditions, nrf2 is retained in the cytoplasm through its interaction with keap1 which prevents its nuclear translocation and rules its ubiquitin - proteasome - mediated turnover, as well. however, in the presence of electrophiles as well as during redox unbalance, keap1 is modified at several reactive cysteine residues, resulting in nrf2 stabilization and the activation of the protective gene expression program [71, 72 ]. in line with this accepted model, both groups revealed by mass spectroscopy analyses that fumarate was able to succinate several cysteine residues previously shown to be electrophile targets, including cys and cys, thereby providing a mechanistic explanation of the fumarate - induced nrf2 activation [39, 70 ]. although ros can promote carcinogenesis by inducing oxidative damages to dna, a recent outstanding study demonstrates that oncogene - induced nrf2 activation promotes tumorigenesis by lowering ros levels and conferring a more reduced intracellular environment. therefore, on the basis of these evidence, it is possible to hypothesize that the fumarate - mediated activation of the nrf2-antioxidant pathway might drive the oncogenic signal for tumors characterized by defects in the fh enzyme. although this assumption has not been demonstrated yet, the observation that heme oxygenase 1, one of the best defined target genes of nrf2, is upregulated in fh - deficient cells allowing their survival supports the putative causal role of keap1 succination in the onset of tumors carrying fh defects. furthermore, mounting bodies of evidence show that nrf2 and its downstream genes are overexpressed in many cancer cell lines and human cancer tissues conferring them advantage for survival and growth as well as acquired chemoresistance [75, 76 ]. therefore, it is possible to speculate that besides driving renal tumorigenesis, fumarate - induced succination of nrf2 could contribute to the reduced sensitivity of particularly aggressive and recurrent forms of kidney cancer, such as hlrcc, to many chemotherapeutic approaches. the enhanced activation of nrf2 observed both by pollard and furge groups contributes to explain the results obtained by raimundo and coworkers in nontumor cells. indeed, they documented that fh - deficient diploid human fibroblasts are characterized by a highly reduced redox state with increased gsh levels, as result of increased expression of the gsh biosynthetic enzyme gcl. as highly reducing environment has been shown to stimulate cell proliferation, it is possible to hypothesize that the reduced redox state elicited by fh mutations could favor the doublings of stem - cell - like populations promoting thus the initial event of tumor formation. this assumption finds support in the observation that lower ros levels have been found in many cancer stem cells with respect to the nontumorigenic counterparts, allowing them to maintain a high proliferative status and to prevent their differentiation. the direct involvement of tca cycle enzymes in tumor formation has been arousing from a decade. in tumors associated with defects of sdh, fh, and idh enzymes, the underlying mechanisms of tumorigenesis involve the accumulation of metabolites (succinate, fumarate, and (r)-2-hg) that convey oncogenic signals (oncometabolites). large amount of evidence points towards the generation of pseudohypoxic phenotype and the alteration of epigenetic homeostasis as the main cancer - promoting effects of the tca cycle affecting mutations. besides inhibiting the -kg - dependent hydroxylases, mounting body of evidence supports the ability of these oncometabolites to alter cellular redox state in precancerous as well as transformed cells. therefore, alternatively or concomitantly to the generation of pseudohypoxic phenotype and the alteration of epigenetic dynamics, the oncometabolites - induced engagement of redox - dependent signaling pathways could contribute both to the neoplastic transformation of healthy cells as well as to the progression of malignancies characterized by germline mutations in sdh and fh and of somatic defects in idh. these emerging findings reveal a dynamic interaction between the genetic profile, the metabolic status, and the redox tuning of the cell. moreover, the different impact of oncogenic mutations of the tca cycle on cellular redox state could contribute to explain the differences in the clinical phenotype and outcome of their associated tumors, opening new perspectives in the comprehension of the molecular mechanisms of oncogenesis and therapeutic targeting of these neoplastic alterations. | inborn defects of the tricarboxylic acid (tca) cycle enzymes have been known for more than twenty years. until recently, only recessive mutations were described which, although resulted in severe multisystem syndromes, did not predispose to cancer onset. in the last ten years, a causal role in carcinogenesis has been documented for inherited and acquired alterations in three tca cycle enzymes, succinate dehydrogenase (sdh), fumarate hydratase (fh), and isocitrate dehydrogenase (idh), pointing towards metabolic alterations as the underlying hallmark of cancer. this paper summarizes the neoplastic alterations of the tca cycle enzymes focusing on the generation of pseudohypoxic phenotype and the alteration of epigenetic homeostasis as the main tumor - promoting effects of the tca cycle affecting defects. moreover, we debate on the ability of these mutations to affect cellular redox state and to promote carcinogenesis by impacting on redox biology. |
stroke is one of the leading causes of death worldwide and a major cause of long - term disability. although many clinical trials have been completed in stroke patients, none of these have demonstrated protective efficacy except for thrombolysis [2, 3 ]. suggested reasons for this failure include the complex interplay among multiple pathways (for review see [46 ]) including excitotoxicity, mitochondrial dysfunction, acidotoxicity, ionic imbalance, oxidative stress, and inflammation, which can all lead to cell death and irreversible tissue injury. a generally accepted cell death pathway after cerebral ischemia is mitochondrial permeability transition (mpt) pore opening (figure 1(a)). as the cells are unable to maintain a negative membrane potential, they depolarize, leading to the opening of voltage - gated calcium channels and release of excitatory amino acids into the extracellular space. this cascade of events leads to a massive entry of calcium and this increase in free cytosolic calcium is transmitted to the matrix of mitochondria by ca channels and exchangers located on the inner mitochondrial membrane. recently er stress was found to be one of the effects of excitotoxicity, that is, exposure to toxic levels of excitatory neurotransmitters, with release of ca from the er via both ryanodine receptors and ip3r, with release from inositol trisphosphate receptors (ip3rs) leading to mitochondrial ca overload and activation of apoptosis. excessive increases in matrix ca alter the permeability of mitochondria and finally open the mpt pore, causing the release of cytochrome c and other proapoptotic factors into the cytoplasm. the released cytochrome c activates caspase-3, one of the executioner caspases to initiate cell death. excessive accumulation of calcium in mitochondria is a key factor in the final outcome of the cascade leading to neural cell death (figure 1(a)). mitochondria can accumulate large amounts of calcium through a ca - selective channel known as the mitochondrial ca uniporter (mcu) [12, 13 ]. it is interesting that in response to cytosolic ca transients not exceeding concentrations of 13 m, mitochondrial ca concentrations rise almost simultaneously to values above 10 m. the existence of close contact points between the er and mitochondria (the mitochondria - associated er membrane, mam) is thought to provide a selective direct pathway for calcium from the er to mitochondria. upon cell stimulation, the release of high concentrations of ca at mam leads to the formation of microdomains of high ca concentration that is crucial for efficient ca uptake by mitochondria [16, 17 ]. molecular chaperones are a functionally related group of proteins that assist protein folding in cells and protect cells from injury after cerebral ischemia or other stress. the relationship between molecular chaperones and er - mitochondrial calcium transfer after cerebral ischemia is an emerging research area and is the focus of this mini review. animal models of ischemic stroke are used to study the basic pathophysiological processes and potential therapeutic interventions in this disease ; the extension of knowledge gained from these animal models will lead to improvement of medical treatment for human ischemic stroke in the future. focal cerebral ischemia by middle cerebral artery occlusion (mcao) in rats or mice is the rodent model most immediately relevant to human stroke. using this method, transient ischemia is achieved by inserting a suture into the left middle cerebral artery, temporarily blocking blood flow to the middle cerebral artery territory, and removing the suture to allow reperfusion after a duration of minutes to hours depending on the specific study [9, 19, 20 ]. glucose deprivation (gd) and combined oxygen - glucose deprivation (ogd) are common in vitro models of brain ischemia. either cell cultures or slice cultures are subjected to medium lacking glucose, and in the case of ogd, also placed in a chamber with very low oxygen levels for a fixed period of time [19, 2126 ], followed by restoration of oxygen and glucose to the medium to imitate reperfusion. molecular chaperones were originally defined as a functionally related group of proteins that assist protein folding in bacterial, plant, and animal cells. the heat shock proteins of the 70 kda molecular weight family (hsp70), including hsp72 (cytosol), grp75/mortalin (mitochondria), and grp78/bip (endoplasmic reticulum ; er), are highly evolutionarily conserved and have been extensively studied. studies, including those from our laboratory, show that all three of these hsp70 family members are protective in both in vivo and in vitro models of stroke [19, 2732 ]. it has been a long - standing observation, as documented for hsp72 [3335 ] and grp75, that cells destined to die fail to produce heat shock proteins, while cells that survive make new heat shock proteins. we recently identified translational arrest of grp78 due to microrna181 in focal cerebral ischemia in the mouse. although grp78 mrna was induced following mcao both in the core and outside the infarcted area, grp78 protein was only induced in the penumbra, not within the area of infarction. recently a more complex, integrating role of these proteins has been recognized, that of stabilizing intracellular morphological and functional networks through protein - protein interactions with numerous client proteins [3739 ]. this chaperoning network concept is increasingly accepted as a basic regulatory mechanism in diverse cellular functions [39, 40 ]. these networks allow the cell to change phenotype by releasing client proteins from chaperones allowing them to be activated, or in some cases released and degraded. these functional adjustments are rapid, do not require protein synthesis, and facilitate calibrated and integrated adaptation to changing conditions. in addition to the new concept of the chaperone network, each individual chaperone has been found to have additional functions beyond that of functioning as a molecular chaperone. for example, grp78 is traditionally considered to be a major endoplasmic reticulum chaperone as well as a master regulator of the unfolded protein response. due to recent findings that significant amounts of grp78 are present on the surface of cancer cells, it has emerged as an important regulator of tumor cell viability signaling, and cell surface grp78 is now being used for therapeutic targeting. in addition to grp78, the er calcium - binding protein calreticulin has also been shown to traffic to the plasma membrane and be involved in regulation of cell death [42, 43 ]. grp78 plays a critical role in physiologic and pathologic stress, including developmental and neurological disorders. as a multifunctional receptor on the cell surface because of its multiple locations and functions, grp78 may play a central role in the chaperone network. hsp72 also protects brain by regulating distinct pathways of apoptosis and inflammation which both contribute to outcome after cerebral ischemia (for review see). other er proteins also participate in cell death regulation, and function outside the er. although the association of endoplasmic reticulum (er) with mitochondria was first observed in the 1960s by several independent groups [49, 50 ], morphological evidence for the physical association or interaction between the er and mitochondria first emerged in the early 1990s. such contact has since been observed in mitochondria in many types of cell [51, 52 ]. structural and functional interactions of mitochondria with the er have been demonstrated for rat brain. the close contacts through which er communicates with mitochondria er and the outer mitochondrial membrane (omm) was originally estimated to be approximately 100 nm [51, 52 ]. however, a more recent study using electron tomography showed that the minimum distance is even less, 10 nm at the smooth er and 25 nm at the rough er. actually the spacing between the er and mitochondria changes with different cell physiological and pathological conditions [56, 57 ] and artificial modification of this contact can lead to er stress. numerous proteins have recently been proposed to participate in the interaction and communication between the mitochondria and the er, highlighting the emerging role of this region in bioenergetics, cell survival, and cell death [58, 59 ]. one important structure is the ip3r on the er and the voltage - dependent anion channel (vdac) on the omm which are now thought to be physically coupled through the chaperone grp75/mortalin (figure 1(b)). the sigma-1 receptor (sig1r) chaperone is enriched in the mam fraction [6164 ] and recruits grp78. in addition, other ca - binding er resident chaperones have been found in the mam fraction, for example, calnexin (cnx), calreticulin, and erp44 [6567 ]. the multifunctional cytosolic sorting protein pacs-2 is another protein that has been found in the mam fraction. this fraction can also contain adenine nucleotide translocase (ant) and cyclophylin d, the components of mitochondrial contact sites with similar composition to the mitochondrial permeability transition pore (mptp). such close apposition of the mptp to the er can sensitize mitochondria to ca signals. recently, the mitochondrial gtpase mitofusin 2 has been shown to be enriched in mam as well as localized on the er, where it interacts with mitofusins on mitochondria to form interorganellar bridges. mam can be isolated from tissues and cells to investigate the mechanisms and functions involved [60, 71 ]. briefly the procedure consists of two steps : a crude mitochondrial fraction is isolated from tissue or cells by differential centrifugation, and the crude mitochondria are fractionated to the pure mitochondria and mam fraction by percoll density gradient. it is commonly accepted that the main structure responsible for er - mitochondrial calcium transfer at the mam is composed of the ip3r on the er, vdac on the omm and mcu on the imm (figure 1(b)). ca released upon activation of the ip3r at the er is taken up into mitochondria via vdac and then mcu [72, 73 ]. a major function of mam is the control of ca signaling between er and mitochondria, a central topic of major interest both in normal physiology and pathophysiology. this second messenger has been proposed to have multiple roles in modulating intracellular events including bioenergetics and autophagy. constitutive calcium release via the ip3r was found to be essential for maintaining normal bioenergetics and suppressing autophagy in conditions of ready nutrient availability. in contrast during er stress, ca increase seems to be required for triggering autophagy, though calcium - independent routes to induce autophagy involving interaction of ip3r with beclin have also been reported, and lack of ca release via the ip3r can also induce autophagy. thus the role of calcium is complex, and induction of autophagy reflects combined input from ca dependent and independent pathways (see recent review). under prolonged er stress conditions, as happens in the ischemic core after cerebral ischemia, a slow but sustained increase in mitochondrial matrix free [ca ] can occur, which can reach a critical threshold to trigger the opening of mptp and initiate the apoptotic cascade (figure 1(a)). some studies indicate that the induction of apoptosis by er stress has a mandatory mitochondrial component, further highlighting the intimate connection between these two organelles. the er can play an important role in regulating apoptosis by adjusting the load of ca imposed upon the mitochondrion. previous studies have shown that the reduction in the ca amount that can be released from er to mitochondria decreases the probability of ca - dependent apoptosis. on the other hand, conditions that increase er ca storage have the opposite effect on ca - dependent apoptosis [7982 ]. it has been demonstrated that overexpression of the antiapoptotic protein bcl2 can influence the distribution of ca within the er / mitochondrial complex. knockout of the proapoptotic proteins bax and bak reduced the resting concentration of er ca decreasing the uptake of ca by mitochondria after ca release from the er. the active form of the antiapoptotic protein akt results in reduced er ca release, and diminished cellular sensitivity to ca - mediated apoptotic stimuli [79, 82 ]. antiapoptotic proteins bcl2 and akt affect er calcium homeostasis by differential mechanisms : bcl2 overexpression increases the ca leak from the er, while akt hyperactivation induces a decrease in er ca release, probably through phosphorylation of the ip3r [58, 80 ]. some important chaperones are enriched in mam and may play a key role in regulating ca signaling between er and mitochondria. it was found that the mitochondrial chaperone grp75 regulates ip3r - mediated mitochondrial ca signaling. it was demonstrated that isoform 1 of vdac is physically linked to the er ca - release channel ip3r through grp75, highlighting chaperone - mediated conformational coupling between the ip3r and the mitochondrial ca uptake machinery (figure 1(b)). we have found that overexpression of grp75 improved mitochondrial function after in vivo and in vitro cerebral ischemia [31, 83 ]. er protein sig1r, implicated in neuroprotection, carcinogenesis, and neuroplasticity, is a ca - sensitive and ligand - operated receptor chaperone at the mam. normally, sig1r forms a complex at the mam with another er chaperone grp78/bip (figure 1(b)). upon er ca depletion or after ligand stimulation, sig1r can dissociate from grp78 and begin to chaperone conformationally unstable ip3r (figure 1(b)) to enhance ca signaling from the er into mitochondria to increase the production of atp in the cell through the tricarboxylic acid cycle in the mitochondria. if stimulated by high concentrations of agonists or impacted by extreme er stress, sig1rs translocate from the mam to the plasma membrane to bind various ion channels, receptors, or kinases [63, 8486 ] an increase of sig1r in cells counteracts er stress, whereas decreased levels enhance apoptosis. recent evidence indicates that grp78, like sig1r, may emerge as a novel interorganelle signaling modulator. as a multifunctional receptor on the cell surface after stress, grp78 may be associated with many signaling pathways. however, until now there has been no detailed research on the importance of grp78 in mam except as a binding partner of sig1r (figure 1(b)). grp78 has been found to be one of the vdac interactors (table 1 in) together with grp75, although the authors of the paper never discuss it in the text. we recently found that overexpressing grp78 preserves respiratory activity and mitochondrial membrane potential, reduces free radical production, reduces mitochondria ca overload, and increases ca uptake capacity in isolated mitochondria after stress. in order to follow grp78 directly in response to ischemia - like stress, we created a fusion protein consisting of green fluorescent protein (egfp) fused between the grp78 n - terminal 18 amino acid er signal peptide and the remainder of grp78. we found that egfp - grp78 retargets to mitochondria within a short period of gd by fluorescence and immunoelectron microscopy (iem) as well as western blotting (figure 2). the mitochondrial location of grp78 is mainly on the inner membrane of mitochondria by iem (figure 2(c)). a prior report in 9l tumor cells has demonstrated relocalization of grp78 to mitochondria after induction of er stress by thapsigargin. as in the case of translocation to the cell surface, cytoplasm, and nucleus after stress, the molecular mechanism underlying grp78 translocation to mitochondria has not yet been elucidated. the mitochondrial ca uniporter is the primary influx pathway for ca into respiring mitochondria, and hence is a key regulator of mitochondrial ca. although the uniporter 's biophysical properties have been studied extensively, its molecular composition remained elusive for more than 50 years. a very recent report has identified a 40-kda protein which fulfills the requirements for being the long sought mitochondrial calcium uniporter. overexpression of mcu alone in one report did not give rise to a marked gain of ca uptake in hela cells indicating that additional components or chaperones may be limiting in some settings, though other investigators did observe increased ca with overexpression. the mcu is thought to function as part of a complex including at least micu1. considering the fact that overexpressing grp78 not only reduces mitochondria ca overload in intact cells, but also increases ca uptake capacity in isolated mitochondria, it is possible that translocated grp78 interacts with the uniporter in some way on the imm and regulates the mitochondrial ca. future validation of the hypothesis depends on further development of molecular approaches to confirm this property of mcu and its relationship with grp78. in summary these findings together support a new emerging picture : chaperone machineries at both the er and mitochondrion orchestrate the regulation of ca signaling between these two organelles and control bioenergetics, cell survival, and cell death decisions. in the brain, er calcium release has been found to directly contribute to excitotoxicity, a neuronal death mechanism important both in acute and chronic neurodegenerative diseases. better understanding the roles of chaperones and ca handling in vivo should in the future provide new therapeutic strategies to protect brain cells during ischemia. | it is commonly believed that sustained elevations in the mitochondrial matrix ca2 + concentration are a major feature of the intracellular cascade of lethal events during cerebral ischemia. the physical association between the endoplasmic reticulum (er) and mitochondria, known as the mitochondria - associated er membrane (mam), enables highly efficient transmission of ca2 + from the er to mitochondria under both physiological and pathological conditions. molecular chaperones are well known for their protective effects during cerebral ischemia. it has been demonstrated recently that many molecular chaperones coexist with mam and regulate the mam and thus ca2 + concentration inside mitochondria. here, we review recent research on cerebral ischemia and mam, with a focus on molecular chaperones and er - mitochondrial calcium transfer. |
improvements in the health care system have contributed to an increasingly aged population and a higher prevalence of various chronic disorders and multimorbidity.1,2 one study in australia showed that multimorbidity was commonly associated with psychiatric problems.3 up to one - third of patients in a primary care setting complained of medically unexplained symptoms (mus).4 agera reported that the prevalence of undiagnosed mood disorders in patients with unexplained chronic pain in primary care was 80.4%. it has been reported that a number of physical symptoms are associated with psychiatric disorders, and that some particular symptoms are predictive of psychiatric disorders.68 patients with somatic symptoms caused by psychiatric disorders tend to frequently change doctors without referral, seek unnecessary examinations, receive treatment without consulting psychiatrists, or visit a tertiary hospital directly.9 failure to recognize the psychiatric disorder has been associated with undertreatment, greater impairment, and longer duration of illness.7,10 the international classification of primary care, second edition (icpc-2) allows for the coding of reasons for encounters in an episode of care, applied to both physical and mental issues, specifically for use in primary care.1113 the episode constructor (epicon), which is a useful computerized system for grouping diagnoses and estimating morbidity from electronic medical records, has already been established in northwestern europe, sweden, denmark, and the netherlands.14,15 because such a system has yet to be developed in japan, icpc coding has been performed by checking all pertinent medical documents despite the cost in terms of time and effort involved. even though a large - scale study could not be conducted, there have been several reports that reveal the frequency of reasons for encounters in some primary care settings in japan.16,17 icpc-2 was translated into japanese and its broad use was attempted by the icpc working team of the japan primary care association, because icpc coding was thought to be useful for understanding the medical needs in the primary care setting. the role of general practitioners (gps) in mental health care has been increasing because of the rising burden of mental disorders.1820 gps are expected to become gatekeepers for patients with psychiatric disorders whose somatic symptoms have not been diagnosed as mental problems.21 yamada assessed the accuracy of a family physician s diagnosis of depression and alcoholism. integrated care of mental health by gps was reported to improve patient satisfaction.22 taking these changes in mental health care into consideration, evidence useful in the prediction of mental disorders would be very welcome and research should also be advanced in japan, which is a special setting characterized by certain features, such as easy access to any medical provider. this study was undertaken to clarify the relationship between symptoms and psychiatric disorders in a general internal medicine (gim) outpatient division in a university hospital using icpc-2 to code the symptoms and diagnoses of outpatients. the number of outpatients in the gim division was 1,541 from january june 2012. we identified the 1,209 participants who complained of new symptoms after excluding any returning patients who consulted us for the same symptom as in the previous month. we excluded the patients who came only to receive prescriptions (number [n ] = 6), family consultation (n=6), examination only (n=1), and medical certification only (n=1). the final number of eligible participants was 1,194 for this study (figure 1). the jichi medical university hospital (tochigi, japan) has 1,132 beds and provides not only advanced medical care, but also primary care for the local community. it diagnoses and treats patients with common disorders, multiple health problems, or symptoms of unknown origin. while the percentage of patients with referral for the entire hospital is 60%, that for our division is 30%. japan has a public health insurance system covering most of the population, allowing them to consult all types of health care providers and to consult most physicians without referral.9 the outpatients without referral are guided to make a brief stop at the information counter where a doctor recommends the most appropriate department or division for their consultation. those who need to see generalists are recommended to visit the division of gim. some of these patients often have fears regarding their own symptoms because no doctors approached or managed their health problems of unknown origin. therefore, they started to insist on obtain ing a guaranteed high level of service. the role of gim is thought to include the management of mental problems that cause physical symptoms. we evaluated symptoms and diagnoses from the patients medical records and coded them according to the icpc-2.23 the icpc-2 code consisted of 17 chapters (a z) and seven components, including symptoms and diagnoses. six physicians who practice in the outpatient clinic of the gim division attended a tutorial about coding by icpc-2. in the tutorial, they were informed of the methods extracting symptoms and diagnosis from medical documents and coding them in icpc. two investigators later checked all coded data sheets for accuracy. if a discrepancy in the coding between investigators was found, one author (jm), who is a member of the icpc working team of the japan primary care association, provided the final classification code. if the patients had multiple symptoms, we selected the symptom noted first by a physician and coded it for the analysis. we gave a final diagnosis and coded it after we checked the current medical history and the following medical documents as well. those diagnoses and the coding of psychiatric disorders were not obtained by psychological tests, but by clinical diagnoses by the gps or the result of psychiatric consultation. if the participants had at least one psychiatric diagnosis, they were defined as having a psychiatric disorder regardless of the existence of other diagnoses. a comparison of various characteristics between the groups with and without a psychiatric disorder was performed using the chi - squared test for nominal variables and the student s t - test for continuous variables. the odds ratio (or) and 95% confidence intervals (ci) were calculated by multivariable logistic regression to evaluate the risk of having a psychiatric disorder for the participants with each symptom. we analyzed the association between common somatic symptoms and psychiatric disorders using multivariable logistic regression analysis adjusted by sex, age, and the presence of multiple symptoms. the statistical analyses were performed using the spss version 19.0 (ibm corporation, armonk, ny, usa) computer software package. the number of outpatients in the gim division was 1,541 from january june 2012. we identified the 1,209 participants who complained of new symptoms after excluding any returning patients who consulted us for the same symptom as in the previous month. we excluded the patients who came only to receive prescriptions (number [n ] = 6), family consultation (n=6), examination only (n=1), and medical certification only (n=1). the final number of eligible participants was 1,194 for this study (figure 1). the jichi medical university hospital (tochigi, japan) has 1,132 beds and provides not only advanced medical care, but also primary care for the local community. it diagnoses and treats patients with common disorders, multiple health problems, or symptoms of unknown origin. while the percentage of patients with referral for the entire hospital is 60%, that for our division is 30%. japan has a public health insurance system covering most of the population, allowing them to consult all types of health care providers and to consult most physicians without referral.9 the outpatients without referral are guided to make a brief stop at the information counter where a doctor recommends the most appropriate department or division for their consultation. those who need to see generalists are recommended to visit the division of gim. some of these patients often have fears regarding their own symptoms because no doctors approached or managed their health problems of unknown origin. therefore, they started to insist on obtain ing a guaranteed high level of service. the role of gim is thought to include the management of mental problems that cause physical symptoms. we evaluated symptoms and diagnoses from the patients medical records and coded them according to the icpc-2.23 the icpc-2 code consisted of 17 chapters (a z) and seven components, including symptoms and diagnoses. six physicians who practice in the outpatient clinic of the gim division attended a tutorial about coding by icpc-2. in the tutorial, they were informed of the methods extracting symptoms and diagnosis from medical documents and coding them in icpc. after the tutorial, they coded the medical documents of the participants. two investigators later checked all coded data sheets for accuracy. if a discrepancy in the coding between investigators was found, one author (jm), who is a member of the icpc working team of the japan primary care association, provided the final classification code. if the patients had multiple symptoms, we selected the symptom noted first by a physician and coded it for the analysis. we gave a final diagnosis and coded it after we checked the current medical history and the following medical documents as well. those diagnoses and the coding of psychiatric disorders were not obtained by psychological tests, but by clinical diagnoses by the gps or the result of psychiatric consultation. if the participants had at least one psychiatric diagnosis, they were defined as having a psychiatric disorder regardless of the existence of other diagnoses. a comparison of various characteristics between the groups with and without a psychiatric disorder was performed using the chi - squared test for nominal variables and the student s t - test for continuous variables. the odds ratio (or) and 95% confidence intervals (ci) were calculated by multivariable logistic regression to evaluate the risk of having a psychiatric disorder for the participants with each symptom. we analyzed the association between common somatic symptoms and psychiatric disorders using multivariable logistic regression analysis adjusted by sex, age, and the presence of multiple symptoms. the statistical analyses were performed using the spss version 19.0 (ibm corporation, armonk, ny, usa) computer software package. the participants ages ranged from 15 to 92 years (mean age : 50.519.3 years) and 686 (57.5%) of the 1,209 participants were men. table 1 shows the characteristics of the study participants between those with and without psychiatric disorders. the number of symptoms in those with psychiatric disorders was greater than that in those without them, and the proportion of the participants with two or more symptoms among those with psychiatric disorders was greater than among those without the disorders. of those, the most frequent diagnoses were p76 (depression ; 19.6%), p99 (psychological disorders, other ; 16.2%), p74 (anxiety disorder ; 14.9%), p75 (somatization ; 14.2%), and p06 (sleep disturbance ; 11.5%). the p99 was defined to include an unspecified status that was attributed to psychosomatic factors. table 3 shows the risk of having a psychiatric disorder for those participants with common somatic symptoms. the participants with psychiatric symptoms showed obvious sleep disturbance (or = 73.99 ; 95% ci : 8.97609.96). the presence of particular physical symptoms was associated with having a psychiatric disorder, as compared with their absence after adjusting for sex, age, and the presence of multiple symptoms (or = 4.98 [95% ci : 1.6614.89 ] for palpitation ; or = 4.36 [95% ci : 2.059.39 ] for dyspnea ; or = 3.46 [95% ci : 1.438.36 ] for tiredness ; and or = 2.99 [95% ci : 1.755.13 ] for headache). in our study, participants in whom palpitation, dyspnea, tiredness, or headache was identified were more likely to have psychiatric disorders. various patient factors might explain why many patients with a psychiatric disorder complained of only physical symptoms. first, they may not be good at expressing their own mental condition.24 additionally, they may want to be reassured by consulting a health service and being examined repeatedly, because of a fear that they are suffering from a serious physical illness.25 physician factors might include an inappropriate patient physician relationship that may not provide an opportunity for patients to express their psychiatric symptoms to physicians. gps at university hospitals, who often encounter such difficult patients, should be competent to exclude critical illness and determine the possibility of psychiatric disorders.2628 rasmussen reported that headache, chest pain, dizziness, sleep disturbance, dyspnea, and tiredness were significantly related to the presence of psychiatric disorders in rural primary care adults. these symptoms were similar to those found in our study with the exception of palpitation. barsky reported that 29% of 82 outpatients who complained of palpitation without any abnormalities on ambulatory electrocardiographic monitoring had a current psychiatric disorder, and 83% of these patients had major depression or panic disorder. ie, ischemic heart disease, cardiac failure, ventricular arrhythmia, atrial fibrillation, atrial flutter, pulmonary embolism, other pulmonary disorders, or hematological or metabolic disorders. han reported that the presence of the urge to breathe, affective dyspnea, anxiety, and tingling pointed to a diagnosis of mus, whereas the reporting of wheezing, cough and sputum, and palpitation were more likely to be due to cardiopulmonary diseases causing dyspnea. one limitation of our study was that the number of participants was relatively small for identifying the symptoms predictive of psychiatric disorders. the lack of an automatic conversion system for coding the icpc from the medical records made it difficult to collect sufficient data. the prevalence of psychiatric disorders was 12.1% in our study, while it was 22.6% in rasmussen s study using the primary care evaluation of mental disorders (prime - md) in all the outpatient primary care adults.7 olivera reported that the prevalence of psychiatric disorders was 46.1% in the elderly, as determined by psychogeriatric screening instruments. the proportion of participants with psychiatric disorders in our study might have been underestimated because the diagnoses of psychiatric disease were based on clinical interviews alone. in conclusion, not only psychiatric symptoms, but also palpitation, dyspnea, tiredness, and headache, were associated with the physical symptoms of psychiatric disorders in outpatients consulting the gim division at one japanese university hospital. the diagnostic accuracy of psychiatric disorders in patients with mus could lead to appropriate treatment and health care cost reduction. | purposegeneral practitioners have an important role in diagnosing a variety of patients, including psychiatric patients with complicated symptoms. we evaluated the relationship between physical symptoms and psychiatric disorders in general internal medicine (gim) outpatients in a japanese university hospital.materials and methodswe coded the symptoms and diagnoses of outpatients from medical documents using the international classification of primary care, second edition (icpc-2). the participants were new outpatients who consulted the gim outpatient division at jichi medical university hospital in tochigi, japan from january june, 2012. we reviewed all medical documents and noted symptoms and diagnoses. these were coded using icpc-2.resultsa total of 1,194 participants were evaluated, 148 (12.4%) of whom were diagnosed as having psychiatric disorders. the prevalence of depression, anxiety disorder, and somatization was 19.6% (number [n ] = 29), 14.9% (n=22), and 14.2% (n=21), respectively, among the participants with psychiatric disorders. the presence of several particular symptoms was associated with having a psychiatric disorder as compared with the absence of these symptoms after adjusting for sex, age, and the presence of multiple symptoms (odds ratio [or ] = 4.98 [95% confidence interval { ci } : 1.6614.89 ] for palpitation ; or = 4.36 [95% ci : 2.059.39 ] for dyspnea ; or = 3.46 [95% ci : 1.438.36 ] for tiredness ; and or = 2.99 [95% ci : 1.755.13 ] for headache).conclusionnot only the psychiatric symptoms, but also some physical symptoms, were associated with psychiatric disorders in gim outpatients at our university hospital. these results may be of help to general practitioners in appropriately approaching and managing patients with psychiatric disorders. |
to assess trends in meningococcal strain carriage, and to determine the immediate effect of the menacwy vaccine on carriage of menw / y strains, we conducted a cross - sectional study in first - year students at the uon from registration during september 2015 through march 2016. menacwy vaccination coverage in this student population increased from 31% (preregistration) to 70% (immediately postregistration) as a result of a campus - based vaccination campaign targeting freshmen (12). the study was approved by the research ethics committee at the uon, and written informed consent was obtained from all participants. we recruited convenience samples of first - year students in september and november 2015 and march 2016. in september, students were recruited during registration ; in november and march, students were recruited in 5 dormitories (a e) with single - occupancy rooms. we searched the uon health service registration database (emis web software ; emis health, leeds, uk) to determine vaccination status in registered first - year students on arrival at the uon and after the campus - based vaccination campaign. in september, we obtained pharyngeal swab specimens from eligible students immediately before they received the menacwy vaccine. we immediately inoculated all pharyngeal swabs onto gc selective agar (oxoid, basingstoke, uk) and incubated them at 37c in air containing 5% co2. after 24 and 48 hours, we selected oxidase - positive colonies suggestive of neisseria spp. and confirmed their identity by amplification of the meningococcal gene crga plus ctra and/or pora, as described previously (13). the meningococcal reference unit, public health england, manchester, uk, performed serogrouping and serotyping of menw isolates using dot - blot enzyme immunoassay. we performed tests for significance by using statcalc (epi info version 7.2.0.1 ; centers for disease control and prevention, atlanta, ga, usa). the september sample of 769 first - year students represented 10.9% of the 7,049 first - year students registered in 2015. carriage rates among this group increased from 14% in late september 2015 to 39% by mid - november 2015 and 46% in march 2016 (technical appendix table 1). the characteristics of enrolled students and behavioral risk factors for carriage were similar at the 3 time points. the initial carriage rate of 14% was much lower for first - year students in september 2015 than in september 2009 (23.2% ; = 34, df = 1 ; p<0.00001) (3), suggesting a reduction in meningococcal carriage in adolescents in the united kingdom, possibly attributable to an alteration in risk factors for carriage. the meny carriage rate for incoming students (1.8%) was also lower than that detected in 2009 (2.9% ; = 2.0, df = 1 ; p = 0.15) (3). in september 2015, carriage rates were 4.2% for genogroup capsule null locus (cnl), 3.3% for b, 1.8% for y, and 0.7% for w strains. a substantial part of the increase in carriage from september 2015 through march 2016 was the result of a notable increase (0.7% to 8.0%) in carriage of menw strains (technical appendix table 1). no change in the carriage of meny strains was detected (technical appendix table 1). of the 50 students colonized with menw, 36 (72%) had received menacwy vaccine either before or during registration, which is consistent with the overall menacwy coverage in our first - year student cohort. students colonized with menw at the second and third sampling times were distributed across all 5 dormitories, suggesting widespread dissemination, and 21 (91%) of the menw carriers in the last time point (march 2016) had been vaccinated at least 5 months before sampling (technical appendix table 2). analysis of the genogroup w isolates showed that 47 (90%) of 52 were serotype 2a (technical appendix table 1) and harbored alleles for factor h binding protein peptide 22 and pora p1.5,2, identical to the corresponding alleles harbored by the menw : st-11 clone responsible for the increase in invasive menw disease in the united kingdom (5). we examined capsular expression by serogrouping and found 32 (62%) of the menw isolates expressed the w capsular polysaccharide. of the 21 menw carriers in march 2016 who had been vaccinated at least 5 months before sampling, 15 (71%) were harboring isolates expressing the w capsule (technical appendix table 2). we detected a rapid rise in carriage of menw among first - year students in a university setting in the united kingdom. in comparison, carriage of menc in adolescents and young adults in the united kingdom, including in university students, was rare before the introduction of menc monovalent conjugate vaccines (9). the rise in menw carriage is most likely due to acquisition within student dormitories or social spaces on campus but was unexpected because no such isolates were found in a similar study at the uon in 200809 (15), and only a limited number in a multicenter carriage study involving uk universities in 201011 (6,10). the increase in menw carriage among university students merits further monitoring because it could contribute further to the sustained increase in menw disease in the united kingdom. students attending universities exhibit high mobility and may represent an ongoing vehicle for amplification and spread of menw into communities throughout the united kingdom or beyond, with implications for vaccination policy and future research. characteristics of meningococcal carriage in first - year university students and menw carriers in each of 5 dormitories and their respective menacwy vaccination status, university of nottingham, uk, 201516 | menacwy conjugate vaccination was recently introduced in the united kingdom for adolescents and young adults to reduce disease from infection by neisseria meningitidis group w. we conducted a cross - sectional meningococcal carriage study in first - year uk university students. despite 71% menacwy vaccine coverage, carriage of group w increased substantially. |
piceatannol (3,3,4,5-tetrahydroxy - trans - stilbene) is a polyphenol found in food sources such as grapes, berries, peanuts, and sugar cane [14 ]. subsequent experiments showed that piceatannol displays antioxidant [6, 7 ], anti - inflammatory [8, 9 ], and anticarcinogenic properties [1012 ]. in cell model studies, piceatannol prevented tnf - induced nfb activation [9, 13, 14 ], by controlling the oxidoreductive status of cysteine-179 in ikk. suppression of lung metastasis occurred in lewis - lung - carcinoma - bearing mice fed piceatannol - fortified diet. mechanistically, piceatannol has been investigated as an inhibitor for tyrosine kinases, including syk [1618 ], fak [19, 20 ], and serine / threonine kinases. furthermore, piceatannol is also used to explore the role of the mitochondrial f0f1-atpase [22, 23 ], in relation to apoptosis. recent studies show that piceatannol inhibits proliferation and induces cell cycle arrest and apoptosis in du145 cap cells [2426 ] and that the anticellular effects of piceatannol are mediated by suppression of the cyclin - dependent protein kinase activities (cdks). the mtor is a serine / threonine protein kinase that plays a crucial role in sensing the availability of nutrients for control of cell growth, generally conferring survival benefits [27, 28 ]. since mtor is frequently deregulated in cancer and because, as mentioned, piceatannol acts as a potent kinase inhibitor, it is of interest to determine whether piceatannol might affect mtor activity / expression and in turn disrupt mtor - mediated signaling events. in this study, we tested the hypothesis that piceatannol controls proliferation of both androgen - dependent (ad) and rogen - independent (ai) cap cells by targeting the expression of mtor. we also determined whether piceatannol disrupts the mtor signaling pathway in cap cells by eliciting changes in mtor and its upstream and downstream effector proteins : mtor, protein kinase akt, initiation factor eif-4e regulatory binding protein eif-4e - bp1, and ribosomal protein p70 s6 kinase. we found that piceatannol suppressed ad and ai cap cell proliferation and that its growth inhibitory activity was accompanied by reduced expression of mtor and its key effectors akt and eif4ebp-1. (beverly, ma). the primary antibodies for cyclins d1 and e, cdks 2 and 6, aif, caspase 3, cytochrome c, actin, and secondary antibodies were from santa cruz biotechnology, inc. (plymouth meeting, pa). fetal bovine serum (fbs), rpmi 1640, penicillin, and streptomycin were from cellgro, inc (herndon, va). human lncap, du145, and pc-3 cells were obtained from the american tissue culture collection (manassas, va) and cultured in rpmi 1640 supplemented with penicillin, streptomycin, and 10% heat - inactivated fbs, as described. piceatannol was dissolved in dimethyl sulfoxide (dmso) and added to the culture media at the specified dose. briefly, cells (8002000 cells / ml, 2 ml / well in 6-well plates) were incubated with increasing doses of piceatannol. colonies were stained with 1.25% crystal violet, extracted with 10% acetic acid, and quantified by spectrometry at 595 nm. cells were seeded in 6-well plates at a density of 1 10 cells / ml for lncap cells and 5 10 cells / ml for du145 and pc-3 cells. following treatment, control and cells were treated with 0, 10, and 25 m piceatannol for 72 h, washed with pbs, and stained with 1.0 g / ml dapi (sigma chemical co., st. cell cycle phase distribution was assayed by flow cytometry [31, 32 ]. multicycle software program from phoenix flow systems (san diego, ca) was used to deconvolute the cellular dna histograms and quantify the percentage of cells in the g1, s, and g2 m phases. induction of apoptosis was also assayed by flow cytometry, as the sub - g1 peak [31, 32 ]. cells were collected and lysed in ice - cold ripa buffer, which contained 50 mm tris, ph 7.4, 150 mm nacl, 1 mm edta, 1% triton x-100, 1% deoxycholate, 0.1% sds, 1 mm dithiothreitol, and 10 l / ml protease inhibitor cocktail from sigma - aldrich corp. protein concentrations of cell lysates were determined by coomassie protein assay kit (pierce, rockford, il) using bovine serum albumin bsa as the standard. for immunoblot analysis, lysates containing 10 g of protein were separated by 10% sds - gel electrophoresis, followed by transfer to nitrocellulose membranes and blocked with tbst buffer (10 mm tris, ph 7.5, 100 mm nacl, and 0.05% tween 20) containing 3% nonfat dried milk. immunoreactivity was detected by enhanced chemiluminescence (ecl) using the instructions provided by the manufacturer (kirkegaard & perry laboratories, inc., the intensity of the specific immunoreactive bands was densitometrically quantified and expressed as a ratio relative to the expression of actin. one - way anova and student 's t - test were used to determine the significance of differences in measured variables between control and piceatannol - treated cells. in previous studies by kim and coworkers, du145 cells maintained in dmem / f12 culture media supplemented with 1% charcoal - treated fbs were followed by 24 h serum deprivation and then treatment by piceatannol ; exposure to the polyphenol inhibited cell proliferation and induction of apoptosis. it was of interest to ascertain whether piceatannol exerts a similar antiproliferative activity in cap cells representing different stages of disease progression without prior serum depletion. androgen - receptor-(ar)-positive hormone - responsive lncap and ar - negative hormone - nonresponsive du145 and pc-3 cap cells were exposed to 0, 1, 5, 10, 25, and 50 m piceatannol, and effects on colony formation were determined. the addition of > 10 m piceatannol caused 50% suppression in foci forming ability in all three cell lines tested (figure 1(a)). similarly, as assayed by trypan blue exclusion, a dose - dependent inhibition of proliferation was observed in the three cell lines treated for 72 h with 0, 10, and 25 m piceatannol (figure 1(b)). the nature of growth suppression by piceatannol was next studied by measuring effects on cell cycle distribution by flow cytometry. exposure to piceatannol resulted in cell - type - dependent changes : (i) lncap cells showed g1/s arrest, evident by an increase in the g1 cell population and a corresponding diminution in s phase cells (figure 2(a)). (ii) as previously noted [25, 26 ], a significant induction of apoptosis occurred in du145 cells (figure 2(a)), although, without altering cell cycle phase transition. (iii) s phase accumulation, concomitant with reduction in percentage of g1 cells, was observed in pc-3 cells (figure 2(a)). the differential cell cycle effects elicited by piceatannol in lncap and pc-3 cells prompted us to assess the changes on the expression of cell cycle regulatory proteins by western blot analysis. as cyclins d1and e and cdk2/cdk6 play a pivotal role in controlling the cells entry from g1 into the s - phase, the changes on their expression were first measured. in lncap cells, increased cyclin d1 but suppressed cyclin e expression with relative low to undetectable expression of cdk2 and cdk6 was found in piceatannol - exposed cells (figure 2(b)), in partial support of the g1 cell arrest (figure 2(a)). for pc-3 cells, a dose - dependent reduction in cyclin d1/cdk6/cdk2 and induction of cyclin e expression were observed following treatment by piceatannol (figure 2(b)), consistent with an increase in s paralleled by a decrease in g1 phase transition (figure 2(a)). to corroborate induction of apoptosis in piceatannol - exposed du145 cells (figure 2(a)), the expression of several apoptosis - related genes was assayed. levels of parp and pro - caspase 3 were substantially decreased in cells treated for 72 h with 10 and 25 m piceatannol (figure 2(c)). other apoptosis marker changes induced by piceatannol included cleavage of matured 62-kd aif to its 57-kd product and increase in total cytochrome c (figure 2(c)). further analysis implicated dna damage as a molecular antecedent for piceatannol - induced apoptosis as phosphorylation of ser139 in histone h2ax, a marker for global dna damage [3436 ], showed a marked elevation in du145 cells treated with 10 or 25 m piceatannol (figure 2(d)). to obtain further information on piceatannol - induced growth arrest, we tested the possible involvement of mtor and mtor - linked signaling events. a dose - dependent reduction of mtor expression occurred in all three cap cells exposed to piceatannol, whereas differential expression of mtor among three cap cells was also observed (figure 3(a)). piceatannol also affected mtor downstream effectors eif-4e and eif4e - bp1 [37, 38 ]. for example, a decrease in state of phosphorylation in ser209 of eif-4e and in ser65 of eif4e - bp1 was observed in du145 cells (figure 3(b)), whereas reduced phosphorylated eif4e (ser209) was observed in lncap with undetectable changes on eif4e - bp1 (ser65), following treatment by 25 m piceatannol (figure 3(b)). in pc-3 cells, piceatannol caused downregulation of phosphorylated eif4e - bp1 (ser65) while slightly increasing phosphorylated eif4e (ser209) (figure 3(b)). we additionally tested if piceatannol affected s6 ribosomal protein levels and phosphorylation of p70-s6 kinase, both involved in control of cell proliferation, functioning as mtor downstream targets [39, 40 ]. all three cap cell lines showed undetectable p70-s6 kinase (thr389) (data not shown). however, piceatannol inhibited p - s6 (ser235/236) expression in lncap and pc-3 cells (figure 3(c)). since akt is an upstream modulator and activator of mtor [41, 42 ], we analyzed changes in akt expression. a dose - dependent suppression of total and thr308-phosphorylated akt was found in all three cap cells treated by piceatannol (figure 3(d)). we have investigated the growth suppressive activities of piceatannol by exposing cultured cells representing different stages of cap, respectively, lncap (ad), du145 and pc-3 (both ai) to the polyphenol without prior serum depletion. a dose - dependent inhibition of proliferation and clonogenicity was observed in all cap cells tested ; pc-3 cells were more effectively affected using the proliferation assay (figure 1), while most significant reduction in colony formation was found in du145 cells (figure 1). these results confirmed and extended the reported growth control and apoptotic attributes of piceatannol [25, 26 ] and suggest that this polyphenol inhibits cap proliferation irrespective of cellular dependency on hormones or culture conditions. previously, it has been reported that piceatannol exerts selectivity and potency against du145 cap cells compared to normal prostate pwr-1e cells [25, 26 ] and that it induces cell cycle arrest and apoptosis via the inhibition of cdk activity and activation of the death receptor / mitochondrial - dependent pathways, respectively [25, 26 ]. to more fully glean its anti - cap potential in du145 cell studies we have found that exposure to piceatannol resulted in (i) parp and caspase 3 changes (figure 2(c)) implicating the involvement of caspase - dependent mode of cell death, (ii) aif and cytochrome c changes (figure 2(c)) implicating the involvement of mitochondria - dependent, caspase - independent mode of cell death, (iii) increased histone h2ax ser139 phosphorylation (figure 2(d)) suggesting coupling between induction of apoptosis with piceatannol - elicited dna damage, and (iv) disruption of mtor signaling, as evident by downregulation of akt, mtor, and eif-4e - bp1 protein expression. furthermore, suppression of proliferation and differential downregulation of akt / mtor expression were also found in lncap and pc-3 cells treated with piceatannol. the demonstration that piceatannol induces marked reduction in akt and mtor levels in cap cells (figure 3) is significant and suggests a novel mechanism by which this polyphenol acts as a dietary agent for chemoprevention of cap. conceivably, piceatannol may affect cap cell proliferation by targeting protein synthesis, mediated in part through the akt / mtor / eif-4e - bp1 pathway. akt is robustly activated in various cancers and the akt signaling cascade is well integrated with growth - factor - mediated pathways in cap, having implications in cap survival and development [41, 43 ]. there is a wealth of evidence in support of the profound role mtor plays in cap. for example, inhibitors of the mtor pathway have been shown to restrict cap cell proliferation. furthermore, suppression of mtor by rapamycin effectively reverses akt - dependent prostatic intraepithelial neoplasia (pin) in mouse model studies. since mtor also acts as a molecular sensor and enforcer of cellular responses to changes in growth factors and nutrient status of the cell, by turning on the synthesis of proteins including those critically involved in the control of growth and cell cycle phase transition [44, 45 ], we assayed changes in one of the downstream translational effectors of mtor, eif-4e, and eif-4e - bp1 known to be involved in mrna assembly into productive initiation complexes in eukaryotic protein synthesis. both were found to be modulated by piceatannol, suggesting that this dietary agent acts by regulating the dynamics of interplay between the engagement and sequestration of initiation factors with a dominant role in mrna binding and translation and in the regulation of specific mrna recruitment from mrna - ribonucleoprotein particles for participation in protein synthesis and growth control. one aspect of our current hypothesis is that the mtor signaling pathway is a potential target of piceatannol and that cap showing propensity for activation by mtor might be selectively responsive to treatment by piceatannol. | the polyphenol piceatannol has shown inhibition against tyrosine and serine / threonine kinases. whether piceatannol also exerts activity on the mammalian target of rapamycin (mtor), a kinase involved in growth control of eukaryotic cells, is not known. in this study, we tested the effects of piceatannol on proliferation of androgen - dependent (ad) lncap and androgen - independent (ai) du145 and pc-3 prostate cancer (cap) cells. suppression of ad and ai cap cell growth by piceatannol was accompanied by cell cycle blockade in g1/s and s phases for lncap and pc-3 and induction of apoptosis in du145 cells. induction of apoptosis by piceatannol in du145 cells was evident by reduced expression of poly(adp - ribose) polymerase (parp), cleavage of caspase 3 and apoptosis inducing factor aif, and an increase in cytochrome c. the apoptotic changes occurred in concordance with dna damage, supported by increased phosphorylated histone h2ax. immunoblot analyses showed that exposure of different - stage cap cells to piceatannol also resulted in cell - type - specific downregulation of mtor and its upstream and downstream effector proteins, akt and eif-4e - bp1. we propose that the observed akt and mtor changes are new targets of piceatannol possibly contributing to its inhibitory activities on proliferation of cap cells. |
the investigation of ionic liquids, which are organic salts with low melting points, has exhibited a dramatic growth over the past decade.1 since ionic liquids possess many fascinating and unique properties, such as very low vapour pressures, high thermal stability and excellent solvation properties, they have been under investigation with a great deal of interest for chemical synthesis, electrochemistry, lubrication and catalysis. to date, the majority of the research work, particularly in the fields of surface characterisation and ultrahighvacuum (uhv) studies, has been mainly focused on imidazolium2 and pyrrolidiniumbased ionic liquids.3 pyridiniumbased ionic liquids have attracted more interest recently, mainly because of their proposed application in many processes, such as chemical reactions,4 lubricant additives,5 co2 capture6 and fuel desulfurization.7 they are considered as lowcost alternatives to imidazoliumbased ionic liquids.8 compared to imidazoliumbased ionic liquids, pyridiniumbased ionic liquids exhibit better thermal stabilities,9 higher viscosities,7 slightly lower densities and similar surface tensions.10 the excellent thermal stability is the huge advantage of pyridiniumbased ionic liquids,9, 11 which also suggests that they may be investigated using a wide range of uhv techniques. xray photoelectron spectroscopy (xps) is now accepted as a reliable method for the characterisation of ionicliquidbased systems.2h the focus of xps studies is mainly the confirmation of the surface composition of ionic liquids and the identification of the electronic environments of certain elements present in the sample.12 binding energies, which give the experimentalist a measureable indicator of charge density, and hence charge distribution, can be easily determined for simple ionic liquids, mixtures and also for solutions, as long as the solute concentration is sufficient to be detectable by xps.2 g, i k, 3a, 13 in particular, cation anion interactions of both simple ionic liquids and mixtures have been probed by using xps.2 g, k, 3a these results have successfully been correlated with nmr spectroscopy2 g and kamlet surface charging, as a result of the outgoing photoelectron flux, has been noted in the measurement of xp spectra of more viscous ionic liquids, and hence the development of robust fitting models and reliable chargecorrection strategies has become essential to allow an intersystem comparison.2i, j, 3a in this study, we investigate eight 1alkylpyridiniumbased ionic liquids ([cnpy][a ]) by using xps (see table 1). we also investigate a mixture. a reliable fitting model is developed for the c 1s region of [cnpy][a ], which applies to all ionic liquids studied here and that we believe will apply to all ionic liquids of this type. shakeup / off phenomena are determined for both c 1s and n 1s spectra. anion interactions are investigated for both simple ionic liquids and an ionic liquid mixture ; the effect of the anions on the electronic environment of the cation is explored in detail. throughout the study, comparisons are made to imidazoliumbased and pyrrolidiniumbased ionic liquids. in particular, a detailed comparison is made between [c8py][a ] and 1octyl3methylimidazolium ([c8c1im][a ]) and 1octyl1methylpyrrolidinium ([c8c1pyrr][a ]) based analogues, where a is common for all samples. the publisher did not receive permission from the copyright owner to include this object in this version of this product. please refer either to the publisher 's own online version of this product or the printed product where one exists. all the ionic liquids investigated herein were prepared following established synthetic protocols, [c8py]br,15 [c8py][pf6],15 [cnpy][tf2n],8a where n=2, 4, 6, 8, 10 and 12. the structures of the individual cations and anions investigated in this study are shown in table 1. unless otherwise stated, all ionic liquids were characterised by h and c nmr spectroscopy. the spectra were recorded on a bruker dpx300 spectrometer at 300 and 75 mhz, respectively, as solutions in cdcl3 or [d6]dmso. if anion exchange was one of the synthetic steps, ion chromatography showed that the halide concentration was [pf6]>br. therefore, more charge is transferred from the anion to the cation for the more basic anion, br. these results are in agreement with those for imidazolium2 g, j and pyrrolidiniumbased ionic liquids.3a xp spectra for [c8py][tf2n ], [c8py][pf6 ] and [c8py]br of a) c 1s, b) n 1s. the intensities are normalised to the intensity of the ncation 1s fitted peak for [c8py][tf2n ]. all the xp spectra were chargecorrected by referencing the aliphatic c 1s component (caliphatic 1s) to 285.0 ev. mixtures of ionic liquids have previously been studied by using xps to investigate both surface composition26 and binding energy shifts.2k, 3a a 1:1 mixture of [c8py][tf2n]:[c8py]br was chosen because firstly the simple ionic liquids have been studied, and secondly, the anions have relatively different basicities. the differences in basicity for the two anions are sufficiently large so that the differences in binding energies of chetero 1s and ncation 1s are larger than the magnitude of the error of the experiment. the same cation was chosen to keep the number of variables at a minimum and enable relatively simple and accurate charge referencing. the xp spectra for c 1s, n 1s and br 3d5/2 are given in figure 4. the binding energies of chetero 1s and ncation 1s for the mixture are different to those of the simple ionic liquids, in between those for the two simple ionic liquids (figures 4 a and 4 b). however, the peaks for nanion 1s and br 3d5/2 show no binding energy deviations for the mixture from the simple ionic liquids (figures 4 b and 4 c). these results show that the electronic environment of the cation can be tuned to a desired value by varying the amounts of different anions. however, within the error of the experiment, one anion has no effect on another anion, if the cation is the same. it is vital to point out that the fwhm of ncation 1s for the mixture is similar to that for the simple ionic liquids. this observation demonstrates that for the mixture, the cation is in one electronic environment, not a mixture of two electronic environments (such a scenario would likely give rise to a single peak with a significantly larger fwhm than those of the simple ionic liquids). the conclusion is that the ionic liquid mixture contains intimate mixtures of cations and the different anions, not pockets of the cation and one type of anion, with other pockets of the cation and the other anion. these results agree with those obtained for pyrrolidiniumbased ionic liquids.3a c 1s, n 1s and br 3d for a 1:1 [c8py][a ] mixture of [c8py][tf2n ] and [c8py]br. the intensities are normalised to the intensity of the ncation 1s fitted peak for [c8py][tf2n ]. all the xp spectra were chargecorrected by referencing the aliphatic c 1s component (caliphatic 1s) to 285.0 ev. overall the results for both simple [c8py][a ] and the mixture show that the anion can significantly influence the electronic environment of the cation. this knowledge can be used to tune the electronic environment of the cation, in particular by selection of anions and using the appropriate mixture. comparisons can now be made amongst binding energies of pyridiniumbased ionic liquids, pyrrolidiniumbased ionic liquids and imidazoliumbased ionic liquids. a visual comparison of [c8py][tf2n ], [c8c1pyrr][tf2n ] and [c8c1im][tf2n ] for all regions is given in figure 5. the xp spectra are all chargecorrected to the binding energy of caliphatic 1s, and are normalised to the area of the f 1s peak, as all ionic liquids contain six fluorine atoms. the first observation is that the relative areas of the components agree well, for example, s 2p, o 1s, ccf3 1s, nanion 1s, confirming the validity of normalising the areas of the xp spectra. the second, more important, observation is that the binding energies of all the anion components match, within the error of the experiment (figures 5 a e and table s1). for example, f 1s for [c8py][tf2n ] is 688.8 ev, and for [c8c1pyrr][tf2n ] and [c8c1im][tf2n ] 688.9 ev and 688.8 ev, respectively. in addition, for [c8py][pf6 ], [c8c1pyrr][pf6 ] and [c8c1im][pf6 ], the binding energies of the p 2p3/2 and f 1s components are the same (136.6 ev and 686.6/686.6/686.7 ev, respectively, see table s1). these observations indicate that changing the cation of the ionic liquid has relatively little effect on the electronic environment of the anion. xp spectra of [c8py][tf2n ], [c8c1pyrr][tf2n ] and [c8c1im][tf2n ] for : a) c 1s, b) n 1s, c) f 1s, d) o 1s, e) s 2p and f) c 1s with chopped x axis. the intensities are normalised to the intensity of the f 1s peak for [c8py][tf2n ]. all the xp spectra were chargecorrected by referencing the aliphatic c 1s component (caliphatic 1s) to 285.0 ev. however, there are significant differences in spectra when comparing the binding energies of the peaks derived from the cations, see figures 5 a and 5 b. the binding energy of the ncation 1s for [c8py][tf2n ] is 402.6 ev, which is the same as that obtained for [c8c1pyrr][tf2n ] (402.7 ev), within the experimental error, but different from that obtained for [c8c1im][tf2n ] (402.1 ev). in general, the ncation 1s binding energies for [c8py][a ] and [c8c1pyrr][a ] are higher than those for [c8c1im][a ] (0.50.1 ev) when [a ] is the same, see table s1. the nitrogen atom in [c8c1pyrr][a ] is in sp hybridisation whereas it is in sp hybridisation in the cases of [c8py][a ] and [c8c1im][a ]. the similar binding energies measured for [c8c1pyrr][tf2n ] and [c8py][tf2n ] indicate that the nitrogen atoms, regarding hybridisation, are still in similar partialcharge environments. since there are two nitrogen atoms within the imidazolium cation headgroup, the partial positive charge over each atom is lower, which gives rise to a noticeably higher electron density at each atom, and thus to a lower binding energy. it is evident that [c8c1im][tf2n ] contains a cationbased c 1s component with a higher binding energy than those observed for [c8c1pyrr][tf2n ] and [c8py][tf2n ] (figures 5 a and 5f). this component for [cnc1im][a ] has been identified as the carbon within the imidazolium cation that is bonded to two nitrogen atoms, that is, at the c position.2i, 12a the c atom of [cnc1im ] is more electronpoor than the chetero atoms of [cnc1pyrr ] and [cnpy ] when [a ] is common to all samples. for example, the binding energy of the c component for [c8c1im][tf2n ] is 287.7 ev,2i whereas the binding energies of chetero 1s for [c8c1pyrr][tf2n ] and [c8py][tf2n ] were found to be 286.83a and 287.0 ev, respectively. the similar binding energies of the chetero 1s in both [c8c1pyrr][tf2n ] and [c8py][tf2n ] further supports the hypothesis that the chetero atoms of [c8c1pyrr][tf2n ] and [c8py][tf2n ] are in very similar partialcharge environments. however, the binding energies of the cinter atoms of [c8c1pyrr][tf2n ] and [c8py][tf2n ] are very different from each other, that is, 285.5 and 286.1 ev respectively. this observation illustrates that the cinter atoms for [c8py][tf2n ] are in a more electronpoor environment due to the sp hybridisation and thus the delocalisation of the positive charge within the [c8py ] cation headgroup. pyrrolidiniumbased ionic liquids have been investigated with a great deal of interest for the use in electrochemistry due to their greater stability when compared to imidazolium analogues, in terms of cation electrochemistry reduction.27 furthermore, pyridiniumbased ionic liquids have also been reported to be more thermally stable when compared to imidazolium analogues.10 the differences in stability can be correlated to the ease of removal of the c proton within the imidazolium cation.28 the xps results here confirm that the c carbon within the imidazolium cation is more electronpoor than any carbon atoms found within the pyrrolidinium and pyridinium cations. these results support the conclusion that pyridiniumbased ionic liquids are more stable than their imidazolium analogues. we have successfully measured the xp spectra of a range of pyridiniumbased ionic liquids, varying both the cation aliphatic chain length and the anion. the electronic environments of all the elements were identified. a reliable fitting model for the carbon 1s region of the pyridiniumbased ionic liquids the binding energy of the aliphatic carbon (caliphatic 1s) moiety was determined with high confidence. the chargecorrected binding energies (absolute binding energies) for all the components could then be obtained. comparisons of the chargecorrected binding energies of the pyridinium cations nitrogen atom, ncation 1s (and also the carbon atoms directly bonded to nitrogen, chetero 1s) when the anion is varied were carried out. the binding energy for ncation 1s decreases as the basicity of the anion increases, indicating that more charge is transferred from the anion to the cation for more basic anions such as bromide. in particular, mixtures of anions can be used to tune the electronic properties of ionic liquids. a comparison of the binding energies of the cationic components for imidazolium the charge on the nitrogen atoms in [c8py][a ] is significantly more electropositive than that on the nitrogen atoms in [c8c1im][a ] but is found in a similar electronic environment as the nitrogen atoms in [c8c1pyrr][a ]. in addition, the c carbon in imidazolium is more electropositive than any of the carbon atoms in the pyridinium cation. this observation agrees with the relative cathodic stability of the cations ; pyridiniumbased ionic liquids are generally more stable than their structurally related imidazolium analogues. | abstractwe investigate eight 1alkylpyridiniumbased ionic liquids of the form [cnpy][a ] by using xray photoelectron spectroscopy (xps). the electronic environment of each element of the ionic liquids is analyzed. in particular, a reliable fitting model is developed for the c 1s region that applies to each of the ionic liquids. this model allows the accurate charge correction of binding energies and the determination of reliable and reproducible binding energies for each ionic liquid. shakeup / off phenomena are determinedfor both c 1s and n 1s spectra. the electronic interaction between cations and anions is investigated for both simple ionic liquids and an example of an ionicliquid mixture ; the effect of the anion on the electronic environment of the cation is also explored. throughout the study, a detailed comparison is made between [c8py][a ] and analogues including 1octyl1methylpyrrolidinium ([c8c1pyrr][a ]), and 1octyl3methylimidazolium ([c8c1im][a ]) based samples, where x is common to all ionic liquids. |
malocclusion is common in children and prevalence in different age groups ranges from 20% to 93% [14 ]. studies assessing the deciduous and mixed dentition stages, when interceptive treatment and developing occlusion guidance measures are typically prescribed, are much less common. nevertheless, some studies reported that as early as 3 years of age prevalence of malocclusion is as high as 7082.5%. among pre - school children, the most common conditions are anterior open bite (aob), excessive overjet (oj), class ii malocclusions, and posterior crossbite (cb). malocclusions are believed to be caused by a combination of inherited and environmental factors acting together. it is well accepted that nonnutritive sucking habit persisting beyond 3 years of age are implicated in the development of aob. however, data on the prevalence of oral habits among pre - school children are inconsistent and ranges from 1.1% to 67.9% [1316 ]. this could be because most of these studies used retrospective questionnaires to characterize the presence or absence of oral habits. the use of a single retrospective questionnaire makes it difficult for parents to accurately assess the presence of habits, and, in turn, makes it difficult to estimate their effects on occlusion. the validity of such data is somewhat questionable. since oral habits like digit sucking, tongue thrust swallowing, and mouth breathing are modifiable factors, reliable data and knowledge of how such behaviors contribute to malocclusion is important for its cessation and prevention. the purpose of this study was to determine the prevalence of different occlusal traits among 57-year - old pre - school children and assess their relationship with oral habits, using data gathered from clinical examination of occlusion and extra - oral assessment of the face, combined with a questionnaire for parents. the study was approved by bioethics committee of the lithuanian university of health sciences (no. subjects should : 1) be 57 years old ; 2) have central permanent or deciduous incisors ; 3) be non - syndromic and non - cleft patients ; and 4) have no history of orthodontic treatment. the sample size calculation was based on data from a study by warren., which was chosen because it consisted of children in mixed dentition stages and analyzed relationships between non - nutritive sucking habits and occlusion. they found a 55% prevalence of malocclusion and 51% of children had a predominant digit - sucking habit at the early mixed dentition stage. assuming prevalence of malocclusion and oral habits as not less than 50%, the sample size calculation indicated that 384 subjects would be sufficient to detect a prevalence of malocclusion and sucking habit with a power of 95% (alpha 3 mm) was found in 31.0% of the subjects. class i and class ii molar relationship was equally distributed in the sample and class iii was registered in only 4 subjects. analysis of interrelationship between different occlusal characteristics demonstrated that the only statistically significant correlation was between the distal terminal plane of deciduous molars and increased overjet (p=0.001). the chi - squared test confirmed that there is no evidence (p>0.05) to suggest a difference in prevalence of occlusal traits and oral habits between genders, except for posterior cb (p=0.03) and infantile swallowing (p=0.01), which were more frequent in girls. this study showed that digit suckers have higher incidence of aob (p=0.013) and posterior cb (p=0.005). children with infantile type of swallowing had a significantly higher prevalence of aob (p=0.001). associations were also found between mouth breathing and formation of molar class iii sagittal relationship (p=0.027). the present study aimed to provide detailed insight into the prevalence of clinically relevant occlusal traits and their relationship with oral habits at the early occlusion development stages. an effort was made to ensure accuracy of oral habit diagnostics, based not only on a questionnaire for parents, but also on clinical observation. for results showing consistency, studies on the prevalence of occlusal anomalies in the age group of 57-year - olds are rare and results vary greatly, from 36% to almost 80%. the inconsistency of results between different studies might be due to a different incidence of malocclusion between populations, but also due to different methods of malocclusion registration. the most precise and reliable method to evaluate occlusal traits is measurement on articulated study models, as in the study by warren., who found that 55% of children had malocclusion. we did not use study models due to the very young age of the children in the study sample. the higher prevalence of malocclusion in our study (71.4% vs. 55%) can probably be explained by the different mean age of the study samples (5.95 vs. 8.6 years), as we must consider possible self - correction of some occlusal traits with growth at later developmental stages. our study shows that digit sucking has an impact on occlusal development, and a statistically significant association was found with aob and posterior cb. such findings are not surprising, as numerous studies have linked non - nutritive sucking habits to malocclusion. however, in contrast to previous data indicating prevalence of non - nutritive sucking habits as high as 51.0% or even 88%, we found it only in 1.4% of the study sample. first, in our study, sucking habit was validated only when results from the parents questionnaire and clinical observation were concordant. we found that disagreement between the parents questionnaire and clinical observation establishing diagnosis of digit sucking was 28.5% and 19.6% for mouth breathing. thus, only results from self - reported data can be questioned. secondly, our study sample composition depended on the willingness of the children and their parents to join the study. most available reports on oral habits used data from routine longitudinal medical studies, in which information about these habits was collected along with the other data and were not focused on oral conditions. the participation of volunteers might be a source of bias in the study, because it can be speculated that parents with malocclusion were more motivated to take part in the study. on the other hand, very concerned parents could have already consulted an orthodontist and decided to refuse to participate. this self - selection could have affected the representativeness of the sample, but it is difficult to assess the direction and magnitude of its influence. we believe the relatively large sample size allowed us to reduce this type of bias to a minimum. we found that mouth breathing was the most prevalent condition (10.1%) with a possible potential negative effect on occlusion (molar class iii sagittal relationship). this is in agreement with many other studies, because nasal obstruction and mouth breathing have proven negative effects on development of the cranio - facial complex. however, it should be borne in mind that we found only 4 children with molar class iii, so these associations should be interpreted with caution. the prevalent opinion is that duration of the pressure of the tongue on the anterior teeth during swallowing is too short to have an influence on the eruption of anterior teeth, and therefore the formation of aob. according to proffit, aob itself is more likely to cause the infantile swallowing pattern rather than vice versa. in contrast, the ultrasonography assesment of swallowing type provided data indicating that infantile swallowing is an important factor for aob formation. we found that tongue thrust swallowing is associated with aob formation (p=0.001) and this in agreement with recent reports. tongue thrust swallowing has been assumed to be a contributing factor in the relapse of orthodontic treatment results and should be controlled during the treatment and retention periods. the important advantage of the present study is the accuracy of oral habit registration, based not only on the questionnaire for parents, but also on clinical observation. without this attention to the details of clinical assessment, prevalence of oral habits, our results suggest that prevalence of some habits, like digit sucking, might be overestimated and conditions such as mouth breathing may be overlooked. therefore, further studies are warranted on even larger populations, in order to produce consistent and clinically relevant data. there was a significant association between sucking habits and anterior open bite, as well as posterior crossbite. tongue thrust swallowing is more likely to be a contributing factor for anterior open bite development. | backgrounddigit sucking, tongue thrust swallowing, and mouth breathing are potential risk factors for development of malocclusion. the purpose of this study was to verify the prevalence of different occlusal traits among 57-year - old children and assess their relationship with oral habits.material/methodsthe study included 503 pre - school children (260 boys and 243 girls) with a mean age of 5.95 years. different occlusal traits were verified by intraoral examination. oral habits were diagnosed using data gathered from clinical examination of occlusion and extra - oral assessment of the face, combined with a questionnaire for parents.resultsthe study demonstrated that 71.4% of the children presented with 1 or more attributes of malocclusion and 16.9% had oral habits. the vertical and sagittal malrelation of incisors, as well as spacing, were the predominant features.this study showed that digit suckers have higher incidence of anterior open bite (p=0.013) and posterior crossbite (p=0.005). the infantile type of swallowing demonstrated strong association (p=0.001) with anterior open bite.conclusionsnon-nutritive sucking habits and tongue thrust swallowing are significant risk factors for the development of anterior open bite and posterior crossbite in pre - school children. |
intrathoracic cysts need to be accurately localized to pulmonary or pleural origin on the basis of clinical presentation and laboratory tests before considering further differential diagnosis. this is truly intriguing as large parenchymal cysts or emphysematous bullae have been reported to be confused with hydropneumothorax with intercostal drains being put leading to complications. however, if localized to lung, such large cyst in adults is likely to be infective in origin with history of recurrent lower respiratory tract infections. congenital parenchymal cysts are mostly asymptomatic in adults and may be picked up as an incidental finding. bronchogenic cysts, cystic adenomatoid malformation, and sequestration are congenital conditions rarely associated with large isolated cystic lesion in the lungs. we report a case of large solitary lesion with air - fluid level, which was diagnosed as encysted hydropneumothorax in oblique fissure on contrast - enhanced computerized tomography (cect) of thorax but turned out to be infected pulmonary cystic adenomatoid malformation after surgical excision. a 45-year - old male, defense personnel by occupation, smoker with a history of significant alcohol intake, presented with fever with chills, cough with expectoration, and right - sided pleuritic chest pain for 1 month associated with significant weight loss (5 kg). he consulted a local physician and was started on antitubercular treatment (att) on radiological basis. there was no symptomatic improvement, and he was admitted to our center for further management. on detailed history, the patient gave a history of taking complete att for similar complaints and right - sided effusion 10 years and again 2 years ago. on examination, he was afebrile, with stable vitals and room air saturation of 96%. there were no abnormal findings on general or systemic examination except diminished breath sounds on the right side of the chest posteriorly. 7100/cu mm with normal differential count (polymorphs 67% and lymphocytes 29%), platelets 3.70 l / cu mm, and normal liver and kidney function tests. his chest skiagrams showed air - fluid level on the right side in a large solitary lesion suggestive of encysted hydropneumothorax or infected giant bulla [figure 1a and b ]. sputum for acid - fast bacilli (afb) smear was negative and pyogenic culture showed no growth. cect of the thorax showed a large smooth - walled cystic lesion with air - fluid level below the oblique fissure with upper margin of the cyst abutting the fissure and infiltrating the right lower lobe (rll) [figure 1c f ]. the patient underwent fiberoptic bronchoscopy, which revealed thick purulent secretions in rll, and bronchoalveolar lavage was negative for afb smear, fungal smear, and pyogenic culture. patient 's cect of the thorax done 2 years back was retrieved which showed similar findings with smaller size [figure 2a b (old cect 2012) compared with c - d (new cect) ]. in view of persistent lesion not responding to treatment, he underwent video - assisted thoracoscopic surgery for removal of the lesion from rll with surrounding lung and segmentectomy [figure 3a and b ]. histopathology of specimen revealed intact cystic lesion with cyst wall lined with ciliated pseudostratified columnar epithelium (bronchiolar type) without cartilage and surrounding lung showing alveoli filled with proteinaceous periodic acid - schiff - negative exudate and hemorrhage [figure 3c e ] establishing diagnosis of congenital pulmonary cystic adenomatoid malformation with infection and hemorrhage. postoperatively, the patient recovered well, was discharged on day five, and was doing well at 1-year follow - up. (a and b) chest x - ray posterior - anterior and right lateral view showing large cystic lesion in the right lung in lower lobe. (c - f) computerized tomography images showing cystic lesion is limited by fissure with patchy consolidation in apical segment of right lower lobe with thickened oblique fissure, interpreted as encysted pyopneumothorax in right oblique fissure computerized tomography images of 2013 in upper panel (a and b) and 2015 in lower panel (c and d) where the cystic lesion seems to have expanded with surrounding consolidation of the right lower lobe in c and d (a and b) thoracotomy with gross specimen of removed cyst and segmentectomy. histopathology of specimen (c - e) showed cyst wall lined by pseudostratified ciliated columnar epithelium with inflammation and hemorrhage in surrounding lung parenchyma in h and e stains congenital cystic adenomatoid malformation (ccam) is a rare congenital disease first described by chin and tang in 1949 due to hamartomatous overgrowth of bronchioles, with almost complete suppression of alveolar development. the incidence of ccam has been estimated at 1:25,0001:35,000 pregnancies in one study while another reports a population prevalence of 9/100,000 total births. this entity is characterized by multiple solid cystic lesions which generally present as neonatal respiratory distress syndrome. this condition is different from closely resembling rare congenital intrapulmonary bronchogenic cysts which are mostly mediastinal and airway centric in location. bronchogenic cysts contained normal tracheal tissue including mucus glands, elastic tissue, smooth muscle, and cartilage and lined by ciliated epithelium while ccam is only lined by respiratory epithelium with absence of cartilage, muscle, and glands, hence requiring pathological examination of the cyst wall for diagnosis. pulmonary sequestration also closely resembles ccam but is supplied by independent vascular supply, which needs to be evaluated by aortography prior to surgical management in all such cystic lesions, or else catastrophic intraoperative bleeding can occur. traditionally, ccam can be classified into three types (stocker classification) [table 1 ]. stocker 's classification of ccam presentation in adults is rare being with mean age at the time of diagnosis being 30.3 years. patients are usually asymptomatic in two - third cases and uncommonly present as recurrent lower respiratory tract infections of one lobe. it may also present as a mass lesion with variable amount of solid and cystic components and may communicate with the bronchial tree. since neither all are cystic nor all are adenomatous, it is more appropriately now called as congenital pulmonary airway malformations (cpams). cpam is frequently mistaken for congenital diaphragmatic hernia in newborns and sequestration or pulmonary bronchogenic cyst in adults. ct imaging reveals mostly cystic lesions of varying sizes and irregular shapes, filled with air, multifocal, and predominantly in lower lobes and has significant overlapping findings. macrocystic type is hard to distinguish from lung cyst as was in our case with air - fluid level. differential diagnosis in adults with infection is difficult as distinction between congenital versus acquired etiology is distorted and includes abscess, tuberculosis, hydatidosis, or vasculitis. this leads to considerable delay in final diagnosis which requires histopathology of the surgical specimen. frequent mimic on imaging in adults is pyopneumothorax and has led to intercostal tube being put in cyst with fluid level. spontaneous pneumothorax due to rupture of the cyst has been reported at the time of presentation causing clinical confusion. hence, the emerging consensus is that imaging findings should simply be described, without attempting to make a pathological diagnosis on radiology. besides infection other complications, for example, hemorrhage, enlargement with space occupying effect, and subsequent development of squamous or adenocarcinoma have been reported. clinico - radiological changes prompt for early investigation to exclude malignancy in long - standing cysts and require surgical removal as noninvasive tests are unreliable. our patient, on serial ct scans, showed an enlargement of the cyst with fluctuating fluid levels and was already complicated at the time of presentation. enlargement of cyst was not seen in bronchogenic cysts, and the absence of anomalous systemic vascular supply was clues to the correct preoperative diagnosis of ccam. however, superadded infection, juxta - fissural position, and previous history of pleural effusion tilted the diagnosis toward encysted hydropneumothorax although a high index of suspicion prevented mishap of putting an intercostal drain. management of ccam of the lung is surgical resection, recommended to confirm the diagnosis and lessen the future risk of infection or malignant degeneration. many surgeons and pathologists recommend lobectomy as it is safer and because demarcation between ccam and normal parenchyma is impossible on grossing. others recommend segmental resection but may lead to incomplete excision and residual pneumothorax. in our patient, surgeon 's choice to perform segmentectomy with complete removal of cyst was dictated by need to preserve lung functions as far as possible by job requirement of patient as well as his confidence in complete excision of cyst and surrounding abnormal lung tissue which was also confirmed by pathologist. there has not been a recurrence in 1-year follow - up of the patient till now. we reported a case who presented as loculated pyopneumothorax on clinico - radiological grounds, treated with att twice ; however, high index of suspicion not only led to correct diagnosis of cpam but also prevented potentially catastrophic implantable cardioverter defibrillator placement, emphasizing need for better understanding of congenital lung diseases presenting in late adulthood where such diagnosis is generally not entertained on account of being late for such conditions. | congenital cystic adenomatoid malformations (ccams) are rare congenital, nonhereditary developmental anomalies of the lung with unknown etiology. ccam is predominantly a disorder of infancy with the majority of the cases being diagnosed within the first 2 years of life. when ccam presents in adults, it represents a diagnostic dilemma and requires careful evaluation. we here report a case of large solitary congenital pulmonary cystic adenomatoid malformation with infection and hemorrhage, which was diagnosed as encysted hydropneumothorax on computerized tomography scans but turned out to be infected pulmonary cystic adenomatoid malformation after surgical excision. |
in developed countries, classical vitamin - deficiency syndromes such as scurvy, beriberi, and pellagra are now uncommon, but specific population subgrozups remain at risk for modest vitamin insufficiencies. this is notably the case in diabetes patients who frequently display inadequate vitamin status, including many from the b group. diabetes mellitus is a metabolic disorder characterized by hyperglycemia and insufficiency of secretion or action of endogenous insulin. although the etiology of diabetes is not well defined, aging is a major factor in the development and progression of diabetes. due to functional insufficiency, the vitamin b6 status of elderly individuals may be subject to higher variability than that of younger adults who are frequently taken as references. moreover, it is reported that plasma plp level is affected by age and gender. it has been reported that vitamin b6 may be involved in the metabolism of carbohydrate. pyridoxal 5'-phosphate (plp), the active form of vitamin b6, acts as an integral part of glycogen phosphorylase (ec 2.4.1.1.) which catalyzes the breakdown of glycogen. a deficiency of vitamin b6 is associated with impaired gluconeogenesis and impaired glucose tolerance. it has also been reported that vitamin b6 deficiency can lead to a decrease in the level of circulating insulin as well as pancreas function and relates to increased risk of coronary artery disease in animal models. thus, proper vitamin b6 status can be deemed an important factor in the care of type 2 diabetes for the prevention of degenerative complications. however, there have been few reports on vitamin b6 status in the korean elderly population or in those with diabetes. therefore, the aim of the present study was to assess vitamin b6 status using plasma plp levels and vitamin b6 intakes of korean patients with newly diagnosed type 2 diabetes since plasma plp level and vitamin b6 intake have been the most accepted and widely used indices of vitamin b6 status in the last decade. in addition, these status indices were compared to those of age and gender - matched healthy non - diabetic subjects to exclude variance from age, as well as gender effects. sixty - four patients with newly diagnosed type 2 diabetes and 8 - 11% glycated hemoglobin (a1c), which is used primarily to identify average plasma glucose concentrations over a prolonged period of time, and 28 age - matched healthy non - diabetic subjects were recruited consecutively from the diabetes clinic at e hospital between february and april, 2005. dietary vitamin b6 intake and food sources were estimated with the 24 hour recall method. the subjects each reported three consecutive daily dietary intakes with the help of a trained interviewer. food portion sizes were estimated by using standard household measures and published average portion sizes. nutrient intakes were estimated using a computer - aided nutritional analysis program developed by the korean nutrition society. when information was unavailable for a particular food, a value was assigned based on values for similar foods. the foods in the vitamin b6 database were categorized into those of animal or plant origin, and the amount of daily vitamin b6 provided by these two categories was calculated for each person. on the day of dietary data collection, weights and heights were measured and body mass index (bmi) was calculated from the measurements of body weight and height. after a 12-hour fast, venous blood was used for the assessment of vitamin b6 status and biochemical indices. immediately following blood draw into heparinized vacutainers, plasma plp concentration was measured using the hplc method, which was modified as follows : mobile phase (0.1 m potassium dihydrogen phosphate containing 0.1 m sodium perchlorate, 0.5 g / l sodium bisulfite, ph 3) was pumped at a flow rate of 1.0 ml / min into the column (bondapack ods column, 3.9300 mm, 10 m porus packing, c18, waters). the plasma was added to perchloric acid (0.8 m) and allowed to sit for one hour to release plp from the protein. this mixture was then centrifuged (18,000 rpm, 4, 15 min) and the supernatant removed. one hundred microliters of supernatant was loaded in the sample loop and then injected into the column. pearson 's correlation coefficient was used to determine possible relationships among the indices of vitamin b6 status and blood biochemical indices. values for vitamin b6 status were regressed based on vitamin b6 intake and dietary vitamin b6 to protein ratio. sixty - four patients with newly diagnosed type 2 diabetes and 8 - 11% glycated hemoglobin (a1c), which is used primarily to identify average plasma glucose concentrations over a prolonged period of time, and 28 age - matched healthy non - diabetic subjects were recruited consecutively from the diabetes clinic at e hospital between february and april, 2005. dietary vitamin b6 intake and food sources were estimated with the 24 hour recall method. the subjects each reported three consecutive daily dietary intakes with the help of a trained interviewer. food portion sizes were estimated by using standard household measures and published average portion sizes. nutrient intakes were estimated using a computer - aided nutritional analysis program developed by the korean nutrition society. when information was unavailable for a particular food, a value was assigned based on values for similar foods. the foods in the vitamin b6 database were categorized into those of animal or plant origin, and the amount of daily vitamin b6 provided by these two categories was calculated for each person. on the day of dietary data collection, weights and heights were measured and body mass index (bmi) was calculated from the measurements of body weight and height. after a 12-hour fast, venous blood was used for the assessment of vitamin b6 status and biochemical indices. immediately following blood draw into heparinized vacutainers, plasma plp concentration was measured using the hplc method, which was modified as follows : mobile phase (0.1 m potassium dihydrogen phosphate containing 0.1 m sodium perchlorate, 0.5 g / l sodium bisulfite, ph 3) was pumped at a flow rate of 1.0 ml / min into the column (bondapack ods column, 3.9300 mm, 10 m porus packing, c18, waters). the plasma was added to perchloric acid (0.8 m) and allowed to sit for one hour to release plp from the protein. this mixture was then centrifuged (18,000 rpm, 4, 15 min) and the supernatant removed. one hundred microliters of supernatant was loaded in the sample loop and then injected into the column. pearson 's correlation coefficient was used to determine possible relationships among the indices of vitamin b6 status and blood biochemical indices. values for vitamin b6 status were regressed based on vitamin b6 intake and dietary vitamin b6 to protein ratio. because aging is one of the major factors affecting both plasma plp levels and the development and progression of diabetes, comparisons of plasma plp concentrations of diabetic patients to those of age - matched healthy non - diabetic subjects are important. sixty - four diabetic patients and 28 age - matched non - diabetic subjects participated in this study, with mean age being 50 years for the diabetic patients and 51.5 years for the non - diabetic subjects. table 2 shows the nutrient intakes of the diabetic patients and non - diabetic subjects. there was a significant difference in daily total calorie intake between the diabetic and non - diabetic groups (1,917 376 vs 2,093 311 table 3 shows dietary vitamin b6 intake and plasma plp levels for the non - diabetic and diabetic subjects. there were no differences in intake of total vitamin b6 (2.51 0.91 vs 2.53 0.81 mg / d) or vitamin b6/1,000 kcal (1.31 0.42 vs 1.20 0.32 mg) between the diabetic and non - diabetic groups. the intakes of total vitamin b6 were above the korean rda for both groups. in the diabetic patients, the mean plasma plp level was 15% lower as compared to the non - diabetic subjects (80.0 61.2 vs 68.2 38.5 nmol / l), but this difference was not statistically significant due to a large standard deviation. 1 shows the frequency distribution of daily vitamin b6 intake, and its relative intake to daily protein intake ratio. daily vitamin b6 intake was not normally distributed in either the non - diabetic or diabetic subjects, and the declination was steeper in the diabetic patients. 2 shows there was no significant correlation between plasma plp level and intake of vitamin b6 in either the non - diabetic subjects or diabetic patients. also, plasma plp levels and intakes of vitamin b6 were more widely scattered in the diabetic patients compared to the non - diabetic subjects. table 4 shows that no significant correlations were found between plasma plp level and biochemical risk indices including plasma levels of fasting glucose, postprandial glucose, triglyceride, albumin, and total cholesterol in either the non - diabetic subjects or diabetic patients. because there were no differences in total vitamin b6 intake and vitamin b6/1,000 kcal between the diabetic and non - diabetic groups, it is considered that the higher energy intake in diabetes patients did not affect intake of vitamin b6. a possible explanation for the tendency of lower vitamin b6 status is based on plasma plp level, which has been suggested as the best single status indicator because it appears to reflect tissue stores. in the diabetic subjects, the mean plasma plp level was 15% lower than that of the non - diabetic subjects (80.0 61.2 nmol / l), but this difference was not statistically significant due to a large standard deviation. however, even though there were no differences in total vitamin b6 intake and vitamin b6/1,000 kcal between the diabetic and non - diabetic groups, and intakes of total vitamin b6 were above the korean rda in both groups, the percentage of subjects with a plasma plp concentration < 30 nmol / l (the proposed cutoff as an index of adequacy in diabetic patients) was higher in the diabetic subjects as compared to non - diabetic subjects. also, plasma plp levels and intakes of vitamin b6 were more widely scattered in the non - diabetic group as compared to those of the diabetic group. thus, if an eccentric value were considered, the 15% lower mean plasma plp level in the diabetic subjects compared to that of the non - diabetic subjects is thought to be a meaningful decrease in a clinical situation, although this difference was not statistically significant. in addition, the results of this study are consistent with previous studies where circulating levels of plasma pyridoxal 5'-phosphate and total vitamin b6 significantly decreased under conditions of hyperglycemia [12 - 14 ]. however, recent epidemiology of plasma plp in the u.s. population showed there was no difference between diabetes and non - diabetes subjects, regardless of using supplemental vitamin b6. this discrepancy may be explained by differences in major vitamin b6 sources, because several studies have indicated that the utilization of vitamin b6 from animal derived foods is more efficient than that from plant foods. furthermore, it was reported that koreans obtain approximately 65% of vitamin b6 from plant sources, whereas in the american diet, approximately 50% of dietary vitamin b6 is from meat and the other 50% is from plant - based foods. there was a previous review on age - associated b vitamin deficiency as a determinant of chronic diseases, and estimations of how much vitamin b6 is required in diabetes must take into account all potential age - related alterations. by the comparison of vitamin b6 status in diabetic patients to that of age - matched healthy non - diabetic subjects in this study, the tendency for a lower plasma plp level in diabetic patients might not be due to age - related alterations. this lowered level of plasma plp in diabetic patients may be due to either lower intake of vitamin b6 or altered distribution of plp in diabetic patients. b vitamin intake is dependent on the food supply and many studies have demonstrated that increased protein intake causes a relative decrease in b6 status, as judged by a variety of b6 status indicators [22 - 24 ]. furthermore, in this study, vitamin b6 intake was highly correlated to intakes of energy and protein. this has led some to define b6 requirements in terms of protein intake or energy intake. however, there was no difference in vitamin b6 intake when expressed as either a ratio of vitamin b6 intake to daily protein intake or as the amount of vitamin b6 intake to a 1,000 calorie intake in this study. these data show that plasma plp levels tended to be lower in the diabetic subjects than in the non - diabetic subjects although there was no difference in vitamin b6 intake. thus, in this study, the lower plasma plp levels of the diabetic patients might not have been due to insufficient intake of vitamin b6, but instead might be due to altered distribution of plp in diabetic patients. the mechanism involved in altered distribution of plp in diabetes could be that elevated plasma glucose reduces plasma plp levels and xanthurenic acid excretion due to abnormal tryptophan metabolism ; xanthurenic acid forms xanthurenic acid - insulin complexes that reduce insulin sensitivity and result in elevated blood glucose levels. it was also reported that urinary excretions of 3-hydroxykynurenine and 3-hydroxyanthranilic acid were increased in diabetic animals, and this might lead to the inhibition of islet insulin secretion. in clinical situations, the question still remains whether altered distribution of plp contributes to the development of degenerative complications, or results from those complications. because no significant correlations were found between plasma plp levels and any of the biochemical risk indices of degenerative diabetes complications, such as plasma levels of fasting glucose, postprandial glucose, triglyceride, albumin, and total cholesterol, in either the non - diabetic or diabetic subjects of this study, the cause - effect nature of this relationship could not be clarified. however, considering the major complications that occur in diabetic patients, maintaining normal vitamin b6 status is an important diet strategy for diabetic patients since retrospective studies have suggested the association between risk of cardiovascular disease and vitamin b6 status, although the cause - effect nature of this relationship has not been clarified [28 - 31 ]. prospective studies also suggest that populations with higher plp concentrations have lower risk of coronary heart disease. therefore, despite the many uncertainties regarding the mode of action, these results suggest that plasma plp levels should be monitored in pre - diabetic patients with diabetic risk factors and in newly diagnosed diabetic patients for long - term management of diabetes, even though this factor is not a major risk factor that contributes to the development of degenerative complications in certain patients. the principal limitations of this study were the cross - sectional design and that a causative nature of the association could not be established. | the purpose of this study was to assess vitamin b6 intake and status in korean patients with newly diagnosed type 2 diabetes. sixty - four patients with newly diagnosed type 2 diabetes and 8 - 11% glycated hemoglobin (a1c), along with 28 age - matched non - diabetic subjects, participated. dietary vitamin b6 intake was estimated by the 24 hour recall method and plasma pyridoxal 5'-phosphate (plp) was measured. there was a significant difference in daily total calorie intake between the diabetic and non - diabetic groups (1,917 376 vs 2,093 311 kcal). there were no differences in intake of total vitamin b6 (2.51 0.91 vs 2.53 0.81 mg / d) or vitamin b6/1,000 kcal (1.31 0.42 vs 1.20 0.32 mg) between the diabetic and non - diabetic groups, andi intakes of total vitamin b6 were above the korean rda in both groups (180.0 57.9 vs 179.0 65.4). there was a higher percentage of diabetic subjects whose plasma plp concentration was < 30 nmol / l compared to non - diabetic group. plasma plp levels tended to be lower in the diabetic subjects than in the non - diabetic subjects, although the difference was not statistically significant due to a large standard deviation (80.0 61.2 nmol / l vs 68.2 38.5 nmol / l). nevertheless, plasma plp levels should be monitored in pre - diabetic patients with diabetic risk factors as well as in newly diagnosed diabetic patients for long - term management of diabetes, even though this factor is not a major risk factor that contributes to the development of degenerative complications in certain patients. |
a systemic skeletal disease is characterized by low bone mass and micro - architectural deterioration with a consequent increase in bone fragility and susceptibility to fracture. asia has the highest increment in the elderly population ; therefore, osteoporotic fracture should be a noticeable health issue. the incidence rate of hip fractures in asia could rise to 45% by the year 2050. complementary and alternative medicine (cam) is a group of various medical and health care systems, practices, and products that are not presently considered as part of formal medicine. cams have been described as diagnosis, treatment, and/or prevention which complements mainstream medicine as a holistic, subjective and various natural approaches to medical problems by contributing to a common whole, satisfying claims not met by orthodoxy, or diversifying the conceptual frameworks of medicine. peer - reviewed publications were identified through a search in scopus, science direct, cochrane, pubmed, and google scholar using keywords osteopenia, osteoporosis, menopause, cam, phytoestrogens, phytotherapy and herbal medicine. the search was completed in july 2015 and was limited to articles published in english. we categorized our results in different classifications including : lifestyle modifications (cigarette, alcohol, exercise and food regimen), supportive cares (intake supplements including vitamin d, c and k), treatments synthetic (routine and newer options for hormone replacement and none hormonal therapies) and natural options (different types of cam including herbal medicines, yoga and chiropractic). established osteoporosis is difficult to treat because bone density has fallen below the fracture threshold and trabecular elements may have been lost. antiresorptive agents can be used to prevent further bone loss and stimulation of new bone formation by the use of anabolic steroids or fluoride may increase the overall amount of bone. | background : a systemic skeletal disease is characterized by low bone mass and micro - architectural deterioration with a consequent increase in bone fragility and susceptibility to fracture. asia has the highest increment in the elderly population ; therefore, osteoporotic fracture should be a noticeable health issue. the incidence rate of hip fractures in asia could rise to 45% by the year 2050. complementary and alternative medicine (cam) is a group of various medical and health care systems, practices, and products that are not presently considered as part of formal medicine. cams have been described as diagnosis, treatment, and/or prevention which complements mainstream medicine as a holistic, subjective and various natural approaches to medical problems by contributing to a common whole, satisfying claims not met by orthodoxy, or diversifying the conceptual frameworks of medicine.methods:peer-reviewed publications were identified through a search in scopus, science direct, cochrane, pubmed, and google scholar using keywords osteopenia, osteoporosis, menopause, cam, phytoestrogens, phytotherapy and herbal medicine. the search was completed in july 2015 and was limited to articles published in english. relevant articles were identified based on the expertise and clinical experience of the authors.results:we categorized our results in different classifications including : lifestyle modifications (cigarette, alcohol, exercise and food regimen), supportive cares (intake supplements including vitamin d, c and k), treatments synthetic (routine and newer options for hormone replacement and none hormonal therapies) and natural options (different types of cam including herbal medicines, yoga and chiropractic).conclusion : established osteoporosis is difficult to treat because bone density has fallen below the fracture threshold and trabecular elements may have been lost. antiresorptive agents can be used to prevent further bone loss and stimulation of new bone formation by the use of anabolic steroids or fluoride may increase the overall amount of bone. |
the authors thank j.a. doudna for helpful comments on the manuscript. supported by grant gm22135 from the usphs. the trnas are shown as colored bars, some with attached amino acids depicted as circles colored to correspond to their trnas. the reactions in the pathway are described in the text ; the mrna and bound ef - g are not shown. | translocation of peptidyl - trna and mrna within the ribosome during protein synthesis is promoted by the elongation factor ef - g and by the hydrolysis of gtp. a new study reports that ef - g binds to ribosomes as an ef - ggdp complex and that gtp is exchanged for gdp on the ribosome. together with cryo - electron microscopy, this unexpected finding helps clarify the role of gtp in translocation. |
several small pilot studies of gi bacterial composition in asd have been conducted, and although the majority agree that gut microbiota composition is distinctive in asd, these studies have yielded conflicting results as to the nature and/or extent of gi bacterial community differences in children with asd compared to controls (2024). in work recently described by kang. (21), high - throughput sequencing of the 16s rdna gene was used to compare bacterial composition in fecal samples from 19 children with asd who had varying gi symptoms and 20 neurotypical controls with minimal gi symptoms. the presence of autistic symptoms rather than the severity of gi symptoms was associated with lower abundance of the bacterial genera prevotella, coprococcus, and unclassified veillonellaceae (p0.8) among neurotypical samples. when paired otus were also present from autistic samples, lines connecting each otu pair are highlighted either in blue or red depending on their correlation among autistic samples (either positive or negative correlation, respectively). if at least one otu in the pair was absent from autistic samples, the connecting line is colored in green to show the changes in microbial interactions that resulted from the absence of the otus in children with asd. prevotella copri - like otus are highlighted in yellow to demonstrate how often their abundance is associated with the other in the network. (17) under an open access license of plos journals called the creative commons attribution (cc - by) license.) a decreased abundance in prevotella in children with asd was reported when compared with their siblings in one other study (23), but its prevalence was not significantly different in other studies of gut microbiota in asd (25). (21), such as increases in clostridium and sutterella with asd, were reported in other studies (20, 26, 27). the study that detected differences in sutterella was unique in the use of mucosal - biopsies (20) rather than fecal samples, which results in the observation of bacteria at different prevalence (28). observed microbiota differences with asd have also been inconsistent with regard to overall microbiota (alpha) diversity. kang. (21) observed significantly decreased alpha diversity in children with asd, which is interesting in light of the fact that low microbiome diversity has been associated with increased vulnerability to various chronic disorders, including a lower resistance to pathogenic bacteria (29). however, finegold. (30) reported higher microbial diversity in feces from children with asd. the differences in currently reported findings could be attributed to : the heterology of the disorder, small sampling sizes, different sample types (e.g. fecal versus mucosal), different methods of characterizing the microbiota (e.g. culture - based versus culture - independent), and to different bioinformatics analysis methods. these differences may also reflect different degrees to which the studies considered potentially confounding factors such as diet, oral antibiotic use, prebiotics, probiotics, gi problems, and autistic symptoms. differences also may reflect whether siblings or unrelated individuals are used as the control population. there is one published study that reported to find no significant differences between the gut microbiome of individuals with asd and controls that used only neurotypical siblings as a control population (22). interestingly, one study that compared the fecal microbiome of children with asd, neurotypical siblings of children with asd, and unrelated neurotypical controls, found the sibling controls to have a microbiome more similar to children with asd than to control subjects without a neurotypical sibling (23). this may indicate either a scenario whereby a shared environment produces the development of a microbiome that leads to autism in only the genetically susceptible sibling or may also be related to the shared genetics of siblings. differences between cohorts may also reflect the natural human microbial diversity both within and between individuals. inconsistent results with regards to the nature of microbiota differences observed across different studies of a disorder are not unique to the study of asd. for instance, there is strong consensus from both human and mouse studies of obesity, another complex disease with varied etiology, that microbial composition is altered, but little consensus on the nature of these changes (31). overall, the study of microbiota associations with complex diseases is difficult and requires large and carefully characterized subject cohorts. the prevalence of asd in developed / western populations has risen dramatically over the past decade and a half (32), leading some to suggest that cultural / ethnic, environmental, and/or socioeconomic factors in the developed world are to blame. this theory has been hard to test because of poor data on asd prevalence trends in the developing world and controversy over the degree to which the observed rise in western populations is due to differences in diagnostic criteria (33). however, in one intriguing study, pervasive developmental disorder (pdd) prevalence rates in children who were currently living in israel was much lower in immigrant ethiopian children compared to native israeli children of ethiopian heritage (34), giving some evidence that there is an environmental risk factor for pdd that is unique to industrialized countries. this notion and the fact that the bacterial genus that was most strongly depleted in the analysis of the fecal microbiome of children with asd by kang. 21, prevotella, is highly enriched in the fecal microbiota in populations in africa including agrarian societies in malawi (35) and burkina faso (36), and the hadza hunter gatherers in tanzania (37) intrigued us and inspired us to perform comparative analyses. since prevotella is only one genus in the very diverse gut microbiota and has a tendency to co - occur with a complex collection of other bacteria species (38, 39), we wanted to determine whether prevotella depletion in children with asd is an indicator that the gut microbiome of children with asd who live in the united states differs even more from individuals in the developing world than does the gut microbiome of neurotypical children in the us, providing evidence of the gut microbiota as an environmental factor that may correlate with increased rates of asd in industrialized countries. to directly relate the gut microbiota of children with asd to those in agrarian cultures, we combined 16s rrna genomic data from the fecal samples sequenced in kang. (21) from children with asd and neurotypical controls, with data from another published study that used 16s rrna gene sequencing to survey the fecal microbiota of individuals from malawi, the amazonas state of venezuela, and the us (35) (fig. 3). this latter paper found the fecal microbiota of individuals in agrarian cultures in malawi and venezuela to have a similar prevotella - rich composition that was highly divergent from individuals living in the us. the fecal microbiota of individuals with asd in the u.s. shows a greater divergence from individuals in agrarian cultures compared to neurotypical controls. unweighted unifrac pcoa plot comparing data from children with asd and neurotypical control in the u.s. (21) with a global survey of fecal microbial community composition conducted in individuals from malawi, the amazonas state of venezuela, and the u.s. (b) same plot, but with points colored by study / asd status. we first assigned sequences from both studies to 97% identity (i d) otus (clusters in which sequences have 97% i d over their aligned 16s rrna genes). this is a method that is typically used by microbial ecologists to use 16s rrna gene sequences to approximate counts of different species in each sample, where each 97% i d otu is a unique species - like unit (40). specifically, we assigned our sequences to their closest relative in a database of previously characterized 16s rrna 97% i d otus (february 4, 2011, greengenes database) (41) using uclustref (42) as described in lozupone. unassigned sequences, which typically were only < 5% of each sample, were dropped from the analysis. the degree of difference in the collection of otus found in each pair of samples was then estimated with the unweighted unifrac distance metric. unifrac is similar to algorithms that estimate distance between communities based on degree to which species are shared versus unique, such as the sorenson index, except that it also considers phylogenetic relationships between species when performing the calculations (44). the relationship between the microbial diversity in the different samples was visualized using principal coordinate analysis (pcoa) (fig. 3). only samples from individuals in yatsunenko. who were between the ages of 4 and 60 we excluded the samples for children younger than 4 to be consistent with the population assessed in kang. since the microbiota is highly variable in early life but stabilizes to an adult - like configuration in children aged 4 and older (35), we did not exclude the adults in the cohort of yatsunenko. from the analysis. as expected based on the analysis conducted by yatsunenko. (35), the individuals from the us separated from individuals from malawi and venezuela along pc1 (fig. the second pc axis separated us individuals evaluated in the two different studies from each other (fig. this separation is not surprising because of methodological differences between the studies, such as the use of different techniques for extracting dna out of the fecal samples and using pyrosequencing 454 versus illumina technology for the sequencing (43). interestingly, along pc1, the samples from children with asd from kang. (21) showed a significantly greater deviation from individuals from agrarian cultures than did the neurotypical children evaluated in kang. hyper - westerization of the fecal microbiota of children with asd is hard to ascertain. since prevotella - prevalence has been linked with dietary patterns within the us population, with prevotella being high in individuals who consumed diets poor in animal protein and saturated fats and rich in carbohydrates (as assessed over the prior year with a food frequency questionnaire) (45), we can not rule out that this observation is due to a distinct aspect of the diets of the children with asd. however, dietary factors, such as adherence to a gluten and casein free diet, could not explain the microbiota differences between children with asd and neurotypical controls (21). another fascinating idea is that this hyper - westernization could also be linked with differences in the immune system. this notion is supported by the observation that individuals with untreated hiv infection have uniformly high prevotella and in a similar meta - analysis with the dataset of yatsunenko. (35), showed the opposite pattern of children with asd, in having a fecal microbiota with a striking resemblance to that of individuals in the developing world (46). evaluation of dietary questionnaires indicated that prevotella - richness in hiv patients occurred independently of diet (47). the greater deviation of children with asd from individuals with hiv that have a suppressed adaptive immune system may indicate that this deviation is driven by individuals with asd having a hyper - active adaptive immune system. this is consistent with the observation that individuals with asd have high adaptive immune cytokine responses in stimulations of their peripheral blood mononuclear cells (48, 49) and high amounts of the th1 cytokine inf - gamma in the brain (50). differences reported on microbial diversity and composition (20, 21, 23, 24) can also be attributed to the fact that several microorganisms can perform the same function. this metabolic function can be assessed by measuring metabolites produced. several published metabolomics analyses of urine and fecal metabolites have revealed differential abundance of bacteria - produced metabolites that have the potential to directly affect neural processes (5154). published urinary metabolites that positively correlate with asd symptoms include 1) 3-(3-hydroxyphenyl)-3-hydroxypropionic acid (hphpa), a probable metabolite of a tyrosine analog that depletes catecholamines and causes symptoms of autism, such as stereotypical behavior, hyperactivity, and hyper - reactivity in experimental animals (51), 2) p - cresol, which can compete with neurotransmitters for enzymes and co - factors essential for sulfonation reactions in the liver (52, 53), and 3) urocanate, which is regulated by the enzyme urocanase (55). deficiency of urocanase raises levels of urocanate in the urine and leads to urocanic aciduria that is associated with neurological disorders (54). evidence of a role for bacterial metabolites in eliciting neurobehavioral symptoms of asd also comes from a recent study of a maternal immune activation (mia) model of asd in mice, in which the mia mice had significant increases in 8% of 322 serum metabolites, with one particular metabolite, 4-ethylphenylsulfate (4eps), displaying a striking 46-fold increase. 4eps is produced by gut bacteria, and treatment with a particular gut bacterial strain (bacteroides fragilis) in early life changed the microbiome structure of mia offspring mice, restored levels of 4eps to normal, and greatly improved asd symptoms. furthermore, injection of 4eps into nave mice resulted in anxiety - like behavior, providing clear evidence that at least one metabolite produced by gut bacteria can substantially affect behavior in mice (56). although these studies provide evidence that particular microbially produced metabolites may directly affect asd symptoms, an important deficiency in our current understanding is which microbes may be responsible for the production of which metabolites, how these microbes interact with each other and with the host, and how feasible is it to modify asd symptoms by managing these microbial interactions. studies that explore links between microbiota composition, functional potential (gene content), gene expression (transcriptomics), metabolomics, presence and severity of asd disease symptoms, or neurotransmitter signaling in the subject have promise for yielding a mechanistic understanding of a link between gut microbiota and asd that will pave the way for therapeutics that target the microbiota in the treatment of asd. a high rate of gi problems in children with asd, correlations between symptom severity and gi symptoms within children with asd, distinctive profiles of gut microbes and their metabolites in children with asd, and a growing appreciation of a link between the gut and the brain for many neurological disorders, all point towards the potential for a role for gut microbiota in the presentation and severity of asd symptoms. furthermore, our observation of a hyper - westernization of the gut microbiota of children with asd could indicate that gut microbiota differences that are driven by unique aspects of the western lifestyle compared to the developing world lead to the association of unique gut microbiota composition with asd. the complexity of the symptoms and the etiology of asd coupled with the complexity of the microbiota and its functions has presented challenges in establishing the nature of an association between gut microbiota and asd, pinning down whether a link even exists and for which individuals with asd, and in producing a mechanistic understanding of the nature of this association. further work in this field that apply cutting edge omics technologies coupled with confirmatory experiments in mouse models, as has been done more extensively with other complex diseases such as obesity, have the promise to address these pressing questions for the millions of people affected by asd worldwide. the authors thank the bhare autism and emch foundations for funding some of this work. | recent studies suggest a role for the microbiota in autism spectrum disorders (asd), potentially arising from their role in modulating the immune system and gastrointestinal (gi) function or from gut brain interactions dependent or independent from the immune system. gi problems such as chronic constipation and/or diarrhea are common in children with asd, and significantly worsen their behavior and their quality of life. here we first summarize previously published data supporting that gi dysfunction is common in individuals with asd and the role of the microbiota in asd. second, by comparing with other publically available microbiome datasets, we provide some evidence that the shifted microbiota can be a result of westernization and that this shift could also be framing an altered immune system. third, we explore the possibility that gut brain interactions could also be a direct result of microbially produced metabolites. |
as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be reorganized for online delivery, but are not copyedited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | abstracta niccolite series of [bnh2 2+][m(hcoo)3]2 (bnh2 2+=1,4butyldiammonium) shows four kinds of metaldependent phase transitions, from high temperature paraelectric phases to lowtemperature ferro, antiferro, glasslike, and paraelectric phases. the conformational flexibility of bnh2 2 + and the different size, mass, and bonding character of the metal ion lead to various disorderorder transitions of bnh2 2 + in the lattice and relevant framework modulations, thus different phase transitions and dielectric responses. the magnetic members display a coexistence or combination of electric and magnetic orderings in the lowtemperature region. |
bread and cereals have the most suggested servings per day in food guide pyramid in individuals with higher daily exercise.1 today, people are being encouraged to consume more starches and fibers instead of fat for both body and oral health benefits.23 bread is a suitable source of both starches and fibers.2 sugars, especially foods containing sucrose, are identified consumables in lowering dental plaque ph and therefore increasing dental caries incidence.4 although, some sweet products have anticaries effects.5 other carbohydrates play different role in dental caries etiology. cariogenicity of sucrose 10%, starch solution 2%, and starch 2% + sucrose 10% was compared in an in - vitro study. higher levels of demineralization and more lactobacillus colonization were observed when starch added to sugar ; also, ph drop following consumption starch solution was still higher than critical ph (5.5) although this drop was not significant.6 in another trial, foods with lower acidogenic potential, such as whole meal bread, increased ph even more than baseline.7 the ph dropped below than 4.75 in 4 - 7 day old dental plaque attributed to the starch presented in bread.8 adding even minute amounts of starchy foods cause considerable changes in glucose and insulin post prandial responses.9 some researchers have revealed that glycemic index (gi) have a direct relation with plaque acidity. the higher degrees of gi were seen with more pronounced ph drop.10 food characteristics such as taste, acidic content, surface texture, and food contents are important variables in mouth biological responses.1112 needed chewing intensity, when a food is consumed, determines the oral clearance, duration of acid attack, and ph drop.1315 there are different methods for evaluating cariogenic potential of foods and drinks.616 one of them is acidogenicity assessment of consumed food. three methods have been described for measuring acidogenicity : sampling, touch - on / microtouch, and telemetric indwelling electrode. touch - on after telemetric method is introduced as the more reliable one.131720 bread is an important part of iranians diet21 and there is no data about the cariogenicity of iranian breads. the aim of this study was to compare ph change pattern following consumption of two popular types of bread with different consistencies, backing methods, and dough context. this study was performed on ten, 27 - 32 year - old postgraduate dental students. volunteers that were at high risk of dental caries development were participated in the study for assessing foods cariogenicity.22 inclusion criteria for selecting subjects were as : healthy individuals that were not under any special diet and medication, restored all active dental caries, saliva streptococcus mutans colonies more than 10, normal saliva buffering capacity (final ph 6), and stimulated saliva flow rate more than 5 ml/5 minutes.23 mean dmft of participants in the study was 6.10 1.56. number of saliva streptococcus mutans colonies count was performed using side - mount (sm) strip (dentocult - sm, orion diagnostica spoo, finland). based on manufacturer instructions, 15 minutes before using sm strip for collecting mutans streptococei, a 5 mg basitrasin tablet was added to a vial containing broth cultural media. the saliva contaminated sm strip transferred to this vial and incubated for 48 hours in 35 - 37c temperature. number of sm colonies was classified according to manufacturer scores available in the dentocult - sm kit. utilizing chair side dentobuff strip (dentobuff, orion diagnostica spoo, finland) saliva buffering capacity was evaluated. based on the color change after 5 minutes, the application of saliva buffering capacity was classified to low (yellow), medium (green) and normal (blue). stimulated saliva flow rate was collected for 5 minutes while subjects were chewing a piece of paraffin. subjects were refrained from any oral hygiene (brushing teeth, fluoride products) for 2 days (48 hours) and they did not drink or eat for at least 3 hours before ph measurements. two types of bread, plain traditionally backed sangak bread and soft bulky baguette bread, without backing soda as well as 10% sucrose solution were tested with a cross over trial design during a 4-week interval with one week washout period between different samples tests. all the test steps were performed between 10 - 12 a.m. by one practitioner who was blind for tested samples. plaque ph was measured by a nmph3/ph - microelectrode (beetrode, wpi instruments inc., new haven, ct) and a dri ref-2, as reference electrode (beetrode, wpi instruments inc., new haven, ct), that were attached to a digital ph - meter (hana instruments co, usa). a salt bridge was formed by placing subject 's finger in 3 molar kcl solution. ph - microelectrode was inserted at proximal site between first molar and second premolar in each quadrant. in case of presence of any restoration for each subject, a baseline plaque ph was recorded and followed by 1, 5, 10, 15, 20, and 30 minutes intervals after 1 minute chewing 10 g of any bread sample or rinsing of 10 ml 10% sucrose solution. all ph recordings were performed 10 seconds after electrode insertion. for each product, ph curve was drawn by mean ph values in all 10 subjects. minimum ph and ph - change between baseline and minimum ph were obtained from the curve. variance analysis followed by tukey test was performed to compare recorded ph between different times and groups. in this study, plaque ph was measured after consumption of 3 products, in - vivo. table 1 shows mean ph values at different times of experience for all three tested samples. mean plaque ph of 10% sucrose solution and baguette was not statistically different at 1, 20, and 30 minutes (p > 0.05). mean plaque ph of sangak and baguette showed significant difference at 0 (p 0.05). however the ph values of 1 (p = 0.006), 20 (p = 0.009), and 30 (p = 0.017) minutes of sangak and baguette were significantly different (p 0.05). in our study, no plaque ph drop below 5.5 (critical ph) was recorded in any group. the pronounced ph drop could only be seen in 3-day or older dental plaque.17 for good brushers, more rigorous conditions would be required to terminate to lowest plaque ph.817 although all subjects were refrained from oral hygiene for 48 hours, no ph drop was seen below 6 in all steps of the experiment. all the participants in the study were postgraduate dental students and it seems to be at highest oral hygiene standards so not falling ph to the values less than 6 despite being at high risk of caries could be expected. it has been revealed that acidogenicity, aciduricity, and producing polysaccharide of sm strains of caries active individuals are higher than sm strains isolated from caries free persons. however this difference is more prominant in very low ph environments.24 during all study intervals, the mean ph values following consumption sangak bread were higher than baguette. higher consistency of sangak bread needs more intense chewing which leads to more oral clearance, more saliva secretion, and higher buffering capacity comparing to soft baguette bread. on the other hand, there is an inverse relation between carbohydrate content and extraction degree of applied flour.25 the extraction degree of flour used for preparation of sangak and baguette bread is 97% and 75%, respectively ; for so it seems that carbohydrate content of baguette is more than sangak.26 in addition, higher temperature and shorter baking time of traditional breads, such as sangak, results in incomplete starch gelatination and as a consequence less degradation by salivary amylase.27 in this study, both breads made rise in plaque ph in 30 minutes which is similar to what have been reported in some other studies.28 lingstrm reported that breads made of wheat or barely flour cause ph drop in first 15 minutes.27 a group of studies found all baked wheat products cariogenic.2930 however, some other researches introduced starchy foods as less cryogenic foods.2231 a food product could be identified safe for teeth or dentally approved which makes no plaque ph drop below 5.7 during first 30 minutes of ph assessment.32 increasing ph more than baseline could be a characteristic of a noncariogenic food. so these two types of bread (sangak and baguette) that tested in this study could be described dentally safe foods. this study was done to assess the perceived sources higher consistency of traditional breads such as sangak, the flour used in traditional bread preparation which is less refined than flour used in bulky modern breads and higher temperature and shorter baking time of traditional bread seems to make traditional breads more | background : consistency, backing process and content differences could influence cariogenic potential of foods. the aim was to compare plaque ph changes following consumption of two types of bread with different physical characteristics.methods:in this clinical trial, interproximal plaque ph of 10 volunteers with high risk of dental caries (saliva streptococcus mutans > 105, high dental caries experience, and average dmft = 6.10 1.56) was measured. plain traditionally backed sangak bread and soft bulky baguette bread and % 10 sucrose solution were tested in a cross over designed experiment. baseline plaque ph was recorded and followed by 1, 5, 10, 15, 20, and 30 minutes intervals. data was analyzed using anova and tukey test (= 0.05).results : sucrose solution caused the most pronounced ph and ph drop from 7.15 0.33 at baseline to 6.78 0.29. means plaque ph of 10% sucrose solution and baguette were not statistically different at 1, 20 and 30 minutes (p > 0.05). mean plaque ph of sangak and baguette showed significant differences at 0, 1, 20 and30 minutes (p < 60 ; 0.05). sucrose solution caused a dramatic plaque ph drop during first 10 minutes and then within 30 minutes returned to baseline ph. for two bread samples within first 10 minutes, ph increased and then started to decrease during tenth to fifteenth minutes.conclusion:during all experiment phases, the mean ph of baguette with less consistency and carbohydrate content and higher rate of starch gelatination was lower compared to sangak. |
pharmacological treatment in schizophrenia has focused on the reduction in symptomatology, ie, mean change in score for specific psychiatric scales, such as positive and negative symptom scale, during a relatively short period (612 weeks) as evidence of successful treatment. actually, the guideline on the clinical investigation of antipsychotics by the european medical agency mentioned that primary efficacy measures should be presented as the numerical change in schizophrenia symptom score from baseline to study end point.1 nevertheless, the most important treatment goal in patients with schizophrenia is enabling each patient to re - engage in meaningful life experiences, namely functional remission and recovery from schizophrenia.2 regarding symptomatic remission, the remission in schizophrenia working group has proposed their definition for remission ; however, it requires further examination of validity and utility, as well as future refinement, particularly in relation to psychosocial functioning and cognitive dysfunctions associated with functional remission and recovery.3 social function is one of the important functional outcomes for patients with schizophrenia.47 several independent factors such as upbringing, premorbid personality and adjustment, social circumstance, shorter duration of untreated psychosis, etc contribute to functional outcomes.812 although antipsychotics have been used primarily to control symptoms, particularly positive symptoms and not with any direct therapeutic effects on cognition, social function, or quality of life related to functional outcomes, improvement of functional outcomes including social function should be mediated by symptom control.13 furthermore, several studies suggested that early symptom responses to antipsychotics should be associated with good functional outcomes, remission, and recovery.112,1417 paliperidone extended - release (pal - er) designed to deliver paliperidone, an active metabolite of risperidone, was approved in the united states, european union, japan, and many other countries for the treatment of schizophrenia. previous studies have demonstrated the effective outcome of pal - er in terms of personal and social functioning improvement evaluated by the personal and social performance (psp) scale as well as symptomatic improvement.1822 the majority of these studies were randomized, controlled, shorter in duration, and have studied the effects of fixed doses in selected and homogeneous groups of patients. therefore, evidence about the treatment effects on social function in routine clinical practice has been limited. we conducted a 1-year post marketing surveillance of pal - er to evaluate effects on social function, symptomatology, and safety in a naturalistic setting. the aims of the present study are : to demonstrate improvement of social function evaluated by social and occupational functioning assessment scale (sofas)23 and symptomatology evaluated by clinical global impression schizophrenia (cgi sch) scale,24 as well as time to discontinuation during 1-year treatment with pal-er.to assess safety of pal - er in clinical practice.to clarify the relationship between improvement of symptomatology and the social functional outcome : association between early symptom responses to pal - er and social functional outcome and which domain of improvement of symptomatology, ie, cgi - sch negative, contributes to social functional outcome. to demonstrate improvement of social function evaluated by social and occupational functioning assessment scale (sofas)23 and symptomatology evaluated by clinical global impression schizophrenia (cgi sch) scale,24 as well as time to discontinuation during 1-year treatment with pal - er. to assess safety of pal - er in clinical practice. to clarify the relationship between improvement of symptomatology and the social functional outcome : association between early symptom responses to pal - er and social functional outcome and which domain of improvement of symptomatology, ie, cgi - sch negative, contributes to social functional outcome. this was a 12-month, open - label, observational, multicenter surveillance study on the use of pal - er, newly initiated as antipsychotic treatment. patients meeting selection criteria were men and women with an established diagnosis of schizophrenia, who had recently been switched to, or started on, pal - er. patients having a history of allergic reactions to risperidone were excluded. physicians were advised that all treatments and dose adjustments should be based on approved local labels, and that management decisions should be made at the physician s discretion, using clinical judgment and routine practice. in general, treatment was recommended to be started with 6 mg pal - er daily. flexible maintenance dosing with pal - er 312 mg / day was recommended, with dose adjustment indicated by the physician s assessment based on individual clinical response and tolerability. the protocol was reviewed by internal review board members including the ethical point of view and was approved by the pharmaceuticals and medical devices agency. symptom severity was assessed with the cgi - sch24 at baseline, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months, 9 months, and 12 months. cgi - sch was scored on a 7-point scale from 1= normal to 7= among the most extremely ill for each symptom domain (overall, positive, negative, depressive, cognitive). social function was assessed with sofas, developed by the american psychiatric association for the diagnostic and statistical manual of mental disorders, fourth edition (dsm - iv) to operationalize functioning, which was improved on the global assessment of functioning scale by incorporating the impact of psychological and general medical symptoms on patient functioning.23 the sofas was scored on a scale of 0100 as a 10-point scale from 110 as 1= persistent hygiene problems to 91100 as 10= superior functioning for the current period at baseline, electronic data capture system was used and the majority of the data were transcribed by the physicians from the source documents on to the electronic case report form and then transmitted in a secure manner to the sponsor. although we recommended pal - er monotherapy, more than 65% of patients were given other antipsychotics combined with pal - er (polypharmacy) ; therefore, we performed post hoc analyses for evaluating the differences between monotherapy and polypharmacy groups (monotherapy versus polypharmacy). the discontinuation rate was calculated by the kaplan meier method, and the monotherapy versus polypharmacy comparison in discontinuation rate was performed using the log - rank test. time effects on sofas and cgi - sch scores were analyzed by generalized linear mixed models (glmm). the interaction of time monotherapy versus polypharmacy, age, sex, sofas, and cgi - sch scores at the baseline were modeled. post hoc comparisons for monotherapy versus polypharmacy following glmm were done with t - tests for each time point against baseline using bonferroni adjustment. regarding the social functional remission, factors which are associated with the social functional remission and changes in the rate of the social functional remission between the baseline and the end of the study were analyzed. to identify variables that explain social functional remission, logistic regression analysis was performed. the factors associated with social functional remission were regressed on delta (follow - up minus baseline) or baseline cgi - sch scores and patient s demographic characteristics such as sex, age, and monotherapy versus polypharmacy. a glmm was applied to examine the association of social functional remission and the interaction of time monotherapy versus polypharmacy. the wilcoxon rank sum test, the fisher s exact test, and the chi - square test were used to assess comparisons between demographic and the incidence of aes for monotherapy versus polypharmacy. statistical analyses were conducted using r statistical software version 3.1.0 (foundation for statistical computing, vienna, austria) and sas version 9.3 (sas institute inc., this was a 12-month, open - label, observational, multicenter surveillance study on the use of pal - er, newly initiated as antipsychotic treatment. patients meeting selection criteria were men and women with an established diagnosis of schizophrenia, who had recently been switched to, or started on, pal - er. patients having a history of allergic reactions to risperidone were excluded. physicians were advised that all treatments and dose adjustments should be based on approved local labels, and that management decisions should be made at the physician s discretion, using clinical judgment and routine practice. in general, treatment was recommended to be started with 6 mg pal - er daily. flexible maintenance dosing with pal - er 312 mg / day was recommended, with dose adjustment indicated by the physician s assessment based on individual clinical response and tolerability. the protocol was reviewed by internal review board members including the ethical point of view and was approved by the pharmaceuticals and medical devices agency. symptom severity was assessed with the cgi - sch24 at baseline, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, 6 months, 9 months, and 12 months. cgi - sch was scored on a 7-point scale from 1= normal to 7= among the most extremely ill for each symptom domain (overall, positive, negative, depressive, cognitive). social function was assessed with sofas, developed by the american psychiatric association for the diagnostic and statistical manual of mental disorders, fourth edition (dsm - iv) to operationalize functioning, which was improved on the global assessment of functioning scale by incorporating the impact of psychological and general medical symptoms on patient functioning.23 the sofas was scored on a scale of 0100 as a 10-point scale from 110 as 1= persistent hygiene problems to 91100 as electronic data capture system was used and the majority of the data were transcribed by the physicians from the source documents on to the electronic case report form and then transmitted in a secure manner to the sponsor. although we recommended pal - er monotherapy, more than 65% of patients were given other antipsychotics combined with pal - er (polypharmacy) ; therefore, we performed post hoc analyses for evaluating the differences between monotherapy and polypharmacy groups (monotherapy versus polypharmacy). the discontinuation rate was calculated by the kaplan meier method, and the monotherapy versus polypharmacy comparison in discontinuation rate was performed using the log - rank test. time effects on sofas and cgi - sch scores were analyzed by generalized linear mixed models (glmm). the interaction of time monotherapy versus polypharmacy, age, sex, sofas, and cgi - sch scores at the baseline were modeled. post hoc comparisons for monotherapy versus polypharmacy following glmm were done with t - tests for each time point against baseline using bonferroni adjustment. regarding the social functional remission, factors which are associated with the social functional remission and changes in the rate of the social functional remission between the baseline and the end of the study were analyzed. to identify variables that explain social functional remission, logistic regression analysis was performed. the factors associated with social functional remission were regressed on delta (follow - up minus baseline) or baseline cgi - sch scores and patient s demographic characteristics such as sex, age, and monotherapy versus polypharmacy. a glmm was applied to examine the association of social functional remission and the interaction of time monotherapy versus polypharmacy. the wilcoxon rank sum test, the fisher s exact test, and the chi - square test were used to assess comparisons between demographic and the incidence of aes for monotherapy versus polypharmacy. statistical analyses were conducted using r statistical software version 3.1.0 (foundation for statistical computing, vienna, austria) and sas version 9.3 (sas institute inc., a total of 1,429 patients were enrolled in the surveillance study, of whom 1,405 were evaluable for safety and 1,142 were evaluable for efficacy (figure 1). two hundred and forty - five subjects who were coded as incomplete for efficacy evaluation by physicians were removed from efficacy dataset because of the lack of baseline information. the mean standard deviation (sd) age was 46.6715.45 years and 51.06% of patients were female. about 65.84% of patients in the safety analysis set were given other antipsychotics combined with pal - er (polypharmacy). the antipsychotics given in the polypharmacy group were risperidone (n=328), olanzapine (n=234), quetiapine (n=143), aripiprazole (n=134), blonanserin (n=109), perospirone (n=33), clozapine (n=1), and typical antipsychotics (n=520). comparisons between monotherapy and polypharmacy groups demonstrated that the polypharmacy group had significantly higher body mass index (bmi) (p=0.01), the rate of hospitalized patients (p<0.001) and the rate of patients treated with pretreatment antipsychotics at the entry (p<0.001), and mean daily dose of pal - er than monotherapy group (p<0.001). the mean score of cgi - sch overall, negative, and cognitive and sofas score at the baseline in the efficacy dataset were significantly worse in the polypharmacy group (overall : p<0.001 ; negative : p=0.01 ; cognitive : p=0.04 ; sofas : p<0.001). the treatment discontinuation rates for any reason during the observation period are shown in figure 2. the withdrawals were due to patient s choice (12.60%), due to aes (10.32%), the lack of efficacy (8.75%), and other reasons (10.75%). the post hoc analysis for monotherapy versus polypharmacy demonstrated a significantly higher discontinuation rate for any reason in the polypharmacy group (37.10%) than in the monotherapy group (29.40% ; log - rank test, p=0.027). chi - square tests revealed that reasons of discontinuations between both groups were not different (=2.72, p=0.436) ; monotherapy versus polypharmacy were as follows : patient s choice : 11.67% versus 13.08%, safety reasons : 8.13% versus 11.46%, lack of efficacy : 6.88% versus 9.73%, and other reasons : 14.79% versus 8.65%. time changes of the treatment in sofas and cgi - sch scores, and results of post hoc t - tests using bonferroni adjustment following glmm are shown in figures 3 and 4. one hundred and twelve patients were scored as not enough information to make an evaluation by physicians on sofas score and these data were handled as missing data. glmm revealed a significant main effect for time in sofas (f[2, 2,056]=23.25, p<0.001). the post hoc test revealed that there were significant improvements in the sofas score between the baseline and all follow - up points, and between 6 and 12 months. in addition to the main effect for time, main effect of monotherapy versus polypharmacy group was significant (f[1, 1,025]=32.18, p<0.001). no significant interaction was found between time and monotherapy versus polypharmacy (f[2, 2,056]=1.00, p=0.366). regarding symptomatic scores, glmm also revealed a significant main effect for time in all cgi scores (overall : f[7, 7,980]=85.54, p<0.001 ; positive : f[7, 7,952]=91.20, p<0.001 ; negative : f[7, 7,959]=69.71, p<0.001 ; depressive : f[7, 7,945]=30.58, p<0.001 ; cognitive : f[7, 7,924]=28.46, p<0.001). the post hoc test revealed that there were significant improvements between the baseline and each follow - up time point. for the post hoc comparisons of each adjacent time point, the cgi - sch overall score, as well as the positive score were significantly improved over time from the baseline to 24 weeks and between 36 and 52 weeks. the cgi - sch negative score was significantly improved over time from the baseline to 12 weeks, and between 36 and 52 weeks. the cgi - sch depressive score was significantly improved over time from the baseline to 24 weeks. the cgi - sch cognitive score was signifi - cantly improved over time from the baseline to 12 weeks. in addition to the main effect of time, main effect of monotherapy versus polypharmacy group was significant in all cgi scores (overall : f[1, 1,137]=162.29, p<0.001 ; positive : f[1, 1,133]=135.50, p<0.001 ; negative : f[1, 1,134]=221.54, p<0.001 ; depressive : f[1, 1,132]=41.59, p<0.001 ; cognitive : f[1, 1,129]=81.44, p<0.001). the interaction of time monotherapy versus polypharmacy group was also significant in all cgi - sch scores (overall : f[7, 7,98]=2.77, p=0.007 ; positive : f[7, 7,952]=3.66, p<0.001 ; negative : f[7, 7,959]=3.71, p<0.001 ; depressive : f[7, 7,945]=3.50, p<0.001 ; cognitive : f[7, 7,924]=1.30, p=0.247). all factors modeled and the results of the logistic regression analysis are showed in table 2. none of the variance inflation factor values were up to 7, indicating that multicollinearity in the following logistic regression model is not evident. logistic regression analysis showed that sex (p=0.048), baseline cgi negative score (p=0.004), and cgi positive at 4 weeks (p=0.024) were significantly associated with the socially functional remission (table 2). the percentage of patients showing social functional remission was 2.89% at the baseline and 13.22% at 52 weeks (the mean sd duration of functional remission was 6.384.11 months). patients with 61 points were 4.58% in the monotherapy group and 2.08% in the polypharmacy group at the baseline, and 15.90% in the monotherapy group and 11.93% in the polypharmacy group at 52 weeks. finally, glmm was used to examine the effect of interaction of time monotherapy versus polypharmacy for the change of the percentage of social functional remission. while the effect of time was significant (f[1, 615]=126.39, p<0.001) and the effect of monotherapy versus polypharmacy group was also significant (f[1, 1,049]=14.54, p<0.001), interaction of time group was not significant (f[1, 615]=0.20, p=0.656). the saes (serious aes) occurring in greater than or equal to two cases and some frequent saes of antipsychotics in addition to the number of deaths are also listed in table 3. the most commonly reported aes were hyperprolactinemia (6.55%), somnolence (5.91%), malaise (4.84%), increased weight (2.85%), akathisia (2.63%), insomnia (2.56%), and extrapyramidal disorder (1.64%). post hoc analysis revealed significantly higher incidences of aes in the polypharmacy group than those in the monotherapy group for all aes (p<0.001), psychiatric symptoms (p=0.003), parkinsonism (p=0.042), hyperprolactinemia (p=0.002), increased blood prolactin level (p=0.007), and increased weight (p=0.003). most commonly reported saes which occurred more than or equal to 1.00% were extrapyramidal disorder (1.00%) and schizophrenia (1.00%). one case (0.07%) each of malignant neuroleptic syndrome and tardive dyskinesia was reported as a sae. post hoc analysis revealed significantly higher incidences of saes in the polypharmacy group than those in the monotherapy group, all saes (p<0.001), psychiatric symptoms (p=0.019), and parkinsonism (p=0.011).. causes of deaths were suicide (n=3, 0.21%), pneumonia (n=2, 0.14%), acute cardiac infarction (n=1, 0.07%), pulmonary malignant neoplasm (n=1, 0.07%), sudden death (n=1, 0.07%), multiple organ failure (n=1, 0.07%), cerebellar hemorrhage (n=1, 0.07%), ileus (n=1, 0.07%), and unknown (n=1, 0.07%). eleven of these patients were in the polypharmacy group (0.21%) and one was in the monotherapy group (1.19%). a total of 1,429 patients were enrolled in the surveillance study, of whom 1,405 were evaluable for safety and 1,142 were evaluable for efficacy (figure 1). two hundred and forty - five subjects who were coded as incomplete for efficacy evaluation by physicians were removed from efficacy dataset because of the lack of baseline information. the mean standard deviation (sd) age was 46.6715.45 years and 51.06% of patients were female. about 65.84% of patients in the safety analysis set were given other antipsychotics combined with pal - er (polypharmacy). the antipsychotics given in the polypharmacy group were risperidone (n=328), olanzapine (n=234), quetiapine (n=143), aripiprazole (n=134), blonanserin (n=109), perospirone (n=33), clozapine (n=1), and typical antipsychotics (n=520). comparisons between monotherapy and polypharmacy groups demonstrated that the polypharmacy group had significantly higher body mass index (bmi) (p=0.01), the rate of hospitalized patients (p<0.001) and the rate of patients treated with pretreatment antipsychotics at the entry (p<0.001), and mean daily dose of pal - er than monotherapy group (p<0.001). the mean score of cgi - sch overall, negative, and cognitive and sofas score at the baseline in the efficacy dataset were significantly worse in the polypharmacy group (overall : p<0.001 ; negative : p=0.01 ; cognitive : p=0.04 ; sofas : p<0.001). the treatment discontinuation rates for any reason during the observation period are shown in figure 2. the withdrawals were due to patient s choice (12.60%), due to aes (10.32%), the lack of efficacy (8.75%), and other reasons (10.75%). the post hoc analysis for monotherapy versus polypharmacy demonstrated a significantly higher discontinuation rate for any reason in the polypharmacy group (37.10%) than in the monotherapy group (29.40% ; log - rank test, p=0.027). chi - square tests revealed that reasons of discontinuations between both groups were not different (=2.72, p=0.436) ; monotherapy versus polypharmacy were as follows : patient s choice : 11.67% versus 13.08%, safety reasons : 8.13% versus 11.46%, lack of efficacy : 6.88% versus 9.73%, and other reasons : 14.79% versus 8.65%. time changes of the treatment in sofas and cgi - sch scores, and results of post hoc t - tests using bonferroni adjustment following glmm are shown in figures 3 and 4. one hundred and twelve patients were scored as not enough information to make an evaluation by physicians on sofas score and these data were handled as missing data. glmm revealed a significant main effect for time in sofas (f[2, 2,056]=23.25, p<0.001). the post hoc test revealed that there were significant improvements in the sofas score between the baseline and all follow - up points, and between 6 and 12 months. in addition to the main effect for time, main effect of monotherapy versus polypharmacy group was significant (f[1, 1,025]=32.18, p<0.001). no significant interaction was found between time and monotherapy versus polypharmacy (f[2, 2,056]=1.00, p=0.366). regarding symptomatic scores, glmm also revealed a significant main effect for time in all cgi scores (overall : f[7, 7,980]=85.54, p<0.001 ; positive : f[7, 7,952]=91.20, p<0.001 ; negative : f[7, 7,959]=69.71, p<0.001 ; depressive : f[7, 7,945]=30.58, p<0.001 ; cognitive : f[7, 7,924]=28.46, p<0.001). the post hoc test revealed that there were significant improvements between the baseline and each follow - up time point. for the post hoc comparisons of each adjacent time point, the cgi - sch overall score, as well as the positive score were significantly improved over time from the baseline to 24 weeks and between 36 and 52 weeks. the cgi - sch negative score was significantly improved over time from the baseline to 12 weeks, and between 36 and 52 weeks. the cgi - sch depressive score was significantly improved over time from the baseline to 24 weeks. the cgi - sch cognitive score was signifi - cantly improved over time from the baseline to 12 weeks. in addition to the main effect of time, main effect of monotherapy versus polypharmacy group was significant in all cgi scores (overall : f[1, 1,137]=162.29, p<0.001 ; positive : f[1, 1,133]=135.50, p<0.001 ; negative : f[1, 1,134]=221.54, p<0.001 ; depressive : f[1, 1,132]=41.59, p<0.001 ; cognitive : f[1, 1,129]=81.44, p<0.001). the interaction of time monotherapy versus polypharmacy group was also significant in all cgi - sch scores (overall : f[7, 7,98]=2.77, p=0.007 ; positive : f[7, 7,952]=3.66, p<0.001 ; negative : f[7, 7,959]=3.71, p<0.001 ; depressive : f[7, 7,945]=3.50, p<0.001 ; cognitive : f[7, 7,924]=1.30, p=0.247). all factors modeled and the results of the logistic regression analysis are showed in table 2. none of the variance inflation factor values were up to 7, indicating that multicollinearity in the following logistic regression model is not evident. logistic regression analysis showed that sex (p=0.048), baseline cgi negative score (p=0.004), and cgi positive at 4 weeks (p=0.024) were significantly associated with the socially functional remission (table 2). the percentage of patients showing social functional remission was 2.89% at the baseline and 13.22% at 52 weeks (the mean sd duration of functional remission was 6.384.11 months). patients with 61 points were 4.58% in the monotherapy group and 2.08% in the polypharmacy group at the baseline, and 15.90% in the monotherapy group and 11.93% in the polypharmacy group at 52 weeks. finally, glmm was used to examine the effect of interaction of time monotherapy versus polypharmacy for the change of the percentage of social functional remission. while the effect of time was significant (f[1, 615]=126.39, p<0.001) and the effect of monotherapy versus polypharmacy group was also significant (f[1, 1,049]=14.54, p<0.001), interaction of time group was not significant (f[1, 615]=0.20, p=0.656). the saes (serious aes) occurring in greater than or equal to two cases and some frequent saes of antipsychotics in addition to the number of deaths are also listed in table 3. the most commonly reported aes were hyperprolactinemia (6.55%), somnolence (5.91%), malaise (4.84%), increased weight (2.85%), akathisia (2.63%), insomnia (2.56%), and extrapyramidal disorder (1.64%). post hoc analysis revealed significantly higher incidences of aes in the polypharmacy group than those in the monotherapy group for all aes (p<0.001), psychiatric symptoms (p=0.003), parkinsonism (p=0.042), hyperprolactinemia (p=0.002), increased blood prolactin level (p=0.007), and increased weight (p=0.003). approximately, 8.75% of patients had one or more saes. most commonly reported saes which occurred more than or equal to 1.00% were extrapyramidal disorder (1.00%) and schizophrenia (1.00%). one case (0.07%) each of malignant neuroleptic syndrome and tardive dyskinesia was reported as a sae. post hoc analysis revealed significantly higher incidences of saes in the polypharmacy group than those in the monotherapy group, all saes (p<0.001), psychiatric symptoms (p=0.019), and parkinsonism (p=0.011). causes of deaths were suicide (n=3, 0.21%), pneumonia (n=2, 0.14%), acute cardiac infarction (n=1, 0.07%), pulmonary malignant neoplasm (n=1, 0.07%), sudden death (n=1, 0.07%), multiple organ failure (n=1, 0.07%), cerebellar hemorrhage (n=1, 0.07%), ileus (n=1, 0.07%), and unknown (n=1, 0.07%). eleven of these patients were in the polypharmacy group (0.21%) and one was in the monotherapy group (1.19%). data from this observational study demonstrated that patients treated with pal - er showed significant improvements in social function and symptoms and these can be controlled with a 34.66% discontinuation rate for any reason at 12 months. the discontinuation rate in the present study is generally consistent in magnitude to the rates observed in previous studies.21,2527 since discontinuation for any reason is a global index of antipsychotic effectiveness and tolerability, the present result indicates that pal - er treatment is efficacious and well tolerated.25,26 although scales measured in the present study are different from those of previous randomized controlled pivotal trials, observed findings of improvements on both symptoms and social function are concordant with randomized controlled trials and a pooled data analysis that have demonstrated a significant improvement of personal and social functioning following treatment with pal - er.1821 a significant increase in the rate of patients with social functional remission was also observed. the data clearly indicate the clinical effectiveness of pal - er in terms of improving social functioning in patients with schizophrenia. improving social functioning even with good symptom control, poor personal and social functioning should compromise the potential of patients to optimize their ability to function in daily life. therefore, the impact of antipsychotic treatment on functioning is the most important factor of improving the long - term prognosis of patients with schizophrenia.7 regarding improvements of symptoms of schizophrenia, improvements were observed within the first 2 weeks of the treatment and improved symptoms were maintained during the observational period. respond to a given antipsychotic medication as symptom reduction is evident within the first 2 weeks of starting an antipsychotic medication.1517 early response to antipsychotic drug therapy has been associated subsequently with an increased likelihood of achieving symptom remission, with greater improvement on functional outcomes.15 we postulate that early symptomatic improvement caused by pal - er should be associated with subsequent improvement on social function, and early symptomatic improvement suggests the clinical usefulness of pal - er in patients with schizophrenia. results from logistic regression analysis demonstrate the improvements in schizophrenic symptoms associated with pal - er treatment ; early improvement in positive symptoms was associated with social functional remission. previous studies have also demonstrated strong associations between good functional outcomes and symptomatic improvements.7,10,11 they also reported that a lower positive and negative symptom scale negative score was predictive of functional remission. several studies have implicated negative symptoms and neurocognitive deficits in poor functional outcomes.25 although the present study did not show a relationship between improvements in negative symptoms caused by treatment and socially functional remission, a significant association of severity of negative symptoms at baseline was observed. our results are in line with those of previous studies28,29 that support the accepted notion about the relationship between negative symptoms and social functional outcomes in patients with schizophrenia. at the same time, however, our results demonstrate that there are still important limitations to current treatments for schizophrenia. first, only approximately 20% of patients had social functional remission in the present study. second, severity of negative symptoms at baseline had marked effects on social functional outcomes. currently available treatments for negative symptoms appear to have modest benefits, with the result that negative symptoms continue to limit patient recovery.28,29 despite the advent of antipsychotics, the relatively low rate of social functional remission observed in the present study demonstrates that there are still important limitations to current treatments for chronic schizophrenia. more effective novel drugs specifically targeting reducing negative symptoms are needed to improve the prognosis of patients. as with symptomatology, sex was also highly associated with social functional remission. it is well known that women with schizophrenia showed better prognosis and social function than men with schizophrenia.30 several sociodemographic factors such as status of employment, and a better premorbid social adjustment, have been reported as potential predictors to be highly predictive of social functional remission as well as symptomatic improvement.10,12 in this study, we did not collect these important factors related to social functional remission. although we recommended monotherapy with pal - er, more than 60% of patients were treated with antipsychotic polypharmacy (pal - er combined with other antipsychotics). in japan, a previous study also reported that more than 65% patients with schizophrenia were given antipsychotic polypharmacy.31 the high rate of polypharmacy in the study is a mirror of current prescription profiles of pharmacotherapy for schizophrenia patients in japan. despite a lack of evidence of increased efficacy and a higher risk for adverse effects related to polypharmacy, it has become more common since the development of second - generation antipsychotics.31,32 in this study, pal - er monotherapy group showed more improvement in symptoms and a lower discontinuation rate than the polypharmacy group. contrary to the present result, a previous study documented the lower discontinuation rate in the polypharmacy group than that in the pal - er monotherapy group.32 the present study is an observational study ; therefore, causality between polypharmacy and efficacy outcomes remains to be clarified. for example, it would be possible that patients with polypharmacy would have a more severe form of schizophrenia, and consequently physicians combine antipsychotics. it is one of the limitations of the present study. on the other hand, the improvement of social functioning and the rate of social functional remission did not differ between the groups. the results also demonstrated that whether patients were given monotherapy or polypharmacy was not related to the social functional outcome. these suggest that pal - er treatment should improve social functioning regardless of monotherapy or polypharmacy, given that improvement in both groups was clinically relevant. the safety data in the present study are generally concordant with the safety profile of pal - er documented in previous studies, with no unexpected findings from long - term treatment and a safety profile consistent with the known pharmacological profile of pal. the mean dose of pal - er in the polypharmacy group was higher than that in the pal - er monotherapy group. furthermore, a considerable number of patients with polypharmacy were given other d2 antagonists in addition to pal - er. the different safety profile of monotherapy versus polypharmacy might be associated with high - dose antipsychotic therapy in the polypharmacy group. because this study was a naturalistic one with flexible dose treatment, we did not evaluate the relationship between mean dose of pal - er and increasing risks of aes in the monotherapy group. this 1-year observational study data from 1,405 patients with schizophrenia indicates that effective symptom control and improvement in social functioning as assessed by sofas can be maintained with pal - er. the findings expand on the evidence obtained from randomized controlled clinical trials with pal - er and support previous positive findings of social functional improvement. furthermore, the data suggest that early response to antipsychotic treatment may result in better outcomes for consequent social functional outcomes. | backgroundsocial functioning is an important outcome for patients with schizophrenia. to evaluate the effects of paliperidone extended - release (pal - er) on social function, symptomatology, and safety in the routine clinical practice, we conducted a 1-year post - marketing surveillance study of pal - er. we also explored relationships between symptomatic improvement and socially functional outcome in patients with schizophrenia.patients and methodspatients with an established diagnosis of schizophrenia were allowed flexible 312 mg / day dosing during the surveillance. patients were assessed on social functioning using the social and occupational functioning assessment scale (sofas) and on symptomatology using the clinical global impression schizophrenia scale. all adverse events (aes) were also collected.resultsa total of 1,429 patients were enrolled in the surveillance study, of whom 1,405 were evaluable for safety and 1,142 were evaluable for efficacy. the treatment discontinuation rate for any reason during the observation period was 34.66%. significant improvements were observed on both social and occupational functioning assessment scale and clinical global impression schizophrenia scale during the observation period. the percentage of patients with socially functional remission (sofas 61) also increased significantly. a significant association between early improvements in positive symptoms, sex, severity of negative symptoms at baseline, and socially functional remission was observed. a total of 33.52% of patients had aes and 8.75% of patients had serious aes. despite the recommendation of monotherapy with pal - er, 65.84% of patients were given additional antipsychotics (polypharmacy). post hoc comparisons of monotherapy versus polypharmacy revealed that the monotherapy group had better outcomes and fewer aes than the polypharmacy treated group. the improvement in social functioning and the rate of socially functional remission did not differ between groups.conclusionpal-er treatment showed effective symptom control and improvement in social functioning. the data suggest that early response to antipsychotic treatment should be important for functional outcomes. |
setaria tundra, a species of filarioid nematode, has caused three documented disease outbreaks among cervids in finland, including those in reindeer (rangifer tarandus) in 1973 and 20032005 (laaksonen., 2007) and in moose (alces alces) in 1989 (nygren, 1990). the first recognized outbreak of s. tundra in fennoscandia was reported by rehbinder. (1975) in 19721973 among swedish reindeer originating from forest herds at relatively low altitudes ; in contrast, the parasite was apparently absent in animals from mountain herds. in 1973, s. tundra was associated with later, in the winter of 19731974, tens of thousands of reindeer died in the northern part of finnish reindeer herding area, where severe peritonitis and large numbers of setaria sp. worms were commonly found in postmortem examination (see laaksonen., 2007). during this outbreak, the reduction was most intense in the northern (sodankyl level ; fig. 1) and eastern (kuusamo) areas where the population decreased by 40 and 30%, respectively (database of finnish reindeer herders association). further in 19731974, s. tundra was observed for the first time in norway where an explosive epidemic among northern herds resulted in widespread condemnation of meat, livers, and adjacent tissues due to the effects of peritonitis, hepatitis, and perihepatitis (kummeneje, 1980). the most recent epidemic in reindeer rapidly emerged in 2003 across the southern parts of the finnish reindeer herding area and was first noticed in the kuusamo region. as of 2005, expansion of the outbreak was extensive, and only the reindeer in the northernmost part of finland (kevo area) appeared to remain free of disease, although carriers of s. tundra also appeared in northern herds (laaksonen., 2008a).figure 1distribution of herding areas for finnish reindeer (black) and the location of the three weather stations representing the region. distribution of herding areas for finnish reindeer (black) and the location of the three weather stations representing the region., 2008a)) in finnish moose was reported in 1989 by nygren (1990) based on an extensive examination of the genital tracts and adjacent tissues from 1,132 females originating from the finnish reindeer herding area. the number of moose examined in this study represented 83% of hunted females in the area. a marked inflammatory granulomatous reaction associated with the parasite was recorded in 29% of the adult hinds, whereas 46% of calves and 55% of yearlings were infected. the epidemic was most intense in the southern and middle parts of the reindeer herding area, whereas moose from the northern part appeared free of infection. although this outbreak took place within the core of the reindeer husbandry area, and the reindeer population was in its peak (database of finnish reindeer herders association), setaria tundra nematodes have a complex life cycle where infective larvae are transmitted to ungulate hosts by mosquitoes (culicidae) and in which many climate - related drivers play a major role (laaksonen., 2009). massive swarms of blood - feeding insects attacking herds of caribou / reindeer are well known (anderson and nilssen, 1998). some estimates suggest that reindeer can be exposed to attacks of approximately 8,000 mosquitoes per hour during the mass appearance of blood sucking insects (kadnikov, 1989), which locally is known as a rkk prevalence of s. tundra among different mosquito populations in 2004 across endemic regions in finland was 0.52.5% (laaksonen., 2009). in these conditions, reindeer could hourly be attacked by 40 to 200 mosquitoes carrying infective larvae of s. tundra. habitat preferences by reindeer during periods of high temperatures during the summer also may contribute as a determinant of exposure to infection. during the height of warm summers, hundreds of reindeer congregate in dense herds in low elevation, mosquito - rich wetlands coinciding with areas of considerable activity by vectors (laaksonen. the microclimate is favorable for mosquitoes, and it is presumed that hyperendemic foci of infection enhance the potential for transmission ; for example, in these wetland habitats, the infection rate of s. tundra in mosquitoes can reach and occasionally exceed 2.5% (laaksonen., 2009). vector breeding sites are not limited by humidity or water resources, because mires and bogs constitute approximately 3040% of the total land area in the regions where outbreaks of s. tundra have been recognized. in contrast, only approximately 12% of upper lapland is bog habitat (kumpula., 1999), which may restrict transmission (laaksonen. where favorable environmental and host factors coincide, the transmission of s. tundra is highly dependent on the life span of female mosquitoes and the specific demographics of the population (laaksonen., 2009) ; survival of adult mosquitoes is in part dependent on both temperature and humidity (barry and juliano, 2001). for example, during the latest epidemic, older females comprised a considerable component of the wild mosquito population but densities were low (laaksonen., 2009). in contrast, the s. tundra outbreak in sweden in 1973 was associated with unusually warm weather and with the appearance of especially large numbers of mosquitoes (rehbinder., 1975). the presence and proportion of older female mosquitoes in a given population, however, is a more critical factor for transmission of s. tundra rather than the density alone. older females may have fed several times and are thus more likely to have become infected with tens of s. tundra larvae (laaksonen., 2009). within limits, warmth also affects the development, reproduction, longevity, and feeding habits of mosquito vectors (clements, 1963, delatte., 2009), and the lowest temperature of the seasonal regime is a limiting factor for survival (e.g., in aedes albopictus) (lwenberg - neto and navarro - silva, 2004). albopictus, may be significantly influenced by temperature (calado and navarro - silva, 2002). finally, the development of s. tundra to the infective stage in mosquitoes is highly temperature - dependent and inversely related. warmth decreases the time required for the larval development of s. tundra (laaksonen., 2009). it is obvious that these factors of the biology of hosts (both definitive host and arthropod vectors) and parasites may act in synergy with the environmental conditions to enhance the potential for significant transmission, infection, and disease outbreaks (lafferty, 2009 ; gubler., 2001). mosquito - borne pathogens and diseases are predicted to be among the most climate - sensitive maladies (patz., 1996) ; however, to date, little empirical evidence has been presented. (2008a, b) discussed some interactions among these drivers related to climate, and the present study provides strong empirical evidence of the relationship. the outbreaks in 1973 and 20032005 led to substantial losses to the herding economy and had a pronounced influence on the welfare of calves (laaksonen. the outbreaks have revealed that s. tundra can act as a significant pathogen for reindeer, which was evident at both ante- and postmortem inspection of slaughter animals and in histological and experimental examinations (laaksonen. thus, these parasites represent a considerable threat to biological diversity, ecological continuity, and cultural and socioeconomic well - being in the region. we studied the effects of ambient summer temperatures on the known outbreaks of s. tundra in populations of finnish cervids, based on historical weather data (19612004) from three independent meteorological stations of the finnish meteorological institute representing the reindeer herding area of finland (kuusamo, sodankyl and kevo) (fig. 1). kuusamo and sodankyl represent the outbreak areas in 1989 and 20032005, whereas all the stations represent the outbreak area in 1973. we tested a hypothesis that the probability of setaria outbreak in year t depends on the summer mean temperatures (summer period : june august) during year t and year t 1. we also assessed whether a high current year summer temperature, tt, was sufficient for an epidemic or whether the effect of current year temperature depended on summer temperature during year t 1. to do this the occurrence of an epidemic was a dichotomous dependent variable ; mean summer temperatures tt, tt 1, and their interaction, as well as site (a random effect) were independent variables in the model. the results of generalized linear modelling indicated that the occurrence of an epidemic increased with tt (b = 6.60 3.39 (s.e.) ; p = 0.0004). however, this effect was conditional on tt 1 since a significant tt tt 1 interaction was also observed (b = 0.86 0.23, p = 0.0002). on the basis of our model, high tt was likely to cause an epidemic only if tt 1 was higher than 14c (fig. 2). the mean summer temperature for the region in study period was 12c (range, 8.815.1).figure 2predicted probabilities of setaria tundra outbreaks as a function of mean summer temperature, tt and tt 1 (c), for an outbreak and the preceding year. the predictions were obtained from a generalized linear model (occurrence of epidemic regressed against tt, tt 1 and their interaction). predicted probabilities of setaria tundra outbreaks as a function of mean summer temperature, tt and tt 1 (c), for an outbreak and the preceding year. the predictions were obtained from a generalized linear model (occurrence of epidemic regressed against tt, tt 1 and their interaction). our data obtained in this study suggest that warm episodes or otherwise extreme events of temperature, embedded within long - term trends for climate warming, are a factor that promotes serious outbreaks and emergence of s. tundra. these factors may represent a generalized determinant for occurrence and outbreaks for other filarioid parasites across northern latitudes. there are many nonclimatological and climatological factors that enhance the life cycle of s. tundra, its transmission, and survival in the reindeer population. many of these factors remain linked to climate at some level. the effect of these drivers on the patterns of distribution for parasites in both definitive hosts and vectors, overall host - pathogen relationships and emergence of an outbreak, may be both incremental (cumulative) and extreme (episodic). the synchrony between peak periods of s. tundra microfilaremia, peak activity of vectors, shedding of adult reindeer, and low immunity status of calves (laaksonen., 2008a, b, 2009) probably promotes the transmission of s. tundra from adult carriers to calves. contributing factors in determining patterns of transmission and outbreaks are seen in the high capacity of s. tundra to produce microfilariae (nikander., 2007), high vector efficiency (laaksonen., 2009), the stress and host behavior during warm periods (helle and aspi, 1984 ; helle., 1992 ; pollard. 1996 ; mrchel and klein, 1997 ; anderson and nilssen, 1998 ; weladj., 2002 ; laaksonen., 2009), and the impact on host physiology (laaksonen., 2008a) of insect harassment. the observations also suggest that the migrations of reindeer (laaksonen., 2009) and the characteristics of reindeer pastures (rehbinder., 1975 ; dadaev, 1984 ; laaksonen., 2009) are involved. on the population level, the abundance of sylvatic reservoirs (laaksonen., 2007, 2008a, b), the host density (laaksonen., 2008b), and massive antiparasitic treatment in semidomesticated reindeer (laaksonen., 2008b), as well as growing immunity in the possibility for emergence of the outbreaks being linked to the introduction of a new s. tundra strain that could have been more pathogenic for hosts can not be excluded (nikander., 2007 ; laaksonen. molecular sequence data indicate that discrete populations of s. tundra may be circulating in moose and reindeer, respectively, even in zones of sympatry (laaksonen., 2008a, b). during the recent epidemic in reindeer during 20032005, the moose population peaked in northern finland and no cases of acute peritonitis or living adult s. tundra worms were detected ; only a few preadults were found encapsulated on the surface of livers (laaksonen., 2007). thus, parasites circulating in reindeer and roe deer, demonstrated as the causative agent of the 20032005 outbreak, appear to be discrete from those that may be circulating in moose or other cervids (laaksonen. parasite species diversity and population structure for setaria are factors that require further exploration in determining relationships to past and future outbreaks. the results obtained from model - development in the current study are congruent with the observations made during the origin of the recent disease outbreak (laaksonen. emergence of disease conditions is not immediate and is associated with considerable lag time between initial transmission, infection, and development of adult parasites in the mammalian host. summer temperatures greater than 14c increase infection rates, but the morbidity manifests the following summer only if the weather conditions are still favorable. according to meat inspection data, the prevalence of s. tundra infection had already increased in slaughter - reindeer in 2002, one year before the outbreak (laaksonen., 2007), and the degree of disease was correlated with the intensity of infection (laaksonen., 2007). it is therefore reasonable to assume that the parasite must reach prevalence high enough in the population before the other conditions enabling the outbreak surpass a threshold. such a relationship is clearly demonstrated empirically by the interaction between cumulative long - term trends in temperature, mean summer temperatures exceeding 14c, and by the fact that outbreak years with the subsequent emergence of diseases in cervids have been warm (mean 13.4c ; range 12.614.2 ; fig. 3). in this system, temperature increases greater than 14c may represent a tipping point for development and amplification of parasite populations (hoberg. these interacting cumulative factors provide an explanation for the temporal duration over 2 years (kummeneje, 1980 ; rehbinder., 1975 ; laaksonen., 2007) and geographic extent of emergent disease. in this regard, the outbreak reached upper lapland (kevo, the region of greatest reindeer density) in 1973 when temperatures were elevated in 1972, but not in 20032005 after the summer of 2002 when the summer temperature did not exceed 14c (laaksonen. as evidence of this cumulative interaction, the documented genesis of the epidemic in 2003 occurred in the area where the host density is lowest and subsequently spread into adjacent areas (sodankyl) in 2004 and 2005 (tt 12.9 and 14.3c, respectively (database of finnish meteorological institute) where reindeer were considerably more abundant (laaksonen., 2008b).figure 3variation in mean summer temperatures (lines) in finnish lapland with the known outbreaks of setaria tundra in reindeer (1973 and 2003) and moose (1989) indicated (bars). annual mean summer temperatures were recorded at three observation stations : kevo, kuusamo, and sodankyl (fig. 1). variation in mean summer temperatures (lines) in finnish lapland with the known outbreaks of setaria tundra in reindeer (1973 and 2003) and moose (1989) indicated (bars). annual mean summer temperatures were recorded at three observation stations : kevo, kuusamo, and sodankyl (fig. 1). the arctic climate is under accelerating change resulting in both incremental (cumulative) warming and extreme (episodic) weather events that influence temperature and hydrological processes (patz., 1996). such processes serve as the physical drivers for changing dynamics in patterns of distribution (host and geographic), development, survival, and transmission for an array of pathogens (kutz., 2004, 2005 ; thus, in the future in many areas, conditions for a diverse assemblage of disease vectors and intermediate hosts of parasites will likely improve leading to a modification in the intricate balance that determines the distribution for emergent disease (dobson and foufopoulus, 2001 ; hoberg. for example, in certain latitudinal zones, coincidental with melting permafrost and increasing rainfall, the area and number of suitable habitats for mosquitoes may expand. pathogen transmission and patterns of emerging disease may become further altered through spatial and temporal shifts in geographic range, patterns of reproduction, and longevity for vectors higher temperatures also may increase the biting rates for vectors and shorten the incubation period for pathogens (patz., 2000) and alter the behavior of hosts (laaksonen., 2009). factors associated with the life history of both arthropod intermediate and ungulate definitive hosts can be convergent in amplification of parasite populations. for example, in the study area during periods of high temperatures, dense herds of reindeer aggregated in the mosquito - rich wetlands in response to available water, abundant forage, and habitat - related thermoregulation (laaksonen., 2009). alternatively, accelerated climate change may have the potential for negative or neutral effects, and not all environmental perturbation will lead to emergence, particularly where tolerances and resilience of developmental stages for parasites and vectors are exceeded by ambient conditions (lafferty, 2009 ; gubler., climate and associated weather events are increasingly being recognized or predicted as factors linked to emerging diseases attributable to both helminth macroparasites and microparasites, including bacterial pathogens (handeland and slettbakk, 1994 ; patz., 1996 ; harvell., 2002 ;, 2006 ; hoberg., 2008a ; ytrehus., 2008 ; laaksonen., drivers for emergence are predicted to be complex, and for s. tundra represent interactions among mammals, arthropods, and parasites where both direct and indirect effects of temperature and humidity can influence the outcome. causes of the current and expanding declines in global populations of caribou and reindeer remain poorly understood, but parasites and pathogens have not been considered in synergy with a diverse array of abiotic and biotic determinants (vors and boyce, 2009 ; kutz., 2009a). conditions in the sub - arctic region of fennoscandia clearly indicate the potential impact of pathogens on the viability, persistence, and sustainability of populations of semi - domestic and free - ranging ungulates (laaksonen., 2007). environmental perturbation and emergent disease can threaten food security, socioeconomic and ecological stability across the north with pervasive cascading effects for northern cultures, and communities that remain dependant on wildlife resources (hoberg. 2008a, b). consequently, parasites, pathogens and disease must be factored into the equations for understanding current and future scenarios for high - latitude ecosystems under a regime of accelerating change (kutz., 2004, 2009b ; lemke., 2008a, b ; tryland., 2009). beyond the sub - arctic, a future of global climate change could facilitate translocation, geographic expansion, and dissemination of pathogenic tropical filarioids into the northern hemisphere, leading to detrimental effects on mammalian host populations and expansion of zoonotic infections in humans (taylor., 2001). understanding these processes depends on broadened investigations and surveillance exploring the emergence of vector - borne and other parasitic diseases in northern wildlife, with attention to the complex interactions among parasites, their invertebrate and mammalian hosts, and the environment (kuiken., 2005). ecosystem approaches that develop comprehensive baselines for biodiversity (linked to museum archives) against which to assess environmental change and an exploration of developmental thresholds, tolerance, and resilience for pathogens and hosts are requisite components of such programs (hoberg. | filarioid parasites represent major health hazards with important medical, veterinary, and economic implications, and considerable potential to affect the everyday lives of tens of millions of people globally (world health organization, 2007). scenarios for climate change vary latitudinally and regionally and involve direct and indirect linkages for increasing temperature and the dissemination, amplification, and invasiveness of vector - borne parasites. high latitude regions are especially influenced by global climate change and thus may be prone to altered associations and dynamics for complex host - pathogen assemblages and emergence of disease with cascading effects on ecosystem structure. although the potential for substantial ecological perturbation has been identified, few empirical observations have emanated from systems across the holarctic. coincidental with decades of warming, and anomalies of high temperature and humidity in the sub - arctic region of fennoscandia, the mosquito - borne filarioid nematode setaria tundra is now associated with emerging epidemic disease resulting in substantial morbidity and mortality for reindeer and moose. we describe a host - parasite system that involves reindeer, arthropods, and nematodes, which may contribute as a factor to ongoing declines documented for this ungulate species across northern ecosystems. we demonstrate that mean summer temperatures exceeding 14c drive the emergence of disease due to s. tundra. an association between climate and emergence of filarioid parasites is a challenge to ecosystem services with direct effects on public health, sustainability of free - ranging and domestic ungulates, and ultimately food security for subsistence cultures at high latitudes. |
application of chair - side core build - up materials can reduce working time, expenditures, and the tissues needed to be removed in the conventional approach in order to fit the cast post and core into the canal.1 being naturally weaker than amalgam,2 composite core build - up materials need to reach their optimum physicomechanical properties. these are highly attributed to degree of conversion (dc).3 the dc is the ratio of single carbon - carbon bonds in a polymer structure to double carbon - carbon bonds among monomers.4 it indicates the percentage of monomer - to - polymer conversion and is a qualitative and quantitative index for the extent of the polymerization.3,5 mechanical - physical characteristics and clinical performance of dental composites are compromised by a low dc;5 the residual monomers might act as plasticizers, reducing mechanical properties and increasing swelling.4,6 due to cross - linkage in the polymer structure, the dc is associated with surface hardness, flexural strength, fracture toughness, flexural modulus, tensile strength, and wear resistance.6,7 according to the manufacturers, the composites should be stored at room temperature, whereas many clinicians store them in refrigerator to prolong product shelf life or improve composite carvability.8,9 both room and refrigerator temperatures are not appropriate for complete poly - merization,4,6,8 and preheating the composite is advocated as a method to increase monomer conversion, improve marginal adaptation, reduce paste viscosity, and to shorten curing times.6,7,9 - 11 another critical factor for dental materials is temperature rise during the exothermic chemical reactions.12 due to being highly vascular, periodontal tissues can be severely affected by thermal injuries. only a temperature rise over 10 on the external surface of the root (= 47) is tolerable by the tissues.13,14 thus heated core composite materials can undermine the vitality of periodontal tissues during dental treatments. these indicate that considering heat produced during restorative procedures of different types and brands of chair - side post and core materials are of great importance.13 - 15 the heat of polymerization (hp) is proportional to the percentage of reacted monomers.3,5 if there is no other thermal sources in the reaction (such as light curing units), the energy released during composite polymerization is directly associated with both the dc and the increase in the temperature of adjacent tissues during chair - side operations. this energy may be measured by differential scanning calorimetry (dsc) which is a thermal analysis method and can provide the variation of enthalpy in the exothermic polymerization reaction, indicating thermal and physical characterizations.5,16 the dsc is known as a highly sensitive approach and as one of the most reliable direct methodologies for assessment of thermal and physical characterizations of the materials such as dc.5,16 - 19 it is of significance to evaluate thermal characteristics (such as the effect of preheating and refrigeration as well as the possibility of harmful temperature increases) and polymerization efficacy of newly marketed core build up materials. however, thermal characteristics of composites are largely unknown,9 and the literature lacks any studies on hp and thermal properties of core build up materials. the aim of this study was to assess the exothermal characteristics and relative dc of two commonly used self - cure composites, none of which had been assessed before, as well as the effect of 5 environmental temperatures on composite polymerization behaviors, using the dsc method. based on a pilot study, the sample size of this in vitro experimental study was predetermined as 50 specimens (divided into 10 groups [2 materials 5 temperatures ]) to obtain a test power > 90%. the experiments were performed at five temperatures : refrigerated : 0, room temperatures : 15 and 23, human body : 37, and a common preheating temperature : 60.6,9,10 the composites tested consisted of a conventional self - cure composite of bis - gma organic matrix filled with silica and opaque glass fillers 5 - 15 micron in diameter (king dental composite [kd ], batch number : mk08j kko3j, king dental corp., us) and a newly introduced, widely - marketed core build - up composite (core max ii [cm ], batch number : 432353, dentsply - sankin, tokyo, japan), which is a type of semi - hybrid composite resin with methacrylic acid, benzoic peroxide, and 78% filler composed of silicon dioxide 3.2 micron in diameter, lanthanum, barium, aluminium, and zirconium. a dsc thermal analyzer (dsc-60, shimadzu, kyoto, japan) was used to perform the isothermal temperature analysis. for each thermal group of each material, the dsc was adjusted to a definite temperature. according to the manufacturers ' instructions, uniform blends of materials were prepared and immediately placed in the dsc aluminium pan (24.5 mm) and transferred to the sample holder of the instrument. afterward, to start the measurement of the heat flow, the temperature was immediately altered to the programmed temperature in 20 s.5 in order to normalize the test conditions for all the material - temperature sets, the isothermal measurements began 2 min after the initial placement of each material on the aluminium pan.5 the heat generated during polymerization of each material and its peak were recorded and graphically illustrated at each temperature. for calibrating the thermal analyzer, an empty aluminium pan was used as a reference at each temperature. any difference between the temperature of the sample and the reference the empty pan was weighed (sartorius, gttingen, germany) for 3 times and the average was considered its weight. each specimen was as well weighed as described and its net weight was calculated by subtracting the weight of the pan. the normalized heat of exothermic reaction caused by the conversion of the monomers of each specimen at each temperature during 30 minutes was calculated by dividing the whole differential energy by the specimen weight. the data were analyzed using a two - way analysis of variance (anova), a tukey 's post hoc test, a linear regression analysis, and an independent samples t - test. none of these materials showed any polymerization reaction at 0. thus the 0 groups were excluded from the statistical analyses. the two - way anova revealed that there were significant differences between material groups (p=.0001) and between temperature groups (p=.0004, fig. 1, table 1). the interaction between the variables material and temperature on polymerization efficacy was as well significant (p=.0180), indicating that the effect of environment temperature differed significantly for the two materials. the hps produced by each material at all temperatures were compared using the tukey 's hsd. results for cm showed significant differences within most of the pairwise comparisons (table 2). however, most of the hps produced by kd were not significantly different from each other (table 2). the independent - samples t - test showed that there were significant differences between the heat flows from the two materials at 15 (p=.0001), 23 (p=.0163), 37 (p=.0039), and 60 (p=.0106). the linear regression analysis showed a significant linear correlation between heat of polymerization and temperature of surrounding environment for cm (r = 0.777), whereas heat of kd polymerization was weakly correlated to environment temperature (r = 0.351). in the present study, the dsc was programmed under isothermal conditions at 5 constant temperatures to evaluate the enthalpy of polymerization as well as the effect of surrounding environment temperatures on the polymerization behavior of the composites. the dsc is a convenient device for measuring the extent of heat produced and reaction kinetics.18 it is sensitive to small masses of materials and can provide data with sharp peaks, low drift from the baseline, and a linear association between the area under the peak and the mass of the specimen.3,5 it is also a convenient tool for analysis of polymerization of resin monomers, and can measure the extent and rate of polymerization of functional monomers by analyzing the amount of released energy.3,5,19 it has also been used successfully to predict the incomplete polymerization in commercial dental light cured composites.18,19 in the current study, the extent of heat produced during polymerization of core max ii was significantly more than king dental composite. in addition, heat of cm polymerization was considerably more affected by the environment temperature. the only significant increase in heat produced by king dental composite was at 60 (compared to the heat flow level at 15), where as core max ii showed a considerable increase in polymerization by increasing the environment temperature. the difference between the materials is attributed to their chemical compositions and viscosities which might affect the polymerization of self - cured composites.5,8,10,16,20,21 the higher variation observed among kd specimens may be relevant to preparation techniques of the materials (cm was available in the form of powder and liquid with superior homogeneity, kd had 2 pastes), and probably lower viscosity of cm components. hp indicates the rate of monomer - to - polymer conversion and polymerization efficacy.7,18,19 hence, higher energy released can be also considered an advantage for cm in case the temperature increase does not reach clinically harmful levels. it is shown that temperatures higher than 50 for one minute or over 47 for five minutes can result in bone resorption and fat replacement, and alkaline phosphatase can be inactivated at 56.15 it has been shown that the dc can be accelerated by dynamic heating of composite materials.4,5,7 - 10,22 this study, as well, showed that preheating the composites may increase the extent of polymerization for both of the composites examined. this may be attributable to reduced viscosity and thus the increased radical mobility, as well as increased collision frequency of unreacted active groups and radicals.4 - 6,8 in this study none of the materials showed any reaction at 0, which might be due to the absence of any initial activation energy necessary to forming the activated complex (the first 2 phases of composite polymerization [initiation and activation]).23 according to thermodynamics, the positive effect of pre - heating on the efficacy of activation and initiation of a reaction might be increased if the material is no more heated (or even be cooled) once the highly - exothermic phase of composite polymerization (propagation) is ongoing.24 the composite polymerization procedure is a self - limiting cascade constrained by the rapid formation of a highly cross - linked polymeric network which decreases the mobility of reactive monomers.6 according to the instructions of the manufactures, cm and kd should be stored at 25 and 22 respectively to prevent early evaporation of the solvent.8 however, they are usually refrigerated to extend their shelf life, and are used immediately after being removed from refrigerator.8,9 it leads to more reduction in the extent of composite polymerization and so proper quality may not be attained.4,6,8,9 some investigators have recommended preheating to increase monomer conversion and reduce the film thickness of the material and therefore to improve marginal adaptability;6,7,9,11 whereas according to some others, it might damage adjacent tissues and thus is not recommended.4 moreover, residual stress of polymerization shrinkage is also greatly increased with increase in temperature.6,8,10,20 as was confirmed in the present study, the type of composite has a significant influence on temperature rise during polymerization.20 the clinical importance of heat of polymerization depends on the health of the gingival tissues in direct contact with the exothermic release and their susceptibility to inflammation;12 traumatized and irradiated tissues as well as tissues in some medically compromised and elderly patients might be highly vulnerable to thermal irritations.12 nevertheless, in clinical conditions, the temperature increase caused by exothermic reaction of pre - heated self - cure composites is short in duration and is rapidly attenuated by the surrounding soft tissues to endurable levels;10,25 as only 0.8 and 1.8 temperature increases have been observed after placement of 60 and 68 heated composites, respectively, while light curing the same materials could increase the temperature up to 6, which was still tolerable by the tissues.10,25 as well, the thickness of composite and residual dentin may lower the temperature rise in adjacent tissues,10,22 so the absence of direct contact with adjacent soft tissue almost guarantees safe practice. also instead of preheating, the adhesive systems can be taken out of refrigerator and be exposed to room temperature for at least 20 min before they are used, to reach efficacious polymerization rates ; and this post - refrigeration period should be longer for materials containing fillers.8 in this study, cm released heat during its polymerization twice as much as did the conventional composite (kd). therefore, unless further clinical studies verify its safe temperature rise and so thermal biocompatibility to previously - irritated tissues, using it in direct contact with recently injured adjacent soft tissues should be approached with caution ; also preheating core max ii should be avoided in such conditions, especially considering the finding that there were no significant differences between its polymerization at 60 and 37, which could as well enhance the polymerization considerably. preheating kd, however, might be advantageous ; as 60 was the only temperature causing heat flows significantly higher than the baseline. optimum preheating times might vary based on material compositions (e.g., filler ratios) and heating units used.8,9 few available works in this regard have demonstrated that 11 minutes of preheating might suffice to elevate composite temperature from about 4 to 60.9 after removing from the device, the clinician has little time to apply the warmed composite since it rapidly loses temperature (50% within 2 minutes and 90% within 5 minutes).9 finally, it should be noted that while using light - cure composites, clinicians should rely on appropriate light - curing durations rather than depending on preheating.26 core max ii showed a much more efficient polymerization capacity ; therefore its usage seems to be advantageous over conventional composite. preheating to 60 should be cautioned when the soft tissue is irritated, because of lack of any considerable positive effect on polymerization compared to body temperature as well as odds of imposing harm to soft tissue. the king dental composite produced much less heat during polymerization, and showed less efficient polymerization. | purposeheat of composite polymerization (hp) indicates setting efficacy and temperature increase of composite in clinical procedures. the purpose of this in vitro experimental study was to evaluate the effects of 5 temperatures on hp of two new composites.materials and methodsfrom each material (core max ii [cm ] and king dental [kd ]), 5 groups of 5 specimens each were prepared and their total hps (j / gr) were measured and recorded, at one of the constant temperatures 0, 15, 23, 37 and 60 (2 5 5 specimens) using a differential scanning calorimetry (dsc) analyzer. the data were analyzed using a two - way anova, a tukey 's test, an independent - samples t - test, and a linear regression analysis (=0.05).resultsno polymerization reactions occurred at 0 ; then this temperature was excluded from statistical analyses. the mean hp of the remaining 20 kd specimens was 20.5 14.9 j / gr, while it was 40.7 12.9 j / gr for cm. the independent - samples t - test showed that there were significant differences between the hp of the two materials at the temperatures 15 (p=.0001), 23 (p=.0163), 37 (p=.0039), and 60 (p=.0106). linear regression analysis showed statistically significant correlations between environment temperatures and hp of cm (r2=0.777).conclusionusing cm is advantageous over conventional composite because of its better polymerization capacity. however due to its high hp, further studies should assess its temperature increase in vivo. preheating kd is recommended. refrigerating composites can negatively affect their polymerization potential. |
human saliva contains a large number of proteins and peptides that are easily accessible and may serve as a potential source of biomarkers to monitor changes that occur under pathological conditions. the value of saliva as a biological fluid for the detection of diagnostic and prognostic biomarkers has become increasingly well established. collection of human saliva is a simple, noninvasive, and cost - effective approach for screening large populations. it is easy to handle and may be repeated without inflicting much discomfort to the subjects. diabetes mellitus is a major global health problem and it has an increasing prevalence due to several factors, such as the population growth, aging, urbanization, and increasing prevalence of obesity or lack of physical exercise. the number of people diagnosed with diabetes is increasing at an alarming rate. it is estimated that by the year 2030, 366 million people worldwide will have the disease. most of these deaths occur in smokers. a widely used approach for measuring exposure is determination of tobacco - derived biomarkers in biologic fluids. the oral cavity is the first organ in the human body to be exposed to the cigarette smoke. the tobacco smoke alters normal homeostasis of the oral cavity, including the saliva 's antioxidant and other protective systems. the mucosal changes in smokers may also arise from the drying effects of the mucosa, high intraoral temperatures, intraoral ph changes, local alteration of membrane barriers and immune responses, or altered resistance to bacteria, fungal, and viral infections. smoking - related cell damage may leave molecular footprints in the saliva, offering the potential for noninvasive early diagnosis of tobacco - related oral diseases. saliva, and not blood, was chosen as the sample used in the study, as many reports have suggested that saliva can be an alternative to blood. saliva contains a large number of proteins that have metabolic, immune response, transporting, and several other cellular functions. its collection is noninvasive compared to the collection of other body fluids, and hence has a great potential for use in the diagnosis of systemic and localized diseases. hence, we have made an attempt to analyze the levels of sodium, potassium, and total protein in diabetic smokers and nonsmokers in comparison with healthy controls. subjects of either sex aged 30 years and above attending the department of oral pathology and microbiology, bapuji dental college and hospital, davangere was considered for inclusion in the study. group i comprised of 25 known diabetic, nonsmoking patients, group ii comprised of 25 known diabetic smoking patients, and group iii comprised of 25 nondiabetic and nonsmoking controls. a thorough general and oral examination was carried out and blood samples were collected for random blood sugar. nonstimulated saliva samples were collected and centrifuged for 30 min at 3000 rpm to obtain a clear supernatant fluid. the clear supernatant saliva was analyzed for sodium, potassium, and total protein using a semiautoanalyzer. correlation between sialochemistry of na+, k+, and the total protein levels and glycemic status in diabetics was determined. salivary na+, k+, and total protein levels between the groups were compared for statistical significance. descriptive data that included mean, standard deviation, and percentages was calculated for each group. multiple group comparisons were made by one - way anova followed by unpaired t - test for pairwise comparisons. for all the tests, a p value of 0.05 or less was considered for statistical significance. total of 75 subjects were analyzed, out of which 25 were diabetic without smokers, 25 were diabetic smokers and 25 were healthy controls. group i comprised of 25 cases out of which 14 were males and 11 were females, age range varied from 32 - 86 years, mean and standard deviation of 51.3 12.2. group ii comprised of 25 subjects were only males, age range varied from 30 - 76 years, mean and standard deviation of 50.2 11.4. the age range varied from 33 - 86 years, mean and standard deviation of 50.0 13.1. the mean age in all groups was found to be statistically nonsignificant [table 1 ]. age and sex distribution between control and diabetics. in group i diabetic nonsmokers, the random blood sugar levels ranged from 143 - 428 mg% with mean and standard deviation of 278.9 91.6 mg%. salivary sodium levels ranged from 23.9 - 271.9 mmol / l with mean and standard deviation of 118.7 80.8 mmol / l. salivary potassium ranged from 7.2 - 24.5 mmol / l, mean and standard deviation of 13.6 4.8 mmol / l. similarly, salivary total protein ranged from 0.74 - 1.39 with mean and standard deviation of 1.00 0.19 mmol / l. in group ii diabetic smokers, the random blood sugar levels ranged from 149 - 522 mg% with mean and standard deviation of 296.7 91.1mg%. mmol / l with mean and standard deviation of 92.1 47.8 mmol / l. salivary potassium levels ranged from 11.4 - 27.4 mmol / l with mean and standard deviation of 20.5 5.7 mmol / l. similarly, salivary total protein ranged from 0.91 - 1.92 mmol / l with the mean and standard deviation of 1.37 0.35 mmol / l. in controls, the random blood sugar levels ranged from 65 - 116 mg% with the mean and standard deviation of 94.4 13.3 mg%. salivary sodium ranged from 11.5 - 217.3 mmol / l with mean and standard deviation of 80.0 51.1 mmol / l with mean and standard deviation of 8.9 4.2 mmol / l and salivary total protein ranged from 0.01 - 0.94 mmol / l with mean and standard deviation of 0.47 0.28 test, on comparison of salivary sodium [graph 1 ] between groups i and iii, [p but there was no significance between groups ii and iii, as well as groups i and ii. the value for the salivary potassium [graph 2 ] showed high significance on comparison of group i and group iii, group ii and group iii, and group i and ii. total protein [graph 3 ] also showed high significance between the groups, that is, on comparison of group i and iii, group groupwise comparison of salivary sodium groupwise comparison of salivary potassium groupwise comparison of salivary total protein the statistical analysis by anova factor showed a f value of 55.8 for random blood sugar levels. for salivary sodium, no significant difference of p = 0.08 with f = 2.57 was noted, but salivary potassium showed high significance p 0001 with f = 35.0. obtaining saliva is advantageous for patients, especially children and diabetic subjects, since the procedure is noninvasive, stress - free, and allows multiple samplings. diabetes mellitus is one such disease affecting the salivary gland functioning and thus altering the salivary constituents. sharon., ben - aryeh., and yavuzyilmaz. analyzed whole saliva, and found significantly higher potassium levels in diabetic groups compared to the nondiabetic group. sharon. citing studies in animals have hypothesized that in diabetes mellitus an autonomic neuropathy exists that causes sympathetic this imbalance may perhaps exert a continuous stimulation on the salivary glands, bringing about increased potassium secretion into the saliva. marder. attempted to explain the higher concentration of potassium in whole saliva of diabetics by different factors such as peripheral vascular damage that had much higher potassium levels in diabetics than controls and elevated conductibility of the acinic cell membrane to potassium. the findings of this study that whole saliva potassium levels are significantly higher in diabetic patients when compared to the control group. laine. reported that smoking was associated with higher concentration of salivary potassium, sodium, and total protein. reported that potassium decreases with increase in the salivary flow rate of chronic tobacco users. our study showed significant increase in salivary potassium among diabetic smokers but the salivary sodium levels was not significant. total salivary protein levels in diabetic nonsmokers and diabetic smokers are increased on comparison with controls and our study is in general agreement with the findings of yavuzyilmaz., tenovero., harrison., pal., and lpez. the increased salivary total protein in diabetics could be attributed to the increase in basement membrane permeability, allowing easy and increased passage of serum proteins into the whole saliva via salivary gland and gingival crevices. streckfus. have demonstrated highly significant positive correlations in salivary total protein levels among uncontrolled and controlled diabetic groups. hence, the purpose of this study was to estimate and compare the levels of salivary potassium, sodium, and total protein in smoker diabetic patients and nondiabetic smokers and controls, and to explore potential of salivary electrolytes [na, k ] and total proteins as markers. the estimated values of salivary constituents add to the data already recorded in indian population. however, further studies using large samples are required to evaluate the findings in our study. | aims : the aim of the study was to evaluate the difference in sodium, potassium, total protein in whole saliva in diabetic smokers, diabetic nonsmokers and healthy controls.materials and methods : nonstimulated saliva samples were collected from a group of diabetic smokers, diabetic nonsmokers, and controls. supernatant after centrifugation was used to determine the levels of sodium, potassium, and total protein by using semiautomatic analyzer.results:there exists a statistical difference in the levels of potassium and total protein between diabetic smokers, nondiabetic smokers, and controls. difference in the levels of sodium is only significant with nondiabetic smokers and controls.conclusion:diabetes mellitus is known to alter the composition of saliva. the purpose of this study was to estimate and compare the levels of salivary potassium, sodium, and total protein in smoker diabetic patients and nondiabetic smokers and controls, and to explore potential of salivary electrolytes [na+, k+ ] and total proteins as markers. the estimated values of salivary constituents add to the data already recorded in indian population. however, further studies using large samples are required to evaluate the findings in our study. |
sickle cell disease (scd) is a major public health problem in french guiana [1, 2 ]. in this french region located in south america, with 230,000 inhabitants, the standards of health are close to those of mainland france. french guiana is also a crossroad for poor caribbean and south american populations that emigrate there in search of better conditions of life. infectious diseases and chronic diseases are both public health problems. transfusion remains a major treatment in scd management. the purpose of red blood cell transfusion (rbc) is to increase oxygen distribution in the tissues and to replace the rigid sickle cell shaped rbcs with healthy deformable rbcs. yet, in french guiana, since 2006, donation of blood products has stopped because of chagas disease. chagas disease (american trypanosomiasis) is caused by the protozoan trypanosoma cruzi, mainly transmitted to humans by blood - sucking triatomine bugs (hemiptera, triatominae) but also transmitted by blood transfusion from infected donors and occasionally by transplacental mother - to - child transmission. it is an endemic disease in the large part of latin america extending from mexico to argentina. in the majority of the cases, after an acute infection sometimes unapparent, the disease becomes chronic, which can be problematic, in case of blood donation. in french guiana, all blood products used for transfusion in scd patients come from lille, in the north of france or guadeloupe. because they will frequently receive transfusions in their life, patients with scd become exposed to rbcs alloantigens of donor units and alloimmunization. alloimmunization in scd has a reported incidence of 20% to 50% [6, 7 ]. red cell alloimmunization is frequent because of the antigen disparities between patients of african descent and donors of european ancestry [811 ]. this study, therefore, aimed to estimate the frequency of alloimmunization in a cohort of scd patients followed in the french blood agency of french guiana from 1995 to 2011, in the particular context of french guiana, where the blood units come mostly from caucasian donors, and to describe the measures organized to decrease alloimmunization. 302 scd patients (151 males and 151 females) followed in the french blood agency of french guiana from 1995 to 2011 were included. all transfused patients (n = 178) had received cross - matched red cell units at least compatible in the abo, rh, and kell systems. patients included in the database of the french blood agency gave informed consent for the use of their data. this data collection was approved by the commission nationale informatique et liberts (cnil), a national committee that oversees research data. data were analysed with stata 10.0 (stata corp lp, college station, tx, usa). among these patients, 68% were homozygous for hbs, 24% had sickle - hemoglobin c, and 8% had hbs/-thalassemia. the major ethnic origins were creole (46%) followed by haitian (27%) and bushinenge (22%). the proportions of blood groups were group a : 21.80%, group b : 21.80%, group o : 51.50%, and group ab : 4.90%. the red cell blood transfusion was available for 178 patients (hb ss), for 2494 red blood cell units. among the sickle cell anemia patients who had received at least 1 transfusion, the most frequent alloantibodies were anti - le1, anti - mns1, anti - le2, and anti - fy1 and were developed after transfusion of standard red cell units (table 1). transfusion was performed for acute chest syndrome (acs) in 26 cases, cholecystectomy in 15 cases, splenectomy in 12 cases, severe infections in 12 cases, and stroke in 10 cases. the frequency of the clinically significant antibodies in this population of scd patients was 11% (19/178). there were six cases of delayed hemolytic transfusion reaction (dhtr), in two children, two pregnant women, and two other adult scd patients. the antibodies found on those patients who had dhtr were anti - k1, anti - fy1, and anti - mns3. the prevalence of alloimmunization is high in french guiana. nevertheless in martinique and in guadeloupe, it is necessary to note that even if in these two territories the blood collection and distribution are realized on the spot, part of the blood units still come from metropolitan france, because the local production does not allow completely covering needs. closer to french guiana, in brazil, where the prevalence of the chagas disease in the general population is raised, the alloimmunization rate is 12.9%. there is a basic assumption that since blood can not be collected locally, use of blood mostly from french caucasian blood donors is causing alloimmunization in the guianese population due to ethnic / genetic differences. this assumption, although intuitive, has recently been scientifically refuted by an article on the scd transfusion policy in a usa scd center where it was shown that ethnically the major consequence of alloimmunization is the delayed hemolytic transfusion reaction (dhtr), a severe and potentially life - threatening complication that is characterized by a hemolytic anemia of transfused as well as patients ' own red blood cells. the diagnosis of dhtr can be difficult because the clinical features could be easily misinterpreted as a severe vasoocclusive crisis. in french guiana, we noted 6 cases of dhtr that represent a rate of 3.4% (6/178). this frequency seems very high when compared with brazil. in brazil, in spite of high prevalence of chagas disease, blood collection in the general population has not been interrupted. so, blood units come from donors whose origin is close to those of patients. however, the prevalence of antibodies to t. cruzi among blood donors has decreased to 0.2% (2012) and in a serosurvey done in 2007 with children of 05 years old no single seropositive subject was detected showing that chagas is a vanishing disease and a minor problem concerning blood transfusion. no case of transmission of chagas by blood transfusion was reported since the introduction of mandatory testing in the nineties. so, prevention of transfusion - transmitted (tt) chagas in brazil is based on serological testing and specific questions included in the predonation interview like the following : have you ever seen a reduviid bug ? french guiana could follow the brazilian model, which has proven itself. while waiting for the implementation of the blood donation in french guiana, we recommend for scd patients who require repeated transfusions extended antigen - matched rbc from afro - caribbean donors living in guadeloupe and taking into account the patient 's immunohematologic characteristics. in french guiana, the alloimmunization for the clinically significant antibodies in the scd patients had a frequency of 11%. the prevention of tt chagas based on serological testing and specific questions included in the predonation interview like have you ever seen a reduviid bug ? as done in brazil could be followed. this strategy for prevention of tt chagas disease needs a strong political engagement of the sanitary authorities. this study also underlines the interest of selecting blood from caribbean donors for all programmed transfusion or exchange transfusion. | this study in french guiana assessed the frequency of alloimmunization to red cell antigens in sickle cell disease patients over 19952011 and identified the most common antibodies. a retrospective analysis of the transfusion history and medical records of 302 patients showed that 29/178 transfused patients had developed alloantibodies (16%). the most frequent alloantibodies were anti - le1, anti - mns1, anti - le2, and anti - fy1 and were developed after transfusion of standard red cell units. the frequency of the clinically significant antibodies in this population of scd patients was 11% (19/178). the antibodies found on those patients who had delayed hemolytic transfusion reaction were anti - k1, anti - fy1, and anti - mns3. the strategies used to decrease alloimmunization in french guiana are discussed. |
its primary function is to attach centromeric chromatin with the plus ends of one or more spindle microtubules in an end - on manner. structure of the kinetochore is built from > 40 different proteins, many of which are assembled into protein subcomplexes. most of the kinetochore proteins are conserved in all eukaryotes (meraldi., 2006). biochemical and structural studies, as well as epistasis analyses, have produced much information about the structural and functional hierarchy among various protein complexes within the kinetochore (westermann. an important question regarding the architecture of a kinetochore with many microtubule attachments is whether it is built by repeating a structural subunit (the repeat subunit 1991) or if it lacks an ordered structure (dong., 2007). accurate counts of the number of copies of structural kinetochore proteins for such a kinetochore can provide key information for understanding the overall organization of the kinetochore and the architecture of microtubule attachment sites. the copy number for each of the eight structural proteins and protein complexes per kinetochore in budding yeast has been accurately determined using quantitative fluorescence microscopy (joglekar., this study found that the centromeric nucleosome containing two molecules of sccse4p (hscenp - a) is linked to the microtubule plus end by a protein linkage that consists of 12 copies of mif2p (hscenp - c), 23 copies of the coma complex (cenp - a / cenp - a cenp - a nucleosome - associated complex and nucleosome - associated distal complex), 5 copies of spc105p (hsknl-1/blinkin), 67 copies of the mind complex (hsmis12 complex), 8 copies of the ndc80 complex (hsndc80/hec1), and 1620 copies of the dam1dash complex. in budding yeast, the centromeric dna is wrapped around one cenp - a nucleosome, which in turn supports one microtubule attachment (furuyama and biggins, 2007). in contrast, regional centromeres in higher eukaryotes span over large stretches of dna and typically support multiple microtubule attachments. these characteristics of regional centromeres raise the possibility that the protein architecture of the associated kinetochore may also be distinctly different from the protein architecture of the budding yeast kinetochore that is built on a point centromere. there are two critical aspects regarding the protein architecture of kinetochores and the chromatin architecture of regional centromeres that must be characterized to understand their overall organization. the first key question is the number of cenp - a nucleosomes in a regional centromere and its relationship with centromere length and the number of microtubule attachments. chromatin immunoprecipitation assays on the regional centromeres in fission yeast and in candida albicans (a multimorphic yeast) show that cenp - a is distributed over a 1012-kb region of the fission yeast centromere (partridge., 2000) and a 34-kb region of the c. albicans centromere (sanyal and carbon, 2002 ; mishra., 2007). biochemical assays in hela cells also estimate a full occupancy of the centromeric dna with 15,000 cenp - a nucleosomes in 2.5 megabases of dna (black., 2007), although this number is likely lower, given that cenp - a nucleosomes are interspersed with canonical nucleosomes containing the conventional histone h3 (blower., 2002 ; sullivan and karpen, 2004). the relationship of the number of cenp - a nucleosomes with the number of microtubule attachments is especially important for understanding the architecture of the centromeric chromatin that immediately surrounds a microtubule attachment at the regional centromere (yeh., 2008). the second key question is how the numbers of structural kinetochore proteins at a regional centromere relate to the number of microtubule attachments. in this study, we address both these issues for regional centromeres in fission yeast (schizosaccharomyces pombe) and in the multimorphic yeast c. albicans. fission yeast and c. albicans both offer important advantages for counting the number of kinetochore proteins using the fluorescence ratio method that we developed for studying the budding yeast kinetochore. the most critical advantage is the ability to replace the endogenous copy of a gene with a gfp - tagged version through homologous recombination. this technique ensures that the gfp - tagged protein is expressed under the control of the endogenous promoter. because of the use of the same gfp allele (egfp) and similar growing conditions, gfp fluorescence can be expected to be equivalent in all three fungi. geometry of the mitotic spindle in these two fungi is also well suited for accurate quantification of the fluorescence signal from gfp - tagged kinetochore proteins. the three pairs of sister kinetochores on the replicated chromosomes remain bound to the spindle pole body, forming a tight cluster (fig. microtubules are nucleated from the nuclear side of the spindle pole body after the onset of mitosis, and each kinetochore establishes two to four microtubule attachments (ding., 1993). each centromere consists of a central core element that is flanked by two sets of inverted repeats known as inner and outer repeats. c. albicans is diploid, with eight chromosomes. spindle morphology in cells expressing tub1p - gfp appears similar to the budding yeast spindle visualized by labeling tub1p - gfp (maddox., 2000 ; finley and berman, 2005). c. albicans centromeres span over a 418-kb - long dna sequence (sanyal., we characterize the protein architecture of the kinetochores built on regional centromeres in fission yeast and c. albicans by determining the numbers of structural kinetochore protein complexes per centromere using quantitative in vivo fluorescence microscopy. pseudo - colored images for a comparison of kinetochore protein fluorescence in metaphase budding yeast and g2/m fission yeast cells. each of the two spots in a metaphase budding yeast cell contains 16 kinetochores and 16 microtubule attachment sites. in g2/m fission yeast, there are six kinetochores in the single spot with a mean of 3 microtubule attachment sites per kinetochore and, therefore, 18 attachment sites in total. the intensity bar is color coded to represent the ratio (indicated by the numbers on the right) with the sccse4p - gfp intensity in the top panel. fission yeast and c. albicans strains were constructed by tagging the c terminus of the genomic copy of kinetochore proteins of interest with gfp. the fluorescence standard for our ratio method of fluorescence signal measurement is the mean signal from separated anaphase kinetochore clusters in budding yeast cells expressing sccse4p - gfp. there are two molecules of sccse4p per kinetochore and, thus, a total of 32 gfp molecules within each. the mean fluorescence signal from other gfp - tagged kinetochore proteins in fission yeast or c. albicans can be converted into the corresponding number of molecules from the ratio of its mean fluorescence signal to that of sccse4p - gfp. in each experiment, fission yeast or c. albicans cells were mixed with budding yeast cells expressing sccse4p - gfp, and the mean fluorescence signal for a kinetochore cluster was obtained for both strains (see materials and methods). for fission yeast, fluorescence signal measurements were obtained for cells in g2/m and anaphase, whereas fluorescence signal was determined only for anaphase c. albicans cells. in fission yeast, we measured 5 1 spcnp1p (cenp - a) molecules per centromere on average (fig. this number translates into two to three cenp - a containing nucleosomes per centromere, and it is similar to the number of microtubule attachments per centromere (two to four) in fission yeast (ding., 1993). because c. albicans is diploid, we constructed four different strains that are homozygous, heterozygous, and hemizygous for cacse4p - gfp. by quantifying the fluorescence signal from c. albicans cells homozygous for cacse4p - gfp, we found that the c. albicans centromere contains 8 1 molecules of cacse4p (fig. this number translates into four cacse4p - containing nucleosomes per centromere (bloom., 1984 ; saunders., 1990 ; blower., 2002 ; the number of cenp - a molecules does not scale with the centromere dna length. (a) the number of cenp - a molecules in the three fungi plotted as a function of centromere length. the number of cenp - a nucleosomes per centromere reflects the number of microtubule attachments per centromere. (b) signal measurement from clusters of one or more sister kinetochores in metaphase - arrested cells expressing spndc80p - gfp cells and a cold - sensitive nda3 (-tubulin) allele (green bars). a multipeak normal curve fit to the histogram (solid line) predicts peaks at 2,000, 3,800, and 5,600 intensity counts. measurement of fluorescence signal from single lagging kinetochores in anaphase wild - type fission yeast expressing spnuf2p - gfp yields a mean signal value of 1,000 counts (red bars). this confirms that the unit of minimum fluorescence signal in the nda3 experiment corresponds to on pair of sister kinetochores we verified that the fluorescence signal measured from the single spot seen in fission yeast cells in g2/m corresponds to the cumulative signal from three pairs of sister kinetochores. a fission yeast strain expressing ndc80-gfp and containing a cold - sensitive allele of -tubulin (nda3) was used for this purpose. cells arrest in mitosis with replicated chromosomes scattered in the nucleus (grishchuk and mcintosh, 2006), which makes it possible to image centromeres of individual chromosomes. by measuring the fluorescence signal from all the fluorescent spots imaged in such cells, we found that the minimum unit of fluorescence corresponds to one pair of sister kinetochores (fig. measurement of fluorescence signal from lagging kinetochores in early anaphase cells expressing spnuf2p - gfp showed that this signal was equivalent to the fluorescence signal for a single kinetochore (fig. we selected a representative kinetochore protein from each of the core structural protein complexes for quantification of their number at the fission yeast centromere (fig. 3 and table s1). we measured three to four molecules of spmif2p (cenp - c) per kinetochore. we found 12 copies of the proteins spfta3p and spsim4p from the fission yeast sim4 complex (liu., 2005). these proteins represent members of the cenp - a (cenp - h and cenp - k, respectively ; foltz., 2006 ; okada., 2006). other members from this complex, spmal2p and spfta2p, representing cenp - a proteins (foltz., 2006 ; okada., 2006), were found to be present in a slightly lower number (nine per kinetochore). spfta1p was present in a much smaller number, which is consistent with biochemical evidence (liu., 2005). members of the kmn complex were present in higher numbers (16 copies of spmis12p, 12 copies of spspc7p, and 21 copies of spndc80p per kinetochore ; liu., 2005). we quantified the copy number for three different members of the dam1dash complex, namely dam1p, dad1p, and ask1p. previous studies have shown that only spdad1p is a constitutive kinetochore protein present at the centromeres before entry into mitosis. other components of the dam1dash complex are recruited at the kinetochore only after the nucleation of intranuclear microtubules at the onset of mitosis (liu., 2005 surprisingly, we found that there are only six or seven copies of the dam1dash complex per kinetochore in anaphase. measurements of spdad1p indicate that the number of copies of spdad1p in g2 was lower than the number of copies of the dam1dash complex measured in anaphase / telophase cells (table s1, available at http://www.jcb.org/cgi/content/full/jcb.200803027/dc1). (a) the number of core structural kinetochore proteins per microtubule attachment in fission yeast is very similar to the number of corresponding proteins at a budding yeast kinetochore. the dam1dash complex, which is nonessential in fission yeast, is the sole exception (black bars, mean protein numbers in fission yeast ; gray bars, mean numbers in budding yeast). (b) although each c. albicans centromere contains approximately four cenp - a nucleosomes on average, the mean number of outer kinetochore proteins, such as mtw1 and nuf2, is sufficient to build only one microtubule attachment site (black bars, mean protein numbers in c. albicans ; gray bars, mean numbers in budding yeast). error bars represent sd from a minimum of two experiments. because there are three microtubule attachments per fission yeast centromere on average, we converted the copy number of kinetochore proteins per centromere into the mean number of molecules per microtubule attachment by distributing the total kinetochore protein count per centromere equally among the three microtubule attachments. we found that, with one exception, the copy numbers of structural kinetochore proteins per microtubule attachment are very similar to the protein numbers measured at the budding yeast kinetochore, which has only one microtubule attachment (fig. this number is much smaller than the 1623 copies necessary to form rings around the attached microtubules (miranda. the dam1dash complex is not essential in fission yeast (sanchez - perez., 2005). it is, however, synthetically lethal with the plus - end microtubule depolymerases klp5 and 6 and the microtubule - associated protein dis1p. we verified that the number of dam1dash subunits per centromere does not show a significant change in strains that have either klp5 or 6 knocked out (unpublished data). thus, the concentration of the dam1dash complex at the kinetochores is not suppressed by these proteins in wild - type cells. the low number of dam1dash complex per centromere could be indicative of altered protein architecture of the microtubule attachment site at the fission yeast kinetochore. this is unlikely, however, because the numbers for the rest of the structural kinetochore proteins per microtubule attachment are nearly identical in both budding yeast and fission yeast. the ndc80 complex is most proximal to the microtubule plus end within the kinetochore because members of this protein complex, nuf2p and ndc80p, can directly bind microtubules (cheeseman., 2006). therefore, we decided to count the number of copies of the ndc80 complex at the centromere in c. albicans to understand the protein architecture of the kinetochore. the number of ndc80 complex molecules was 78 times the number of cenp - a nucleosomes in budding as well as in fission yeast. because we measured four cenp - a nucleosomes per centromere in c. albicans, the expected number of ndc80 molecules would be 32 if all four cenp - a nucleosomes support a microtubule attachment site and if each microtubule attachment site in c. albicans recruits seven to eight copies of the ndc80 complex. similarly, we measured only four molecules of camtw1p (mis12 complex) per centromere (fig. these numbers suggest that the c. albicans centromere likely supports only one kinetochore microtubule attachment site, although it recruits a mean of four cenp - a. interestingly, the number of cenp - a molecules per centromere reduces to five in hemizygotic c. albicans strains (cse4:gfp / cse4), which is sufficient to form only two cenp - a nucleosomes (fig. the copy number for the ndc80 complex in this hemizygotic strain did not change (unpublished data). together with the number of ndc80 complex copies per centromere, these data indicate that the c. albicans centromere likely bears only one microtubule attachment site, although it normally contains four cenp - a nucleosomes. the number of microtubule attachments per c. albicans centromere has not been determined. to experimentally verify that there is only one microtubule attachment site per c. albicans centromere, we devised a strategy for estimating the number of microtubules in the c. albicans spindle by quantifying the fluorescence signal from individual cytoplasmic microtubules and the cumulative signal from all the microtubules in a metaphase half - spindle in cells expressing tub1p - gfp (fig. this method takes the ratio of the mean fluorescence signal from single cytoplasmic microtubules to the maximum fluorescence signal from a spindle half as an estimate of the maximum number of microtubules in a half - spindle. for budding yeast, this method estimates 24 5 microtubules per half - spindle. this measurement confirms the known number of microtubules in each budding yeast half - spindle (16 kinetochore microtubule and 4 microtubules from each spindle pole to construct a central spindle with 8 interpolar microtubules ; winey., 1995). similar measurements on the c. albicans spindle showed that there are 18 3 microtubules in each half - spindle. this number is sufficient to form a mean of only one microtubule attachment per kinetochore on each of the sixteen chromosomes, with two additional interpolar microtubules. this data further supports the prediction that the regional centromere in c. albicans has only one microtubule attachment. the excess of three cenp - a nucleosomes over the one needed for a single microtubule attachment at the c. albicans centromere prompted us to test the role of cenp - a in controlling the number of microtubule attachment sites at the kinetochore. we examined a fission yeast strain with a four- to fivefold constitutive overexpression of cenp - a (takahashi., 2000), which leads to a similar increase in the number of cenp - a molecules at the centromere (fig. overexpression of mutant alleles of cenp - a does not mislocalize other kinetochore proteins in budding yeast (collins., 2004), although it has been shown to mislocalize cenp - c in vertebrate cells (van hooser., 2001). a 30-fold overexpression of drosophila melanogaster cenp - a homologue leads to the recruitment of kinetochore proteins at ectopic sites and massive chromosome missegregation (heun., we counted the copy numbers of kinetochore proteins in the fission yeast strain with constitutive cenp - a overexpression and compared them with the wild - type copy numbers. we found that the copy numbers of structural kinetochore proteins remained comparable to wild - type protein numbers (fig. these results show that although cenp - a is a necessary factor for recruiting kinetochore components at the centromere, its fivefold overexpression does not affect the numbers of kinetochore proteins recruited to the centromere. we verified that the structural kinetochore protein complexes are stably associated with the kinetochore by measuring the fluorescence recovery after photobleaching of gfp - tagged kinetochore proteins. none of the gfp - tagged kinetochore proteins tested (spcnp1p, spmis12p, spspc7p, and spndc80p) showed significant recovery in g2, when there are no microtubule attachments. interestingly, we found the highest recovery percentage for the outermost kinetochore protein complex ndc80, which exhibited only 10% recovery over 5 min (10.8 5.5% ; mean sd ; n = 5). spcnp1p showed no detectable recovery (1.6 1.7% ; n = 5 ; measured in the strain with fivefold overexpression). microtubule attachment is likely to suppress this turnover further to undetectable levels, as found previously for kinetochores in metaphase budding yeast cells (joglekar., 2006). these results show that the core protein architecture of the kinetochore - microtubule attachment site in fission yeast is stable in g2/m. accurate quantification of the number of copies of structural kinetochore protein complexes at regional centromeres elucidates two key aspects of the molecular architecture of the kinetochore. first, the number of cenp - a molecules at the regional centromeres in fungi does not scale with the length of the centromeric dna. based on the exact correspondence between the number of cenp - a nucleosomes and the number of microtubule attachment sites in budding yeast and fission yeast, we hypothesize that each microtubule attachment site is normally built around one cenp - a nucleosome. in budding yeast, the pericentric chromatin region 25 kb long was recently shown to form a loop with the cenp - a nucleosome and the microtubule attachment site residing at the apex of the loop (yeh., 2008). the existence of one cenp - a nucleosome per microtubule attachment raises the possibility that similar chromatin architecture may also be present within regional centromeres. the number of cenp - a nucleosomes alone is not sufficient to decide the number of microtubule attachments. this conclusion is based on the observation that the number of cenp - a nucleosomes can be larger than the number of microtubule attachment sites in these fungi. wild - type c. albicans centromeres have cenp - a nucleosomes in excess of the number of microtubule attachments. similarly, a fission yeast strain that has a four- to fivefold overexpression of cenp - a does not recruit any more kinetochore proteins than wild - type centromeres. experiments in vertebrate cells similarly show that the cenp - a levels must be depleted by > 90% before a noticeable decrease was observed in the levels of outer kinetochore proteins (liu., 2006). thus, although a cenp - a nucleosome is necessary for building a microtubule attachment site, it is not sufficient. factors other than cenp - a, and possibly the architecture of centromeric chromatin, play a role in regulating the recruitment of kinetochore proteins and the assembly of microtubule attachment sites (camahort., 2007 ; mizuguchi., 2007 ; stoler., 2007) the second key finding of this study is that the molecular architecture of the kinetochore - microtubule attachment site is conserved between point and regional centromere. the number of copies of kinetochore proteins and protein complexes per microtubule attachment at the fission yeast kinetochore is nearly identical to corresponding numbers at the budding yeast kinetochore that has only one microtubule attachment. although high resolution electron tomography has failed to find any visual evidence of structural subunits within the vertebrate kinetochore (dong., 2007), our data demonstrate that each microtubule attachment site at a kinetochore with many microtubule attachments is built from a specific number of copies of each of the structural protein complexes. the results presented in this study provide compelling evidence that the complex kinetochores at the regional centromeres in fission yeast and c. albicans are built by repeating a structural subunit, which corresponds to a single microtubule attachment site. furthermore, the protein architecture of this microtubule attachment site is conserved between point and regional centromeres. despite more complex centromere and kinetochore architectures in metazoa, most of the structural kinetochore proteins are conserved in all eukaryotes, from yeast to humans. the remarkable conservation of kinetochore protein architecture, despite highly divergent centromeric architecture in the three fungal systems investigated in this study, leads us to believe that the subunit structure of individual microtubule attachment sites is likely conserved in higher eukaryotes. all the strains (listed in table i) were grown in ypd at 32c (with the exception of the budding yeast strain expressing sccse4p - gfp, which was grown at 25c). ye5s, ypd, and ypd supplemented with 50 g / ml of uridine (sigma - aldrich) were used to grow fission yeast, budding yeast, and c. albicans, respectively. gfp fusions were made by pcr amplification of a gfp kan cassette (from pfa6a gfp(s65 t) kan mx6) flanked with 60 bp of homology to the site of integration at the 3 end of the gene. the fission yeast strains with constitutive cnp1p and cnp1p - gfp overexpression were supplied by k. takahashi and m. yanagida (national bioresource project, okinawa institute of science and technology, okinawa, japan). kb, k. bloom laboratory ; xh, x. he laboratory ; jb, j. berman laboratory. an inverted microscope (te-2000u ; nikon) with a 100 1.4 na differential interference contrast objective (nikon) cells suspended in filter sterile sd complete media were immobilized on coverslips coated with concanavaline a (sigma - aldrich) for imaging. images were acquired with a cooled charge - coupled device camera (orca ii er ; hamamatsu photonics) with 2 2 binning (1 pixel, 133 nm). the microscope shutters and the camera were operated by metamorph 6.1 (mds analytical technologies). a stack of 13 images was obtained for each chosen field (300 300 camera pixels in the center of the field to minimize excitation intensity irregularities), with an exposure time of 400 ms and a 200-nm axial separation between successive images in the stack. image analysis was performed with a custom - written graphical user interface in matlab (mathworks) in the in - focus image plane for each kinetochore cluster (this plane also contains the pixel with maximum intensity value). measurements of fluorescence signal from kinetochore clusters in fission yeast cells in g2/m were performed by placing a 6 6 pixel box on the signal region. it was placed so that the central 2 2 pixel region in the box had the maximum cumulative signal. for fission yeast and c. albicans cells in anaphase, a 5 5 pixel box was used to measure the fluorescence signal. the number of pixels for signal measurement for gfp - tagged kinetochore proteins was determined by fitting 1-d gaussian curves to line scans through kinetochore clusters in the in - focus plane (the maximum intensity plane), with the standard deviation of the gaussian as a free parameter. fluorescence signal was measured over an area corresponding to the 4 (sd) around the maxima. for fission yeast cells expressing ndc80p - gfp, this fitting procedure yielded a mean spot size of 600 60 nm for anaphase cells and 700 44 nm for g2 cells corresponding to an area defined by a 5 5 and 6 6 pixel square, respectively, in the acquired images. measurements from c. albicans cells expressing cse4p - gfp in anaphase prompted the use of a 5 5 pixel square for signal measurement. background correction was applied by measuring the background from a larger square region (8 8 pixels for fission yeast and 7 7 pixels for budding yeast and c. albicans) that is concentric with the signal region, following the scheme detailed in hoffman. s1 shows quantification of the number of microtubules in the budding yeast and c. albicans spindles. s2 shows that a four- to fivefold excess of cenp - a nucleosomes does not alter the number of kinetochore proteins at the centromere in fission yeast. all the strains (listed in table i) were grown in ypd at 32c (with the exception of the budding yeast strain expressing sccse4p - gfp, which was grown at 25c). ye5s, ypd, and ypd supplemented with 50 g / ml of uridine (sigma - aldrich) were used to grow fission yeast, budding yeast, and c. albicans, respectively. gfp fusions were made by pcr amplification of a gfp kan cassette (from pfa6a gfp(s65 t) kan mx6) flanked with 60 bp of homology to the site of integration at the 3 end of the gene. the fission yeast strains with constitutive cnp1p and cnp1p - gfp overexpression were supplied by k. takahashi and m. yanagida (national bioresource project, okinawa institute of science and technology, okinawa, japan). kb, k. bloom laboratory ; xh, x. he laboratory ; jb, j. berman laboratory. an inverted microscope (te-2000u ; nikon) with a 100 1.4 na differential interference contrast objective (nikon) was used for imaging cells at 25c. cells suspended in filter sterile sd complete media were immobilized on coverslips coated with concanavaline a (sigma - aldrich) for imaging. images were acquired with a cooled charge - coupled device camera (orca ii er ; hamamatsu photonics) with 2 2 binning (1 pixel, 133 nm). the microscope shutters and the camera were operated by metamorph 6.1 (mds analytical technologies). a stack of 13 images was obtained for each chosen field (300 300 camera pixels in the center of the field to minimize excitation intensity irregularities), with an exposure time of 400 ms and a 200-nm axial separation between successive images in the stack. image analysis was performed with a custom - written graphical user interface in matlab (mathworks) in the in - focus image plane for each kinetochore cluster (this plane also contains the pixel with maximum intensity value). measurements of fluorescence signal from kinetochore clusters in fission yeast cells in g2/m were performed by placing a 6 6 pixel box on the signal region. it was placed so that the central 2 2 pixel region in the box had the maximum cumulative signal. for fission yeast and c. albicans cells in anaphase, a 5 5 pixel box was used to measure the fluorescence signal. the number of pixels for signal measurement for gfp - tagged kinetochore proteins was determined by fitting 1-d gaussian curves to line scans through kinetochore clusters in the in - focus plane (the maximum intensity plane), with the standard deviation of the gaussian as a free parameter. fluorescence signal was measured over an area corresponding to the 4 (sd) around the maxima. for fission yeast cells expressing ndc80p - gfp, this fitting procedure yielded a mean spot size of 600 60 nm for anaphase cells and 700 44 nm for g2 cells corresponding to an area defined by a 5 5 and 6 6 pixel square, respectively, in the acquired images. measurements from c. albicans cells expressing cse4p - gfp in anaphase prompted the use of a 5 5 pixel square for signal measurement. background correction was applied by measuring the background from a larger square region (8 8 pixels for fission yeast and 7 7 pixels for budding yeast and c. albicans) that is concentric with the signal region, following the scheme detailed in hoffman. s1 shows quantification of the number of microtubules in the budding yeast and c. albicans spindles. s2 shows that a four- to fivefold excess of cenp - a nucleosomes does not alter the number of kinetochore proteins at the centromere in fission yeast. | point and regional centromeres specify a unique site on each chromosome for kinetochore assembly. the point centromere in budding yeast is a unique 150-bp dna sequence, which supports a kinetochore with only one microtubule attachment. in contrast, regional centromeres are complex in architecture, can be up to 5 mb in length, and typically support many kinetochore - microtubule attachments. we used quantitative fluorescence microscopy to count the number of core structural kinetochore protein complexes at the regional centromeres in fission yeast and candida albicans. we find that the number of cenp - a nucleosomes at these centromeres reflects the number of kinetochore - microtubule attachments instead of their length. the numbers of kinetochore protein complexes per microtubule attachment are nearly identical to the numbers in a budding yeast kinetochore. these findings reveal that kinetochores with multiple microtubule attachments are mainly built by repeating a conserved structural subunit that is equivalent to a single microtubule attachment site. |
the considerable number of non - coding rnas (ncrnas) that has been detected in the past few years was largely unexpected (13). although the functions of the many recently identified ncrnas remain mostly unknown, increasing evidence stands in support of the notion that ncrnas represent a diverse and important functional output of most genomes (4). all ncrnas in noncode were filtered automatically from genbank (5) and the literature, and were then later manually curated. with the exception of rrnas and trnas, all classes of reported ncrnas the aim of the database is to provide a platform that will facilitate both bioinformatic as well as experimental research. in addition to containing sequence data, noncode provides a user - friendly interface, a visualization platform and a convenient search option, allowing efficient recovery of sequences, regulatory elements in the flanking sequences, related publications and other information. data collection and annotation for noncode v2.0 was carried out in a similar fashion as for version 1.0 and can be briefly described as follows : genbank entries constituted the major source of noncode. we searched pubmed (6) with a list of ncrna keywords, such as ncrna, grna, etc., and thereafter consulted the literature matched with them and extracted more ncrna keywords. the downloaded genbank files (gbfiles) were then filtered using these keywords, and the filtered entries were subsequently confirmed by manual curation. for all obtained ncrna records, basic information related to sequence, name, alias, length, ncrna class, organism, references and accession number in genbank were extracted and entered into the noncode database. each ncrna sequence was checked for redundancies using perl scripts, and each cluster of redundant sequences was given a non - redundant noncode accession number (uniqid, i.e. unique ncrna i.d.). process function class (pfclass) system based on the biological processes or functions in which an ncrna is involved, and one or more of the 26 pfclasses were also assigned to all ncrnas in noncode v2.0. moreover, a subset of ncrnas has been divided into nine additional categories according to whether they are gender- or tissue - specific or associated with tumors and diseases, etc. where possible, noncode also provides additional annotations, such as information on function, cellular role, cellular location, chromosomal localization and splicing. the annotations and the genomic mapping information of the sequences rely on data provided in the original genbank records, the fantom3 database (2), the ucsc genome browser database (7), or directly from the reference literature. the purpose of the database is to serve the research community by organizing information concerning all types of ncrnas (except trnas and rrnas) from all groups of organisms. as of august 2007, the significant growth in the amount of data, compared with the 5339 non - redundant sequences in the previous edition published in 2005, is primarily due to systematic identification of mrna - like ncrna transcripts (2) and the discovery of piwi - interacting rnas (pirnas) through large - scale cdna sequencing (1,3,8). other novel ncrnas, such as stem - bulge rnas (sbrnas) (9), snrna - like rnas (snlrnas) (9) and a number of unclassified ncrna transcripts were mainly obtained from our laboratory and other published literature (1012). according to the traditional classification system, noncode v2.0 contains three novel classes of ncrnas, the sbrnas, the snlrnas and the pirnas, whereas the number of pfclasses is the same as in noncode v1.0 (i.e. 26), with sbrnas and snlrnas corresponding to the miscfunction_snm and pirnas to rna - processing_cleavage pfclass. sequences can be searched using accession numbers found in genbank, name, traditional class, pfclass, organism and uniqid in noncode. in addition to access to noncode database records, search results are also linked to full genbank entries (figure 1). in the current version of the database, we also included the online blast service (ncbi wwwblast version 2.2.17) which allows sequence similarity searches against the entire noncode v2.0 database. (d) the link from genome browser to noncode. in this updated version of noncode, a ucsc genome browser for noncode was constructed for saccharomyces cerevisiae, caenorhabditis elegans and homo sapiens. ncrna loci of these species may be viewed through the noncode track in the genome browser. other common tracks concerning basic information on these species, such as mrna genes, ests and so on, have also been retrieved from the ucsc genome browser database. for the above three species, ncrna entries in the noncode database can be directly linked to the genome browser ; similarly, noncode ncrna annotations may be accessed through the genome browser (figure 1). as new ncrnas are being progressively discovered, we will continue to update the noncode database. submissions of new ncrnas are invited, and should be sent to [email protected]. within the coming year, we will continue to add genome browser services for other model organisms, such as mouse and fly. given the increasing amount of ncrna data and the emergence of ncrna prediction software [e.g. qrna (13), rnaz (14) ], we will attempt to establish a service for ncrna prediction based on the mentioned softwares and the information in the noncode database. | the noncode database is an integrated knowledge database designed for the analysis of non - coding rnas (ncrnas). since noncode was first released 3 years ago, the number of known ncrnas has grown rapidly, and there is growing recognition that ncrnas play important regulatory roles in most organisms. in the updated version of noncode (noncode v2.0), the number of collected ncrnas has reached 206 226, including a wide range of micrornas, piwi - interacting rnas and mrna - like ncrnas. the improvements brought to the database include not only new and updated ncrna data sets, but also an incorporation of blast alignment search service and access through our custom ucsc genome browser. noncode can be found under http://www.noncode.org or http://noncode.bioinfo.org.cn. |
ocular drug delivery is challenging in terms of achieving optimum drug concentration due to unique protective mechanisms of the eye. development of a drug delivery system for attaining therapeutic concentration at the target site requires a comprehensive understanding of static and dynamic barriers of the eye. the eye has two broadly defined segments, (a) anterior segment, and (b) posterior segment. anterior segment is the front one - third of the eye that includes the optical structure in front of vitreous humor : cornea, pupil, aqueous humor, iris, lens and ciliary body. posterior segment is the back two - thirds of the eye that mainly includes sclera, choroid, retina, vitreous humor, macula, and optical nerve. the common routes of drug administration for the treatment of eye disorders are topical, systemic, periocular, and intravitreal. topical administration is the most preferred route because of highest patient compliance and least invasive nature. upon topical instillation, absorption of drugs takes place either through corneal route (cornea, aqueous humor, intraocular tissues) or noncorneal route (conjunctiva, sclera, choroid / rpe). the cornea can be mainly divided into the epithelium, stroma and endothelium, where each layer offers a different polarity and a potential rate - limiting structure for drug permeation. the non - corneal route involves absorption across the sclera and conjunctiva into the intraocular tissues. however, a small fraction of the topically applied drugs, generally less than 5%, reaches the intraocular tissues. factors responsible for poor ocular bioavailability following topical instillation are precorneal drainage and lipoidal nature of the corneal epithelium. in addition, a major fraction of drug reaches the systemic circulation through conjunctival vessels and nasolacrimal duct, which leads to severe adverse effects. consequently, topical route has met with limited success in attaining therapeutic drug concentrations in the posterior segment. systemic administration can provide therapeutic levels in the posterior segment, but administration of high doses is necessary, which often leads to severe side effects. blood - aqueous barrier and blood - retinal barrier are the two major barriers for anterior segment and posterior segment ocular drug delivery, respectively, after systemic administration. the tight junctional complexes located in the two discrete cell layers, the endothelium of the iris / ciliary blood vessels, and the nonpigmented ciliary epithelium offer blood - aqueous barrier which prevents the entry of solutes into the aqueous humor. blood retinal barrier is composed of two types of cells, that is, retinal capillary endothelial cells and retinal pigment epithelium (rpe) cells which prevents the entry of solute into the retina. intravitreal administration requires frequent administration which may lead to high susceptibility for vitreous hemorrhage, retinal detachment and endophthalmitis. these side effects can be minimized by developing delivery systems which provide controlled and targeted drug delivery for prolonged periods [13 ]. conventional ophthalmic formulations such as solutions and suspensions exhibit poor bioavailability. over the last decade, numerous drug delivery systems have been explored to overcome the limitation of conventional dosage forms. novel formulations such as nanoparticles, liposomes, dendrimers, and niosomes were developed to enhance drug bioavailability and to minimize adverse effects [4, 5 ]. among them liposomal formulations were widely explored in the last decade for drug delivery applications. in 1965 liposomes are usually within the size range of 10 nm to 1 m or greater. these vesicular systems are composed of aqueous core enclosed by phospholipid bilayers of natural or synthetic origin. liposomes are structurally classified on the basis of lipid bilayers such as small unilamellar vesicles (suvs) or multilamellar vesicles (mlvs). furthermore, on the basis of size, liposomes are classified into small unilamellar vesicles (suvs), giant unilamellar vesicles (guvs), and large unilamellar vesicles (luvs) (figure 1). unilamellar vesicles are composed of single layer of lipid such as lecithin or phosphatidylglycerol encapsulating aqueous interior core. mlvs are metastable energy configuration having different facets depending upon the polydispersity of the liposomal formulation. drug loading capacity of liposomes depends on many factors such as size of liposomes, types of lipid utilized for preparation, and physicochemical properties of therapeutic agent itself. for example, being the smallest in size entrapping efficiency for suvs is poor in comparison to mlvs. hydrophilic drugs are entrapped in the aqueous layer, while hydrophobic drugs are stuck in the lipid bilayers. loading capacity of ionic molecules can be further improved by using cationic or anionic lipids for the preparation of liposomes. majority of liposomal formulations utilize phosphatidylcholine (pc) and other constituents such as cholesterol and lipid - conjugated hydrophilic polymers as the main ingredients. stability of liposomes depends upon the various properties such as surface charge, size, surface hydration, and fluidity of lipid bilayers. neutral liposomes upon systemic administration evade the elimination by reticuloendothelial system (res). however, these vesicles possess higher self - aggregation tendency. in contrast, negatively and positively charged liposomes exhibit lower aggregation tendency but undergo rapid clearance by res cells due to higher interaction with serum proteins. liposomes of size less than 100 nm generally exhibit significantly higher circulation time due to decrease in opsonization of liposomes with serum protein. in general, hydration of phospholipids results in the formation of mlvs, which can be processed into suvs with proper sonication. however, addition of aqueous solution of surfactant above the critical micelle concentration results in the formation of phospholipids micelles. after the dialysis of surfactant aggregation of micelles form luvs, critical micelle concentrations of amphiphiles which can form micelles are four to five orders of magnitude higher than the phospholipids which form liposomes. most commonly solvent evaporation method, reverse phase evaporation method and detergent dialysis method are employed. the encapsulated drug from liposome can be released either through passive diffusion, vesicle erosion, or vesicle retention. in passive diffusion, drug molecules tend to penetrate through the lipid layers of liposome to reach extra vesicular layer either by diffusion or convection mechanism. the rate of diffusion depends on the size, lipid composition, and the properties of the drug itself [1517 ]. unilamellar liposomes exhibit faster release rate than multilamellar ones because in multilayered liposome, drug diffusion occurs through a series of barriers ; hence, the drug release is delayed. phospholipase and high - density lipoprotein present in blood plasma can damage phospholipid layers of liposome and thus results in vesicle erosion and releases the encapsulated drug into the cell. liposome - cell interactions depend on several factors like size, surface charge, composition of liposomes, targeting ligand on the surface of liposome, and biological environment. liposomes can interact with cells by four different mechanisms : adsorption, fusion, lipid exchange and endocytosis (receptor mediated). liposomes can be specifically or nonspecifically adsorbed onto the cell surface or can be fused with cell membranes, and release encapsulated drug inside the cell. during adsorption, liposomes can release encapsulated drug in front of cell membrane, and released drug can enter cell via micropinocytosis. negatively charged liposomes have been found to be more efficient than neutral liposomes for internalization into the cells by endocytosis process. liposomes bind to the receptor present in the invaginations of cellular membrane and are internalized into the cell by endocytotic pathway. after endocytosis, they can fuse with the endosomal membrane to form endosome which can be delivered to lysosomes. in lysosomes, the presence of peptidase and hydrolase degrades the liposomes and their content. to avoid this degradation and thus to increase cytoplasmic bioavailability, stimuli - responsive liposomes (such as ph or temperature) ph - sensitive liposomes can undergo fusion with endosomal membrane and release their content directly into cytosol. in some cases liposomes become destabilized inside the endosome and release their content, or they destabilize endosomal membrane resulting in leakage of encapsulated content into cytosol [19, 20 ]. in this paper we have attempted to summarize the application of liposomes in the field of ophthalmic drug delivery attempted by numerous investigators over the last decade. liposomes have been investigated for ophthalmic drug delivery since it offers advantages as a carrier system. it can enhance the permeation of poorly absorbed drug molecules by binding to the corneal surface and improving residence time. in addition, liposomes can improve pharmacokinetic profile, enhance therapeutic effect, and reduce toxicity associated with higher dose. owing to their versatile nature, liposomes have been widely investigated for the treatment of both anterior and posterior segment eye disorders. current approaches for the anterior segment drug delivery are focused on improving corneal adhesion and permeation by incorporating various bioadhesive and penetration enhancing polymers. however, in the case of posterior segment disorders, improvement of intravitreal half - life and targeted drug delivery to the retina is necessary. currently verteporfin is being used clinically in photodynamic therapy for the treatment of subfoveal choroidal neovascularization (cnv), ocular histoplasmosis, or pathological myopia effectively. verteporfin is a light - activated drug which is administered by intravenous infusion. in photodynamic therapy, after the drug is injected, a low - energy laser is applied to the retina through the contact lens in order to activate verteporfin that results in closure of the abnormal blood vessels. unfortunately, photodynamic therapy usually does not permanently close the abnormal vessels and choroidal neovessels reappear after several months. another liposomal photosensitizing agent, rostaporfin, was evaluated for the treatment of age - related macular degeneration. however, there are some issues to be addressed such as formulation, and storage of liposomes is very difficult, and they are known to cause long - term side effects. intravitreal administration of liposomes has resulted in vitreal condensation, vitreal bodies in the lower part of eye, and retinal abnormalities. therefore, all these factors should be taken into account while developing liposomal formulation for ophthalmic application [2125 ]. in 1981, samolin. investigated the role of liposomes in ophthalmic drug delivery. since then several investigators proposed strategies to enhance absorption of drugs having poor physicochemical properties. studies performed by schaeffer and krohn suggested the role of charge and size in transcorneal permeation. investigators observed four - fold higher in vitro corneal flux from penicillin g - loaded suvs. they reported corneal permeation in the order of suv+ > mlv > suv > suv > mlv free drug. these studies explored the role of vesicle type on transcorneal permeation across the excised rabbit cornea. liposomal formulation of ta produced twofold increase in drug concentration in both the cornea and aqueous humor in the rabbit model. on the contrary, liposomal formulation of hydrophilic drug, that is, dihydrostreptomycin sulfate, did not improve the corneal permeation [37, 38 ]. considering these findings, it was evident that both vesicle type and physicochemical property of drug significantly affects the transcorneal flux of the formulation. earlier investigation by fitzgerald. was significant in exploring the clearance of liposomes by gamma scintigraphy following topical administration in the rabbit model. these investigators reported, suvs with positive charge had improved the corneal retention by interacting with negatively charged corneal surface. since then, approaches based on positively charged liposomes were explored considerably. researchers also explored immunoliposomes, lectin functionalized liposomes, and positively charged lipid analogs. among these approaches however, lectin and lipid analog - based approaches are not explored considerably in the field of ophthalmic drug delivery. approach of utilizing chitosan in the formulation was reported to be advantageous in improving the precorneal residence time due to its mucoadhesive nature. degradation of chitosan into oligosaccharides is mediated through lysozymes, and degradation products are nontoxic in nature [40, 41 ]. biodegradable nature is advantageous for selecting chitosan in the formulation of ocular drug delivery systems. topical administration of chitosan - coated liposomes (chitosomes) improves precorneal retention and also slows down drug metabolism at the precorneal epithelial surface. chitosan - based mucoadhesive liposomal formulation of cpx was prepared and evaluated by mehanna. reverse phase evaporation technique was utilized for the preparation of liposomes, which were further coated with chitosan of different molecular weights. the authors reported that liposomes coated with high molecular weight chitosan were smaller in size due to complete coverage of liposomal surface, which acted as a physical barrier to inhibit aggregation. in addition, authors determined lower encapsulation efficiency (ee) of 49.93% for coated liposomes in comparison to uncoated negative and neutral liposomes with 71.4% and 53.2% ee, respectively, due to electrostatic repulsion between chitosan and cationic drug. negatively charged liposomes were larger in diameter due to predominantly electrostatic attraction between the positively charged chitosan and negatively charged phospholipids. rheological studies revealed ideal pseudoelastic behavior of chitosomes and higher apparent viscosity than the liposome dispersion. the author suggested that pseudoelastic property of chitosome provides prolonged retention and stability of tear film. moreover, in vitro release studies with chitosomes exhibited slower drug release rate in comparison to free liposomes due to additional diffusion barrier for drug molecule. ex vivo corneal permeation studies across isolated rabbit cornea suggested that due to absorption enhancing nature of chitosan relative permeability of chitosomes was 1.74-fold higher than free drug. furthermore, in vitro antibacterial studies revealed that chitosomes exhibited enhanced antibacterial activity than the marketed aqueous solution against reference and clinically isolated strains of pseudomonas aeruginosa and staphylococcus aureus. authors suggested the electrostatic interaction of positively charged chitosan and negatively charged bacterial cell wall enhanced the antibacterial action of liposomal formulation. comparative single dose in vivo study performed on bacterial conjunctivitis rabbit model revealed that chitosomes inhibited the growth of pseudomonas aeruginosa for 24 h. it was reported that marketed product (clioxan) is comparatively less effective and requires frequent administration. however, other studies suggest the advantages of water - soluble low molecular weight chitosan as potential biopolymer for coating liposomes. application of lch was advantageous in eliminating the aggregation behavior of chitosan at physiological ph that had dramatically influenced in vivo performance of the liposomal formulation. investigator reported higher ex vivo corneal penetration across excised rabbit cornea in the case of lch - coated liposomes as shown in figure 2. however, higher concentration of lch (0.25% and 0.5% w / w) did not show significant change in particle size. researchers suggested that a loose coating layer is responsible for aggregation of vesicles which resulted in higher particle size in the case of 0.1% w / v lch. moreover, the drug release at 6 h was 38.9% in noncoated liposomes whereas only 25.4% drug release was observed in liposomes coated with 0.25% w / v chitosan solution. both nontreated and treated group did not demonstrate any abnormality of the corneal and conjunctival epithelial cells. in addition, no ocular irritation and inflammatory response was observed. in vitro precorneal retention studies in rabbits showed that the elimination of chitosan - coated liposomes was slower than non - coated liposomes. authors suggested that mucin film, which primarily covers the surface of cornea and conjunctiva, is composed of negatively charged glycoprotein. in addition, hydrogen bonding interactions of lch with the ocular surface also favors precorneal retention. however, previous studies with high molecular weight chitosan - coated liposomes did not improve the precorneal retention due to enhanced intramolecular interactions. histopathological analysis of the lch - coated liposomes in rabbits after long - term irritation test revealed that the formulation was biocompatible with the ocular tissues (figure 3). application of quaternized derivatives of chitosan that is, n - trimethyl chitosan chloride (tmc), with significantly higher water solubility at physiological ph, was evaluated for surface modification of coenzyme q10-loaded liposomes. in addition, surface modification with cationic polymeric film reduced particle aggregation through stearic stabilization and improved precorneal retention than uncoated liposomes due to ionic interaction with negatively charged corneal surface. investigators reported almost 4.8-fold increase in precorneal residence time measured by gamma scintigraphy after administration of 25 l of formulation. histological analysis and draize test performed on rabbits revealed that tmc was biocompatible with corneal epithelium. moreover, higher molecular weight tmc exhibited better anticataract activity in sprague dawley rats. to take the dual advantage of chitosan - based nanoparticles and liposomes, diebold. as mentioned earlier, chitosan nanocarriers were employed in topical drug delivery because of its mucoadhesive nature, whereas liposomes can incorporate variety of drug molecules and improve ocular drug bioavailability [4547 ]. these nanosystems were formulated as eye drops, which possessed combined properties of both carriers and overcome the ocular mucosal barriers. these authors evaluated the nanosystems for toxicity on spontaneously immortalized epithelial cell line from normal human conjunctiva (ioba - nhc). cells pre incubated with xtt (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2h - tetrazolium-5-carboxyalinide) solution (1 mg / ml xtt in 100 ml of phenol red - free rpmi culture medium) were exposed to different concentrations of chitosan nanoparticles and liposome - chitosan nanoparticles complexes. cytotoxicity was determined by measuring the production of yellow color due to cleavage of xtt by mitochondrial enzymes. cell viability after exposure of liposome - chitosan nanoparticle complexes was higher in comparison to chitosan nanoparticles alone. they also performed in vivo acute tolerance test by administrating the formulations topically to the female albino new zealand rabbits. the nanosystems did not show any evidence of toxicity to the both sham - controlled and treated eyes. also, in vivo experiments have shown that nanosystems can enter the conjunctival cells without causing histological alteration to the cornea, conjunctiva, and lid tissues in the rabbit model. in addition, the complexes did not release any inflammatory mediators in cornea, conjunctiva, and eyelids. vaccination approach can successfully overcome the limitations of antiviral agents in the treatment of hsv infections. administration by conventional parenteral route has several drawbacks such as high cost, need of highly trained personnel, and needle - stick injuries. cationic liposomes containing herpes simplex virus (hsv) antigens were proposed as potential carriers, in the form of a periocular vaccine, to protect animals against subsequent hsv-1 ocular challenges. two different peptides, namely, dtk1 and dtk2 (dtks), having antiherpetic activity were synthesized. zhang. utilized cytochrome - c (cyt - c) loaded cationic liposomes for the treatment of selenite - induced cataract in rats. this study reported improvement in the entrapment efficiency (ee) with increasing phosphatidylcholine component, whereas ee was lowered by incorporating stearylamine. cyt - c loaded freeze - dried liposomes were stable for one year at 4c. furthermore, these liposomes exhibited remarkable efficacy (28% decrease in lens opacity) in minimizing the cataract formation. liposomal encapsulation of cyt - c has significance, but the preparation method adapted by these authors was similar to previous investigations. in another study, fluconazole liposomal formulation was evaluated in the candidal keratitis model in rabbits. in this investigation, the purpose of developing liposomal formulation was to prolong the antifungal action by increasing the contact time. in the rabbits treated with fluconazole solution, 50% healing was observed in 3 weeks, whereas 86.4% healing was observed in rabbits treated with fluconazole encapsulated liposomes. authors attributed enhanced pharmacological activity to higher viscosity and lipid solubility of fluconazole - loaded liposomes. chronic ocular infectious diseases such as conjunctivitis, bacterial keratitis need high drug concentration at the site of infection. treatment of these diseases requires frequent eye drop administrations that may cause drug resistance and also decrease patient compliance. in order to minimize precorneal drainage and increase bioavailability viscosity enhancers such as poly (vinyl alcohol) and polymethacrylic acid were blended with eye drop solution. many investigators evaluated the role of liposomal hydrogel formulation for the delivery of fluoroquinolone antibiotics. for example, liposomal hydrogel formulation of ciprofloxacin (cpx) was reported to avoid tear - driven dilution in the cul de sac. lecithin (lec) and -l - dipalmitoylphosphatidylcholine (dppc) were utilized as major ingredients in the preparation of multilamellar liposomes. poly (vinyl alcohol) (pva) and polymethacrylic acid (pma) derivatives were utilized for gel formulation. various formulation parameters such as viscosity and rheological property of liposomes was evaluated in relation to the in vitro release. cpx because of its negative charge electrostatically interacts with lipid head group of the phospholipid bilayers. similar electrostatic interaction between lipid bilayers and other fluoroquinolones such as ofloxacin and lomefloxacin were reported in other studies. the investigator observed that use of viscosity enhancing agents in the formulation had affected the drug release rate. the addition of gel forming agents pva and pma did not affect the rigidity of liposomal membrane, instead these polymers were adsorbed on the surface of multilamellar liposomal surface because of method of formulation. hydration of lipids with proper concentration of pva and pma results in the formation of polymer layer on the surface of the liposomes [54, 55 ]. in addition, they found a remarkable difference in drug release half - time between two different lipids, that is, lec and dppc. the presence of unsaturated lipid in lec provides less rigid structure to the liposome formulation that resulted in faster drug release in comparison to dppc. hydrogel formulation has shown plastic properties ; that is, under higher shear stress condition, it remained in free flowing state, whereas it exhibited no flow state at rest. overall, the use of optimized formulation of liposomal hydrogel can sustain the release of antibacterial agents in comparison to liposomes alone, and this approach could be beneficial in the treatment of various chronic ocular infectious diseases. in another study, cpx - loaded liposomal hydrogel formulation improved transcorneal permeation in rabbit model. the investigators reported that drug entrapment efficiency was enhanced with the increase of cholesterol concentrations, which provided higher stability and lower permeability of lipid bilayers. furthermore, higher encapsulation efficiency with positively charged liposomes was observed due to favorable electrostatic attraction between cpx and cationic stearylamine. liposomes of higher size were obtained upon incorporation of charge inducing agents, which expand lipid bilayers distance. positively charged liposomes exhibited slower release rate, and cpx release was more sustained from the liposomes suspended in the carbopol gel because of additional barriers for diffusion. liposomal hydrogel displayed fivefold higher in vitro transcorneal permeation across excised rabbit cornea than the aqueous solution. although authors observed enhanced in vitro transcorneal permeation, it would be interesting to evaluate these formulations for in vivo studies, where tear dilution plays a major role. in a similar study by these researchers, transcorneal permeation of ofloxacin - loaded thermosensitive two different types of liposomes, mlv and reverse phase evaporation vesicles (rev), were prepared. authors observed smaller particle size with rev relative to mlv due to differences in the method of preparation. splicing of the lipid monolayer in a more curved structure resulted in rev of smaller diameter. incorporation of liposomes in thermosensitive gels reduced the gelling time from 5 to 1 minute. transcorneal permeation studies across excised rabbit cornea revealed sevenfold higher drug permeation from the liposomal formulation than ofloxacin aqueous solution. this effect was observed due to mucoadhesive nature of the hydrogel base which prolonged the retention of formulation across the excised rabbit cornea. in addition, cationic nature of chitosan in the thermogelling system promoted corneal adherence and opened corneal epithelial tight junctions. researchers concluded that ofloxacin liposomal formulation will reduce the formation of crystalline deposit and also frequency of administration. the ocular irritation test suggests excellent tolerance of chitosan formulation evaluated with confocal laser scanning ophthalmoscope [56, 57 ]. liposomal formulation was evaluated on human subjects, and effectiveness was compared to normal saline at different time points. authors reported statistically significant improvement in tear film stability and lipid layer stability in comparison to control. these studies suggest the potential of liposomal sprays in the treatment of dry eye syndrome. liposomes were also investigated for the topical delivery of intraocular pressure (iop) lowering agents. for example, acetazolamide was encapsulated in liposomes to enhance the solubility and corneal permeation. liposomes were formulated by reversed phase evaporation and liquid hydration methods with and without the use of positive or negative charge inducers to prepare rev and mlv. liposomes of different compositions were evaluated for entrapment efficiency, stability, in vitro release, and iop lowering efficacy in rabbit model. the entrapment efficiency of acetazolamide was found highest with positively charged liposomes followed by neutral and negatively charged liposomes because of ionic interaction between anionic drug and lipid bilayers. cationic and neutral mlvs of acetazolamide exhibited maximum effectiveness in terms of release profile for the same reason. another iop reducing agent, demeclocycline (dem), was encapsulated in liposomes which enhanced ocular permeability. neutral liposomes were more effective in iop lowering effect than negatively charged liposomes or free drug. in addition, phase transition and size distribution studies showed long term stability (15 months) of the liposomal formulation. shen and tu reported the application of liposomes for the delivery of ganciclovir (gcv) to the vitreous humor via topical administration in the rabbits. gcv liposomes were prepared by the reversed phase evaporation method utilizing pc / ch / sodium deoxycholate mixture. in vitro transcorneal permeability and in vivo ocular transcorneal permeability was 3.9-fold higher (figure 4), and ocular bioavailability of gcv liposomes was 1.7-fold greater in comparison to solution (figure 5). gcv concentrations from liposomal formulation were 2 to 10 times higher in various ocular tissues. in addition, in vivo experiments suggested that the scleral pathway contributed in the absorption of gcv liposomes, as the highest concentration of gcv was obtained in the sclera. concentrations of gcv attained in the cornea and the sclera were higher than ic50 value of gcv against cmv. the author suggested that the particle size (i.e., 200 nm) and composition of the liposomes played a major role in transocular permeation. disposable contact lenses presoaked with medication solution have been utilized for continuous drug delivery. however, in presoaked contact lenses, drug molecules randomly disperse within the contact lenses and show burst release that can cause local tissue toxicity or other side effects. to avoid rapid drug release and to provide site - specific delivery, another novel strategy, liposomes loaded soft contact lenses, was proposed for the antibiotics in the treatment of ocular infections such as bacterial keratitis. contact lenses with surface - immobilized levofloxacin - loaded liposomes followed first - order release kinetics and released the drug over more than 6 days. in addition, the liposomal formulation has shown antibacterial activity against s. aureus [28, 62 ]. in another study, chloramphenicol (cap) was encapsulated in dimyristoylphosphatidylcholine (dmpc) liposomes and formulated in the form of eye drops. three methods, that is, cap - part (partitioning of cap in the vesicle bilayers), cap - en (entrapment of cap via normal hydration method), and cap - ads (adsorption of cap on the vesicle surface) were employed for the preparation of liposomes. the formulation was evaluated for interaction of the drug with the phospholipid bilayers resulting in optimum efficacy against s. aureus. cap was localized in the interfacial lipid bilayers in the case of cap - en whereas entrapped deeper in the bilayers in the case of cap - part. these results showed that cap located near the interfacial region within the hydrophobic core of the liposomes had shown highest anti - bacterial activity against s. aureus for almost 5 hrs. chetoni. reported acyclovir (acv) containing positively charged unilamellar liposomes (lipo - acv), administered topically into rabbit eyes. the bioavailability of lipo - acv was compared with free acv in solution (sol), acv encapsulated in empty liposomes (lipo - empty), and a diluted dose of commercially available acv ointment, containing same acv concentrations (0.12%). the pharmacokinetic profile of the drug in the aqueous humor of rabbits showed highest drug concentration profile for lipo - acv system with 90 minutes plateau. lipo - acv exhibited aqueous humor acv concentration in the upper range of the id50 (0.01 to 0.7 g / ml). in a separate study concentrated acv ointment (containing 8-fold greater dose of acv) was compared with lipo - acv. these results indicate a significant advantage of lipo - acv as an alternative to acv ointment. in order to give an insight on release mechanism of acv from liposomal vehicle, in vitro release experiments through a cellophane membrane was performed which showed lower drug release from the liposomal vehicle through cellophane membrane compared to that of sol and lipo - empty. these results sustained the concept that negatively charged corneal epithelium enhances the efficacy of positively charged liposomal formulation. pleyer. formulated different cationic liposomes by changing their lipid compositions in order to improve gene expressions in corneal endothelial cells. the authors reported six formulations with different cationic lipids 3[n-(n, n-dimethylaminoethane)-carbamoyl ] (dac), dicarbobenzoxyspermin - carbamoyl (sp), n - amidino--alanin-[2-(1,3-dioleoyloxy)propyl]amid - hydrochlorid (dosga), and 1,2-dimyristyloxypropyl-3-methylhydroxethylammoniumbromide (dmrie) which were coupled in varying concentrations with neutral lipid dioleoylphosphatidylethanolamine (dope). fixed amount of dna was entrapped in each liposome which expressed e. coli beta - galactosidase. transfection experiments on bovine corneal endothelial cells (bcec) indicated that sp20 (sp / dope 20/80) generated highest efficiency followed by dmrie 50 (dmrie / dope 50/50) ranging at approximately 3 mu per -gal per well. the researchers observed low gene expressions with dac 30 (dac / dope 30/70), and dosga 30 (dosga / dope 30/70), dosga 100 (dosga 100) and no gene expressions for free dna. at a fixed dna concentration, the relative -galactosidase expressions were decreased with increasing the cationic lipid dose, which might be due to either toxic effects of cationic lipids at higher concentrations to the cells or non - optimal lipid / dna ratios. the highest efficiency of sp20 liposomes in delivering dna into bcec can be rationalized by considering its rapid and stable complexation with dna due to result of ionic interactions between the multivalent lipid and negatively charged phosphate groups of dna. sp20 was completely biodegradable compared to many synthesized lipids as it was derived from naturally occurring compounds resulting in least toxicity compared to other liposomal formulations. teshima. studied prednisolone- (pls-) incorporated liposomes to improve retention property of prednisolone. introduction of a lipophilic moiety (palmitoyl) to prednisolone (pal - pls) greatly enhanced drug retention in liposomes as lipophilic moiety increased its affinity to liposomal lipid bilayer. the investigators studied two liposomes containing two different lipids, egg phosphatidylcholine (eggpc) and distearoyl phosphatidylcholine (dspc). ultrafiltration and gel filtration techniques were used to investigate retention properties of pls and pal - pls in liposomes. while ultrafiltration method showed high incorporation efficiency of pls into the liposomes, a significant decrease of its incorporation efficiency this result indicated that elution medium in gel filtration studies released incorporated pls from liposomes. however, incubation of liposomes with rat plasma for 1 min effectively decreased pal - pls incorporation into eggpc / chol liposomes as detected by gel filtration. the reducing effect of pal - pls incorporation into liposomes by rat - plasma was overcome by using dspc lipid in liposomal formulation. further surface modification of liposomes with a hydrophilic polymer peg resulted in the protection of the entrapped palmitoyl - pls and thus generated a stable retention property of the drug. law. reported topical administration of acyclovir- (acv)- encapsulated liposomes, where in vitro corneal penetration and in vivo corneal absorption (using male rabbits) of acyclovir from acv - encapsulated liposomes were studied. this study reported the effect of liposomal surface charge on their corneal penetration and absorption. surface charge of liposomes plays a significant role in improving the efficiency of ocular drug delivery system. positively charged liposomes exhibited higher drug loading efficiencies as well as faster drug release rates compared to negatively charged liposomes. the penetration rate for positively charged liposomes was found to be approximately 3.6-fold lower than free acv and approximately 2-fold lower than negatively charged liposomes. similarly, acv concentration profile in aqueous humor indicated higher corneal absorption and greater corneal deposition of acv for positively charged liposomes relative to negatively charged acv and free acv. the researchers suggested that positively charged liposomes can interact electrostatically with the negatively charged surface of cornea. this interaction can result in stronger binding which leads to formation of a completely coated layer on the corneal surface. this layer may cause an increase in residence time on the cornea surface resulting in higher acv absorption and greater extent of acv deposition in the cornea compared to that of negatively charged liposomes. kawakami. reported o - palmitoyl prodrug of tilisolol - encapsulated liposome to improve the retention time of tilisolol in the precorneal area and vitreous body. following topical administration, the researchers observed very low retention of o - palmitoyl tilisolol in the tear fluid even when it was applied as liposomal formulation. the investigators significantly increased the retention property of liposomes by adding 2% of carmellose sodium which acted as a reservoir for liposomes. in case of intravitreal administration, o - palmitoyl tilisolol - encapsulated liposomes responded well resulting in higher drug concentration in the vitreous body compared to free tilisolol. in the last decade numerous researchers addressed the challenge of minimizing rapid clearance from precorneal site and enhancing the corneal permeation through various approaches. utilization of chitosan in the preparation of mucoadhesive and cationic formulations was widely explored for the delivery of small therapeutic molecules from different categories. other mucoadhesive polymers were also applied in the formulation of hydrogels that can regulate the drug release rate at the ocular surface., liposomal formulation can minimize the tissue toxicity and enhance the intravitreal half - life of drugs by decreasing rapid clearance from vitreous cavity [67, 68 ]. barza. delineated the effect of liposome size and pathological state of eye on the intravitreal elimination kinetics of carriers. recently ocular pharmacologists have utilized liposomal hydrogel and sterically (pegylated) stabilized liposomes to address the drawbacks associated with intravitreal administrations of liposomes. in an application, rhodamine - conjugated liposomes loaded with vasoactive intestinal peptide (vip) were given intravenously to healthy rats to examine efficacy in the treatment of ocular inflammation. vip is an immunomodulatory neuropeptide involved in the regulation of ocular immune response by modulating the activities of macrophages, t lymphocytes, and dendritic cells [19, 71 ]. intravitreal application of vip - loaded liposomes was proposed for the treatment of endotoxin - induced uveitis. internalization of rhodamine - conjugated liposomes (rh - lip) alone and loaded with vip (vip - rh - lip) was examined in male lewis rats. the authors reported that, after single intravitreal injection, liposomes were internalized by retinal mller glial cells, resident macrophages, and rare infiltrating activated macrophages. vip - rh - lip internalized via macrophages resulted in slower release and long - term expression inside the ocular tissues and cervical lymph nodes. thus, intravenous delivery of vip by liposomes would be helpful in the treatment of uveitis and other immune - mediated eye diseases by modulating the immune microenvironment of the ocular region. evaluated the liposomal formulation dispersed in hyaluronic acid (ha) gel for the delivery of vip in the treatment of uveitis and uveoretinitis in lewis rats. major limitation with the vip - lp was shorter residence time in the vitreous cavity due to rapid elimination through the lymphatic circulation. investigators attempted to increase the half - life of vip - loaded liposomes (vip - lp) after intravitreal administration by suspending them in the hydrogel. the researchers incorporated liposomes in ha gel in order to attain sustained release of vip from the liposomes. vip - lp suspended in ha gel was retained in the vitreous cavity for 8 days after single intravitreal injection. authors reported that incorporation of liposomes in the gel had increased the viscosity of the gel due to the enhanced interaction between ha gel and phospholipids. moreover, it was reported that formulation was effective in the treatment as evident by reduced clinical score and number of polymorphonuclear cells. in a study tacrolimus - loaded liposomes the vesicles were prepared by reverse phase evaporation technique and subsequently evaluated for efficacy and safety following intravitreal injection in rats. liposomes were able to maintain the vitreous concentration of more than 50 ng / ml for 2 weeks after single administration. the formulation also reduced drug - related toxicity to inner retinal cells. in another study, abrishami. prepared nanoliposomes of bevacizumab. researchers attempted to reduce the clearance of bevacizumab liposomes by incorporation of cholesterol. in comparison to free drug, concentration of liposomal formulation was 5 times higher at 42 days. this study revealed that liposomal formulation of bevacizumab was proven effective in the controlled release of bevacizumab for more than 6 weeks in rabbit model. fluconazole liposomes were evaluated for the treatment of candidal endophthalmitis. in the comparative study, intravitreal injections of fluconazole solution or liposomal formulation were given at different dose levels in the rabbit eyes. administration of fluconazole solution caused photoreceptor disorientation and ultrastructural changes of the retina at the concentration of 100 g in 0.1 ml or above. in contrast, liposomal formulation of fluconazole did not show any retinal alteration up to concentration of 200 g in 0.1 ml. formulated lipid prodrug of ganciclovir (gcv), 1-o - hexadecylpropanediol-3-phospho - gcv into liposomes which were injected intravitreally in rabbits. the researchers used this liposomal formulation for antiviral treatment against herpes simplex virus type 1 (hsv-1) and human cytomegalovirus (hcmv). nm intravitreal concentration was the most effective without causing any side effects of vitreous clarity or cataracts development in the eye. moreover, this formulation provided complete retinal protection even after simultaneous intravitreal injection. bochot. reported that phosphodiester oligonucleotide encapsulated sterically (pegylated) stabilized liposomes which were administered intravitreally in rabbits. it was the first reported use of liposomes as vehicle for intravitreal delivery of phosphodiester oligonucleotides. the investigators tried to overcome the problem of short intravitreal half - life of oligonucleotide by encapsulating [33p ] labeled 16-mer oligothymidylate (pdt16) within liposome. after intravitreal injection liposomal formulations yielded significantly higher concentration of radiolabeled 33p within the posterior segment of the eye (vitreous, retina, choroid, and sclera) than the solution. a heterogeneous competitive hybridization assay revealed a significantly improved intraocular stability of pdt16 when it was administered in a liposomal formulation. the sterically stabilized hydrophilic polyethylene glycol (peg) chains on the liposome 's surface protected them from degradation, resulting in prolonged residence time in vitreous and sustained release of encapsulated oligonucleotide into the vitreous and the retina - choroid. controlled release of [33p ] pdt16 from liposomes also inhibited unwanted distribution of oligonucleotide in the nontargeted tissues (sclera, lens) and thus reduced overall ocular toxicity. reported cationic liposomes as nonviral gene carriers which were complexed with therapeutic dna, called lipoplexes (lpxs). the authors investigated the factors responsible for inefficient vitreous diffusion of nonviral gene complexes and addressed the problems to overcome vitreous barrier for lipoplexes. fitc - dextran, fluorescent polystyrene nanospheres as models for lpxs and lpxs were mixed with vitreous gel obtained from bovine eyes, and their mobility in vitreous was studied by fluorescence recovery after photobleaching (frap) technique. polystyrene nanospheres can bind to collagen fibers within the vitreous due to hydrophobic interactions resulting in restricted mobility in the vitreous. to overcome this problem, hydrophilic polyethylene glycol (peg) chains were grafted on the surface of nanoparticles that had prevented adsorption to the collagen fibers and thus increased their mobility in the vitreous. they reported that the size of the nanospheres should be less than 500 nm to obtain good vitreous mobility ; otherwise it would be sterically hindered by vitreous network and spread nonhomogeneously throughout the vitreous resulting in accumulation near the injection site. nonpegylated cationic liposomes aggregated in the vitreous as negatively charged glycosaminoglycans (gags) strongly bind to the cationic lipoplexes, which neutralize positive zeta potential of lipoplexes, and thus favor aggregation. low to moderate pegylation (1.9 mol% dspe - peg to 9.1 mol% dspe - peg) on cationic lipoplexes prevented their aggregation but, binding to biopolymers in the vitreous still occurred. further increase of dspe - peg to 16.7 mol% prevented both vitreous aggregation as well as binding to vitreous fibrils, resulting in homogeneous vitreous distribution and vitreous mobility. the size and zeta potential of pegylated lpxs decreased with increasing the amount of pegylated lipids (dspe - peg) in lpxs. the data on mobility, aggregation, and stability of lipoplexes opened up a new direction to nonviral ocular gene therapy, but some factors need to take into consideration. here transport of drugs in vitreous was assumed by diffusion mechanism only but in case of larger animal species like humans drug transport through convection plays a significant role. cortical vitreous zone containing densely packed collagen and inner limiting lamina may produce additional barriers to the diffusion of lpxs into the retina. gupta. evaluated fluconazole - encapsulated liposomes which were administered intravitreally in rabbit eyes. entrapping of fluconazole into liposomes significantly slowed down clearance of free fluconazole after intravitreal injection and thereby achieved higher fluconazole concentration in the vitreous. the liposomes showed longer half - life (23.40 h) in comparison to free fluconazole (3.08 h). among all these investigations performed by numerous researchers, approach of entrapping bevacizumab will be advantageous for designing controlled release system for therapeutic macromolecules. another approach of using sterically stabilized liposomes for oligonucleotide delivery can be further explored for resolving the challenges in ocular gene therapy. this approach will be advantageous in minimizing the intravitreal clearance of liposomes and distribution of oligonucleotide in the non - targeted tissues. subconjunctival mode of administration has gained new momentum in delivering the drugs to both the anterior and posterior segments. subconjunctival injection of liposomes can provide retentive effect and steady - state release at the site of application. therefore, higher drug concentrations can be achieved at the target site. in addition, subconjunctival injection is better in comparison to topical application as it can improve patience compliance by avoiding repeated administrations and provide direct access of the drug to the target site [80, 81 ]. absorption rate of liposome - bound low molecular weight heparin (lmwh) was investigated after subconjunctival injection in the treatment of subconjunctival hemorrhage (sh) in rabbits. low concentration of liposome - bound lmwh was observed as compared to the free lmwh in the intraocular regions (aqueous and vitreous). 550 nm in size), liposomes remained at the site of injection and avoided lymphatic drainage. also, positively charged liposomes encapsulated higher amounts of lmwh and released the drug in a sustained manner, thus providing longer residence time and increased concentration at the targeted site. thus, subconjunctival application of liposomes is a possible strategy to avoid systemic side effects of lmwh. in a similar study, baek. attempted subconjunctival administration of streptokinase- (sk-) loaded liposomes for the treatment of sh in rabbits. the study reported that 81% of the drug was released in 48 h. higher absorption efficiency of liposomes in comparison to free drug was observed. sk - encapsulated liposomes in the early phase of sh need to be assessed. fukushima. reported clodronate liposomes (cl2mdp - lip), which were used to inhibit infiltration of macrophages in the conjunctiva in the case of blepharo conjunctivitis (ec) developed in brown norway rats. they found that cl2mdp - lip effectively decreased the number of ed2-positive macrophages in the conjunctivas, where ed1-positive macrophages infiltration could only be controlled if the injection was administered just prior to ova challenge. limited investigations on subconjunctival delivery of liposomes were performed in the last decade. however, approach of utilizing liposomes of size greater than 550 nm can be explored in future for long - term delivery by minimizing the systemic clearance of liposomes through conjunctival capillaries. it would be interesting to investigate the subconjunctival clearance of liposomes of various sizes. these carriers have successfully improved the drug bioavailability by controlled and targeted delivery. in the case of topical application improvement in the precorneal retention, transcorneal permeation, and therapeutic efficacy in addition, effects of charge and composition of liposomes were explored in detail, which have provided comprehensive understanding of the interaction between liposome and ocular tissues. the applications of chitosan and hydrogel for improving the precorneal retention of liposomes were explored and shown potential for further investigation. liposomal formulations have been evaluated for encapsulation of various drug molecules of different therapeutic classes. in particular, liposomal formulation of small molecules for the treatment of bacterial conjunctivitis and glaucoma was developed. moreover, posterior segment delivery of liposomes was proven successful in enhancing the intravitreal half - life and targeted delivery to the inner retinal cells. in the case of posterior segment disorders liposomal formulation of therapeutic macromolecules was examined. however, research on targeted delivery of liposomes was limited. receptors expressed on the cornea and retina could be explored in future for targeted drug delivery utilizing surface - modified liposomes. | liposomal formulations were significantly explored over the last decade for the ophthalmic drug delivery applications. these formulations are mainly composed of phosphatidylcholine (pc) and other constituents such as cholesterol and lipid - conjugated hydrophilic polymers. liposomes are biodegradable and biocompatible in nature. current approaches for topical delivery of liposomes are focused on improving the corneal adhesion and permeation by incorporating various bioadhesive and penetration enhancing polymers. in the case of posterior segment disorders improvement in intravitreal half life and targeted drug delivery to the retina is achieved by liposomes. in this paper we have attempted to summarize the applications of liposomes in the field of ophthalmic drug delivery by citing numerous investigators over the last decade. |
since 2010, copd has been the third leading cause of death.1 copd is a progressive, destructive disease of the airways and lung parenchyma, with no clear pathological or clinical starting points. its prevalence and consequent burden is expected to rise with rapidly increasing smoking rates in developing countries.2 overall, the prevalence of copd in the general population is estimated to be about 1% across all ages, rising steeply to 8%10% or higher in individuals 40 years or older.3 the copd prevalence, using an estimation model, varies twofold between 12 asian countries, ranging from 3.5% to 6.7%, with thailand between the two extremes at 5.0%.4 in northern thailand, hospital - based copd patients are mostly in advanced stages and are undertreated;5 however, there are no community - based studies of copd prevalence, disease severity, and management. the objectives of this study were to compare the prevalence, clinical characteristics, disease severity, previous physician diagnosis, and management of copd between urban and rural communities in chiang mai province, thailand. a cross - sectional population - based study was designed to compare copd prevalence in adults over 40 years living in municipal areas of chiang mai (urban community) vs the chiang dao district (rural community), chiang mai province, thailand, between 2008 and 2010. the sample size was calculated using registered populations, with a total of 60,000 (urban) and 22,000 (rural) adults. a minimal sample size of 398 was determined using slovin s formula6 with a 95% confidence interval (ci) (accepted a type 1 error rate of 0.05). we anticipated that 60% of available subjects would be unable to participate or would decline participation, so we planned to enroll approximately 636 subjects (318 subjects for each community). selection of the community areas in each group was performed by random - route methodology. the chosen areas were then divided into several blocks based on geographical area and numbers of street, and systematic sampling of households within these randomized blocks was conducted. every third house within each block was selected, and only one patient was interviewed per household. each patient participated in a face - to - face interview, using a previously validated respiratory health questionnaire adapted from the european community respiratory health survey (ecrhs),7 administered by a trained interviewer, for information on general health, chronic respiratory symptoms, and previous physician - diagnosed respiratory diseases. three levels of economic status were assigned based on annual household income : low (70,000 baht), moderate (70,001195,749 baht), and high (195,750 baht).8 in addition, history of biomass fuel exposure, as hour - years, and occupation were also recorded for each participant.9 at the onset of the study, all subjects were invited to the administrative office at selected hospitals located in each community for a face - to - face interview (to confirm their information) and for a physical exam by a pulmonologist from the study team. every enrolled subject received a chest radiograph, and post - bronchodilator (bd) spirometry using the same instrument (spirobank ; medical international research s.r.l. standard chest radiograph and the standard american thoracic society / european respiratory society post - bd spirometry10 results were further used for interpretation of study results, by a radiologist and pulmonologists, respectively, in the study team. the spirometric values, recorded as % predicted, were calculated using national health and nutrition examination survey (nhanes) iii reference equations.11 a correction factor of 0.88 was applied to the forced vital capacity (fvc) and forced expiratory volume in first second (fev1) predicted, to correct for variations between european and asian races.12 subjects with current unstable psychiatric illness, alcoholic addiction, severe systemic comorbidity (homebound or hospitalized subjects), and an inability to perform spirometry were excluded from this study. all data, including age, sex, body mass index (bmi), smoking history, biomass fuel exposure, socioeconomic status, occupation, respiratory symptoms, previous medical history, and prior diagnosis of respiratory diseases, general physical examination, and chest radiographic findings interpreted by a radiologist, were evaluated. the copd subjects were diagnosed by detection of airflow obstruction, based on a fixed threshold criterion (a ratio of post - bd fev1/fvc less than 0.7),13 and normal or abnormal chest radiographs compatible with the disease (the presence of diffuse pulmonary hyperinflation with flattened diaphragms). the copd subjects were further interviewed by a pulmonologist in the study team for history of previous spirometry test, previous physician diagnosis, and treatment with inhaled long acting bronchodilators + / inhaled corticosteroid and/or participation in an exercise training program within the past year. this study was approved by the ethics committee of the faculty of medicine, chiang mai university. results for numerical values were expressed as mean sd, and those for categorical data were expressed as absolute frequencies and percentages. unpaired t - test and chi - square were used to compare differences between the groups for numerical values and categorical data, respectively. disease prevalence between the groups was compared using risk regression analysis to account for age, sex, and smoking status. results for numerical values were expressed as mean sd, and those for categorical data were expressed as absolute frequencies and percentages. unpaired t - test and chi - square were used to compare differences between the groups for numerical values and categorical data, respectively. disease prevalence between the groups was compared using risk regression analysis to account for age, sex, and smoking status. a total of 1,508 subjects (888 from urban areas and 620 from rural areas) were initially screened by face - to - face interview for this study, resulting in 1,003 who were expected to undergo further investigations at the hospitals. on the appointed dates, the subjects with spirograms that met acceptability criteria (574 [urban ] and 293 [rural ]) were analyzed. the demographic data of the excluded subjects in each group was not significantly different from those of the analyzed subjects. there was no statistically significant difference in the mean age of subjects between the two groups (52.910.2 years vs 56.611.6 years, respectively) (p=0.065), but the rural group had more elderly subjects (age > 60 years) (p 5 pack - years (p 5 pack - years) subjects were also not significantly different (9.6% vs 13.4% [p=0.342 ] and 11.2% vs 10.8% [p=0.913 ], respectively). the characteristics of copd patients between the two groups were not significantly different in terms of the means age of subjects, smoking status, smoking pack - years, chest radiograph findings, previous physician diagnosis, and treatment of copd (table 3). however, the copd subjects in the rural group were significantly more underweight (p=0.002) and had a longer duration of smoking (p=0.015). there were significant differences between the groups in terms of education, occupation, and economic status (p<0.05). there was no significant difference between the groups in term of exposure to biomass fuel smoke (p=0.630). they were clinically diagnosed as copd by their physicians. the pulmonary function test results (fvc, fev1, % predicted fvc, % predicted fev1, and ratio of fev1/fvc) of copd subjects in the rural group tended to be lower than those in the urban group, but the difference did not reach a statistically significant level. most rural copd subjects were clinically more severe by global initiative for chronic obstructive lung disease (gold) classification than those in the urban group (gold iii iv : 65.0% vs 33.3%) ; however there was no statistically significant difference (p=0.146). large percentages of copd subjects from both groups had never been diagnosed (80.0% [rural ] vs 76.2% [urban ]) or treated for copd by physicians (85.0% [rural ] vs 80.9% [urban ]). this is the first community - based epidemiological study of copd burden comparing urban and rural communities in thailand. the prevalence of copd is difficult to evaluate because of low awareness of the disease, underdiagnosis, variability within age groups, and discrepancies in study methodologies.14,15 our findings have demonstrated the benefit of spirometric screening of copd16 using the post - bd fixed ratio of fev1/fvc < 0.7 as a discriminating criterion. the copd prevalence in people aged more than 40 years were 3.7% and 6.8%, respectively, in urban and rural communities, which is similar to previously reported findings from throughout asia4,17 our study prevalence was also lower than that from european countries using the same criteria, as has been reported elsewhere.1821 smoking has been identified as the major cause of copd.13 the prevalence of copd in general, and particularly in females in the rural group tended to be higher than that in the urban group and was expected because historically, as previously reported, about half (51.5%) of females living in rural communities in thailand are smokers.22 however, after adjustment for confounding factors (age, sex, and smoking status), no significant differences were demonstrated. further, 60.1% of rural patients in this study were underweight (bmi < 18.5 kg / m), and this is similar to results reported in our previous study.5 the rural and urban groups had equally low exposure to biomass fuel smoke (41.012.4 vs 31.78.8 hour - years, respectively) (p=0.649). a previous study revealed that the risk of chronic bronchitis increased with exposure to more than 100 hour - years.9 all copd subjects in the rural group were chronic smokers with no other known risk factors for airflow obstruction, whereas four (19%) subjects in the urban group were nonsmokers. the four nonsmoking - related copd subjects in the urban group were further investigated at the hospital and diagnosed as asthmatics with fixed airflow obstruction (two), bronchiectasis (one), and post - pulmonary tuberculous bronchiectasis (one) by pulmonologists. the majority of the copd subjects in this study (28/41 [68.3% ]) were more than 60 years, and their prevalence (13.4% and 9.6% in the rural and urban groups, respectively) was much higher than the prevalence of all population. these findings were similar to those of previous epidemiological studies, where the proportion of copd sufferers showed an incremental increase in prevalence with increasing age and reached a peak in those over 60 years.1620 a higher prevalence of copd was also shown to be associated with sex (male), age (older), and smoking pack - years. only 12.2% of the copd subjects in the two communities (14.3% [urban ] and 20.0% [rural ]) were classified as mild (gold i). these rates are contrary to the findings of a large epidemiological study from spain, in which 84.4% of the cases identified had mild disease.18 although the pulmonary function between the two copd groups were comparable, mild to moderate copd (gold i and ii) severity was mostly found in the urban group (66.7%), whereas 65% of copd subjects in the rural group were at severe to very severe stages (gold iii and iv). the rates of previously underdiagnosed copd in both groups were equally high (76.2% [urban ] and 80.0% [rural ], respectively) and were similar to the rates reported in developed countries.18,21 no subjects diagnosed as copd from either group in this study had ever been evaluated by spirometry, with the copd diagnosis being made by presumptive diagnosis based on signs and symptoms. the underdiagnosis of this disease in real - world practices worldwide could be due to the cryptic nature of the disease and the underuse of spirometry. because of underdiagnosis in most of the copd subjects, standard pharmacological treatment and exercise training programs, as recommended by gold guidelines, were inaccessible to the majority.13 improvements in diagnosis and the treatment of copd, as well as in awareness of copd risks, should be raised in thailand. treatment and prevention programs, in both urban and rural communities, should be implemented to reduce the prevalence, morbidity, and mortality associated with copd. the strengths of this study were firstly, the inclusion of chest radiographs in the preferential diagnosis of copd, which excluded other obstructive pulmonary diseases (eg, pulmonary tuberculosis and chronic destroyed lung), as well as the inclusion of post - bd spirometry diagnosis, as recommended by gold guidelines.13,23 use of post - rather than pre - bd data alone can lower the estimated prevalence of copd by 30%50%.2326 secondly, we used the same instrument and the same qualified technician to evaluate patients in both groups, using methods that have been adopted as standard for comparing copd prevalence across the globe. firstly, the difference in prevalence based on sex and region was altered by confounding factors, such as socioeconomic status, occupation, and education level, which were not addressed. secondly, the numbers of copd subjects from both groups were too small to assess the differences between them, if one existed. this might be a confounder because comorbidities are commonly reported with copd.27 although the reasons for subject nonparticipation were not fully evaluated, a self - selection bias could lead to over- or underestimation of copd prevalence. fourthly, our findings were based on data from a single province only and might not be reliably generalized to other regions of thailand. moreover, the subjects in both groups lived in communities with convenient transportation therefore, the data might not be representative of copd subjects living in wilderness communities. the prevalence of copd in general, particularly in females, tended to be higher in the rural community with a higher level of disease severity. | backgroundcopd prevalence and consequent burden are expected to rapidly increase worldwide. until now, there has been no community - based study of copd in thailand.purposewe aimed to compare the prevalence, clinical characteristics, disease severity, previous diagnosis, and management of copd between urban and rural communities.materials and methodsa population - based cross - sectional study was designed to compare copd prevalence and burden in rural and urban communities in chiang mai province, thailand. the copd subjects were diagnosed and severity categories assigned using global initiative for chronic obstructive lung disease (gold) criteria. the prevalence between the groups was compared using risk regression analysis. unpaired t - test and chi - square were used to compare differences between the groups.resultsthere were 574 and 293 enrolled subjects with acceptable spirometry, in rural and urban communities respectively. the prevalence of copd in general and copd in females was higher in the rural group (6.8% vs 3.7% and 4.4% vs 0.9%, respectively) across all independent variables. however, after adjustment for age, sex, and smoking status, no significant differences were demonstrated. although the pulmonary function and disease severity between the two groups were not significantly different, the tendency was more pronounced in the rural group (copd stage iii iv : 65.0% vs 33.3%). most of the copd patients in both groups were underdiagnosed (80.0% vs 77.2%) and undertreated (85.0% vs 81.9%). none of the patients in the study had participated in exercise training programs.conclusionthe prevalence of copd in general and particularly copd in females tended to be higher, with more severe disease in the rural community. however, both groups were similarly underdiagnosed and undertreated. |
previously, we provided evidence that the behavior of viruses can be predicted from the analysis of their predicted intrinsic disorder in their protein shells, more specifically, by looking at the peculiarities of disorder distribution in their matrix and capsid proteins [13 ]. for example, the predicted disorder in the matrix of retroviruses was shown to vary with the mode of the viral transmission. the hiv and eiav viruses, that are related but have distinctly different modes of transmission, were used to illustrate this point since. hiv is largely transmitted sexually, whereas eiav is transmitted by a blood - sucking horsefly. it has been observed that the abundance of predicted intrinsic disorder (pid) in the hiv and eiav matrix proteins was very different, with the hiv proteins being highly disordered, especially hiv-1. an explanation for this has to do with the need for a more rigid encasement in viruses that are not sexually transmitted, so as to protect the virion from harsher environmental factors. further development of a model that could predict how a virus will behave in terms of transmission would be extremely useful for both clinical and fundamental research. such a model will also provide a tool to assist the implementation of public health policies for handling old and newly emerging pathogenic viruses. this paper extends the line of research on protein intrinsic disorder in viral proteins to coronaviruses (cov), which have caught the attention of the scientific community because of the sudden appearance of the lethal virus causing severe acute respiratory syndrome, the sars - cov [4, 5 ]. clinical, structural, and epidemiological data are available for sars - cov and its animal cousins, which remain to be a serious threat to farming communities [4, 610 ]. one goal of this research is to use of the concept of protein intrinsic disorder to shed light on behaviors of coronaviruses by creating a predictive model, which could provide insight into the differences between the transmission behavior of animal and human coronaviruses and also classify the various animal coronaviruses by their spread behavior. in this way, greater understanding of the viral evolution based on its hosts and its environment can be achieved along with the better understanding of the structural mechanisms involved in such adaptive evolution. for a long time greater attention was given to this family of viruses when the sars - cov moved into human hosts beginning in 2002 and inflicted 1091 deaths [11, 12 ]. during the outbreak of sars - cov, greater understanding of the peculiarities of the transmission mode(s) would have enabled better decisions to control the spread of this ominous virus. however, as of today, complete understanding of the molecular mechanisms determining the transmission behavior of the virus remains elusive. for example, there is no satisfactory explanation for the observation that many of those infected with sars - cov did not have any contact with the infected individuals. while sars - cov had been observed to spread among human most easily by respiratory means, the sars - cov was also observed to be not as infectious as influenza (http://www.who.int/csr/sars/sarsfaq/en/). it is likely that sars - cov, like most animal coronaviruses, spreads most efficiently by contact or by oral - fecal routes among animals. several human coronaviruses (hcov) such as 229e, oc43, hku1, and nl63 have been known for some time [15, 16 ], with hcov-229e being the most studied hcov. comparison between the spread mechanisms of hcov and animal coronaviruses such as sars - cov has been made. using hcov-229e as a representative virus, it has been shown that hcov tends to spread more efficiently by a respiratory route, whereas the animal covs tend to spread most efficiently by direct contact. furthermore, gastroenteritis is a common disease provoked by coronaviruses, and oral - fecal route is also common mode of transmission, especially among animal hosts. therefore, in contrast to human, contact and oral - fecal routes are generally the most efficient mode of cov spread in animals [15, 17, 18 ]. in order to introduce the two structural proteins investigated in this paper, a quick overview of virus structure needs to be put forth. proteins near or at the surface of the coronavirus include the spike protein (s, 150 kd), the hemagglutinin - esterase protein (he, 65 kd), membrane / matrix glycoprotein (m, 25 kda), and the small envelope glycoprotein (e, 912 kd). a protein that is closer to the rna is the nucleocapsid protein (n, 60 kd). they are all likely to play roles in protecting the virions [1, 2, 19, 20 ]. since the m glycoproteins are the most abundant structural proteins in the coronavirus, they are likely to play a greater role in protecting the virion from damage. the m - protein is a triple - spanning transmembrane protein and has a short aminoterminal ectodomain. other than its protective function, m - protein also plays a role in the capsid self - assembly and serves as a major determinant of the virion morphogenesis via selecting the s protein for incorporation into virions during viral assembly. another protein of interest to this paper is the n - protein [5, 12 ]. while many of its functions remain unknown, it is likely that the n - protein is involved in packaging and protecting the viral rna and also plays a role in viral replication participating in transcription [7, 8 ]. although human coronaviruses, with the exception of sars - cov, are generally mild, their animal cousins (e.g., the avian, porcine, and bovine coronaviruses) are often devastating to the farming industry. in fact, an outbreak could be costly in terms of the livestock loss [10, 21 ]. coronaviruses are generally classified into three groups based on their genetic and antigenic makeup [12, 16 ]. the sar - cov did not fit into any of the current three groups but did have some resemblance to group 2. for this reason, sars - cov fell into a new category, group 2b. previously, we showed that the similarity in protein intrinsic disorder prediction does not necessarily reflect the genetic proximity of proteins studied, but rather could be related to the evolution, the modes of transmission, and the environment that the virus lives in [1, 2 ]. therefore, the categorization of coronaviruses based on the intrinsic disorder propensities of their proteins might provide important clues for useful hypotheses, especially when intrinsic disorder of the similar proteins is considered across coronaviruses, serotypes, or subtypes. intrinsically disordered proteins have also been described by various other names such as intrinsically unstructured and natively unfolded [23, 24 ]. the generality of the intrinsic disorder concept emerged from the occasional observations of exceptions to the structure - to - function paradigm according to which unique protein structures are necessary for specific protein functions. comparison of ordered and disordered proteins revealed that there is a noticeable difference between the amino acid sequences of ordered and intrinsically disordered proteins and that disordered proteins / regions share at least some common sequence features over many proteins [24, 2628 ]. in fact, the disordered proteins / regions were shown to be significantly depleted in bulky hydrophobic (ile, leu, and val) and aromatic amino acid residues (trp, tyr, and phe), which would normally form the hydrophobic core of a folded globular protein, and also possess low content of cys and asn residues. the depletion of disordered protein in cys is also crucial as this amino acid residue is known to have a significant contribution to the protein conformation stability via the disulfide bond formation or being involved in coordination of different prosthetic groups. these depleted residues, trp, tyr, phe, ile, leu, val, cys, and asn, were proposed to be called order - promoting amino acids. on the other hand, i d proteins were shown to be substantially enriched in ala, polar, disorder - promoting amino acids : arg, gly, gln, ser, glu, and lys and also in the hydrophobic, but structure - breaking pro [2731 ]. development of such predictors provided a direct support for the hypothesis that intrinsic disorder is encoded in protein amino acid sequences. these features made intrinsically disordered proteins / regions recognizable and were used to develop specific predictors of intrinsic disorder. currently, design of algorithms for finding regions lacking ordered structure is a very active area of research, and more than 50 predictors of disorder have been developed. the predictor used in this paper is pondr vlxt (predictors of naturally disordered regions), which is a set of neural network predictors of disordered regions on the basis of local amino acid composition, flexibility, hydropathy, and other factors [3336 ]. these predictors classify each residue within a sequence as either ordered or disordered. since pondr vlxt is sensitive to local sequence peculiarities, it is frequently used for identifying functionally important sites within the disordered regions. figure 1 represents a graphical comparison of the percent of intrinsic disorder (pid) of the m- and n - proteins of coronaviruses with that of the influenza a virus and the matrix and nucleocapsid proteins of rna viruses in general. the mean pids of matrix and nucleocapsid proteins of the influenza a virus and coronaviruses provide an interesting contrast since both viruses have similarities and dissimilarities. for example, the amounts of disorder in the n - proteins of both viruses are rather similar, whereas the m - proteins of coronaviruses are predicted to be more ordered. since the major function of m - proteins is to protect the virion, it is tempting to hypothesize that these differences in the overall disorder of m - proteins can be related to the need to protect viruses from different environments, and therefore can reflect differences in the viral transmission mode. we know, for example, that both viruses are often spread via droplet transmission, but animal coronaviruses are often more associated with oral - fecal transmission routes. a more detailed comparison between the pid in m- and n - proteins of the hcovs and those of animal coronaviruses in terms of predicted disorder is shown in figure 2. figure 2 shows that the n - protein of the avian coronavirus, ibv, is characterized by the highest pid level. the high pid variance (standard deviation) of the hcov m- and n - proteins should be also noted. both features likely hint to a higher respiratory spread component. while figure 2 allows us to compare human coronaviruses (hcov) with nonhuman ones in general, figure 3 breaks down the data of animal coronaviruses further by animal hosts. we are able to see differences in pid of both matrix and nucleocapsid proteins of viruses by the various animal host species. figure 4 provides an overview of the mean pids in the m- and n - proteins of various animal coronaviruses by species of the hosts and by the type of virus. for instance, in comparison with its porcine counterparts, bovine coronaviruses tend to have higher pids in their n - proteins. the important note here is that the pids of the n - proteins for all these animal coronaviruses are below 50%, unlike human or avian coronaviruses. table 2 provides numerical pid values for the n- and m - proteins of various porcine strains shown in figure 4. a close examination of these data revealed that the particular strains may be quite different from each other by the amount of intrinsic disorder they possess in their n- and m - proteins. an illustrative example is the remarkable differences in the pids of the n - proteins from tegv and pedv. here, the cv777 strain of the pedv has lower disorder levels in its matrix protein than that of the br1/87 strain (8% versus 13%). using sars - cov as a reference point, we could clearly see that each strain of the virus is characterized by a unique pid signature. for example, tgev is characterized by the relatively low pid score for its n - protein (~43%), whereas its m - protein has a somewhat higher pid (~14%) especially when compared to certain strains of pedv (~8%). a breakdown of the hcov pids by strains is shown in figure 5 which shows the unusually high and low pids for the m- and n - proteins of the hcovs 229e and hku1. the noticeable differences in the pid values of hcov 229e and sars - cov should also be noted. some hcov strains were studied clinically and the peculiarities of their transmission modes are listed in table 1. the hcov-229e has been studied more extensively than other human coronaviruses and has been shown to spread by respiratory modes more easily. the results shown in figure 5 illustrate that, in general, the n- and m - proteins of human coronaviruses tend to be more disordered than those of the animal coronaviruses (cf. figures 13). figure 5 also shows that both matrix and nucleocapsid proteins of the hcov-229e are exceptionally disordered. figure 5 also illustrates an important point that not all hcov strains have the same characteristics as 299e and there is great variability in the pids of the matrix and nucleocapsid proteins of hcovs. for example, the predicted disorder in hku1 for some reason resembles the mean pids we would normally find in the animal coronaviruses. the patterns of predicted disorder seen in figures 15 allowed us to regroup the various coronaviruses by their pid levels. it could be seen that although the new grouping of covs shown in table 3 is based on the disorder analysis of the viral shells, and in particular their n - proteins, the grouping seems to reflect how the viruses spread. in other words, a correlation between common transmission behavior and the disorder characteristics of the viruses in each group can be observed. we see, for example, that based on their pid analysis, the canine respiratory coronavirus falls in category b, which contains viruses with moderate levels of respiratory and fecal - oral components. its less disordered enteric counterpart falls into category c, which has greater fecal - oral component and less respiratory component. therefore, data shown in table 3 can be used for the prediction of the levels of respiratory and oral - fecal transmission modes for each virus in a group based on the pids of their m- and n - proteins. for example, we can conclude that viruses in group a will have greater respiratory component than those in group b or c. manova analysis reveals statistically significant influence of the pids of both n and m proteins on the transmission behaviour of coronaviruses (p < 0.05 for each variable, f = 16.3, p < 0.05). furthermore, because of the statistical significances of the model and its variables, the three groups should be easily identifiable via the analysis of the pid levels of the corresponding m and n proteins. however, any correlation between pids of the two proteins is not statistically significant (manova, p = 0.15). an interesting note is that not all the viruses in the category c have low pid levels of their m - proteins, even if their n - proteins are characterized by low predicted disorder. while the figures and tables above show the differences in mean pid levels between different cov proteins, figure 6 visualizes the differences in the predicted disorder levels by comparing the 3d structures of parts of the n - proteins of sars - cov and ibv. large disordered regions (shown in red) can be seen in the ibv nucleocapsid, whereas the sars - cov nucleocapsid possesses much smaller amount of disordered regions. a rough disorder analysis revealed that the pid of the sars - cov nucleocapsid is 50%, whereas in the case of ibv nucleocapsid, the mean pid is of 56%. data shown in figure 1 suggest that the protective functions of the viral surface proteins can be seen from the results of protein disorder predictions. in fact, there is a correlation between the pid levels and the localization of surface proteins, with proteins located closer to the virion surface being generally more rigid than other surface proteins (e.g., in coronaviruses, nucleocapsid proteins possess noticeably higher pid than the matrix proteins). generally, the stepwise decrease in the pids is seen for all viral nucleocapsid, capsid, and matrix proteins analyzed so far. figure 1 shows that there are similarities and dissimilarities between the pid levels in the influenza and coronavirus shell proteins. disorder peculiarities can be potentially mapped to the transmission behavior and the nature of the viruses. it can be seen that in comparison with other viruses, the coronaviruses possess a tendency to be more ordered at the level of the matrix proteins, but their nucleocapsid proteins are generally more disordered than nucleocapsid proteins rna viruses in general. the fact that both influenza viruses and coronaviruses have high predicted disorder in their nucleocapsid proteins suggests that higher nucleocapsid disorder may be necessary for viruses with ability to spread via respiratory means. further support for this hypothesis will be presented below as we inspect and categorize the various coronaviruses. past analysis showed that many viruses that spread by respiratory modes are characterized by disordered shell proteins. viral shell proteins constitute the protective proteinaceous layer which is needed for virus to survive during its transmission between the hosts. figure 1 shows that the mean pid levels of m - proteins in coronaviruses are strikingly lower than those of influenza a. on the other hand, coronaviruses are often transmitted via the oral - fecal and fecal - contact modes [10, 13, 15, 18 ], whereas the major transmission mechanism of the influenza viruses is the respiratory mode. based on these and similar observations we hypothesize that there is a correlation between the pid levels in the viral shell proteins and the virus transmission modes. while higher levels of disorder in shell proteins are likely to be associated with greater probability of respiratory transmission, lower pid levels in the nucleocapsid and matrix proteins are conversely often associated with increased levels of fecal - oral transmission mode. these correlations can be due to the need of a given virus to adjust to the changes in the environmental conditions associated with the process of transmission between the hosts. obviously, the environmental conditions associated with the respiratory transmission are less harsh than those seeing in the fecal - oral transmission mode. however, the viruses that are spread via the respiratory mode might experience greater environmental pressure during transmission and they have to be able to adjust to a greater range of environmental changes to survive and to be successfully transmitted. this ability of the respiratory transmitted viruses to adjust and survive in a wide range of conditions can be due to the higher levels of intrinsic disorder in their shell proteins. in other words, shell proteins of these viruses are assembled into a flexible shield, the pliability of which helps viruses to rapidly adjust to the environmental changes. table 3 supports this hypothesis by showing that for several viruses analyzed, there is a noticeable correlation between the level of disorder in the shell proteins and the transmission mode. marked differences in disorder of shell proteins were predicted among human, avian, and other animal coronaviruses. there are also noticeable differences in the disorder propensities among the coronaviruses infecting different animal (figures 26, table 2). for example, the pid levels in the matrix and nucleocapsid proteins of the porcine and canine coronaviruses are generally lower than those of the bovine counterparts (figure 3). a plausible explanation lies in the nature of the hosts of the various viruses and in the mode of the virus transmission. furthermore, since the habits and diets of the various animals can also contribute to the tendency of them to be exposed to fecal material, that are crucial factors determining the peculiarities of the virus transmission. both the porcine and canine coronaviruses have greater fecal - oral components, whereas the bovine coronaviruses are more efficiently transmitted via the respiratory routes. all these factors are apparently more definitive determinants of the intrinsic disorder levels in the viral shell proteins than the genetic proximities and the categorization of the viruses seen in table 1. some variations in the levels of predicted intrinsic disorder might depend not only on the transmission mode but also on the nature of organ affected by the virus during infection. figure 4 shows that the canine respiratory coronavirus (that affects the respiratory tract) has higher pid levels than the canine enteric coronavirus (preferentially affecting intestines). similar patterns can also be seen among the porcine coronaviruses (see table 3). the transmissible gastroenteritis coronavirus (tgev) and porcine epidemic diarrhea virus (pedv) have similar modes of transmission. although they are preferentially passed on via the oral mode, both viruses can be transmitted through the lungs too [17, 18 ], with the pedv being generally less efficiently transmitted. a puzzling aspect of the pedv is that this virus has the ability to reemerge to infect hosts months after the breeding areas have been cleaned. this suggests that pedv is perhaps more persistent in the environment outside the host organism. as it will be seen from the next paragraphs, our analysis suggested that intrinsic disorder can produce useful information for better understanding of the viral behavior. tables 2 - 3 show that the level of predicted disorder in the tgev n - protein is noticeably lower than that of the pedv analogue, and that at least one pedv strain has a noticeably lower pid in its m - protein (table 2). based on the fact that the m - protein of pedv possesses the greater rigidity we hypothesize that some strains of pedv are likely to be more persistent outside the physiological environments when compared to tgev. this hypothesis is also consistent with the observed pedv ability to survive in the harsh nonphysiological environment (outside the host), to sustain the disinfection of the pig pens and infect new hosts many months after the first infection. our analysis also suggests that the observed intrinsic disorder propensities of the pedv shell proteins may be related to the way of how the virus spreads between hosts. because of the higher levels of intrinsic disorder predicted in the n - protein by pondr vlxt, it is expected that there is a relatively large respiratory component in the pedv transmission (see table 3). on the other hand, tgev spreads more easily since contact and oral - fecal modes are the more advantageous forms of transmission among swine [17, 18 ]. the comparison of the pid levels in the m- and n - proteins suggests that various coronaviruses can be grouped as shown in table 3. an important result of this analysis is the conclusion that in terms of the intrinsic disorder in m- and n - proteins of various coronaviruses, the closest neighbor of the sars - cov is pedv. the structural disorder similarity suggests that the behaviors of these two viruses might also be similar, insights that were not previously noticed. it should be noted, however, that there are some strains of the animal coronaviruses that could be used as counterexamples of the categorization shown in table 3. one of such case is porcine respiratory coronavirus (prcv), which is a mild variant of the transmissible gastroenteritis coronavirus (tgev) that has been observed to transmit predominantly by respiratory means and can scarcely be detected in feces or small intestines [4, 10 ]. the prcv transmission behavior was explained by the specific changes in the viral spike (s protein) which defined the ability of this protein to interact with specialized cells in the respiratory tract, and not with the receptors found in cells from the gastrointestinal region. since prcv and tgev have virtually identical levels of predicted disorder in their m- and n - proteins, both of them should be assigned to the category c, that is, to the class of coronaviruses that are spread mostly via the fecal - oral and contact modes. therefore, prcv that relies on the respiratory transmission mode may be inept by evolution. this potential evolutionary misfit may also explain why the symptoms resulting from the prcv infection are generally mild and why prcv is a vaccine strain. the observation may also suggest a new vaccine search strategy based on the recognition of viruses or strains that are evolutionary misfits. data shown in figures 15 and table 3 can be used for the comparison of the human matrix and nucleocapsid proteins with the corresponding proteins from the nonhuman coronaviruses. a striking feature is the presence of large pid variability for both the m and n of human coronaviruses especially when compared to those of nonhuman animal coronaviruses. furthermore, many of the hcovs are characterized by the relatively high levels of predicted disorder in their n and m proteins (see table 3 and figure 5). since our analysis revealed that higher pid levels in one or both of the capsid proteins typically correspond to the coronaviruses with greater respiratory transmission component, the high disorder levels seen for both m- and n - proteins may indicate that many hcovs are more easily spread by respiratory means, an important hypothesis which is in agreement with the clinically and experimentally observed transmission behavior of hcovs. figures 26 and table 3 show that nucleocapsid of the avian coronavirus (ibv) is characterized by the high predicted disorder levels. the only virus that possesses the comparable level of disorder is the human coronavirus 229e (figures 35). however, hcov-229e and ibv - cov have some differences too. in hcov-229e, both m- and n - proteins are disordered, whereas in ibv - cov, the nucleocapsid is more disordered but the pid of the m is only slightly above average. this implies that although ibv - cov and some hcov are likely to be highly infectious mostly via the respiratory transmission, the ibv virus could also be present in the gastrointestinal region, and larger quantity of this virus can be found in stools. previous studies revealed that predicted intrinsic disorder in the matrix and surface proteins of other avian viruses is often associated with the peculiarities of their evasion of immune system [1, 2, 38 ]. here, the ability of the viruses to evade the immune systems may allow them to be spread between the different host species. another reason for the high disorder in the avian influenza nucleocapsid is related to its predominant transmission via the respiratory modes. comparison of the pid values in n- and m - proteins of these two viruses showed that despite the comparable disorder levels at the nucleocapsid, the m - protein of ibv - civ is predicted to be relatively more ordered than the corresponding protein of the influenza virus (figure 2). this is an indication of the greater likelihood of the presence of the virus in stools, despite its predominant respiratory transmission. in agreement with this hypothesis, ibv - cov has been reported to be present in feces of infected birds, and respiratory mode is believed to be the main transmission means [21, 39 ]. similar interpolations can also be made using the analysis of the various porcine coronaviruses in terms of their shell disorder and their respective transmission behavior. based on the experimental and clinical studies on the hcov-229e and sars - cov, it has been concluded that hcov-229e is easily transmissible by respiratory modes, whereas sars - cov is more easily transmitted via contact, and these observations were used to generalize the transmission differences between human and other coronaviruses. our data on protein intrinsic disorder support this conclusion and also provide some additional points for consideration. the fact that hcovs are generally characterized by high pid levels of their m - proteins suggests that many human coronaviruses may have a higher respiratory component in their transmission mode. however, as we have seen above, the variability of predicted disorder in hcov is very high, with hcov-229e possessing the highest pid rates among hcovs and with hcov - hku1 being characterized by lowest levels of predicted disorder in its n- and m - proteins. this suggests that it is difficult to expect that all the hcovs would have the same transmission characteristics as hcov-229e. for example, hcov - hku1 is quite different from other hcovs, even though several of them are found in the same group (see table 1 and figure 5). table 3 further emphasizes the presence of a noticeable variability in the pid levels of hcov surface proteins and also shows that different hcovs can have noticeable variability in their transmission modes. it has been generally believed that hcov - hku1 is spread by respiratory means like the other hcovs. however, more recent studies revealed that hcov - hku1 may be quite different from the other hcovs. for example, there is a noticeable difference between the genetic makeups of hcov - hku1 and hcov - oc43, and, genetically, hcov - hku1 seems to be close to the mhv. furthermore, a case was described where hcov - hku1 was detected in a patient suffering from hepatitis. given this observation and the close genetic proximity of hcov - hku1 and mhv, it is suspected that hcov - hku1 may play a role in the pathogenesis of hepatitis. in agreement with these observations and hypotheses, table 3 shows that there is a close similarity in the pid levels evaluated for the surface proteins of hcov - hku1 and mhv. this finding is rather surprising, even if the genetic similarity of these two covs were to be taken into account, since data shown in tables 13 clearly illustrate that genetic proximity does not necessarily translate into the disorder pattern similarity. this also suggests that hcov - hku1 and mhv may also possess similar transmission behavior. this hypothesis is supported by the recent clinical studies which indicated the greater presence of hcov - hku1 in stools of patients and the greater association of gastrointestinal illness with hcov - hku1 infections when compared to cases of other hcov infections. viruses, such as mhv, that infect the liver may need harder shell encasements to protect the virion during their exposure to bile, which is known to inflict damage on certain viruses. based on the results of the disorder analysis, we can hypothesize that there is a great likelihood that hcov-229e is most easily spread via the respiratory mode. based on the pid data shown in table 3 one can expect that sars - cov should have a larger fecal - oral component than hcov-229e and therefore should likely be spread by contact, oral - fecal, and respiratory means. in fact, more moderate pid levels in sars - cov and many animal covs imply that these viruses are likely to have reasonably high levels of both oral - fecal and respiratory components, which allow them to persist in the environment for a longer time and yet being able to infect via droplets or aerosols. these hypotheses are consistent with the previously described direct observations of the mostly respiratory transmission mode of hcov-229e. on the other hand, although many animal covs were shown to have a larger fecal - oral component, they also can be spread by touch, since a larger fecal - oral component will allow them to persist in the environment for a longer time, or via the fecal - respiratory mode. one of the difficulties that epidemiologists experienced during the sars outbreak of 2003 - 4 was the way the virus spreads. from the way the virus passed between the hosts when it was then shown to be a coronavirus, a special attention was paid to possible oral - fecal routes, given the nature of coronaviruses. in fact, there were instances where the spread involved fecal routes, such as in the case of the outbreak at amoy gardens in hong kong, which involved a spread via the sewerage system [11, 43 ]. despite of what was known from the outbreak at amoy gardens, the exact modes of sars - cov spread remain unclear as of yet. for example, there were many cases where patients were infected without any known contact with an infected person. therefore, the precise spread mechanisms remain somewhat a mystery, and there are no appropriate animal models for the sars - cov transmission modes. the disorder analysis of sars - cov and other coronaviruses suggests that sars - cov falls in category b (see table 3), which includes viruses that are likely to have intermediate levels of both respiratory and fecal - oral components. these viruses are expected to have less respiratory component than hcov-229e and ibv from the category a (table 3 and figures 3, 5, and 6), but greater contribution of the respiratory mode than viruses of the category c, such as tgev and mhv. by the same token, the sars - cov has a higher oral - fecal component than the former but lower oral - fecal component than the latter. this suggests a greater likelihood of being spread via the fecal - respiratory mode, which affirms what has been long suspected clinically. the role of fecal - respiratory transmission, as suggested by the disorder analysis mentioned above, also explains many of features observed for pedv, and not observed for its counterpart, tgev. it also explains similarly in the spreading behaviors of sars - cov and pedv, given that both have the closest shell disorder seen in our sample. another feature that was a puzzle during the sars epidemic and remains unclear now is the question on the sars - cov persistence outside the physiological environment. although the ability of sars - cov to survive on the surfaces and feces for extended periods is known [6, 43 ], the level of persistence and the corresponding evolutionary mechanisms have not been fully understood. the results shown in tables 2 - 3 suggest a way to address the problem. in the case of pedv and sars - cov, the pid levels of both n- and m - proteins are quite moderate. in pedv and tgev, the differences in the transmission behavior and the levels of shell disorder suggest that special attention should be paid to the pid peculiarities of the m - protein. a sign of persistence of sars - cov and some specific strains of pedv (see tables 2 - 3) can be found in the relatively low pid levels of their m - proteins (~8%), especially when compared to viruses such as tgev (~14%) and hcov-229e (~23%). another enigma is the ability of sars - cov to infect hosts without any apparent contact with an infected host [6, 44 ]. the differences between pedv and tgev in terms of shell disorder and observed spread characteristics offer some clues to this conundrum, since the ability of pedv to infect pigs remains even after attempted cleaning of pens and isolation of infected pigs. both shell proteins of both pedv and sars - cov therefore, the same reasoning used to predict the environmental persistence and the greater fecal - respiratory transmission component in pedv can be extended to explain the behavior of sars - cov. the sars - cov did not exhibit higher spread efficiency especially when compared to influenza a, whereas pedv has been observed to spread less quickly than tgev. it would then be tempting to conclude that these inefficiencies are for the same reasons. a closer analysis of the corresponding intrinsic disorder data reveals that the reasons for the spread inefficiency are actually very different. comparisons of the pids of n - proteins of sars - cov (tables 2 - 3), ibv (figure 6), and hcov-229e (figure 5, table 2) revealed that the intrinsic disorder in the sars - cov n - protein is relatively moderate. conversely, when the n - protein of sars - cov is compared to tgev (tables 2 - 3) and many other animal covs, the opposite is held true (figure 2) : the pid level in the sars - cov n - protein is higher than the corresponding levels in many animal coronaviruses, especially tgev. a model to relate disorder at the m- and n - proteins to the behavior of coronaviruses can be built. this model is based on the observation that viruses that are exposed to a less harsh environment, such as those that are transmitted via oral - fecal route, require a more rigid encasement so as to protect their virions from damage. one way to measure the rigidity of the encasement is by looking at the level of predicted intrinsic disorder in the capsid and matrix proteins. from the known behavior and shell disorder patterns of influenza a virus and various porcine coronaviruses, it can be deduced that higher disorder at m - protein can be linked to greater persistence, while higher (or lower) levels of predicted disorder in the nucleocapsid can be related to the levels of respiratory (or fecal - oral) transmission components, respectively. while the disorder levels in these two proteins tend to follow each other, this is not necessarily the case for all coronaviruses. previous studies have already provided evidence that sexually transmitted viruses often have highly disordered m- and n - proteins since such viruses do not need a rigid protective shell but, instead, flexible layers of proteins that could help these viruses evade the host 's immune system. in this paper, a number of coronaviruses were sampled, and further support of the link was found. for instance, many covs that are known to spread predominantly by the respiratory mode are characterized by higher disorder levels in their shell proteins. this is especially the case for the hcov-229e, for which our analysis revealed that both the m- and n - proteins are highly disordered. the data also suggest that many other human coronaviruses may rely on the respiratory route as the main mode of transmission since hcovs generally have large pid levels in both matrix and nucleocapsid. an especially large respiratory component has been observed for hcov-229e when compared with animal coronaviruses including the sars - cov. such high level of disorder was not generally detected in the animal covs, with the exception of the avian ibv. it is likely that ibv possesses higher ability to spread via fecal - respiratory route given the more ordered m - protein and more disordered nucleocapsid protein. the results of the disorder analysis of the shell proteins of the porcine coronaviruses not only gave more evidence to link predicted disorder to viral behavior but also showed how the model can be used to predict the cov behavior. in fact, there is a close similarity between the pid levels in the matrix and nucleocapsid proteins of sars - cov and pedv. furthermore, the transmission behaviors of these two viruses are strikingly similar (both pedv and sars - cov spread primarily by contact), despite their relatively distant genetic relationship (table 1). on the other hand, based on the lower nucleocapsid pid found in tgev, we could expect to see a larger oral - fecal component in the transmission of this virus. this suggests that since tgev has much larger oral - fecal and contact components in transmission, it can spread much more efficiently than pedv, the hypothesis that can be deduced from the presented pid analysis. this suggests that the levels of predicted disorder provide a definite way to evaluate the fitness of the virus. the model also suggests a mechanism by which pedv could reemerge to infect herds even after cleaning of the premises. our analysis suggests that this ability to reemerge arises from the existence of both oral - fecal and respiratory components. therefore, the aerosol transmission arising from the viral particles left behind may have a crucial role in this reemerging. in its turn, the ability to have two transmission components can be determined by the peculiarities of the predicted intrinsic disorder distribution in the viral shell proteins. pid similarity between pedv and sars - cov suggests that these two viruses might have similar transmission mechanisms and suggests that sars - cov might have propensity to reemerge, which can explain how people could be infected even though they had not been known to be in contact with the sars - cov - infected persons. overall, the disorder - based analysis constitutes the categorization algorithm shown in table 3 that can be used to identify the transmission modes of various coronaviruses. results of our analysis show that disorder predictors can be used to predict transmission behavior of newly emerging strains of viruses. in the cases of epidemic outbreaks, such a technique would be a useful tool for predicting the potential transmission behavior of a new virus. furthermore, this analysis gives new clues for better understanding the spread behavior of viruses that have been known for years. further details of implementation can be found in our previous papers [1, 2, 38 ]. the data extracted from pdb were placed into the database that enables further development of the java codes to create 3d representation in jmol. the relational database was modified to allow import and storage of the data from uniprot (http://www.uniprot.org/). a graphical user interface program was implemented using java to allow easy entry of protein details and accession codes. the open - source statistical package, r (http://www.r-project.org/), was used to analyze data. | besides being a common threat to farm animals and poultry, coronavirus (cov) was responsible for the human severe acute respiratory syndrome (sars) epidemic in 20024. however, many aspects of cov behavior, including modes of its transmission, are yet to be fully understood. we show that the amount and the peculiarities of distribution of the protein intrinsic disorder in the viral shell can be used for the efficient analysis of the behavior and transmission modes of cov. the proposed model allows categorization of the various covs by the peculiarities of disorder distribution in their membrane (m) and nucleocapsid (n). this categorization enables quick identification of viruses with similar behaviors in transmission, regardless of genetic proximity. based on this analysis, an empirical model for predicting the viral transmission behavior is developed. this model is able to explain some behavioral aspects of important coronaviruses that previously were not fully understood. the new predictor can be a useful tool for better epidemiological, clinical, and structural understanding of behavior of both newly emerging viruses and viruses that have been known for a long time. a potentially new vaccine strategy could involve searches for viral strains that are characterized by the evolutionary misfit between the peculiarities of the disorder distribution in their shells and their behavior. |
kearns - sayre syndrome (kss) is a rare sporadic mitochondrial cytopathy caused by a single large - scale mitochondrial dna (mtdna) deletion. classically, kss has a triad of features including onset before 20 years of age, progressive external ophthalmoplegia (peo), and pigmentary retinopathy. in addition, heart blocks, cerebellar ataxia, short stature, and sensory hearing loss are frequently present in these patients. muscle pathology plays a vital role in differentiating kss with other diseases which present as ophthalmoplegia, since ragged - red fibers (rrfs), ragged blue fibers (rbfs), and cytochrome oxidase (cox) negative fibers are histopathological hallmarks of mitochondrial disease. the most commonly reported brain magnetic resonance imaging (mri) findings in kss are cerebral and cerebellar atrophy with bilateral high - t2 signals in subcortical white matter, thalamus, basal ganglia, and brainstem. until now, reports on kss patients in mainland of china were uncommon, making it necessary to clarify the natural history and characteristics of brain mri changes in more kss patients. herein, we report clinical profiles of 19 chinese patients with kss, focusing on the dynamic changes in electrocardiogram (ecg), clinical follow - up, brain mri feature as well as possible relationships between phenotype and genotype. nineteen unrelated kss patients who visited peking university first hospital from january 2004 to october 2015 were enrolled in this study [table 1 ]. all patients conformed to the diagnostic criteria of kss, i.e., the triad of peo, pigmentary retinopathy, and onset before 20 years of age, plus at least one of the following : heart block, cerebellar symptoms, or cerebrospinal fluid (csf) protein levels above 1000 mg / l. their clinical records were collected and analyzed, as well as the results of auxiliary examinations, including fundus photography, ecg, and brain mri. in addition, 13 of the patients were followed up 6 months to 8 years after their confirmed diagnosis. clinical, myopathological and genetic features of 19 kss patients receiving permanent pacemaker implantation. eo : external ophthalmoplegia ; pr : pigmentary retinopathy ; dm : diabetes mellitus ; avb : atrioventricular block ; rbbb : right bundle branch block ; st : sinus tachycardia ; lafb : left anterior fascicular block ; : normal ; nd : not done ; rrf : ragged - red fibers ; rbf : ragged - blue fibers ; cox : cytochrome - oxidase ; mtdna : mitochondrial dna ; kss : kearns - sayre syndrome. muscle biopsies were performed on 15 patients for diagnostic purpose after they gave written informed consent. for histological examination, serial frozen sections (8 m) the percentage of rbfs was counted under the microscope by at least two different experts in muscle pathology. the method of detecting large - scale mtdna deletion was the same as previously described. spearman correlation coefficient was performed between the age of onset, the percentage of rbfs, and the length of mtdna deletions. nineteen unrelated kss patients who visited peking university first hospital from january 2004 to october 2015 were enrolled in this study [table 1 ]. all patients conformed to the diagnostic criteria of kss, i.e., the triad of peo, pigmentary retinopathy, and onset before 20 years of age, plus at least one of the following : heart block, cerebellar symptoms, or cerebrospinal fluid (csf) protein levels above 1000 mg / l. their clinical records were collected and analyzed, as well as the results of auxiliary examinations, including fundus photography, ecg, and brain mri. in addition, 13 of the patients were followed up 6 months to 8 years after their confirmed diagnosis. clinical, myopathological and genetic features of 19 kss patients receiving permanent pacemaker implantation. eo : external ophthalmoplegia ; pr : pigmentary retinopathy ; dm : diabetes mellitus ; avb : atrioventricular block ; rbbb : right bundle branch block ; st : sinus tachycardia ; lafb : left anterior fascicular block ; : normal ; nd : not done ; rrf : ragged - red fibers ; rbf : ragged - blue fibers ; cox : cytochrome - oxidase ; mtdna : mitochondrial dna ; kss : kearns - sayre syndrome. muscle biopsies were performed on 15 patients for diagnostic purpose after they gave written informed consent. for histological examination, serial frozen sections (8 m) were stained by routine histological and histochemical methods. the percentage of rbfs was counted under the microscope by at least two different experts in muscle pathology. the method of detecting large - scale mtdna deletion was the same as previously described. spearman correlation coefficient was performed between the age of onset, the percentage of rbfs, and the length of mtdna deletions. the mean age of onset was 9.6 4.3 years (216 years) and the mean age at diagnosis was 16.6 6.1 years (831 years). the symptoms at onset were ptosis and external ophthalmoplegia in 16 cases (84.2%) and short stature in three cases (15.8%). all patients developed ptosis, external ophthalmoplegia, and pigmentary retinopathy with disease progression. in addition, ten cases (52.6%) showed cerebellar ataxia, mainly presenting as unstable gait and cerebellar tremor. one case (5.3%) was diagnosed with diabetes mellitus and one case (5.3%) complained of limb weakness but could still walk independently. at the early stage of the disease, patients usually presented with extraocular muscle symptoms, and during the course of the disease gradually developed other clinical features related to cerebellum, audition, and heart conduction [figure 1 ]. four patients who underwent lumbar puncture showed a significant increase in csf protein levels (> 1000 mg / l). in the follow - up studies of 13 patients walking difficulties were seen in three due to cerebellar ataxia, and loss of ambulation in two patients due to heart failure. twelve cases (63.2%) showed conduction blocks, including right bundle branch block (rbbb) in three cases, complete atrioventricular block (avb) in three cases, complete avb with rbbb in three cases, left anterior fascicular block (lafb) in one case, rbbb with lafb in one case, and mobitz type ii 2 degree avb with rbbb in one case. one case (5.3%) showed sinus tachycardia, and the remaining six cases (31.6%) had no abnormalities of ecg at the time of their last visit. it is noteworthy that although rbbb was detected in four patients on their first abnormal ecg, all of them developed rbbb combined with lafb, and finally deteriorated to complete avb within 372 months during the following monitoring of ecgs. during the follow - up, five patients with complete avb showed relatively stable situations after receiving permanent pacemaker implantations. abnormalities were found in all 15 patients who had brain mri examinations [table 2 and figure 2 ]. all cases showed symmetric high - t2 signals in cerebral and cerebellar white matter, as well as brainstem with various extent. in addition, symmetric high - t2 signals were found in basal ganglia (mainly globus pallidus) in seven cases (46.7%), and in thalamus in eight cases (53.3%). according to the distribution of cerebral white matter lesions group 1 included six patients who, on brain mris, showed subcortical u - fiber involvement with sparing of the periventricular white matter. in this group, abnormal high - t2 signals were detected in the corpus callosum (mainly in the splenium), basal ganglia, and dorsal brain stem in all six patients, in the thalamus of five patients (83.3%), and in the cerebral peduncle of five patients (83.3%). the remaining nine patients belonged to group 2 who had mainly periventricular white matter involvement on brain mris. in this group, abnormal high - t2 signals were seen in the corpus callosum of four patients (44.4%), basal ganglia in 2 (22.2%), thalamus in 3 (33.3%), cerebral peduncle in 8 (88.8%), and dorsal brain stem in six patients (66.6%). patients in both group 1 and group 2 showed involvement of bilateral internal capsule, especially the posterior limb, and brachium pontis. there were three cases (20.0%) with abnormal high - t2 signals in cerebellar dentate nuclei. cerebellar atrophy was observed in five cases (33.3%), while obvious cerebral atrophy was not found in any of the 15 patients. moreover, of the eight patients who received diffusion - weighted imaging (dwi) sequence scanning, 6 (75.0%) showed restricted diffusion on dwi in white matter and basal ganglia. distribution of high - t2 signals on brain mris of 15 kss patients the rows in gray were cases with subcortical white matter involved, while the rest were cases with prominent periventricular white matter involved ; internal capsule in this group was affected in all 15 patients ; brachium pontis in this group was affected in all 15 patients. (a - d) brain mri in patient 2 showed abnormal high - t2 signals in the subcortical white matter with u - fibers involved (a), splenium of corpus callosum, internal capsule, basal ganglia, and thalamus (b), dorsal brainstem (c), and brachium pontis and cerebellar white matter (d), respectively. (e - h) brain mri in patient 6 showed abnormal high - t2 signal signals in the periventricular white matter (e), splenium of corpus callosum, internal capsule (f), dorsal brainstem (g), brachium pontis, and cerebellar white matter (h), respectively. myopathological examination showed rrfs, rbfs, and cox - negative fibers with different ratios in all 15 patients receiving biopsy [figure 3 ]. single large - scale deletions of mtdna were detected in all 12 patients muscle dna who underwent mtdna mutation analysis. nine patients (75.0%) carried mtdna 4977 bp deletions (nt8482nt13,459), three patients carried three other different larger mtdna deletions. basophilic fibers on h & e staining (arrow) (a), rrfs on mgt staining (arrow) (b), and rbfs on sdh staining (arrows) (c and d). rrf : ragged - red fiber ; mgt : modified gomori trichrome ; rbf : ragged - blue fiber ; sdh : succinate dehydrogenase ; kss : kearns - sayre syndrome. statistical analyses showed no correlations between size of mtdna deletions and age of onset (p = 0.848) or percentage of rbfs (p = 0.722). six cases carrying the same type of mtdna 4977bp deletion had brain mris. however, the distribution and severity of brain lesions revealed by mri findings varied greatly in these patients. the mean age of onset was 9.6 4.3 years (216 years) and the mean age at diagnosis was 16.6 6.1 years (831 years). the symptoms at onset were ptosis and external ophthalmoplegia in 16 cases (84.2%) and short stature in three cases (15.8%). all patients developed ptosis, external ophthalmoplegia, and pigmentary retinopathy with disease progression. in addition, ten cases (52.6%) showed cerebellar ataxia, mainly presenting as unstable gait and cerebellar tremor. one case (5.3%) was diagnosed with diabetes mellitus and one case (5.3%) complained of limb weakness but could still walk independently. at the early stage of the disease, patients usually presented with extraocular muscle symptoms, and during the course of the disease gradually developed other clinical features related to cerebellum, audition, and heart conduction [figure 1 ]. four patients who underwent lumbar puncture showed a significant increase in csf protein levels (> 1000 mg / l). in the follow - up studies of 13 patients walking difficulties were seen in three due to cerebellar ataxia, and loss of ambulation in two patients due to heart failure. all patients had ecg examinations. twelve cases (63.2%) showed conduction blocks, including right bundle branch block (rbbb) in three cases, complete atrioventricular block (avb) in three cases, complete avb with rbbb in three cases, left anterior fascicular block (lafb) in one case, rbbb with lafb in one case, and mobitz type ii 2 degree avb with rbbb in one case. one case (5.3%) showed sinus tachycardia, and the remaining six cases (31.6%) had no abnormalities of ecg at the time of their last visit. it is noteworthy that although rbbb was detected in four patients on their first abnormal ecg, all of them developed rbbb combined with lafb, and finally deteriorated to complete avb within 372 months during the following monitoring of ecgs. during the follow - up, five patients with complete avb showed relatively stable situations after receiving permanent pacemaker implantations. abnormalities were found in all 15 patients who had brain mri examinations [table 2 and figure 2 ]. all cases showed symmetric high - t2 signals in cerebral and cerebellar white matter, as well as brainstem with various extent. in addition, symmetric high - t2 signals were found in basal ganglia (mainly globus pallidus) in seven cases (46.7%), and in thalamus in eight cases (53.3%). according to the distribution of cerebral white matter lesions group 1 included six patients who, on brain mris, showed subcortical u - fiber involvement with sparing of the periventricular white matter. in this group, abnormal high - t2 signals were detected in the corpus callosum (mainly in the splenium), basal ganglia, and dorsal brain stem in all six patients, in the thalamus of five patients (83.3%), and in the cerebral peduncle of five patients (83.3%). the remaining nine patients belonged to group 2 who had mainly periventricular white matter involvement on brain mris. in this group, abnormal high - t2 signals were seen in the corpus callosum of four patients (44.4%), basal ganglia in 2 (22.2%), thalamus in 3 (33.3%), cerebral peduncle in 8 (88.8%), and dorsal brain stem in six patients (66.6%). patients in both group 1 and group 2 showed involvement of bilateral internal capsule, especially the posterior limb, and brachium pontis. there were three cases (20.0%) with abnormal high - t2 signals in cerebellar dentate nuclei. cerebellar atrophy was observed in five cases (33.3%), while obvious cerebral atrophy was not found in any of the 15 patients. moreover, of the eight patients who received diffusion - weighted imaging (dwi) sequence scanning, 6 (75.0%) showed restricted diffusion on dwi in white matter and basal ganglia. distribution of high - t2 signals on brain mris of 15 kss patients the rows in gray were cases with subcortical white matter involved, while the rest were cases with prominent periventricular white matter involved ; internal capsule in this group was affected in all 15 patients ; brachium pontis in this group was affected in all 15 patients. (a - d) brain mri in patient 2 showed abnormal high - t2 signals in the subcortical white matter with u - fibers involved (a), splenium of corpus callosum, internal capsule, basal ganglia, and thalamus (b), dorsal brainstem (c), and brachium pontis and cerebellar white matter (d), respectively. (e - h) brain mri in patient 6 showed abnormal high - t2 signal signals in the periventricular white matter (e), splenium of corpus callosum, internal capsule (f), dorsal brainstem (g), brachium pontis, and cerebellar white matter (h), respectively. myopathological examination showed rrfs, rbfs, and cox - negative fibers with different ratios in all 15 patients receiving biopsy [figure 3 ]. single large - scale deletions of mtdna were detected in all 12 patients muscle dna who underwent mtdna mutation analysis. nine patients (75.0%) carried mtdna 4977 bp deletions (nt8482nt13,459), three patients carried three other different larger mtdna deletions. basophilic fibers on h & e staining (arrow) (a), rrfs on mgt staining (arrow) (b), and rbfs on sdh staining (arrows) (c and d). rrf : ragged - red fiber ; mgt : modified gomori trichrome ; rbf : ragged - blue fiber ; sdh : succinate dehydrogenase ; kss : kearns - sayre syndrome. statistical analyses showed no correlations between size of mtdna deletions and age of onset (p = 0.848) or percentage of rbfs (p = 0.722). six cases carrying the same type of mtdna 4977bp deletion had brain mris. however, the distribution and severity of brain lesions revealed by mri findings varied greatly in these patients. in this study, we recruited 19 patients with kss - the largest cohort in mainland china studied so far. the mean age of onset in our patients was 9.6 4.3 years, which was similar to other reports on chinese kss patients. it has been reported that the age of onset was between 13 and 15 years in korean kss patients, and 610 years in japanese kss patients. therefore, the age of onset in asian patients with kss is a little younger than the us patients with this disease where the age of onset is 17 10 years old. the average time interval from disease onset to diagnosis in our case studies was 7 years, similar to the study in the us patients, suggesting that early diagnosis of kss is a challenge for clinicians worldwide. all patients developed full kss phenotype after a disease duration of 215 years. as indicated in figure 1, in most patients the evolution of disease course showed a similar pattern. most of them presented with ptosis or ophthalmoplegia at the initial stage of the disease. with disease progression, other systems were affected gradually within several years, including the appearance of neurological dysfunction before 20 years of age and cardiac conduction blockages before the third decade. cerebellar ataxia was the most common neurological symptom in our cohort (52.6%), which was also frequently described in other reports. however, it only appeared in one of 35 us patients and was not described in other japanese or korean case series. we previously found 71.0% of 73 patients with different subtypes of mitochondrial encephalomyopathy had a hearing impairment. in the present study, however, only five kss patients (26.3%) had hearing loss, much lower than the incidence of 64.0% in japanese patients, suggesting thorough auditory function evaluation is needed in these kss patients to detect subclinical hearing loss in the future. proximal muscle weakness was reported in some kss patients in other studies, but it was not common in our patients. follow - up showed that the greatest impairments affecting kss patients were cerebellar signs and heart problems. our study showed that heart conduction block was very common among chinese kss patients, which was consistent with other reports. there were different types of conduction blocks including rbbb, lafb, and different degrees of avbs. the most common type of ventricular arrhythmia reported in kss patients by others was bradycardia - related polymorphic ventricular tachycardia. however, this was neither found in any of our patients nor in other chinese kss patients reported so far. we found it was very common that in kss, conduction defects were aggravating and not constant, as seen in most of our patients who gradually deteriorated from bundle branch blockages to complete avbs. the progression rate of conduction defects differed widely in patients, ranging from several months to several years. other reports also stressed that the primary cause of sudden death in kss patients was high - grade heart block, and the incidence of sudden cardiac death in kss patients was 20% as reported, making prompt pacemaker implantation a prerequisite in such conditions. however, most cases in our cohort showed no cardiac symptoms with bundle block detected on ecgs, and when syncope or sudden cardiac death presented, it had usually already progressed to a high - grade heart block. therefore, we strongly suggest that all patients diagnosed with kss should have ecg screening at least once a year to detect conduction defects, ventricular arrhythmias, and qt prolongation. for those already having bundle branch heart block, further closer monitoring should be carried out to notice complete avb, which can lead to sudden cardiac death. brain mris were abnormal in all of our patients who received mri examinations, although only half of them were clinically affected, indicating that the severity of clinical manifestations was not correlated with brain mri changes. previous studies by other researchers reported that the percentage involvement was 90.9% subcortical white matter, 63.6% basal ganglia, 63.6% brainstem, 54.5% thalamus, and 25.0% cerebellum. in contrast, we found all patients had involvement of cerebral and cerebellar white matter, as well as brainstem with varying degrees. about 53.3% of our patients presented with high - t2 signals in basal ganglia and thalamus, which was similar to other reports. reported that the characteristic mri findings of white matter changes in kss patients are the involvement of subcortical u - fibers with sparing of the periventricular white matter, differentiating kss from most lysosomal, and peroxisomal disorders where subcortical regions are only affected late in the course. our study, however, showed there were two patterns of cerebral white matter involvement in kss : one with selective subcortical u - fibers involvement and the other with prominent periventricular white matter affected, while the latter was also previously reported in an occasional single case. the percentages of corpus callosum, basal ganglia, thalamus, and dorsal brain stem involvement were significantly higher in the group affecting subcortical white matter than in the group affecting periventricular white matter, while the involvement of cerebral peduncles showed no difference between the two groups. however, we did not detect the differences in the severity of clinical features between the two groups. in addition, the involvement of the splenium of the corpus callosum and the posterior limb of internal capsule was common in our patients, suggesting another characteristic neuro - radiological feature of kss patients. the involvement of the dentate nuclei was not correlated to clinical cerebellar ataxia, while the common findings of abnormal signals involving brachium pontis fibers and cerebellar white matter might provide a possible explanation. the findings of restricted diffusion on dwi were not reported previously and might be a characteristic feature of kss patients. in our study, brain mris were carried out at different disease stages ; future research should include long - term clinical and mri follow - up to further determine the evolving state of brain mris and its relationship to clinical features. mtdna deletions were detected in all 12 patients who were examined by molecular analysis, with 75.0% of them carrying 4977 bp common deletions. according to previous studies, the size of the deletion, the deletion heteroplasmy level in skeletal muscle, and the location of the deletion were significantly correlated with age at onset of symptoms and progression of disease burden in kss and other mtdna deletion syndromes. however, our study could not find any correlations between the size of the deletion and the age of onset or the percentage of rbfs in our case series. as the percentage of mtdna deletion was not determined in our study, we assume the deletion heteroplasmy might be the major factor associated with phenotype. in the future, more detailed research with a larger cohort of kss patients may help determine the actual relationship between mtdna mutations and mri changes. in conclusion, the present study showed that the clinical features of kss had a tendency to evolve. the progression rate of heart block varied widely among kss patients, highlighting the significance of close ecg monitoring. brain mri often showed pronounced changes involving cerebral and cerebellar white matter and the deep gray nucleus. the group with the dominant involvement of subcortical white matter showed higher percentages of corpus callosum, basal ganglia, thalamus, and dorsal brain stem involvement than the group with the involvement of periventricular white matter. clinical presentation or the severity of muscle pathological changes is not related to the size of mtdna deletions. this work was supported by grants from the ministry of science and technology of china (no. 2011zx09307 - 001 - 07) and beijing municipal science and technology commission (no. this work was supported by grants from the ministry of science and technology of china (no. 2011zx09307 - 001 - 07) and beijing municipal science and technology commission (no. | background : kearns - sayre syndrome (kss) is a mitochondrial dna (mtdna) deletion disorder characterized by a triad of onset before 20 years of age, ophthalmoplegia, and pigmentary retinopathy. the heart and central nervous system are commonly involved. we summarized clinical and brain magnetic resonance imaging (mri) features of a cohort of chinese kss patients.methods:nineteen patients confirmed by muscle biopsy and mtdna analysis were enrolled. we examined clinical profiles, mainly focusing on changes in electrocardiogram (ecg) and brain mri. the correlation between genotype and phenotype was statistically analyzed.results:the mean age of onset was 9.6 4.3 years, with all developing the classic triad at the time of diagnosis. heart conduction block was detected in 63.2%, with four initially presenting as bundle branch block and developing into complete atrioventricular block over 372 months. brain mri showed symmetric high - t2 signals in 100% of cerebral and cerebellar white matter, as well as brainstem, 46.7% of basal ganglia, and 53.3% of thalamus. there were two patterns of cerebral white matter involvements, one with selective subcortical u - fibers and the other with periventricular white matter. the size of mtdna deletion did not significantly correlate with age of onset or percentage of ragged blue fibers on muscle pathology.conclusions:the clinical features of kss evolve dynamically, affecting the cardiac conduction system predominantly, highlighting the significance of ecg monitoring. brain mri showed changes involving both the white matter and deep gray nuclei. clinical presentation or severity of muscle pathological changes is not related to the size of mtdna deletions. |
tooth movement can occur when the applied forces adequately overcome the friction at the bracket slot - archwire interface. high levels of frictional force between the bracket slot and the archwire might cause binding between the two components ; this in turn result in little or no tooth movement. furthermore, low forces are considered desirable to conserve anchorage and reduce the risk of root resorption. therefore, it is essential to understand the friction between the bracket and the archwire so that the proper force can be applied to obtain adequate tooth movement and optimum biologic response. friction has been attributed to many factors, such as bracket type, wire size and alloy, method of ligation and angulation between the bracket slot surface and orthodontic wires. these brackets are characterized by having a " ligature " similar to an opening and closing cover or precision latch, thus avoiding the use of additional ligatures for attachment. the main advantage of self - ligating brackets is the reduction of frictional forces. studies comparing self - ligating brackets with different ligating systems for conventional brackets have reported and showed that the former has a significantly lower level of frictional resistance. however, some studies that evaluated rectangular wires and applied moments showed no differences between self - ligating and conventional brackets. a recent systematic review concluded that, in comparison with conventional brackets, self - ligating brackets maintain lower friction only when coupled with small round archwires. sufficient evidence, however, has not been found to claim that the self - ligating produce lower friction with large rectangular wires in the presence of tipping and/or torque. it should be taken into account that reduced friction force is interesting in the initial stages of orthodontic treatment and during retraction of anterior teeth using sliding mechanics. in the last phases, however, higher friction force can be used to obtain a three - dimensional control of the tooth position. the ideal self - ligating bracket is the one that can be conventionally attached when high friction is needed. the design of four double wings of the smartclip ligatures to be used when friction is desired. to our knowledge, there are no studies in the literature evaluating friction in these brackets associated with different types of wire at different angles. the objective of the present work was to analyze the influence of self - ligating brackets (smartclip) combined with rectangular archwires even at different angulations on frictional forces and compare them with conventional brackets. two types of brackets were tested : self - ligating brackets (smartclip, 3 m unitek, monrovia, california, usa) and conventional brackets (gemini, 3 m unitek, monrovia, california, usa). only upper central incisor brackets with 0.022x0.028-in slots and the brackets were tested with 0.019"x0.025 " nickel - titanium, beta - titanium, and stainless steel archwires (3 m unitek, monrovia, california, usa). conventional brackets were attached by using elastomeric ligatures (tp orthodontics, la porte, in, usa). the dislocation resistance of the archwires resulted from friction force produced by the contact between the bracket slot surface and orthodontic wires segments of 5.0 cm. each bracket / wire combination was submitted to mechanical traction test at angulations of 0, 5, and 10 degrees. each combination of bracket / wire / angulation was submitted to 10 tests by a single operator, thus totalizing 90 mechanical testing for each group of brackets and 180 for both groups. the friction mechanical testing was performed by using a universal testing machine (emic dl 10000, so jos dos pinhais, pr, brazil) with load cell of 20 n. for conducting such an experiment, devices were developed specially for this type of mechanical testing (figures 1a, 1b, and 1c). the brackets were positioned at the center of a circular piece and then fixed there with screws located at the tip of this piece. as the brackets had mbt prescription (17 torque), the circular piece had an angulated shape in order to eliminate the angulation of the brackets. a) angulation of 0 between bracket and wire ; b) angulation of 5 between bracket and wire ; and c) angulation of 10 between bracket and wire before the mechanical testing, both wires and brackets were cleaned with alcohol. for the conventional brackets, elastomeric ligatures were used to attach the wires. following placement of each ligature, a 3-minute period the ligatures were installed by means of an applicator (morelli 75.01.002, sorocaba, sp, brazil) and replaced before every test. for self - ligating brackets, no type of attachment was used. for the mechanical testing of brackets with zero - degree angulation, the wire segments were positioned perpendicular to the base of the circular piece, thus keeping a passive contact with the bracket slots. at angulations of 5 and 10 degrees, the circular piece was turned in relation to the long axis of the orthodontic wires. the wires were pulled through the bracket slots at a cross - head speed of 3 mm / min until a displacement of 2 mm. the friction was measured under dry conditions and at room temperature (20c2c).the values of maximum force (gf) produced were recorded by the tesc software, version 3.04, and then statistically analyzed. arithmetic means, standard deviations, interquartile ranges, and minimum and maximum values were calculated for combinations of bracket / wire/ angulation. kruskal - wallis test was applied for study of the effect of wire type and angulation on frictional resistance, whereas mann - whitney test was used for post - hoc analysis. a scanning electron microscopy (sem - jeol jsm 5800 lv, tokyo, japan) was used to analyze the surface morphology of both bracket and archwire. the following variables were examined to determine the static friction : type of attachment, type of wire, and angulation between archwire and bracket slot. the influence of type of wire material and angulation on friction was analyzed separately for conventional and self - ligating brackets, thus allowing the behavior of these variables to be assessed in relation to both groups of brackets. descriptive statistics for different combinations of bracket / wire / angulation is shown in table 1. statistical description of maximum forces for different variables regarding conventional and self - ligating brackets kruskal - wallis test showed a significant effect of the type of wire material (p < 0.0001). with regard to conventional brackets, mann - whitney test showed statistic differences in the maximum friction force produced by stainless steel, nickel - titanium (p=0.011), and beta - titanium (p < 0.0001) archwires, although nickel - titanium wires presented statistic difference compared to the beta - titanium one (p=0.0003). by using the mean values, it was observed that lowest frictional forces were produced by stainless steel wire, followed by nickel - titanium and beta - titanium ones (figure 2a). with regard to self - ligating brackets, the kruskal - wallis test showed that type of wire material had a significant effect (p<0.0003). the mann - whitney test showed that the maximum force of stainless steel wire differed from that of the nickel - titanium wire (p=0.013). the beta - titanium wire differed from the nickel - titanium one (p=0.0002), but did not present difference compared to stainless steel wire (p=0.028). the observation of mean values showed that nickel - titanium wire had produced the lowest forces, followed by stainless steel and beta - titanium archwires, without statistical differences between them (figure 2b). a) maximum forces (gf) exerted on conventional brackets by type of orthodontic wire ; b) maximum forces (gf) exerted on self - ligating brackets by type of orthodontic wire ; c) maximum forces (gf) exerted on conventional brackets by angulation ; d) maximum forces (gf) exerted on self - ligating brackets by angulation ; and e) maximum forces (gf) exerted by ligation method kruskal - wallis showed a significant effect of angulation (p < 0.0001). with regard to conventional brackets, the mann - whitney test indicated differences in the maximum force values produced by different angulations. it was observed that zero - degree angulation differed from five - degree (p=0.0002) and ten - degree (p=0.0001) angulations, whereas five - degree angulation differed from the ten - degree one (p < 0.0002) (figures 2c and 2d). mean values showed that both conventional and self - ligating brackets produced lower frictional forces at angulations of 0, followed by 5 and 10. the mann - whitney test showed statistically significant difference (p < 0.0001) between maximum forces produced by attachment systems using conventional and self - ligating brackets, with the former (gemini) having greater maximum force compared to the latter (smartclip) (figure 2e). the interactions between each type of bracket and the different archwires and angulations are shown in figure 3. mean friction values (gf) of interactions between brackets and types of orthodontic wires at 0, 5 and 10. in the present study, conventional and self - ligating brackets were submitted to mechanical traction testing, combined with 0.019"x0.025 " stainless steel, nickel - titanium, and beta - titanium archwires at angulations of 0, 5, and 10 degrees. this methodology was adopted because, under clinical conditions, the bracket shifts along the archwire or vice - versa repeatedly during the sliding mechanics for a given period of time. although some authors had reported that the repeated use of brackets and wires can cause surface alterations in these materials, thus changing the friction coefficient values produced, the present study has demonstrated that no significant changes occurred in the friction force values regarding the use of one bracket during the mechanical tests repeated 10 times. the brackets used had mbt prescription (17 torque and 4 angulation), and torque was eliminated by attaching the brackets to a metallic circular piece with the same 17-degree inclination. angulation was eliminated with a 4-degree rotation in the metallic piece towards a counter - clockwise direction in relation to the angulation of the bracket slot so that the wires, which were attached by a fixed device, remained passive inside de slots. as the brackets had the same angulation and torque in the present study, the most important issue was to compare the frictional values found instead of quantifying the friction that occurs clinically in either material. nevertheless, elimination of torque allows comparison with other brackets requiring different prescriptions. in the present study, only static friction was evaluated as it is the force that must be overcome so that dental movement can be initiated. moreover, static friction is greater than the kinetic one, since the latter is related only to the maintenance of movement. the large standard deviation observed in statistical descriptions was also found in previous studies that evaluated different combinations of brackets / wires and it can be explained by the mean maximum forces that refer to different brackets, wires and angles together with the heterogeneity inherent to each one. scanning electron microscopy showed the roughness increases in the following order : stainless steel, nickel - titanium, and beta - titanium (figures 4a, 4b, and 4c). mechanical tests showed that the friction results followed the same order of roughness for different combinations of wires and conventional brackets, meaning that the surface roughness of the wire seems to influence the frictional values. previous studies have also found low friction for stainless steel archwires, followed by nickel - titanium and beta - titanium ones. however, the self - ligating brackets (smartclip) exhibited lower friction force when combined with nickel - titanium, stainless steel, and beta - titanium wires, in this order. a possible explanation is the fact that smartclip has nickel - titanium clips, which in contact with wires of the same material could produce lower frictional values. it was not previously found in the literature, since, to our knowledge, there are no studies evaluating the smartclip brackets associated with different types of wire. therefore, further researches should be performed in order to quantify this issue of yielding virtually null friction values. a) stainless steel wire (200x) ; b) nickeltitanium wire (200x) ; and c) beta - titanium wire (200x) before mechanical testing with regard to the angulation between bracket and orthodontic wire, the results demonstrated that frictional values were statistically significant and directly proportional to the increase in angulation, both in conventional and self - ligating brackets, a finding also corroborated elsewhere. interestingly, the greater the angulation the lower the friction difference between self - ligating and conventional brackets. this probably occurs because there is a space between the wire and the slots of self - ligating brackets, at zero - degree angulation, thus yielding virtually null frictional values. on the other hand, the ligation force produced by conventional brackets causes the wire to be in contact with lateral walls of the slot, thus yielding binary forces that increase the friction. moreover, the ligation force is not present in the self - ligating brackets. our results show that even at different angulations, the self - ligating brackets showed significantly lower friction force values than the conventional brackets, thus the self - ligating brackets can be an interesting option for the translation of a tooth or block of teeth using sliding mechanics. in clinical orthodontics, when the tooth begins to move the wires start to contact the corners of the bracket and binding (angulation) starts. finite element analysis has shown that 60% to 80% of the applied orthodontic force is lost during retraction by sliding mechanics of a canine along a rectangular archwire. since the orthodontic force must overcome the frictional resistance, minimizing friction will result in reduced levels of the clinically applied force needed for moving the teeth. low friction may also be desired during the orthodontic phase of alignment, however, in the last phases, higher friction force can be used to obtain a three - dimensional control of the tooth position. a recent study evaluating how self - ligating brackets compared to conventional brackets in terms of orthodontists ' perceptions showed that the first ones were preferred during the initial stage of treatment, but practitioners preferred conventional brackets during the finishing stages. the solution could be a self - ligating bracket that can be ligated if necessary. there seems to be agreement about the use of round wires for self - ligating brackets as such combination produces significantly lower friction compared to that of conventional brackets. these results allow us to conclude that the same outcome occurs even in rectangular wires, which is in accordance with some previous studies but in discordance with other authors, who found no significant difference or observed greater friction in the self - ligating brackets. these discrepancies can be attributed to differences between experimental models, including shapes, sizes and prescriptions of self - ligating brackets, as well as clips or caps made of different materials. in vitro studies contribute to a better understanding of the frictional resistance in self - ligating brackets, but they do not replicate what really occurs during clinical dental movement. the frictional values found in the present study should be used as mean values for comparison of the effects of different types of brackets, archwires, and angulations instead of in vivo friction quantification. investigation of frictional effetcs in vivo is needed so that bracket systems may be further refined to reduce friction and optimize sliding mechanics. self - ligating brackets showed significantly lower friction compared with conventional brackets, even with increased bracket / wire angulation ; 2. among the combinations tested, it was observed that self - ligating brackets (smartclip) associated with nickel - titanium archwire produced the lowest friction. | objectiveto compare the influence of archwire material (niti, beta - ti and stainless steel) and brackets design (self - ligating and conventional) on the frictional force resistance.material and methodstwo types of brackets (self - ligating brackets - smartclip, 3m / unitek - and conventional brackets - gemini, 3m / unitek) with three (0, 5, and 10 degrees) slot angulation attached with elastomeric ligatures (tp orthodontics) were tested. all brackets were tested with archwire 0.019"x0.025 " nickel - titanium, beta - titanium, and stainless steel (unitek/3 m). the mechanical testing was performed with a universal testing machine emic dl 10000 (emic co, brazil). the wires were pulled from the bracket slots at a cross - head speed of 3 mm / min until 2 mm displacement.resultsself-ligating brackets produced significantly lower friction values compared with those of conventional brackets. frictional force resistance values were directly proportional to the increase in the bracket/ wire angulation. with regard to conventional brackets, stainless steel wires had the lowest friction force values, followed by nickel - titanium and beta - titanium ones. with regard to self - ligating brackets, the nickel - titanium wires had the lowest friction values, significantly lower than those of other materials.conclusioneven at different angulations, the self - ligating brackets showed significantly lower friction force values than the conventional brackets. combined with nickel - titanium wires, the self - ligating brackets exhibit much lower friction, possibly due to the contact between nickel - titanium clips and wires of the same material. |
the world health organization predicts that by the year 2020, depression will be the first cause of invalidity in the world followed by cardiovascular disease. although various psychological and pharmacological treatments exist for the treatment of depression (for a review, see), difficult access to psychotherapy due to monetary or transportation issues and/or low acceptance of antidepressant treatments has led to the development of other forms of treatments. in recent years, there has been a rise in the use of self - help treatments that provide users with information on how to self - identify their problems and propose methods to overcome them. the most frequent form of delivery includes books (bibliotherapy) and use of the internet (internet - based therapy ; for a review, see [3, 4 ]). guided self - help treatment implies that some form of support from a therapist is delivered to the patient, either through self - help booklets developed by health professionals or scientists, or via support provided directly by a therapist in addition to utilization of the self - help material. in contrast, unguided self - help represents the use of self - help books available in bookstores with no additional support from a health professional [4, 6 ]. unguided self - help books represent books written by recognized or unrecognized specialists in the field that provides guidance on how to live a better life, be happy, and so forth [4, 7 ]. two dimensions of self - help are generally proposed in unguided self - help books [4, 6 ], that is, problem - focused or growth - oriented. problem - focused self - help books represent books that extensively discuss the nature of problems one can encounter and how to recognize and circumvent them (this category of self - help books has also been named victimization books). in contrast, growth - oriented books present inspirational messages about life and happiness and propose various methods of coping and development of new skills (this category of self - help books has also been named meta - analyses have shown that guided self - help interventions for depression are more effective than absence of treatment, and guided self - help interventions present similar efficacy to psychotherapies and/or antidepressants [2, 8, 9 ]. moreover, guided self - help interventions are now recommended by the national institute for health and clinical excellence. although guided self - help interventions presented in books or via the internet have been extensively studied [2, 11, 12 ], unguided self - help books have received very little attention. some studies suggest that reading problem - focused self - help books can have positive effects in the treatment of some problematics such as marital conflict and general emotional disorders, and others suggest that unguided self - help books could be used to prevent the incidence of depression in high risk groups. however, at this point, there is a lot of cynicism about the potentially positive effects of unguided self - help books, with some authors claiming that self - help books are fraudulent, and others suggesting that buying self - help books may be part of a false hope syndrome. for many authors, the major limitation of unguided self - help books is their one - size fits all approach in which advice is given without taking into account the personality and/or diagnosis and/or personal circumstances of the reader [1618 ]. this later point brings attention to the lack of information that exists on the type of readership of unguided self - help books. the few studies that were performed to date showed that consumers of self - help books come from all levels of educational backgrounds, socioeconomic status, and positions, although women tend to consume more self - help books than men. notwithstanding, the literature is inconsistent in describing whether consumers of self - help books differ from nonconsumers in terms of personality. one study showed that consumers of self - help books present higher neuroticism than nonconsumers, a second study did not find such a difference [4, 21 ], and a third reported that reading self - help books is associated with an increase in self - actualization. although these data are interesting, they do not inform us about the characteristics of self - help book readership. indeed, studies assessing why certain people are attracted to self - help books propose that many adults are active consumers of self - help books as a way of self - diagnosing and/or treating their own psychological distress, and that this would mainly result from the stigma surrounding depression in adults [22, 23 ]. in this sense, the active proliferation of the self - help book industry would mainly reflect the underlying depressive symptomatology of individuals, and this industry would be highly successful because individuals need some sort of autotreatment to alleviate their depressive mood and/or disorder. if this is the case, one could predict that active consumers of self - help books might present increased stress physiology and increased depressive symptomatology when compared to nonconsumers of self - help books. impairment in the regulation of the hypothalamic - pituitary - adrenal (hpa) system has been reported in acute and/or chronic episodes of depression [24, 25 ]. the impaired negative feedback of the hpa system ultimately leads to hypersecretion of crf, shifting the activity of the hpa axis to greater production of glucocorticoids (cortisol in humans ; for a review, see). in this first pilot study, we assessed whether consumers of unguided self - help books present differences in diurnal levels of cortisol, stress reactive cortisol levels, depressive symptoms, and personality traits in comparison to nonconsumers. personality and depressive symptomatology are important factors to measure in consumers of self - help books as they could potentially be important predictors of increased stress reactivity and/or depressive symptomatology. in line with the goals of pilot studies (for a review on pilot studies, see), we performed this first small scale preliminary study in order to evaluate the feasibility of studying self - help book consumers and potential adverse events related to these types of studies. most importantly, to guide future research, we aimed to generate effect sizes for our dependent variables (cortisol levels, depressive symptomatology, and personality factors) in order to determine the appropriate sample size needed for a larger experimental study on this issue that has received no empirical evidence. the definition of self - help books that we used in this research project is the definition given by the neuropsychologist paul pearsall who defines self - help books as books that give advice on how to change your life, attain happiness, find true love, lose weight, and more. we defined consumers of self - help books as individuals who have bought or browsed a minimum of four self - help books in the previous year. we felt that including only individuals who have bought (and not browsed) four self - help books might bias the sample toward people from higher socioeconomic status, which could then have a significant impact on the results. questions about the number and types of books bought and/or browsed by the participants were asked during a recruitment phone interview. participants defined as consumers of self - help books were asked to provide the names of these books during the phone interview in order to ascertain whether they fell into our category of consumers of self - help books. online recruitment was performed using advertisements posted on general or university websites. since the purpose of the study was to compare two different populations (self - help books ' consumers and nonconsumers), two different types of advertisement nonconsumers were recruited via an advertisement featuring a study on personality traits and stress, without any mention on self - help books consumption. this procedure was used to ensure that the nonconsumer group was not composed of people against this type of literature but only not attracted to it. these potential nonconsumer participants were then screened on the phone and additional questions were asked to validate that they had never read or browsed that kind of self - help literature and that they were not attracted to it. only those individuals who did not read self - help books and were not attracted to them self - help book consumers were recruited via an advertisement stating that we were looking for adults who were active consumers of self - help books for a study on personality and stress. during their visit to the lab, participants from that group were evaluated on their preference for problem - focused versus growth - oriented self - help books using a classification task that we developed. in this task, we presented the consumer group with 10 books and, after giving them 10 minutes to browse the various books, we asked them to sort out the five books that they would buy given the opportunity. five of the ten books proposed a growth - oriented approach (e.g., the power of positive thinking), while five of them proposed a problem - focused approach (e.g., how can i forgive you ? : the courage to forgive, the freedom not to). books used to assess preference for growth - oriented (books # 1 to # 5) versus problem - focused (books # 6 to book # 10) self - help books. growth - oriented self - help books are the following:the power of positive thinking by norman vincent peale, 1952.how to stop worrying and start living by dale carnegie, 1990.you're stronger than you think by peter ubel, 2006.you can be happy no matter what by richard carlson, 2006.choices that change lives : 15 ways to find more purpose, meaning, and joy by hal urban, 2006. the power of positive thinking by norman vincent peale, 1952. choices that change lives : 15 ways to find more purpose, meaning, and joy by hal urban, 2006. problem - focused self - help books are as follows:(6)why is it always about you ? : saving yourself from the narcissists in your life by sandy hotchkiss, 2003.(7)i'm ok, you 're my parents by dale atkins, 2004.(8)shame and guilt by jane middelton - moz, 1990.(9)self nurture : learning to care for yourself as effectively as you care for everyone else by alice d. domar and henry dreher, 2001.(10)how can i forgive you ? : the courage to forgive, the freedom not to by janis a. spring, 2005.a ratio of growth - oriented / problem - focused preference was calculated by adding the number of books from each pole that fell within the category of books to buy by the participants. for example, if a participant stated that they would buy three growth - oriented books and two problem - focused books, this participant received a ratio of 3/2 = 1.5. with this ratio, the larger the number, the greater the attraction to growth - oriented books and vice versa for problem - focused books. participants displaying a ratio of 4 and above were classified in the growth - oriented group as scores lower than 4 were closer to chance level for preference assessment. when presented with books, participants were not aware that the goal of this task was to determine their attractiveness to growth - oriented versus problem - focused books. the reason for this is that it can be predicted that most people would choose not to select problem - focused books if told about the two poles (growth - oriented versus problem - focused), given the negative social value that may be attached to problem - focused self - help books. why is it always about you ? : saving yourself from the narcissists in your life by sandy hotchkiss, 2003. i 'm ok, you 're my parents by dale atkins, 2004. self nurture : learning to care for yourself as effectively as you care for everyone else by alice d. domar and henry dreher, 2001. how can i forgive you ? : the courage to forgive, the freedom not to by janis a. spring, 2005. participants from both groups were screened over the phone prior to recruitment in order to make sure that they fulfilled our inclusion criteria. exclusionary criteria included presence or history of neurological or psychiatric conditions, diabetes, respiratory disease, asthma, infectious illness, thyroid or adrenal dysfunctions, obesity (body massive index > 30), any glucocorticoid or cardiovascular altering medications (e.g., antidepressants, diuretics, antiasthmatics, and b - blockers), and excessive use of drugs or alcohol. thirty - two healthy men and women aged between 18 and 65 (m = 36.03 16.09) participated in this study. eighteen self - help consumers (75% female) and 14 nonconsumers (75% female) were recruited. the average age of the consumers was 38.33 years old (3.5) and 33.07 years old (4.72) for the nonconsumers. within the group of self - help books consumers, 11 individuals were classified as having a preference for problem - focused books (hereon referred to as the problem - focused group) and 7 were classified as having a preference for growth - oriented books (hereon referred to as the growth - oriented group). three women were menopausal (one in each condition) and all others were tested in the follicular phase of their menstrual cycle. all participants provided written informed consent and were compensated for their participation in the study. this study was approved by the research ethics board of the mental health university institute respecting the canadian tri - council 's policy statement for the ethical conduct for experimentation using humans, guided by the world medical association 's declaration of helsinki. we measured personality traits in order to determine whether preference for problem - focused or growth - oriented books would be associated with personality traits that could predict cortisol levels. personality traits were measured using the neo five factor inventory (neo - ffi). this 60-item personality inventory was developed as a short form of the neo - pi. extraversion, openness to new experiences, agreeableness, and conscientiousness. participants are asked to respond on a likert - scale with the extent to which they agree with each item (strongly agree to strongly disagree). the mean coefficient alpha for the revised inventory scale was 0.77. since low sense of control is linked to the cortisol stress response, locus of control was measured in order to explain any potential physiological stress response differences between groups. using a six - point likert scale (not at all true to very true), the bcc yields four scales including self - concept of own competence, control expectancy : internality, control expectancy : externality, and control expectancy : chance control. the mean alpha for this questionnaire is 0.82 for young students and 0.83 for the elderly. self - esteem was measured using the 10-item rosenberg self - esteem scale (res), which is a unidimensional scale that measures personal worth, self - confidence, self - respect, and self - depreciation. participants are asked to respond on a four - point scale with the degree to which they agree with each item (strongly agree to strongly disagree). the scale shows good reliability (= 0.80) and is a valid test of global self - worth. self - reported depressive symptoms were assessed using the 21-item beck depression inventory ii (bdi ii), which is a unidimensional scale that assesses diverse psychological and physiological symptoms related to depression on a four - point scale. the bdi 's total score ranges from 0 to 63, displaying a continuum of depression related symptoms. they were asked to provide samples on two different days, separated by 3 days, with the first day of sampling starting 3 days after their visit to our laboratory. saliva was collected using passive drool at the time of awakening and 30 minutes after awakening in order to calculate the cortisol awakening response (car). it has been reported that during the first hour after awakening, cortisol levels show an acute increase. cortisol determination during this time of day appears to represent a response of the hpa axis to an endogenous stimulation and is a reliable indicator of diurnal hpa activity. participants were also asked to provide three additional samples at 14:00 and 16:00 and before bedtime. these sampling times have been shown in previous studies to be reliable markers of the diurnal cycle of cortisol secretion [35, 36 ]. as the nonadherence to saliva sampling in ambulatory settings has been shown to exert a significant impact on the resulting cortisol profile, a individuals were asked to record the exact time of each saliva sample to assess participants ' compliance. the tsst is an established and highly effective psychosocial stress paradigm used to provoke activation of the hpa axis. the version of the tsst that we used in the current study was somewhat different from the original version as we used a panel - out the reason why we made the decision to use the panel - out condition in the current study is that the research assistants who acted as judges in our experiment were younger than the participants. we have shown in previous studies that environmental factors such as age of research assistants can lead to a spurious stress response in some individuals [39, 40 ], and, consequently, we wanted to limit contact between our participants and the judges. the panel - out version of the tsst was used in many of our studies. while one study reported no significant differences between the panel - in and the panel - out conditions in men, another study has reported higher cortisol reactivity in the panel - in compared to the panel - out condition in women. our laboratory found no significant differences in terms of cortisol reactivity between the panel - in and panel - out condition when comparing 140 men, women in the luteal phase of their menstrual cycle, and women taking oral contraceptives. therefore both conditions induce a stress response (article in preparation). in summary, the tsst involves an anticipation phase (10 minutes) and a test phase that comprises 10 minutes of public speaking. the test phase is divided into a mock job interview (5 minutes) followed by mental arithmetic (5 minutes). throughout their performance, participants face a one - way mirror and a camera. behind this mirror, two confederates act as judges and pretend to be experts in behavioral analysis while observing the participants and communicating with them via an intercommunication system. a total of eight saliva samples for cortisol determination were obtained at 20 min and 10 min (baseline), immediately before the tsst as well as + 10, + 20, + 30, + 40, and + 50 min after the tsst began. during recruitment, potential participants were told on the phone that the study consisted of one testing day, lasting two hours, and two days of saliva sampling at home were required following the testing session., participants were tested in the afternoon in order to obtain adequate cortisol reactivity to the psychosocial stressor and to control for possible differential effects of the circadian cortisol patterns. upon arrival at the laboratory, participants were asked to read and sign an informed consent form. thereafter, they were asked to answer the psychological questionnaires, which took approximately 15 minutes. participants provided saliva samples by filling a small plastic vial with 1 ml of pure saliva (i.e., passive drool). participants were instructed about the tsst and prepared their mock job interview speech during a 10-minute anticipation phase. participants then had to do the verbal (5 minutes) and mental arithmetic (5 minutes) tasks. after the recovery period, they were debriefed with regard to the goal of the public speaking task. participants were debriefed about the general hypothesis of the study when they brought the home saliva kit back to the lab. dominique walker 's laboratory at the douglas institute research center by radioimmunoassay using a kit from dsl (diagnostic system laboratories, inc., texas, usa). the intra - assay and interassay coefficient of variation for these studies are 4.6% and 5%, respectively. the limit of detection of the assay is 0.01 dl, and all samples were assayed in duplicates. the first set of analyses was done with group (2 levels : consumer versus nonconsumer) as the independent variable to test whether as a group, consumers of self - help books present different psychoneuroendocrine profiles when compared to nonconsumers of self - help books. in the second set of analyses, consumers of self - help books were split as a function of their preference for growth - oriented or problem - focused books and compared with the nonconsumer group, using group (3 levels : growth - oriented, problem - focused, and nonconsumer) as the independent variable. for each analysis, personality traits (as measured by the five neo subscales neuroticism, extroversion, openness, agreeableness, and conscientiousness), locus of control, self - esteem, and depressive symptoms were included in univariate anovas. for cortisol, both diurnal and reactive cortisol values followed a normal distribution and, for this reason, raw data of cortisol were used for all analyses. for each salivary cortisol analysis, sex and body mass index (bmi) were entered as covariates as these are factors associated with cortisol production. diurnal cortisol secretion was calculated using the mean concentration of cortisol for each sample on both days of saliva sampling, resulting in five cortisol means. in order to determine whether self - help book use was related to diurnal cortisol secretion, we calculated the car as well as using the trapezoidal method to calculate area under the curve with respect to ground (aucg ; basal cortisol). in order to determine whether self - help book use was related to reactive cortisol secretion, we calculated the area under the curve relative to increase (auci ; reactive cortisol). these analyses were made in order to determine whether there were significant group differences in terms of basal and reactive cortisol levels between groups. to ascertain the participant 's compliance regarding the diurnal saliva sampling, time when saliva samples were taken was computed into a mean in each group and anovas were used to calculate whether there were significant group differences. finally, we calculated the effects size for the comparison between consumers versus nonconsumers and the comparison between preference for growth - oriented or problem - focused books in order to determine (1) the statistical power of the significant differences observed and (2) the appropriate sample size for a larger full scale study. in terms of feasibility, we found it quite easy to recruit consumers of self - help books as no differences were observed in terms of time and cost of recruitment of this population compared to other populations we have tested in the past. recruitment of nonconsumers was more time consuming because we had to validate a posteriori the nonconsumption of self - help books in the individuals calling us to participate in the research but, overall, the burden was not high on recruitment. no adverse events were reported during recruitment and testing, although the research assistants working on this project reported that the testing of consumers of self - help books took generally longer than testing of nonconsumers because consumers were generally more verbal and interacted more with the assistants during testing. figure 1 shows that participants displayed a normal diurnal cortisol rhythm as well as an increase in cortisol in response to the tsst. preliminary analysis also revealed that groups did not differ in terms of time of saliva sampling (all p values > 0.763) and that groups did not differ in terms of age, bmi, years of education, or sex of the participants (all p values > 0.165). also, no group differences were observed for personality traits (all p values > 0.112), locus of control (all p values > 0.162), and self - esteem (all p values > 0.295) when we contrasted the consumers to the nonconsumers, and when we split the consumers into those individuals with a preference for growth - oriented or problem - focused books. we first contrasted consumers and nonconsumers on basal / reactive cortisol levels and depressive symptomatology. we found no differences between consumers and nonconsumers on diurnal cortisol levels aucg (f(1,30) = 0.080, p = 0.780 ; see figure 2(a)), car (f(1,30) = 0,31, p = 0.862 ; see figure 2(b)), and reactive cortisol auci (f(1,30) = 2.172, p = 0.151 ; see figure 2(c)). for depressive symptomatology, the analysis showed a significant between - group effect (f(1,31) = 6,186, p = 0.019), with the consumer group displaying a higher depressive mean score (7,28 1, 01 versus 4,14 0, 57) when compared to nonconsumers (see figure 2(d)). in a second set of analyses splitting the consumer group into those individuals with a preference for growth - oriented or problem - focused books, we found no group differences in aucg diurnal cortisol levels (f(2,29) = 0.789, p = 0.464 ; see figure 3(a)) or car (f(2,29) = 0.015, p = 0.985 ; see figure 3(b)). we did, however, find a significant group difference in reactive cortisol levels auci [f(2,29) = 4.079, p = 0.028 ]. post hoc analyses showed that the growth - oriented group presented a significantly greater auci when compared to the nonconsumer group (p = 0.040 ; see figure 3(c)). no differences were found between the problem - focused group and nonconsumer group (p = 1.00) or between the problem - focused group and the growth - oriented group (p = 0.10). strikingly, when one looks at cortisol levels in response to the tsst in the group of nonconsumers (see figures 1 and 3(d)), one can see that the cortisol response appears to be quite low compared to that of consumers of self - help books. this could represent either a hyporesponse to the tsst in the nonconsumers of self - help books, or a hyperresponse to the tsst in the consumers of growth - oriented self - help books (see figure 1). in order to contextualize the cortisol response to the tsst in the group of nonconsumers, we extracted compiled databases on reactive cortisol in response to tsst (we have more than a thousand participants tested with the same protocol on the tsst in our databases). we extracted data for sex- and age - matched controls and compared their response to the tsst to that of the nonconsumers. we found no significant differences between the cortisol levels in response to the tsst among participants from our previous studies when compared to nonconsumers of self - help books. this suggests that the group of nonconsumers presents a typical cortisol response to the tsst but that the effect seems blunted given the hyperreactivity observed in the group of consumers of growth - oriented self - help books. when we compared groups on depressive symptomatology, we found a group difference in depressive scores [f(2,29) = 5.876, p = 0.008 ]. post hoc analyses showed that the problem - focused group presented a significantly higher score on the bdi than the nonconsumer group (p = 0.006 ; see figure 3(d)). no differences were found between the growth - oriented group and nonconsumer group (p = 0.795) or between the problem - focused group and the growth - oriented group (p = 0.095). cohen 's f effect sizes for group differences on depressive symptomatology were large for both the comparison between consumers and nonconsumers of self - help books (f = 0.454) and between growth - oriented and problem - focused groups when compared to nonconsumers (f = 0.63). we found a similar large effect size for the group difference on reactive cortisol levels when comparing the growth - oriented and problem - focused groups to the nonconsumer group (f = 0.507). table 1 presents the effect size for all the comparisons performed in the present study. we also calculated the number of participants that would be needed in a future larger scale study in order to have sufficient statistical power to find group differences on the variables tested. this analysis showed that between 150 and 1000 participants would be needed to find any significant differences in basal cortisol levels as a function of self - help book consumption. by contrast, a much smaller sample size would be needed for reactive cortisol levels (n = 40) and depressive symptoms (n = 30), based on the medium / large effect sizes found in this small pilot study. the first goal of this pilot study was to determine whether consumers and nonconsumers of self - help books differ in physiological and/or psychological markers of stress. we found no differences in basal and reactive cortisol levels but reported that consumers of self - help books present increased depressive symptomatology when compared to nonconsumers of self - help books. although this difference was obtained with a small sample size, the effect size of the difference was large (f = 0.454). this first result confirms previous suggestions stating that individuals may buy self - help books in order to self - diagnose and/or treat their psychological distress. the second goal of this pilot study was to assess whether the type of self - help books one has a preference for is a better marker of physiological and psychological markers of stress than general interest in self - help books as a whole. first, we found that consumers of problem - focused self - help books presented significantly more depressive symptoms than consumers of growth - oriented self - help books. this later result shows that the group differences observed between consumers and nonconsumers of self - help books on depressive symptoms is mainly driven by consumers of problem - focused self - help books. the increased depressive symptoms found in consumers of problem - focused self - help books converge with the literature on depressive symptomatology suggesting that these symptoms are associated with higher self - victimization. future studies on self - help books consumers should therefore measure self - victimization in order to verify if it mediates the association between preference for problem - focused self - help books and depressive symptomatology. while we can not ascertain that consumers of this literature chose to read these kinds of books because they show higher depressive symptoms, it is possible that using this literature leads to higher depressive symptomatology. since our cross - sectional design does not allow us to determine the directionality of the association found, a longitudinal study would be necessary to test this. given the large effect size obtained for this group difference in depressive symptomatology, sample sizes in the range of 20 to 30 participants per group would provide sufficient statistical power to confirm group differences. in future studies of these populations, it could be interesting to assess potential cognitive behavioral tendencies that have been linked to depression. for example, rumination, guilt, mind wandering, and worries [39, 49, 50 ] are behavioral tendencies among individuals with depressive symptomatology that may be more prominent among consumers of problem - focused books. indeed, these cognitions and/or behaviors have been shown to be linked to both depressive symptomatology and stress physiology and could act as mediators in the association between problem - focused self - help books consumption and presence of higher depressive symptomatology. measuring them in future studies could therefore strengthen our understanding of the psychoneuroendocrine profile of consumers of problem - focused self - help books. the groups did not differ on diurnal cortisol levels, when consumers were compared to nonconsumers and when the consumer group was split as a function of preference for problem - focused or growth - oriented self - help books. also, the effect sizes for these differences were very low and we calculated that sample sizes between 150 and > 1000 individuals would be necessary to find any statistical differences in diurnal cortisol levels between groups. it is important to note that diurnal cortisol rhythm has been shown to be very stable in healthy populations and that most differences observed in basal cortisol secretion are observed in clinical populations [34, 51 ]. therefore, the fact that we recruited healthy consumers of self - help books and that we excluded participants presenting psychopathologies might explain why we were not able to detect any differences in terms of diurnal cortisol levels. therefore, in future studies, it would be interesting to compare the diurnal cortisol profile of clinically depressed individuals who consume self - help books and clinically depressed nonconsumers if one is interested in measuring diurnal cortisol levels as a function of consumption of self - help books. when we compared groups on reactive cortisol levels, we found that consumers of growth - oriented self - help books are significantly more reactive to a laboratory psychosocial stressor when compared to consumers of problem - focused self - help books or nonconsumers of self - help books and the effect size was large for this group difference (f = 0.507). this is an important finding as we had previously found no significant difference between consumers and nonconsumers of self - help books on reactive cortisol levels. this result suggests that it is the preference for a particular type of self - help books (here, growth - oriented self - help books) that is associated with increased production of cortisol in response to a psychosocial stressor and not general attraction toward self - help books more generally. this suggests that the increased stress reactivity to the tsst that we observed in consumers of growth - oriented self - help books can not be explained by one 's belief that one has control over the situation, as suggested by this type of self - help books. one mechanism that could explain this higher reactivity might be some other personality trait inherent to people who are attracted by this type of literature. even though we measured basic personality traits using the neo - ffi and did not find any differences for five factors measured, it is still possible that some other personality traits that elude measurement with the neo - ffi could explain the greater cortisol reactivity reported in individual having a preference for growth - oriented self - help books. on the other hand, we do know that hpa axis reactivity to stressors plays a critical role in providing energy resources to face the environment and is therefore both adaptive and necessary. therefore, another possible mechanism that could explain the higher stress reactivity observed in individuals having a preference for growth - oriented self - help books is that coping mechanisms taught in this literature allow these consumers to react in a more effective way to their environment as required by the situation. this suggestion goes along with studies performed in depressed patients and normal individuals showing that greater use of escape - avoidance coping (unhealthy coping mechanism) is associated with less cortisol reactivity. the present pilot study is characterized by a number of limitations, including a small sample size, a cross - sectional protocol, and an underrepresentation of men. although we made sure that our groups were equivalent in a number of factors that are known to have effects on the physiological stress response (such as sex, sex hormones, socioeconomic status, age, and bmi), it is still possible that some of the negative findings reported here are due to a type ii error due to small sample size. additionally, while the current pilot study relied on the use of a daily sampling questionnaire in order to assess participant 's compliance when collecting diurnal cortisol saliva samples, this method has been shown to be less reliable than the use of electronic devices. however, a recent study suggests that multiday sampling somewhat tempers this effect in comparison to only one day of sampling [42, 55 ]. future studies on consumers of self - help books should consider using electronic devices in the assessment of diurnal cortisol as this method was shown to be more reliable. furthermore, even though locus of control did not explain the intergroup differences in terms of stress reactivity and depressive symptoms, other factors such as coping strategies that have not been measured in the present study may have predictive value for cortisol secretion in consumers of problem - focused versus growth - oriented self - help books. future studies assessing psychological and/or physiological markers in consumers of self - help books should therefore consider measuring coping strategies, which may explain some of the observed associations between variables. also, as mentioned earlier, the cross - sectional design prevents us from determining any directionality between variables and, consequently, a longitudinal design measuring stress hormones before and after utilization of self - help books could help disentangle the cause - effects relationship of the self - help book industry on physiological and psychological markers of stress. finally, given the differences in psychological and biological markers of stress observed in consumers of problem - focused versus growth - oriented self - help books, it would be important in future studies to determine whether one group of consumers benefits more from a particular type of unguided self - help literature when compared to the other group. although we found no general difference in cortisol levels when comparing consumers and nonconsumers of self - help books, we found that consumers of growth - oriented self - help books are more stress reactive when facing a social evaluative threat, while consumers of problem - focused self - help books show higher depressive symptomatology when compared to nonconsumers of self - help books. our results therefore suggest that preference for a particular genre of self - help book (problem - focused versus growth - oriented) may be associated with increased stress and/or mental burden in consumers of self - help books. every year, the self - help industry generates billions of dollars in the us and canada making it one of the most lucrative businesses in north america. clinicians are now using guided bibliotherapy to help patients deal with various life conditions and we know that unguided self - help books differ greatly in terms of quality of valid scientific information provided. it is predicted that the self - help book industry will only grow in future years. consequently, it is essential to understand the impact of different types of self - help books on individuals ' physical and mental health. | the self - help industry generates billions of dollars yearly in north america. despite the popularity of this movement, there has been surprisingly little research assessing the characteristics of self - help books consumers, and whether this consumption is associated with physiological and/or psychological markers of stress. the goal of this pilot study was to perform the first psychoneuroendocrine analysis of consumers of self - help books in comparison to nonconsumers. we tested diurnal and reactive salivary cortisol levels, personality, and depressive symptoms in 32 consumers and nonconsumers of self - help books. in an explorative secondary analysis, we also split consumers of self - help books as a function of their preference for problem - focused versus growth - oriented self - help books. the results showed that while consumers of growth - oriented self - help books presented increased cortisol reactivity to a psychosocial stressor compared to other groups, consumers of problem - focused self - help books presented higher depressive symptomatology. the results of this pilot study show that consumers with preference for either problem - focused or growth - oriented self - help books present different physiological and psychological markers of stress when compared to nonconsumers of self - help books. this preliminary study underlines the need for additional research on this issue in order to determine the impact the self - help book industry may have on consumers ' stress. |
unless otherwise specified, all compounds were manipulated using a glovebox or standard schlenk line techniques with an n2 atmosphere. anhydrous tetrahydrofuran (thf) was purchased from aldrich in 18 l pure - pac containers. anhydrous acetonitrile, benzene, dichloromethane, diethyl ether, and thf were purified by sparging with nitrogen for 15 min and then passing under nitrogen pressure through a column of activated a2 alumina (zapp s). anhydrous n, n - dimethylformamide (dmf) was purchased from aldrich and stored over molecular sieves. cd2cl2 was purchased from cambridge isotope laboratories, dried over calcium hydride, then degassed by three freeze pump thaw cycles and vacuum - transferred prior to use. h nmr spectra were recorded on a varian 300 mhz instrument, with shifts reported relative to the residual solvent peak. f nmr spectra were recorded on a varian 300 mhz instrument, with shifts reported relative to the internal lock signal. ln(otf)3 (ln= la, ce, nd, eu, gd, tb, dy, yb, lu) were purchased from strem. a solution of ln(otf)3 (0.02 mmol) in dmf (2 ml) was added to lmn3cao4(oac)3(thf) (0.0274 g, 0.02 mmol) solution in dmf (1 ml). the dark brown solution was stirred for an hour and then diethyl ether was added to precipitate the red - brown product. the dark brown ch2cl2 filtrate was concentrated in vacuo and crystallized from ch2cl2/dmf / diethyl ether (1:1:5, v / v) to yield the product as red - brown crystals. 1-la : h nmr (cd2cl2, 300 mhz) : 16.6, 11.7, 11.1, 9.2, 7.9, 5.9, 5.3, 4.7, 3.0 1.2, 0.9, 18.5 ppm. calcd for c72h68f3lamn3n9o19s : c, 49.24 ; h, 3.90 ; n, 7.18. found : c, 49.52 ; h, 3.88 ; n, 7.03. 1-nd : h nmr (cd2cl2, 300 mhz) : 16.3, 11.5, 10.5, 10.1, 9.5, 5.6, 5.3, 3.5, 1.3, 0.9, 19.0 ppm. calcd for c70h62f3mn3n8ndo18s : c, 49.42 ; h, 3.67 ; n, 6.59. found : c, 49.37 ; h, 3.80 ; n, 5.61. 1-ce : h nmr (cd2cl2, 300 mhz) : 18.3, 13.5, 13.1, 12.5, 11.5, 10.8, 7.3, 7.2, 3.3, 2.1, 17.0 ppm. calcd for c73h68cecl6f3mn3n8o18s : c, 44.92 ; h, 3.51 ; n, 5.74. found : c, 44.83 ; h, 3.27 ; n, 6.12. 1-eu : h nmr (cd2cl2, 300 mhz) : 15.9, 12.0, 11.7, 9.0, 6.8, 6.4, 5.4, 4.9, 4.0, 3.5, 2.7, 2.5, 1.7, 1.2, 1.0, 0.90, 20.46 ppm. calcd for c70h62euf3mn3n8o18s : c, 49.19 ; h, 3.66 ; n, 6.56. found : c, 49.24 ; h, 3.72 ; n, 6.59. 1-gd : h nmr (cd2cl2, 300 mhz) : 16.8, 11.9, 9.3, 6.0, 5.3, 3.0, 1.3, 1.2, 20.8 ppm. f nmr (cd2cl2, 282 mhz) : 77.2 ppm. anal. calcd for c70h62f3gdmn3n8o18s : c, 49.04 ; h, 3.65 ; n, 6.54. found : c, 49.13 ; h, 3.71 ; n, 6.64. 1-tb : h nmr (cd2cl2, 300 mhz) : 27.1, 17.9, 16.7, 15.3, 12.9, 9.0, 7.5, 6.7, 5.5, 3.6, 1.8, 1.4, 0.0, 1.4, 17.7 ppm. calcd for c70h62f3mn3n8o18stb : c, 48.99 ; h, 3.64 ; n, 6.53. found : c, 49.13 ; h, 3.58 ; n, 6.46. 1-dy : h nmr (cd2cl2, 300 mhz) : 36.1, 21.1, 18.2, 17.3, 15.7, 10.4, 8.0, 5.3, 4.6, 3.4, 2.0, 1.3, 4.0, 16.642.0 ppm. calcd for c70h62dyf3mn3n8o18s : c, 48.89 ; h, 3.63 ; n, 6.52. found : c, 48.84 ; h, 3.70 ; n, 6.62. 1-yb : h nmr (cd2cl2, 300 mhz) : 16.2, 14.5, 13.6, 9.3, 7.5, 5.6, 4.2, 3.7, 2.6, 1.7, 1.5, 1.2, 24.1 ppm. calcd for c73h69f3mn3n9o19syb : c, 48.62 ; h, 3.86 ; n, 6.99. found : c, 48.49 ; h, 3.66 ; n, 7.31. 1-lu : h nmr (cd2cl2, 300 mhz) : 14.2, 11.4, 11.0, 8.8, 7.3, 6.7, 5.5, 4.7, 3.7, 2.8, 2.2, 0.5, 23.4 ppm. f nmr (cd2cl2, 282 mhz) : 76.7 ppm. yield : 42% anal. calcd for c70h62f3lumn3n8o18s : c, 48.54 ; h, 3.61 ; n, 6.47. a solution of 1-gd (0.037 g, 0.02 mmol) in thf (2 ml) was added to a decamethylferrocene (0.007 g, 0.02 mmol) solution in thf (2 ml). a dark - brown precipitate was collected on a fritted glass funnel and washed with mecn (4 ml) to remove the remaining [cp2fe ]. the filter cake was washed with dcm, then dissolved in benzene / thf (1:1, v / v) and concentrated in vacuo. the resulting dark brown residue was recrystallized from dmf / benzene / diethyl ether (1:3:10, v / v) to yield the product as dark brown crystals. h nmr (c6d6, 300 mhz) : 7.1, 3.5, 3.2,1.6, 1.4, 1.1 ppm. calcd for c64h50cl2gdmn3n6o13 : c, 51.11 ; h, 3.35 ; n, 5.59. found : c, 50.92 ; h, 3.30 ; n, 5.81. performed in air, a solution of dy(otf)3 (0.02 mmol) in mecn (1 ml) was added to [lmn3cao4(oac)3(thf) ] (0.0274 g, 0.02 mmol) in dcm (2 ml). dark brown solution was stirred magnetically for overnight until the solution became homogeneous. a single - solvent system was tried but the reaction could not be completed because dy(otf)3 is poorly soluble in dcm and the camn3 cubane is poorly soluble in mecn. the product was recrystallized from h2o / mecn / diethyl ether (1:10:30, v / v) to yield the product as red - brown crystals. h nmr (cd2cl2, 300 mhz) : 80.9, 44.5, 22.6, 17.6, 14.3, 11.7, 8.3, 6.2, 5.3, 2.0, 1.5, 1.1, 0.3, 18.5 ppm. calcd for c69h63cl6dyf3mn3n9o19s : c, 43.09 ; h, 3.30 ; n, 5.10. found : c, 42.82 ; h, 2.90 ; n, 5.17. in glovebox, a solution of 1-ce (75 mg, 0.042 mmol) in dcm (5 ml) was added with a dcm (5 ml) solution of tris(p - tolyl)ammoniumyl triflate (29.4 mg, 0.047 mmol), which was synthesized following procedure in the literature. diethyl ether was added to wash the mixture until filtrate cake becoming colorless and solid was collected over celite. the filter cake was dissolved in dcm (5 ml) and the mixture was filtered through celite. the filtrate was concentrated in vacuo to yield crystalline dark brown product. h nmr (cd2cl2, 300 mhz) : 11.8, 9.7, 6.0, 4.5, 3.2, 23.2 pm. calcd for c76h73cecl4f6mn3n9o22s2 : c, 43.69 ; h, 3.52 ; n, 6.03. found : c, 43.97 ; h, 3.19 ; n, 6.30. | we report the syntheses and electrochemical properties of nine new clusters ([llnmniv3o4(oac)3(dmf)n]+ (ln = la3 +, ce3 +, nd3 +, eu3 +, gd3 +, tb3 +, dy3 +, yb3 +, and lu3 +, n = 2 or 3)) supported by a ligand (l3) based on a 1,3,5-triarylbenzene motif appended with alkoxide and pyridine donors. all complexes were obtained by metal substitution of ca2 + with lanthanides upon treatment of previously reported lmn3cao4(oac)3(thf) with ln(otf)3. structural characterization confirmed that the clusters contain the [lnmn3o4 ] cubane motif. the effect of the redox - inactive centers on the electronic properties of the mn3o4 cores was investigated by cyclic voltammetry. a linear correlation between the redox potential of the cluster and the ionic radii or pka of the lanthanide metal ion was observed. chemical reduction of the lmniv3gdo4(oac)3(dmf)2 cluster with decamethylferrocene, resulted in the formation of lgdmniv2mniiio4(oac)3(dmf)2, a rare example of mixed - valence [mmn3o4 ] cubane. the lanthanide - coordinated ligands can be substituted with other donors, including water, the biological substrate. |
breast cancer is the most common cause of morbidity and mortality among women worldwide.1 more than half of patients with breast cancer reside in developing countries, where resources to fight the disease are limited.2 most women suspected of having breast cancer are referred for breast biopsy to determine if the lesion seen on imaging is benign or malignant and whether further work - up and management is warranted. recently published data for screening studies showed that 2616 open biopsies were performed in the uk in 20082009 and that 69% of these were benign and 31% were malignant. the malignant biopsy rate has shown a decline from 2.04 per 1000 women in 19961997 to 0.40 per 1000 women in 20082009, and that the nonoperative diagnosis rate for cancers has increased from 63% to 95%.3 breast biopsies may be performed by open surgery (incisional or excisional biopsy) or by minimally invasive core needle biopsy. core needle biopsy involves removing small cores of breast tissue obtained by a shallow core needle inserted through the skin. core needle biopsy is less expensive, has fewer complications and a shorter recovery time, and incurs less psychological trauma. according to a systematic review, stereotactic - guided and ultrasonography - guided core needle biopsy procedures seem to be almost as accurate as open surgical biopsies, and have a lower complication rate.4 stereotactic breast biopsy using a 14-gauge needle is a reliable method of biopsy for nonpalpable breast lesions.5 the data suggest that 2%4% of women undergoing screening mammography are referred for biopsy of a mammographic abnormality.6 the majority of these patients have benign lesions. the effort and cost involved in further evaluation of these abnormalities is huge, and most of this is incurred by surgical biopsies. stereotactic breast biopsy is a less expensive and less invasive method of breast biopsy for evaluating mammographically detected suspicious breast lesions. we conducted this study to determine the yield of stereotactic core needle biopsy for evaluation of mammographically detected nonpalpable lesions, and its effect on cost saving for the patient. this descriptive study was conducted in the department of radiology at the aga khan university hospital in karachi from january 2005 to may 2010. all patients (n = 84) undergoing stereotactic breast biopsy in the department were included. the mammographic findings were categorized according to the breast imaging reporting and data system (bi - rads) assessment criteria. the biopsy was performed on a mammomat nova 3000 (siemens ag, berlin, germany) using an opdima stereotactic biopsy device. the specimens removed were radiographed to confirm that the sample contained the targeted suspicious microcalcifications or parenchymal density. the age of the patient, indication for mammography, histopathological outcome, and further management were recorded from patients personal files. the cost comparison was done by calculating the difference between the charges for stereotactic biopsy and open surgical biopsy per patient. of these, ten had incomplete medical records or follow - up and were excluded. of the remaining 74 women, prebiopsy mammograms were categorized as bi - rads ii in 25 cases, bi - rads iii in 16 cases, bi - rads iv in 27 cases, and birads v in six cases. the biopsy was performed in patients with bi - rads category ii mammograms either because of strong family history or a history of malignancy in the contralateral breast in order to decide on an appropriate management plan. similarly, in mammograms reported as bi - rads iii, a biopsy was performed because the clinician did not want to wait for 6 months to obtain a follow - up mammogram, to alleviate patient anxiety, or if the clinician was concerned that the patient would not attend the follow - up mammography. biopsy was performed in 23 patients to evaluate a suspicious parenchymal density or nodule and in the rest for suspicious microcalcifications seen on mammography. in a few patients, a mass was clinically palpable, but the clinician opted for image - guided biopsy as a means to target microcalcifications in the mass. among the patients who underwent biopsy, the remaining 59 patients had benign results on histopathology ; five of these patients had needle localization in the same area due to either suspicious mammographic findings or strong clinical suspicion of malignancy. fifty - four patients with benign results on histopathology were also followed up with mammograms. the follow - up period was 18 months to 5 years, and confirmed benign findings. excellent agreement was noted between mammographic abnormality and histopathological results with a kappa value of 8 (p = 0.000). the cost of stereotactic core biopsy at our institution is us$100, whereas open surgical biopsy after needle localization costs us$353. pakistan has a higher burden of breast cancer than other asian countries.7,8 image - guided breast biopsy techniques were developed to overcome the diagnostic problem of increasing numbers of suspicious lesions detected at mammography.7 stereotactic breast biopsy using a 14-gauge needle is an accurate method of tissue sampling for nonpalpable breast lesions, and was used for the first time in sweden in 1974 for fine needle aspiration cytology.5 improvement in techniques over the last 30 years have allowed this method to be used to assess both palpable and nonpalpable lesions of the breast in both screening and symptomatic settings.9 according to most published reports, the targets for core biopsy are all types of nonpalpable mammographic abnormalities, including a mass, calcifications, or a calcified mass.1012 the reported concordance for surgical and stereotactic biopsy is 87%96%.10 our results show that 80% of all lesions biopsied were benign, which is comparable with a study conducted by jackman.13 recently published screening data from the uk show that 2616 open surgical biopsies were performed in 20082009, of which 69% were benign and 31% were malignant.3 biopsy results strongly influence the algorithm for evaluation of suspicious lesions. the cost of stereotactic core biopsy at our institution is us$100 whereas the cost of open surgical biopsy after needle localization is us$353. open surgical biopsy requires a 1-day hospital admission, and is associated with more anxiety on the part of the patient about undergoing a procedure in an operating room. in contrast, stereotactic breast biopsy does not require hospital admission and the entire procedure is completed in 1 hour, it is associated with no scarring clinically or radiologically, and patients can resume their daily activities immediately after the procedure. our study showed a sensitivity of 100%, which is comparable with that in a study conducted by peters.14 in this study, all patients with benign findings on stereotactic biopsy underwent surveillance mammography which is routine clinical practice. no breast malignancy was missed on surveillance mammography after 2 years of follow - up mammography. however, the cobra (core biopsy after radiological localization)15 study reported a sensitivity of 97%. in cobra, all lesions, whether benign or malignant on stereotactic core needle biopsy, underwent open surgical biopsy. our specificity was 100% which is similar to the 99% specificity reported by the cobra study, in which 973 patients under went stereotactic core needle biopsy followed by open surgical biopsy if the results of stereotactic core needle biopsy were benign, and therapeutic surgery if the results of stereotactic core needle biopsy were malignant. in our study, only five patients underwent open surgical biopsy if the results were benign, and the rest of the patients were followed up by surveillance mammography over a follow - up period of 18 months to 5 years. a small sample size might have resulted in 100% sensitivity and specificity ; all patients with benign results on stereotactically guided core needle biopsy did not undergo open surgical biopsy, and were followed up by surveillance mammography, although the follow - up period ranged from 18 months to 5 years. stereotactic core breast biopsy is a safe and cost - effective method for determining the nature of suspicious finding on mammograms. in patients with benign findings on stereotactically guided core needle biopsy, surgical excision is not warranted, but studies with larger numbers of patients are needed to generalize this recommendation. | backgroundthe purpose of this study was to determine the yield of stereotactic core breast biopsy and its cost - saving potential.methodsthis observational study was conducted at the department of radiology at aga khan hospital in karachi. all female patients (n = 84) undergoing stereotactic core breast biopsy under mammographic guidance from january 2005 to may 2010 were included. stereotactic core biopsy was performed on a dedicated mammography unit employing a 14-gauge needle with an automated biopsy device. ten patients with incomplete medical records were excluded. all breast biopsy results were either compared with surgical findings in cases of malignant histopathological findings or with follow - up needle localization in case of benign core biopsy findings.resultsfifteen of our 74 patients had malignant findings on stereotactic biopsy, confirmed on histopathology of the final surgical mastectomy specimen. the remaining 59 patients had benign results on histopathology ; five patients had needle localization of the same area due to either suspicious mammographic findings or clinical suspicion of malignancy. all were proven to be histopathologically benign on open surgical biopsy. fifty - four patients with benign results had follow - up mammograms, and the follow - up period was 18 months to 5 years. the sensitivity and specificity was 100%. the cost saving per patient was us$253.conclusionstereotactic core breast biopsy is a safe and cost - effective method for determining the nature of suspicious mammographic findings. |
human oral cavity is inhabited by many different kinds of microorganisms whose composition, metabolic activity, and pathogenicity are affected by external and internal factors [1, 2 ]. among fungi, yeasts belonging to the genus candida candida species are the major causes of mucocutaneous infections that are usually classified as oropharyngeal, esophageal, and vulvovaginal candidiasis. oropharyngeal candidiasis (opc) is the commonest mucocutaneous candidiasis amongst hiv - positive patients worldwide [1, 3, 4 ], occurring in more than 95% of aids patients [1, 5 ]. high viral load, low cd4 + t lymphocyte count, and disease progression have been incriminated as the greatest risk factors for the development of opc [46 ]. although opc infection is caused by many different species of yeast with the genus candida, c. albicans remains the most predominant reported species globally. opportunistic fungal infections resistant to antifungal agents have been increasingly documented and there are concerns that their frequency will likely continue to increase. demonstrated that emergence of resistance to antifungal agents in hiv / aids patients with opc is common. increased use of antifungal agents to treat fungal infections that occur in immune - compromised patients has been incriminated as a major factor for emergence of drug resistant yeast isolates, failure to respond to antifungal treatment with appropriate doses for a standard duration of time, and noticeable shift towards non - albicans candida species with relative resistance to azole antifungal agents and associated refractory and recurrent infections [11, 12 ]. although the introduction of highly active antiretroviral therapy (haart) has dramatically reduced the incidence of opportunistic infections [1315 ] in hiv - positive individuals who have received antifungal drugs, opc with a shift in the spectrum of candida species remains the most frequent hiv associated oral lesion in developing countries including ethiopia. emergence of non - albicans candida species as etiologic agents of mucocutaneous candidiasis and development of drug resistance by c. albicans to the currently available antifungal principles have initiated further studies in isolation and identification of the causative fungal species and determining of their antifungal profile. in ethiopia, fungal culture and in vitro drug susceptibility pattern of yeast therefore, little is known regarding the distribution and the in vitro antifungal susceptibility profile of yeasts isolated from hiv infected patients with opc. to this end, determining species distribution of yeast isolates from ethiopian hiv infected patients with and without haart and evaluating their drug susceptibility profile to antifungal drugs is one of the highest priorities. the present study was a single institutional cross - sectional study carried out in zewditu memorial hospital, addis ababa, ethiopia, over ten moths (september 2013 to june 2014). the hospital is one of the dedicated centers in the city for the management of hiv / aids patients and runs both outpatient and in - patient services. the hiv clinic of the hospital consists of an integrated counseling and testing center in addition to cd4 + t cells monitoring laboratory and art pharmacy. two hundred and twenty - four consecutive hiv infected patients with opc, 112 under haart and 112 not under haart, were recruited when they were referred to the hospital for voluntary hiv counseling and testing (vct) center and/or for outpatient departments (opd) and/or referred from other health institution. inclusion criteria were a previous positive diagnosis of hiv, will to participate in the study, a presumptive diagnosis of opc following an appropriate complaint made at the clinic visit, and no history of antifungal therapy within two weeks prior to the attendance. upon admission to the study, oral examination of each patient was performed and then oropharyngeal swabs were taken from oral lesions, oral cavity mucosa, and dorsal surface of the tongue and the floor of the mouth of each study subject with sterile rayon tipped applicator stick swabs. all samples were then inoculated into brain - heart infusion broth (oxoid, basingstoke, uk) supplemented with chloramphenicol (50 mg tubes of inoculated brain heart infusion were then transported to the microbiology laboratory of the department of medical laboratory science, college of health sciences, and addis ababa university, and incubated at 3537c for 18 to 24 hours. the brain - heart infusion broth was then subcultured onto sabouraud dextrose agar (sda) supplemented with chloramphenicol (oxoid, basingstoke, uk) and incubated aerobically for 48 hours. yeasts were identified by employing conventional biochemical and assimilation test procedures, using chromagar candida culture medium (becton dickinson) as per the instruction of the manufacture, germ - tube formation in human serum, and production of blastoconidia, pseudohyphae, and chlamydospore on cornmeal agar (oxoid, basingstoke, uk). the in vitro antifungal susceptibility pattern of yeast isolates to six antifungal agents, fluconazole, ketoconazole, miconazole, amphotericin b, clotrimazole, and nystatin (usp, rockville, usa) was determined by agar diffusion procedure according to antifungal disk potency of rosco diagnostica company (neosensitabs, denmark). all antifungal drugs were generously provided as standard powder by ethiopian food medicine and healthcare administration and control authority (efmhaca). the stock solutions were prepared by dissolving standard powders of each drug in their specific solvents (dmso, water, and ethanol), after which they were impregnated into 6 mm sterile blank antibiotic assay disks (sigma aldrich, germany) at the following potencies : clotrimazole 10 g / disk, fluconazole 25 g / disk, ketoconazole 10 g / disk, miconazole 10 g / disk, amphotericin b 10 g / disk, and nystatin 50 g / disk according to antifungal disk potency of rosco diagnostica company (neosensitabs, denmark). yeast inocula were prepared by suspending five colonies of each isolate from 24-hour old pure culture in sterile saline and suspensions were then adjusted to the turbidity of a 0.5 mcfarland standard to obtain 1 10 to 5 10 cells per ml. yeast suspensions were then streaked onto muller hinton agar (oxoid, basingstoke, uk) supplemented with 2% glucose and 0.5 g / ml methylene blue (gmb). dried antibiotic assay disks impregnated with antifungal agents as described above were placed on muller hinton agar seeded with yeast isolates after the plates were dried at ambient temperature for 15 minutes. diameter zone of inhibition was measured by a metal caliper after 24 and 48 h of incubation at 35c. filter paper disks soaked in respective solvents without antifungal agent were placed on culture plate to serve as control. criteria of susceptibility and resistance of antifungal agents were determined according to zone diameter interpretation for fungi of rosco diagnostica company (neosensitabs, denmark) as shown in table 1. data were captured in ms excel and analyzed using spss version 20 (ibm, chicago, usa). comparisons of proportion between groups were carried out by chi - square test and the significant level set at p < 0.05. all ethical considerations and obligations were duly addressed and the study was conducted after the approval of the department research and ethical review committee (drerc) of the department of medical laboratory sciences, college of health sciences, and addis ababa university and the addis ababa city health bureau. the respondent was given the right to refuse to take part in the study and to withdraw at any time during the study period. when the participants were found to be positive for fungal pathogen, they were informed by the hospital clinician and received proper treatment. assent form was completed and signed by family member and/or adult guardian for participants under the age of 18 years. in the present study, a total of 224 clinical samples were collected from hiv - sero - positive individuals with opc of which 155 (69.2%) were from female patients and 69 (30.8%) were from male patients. the ages of study subjects ranged from 3 to 78 years with a median age of 34.5 years. among the study participants, 112 (50%) were under haart among which 76 (49%) were females and 36 (52.2%) were males. out of a total of 224 study subjects, 155 yeast isolates were recovered giving a prevalence of 69.2% colonization rate, of which 105 (67.7%) were from female patients and 50 (33.3%) were from male patients (table 3). differences in the isolation rate between gender were not statistically significant [(or = 0.750, 95% ci, 0.4141.36) (p = 0.342) ]. of one hundred and fifty - five (155) yeast isolates recovered from hiv patients with opc, ninety - one (91) isolates were from patients that were not under haart and 64 isolates were from patients that were under haart (table 4). difference in yeast isolation rate between patients under haart and those that were not under haart was statistically significant [(or = 2.433, 95% ci = 1.5964.240) (p = 0.002) ]. species distribution as presented in table 4 showed that c. albicans was the most frequently isolated species accounting 106 (68.4%) of the total yeast isolates followed by c. glabrata, 24 (15.5%), c. tropicalis, 17 (11.0%), c. krusei, 4 (2.6%), and c. kefyr, 2 (1.3%). c. laurentii, 1 (0.65%), and rhodotorula species, 1 (0.65%), were the only isolated non - candida species from these patients. sixteen (16) patients had mixed infections and c. albicans appeared in all mixed infections. c. albicans appeared in seven patients with c. glabrata and in five patients with c. tropicalis, c. krusei, c. kefyr, and c. laurentii, and rhodotorula species appeared once with c. albicans. the susceptibility of yeast isolates to the six antifungal drugs is summarized in table 5. as can be shown from the table, 83.9% (130/155) of the total yeast isolates were susceptible, 10.3% (16/155) were intermediate, and 5.8% (9/155) were resistant to amphotericin b. one hundred and forty - eight (95.5%), 16 (10.3%), and 9 (5.8%) of yeast isolates were susceptible, intermediate, and resistant to clotrimazole, respectively. yeast isolates were more resistant to fluconazole in which 19 (12.3) were resistant, while 123 (79.4%) and 13 (8.4%) were susceptible and intermediate, respectively. one hundred and thirty - four (86.5%), 8 (5.2%), and 13 (8.4%) of yeast isolates were susceptible, intermediate, and resistant to ketoconazole. more intermediate and least resistant yeasts were recorded against miconazole 21 (13.5%) and 1 (0.6%) was being intermediate and resistant against the drug, s : susceptible ; i : intermediate ; r : resistant ; am : amphotericin b ; clo : clotrimazole ; flu : fluconazole ; keto : ketoconazole ; mic : miconazole ; ny : nystatin, while 133 (85.8%) were being susceptible to the drug. more yeast isolates were susceptible to nystatin in which 150 (96.8) were being susceptible, while 3 (1.9%) and 2 (1.3%) were intermediate and resistant to the drug, respectively. nystatin was the most effective drug against c. tropicalis and c. krusei with no resistant strains of both species to the drug being observed. nystatin also exhibited the greatest activity against c. albicans with no resistant strain found ; overall, only one out of 106 c. albicans isolates (0.9%) was found out to be intermediate, while 105 (99.1%) were susceptible to this agent. nystatin was also relatively active drug against c. glabrata to which 22 (91.6%) out of 24 isolates were susceptible to the drug. among the three major isolates of the present study, c. tropicalis was less sensitive to amphotericin b (53.0%), while the sensitivity of c. albicans and c. glabrata to the drug was 92.4% and 87.5%, respectively. fluconazole was relatively the least effective drug against c. albicans, c. glabrata, and c. tropicalis which were the major isolates of this study. the sensitivity of c. albicans, c. glabrata, and c. tropicalis to the drug was 89.6%, 79.2%, and 58.8%, respectively. none of the isolates of c. kefyr and c. krusei were susceptible to ketoconazole, but the sensitivity of c. albicans, c. glabrata, and c. tropicalis to the drug was 89.6%, 83.3, and 58.8%, respectively. the sensitivity of c. albicans, c. glabrata, and c. tropicalis to clotrimazole was 99.1%, 87.5%, and 882%, respectively. among the azole antifungal agents, more intermediate strains were produced against miconazole in which 100% of c. krusei and c. kefir, 35.5% of c. tropicalis, 20.8% of c. glabrata, and 3.8% of c. albicans were intermediate to the drug. little is known about the profile and the in vitro antifungal susceptibility pattern of oral yeasts in ethiopian hiv infected patients with opc. our finding of c. albicans as the predominant species was consistent with similar earlier [6, 1925 ] and recent [26, 27 ] studies conducted internationally. our finding of c. albicans as the predominant species was also consistent with similar study conducted locally in gondar, southwest ethiopia, but there were some striking differences in the species spectrum and percentage of yeast isolates. for instance, the culture positivity rate obtained in our study (69.2%) was comparatively lower than the culture positivity rate (82.3%) reported in the study carried out in gondar. differences in the recovery rate of different species of yeasts were also observed between these two studies. the recovery rate for c. albicans in our study was 106 (68.4%), 24 (15.5%) for c. glabrata, 17 (11%) for c. tropicalis, 4 (2.6%) for c. krusei, and 2 (1.3%) for c. kefyr. in the study conducted in gondar, the recovery rate of different species of yeasts was higher, 139 (78.5) for c. albicans, 40 (22.5%) for c. glabrata, 17 (14.1%) for c. tropicalis, and 10 (5.6) for c. krusei, respectively. similarly, their study apparently could not isolate c. kefyr, c. laurentii, and rhodotorula species that made 2.6% of yeast isolates in our study. c. kefyr and other yeasts have been isolated as one of the oral yeasts by other works [6, 19 ]. disparity in species spectrum and percentage of isolation rates of different yeasts between the two studies could be resulting from differences in study subjects enrolled in the two studies since half of our study subjects were under haart. a marked decrease in the incidence of oral candidiasis in patients receiving haart although numerous studies on the prevalence of different candida species have led to the general consensus that c. albicans is the most commonly isolated species in the oral cavity of patients infected with hiv, there has been a growing trend of recovery of non - albicans candida species. this is evident by the present study in which the isolation rate of non - albicans candida species was 30.8%. comparatively, less recovery rates of non - albicans candida species of 15% in tanzania, 19% in ethiopia, 22% in texas, and 16.5% in mexico have been reported. similarly, comparatively higher recovery rates of 55% and 50% of non - albicans candida species have been reported in similar studies conducted in nigeria and brazil, respectively. a total of 155 isolates were obtained from 224 specimens during the 10-month period. of clinical specimens collected 7.1% (16/224) yielded more than one yeast (mixed culture) species in which c. albicans was isolated from all mixed cultures. four (1.5%) and forty (18.6%) mixed infections were reported by similar studies conducted in tanzania and ethiopia, respectively. fifteen percent (15%) and 29% mixed infections of candida species among hiv patients were also reported by baumgartner. and schoofs. our finding regarding the prevalence of mixed culture may reflect the change from single to multiple candida species isolates, which have been responsible for epidemiological shift in opc. the most predominant species isolated together with c. albicans in the present study was c. glabrata (43.8%). the significance of this finding is that c. glabrata may replace c. albicans under selective pressure of fluconazole, resulting in infections refractory to the current fluconazole based treatment in ethiopia. like other african countries, the present guideline of the ethiopian ministry of health (moh) for the management of candidiasis includes fluconazole as a first choice drug and ketoconazole, miconazole ointment as alternative antifungal agents [33, 34 ]. in this study, the occurrence of opc was higher in the non - haart group than in the haart group. of one hundred and fifty - five (155) yeast isolates recovered from hiv patients with opc, ninety - one (91) isolates were from patients that were not under haart and 64 isolates were from patients that were under haart. ceballos - salobrena., in their study of 154 patients who were on haart for a minimum of 6 months, reported a 30% reduction in the prevalence of opc. ramirez - amador., in their 12-year prospective study in mexico, observed a decrease in the prevalence of opc by half during the course of their defined study periods. in the present study, the number of female patient participants (155, 69.2%) was greater than male patient participants (69, 30.8%). the significant difference in the number of female - male study participants could be due to the fact that female patients are more exposed to hiv infection than male patients. opportunistic fungal infections resistant to antifungal agents have been increasingly documented and their frequency will likely continue to increase. this phenomenon appears largely due to the extensive use of antifungal agents to treat fungal infections that typically occur in severely immune - compromised and/or critically ill patients. are among the leading fungi responsible for these invasive infections. while antifungal resistance has been described with each of these fungi, resistance among candida constitutes by far the most significant problem. this was evident by the present study in which 31% (48/155) yeast isolates were found out to be resistant to one or more antifungal drugs tested. this result was comparable with earlier study conducted in ethiopia but relatively higher than similar studies from africa [6, 21 ] and the rest of the world. of the 48 yeast isolates which were resistant to one or more drugs more than 64.6% (31/48) of the isolates were non - albicans candida and this may reflect the intrinsic less susceptibility of some of the non - albicans candida species to some antifungal agents such as fluconazole and/or the reflection of the inappropriate use of antifungal in study area. amphotericin b is traditionally used in topical formats, although it may be administrated systemically for the treatment of systemic infections in hospitalized patients. our result on in vitro susceptibility of candida species to polyene antifungal agents (amphotericin b and nystatin) was consistent with that reported previously and showed that candida isolates recovered in the study were highly sensitive to these polyene antifungal agents. out of 155 yeast isolates, only 2 (1.3%) and 9 (5.8%) isolates were resistant to nystatin and amphotericin b, respectively. these results would support the effectiveness of topical amphotericin b and nystatin therapy for superficial candidosis. recurrent opc and repeatedly and/or prolonged exposure of patients to antifungal therapy induce reduced susceptibility of yeasts to azole antifungal agents [8, 9 ]. selective pressure caused by antifungal agents and azole cumulative doses due to exposure to several courses of short- or long - term suppressive therapies in patients with opc has been incriminated as a cause of induction of reduced susceptibility of yeasts to azole antifungal agents [9, 10 ]. similarly, the risk of developing opc with reduced susceptibility to azoles has been associated with greater duration of hiv infection and severe immunosuppression. isolation of yeasts more resistant to azole antifungal agents in the present study could be explained based on the above risk factors. regardless of yeast identity, 19 (12.3%), 13 (8.4%), and 4 (2.6%) isolates were resistant to fluconazole, ketoconazole, and clotrimazole, respectively. fluconazole was also the least active drug against c. albicans which is the most frequently isolated yeast. though fluconazole has been widely used for the treatment of mucosal candidiasis because of its low toxicity and ease of administration local, many international studies have reported fluconazole resistance in candida strains isolated from hiv infected patients with opc [4042 ]. although we have no immediate reasons for a higher resistance of yeast isolates to fluconazole in the present study as indicated above, the accessibility of the drug being free of charge with the scale - up of haart since 2005 in the country and the frequent usage of the drugs as the drug of choice in the settings could be responsible. reported that 9.8% c. albicans isolated from patients with no previous treatment were resistant to fluconazole which increased to 44.7% after treatment with this drug. this data suggest that the continued use of fluconazole may lead to clinical treatment failure which is significantly correlated with reduced susceptibility to fluconazole and other azoles. in general, our study has shown that polyene antifungal (amphotericin b and nystatin) was more active than azole antifungal agents. therefore, it is advisable to use these drugs as a second - line therapy for the mucosal candidiasis which is resistant to fluconazole or for empiric therapy as reported in other studies. only one isolate out of the 155 yeast isolates was found out to be resistant to miconazole, but 21 (13.5%) of the isolates were found out to be intermediate to the agent and why more isolates were found out to be intermediate to the agent is not clear and thus further study is recommended. this study demonstrated that although c. albicans is the most frequently isolated species from hiv patients that are under haart and not under haart, high prevalence of mixed culture in this study may reflect the change from single to multiple candida species isolates, which have been responsible for epidemiological shift in opc. infections with candida are almost endogenous ; therefore, identification of the species and corresponding susceptibility patterns to antifungal agents can be helpful for the management of these infections. as demonstrated in this study, resistance to azole drugs such as fluconazole, the most frequent antifungal used in the country, could be suggestive of the need for routine fungal culture and in vitro drug susceptibility pattern of yeast in medical centers in order to manage more efficiently the invasive candidiasis in the above - mentioned patients. | background. in ethiopia, little is known regarding the distribution and the in vitro antifungal susceptibility profile of yeasts. objective. this study was undertaken to determine the spectrum and the in vitro antifungal susceptibility pattern of yeasts isolated from hiv infected patients with opc. method. oral pharyngeal swabs taken from oral lesions of study subjects were inoculated onto sabouraud dextrose agar. yeasts were identified by employing conventional test procedures and the susceptibility of yeasts to antifungal agents was evaluated by disk diffusion assay method. result. one hundred and fifty - five yeast isolates were recovered of which 91 isolates were from patients that were not under haart and 64 were from patients that were under haart. c. albicans was the most frequently isolated species followed by c. glabrata, c. tropicalis, c. krusei, c. kefyr, cryptococcus laurentii, and rhodotorula species. irrespective of yeasts isolated and identified, 5.8%, 5.8%, 12.3%, 8.4%, 0.6%, and 1.3% of the isolates were resistant to amphotericin b, clotrimazole, fluconazole, ketoconazole, miconazole, and nystatin, respectively. conclusion. yeast colonization rate of 69.2% and 31% resistance to six antifungal agents was documented. these highlight the need for nationwide study on the epidemiology of opc and resistance to antifungal drugs. |
solid luminescent materials have attracted much attention during the last decades, because of their wide range of applications in our daily life such as in lamps, sensors, x - ray detectors, and fluorescent tubes. one strong research focus is on the improvement of the quantum yields or the spectral energy distribution, and with their narrow emission peaks, rare - earth luminescent materials soon became important in this area. new fields of applications (e.g., novel laser materials, luminescent markers in biological devices, or light - emitting diodes (leds)), have been established and there still has been a lot of effort devoted to the further development of new lanthanide - doped materials with improved chemical stability. for this goal, the lanthanide ions must be inserted into a stable inorganic, organic, or inorganic organic hybrid matrix. particularly, the incorporation of lanthanide ions into inorganic mesoporous hosts with high specific surface areas has attracted much interest in recent years (e.g., for catalytic devices, adsorbents, and separation agents and in the development of optical sensors). an applicable method for the preparation of such materials is based on sol gel processing, in which the low temperatures allow the introduction of coordination compounds and organic moieties. with its sharp, near - monochromatic emission line centered at 611 nm and the resulting outstanding luminescence properties, europium(iii)-doped mesoporous silica materials are of special interest and several synthetic routes toward these materials using the sol this can be a one - step synthesis by mixing eu2o3 nanoparticles in a spin - coating solution, a post - synthetic grafting of mcm-41 materials with europium(iii) - diketonate complexes, or the often used co - condensation method of two different precursors (for example, tetraethylorthosilicate (teos) and europium(iii) nitrate). however, one must consider that the luminescence efficiency of europium(iii) ions embedded in a silica matrix is limited by the aggregation of the rare - earth metal at higher concentrations or by hydroxyl groups of residual water and unreacted silanol groups, both leading to a remarkable quenching of the emission. therefore, it is indispensable that the europium(iii) ions are homogeneously dispersed in the silica matrix. this can hardly be realized by the co - condensation method, because the reaction rates of the molecular precursors differ greatly and, as a result, no homogeneous dispersion is achieved, but phase separation can occur easily. to overcome this inherent problem, it is necessary to adjust the reaction rates of the individual components by (i) prehydrolyzing the slower reacting component, (ii) chemical modification of the faster reacting component, or (iii) the application of single - source precursors (ssps), in which the matrix - forming silane and the active rare - earth metal species are coordinatively linked via an organic spacer. in the present work, we report the coordination of europium(iii) ions to two tailor - made functional silanes (see figure 1), carrying coordinating organic moieties and the application of these two different ssps in the preparation of europium(iii)-doped mixed oxide coatings. special emphasis is given to the investigation of the influence of an increasing amount of europium(iii) on the structural and luminescence properties of the final coatings. ethanol (96%), acetone (99%), potassium carbonate (99%), sodium iodide (99%), tetraethoxysilane (99.9%), and hydrochloric acid were purchased from merck kgaa (darmstadt, germany). 3-(chloropropyl)triethoxysilane (97%), acetylacetone (99%), the nonionic surfactant poly(ethylene glycol)-block - poly(propylene glycol)-block - poly(ethylene glycol) (pluronic p123) and europium(iii)chloride hexahydrate (99%) were supplied by sigma aldrich (munich, germany) and used as received. glass substrates (d = 18 mm) were supplied by menzel (braunschweig, germany) and p - doped silicon wafers with (100) orientation were supplied by active business company gmbh (brunnthal, germany). the acetylacetone - modified precursor ssp1 was synthesized according to schubert. 3-(chloropropyl)triethoxysilane was added to a suspension of sodium iodide in acetone under an argon atmosphere. after heating under reflux overnight, potassium carbonate and acetylacetone after cooling to room temperature, the mixture was centrifuged and the solvent was distilled off. three weight percent (3 wt %) of the surfactant pluronic p123 were dissolved in a mixture of 0.16 mol ethanol, 24.98 mmol distilled water, and 9.04 mmol hydrochloric acid as a catalyst and tetraethylorthosilicate (teos). this mixture was stirred for 1 h in a closed polypropylene bottle to prehydrolyze the slower reacting silica precursor. in case of pure silica precursor solutions, the synthesized organosilane ssp1 or ssp2 was added directly to the prehydrolyzed solution, whereas the single - source precursor had to be previously synthesized. therefore, the organosilane ssp1 or ssp2 was added to an ethanolic solution of eucl36h2o in a molar ratio of 3:1 or 1:1 (organosilane : eu), respectively. after this in situ synthesis, the single - source precursor was added to the prehydrolyzed teos solution and the sol was aged for another hour prior to the coating process. different organosilane or europium(iii) concentrations in the precursor solutions were adjusted by variable amounts of the individual precursors. for the pure silica coatings prepared with teos and an organosilane ssp1 or ssp2, teos is directly replaced by the same molar amount of the organosilane, because both precursors exhibit one hydrolyzable silicon center. in contrast, if teos is replaced by one of the metal - coordinated ssps, in which the ratio of organosilane to europium(iii) is 3:1, it must be considered that the ssp now contains four hydrolyzable centers. that means that, in the case of a coating with, e.g., 2.5 mol % ssp1-eu (2.5 mol %, according to 8.40 mmol hydrolyzable metal centers), 7.56 mmol teos and 0.21 mmol ssp1-eu are needed. accordingly, for the sample with 12.5 mol % ssp1-eu, 4.20 mmol teos and 1.05 mmol ssp1-eu were used, and for the coating with 25 mol % ssp1-eu, 0 mmol teos and 2.1 mmol ssp1-eu were used (see table 1). europium(iii) oxide - doped silica coatings were prepared on commercially available glass slides and silicon wafers with (100) orientation by spin coating (rotation speed of 4000 rpm). after the coating process the samples were first aged overnight at room temperature and afterward at 120 c for 10 h. finally, the coatings were calcined in air at 350 c for 3 h with a heating ramp rate of 1 c min. for the nitrogen sorption measurements, a larger quantity of the mixed - oxide material was needed. the remaining coating solution was cast in petri dishes and analogously aged to the thin coatings. after the aging step, the material was scraped off and calcined in air for 3 h at 550 c with a heating ramp rate of 1 c min. one must keep in mind that the data obtained from nitrogen sorption measurements for scraped coatings might deviate from the data for the coatings on glass slides. for nitrogen sorption measurements, the calcined samples were degassed under vacuum at 300 c for 3 h and measured on a nova 4000e (quantachrome instruments, usa) at 77 k in the relative pressure range of p / p0 = 0.050.99. for the calculation of the specific surface area (bet), the 5-point method in the relative pressure range from 0.05 to 0.30, according to brunauer., was used. powder x - ray diffraction (xrd) patterns were recorded on a panalytical mpd pro diffractometer (panalytical, the netherlands) using cu k radiation. the elemental composition of the coatings was determined by x - ray photoelectron spectroscopy (xps) measured on a phi 5800 esca system (physical electronics) using monochromatic al k radiation. transmission electron microscopy (tem) images were obtained using a philips em 400 (philips, the netherlands ; u = 80 kv). small - angle x - ray scattering (saxs) and grazing - incidence small - angle x - ray scattering (gisaxs) measurements of the coated films were performed under vacuum with a rotating - anode x - ray generator equipped with a pinhole camera (nanostar, bruker axs). cu k radiation was monochromatized and collimated from crossed goebel mirrors, and the scattered intensity was detected by a two - dimensional (2d) position - sensitive detector (vantec 2000). the sample - to - detector distance was 108 cm, from which scattering data in the q - range from 0.1 to 2.8 nm were obtained. the saxs patterns were radially averaged and corrected for background scattering to obtain the scattering intensities in dependence on the scattering vector q = 4/ sin, where 2 is the scattering angle and is the x - ray wavelength (= 0.1542 nm). in order to quantify the saxs data, the background scattering was subtracted using a linear baseline, and the diffraction peaks were fitted with a lorentzian function. the d - spacing was calculated from the peak maximum (in the case of a perfect hexagonal lattice, the pore - to - pore distance would be a = 2d/3, with d = 2/qmax). this size is interpreted here as the crystallite size, but represents only a lower limit, because polydispersity (statistical variation of cylinder diameter) and translational disorder (statistical variation of the cylinder centers) also might contribute to the peak broadening. since we have a 2d lattice, we use the formula for 2d particles (the value being twice as large as the corresponding value for three - dimensional (3d) particles), la = (2k)/q. this equation is the form of the reciprocal, not the angular space. here, q is the full width at half - maximum (fwhm) of the peak intensity and k is the scherrer constant (a number close to 1, 0.94 for crystallite cubes). the film thickness was detected by a dektak 150 surface profiler (veeco instrument, inc., photoluminescence emission and excitation, as well as lifetime measurements, were performed with the aid of a fluorolog3 spectrofluorometer (model fl3 - 22, horiba jobin yvon) that was equipped with double czerny turner monochromators, a 450-w xenon lamp, and a r928p photomultiplier with a photon counting system. cooling down to 10 k was achieved by a closed - cycle he cryostat (janis research). all emission spectra were corrected for the photomultiplier sensitivity, and all excitation spectra were corrected for the intensity of the excitation source. several authors describe the preparation of sol gel - based mixed - oxide materials via approaches such as the direct synthesis starting from different precursors (e.g., tetramethoxysilane (tmos) and eu(no3)3h2o), post - treatment of a preformed porous matrix (such as mcm-48 silica hosts, with europium(iii) dibenzoylmethane complexes), or the coordination of the faster - reacting metal alkoxides to the structure - directing surfactant (e.g., fe, ti, hf - mixed oxides). in this study, a novel route to porous europium(iii)-doped silica films is investigated using a prehydrolyzed silica sol and different europium(iii)-coordinated organosilanes (see figure 1). the acetylacetone - based organosilane ssp1 (1) has previously been applied for the synthesis of silica titania mixed metal oxide materials with no long - range ordering of the pores via the complexation of tetraisobutylorthotitanate, as well as for thin silica titania coatings in biological applications. in this work in addition, a second single - source precursor ssp2-eu (4) was synthesized based on 5-(triethoxysilyl)pentanoic acid (3) and was also applied for the complexation of europium(iii) ions and finally for the preparation of europium(iii)-doped silica films. first of all, the rate of condensation of europium is controlled via the coordinative linkage to the organosilane, and second, based on the stable coordination, europium and silicon are positioned in close proximity to each other in the final material, thus phase separation in a silica - rich and europium oxide - rich phase is hindered. based on the stability differences of the coordinative linkage and the number of coordinating molecules (n = 1 or n = 3), a different behavior in sol gel processing as well as variations in the structural features of the coatings are expected, which will be investigated in detail in this work. synthesis of metal - coordinated (eu) single - source precursor molecules (n = 13). based on a pure silica system using teos as silicon precursor and 3 wt % pluronic p123 as a structure - directing agent, teos was replaced step by step by a defined amount of the organosilane ssp1 (1) or ssp2 (3) and, furthermore, by the corresponding single - source precursor ssp1-eu (2) or ssp2-eu (4). for the pure silica systems, substitution of teos by the organosilane was calculated based on the number of silicon centers, i.e., 10 mol % of teos were substituted by 10 mol % of ssp1 or ssp2. for the europium(iii)-coordinated ssp precursors, the calculation is based on the amount of hydrolyzable metal centers, thus including si and eu. the amount of hydrolyzable centers was kept at a constant value of 0.0084 mol, meaning that, for n = 1, substitution of 10 mol % teos was done with 5 mol % of the ssp - eu precursor, while for n = 3, substitution of 10 mol % teos resulted in 2.5 mol % of the ssp - eu precursor. table 2 gives the relationship between the amounts of the corresponding single - source precursor and the silicon - to - europium ratio of the final material. via this approach, on the one hand, a direct comparison of the influence of an increasing amount of the pure organosilane on the properties of the final coating is possible, while, on the other hand, the influence of an europium(iii) doping is also possible. to investigate the structural properties of the coatings, small - angle x - ray scattering (saxs) analyses in transmission geometry directly on the coating, as well as transmission electron microscopy (tem) and nitrogen sorption measurements on the corresponding powders, the film thickness of the calcined coatings obtained for the different precursors (150 and 200 nm) are almost in the same range. the saxs intensities of pure silica films prepared with different teos / organosilane ratios after calcination at 350 c are shown in figure 2. coatings prepared with teos as a sole precursor show a sharp peak at q = 0.9 nm, indicating large domains of hexagonally arranged mesopores (la > 250 nm). the broader peak at q = 0.7 nm for a coating containing 10 mol % ssp1 or 10 mol % ssp2 is due to the smaller size of the coherently scattering domains of hexagonally arranged mesopores (la 37 nm). the domain sizes la have been calculated from the fwhm using the scherrer formula (also see table 3). small - angle x - ray scattering (saxs) curves of pure silica coatings using different teos / organosilane ratios : (a) ssp1 and (b) ssp2. this illustrates that the addition of increasing amounts of organosilanes, which can be described as trifunctional silicon precursors as well, lead to scattering curves without any observable peak and, consequently, to a complete destruction of the hexagonal ordering of the pores within the silica matrix. the influence of an increasing amount of organosilane on the arrangement of the pore system in the mesoscopic range is clearly visible and has already been described in the literature. it can be attributed to several effects, such as a change in the polarity in the sol due to the organofunctional moiety, different reaction rates of the tetrafunctional to trifunctional silicon centers (tetrafunctional and trifunctional are given, with respect to the number of hydrolyzable groups). as a consequence, not only does heterocondensation between the different precursors take place, but also a possibility of homocondensation is given. in addition, with increasing amount of the organofunctional silane, the degree of condensation is reduced. the saxs measurements of the europium(iii)-doped silica coatings prepared with the europium(iii)-coordinated precursors ssp1-eu and ssp2-eu (n = 3) are compared in figure 3. although a significant broadening of the diffraction peak can be observed for an increasing amount of the single - source precursor, a low level of periodicity in the mesoscopic range, even at high europium(iii) concentrations, is still observable (well pronounced for the ssp2-eu coatings). besides the broader diffraction peaks, a peak shift from q = 0.68 nm to q = 0.53 nm also is observed, indicating larger repeating unit distances for the ssp2-eu coatings. for the ssp1-eu coatings, the sample with si / eu = 7/1 shows an exception. here, a peak shift toward larger q - values is visible, which does not follow the general trend of increasing pore distance with increasing amount of europium. saxs curves of europium(iii)-doped silica coatings using teos and different amounts of the europium(iii)-coordinated organosilane : (a) ssp1-eu and (b) ssp2-eu. the d - spacing and the size of the hexagonal domains of all coatings are summarized in table 3. comparing samples produced with teos and different amounts of the organosilane ssp1/ssp2 with samples produced with teos and different amounts of the europium(iii)-complexed organosilane ssp1-eu / ssp2-eu, the former show significantly broader diffraction peaks and, thus, smaller hexagonal domains. that implies that eu has a stabilizing effect on the mesoscopic structure. in addition, grazing - incidence small - angle x - ray scattering (gisaxs) images were collected for selected samples to obtain more information on the pore orientation of the coatings. figure 4 shows gisaxs images of a calcined silicon wafer coated with a pure teos / surfactant sol and a silicon wafer coated with the pure ssp2-eu with n = 3 (si / eu = 3/1). for the wafer coated with the teos / surfactant sol, an almost - perfect hexagonal orientation is observed with a compressed axis perpendicular to the film surface, because of shrinkage during drying. the coating prepared with the pure single - source precursor ssp2-eu without further addition of teos (si / eu = 3/1) shows, in principle, similar features ; however, the spots are strongly smeared out and appear more as a halo. this is a consequence of randomly oriented domains in the pure ssp2-eu (si / eu = 3/1) sample (figure 4b), instead of one large crystallite in the pure teos sample (figure 4a). in addition, the domain size decreases from a value larger than 250 nm (which is only a given lower limit due to the resolution limit of the equipment) for pure teos to 60 nm for the ssp2-eu (si / eu = 3/1), as evaluated from the peak width by the scherrer formula (table 3). the domain sizes calculated from the gisaxs data coincide well with the results obtained from the transmission measurements. gisaxs pattern of (a) a pure teos - coated silicon wafer and (b) a wafer coated with the pure single - source precursor ssp2-eu (si / eu = 3/1). the described short - range ordered or wormhole - like pore system of coatings prepared with the single - source precursor ssp2-eu (n = 3) can also be observed in tem images (see figures 5c and 5d). pure silica coatings with teos and the organosilane ssp2 result in porous materials only at low ssp2 concentrations (figure 5a) ; higher amounts of ssp2 give nonporous materials, as seen from nitrogen sorption analysis and tem images (figure 5b). tem images of coatings prepared with (a) 2.5 mol % ssp2, (b) 25.0 mol % ssp2, (c) 2.5 mol % ssp2-eu (si / eu = 39/1), and (d) 12.5 mol % ssp2-eu (si / eu = 7/1). the differences in porosity between the pure silica and the europium(iii)-doped coatings are also reflected in the results of the nitrogen sorption measurements (figure 6). higher specific surface areas (sbet) of the coatings could be achieved through the incorporation of europium(iii) ions in the silica matrix, regardless of whether the single - source precursor ssp1-eu or ssp2-eu was used. even the coated films prepared with the single - source precursors solely gave porous materials with specific surface areas of 276.1 m g for 25.0 mol % ssp1-eu (si / eu = 3/1) and 178.4 m g for 25.0 mol % ssp2-eu (si / eu = 3/1), respectively. specific surface areas for the powders ssp1 and ssp1-eu (top) or ssp2 and ssp2-eu (bottom). to summarize the results of the saxs, tem, and nitrogen sorption measurements, it can clearly be seen that the incorporation of europium(iii) in the silica matrix gave porous materials in which the long - range ordering is disturbed, but small domains of hexagonally arranged mesopores are observed. the application of ssp1 and ssp2 without coordination of europium shows an even more dramatic effect on the porous structure, with a complete loss of mesoporosity for 50 and 100 mol % ssp2. this is less pronounced when europium is coordinated to the functional organic group, and differences here can probably be related to the different hydrolysis behavior. the surface and in - depth composition of the calcined thin films were investigated by x - ray photoelectron spectroscopy (xps). the results for the eu / si ratio are in good agreement with the theoretical values across the entire film thickness. detailed scans of the regions of interest were also acquired. concerning the o(1s) region, a broadening of the peak was observed, thus suggesting the presence of different chemical environments for oxygen. while the o(1s) binding energy for pure silica materials is 533.1 ev, the value is shifted to 530.5 ev for pure europium(iii) oxide materials. as can be seen in figure 7, the values for the mixed oxide films are positioned between these two binding energies, thus indicating that si as well as eu atoms are located in the immediate environment of the same oxygen atom. binding energy of the o(1s) electron of coatings with different eu concentrations prepared with the single - source precursors (a) ssp1-eu and (b) ssp2-eu. europium(iii)-doped calcined mesoporous silica films prepared with ssp1-eu coated on silicon wafers with a molar concentration of 12.5 mol % ssp1-eu show a red emission when irradiated by a uv lamp with an excitation energy of 254 nm (figure 8). this observation is very remarkable because of the low thickness of the films (150200 nm), showing the efficiency of these materials. red emission of a coating with a si / eu ratio of 7/1 (12.5 mol % ssp1-eu). the respective photoluminescence emission spectra upon excitation at 280 nm are depicted in figure 9. the five peaks located at around 580, 595, 615, 655, and 700 nm correspond to the typically observed d0 fj 4f4f transitions of eu with j = 0, 1, 2, 3, and 4, respectively. the emission band at 580 nm results from the parity - forbidden d0 f0 electric dipole transition band and demonstrate, as expected, that eu is located in an environment with low symmetry. the emission with the highest intensity located at 605630 nm corresponds to the d0 f2 transition. temperature - dependent measurements show an increase of the emission intensity at low temperatures, because of the higher occupation probability of excited vibrational states with increasing temperature, resulting in an increase of quenching processes. some splitting of the emission bands can be detected at low temperatures ; this will be discussed below. excitation spectrum at room temperature (top, em = 614 nm) and temperature - dependent emission spectra (bottom, ex = 280 nm) of the metal oxide - doped mesoporous silica coatings doped with 12.5 mol % ssp1-eu. the excitation spectrum shows only weak excitation peaks in the visible and near - uv region originating from the forbidden eu f f transitions. small peaks can be, however, observed at 394 and 465 nm, respectively, which could be assigned to the f0 l6 and f0 d2 transition of eu. the onset of a much more intense, broad excitation band is observed, starting at 400 nm, originating from excitation of the silica host and eu o charge - transfer transitions. similar emission spectra could be observed for the coatings prepared via the single - source precursor ssp2-eu. to investigate the influence of a still - higher europium concentration on the emission intensity therefore, the ratio of ssp to metal center was changed from 3:1 to 1:1 (ssp : metal). figure 10 shows the luminescence spectra of a calcined (excitation wavelength : 270 nm) and an as - synthesized (uncalcined) (excitation wavelength : 394 nm) eu - doped silica coating. we chose direct eu excitation for the uncalcined samples rather than ligand excitation, because the organic ligands were decomposed after some time in the case of 270 nm excitation. the emission spectra of the uncalcined samples depict structureless broad bands due to d0 fj transitions. this can be explained by the fact that numerous different coordination spheres for europium exist, which shift the crystal field levels of the fj states to a small amount, so that their superimposition results in a broad band. in contrast, in the case of calcined samples, some structure is observed for the d0 f2 transitions and the width of the bands is remarkably increased. the assignment to crystal field - level splitting is rather implausible, because the width of the bands should not broaden, as in the present case. this observation may be caused by the forming of two groups of eu sites during calcination each with comparable coordination spheres, although this point needs further investigation because the d0 f0,1 transitions show no or almost no splitting. in general, numerous different sites should be present in such a glasslike material. with respect to the temperature - dependent emission intensity, the properties of the calcined and the uncalcined samples differ considerably from each other. the emission intensity of the calcined coating is not detectable during these measurements (slit width 0.4 nm) at temperatures above 110 k, the emission intensity of the uncalcined samples is less temperature dependent and emission peaks can also be observed at room temperature with these settings. that means that nonradiative relaxation processes take place on a larger scale in the calcined samples than in the uncalcined one which quenches the luminescence efficiency. this behavior can be explained by the very small distance of neighboring eu ions after the calcination step in which the organic spacers between silicon and europium are removed. in fact, the observed concentration quenching is assumed due to the 50% concentration, and it should be emphasized that the uncalcined films show emission at room temperature, but also the calcined ones, which can be observed at lower resolutions (larger slit widths). excitation spectra at room temperature (left) and temperature - dependent emission spectra (right) of the coatings containing a si / eu ratio of 1:1 (ssp2-eu) : (a) the uncalcined coating (ex = 394 nm) and (b) the calcined coating (ex = 270 nm). for further investigations, the lifetimes of the d0 state of the calcined and uncalcined ssp2-eu coatings (si / eu ratio = 1:1) were determined. for both samples, a biexponential decay was detected (uncalcined coatings, 0.31 and 0.39 ms ; calcined coatings, 0.30 and 0.04 ms). these lifetimes are remarkably shorter than those generally observed for bulk eu - doped luminescent materials, which are in the range of milliseconds, but somewhat longer than that of ni eu2o3 composite thin films (< 0.015 ms). in contrast, the doped composite film ni y2o3:eu has a longer lifetime of 1.04 ms, which is the same as for bulk y2o3:eu. therefore, the low lifetimes of the samples presented here are due to high eu concentrations, which lead to quenching, because of the short eu distances mainly for the calcined samples as already observed in the emission spectra. in the case of the uncalcined samples some quenching the observation of biexponential decays with different lifetimes mainly for the calcined samples assists the assumption of two different types of eu coordination. the excitation spectrum of the calcined films is similar to those of the coatings prepared with ssp1-eu, but some more eu f f transitions with higher intensity are observed in the low - energy region. the latter are also depicted for the uncalcined films, but the band due to the host has an onset at lower energy and shows some structure, which is attributed to the organic linkers. porous silica - europium(iii) mixed metal oxide coatings on glass were successfully prepared via an evaporation - induced self - assembly process with the application of novel precursors in the presence of structure - directing agents. deliberate substitution of the tetraethoxysilane by the functional noncoordinated trialkoxysilane already has a profound influence on the structural features of the final coatings, resulting in the most pronounced case in nonporous films, e.g., 100 mol % of ssp2. the coordination of europium(iii) to the acetylacetonate or carboxylate functionality weakens this impact on the porous structure, still yielding porous coatings. however, the final europium(iii)-containing silica materials show a reduced ordering of the pores in the mesoscopic range and, in parallel, the specific surface area is reduced, compared to a pure silica coating. in the case of the 5-(triethoxysilyl)pentanoic acid - modified precursor, the resulting eu - doped silica films exhibit mesopores even at a ssp2-eu content of 100 mol %. in addition the thin coatings show luminescence properties with characteristic emission peaks according to the d0 fj transitions. the spectra and the lifetime measurements suggests that, in the calcined materials, two different types of coordination spheres exist. the fact that the emission also is clearly visible for very thin films exhibits the efficiency of this new type of eu - containing material. | europium(iii) ions containing mesoporous silica coatings have been prepared via a solvent evaporation - induced self - assembly (eisa) approach of different single - source precursors (ssps) in the presence of pluronic p123 as a structure - directing agent, using the spin - coating process. a deliberate tailoring of the chemical composition of the porous coatings with various si : eu ratios was achieved by processing mixtures of tetraethylorthosilicate (teos) and eu3 + -coordinated ssps. small - angle x - ray scattering (saxs) and transmission electron microscopy (tem) analyses demonstrate that the thin metal oxide - doped silica coatings consist of a porous network with a short - range order of the pore structure, even at high europium(iii) loadings. furthermore, luminescence properties were investigated at different temperatures and different degrees of eu3 + contents. the photoluminescence spectra clearly show characteristic emission peaks corresponding to the 5d0 7fj (j = 05) transitions resulting in a red luminescence visible by the eyes, although the films have a very low thickness (150200 nm). |
optimal control of intraocular pressure (iop) has been shown to reduce the risk of glaucoma - related optic nerve damage and visual field loss.14 prostaglandin analogs (pga) are the most commonly prescribed agents to lower iop.5 a single iop - lowering medication may not provide sufficient iop control, thus resulting in the need for multiple iop - lowering medications to reach the target iop.6 -blockers with pga are often employed for lowering the iop and have been found to be effective.7 up to 30% of glaucoma patients require adjunctive therapy within 1 year, and there is a general increase in the number of patients prescribed three or more agents for iop control.5,6 although -blockers are frequently employed along with pga, in the united states, the most common fixed - combination iop - lowering medication consists of -blockers with carbonic anhydrase inhibitors (cais ; eg, brinzolamide and dorzolamide) or 2-adrenergic agonists (eg, brimonidine).8 recently, a non--blocker combination solution that consists of a fixed combination of brinzolamide and brimonidine suspension has been approved.9 to our knowledge, there is no comparative study of non--blocker combination agents against -blocker combination agents when used adjunctively with a glaucoma agent in a different class. in this study, patients previously taking dorzolamide / timolol solution and pga for iop control with medication - related ocular irritation and intolerance who were switched from dorzolamide / timolol solution to brinzolamide / brimonidine while concomitantly taking the same pga were analyzed. this was a retrospective, open - label chart review of patients with a diagnosis of open - angle glaucoma or ocular hypertension treated with pga, but needing a combination agent to meet target iop. patients using dorzolamide / timolol solution with pga who reported medication - related ocular irritation were switched to brinzolamide / brimonidine suspension while concomitantly on the same pga. data collection and reporting were in compliance with all health insurance portability and accountability act requirements. data were collected for patients who were at least 21 years old with a clinical diagnosis of open - angle glaucoma and/or ocular hypertension in at least one eye. they needed to have been treated with concomitant use of pga and dorzolamide / timolol solution for at least 1 month. patients using dorzolamide / timolol solution plus pga with medication - related ocular irritation were switched to brinzolamide / brimonidine suspension with the same pga. best - corrected visual acuity (bcva), ocular hyperemia grading (scale of 03), slit - lamp biomicroscopy, and goldmann applanation tonometry measurements were all recorded at the visit when medications were altered. patients taking brinzolamide / brimonidine suspension plus pga were seen at baseline and 1 and 3 months later. a two - tailed paired student s t - test was used to calculate statistical significance of iop change, hyperemia level, visual acuity, and preference of medication while taking dorzolamide / timolol solution plus pga at the baseline visit as compared to brinzolamide / brimonidine suspension with the same pga after 3 months. a p - value less than 0.05 was considered to be statistically significant. forty eyes of 20 patients, eight males (40%) and 12 females (60%) aged 3287 (6814) years, were included. seven (35%) patients were on latanoprost, seven (35%) patients were on travoprost, and six (30%) patients were on bimatoprost with dorzolamide / timolol solution. as shown in table 2, there was no significant difference in baseline mean iop (17.21.5 mmhg) as compared to brinzolamide and brimonidine suspension with pga at 3 months (16.51.6 mmhg, p=0.20). no significant difference was noted in mean ocular hyperemia (1.20.4 vs 1.10.3, p=0.064). no significant changes in visual acuity, corneal staining, or slit - lamp biomicroscopy findings were noted. two treatment - related adverse events were reported : one episode of increased ocular hyperemia and one occurrence of allergic conjunctivitis. significantly more patients reported less stinging and preferred the brinzolamide / brimonidine suspension compared with the dorzolamide / timolol solution (14 vs 6, p=0.011). multiple iop - lowering medications with separate bottles can be difficult for patients to manage.1012 in addition to the risk of preservative - induced ocular symptoms, the drops, if not properly spaced apart, may introduce a washout effect.13 there is a trend toward increased use of a fixed - combination agent as the first - line adjunctive therapy, because it provides convenience and improved adherence versus concomitant use of multiple separate bottles.6,10 because glaucoma is a chronic disease, the long - term tolerability of the eye drops determines a patient s adherence, persistence, and willingness to take the prescribed medication.14 previous studies confirmed the greater iop - lowering effect of the brinzolamide and brimonidine combination compared with brinzolamide or dorzolamide monotherapy.9,15 the safety profile and tolerability of brinzolamide and brimonidine, like other fixed - combination iop - lowering medications, is consistent with its individual components.9,15 fixed - combination solutions were more effective than timolol monotherapy. adding a fixed - combination eye drop to a pga provides an alternative therapeutic benefit for patients with glaucoma needing multiple drug therapy.6 the two types of fixed - combination eye drops appear to have different ocular and systemic side effect profiles.16 in this study, patients who were unable to tolerate dorzolamide / timolol fixed combination with pga were switched to brinzolamide / brimonidine suspension while maintaining the same pga. there was no significant change in iop 3 months after transitioning from dorzolamide / timolol solution to brinzolamide / brimonidine suspension, suggesting brinzolamide / brimonidine suspension with pga is a viable option for iop control especially in patients with comorbidities restricting the use of -blockers. the results of our chart review demonstrated significantly less stinging of shorter duration with brinzolamide / brimonidine suspension versus the dorzolamide / timolol solution. this is believed to be a result of a more neutral ph (6.5) in the brinzolamide / brimonidine suspension than the acidic ph (5.6) of the dorzolamide / timolol solution.17 in addition, eye drops with dorzolamide use sodium citrate as a buffer, whereas drops with brinzolamide do not.17 there were two treatment - related adverse events, one episode of increased ocular hyperemia and one occurrence of allergic conjunctivitis. but fixed combination of pga and timolol was shown to have less conjunctival hyperemia than when used separately.7 in our study, patients also reported less redness with the brinzolamide / brimonidine suspension and preferred it to the dorzolamide / timolol solution. reduction of ocular symptoms associated with the prescribed medication would have a beneficial effect on patient preference and may increase adherence of glaucoma medication. despite this, we found no statistically significant difference (p=0.064) in redness with the brinzolamide / brimonidine suspension versus dorzolamide / timolol solution, irrespective of the pga concomitantly used, most likely due to the small sample size of this study. the brief duration of dorzolamide / timolol solution plus pga therapy prior to transitioning to brinzolamide / brimonidine suspension in this study may not have allowed enough time to observe difference in iop and adverse effects between treatments. a previous study revealed no change in mean blood pressure regardless of non--blocker combination or individual components used.15 in this study, we did not look at the effect on blood pressure in our subjects when they were switched from topical -blocker combination to non--blocker combination solution. a similar study with a longer duration of use of dorzolamide / timolol solution with pga use prior to switching might produce differences in other parameters that were not evident in the current study. however, the fact that our patients had a strong preference for brinzolamide / brimonidine suspension after taking dorzolamide / timolol solution for a relatively short time strongly increased tolerability of brinzolamide / brimonidine suspension versus dorzolamide / timolol solution when used with a glaucoma agent in a different class. our study, albeit limited by small sample size, confirms that all currently available fixed - combination iop - lowering medications have similar iop - lowering efficacy. patients with open - angle glaucoma and/or ocular hypertension requiring multiple medications can be switched from dorzolamide / timolol solution plus pga to brinzolamide / brimonidine suspension plus pga with similar iop control with benefits of improved compliance owing to increased tolerability. brinzolamide / brimonidine suspension is -blocker free, making it a viable treatment option for our aging glaucoma patients with comorbidities restricting -blocker use. | objectivefixed combination glaucoma medication is increasingly used in glaucoma treatment. there is a lack of comparative study in the literature of non - beta blocker combination agents used adjunctively with a glaucoma agent in a different class. the objective of this study is to evaluate the effect of intraocular pressure (iop) control and tolerability of non - beta blocker combination suspension with prostaglandin analogs (pga) in patients with open angle glaucoma who were previously treated with beta blocker combination solution with pga.designopen-label retrospective review of patient records.patients and methodsthis study looked at patients with open angle glaucoma taking dorzolamide / timolol solution with pga that were switched to brinzolamide / brimonidine combination suspension with pga. this study reviewed the charts of all patients who were at least 21 years old with a clinical diagnosis of open - angle glaucoma or ocular hypertension in at least one eye. patients needed to have been treated with concomitant use of pga and dorzolamide / timolol solution for at least one month. patients using dorzolamide / timolol solution plus pga with medication related ocular irritation were switched to brinzolamide / brimonidine suspension with the same pga. best - corrected visual acuity, ocular hyperemia grading, slit lamp biomicroscopy and goldmann applanation tonometry measurements, and patient medication preferences were assessed at baseline, 1 month and 3 months.resultsforty eyes with open angle glaucoma. the mean age of the patients was 68 and 60% were females. the iop before the switch was 17.2 and 16.5 (p=0.70) following the switch at 3 months. we found a decreasing trend of ocular hyperemia (p=0.064) and strong preference (p=0.011) for non - beta blocker combination suspension but no difference of visual acuity and slit lamp findings.conclusionbrinzolamide/brimonidine combination suspension when used adjunctively with pga is equally effective. patients in this study reported greatly reduced ocular redness and shorter duration of stinging with non - beta blocker combination suspension. their preference of it over dorzolamide / timolol combination solution makes it a viable treatment option, particularly for the aging glaucoma patient with comorbidities that restrict the beta blocker use. |
post - transplant lymphoproliferative disorder (ptld) includes lymphoid proliferation that is the consequence of immunosuppression in a recipient of a solid organ or stem cell allograft. the pathologic spectrum of ptld is heterogeneous, ranging from epstein - barr virus (ebv)-driven infectious mononucleosis - type to ebv - negative proliferations resembling b or less frequently t - cell lymphomas. currently, rituximab, an anti - cd20 monoclonal antibody, remains a first line therapeutic option for patients with ptld following allohsct. additionally, when it is possible, rapid reduction of immunosuppression should be strongly advised. pure red cell aplasia after abo - mismatched allohsct is associated with recipient s anti - a or anti - b isohemagglutinin directed against a or / and b antigens on donor erythroid precursor cells. prca may resolve spontaneously, but it usually requires several weeks or months and multiple red blood cell (rbc) transfusion are associated with iron overload with subsequent organ damage. herein we present a male patient who developed prca and ptld after allohsct and rapidly responded to rituximab. a 34-year male patient was diagnosed with myelodysplastic syndrome - refractory cytopenia with multilineage dysplasia (mds - rcmd) in april 2010. he was treated with corticosteroids (cs) and erythropoietin (epo), but this therapy failed. a fully matched unrelated donor was found and the patient was scheduled for a transplant procedure. the conditioning regimen consisted of treosulfan, fludarabine and rabbit atg (total doses : 81 000 mg, 250 mg and 1100 mg, respectively). there was major and minor abo blood group incompatibility between recipient (blood group a rh - positive) and donor (blood group b rh - positive). anti - b isohemagglutinin titers before transplant were 1 : 128 (igm) and 1 : 64 (igg). the source of stem cells was peripheral blood and the total number of transplanted nuclear cells was 4.11 10/kg including 6.46 10/kg cd34 + cells and 12.1 10/kg cd3 + cells. complete neutrophil and platelet engraftments were demonstrated on day + 16, but moderate anemia was still present. marrow assessment performed on day + 30 after allohsct showed normal myeloid and megakaryocytic cells, but the number of erythroid precursors was markedly decreased. two weeks later he was admitted to our department due to a fever and general weakness. on physical examination cytomegalovirus (cmv) and parvovirus b19 were excluded whereas pcr test revealed 19 200 copies/l of ebv. anti - b isohemagglutinin titers after transplant were 1 : 64 (igm) and 1 : 32 (igg). histological examination of the lymph node was not done due to bad patient s condition overall, but flow cytometry of a peripheral blood specimen detected a monoclonal population of b cells expressing cd20. despite ri, the progressive lymphadenopathy was still observed. rituximab at weekly doses of 375 mg / m was administered twice with good tolerance. two weeks later, a marked increase in reticulocyte count was noted with hemoglobin increase. the patient became transfusion independent. the anti - donor isohemagglutinin titers were undetectable and the donor s blood group conversion was observed. currently, 8 months later, the patient is alive with no features of prca and ptld with full donor chimerism. ebv - ptld has become a growing problem in allograft recipients due to the increasing number of transplantations. the incidence of ebv - ptld after allohsct is above 1%, but it may significantly increase up to 20% in patients with well - known risk factors such as ebv seronegativity at the time of transplantation, t - cell depletion of donor grafts, hla mismatch and use of atg for prophylaxis of graft versus host disease. the diagnosis is usually based on histological findings and we can distinguish the following forms : early benign lesions, polymorphic and monomorphic ptld and classical hodgkin lymphoma ptld. according to the ecil (european conference on infections in leukemia) the diagnosis of ebv - associated ptld was divided into : 1) proven ebv - ptld (histological evidence of tissue infiltration by monoclonal lymphoid cells and detection of ebv gene products), 2) probable ebv - ptld (usually marked lymphadenopathy with an increased number of ebv copies in blood but without an established diagnosis) and 3) ebv - dnaemia (the presence of ebv - dna in the blood). currently, the anti - cd20 monoclonal antibody rituximab remains the first line treatment in patients with ptld after allohsct. a recently published review showed that rituximab was found to be effective in about 63% of patients when used in monotherapy or in combined treatment. it should be mentioned that rituximab causes prolonged b - cell depletion lasting up to 12 months and therefore its use may lead to severe infectious complications. a summary of current management in ptld was recently presented by gil.. prca after major abo - incompatible transplant results from the presence of host - derived b lymphocytes which produce isohemagglutinins directed against erythroid cells of donor origin. several risk factors of post - transplant prca development were defined and they included : 1) elevated post - transplant anti - donor isohemagglutinin titers, 2) reduced - intensity conditioning before transplant, 3) the presence of anti - a agglutinin, 4) ciclosporin for graft versus host disease (gvhd) prophylaxis, and 5) transplant from sibling donor [3, 4, 10, 11 ]. plasmapheresis and immuno - adsorption remain the first - line therapeutic option in a majority of abo - mismatched prca cases. rituximab was found to be effective in single patients although the mechanism of its efficacy remains unclear. it is postulated that opsonization of b - cells by antibody may be responsible for an early rapid phase of response. an additional mechanism is associated with the suppression of autoreactive b - cells producing autoantibodies and it allows the maintenance of remission [13, 14 ]. it is unlikely that the drop of agglutinin titers demonstrated after rituximab was responsible for prca recovery in our patient. some authors share the view that the correlation between pre - transplant hemagglutinin titers and the occurrence of prca remains controversial. to our best knowledge this is the first report on an adult patient who simultaneously developed prca and ptld after allohsct and promptly responded to rituximab. zhu. presented a case of a 5-year - old girl with chronic myeloid leukemia who developed prca and ptld after hla - identical unrelated cord blood transplantation. the clinical symptoms of ptld resolved after rituximab at four standard lymphoma doses with a subsequent decline in anti - donor agglutinin titers and prca recovery. both presented cases demonstrated several risk factors of development of ptld and prca in the transplant period. regarding these two reported patients we may conclude that : 1) early recognition of high ebv load after transplant with symptoms of ptld may enable rapid treatment with anti - cd20 antibody, and 2) rituximab may offer rapid and complete recovery from overt ptld and prca with some caution regarding infectious complications. | pure red cell aplasia (prca) and post - transplant lymphoproliferative disorder (ptld) constitute rare complications after allogeneic hematopoietic stem cell transplantation (allohsct). the incidence of ebv - ptld is above 1%, but it may increase in patients with well - known risk factors such as ebv seronegativity at the time of transplantation, t - cell depletion of donor grafts, hla mismatch and use of antithymocyte globulin (atg) for prophylaxis of graft versus host disease. the risk factors for prca were defined and they include : 1) elevated post - transplant anti - donor isohemagglutinin titers, 2) reduced - intensity conditioning before transplant, 3) the presence of anti - a agglutinin and 4) ciclosporin for graft versus host disease (gvhd) prophylaxis and 5) transplant from sibling donor. the anti - cd20 monoclonal antibody rituximab remains the first line treatment for ptld following allohsct, but its efficacy in prca is limited. reduction of immunosuppression is also strongly advised. this is the first report on an adult patient who simultaneously developed prca and ptld after abo - mismatched allohsct. the early introduction of rituximab resulted in prompt resolution of clinical symptoms with subsequent full recovery. |
the greater saphenous vein (gsv) remains the most commonly harvested conduit for revascularization in coronary artery bypass grafting (cabg) (1, 2). the conventional technique for this procedure has long been open vein harvesting (ovh). several studies have reported that the ovh technique results in post - operative pain, delayed healing, and prolonged hospital stay (35). therefore, in the past decade, a minimally invasive technique has been developed to reduce the surgical trauma associated with ovh and improve patients satisfaction without disturbing the post - surgical outcomes (35). there is strong evidence to suggest that the endoscopic vein harvesting (evh) technique can reduce post - operative infections, pain, mobility restriction, and the duration of hospital stays (6). in preliminary studies, no significant differences in graft patency were observed between the ovh and evh techniques within six months of the procedures (7). however, in recent studies, it has been suggested that evh may be accompanied by reduced graft patency (6). from the histological perspective, evh has been proven to be very similar to the ovh technique ; yet certain studies focusing on changes in the endothelial cellular surface are inconsistent with these findings. in a recent study, evh was associated with a higher rate of venous graft failure and higher rates of mortality, myocardial infarction, and the need for revascularization during the first year after the surgery (3). since post - op angiographic studies are not routinely performed, we decided to perform this study on elective, off - pump cabg candidates who made their own decisions to undergo the techniques. the aim of this study was to compare the clinical and pathological outcomes of ovh and evh in patients who underwent the coronary artery bypass grafting procedure. in addition to the clinical and pathological outcomes, we compared the mean fees for the hospital stays for the evh and ovh groups. in this cohort study performed from october 2013 through september 2014, all patients scheduled for off - pump cabg in the cardiac surgery ward of imam reza medical were enrolled. those undergoing cabg for the first time entered either the ovh group (86 cases) or evh group (87 cases) based on their own decision - making. patients were included in this study if they were more than 18 years old and scheduled for an elective off - pump cabg for the first time. patients who also were also candidates for heart - valve surgery, had leg or other ulcers, had active bacterial infections, had simultaneous evh and ovh, and those who died during surgery were excluded from the study. all operations were performed by a well - experienced surgeon in a single, well - equipped center. the aim of surgery was to obtain complete revascularization by using the graft obtained from the great saphenous vein or the left internal mammalian artery. evh was performed in group a using the vaso - view system (open carbon dioxide (co2), sorin group co). openings were performed in the center on the upper and/or the bottom part of the knee through a small cut of 1.5 to 2.5 cm, in accordance with the required length of selected vein ; cutting was not done in the region of the knee flexor. harvesting was conducted primarily to the groin region in order to get the enough vessel length (24). bipolar cauterizing scissors were used for splitting the lateral branches when the peripheral vein was removed. a small cut was made close to the origin on the basis of endoscopic vision on saphenous vein to seal, freeze, and split the vessel for removal and preparation. after that, the lateral branches were closed and 7 - 0 monofilament prolene sutures were used, if required. endoscopic dissection was done beneath the leg away from the center when an extra length of vessel was required. typically, two or three pieces of the saphenous vein can be removed with each measuring about 15 cm (24). the lesions of the leg were examined closely for any bleeding, and they were kept open to reverse the effects of heparin. the removed regions were rubbed lightly in order to detect any bleeding or clotting, and, then, absorbable subcutaneous and subcuticular sutures were used to close the area. long cutting were carried out in the saphenous vein area depending on the required number and length of vein grafts (24). when the vessel was visible, lateral branches were closed or clipped on both the case side and the graft side. the incisions were closed in layers by absorbable sutures and then ended by a subcuticular closure. finally, the wound was wrapped with cotton gauze, and an ace wrap was applied to the entire leg for 48 hours. demographic data, such as age, gender, body mass index (bmi), positive medical history of chronic obstructive pulmonary disease (copd), asthma, transient ischemic attack (tia), and diabetes were mentioned in each patient s history. then, echocardiographic reports for ventricular ejection fraction (ef %), baseline serum creatinine (mg / dl), and hematocrit levels (%) were recorded for all patients. then we recorded the circumference (cm) of the ankle of the target leg for harvesting leg, and pre - operative intra - aortic balloon pump (iabp) use was recorded. during the surgery, the mean duration (min), the mean blood products required during the operation, and the mean number of grafts performed were entered on the patients records for both groups. surgical outcomes were the length of the incision on the leg (cm), the mean harvesting time (min), and the length of the harvested vein (cm). during the surgery, a specimen of the harvested vein was sent for pathological examination. patients were followed up on the second day of their stay in the post - surgical intensive care unit (icu) and on the last day of their stay in the post - surgical ward. icu and ward observed clinical outcomes were as follows : the circumference (cm) of the ankle of the harvesting leg, pain score (by visual analog scale), serum albumin level (mg / dl), serum creatinine level (mg / dl), positive troponin levels (n), number of transfusion blood pack cells, cardiac arrhythmia, cerebrovascular accident (cva), iabp use, re - operation rate, and death rate. mean hospital stay and the fees for the hospital stays also were compared for the two groups. all patients were monitored for six weeks for the circumference of the ankle of the leg of harvested vein, the pain score, and the rate of wound infections. the study protocol was approved by the ethics committee of mashhad university of medical sciences and described to all patients. spss version 17.0 (spss, inc., chicago, illinois, united states of america) software was used to analyze the data. the paired sample t - test, the independent t - test, their non - parametric equivalents, and the chi - squared test were used as appropriate. in this cohort study performed from october 2013 through september 2014, all patients scheduled for off - pump cabg in the cardiac surgery ward of imam reza medical were enrolled. those undergoing cabg for the first time entered either the ovh group (86 cases) or evh group (87 cases) based on their own decision - making. patients were included in this study if they were more than 18 years old and scheduled for an elective off - pump cabg for the first time. patients who also were also candidates for heart - valve surgery, had leg or other ulcers, had active bacterial infections, had simultaneous evh and ovh, and those who died during surgery were excluded from the study. all operations were performed by a well - experienced surgeon in a single, well - equipped center. the aim of surgery was to obtain complete revascularization by using the graft obtained from the great saphenous vein or the left internal mammalian artery. evh was performed in group a using the vaso - view system (open carbon dioxide (co2), sorin group co). openings were performed in the center on the upper and/or the bottom part of the knee through a small cut of 1.5 to 2.5 cm, in accordance with the required length of selected vein ; cutting was not done in the region of the knee flexor. harvesting was conducted primarily to the groin region in order to get the enough vessel length (24). bipolar cauterizing scissors were used for splitting the lateral branches when the peripheral vein was removed. a small cut was made close to the origin on the basis of endoscopic vision on saphenous vein to seal, freeze, and split the vessel for removal and preparation. after that, the lateral branches were closed and 7 - 0 monofilament prolene sutures were used, if required. endoscopic dissection was done beneath the leg away from the center when an extra length of vessel was required. typically, two or three pieces of the saphenous vein can be removed with each measuring about 15 cm (24). the lesions of the leg were examined closely for any bleeding, and they were kept open to reverse the effects of heparin. the removed regions were rubbed lightly in order to detect any bleeding or clotting, and, then, absorbable subcutaneous and subcuticular sutures were used to close the area. were carried out in the saphenous vein area depending on the required number and length of vein grafts (24). when the vessel was visible, lateral branches were closed or clipped on both the case side and the graft side. the incisions were closed in layers by absorbable sutures and then ended by a subcuticular closure. finally, the wound was wrapped with cotton gauze, and an ace wrap was applied to the entire leg for 48 hours. demographic data, such as age, gender, body mass index (bmi), positive medical history of chronic obstructive pulmonary disease (copd), asthma, transient ischemic attack (tia), and diabetes were mentioned in each patient s history. then, echocardiographic reports for ventricular ejection fraction (ef %), baseline serum creatinine (mg / dl), and hematocrit levels (%) were recorded for all patients. then we recorded the circumference (cm) of the ankle of the target leg for harvesting leg, and pre - operative intra - aortic balloon pump (iabp) use was recorded. during the surgery, the mean duration (min), the mean blood products required during the operation, and the mean number of grafts performed were entered on the patients records for both groups. surgical outcomes were the length of the incision on the leg (cm), the mean harvesting time (min), and the length of the harvested vein (cm). during the surgery, a specimen of the harvested vein was sent for pathological examination. patients were followed up on the second day of their stay in the post - surgical intensive care unit (icu) and on the last day of their stay in the post - surgical ward. icu and ward observed clinical outcomes were as follows : the circumference (cm) of the ankle of the harvesting leg, pain score (by visual analog scale), serum albumin level (mg / dl), serum creatinine level (mg / dl), positive troponin levels (n), number of transfusion blood pack cells, cardiac arrhythmia, cerebrovascular accident (cva), iabp use, re - operation rate, and death rate. mean hospital stay and the fees for the hospital stays also were compared for the two groups. all patients were monitored for six weeks for the circumference of the ankle of the leg of harvested vein, the pain score, and the rate of wound infections. the study protocol was approved by the ethics committee of mashhad university of medical sciences and described to all patients., chicago, illinois, united states of america) software was used to analyze the data. the paired sample t - test, the independent t - test, their non - parametric equivalents, and the chi - squared test were used as appropriate. the demographic characteristics of the two groups as they entered the study are provided in table 1. para clinic studies, including ventricular ejection fraction (ef %) (ovh vs. evh : 44.3 11.6 vs. 50.5 12.1 ; p = 0.092), serum creatinine (mg / dl) (ovh vs. evh : 1.1 0.7 vs. 1.1 0.4 ; p = 0.625), and hematocrit levels (%) (ovh vs. evh : 40.5 4.9 vs. 38.1 4.8 ; p = 0.312) on the pre - op day showed no significant difference between the two groups. moreover, the two groups of ovh and evh were similar regarding the mean duration of surgery (min) (ovh vs. evh : 263.2 66.3 vs. 256.8 60.4 ; p = 0.412) and the mean blood products required during the operation (n) (ovh vs. evh : 1.0 1.3 vs. 1.0 1.2 ; p = 0.734). among the 173 patients who underwent cabg, 584 grafts were performed with a mean number of 3.37 grafts per patient, indicating no meaningful difference between the ovh and evh groups (ovh vs. evh : 3.2 0.7 vs. 3.4 0.6 ; p = 0.061) the lengths of the incisions in the legs of the evh group were significantly less than those in the ovh group, showing a meaningful difference (3.719 3.66 vs. 16.963 45.92 cm, p<0.001). the mean harvesting time also was significantly less in the evh group than in the ovh group (16.518 36.55 vs. 23.680 56.57 min, p < 0.001). accordingly, the length of the harvested vein in the evh group was less than that in the ovh group (14.440 35.59 vs. 15.932 44.47, p = 0.009). the most common locations for vein harvesting in both groups were above and below the knee (86.46% vs. 86.40%). however, in the ovh group, the most commonly used location was below the knee, whereas it was above the knee in the evh group, showing a meaningful difference (p = 0.01). in the icu, no significant difference was found between the evh and ovh groups considering the studied variables in their post - op icu stay (table 2). during hospitalization in the cardiac surgery ward, no significant difference was found between the two groups considering the studied variables in post - op ward stay (table 3). the only difference between the two groups at the end of hospital stay was the hospital fees (table 3). in the sixth post - op week, the circumference (cm) of the ankle of the leg of harvested vein (ovh vs. evh : 23.7 1.5 vs. 23.4 1.4 ; p = 0.309) showed no meaningful difference between the two groups. pain score was significantly less in the evh group than in the ovh group (ovh vs. evh : 1.3 0.8 vs. 0.9 1.08 ; p = 0.02). the vein grafts taken in the two groups showed no meaningful difference regarding their pathologic status based on endothelia injury (ovh vs. evh : 2.3% vs. 0.0% ; p = 0.241) and intimal fibrosis (ovh vs. evh : 8.1% vs. 2.3% ; p = 0.091). the demographic characteristics of the two groups as they entered the study are provided in table 1. para clinic studies, including ventricular ejection fraction (ef %) (ovh vs. evh : 44.3 11.6 vs. 50.5 12.1 ; p = 0.092), serum creatinine (mg / dl) (ovh vs. evh : 1.1 0.7 vs. 1.1 0.4 ; p = 0.625), and hematocrit levels (%) (ovh vs. evh : 40.5 4.9 vs. 38.1 4.8 ; p = 0.312) on the pre - op day showed no significant difference between the two groups. moreover, the two groups of ovh and evh were similar regarding the mean duration of surgery (min) (ovh vs. evh : 263.2 66.3 vs. 256.8 60.4 ; p = 0.412) and the mean blood products required during the operation (n) (ovh vs. evh : 1.0 1.3 vs. 1.0 1.2 ; p = 0.734). among the 173 patients who underwent cabg, 584 grafts were performed with a mean number of 3.37 grafts per patient, indicating no meaningful difference between the ovh and evh groups (ovh vs. evh : 3.2 0.7 vs. 3.4 0.6 ; p = 0.061) the lengths of the incisions in the legs of the evh group were significantly less than those in the ovh group, showing a meaningful difference (3.719 3.66 vs. 16.963 45.92 cm, p<0.001). the mean harvesting time also was significantly less in the evh group than in the ovh group (16.518 36.55 vs. 23.680 56.57 min, p < 0.001). accordingly, the length of the harvested vein in the evh group was less than that in the ovh group (14.440 35.59 vs. 15.932 44.47, p = 0.009). the most common locations for vein harvesting in both groups were above and below the knee (86.46% vs. 86.40%). however, in the ovh group, the most commonly used location was below the knee, whereas it was above the knee in the evh group, showing a meaningful difference (p = 0.01). in the icu, no significant difference was found between the evh and ovh groups considering the studied variables in their post - op icu stay (table 2). during hospitalization in the cardiac surgery ward, no significant difference was found between the two groups considering the studied variables in post - op ward stay (table 3). the only difference between the two groups at the end of hospital stay was the hospital fees (table 3). in the sixth post - op week, the circumference (cm) of the ankle of the leg of harvested vein (ovh vs. evh : 23.7 1.5 vs. 23.4 1.4 ; p = 0.309) showed no meaningful difference between the two groups. pain score was significantly less in the evh group than in the ovh group (ovh vs. evh : 1.3 0.8 vs. 0.9 1.08 ; p = 0.02). the vein grafts taken in the two groups showed no meaningful difference regarding their pathologic status based on endothelia injury (ovh vs. evh : 2.3% vs. 0.0% ; p = 0.241) and intimal fibrosis (ovh vs. evh : 8.1% vs. 2.3% ; p = 0.091). abundant evidence has emerged in the recent years emphasizing that evh is accompanied with a lower rate of leg - wound morbidity, better cosmetic results, and improved patient satisfaction (1, 8, 9). despite all such advantages, there are still certain concerns regarding the potential ability of this technique to damage the endothelial integrity of the vein (10). however, the results of our study showed that evh did not cause any undesired clinical outcomes and the patients experienced less pain than the ovh group. in this study, the post - op pain score during the 6-week follow - up period in the evh group was significantly less than the ovh group. in other similar studies that also have used the vas for pain assessment, patients undergoing evh rated their experience of pain on a 010 scale two points lower throughout the entire post - operative period and were pain - free a few days earlier than the ovh group (5, 11, 12). patients undergoing evh due to experiencing less pain had shorter time to mobilization (12, 13). in the study by cheng. (31), the rate of pain (23.1% vs. 6.7%), neuralgia (24.3% vs. 7.1%), and patient satisfaction (49% vs. 75%) were in a better status in the evh than in the ovh group. one of the other complications of vein harvesting is infection at the site of the incision. various studies have indicated that the rate of infection in the ovh group varies between 225%, resulting in significant clinical complications and additional costs to the healthcare system (3). in a meta - analysis by athanasiou. of eleven rcts, the evh technique was associated with a significantly lower rate of infection at the harvesting site than ovh (or = 0.22, p < 0.00001) (15). in another meta - analysis including 35 studies, the evh group again had a lower infection rate (p < 0.0001) (16). in another study by raja. in 2013 (3) on 411 cabg patients, the rate of infection at the harvesting site was followed up for four years. it was reported that the evh technique almost eliminates the probability of infection at this site when compared to the ovh technique (1.13% vs 1.3%, p < 0.001). the reason may be due to the smaller incision and the safe transfer of tissue in this surgical method. another less important aspect may be due to preserved tissue perfusion and a lower likelihood of creating vital tissue flaps. however, the highlight of the current study was the zero infection rate in the 6-week follow - up period. this lower rate of infection in the evh technique compared to ovh is of particular value in diabetic and obese patients and those with peripheral arterial diseases in whom evh is considered the method of choice (17, 18). irrespective of the harvesting site s infection rate, which has always been a major concern, complications related to the quality of the harvested vein, which, by closing the graft, can cause serious complications in other organs, is of great importance as well. in the current study the two groups were compared regarding heart, kidney, and cerebral complications during hospitalization, and there were no meaningful differences. myocardial infarction (mi) is the most important complication, and it is an indicator of the graft s patency. in this study, similar to others, no difference was seen in the rate of mi in the short - term. in a meta - analysis by satry. in 2013 (16) that included twelve studies and 3,872 patients, no difference was reported in the rate of mi after the operation by either technique (sr risk : 0.87 ; 95% ci : 0.681.11 ; p = 0.26). one of the other important factors in estimating the safety of a certain technique is investigating the short-, mid- and long - term mortality. our study showed no difference in mortality during hospitalization and the 6-week follow - up between the two groups. this also was reported in the few meta - analyses performed comparing evh and ovh. yet, more studies are required regarding this issue in order to obtain more precise results, especially in short- and mid - term follow ups. another important aspect of the current study is the therapeutic costs for which higher costs were achieved in the evh group compared to ovh. according to the few studies that have investigated this issue, it has been observed that the shorter time to ambulation and the lower rate of leg wound morbidity result in shortened hospital stay and lower medical costs in the evh group (3). however, the two we studied showed no meaningful difference regarding the lengths of their hospital stays. despite the increasing recognition of the benefits of the evh technique, the quality of the harvested vein is still a major concern, because endothelial injury affects the graft opening following cabg.. reported no difference in the structural and functional viability of the saphenous vein endothelium between the evh and ovh groups, yet they stated that the vasomotor function may decrease (19). andreasen s study in 2015 showed that over the past 6.3 years, the majority of vein graft failures were significantly detected by evh rather than ovh without any differences in long - term clinical outcomes (21). angiographic follow - up results had no difference with clinical outcomes in cases with open versus endoscopic harvesting for coronary bypass surgery (23). the evh is an ordinary technique to train for removing vein conduit in cabg (24). reduction in wound complications, satisfaction of recovery, shorter durations of admission, and reduced post - operative pain at the opening area after evh have been reported when evh and ovh were compared (24). the 2014 society of cardiology (esc) and the european association for cardio - thoracic surgery (eacts) guidelines on myocardial revascularization addressed the methods of conduit harvest and issued a class iia level a recommendation for evh. this recommendation, which represents the first formal recommendation for evh by esc / eacts, was based on data from meta - analyses as well as randomized trials, noting that nearly all studies documented reductions in wound infection and impaired healing, and the guidelines also asserted that the most recent data do not demonstrate inferior clinical outcomes with evh. the recommendation based on 2014 esc / eacts guidelines about evh is endoscopic vein harvesting should be considered to reduce the incidence of leg wound complications (25). moreover, in this study the vein grafts taken in the two groups showed no meaningful difference regarding their pathological findings (p = 0.241). first, we could not do a post - operative control angiography or ct - angiography for evaluating the grafts patency, because there was no evidence of graft failure in our studied population. so, we were not able to publish the comparison of grafts patency between two groups of evh and ovh. we recommend to the other researchers to compare the clinical outcomes of evh and ovh over longer follow - up periods. the findings of the current study revealed that the harvesting time is generally shorter in the evh technique in contrast to several other studies. this discrepancy in the results may be due to the experience of the technicians and the equipment used for this purpose. a shorter harvesting time results in a shorter period of post - op care regarding leg - wound morbidity. it seems that we have once again illustrated an important link between minimally - invasive great saphenous vein harvesting and improved tissue healing when compared to conventional open surgery. however, additional research is required to investigate the cosmetic outcomes, hospital costs, and cost - efficiency further ; more importantly, long - term graft patency should be investigated in the evh technique. taking into consideration the large number of cabg procedures performed in our region using the evh technique, its training course should be further valued and emphasized to improve the quality of vein grafts besides causing minimal injury to the surrounding tissue. | introductionharvesting of the greater saphenous vein is almost an inevitable part of coronary artery bypass grafting (cabg) operations, and it is done by two main techniques, i.e., conventional or open vein harvesting (ovh) and the minimally - invasive endoscopic vein harvesting (evh). this study aimed to compare these two techniques in off - pump cabg procedures with respect to clinical and pathological outcomes.methodsthis cohort study was conducted on cabg candidates during a one - year period from october 2013 through september 2014 in the department of cardiac surgery at mashhad university of medical sciences. eighty - seven patients voluntarily underwent evh, and another 86 patients matched for age, gender, and other cardiovascular risk factors were selected for ovh. they were followed up for six weeks, and the main outcome measures were infections of the wound, pain, duration of hospital stay, and the costs of hospitalization. paired sample t - test, independent t - test, or their non - parametric equivalents and the chi - squared test were used by spss version 17.0 for data analysis.resultsthe mean duration of time for vein harvesting was shorter in the evh group (p < 0.001), and the pain score was lower (p = 0.04). no infections occurred at the site of the wound. the length of hospital stay was not significantly different for the two groups (ovh versus evh : 8.5 3.3 versus 8.4 3.2 days ; p - value : 0.08). hospitalization costs were significantly higher in the evh group (ovh versus evh : 5.8 4.7 versus 7.3 2.0 million tomman ; p - value : 0.008), yet no difference was diagnosed with respect to endothelial damage in the vein grafts harvested by the evh and ovh techniques.conclusionevh is considered as a minimally invasive and safe vein harvesting technique in our center, and it can reduce the harvesting time and post - operative pain. in addition, its efficiency was similar to that of ovh. |
the availability of high resolution ultrasound imaging and aneuploidy screening programmes has made the unborn a patient sui generis. when fetal malformations, genetic diseases or in - utero acquired conditions are suspected, pregnant patients should be referred to fetal medicine units with more specialized skills, larger experience and multidisciplinary counsellors to define potential options. in some cases, intervention before birth may be desirable, often not requiring direct access to the fetus, e.g. transplacental administration of antibiotics in case of fetal infection or anti - arrhytmic drugs in case of tachy - arrhytmia. some conditions are amenable to surgical correction, and in the majority of cases this is best done after birth. occasionally prenatal surgery may save the life of the fetus or prevent permanent organ damage. because of the potential complications, risks and benefits of the intervention must be weighed against each other. a consensus, endorsed by the international fetal medicine and surgery society (ifmss), has been reached on the criteria and indications for fetal surgery (table 1 ; harrison, 1991). the majority of procedures currently clinically offered in europe are minimally invasive (by fetoscopy) (deprest., 2006), although open fetal surgery is now increasingly practiced in the united states (adzick, 2010). an overview of indications can be found in table 2 (deprest., 2008). fetal therapy raises a number of ethical concerns, of which the most obvious one is the balance between potential benefit and harm for the fetus as well as for its mother. this is in essence first a scientific question, and involves aspects related to point 1 to 4 of table 1. it is up to the medical community to provide evidence that fetal intervention can provide the claimed benefit, in the absence of harm, or only at the expense of minimal and acceptable risk. there is unfortunately no evidence of benefit for the vast majority of fetal therapeutic procedures that are offered today. exceptions are for instance the use of steroids in the prevention of respiratory distress syndrome. also, for endoscopic procedures there is now level i evidence that laser coagulation of placental anastomoses for twin to twin transfusion syndrome is better than amniodrainage (senat., 2004). the only open fetal surgical procedure with a proven benefit is the antenatal repair of selected neural tube defects (adzick., 2011). the other surgical procedures are strictly spoken investigational, i.e. that there is no evidence in randomized controlled trials (rct) showing their benefit. for a number of procedures for instance in the case of the administration of fetal red blood cells for rh - sensitization, fetal transfusion has an excellent track record and there are good data on long term outcomes. also the risks associated to it are limited, but include rupture of the membranes, infection, bleeding, and occasionally fetal death. it does not seem reasonable to conduct a trial for the simple purpose of doing a rct : it is unlikely that such will advance our knowledge or improve outcome of this disease. for other procedures, such as reversal of urinary tract obstruction, valvuloplasty for congenital heart defects, tracheal occlusion for diaphragmatic hernia, etc it is possible that the inherent adverse effects exceed the assumed benefit. outcomes are also very often much less conclusive, if not poorly documented. in such situations it is a duty of the medical community to conduct appropriately designed trials that balance the claimed benefits of fetal intervention against the inherent side effects of the surgery (rodrigues., 2011). one of the principal reasons is that fetal medicine specialists often have certain prejudices or biases towards (or against) given fetal therapies. mediagenicity of fetal therapy also tempts many clinicians and hospitals to advocate intervention, and the lay press often overadvertises procedures of yet unproven efficacy. an often forgotten ethical aspect of fetal surgery is that these highly specialized procedures should be offered only by teams, and individuals that are familiar with and experienced in management of the pathology involved and the execution of these procedures. for a number of fetal interventions learning curves for example numbers have been determined to achieve as well as maintain proficiency in laser surgery for twin - to - twin transfusion syndrome (hecher., 2000, a similar learning curve effect has been shown for prenatal imaging, required to select cases for fetal surgery (cruz - martinez., 2011). given the numbers required and the rarity of cases implicated a certain centralisation is necessary to obtain optimal results. if those are not met, the fetal therapy centre should disclose its previous experience as well as turn over to the patient, and when insufficient, refer the patient to a more experienced unit. the complexity as well as the overall rarity of indications are both limitations to the wide implemention of fetal therapy. there may be a need for a regulatory authority to determine viability and efficacy for current and new programmes. it is unclear who is entitled and qualified enough for this but in the usa the medical profession has already taken an initiative to regulate this (chescheir, 2009 ; johnson 2010). conversely, centers not offering certain fetal therapies, should give the patient options to seek advice and eventually therapy elsewhere. this should be accompanied by information on the level of evidence for the suggested therapy. groups that offer fetal therapy have to do so within strict protocols, and are expected to keep track of their outcomes. indeed, long term follow - up for children that have undergone a fetal invasive surgery is lacking for numerous fetal interventions despite being an essential part of information given to parents (harrison. last, maternal side effects as well as the potential impact on future reproduction and pregnancies should be well studied and discussed (wilson., 2010). thanks to prenatal diagnosis the fetus has become a patient, if not in its own right, at least with a quasi - independent consideration of interest. according to a preeminent view about the ethics of fetal surgery, in the viable period, the moral status of the fetus is typically perceived as (nearly) the same as that of a neonate. this makes the fetus a patient sui generis which can be considered more or less independent from the mother : perhaps with its own rights, including a right to therapy. it is often argued that the obstetrician has a duty towards the fetus who will become a born baby (chervenak., 1993 ; chervenak., 1985). when the fetus is not viable yet, it seems logic to interpret our duties towards the fetal patient differently, and one would only act if the mother confers her fetus the status of patient and beneficiary of the therapy we propose. making a sharp distinction for fetuses that have reached viability quasi provides such fetus the status of an independent patient, to whom both the physician and the mother would have stronger moral obligations. in some countries the landmark of viability is reflected in the legislation on legal abortion for medical reasons. the fetus would in this perspective at a given timepoint (viability) be considered as a patient, irrespective of the mother s preferences (chervenak., 1993). this is tempting, but not true : the fetus irrespective of its gestational age- is dependent on the mother and her body, and no treatment can be offered without involving the mother as well. it is the mother who bears the burden of fetal therapy (including its failure). she acts as the moral agent in relation to choices for the fetus (noble., 2008). as a consequence, the mother has the right to refuse treatment as well, irrespective of viability borders. in practice it will be mostly a shared decision by the mother and the father and family, after consultation with the multidisciplinary fetal care team. given the emotional and complex nature of such a decision, it is required that the multidisciplinary professional team gives not only appropriate information about the prognosis, the impact of the condition for the future child and its family environment, the need and availability of structured medical and educational support, the benefits and harms of the intervention as well as all possible alternatives. such counselling should in a careful and expert way offer personalised support to the pregnant couple and family. as to better understand the family s decision process, counsellors will have to be aware of the very individual circumstances that may influence the mother s decision, such as maternal age, previous and future fertility perspectives, the presence of other children affected by the same or other serious conditions in her own or wider family, socio - cultural and religious background, etc... besides that, if there is a reasonable certainty that the fetus will suffer from irreversible and serious harm without the intervention, and if there is evidence regarding the effectiveness of its treatment, with very few feto - maternal risks, relatively directive counselling of the couple can be a moral duty. but ultimately, the physician has to respect the autonomous decision of the pregnant woman (and her partner). on the other hand, when a mother or couple requests a procedure of questionable benefit or carrying a significant risk, according to the treating physician or center, it should be clair that they have not a right to an intervention that experts judge as too risky and medically not justifiable. a referral for second opinion to another expert center familiar with and offering the procedure seems to be a fair step in that case. fetal therapy raises a number of ethical concerns, of which the most obvious one is the balance between potential benefit and harm for the fetus as well as for its mother. this is in essence first a scientific question, and involves aspects related to point 1 to 4 of table 1. it is up to the medical community to provide evidence that fetal intervention can provide the claimed benefit, in the absence of harm, or only at the expense of minimal and acceptable risk. there is unfortunately no evidence of benefit for the vast majority of fetal therapeutic procedures that are offered today. exceptions are for instance the use of steroids in the prevention of respiratory distress syndrome. also, for endoscopic procedures there is now level i evidence that laser coagulation of placental anastomoses for twin to twin transfusion syndrome is better than amniodrainage (senat., 2004). the only open fetal surgical procedure with a proven benefit is the antenatal repair of selected neural tube defects (adzick., 2011). the other surgical procedures are strictly spoken investigational, i.e. that there is no evidence in randomized controlled trials (rct) showing their benefit. for a number of procedures for instance in the case of the administration of fetal red blood cells for rh - sensitization, fetal transfusion has an excellent track record and there are good data on long term outcomes. also the risks associated to it are limited, but include rupture of the membranes, infection, bleeding, and occasionally fetal death. it does not seem reasonable to conduct a trial for the simple purpose of doing a rct : it is unlikely that such will advance our knowledge or improve outcome of this disease. for other procedures, such as reversal of urinary tract obstruction, valvuloplasty for congenital heart defects, tracheal occlusion for diaphragmatic hernia, etc it is possible that the inherent adverse effects exceed the assumed benefit. outcomes are also very often much less conclusive, if not poorly documented. in such situations it is a duty of the medical community to conduct appropriately designed trials that balance the claimed benefits of fetal intervention against the inherent side effects of the surgery (rodrigues., 2011). one of the principal reasons is that fetal medicine specialists often have certain prejudices or biases towards (or against) given fetal therapies. mediagenicity of fetal therapy also tempts many clinicians and hospitals to advocate intervention, and the lay press often overadvertises procedures of yet unproven efficacy. an often forgotten ethical aspect of fetal surgery is that these highly specialized procedures should be offered only by teams, and individuals that are familiar with and experienced in management of the pathology involved and the execution of these procedures. for a number of fetal interventions learning curves for example numbers have been determined to achieve as well as maintain proficiency in laser surgery for twin - to - twin transfusion syndrome (hecher., 2000, a similar learning curve effect has been shown for prenatal imaging, required to select cases for fetal surgery (cruz - martinez., 2011). given the numbers required and the rarity of cases implicated a certain centralisation is necessary to obtain optimal results. if those are not met, the fetal therapy centre should disclose its previous experience as well as turn over to the patient, and when insufficient, refer the patient to a more experienced unit. the complexity as well as the overall rarity of indications are both limitations to the wide implemention of fetal therapy. there may be a need for a regulatory authority to determine viability and efficacy for current and new programmes. it is unclear who is entitled and qualified enough for this but in the usa the medical profession has already taken an initiative to regulate this (chescheir, 2009 ; johnson 2010). conversely, centers not offering certain fetal therapies, should give the patient options to seek advice and eventually therapy elsewhere. this should be accompanied by information on the level of evidence for the suggested therapy. groups that offer fetal therapy have to do so within strict protocols, and are expected to keep track of their outcomes. indeed, long term follow - up for children that have undergone a fetal invasive surgery is lacking for numerous fetal interventions despite being an essential part of information given to parents (harrison. last, maternal side effects as well as the potential impact on future reproduction and pregnancies should be well studied and discussed (wilson., 2010). thanks to prenatal diagnosis the fetus has become a patient, if not in its own right, at least with a quasi - independent consideration of interest. according to a preeminent view about the ethics of fetal surgery, in the viable period, the moral status of the fetus this makes the fetus a patient sui generis which can be considered more or less independent from the mother : perhaps with its own rights, including a right to therapy. it is often argued that the obstetrician has a duty towards the fetus who will become a born baby (chervenak. when the fetus is not viable yet, it seems logic to interpret our duties towards the fetal patient differently, and one would only act if the mother confers her fetus the status of patient and beneficiary of the therapy we propose. making a sharp distinction for fetuses that have reached viability quasi provides such fetus the status of an independent patient, to whom both the physician and the mother would have stronger moral obligations. in some countries the landmark of viability is reflected in the legislation on legal abortion for medical reasons. the fetus would in this perspective at a given timepoint (viability) be considered as a patient, irrespective of the mother s preferences (chervenak., 1993). this is tempting, but not true : the fetus irrespective of its gestational age- is dependent on the mother and her body, and no treatment can be offered without involving the mother as well. for this reason maternal consent for any fetal therapy is necessary. it is the mother who bears the burden of fetal therapy (including its failure). she acts as the moral agent in relation to choices for the fetus (noble., 2008). as a consequence, the mother has the right to refuse treatment as well, irrespective of viability borders. in practice it will be mostly a shared decision by the mother and the father and family, after consultation with the multidisciplinary fetal care team. given the emotional and complex nature of such a decision, it is required that the multidisciplinary professional team gives not only appropriate information about the prognosis, the impact of the condition for the future child and its family environment, the need and availability of structured medical and educational support, the benefits and harms of the intervention as well as all possible alternatives. such counselling should in a careful and expert way offer personalised support to the pregnant couple and family. as to better understand the family s decision process, counsellors will have to be aware of the very individual circumstances that may influence the mother s decision, such as maternal age, previous and future fertility perspectives, the presence of other children affected by the same or other serious conditions in her own or wider family, socio - cultural and religious background, etc... besides that, if there is a reasonable certainty that the fetus will suffer from irreversible and serious harm without the intervention, and if there is evidence regarding the effectiveness of its treatment, with very few feto - maternal risks, relatively directive counselling of the couple can be a moral duty. but ultimately, the physician has to respect the autonomous decision of the pregnant woman (and her partner). on the other hand, when a mother or couple requests a procedure of questionable benefit or carrying a significant risk, according to the treating physician or center, it should be clair that they have not a right to an intervention that experts judge as too risky and medically not justifiable. a referral for second opinion to another expert center familiar with and offering the procedure seems to be a fair step in that case. therapeutic procedures of uncertain benefit to the fetus must be evaluated within properly designed trials with appropriate ethics committee approval, and with maternal informed consent. consent is only informed and voluntary if the potential harms and benefits are clearly understood by the mother. the latter are not the only aspects covered during consent ; appropriate access to counselling and support is necessary to ensure that there is sufficient understanding and that support is available in the event of a poor outcome. although in medicine, clinical research and medical ethics, the free and informed consent is considered as a very important procedural way of expressing the principle of respect for autonomy, it does in the context of fetal surgery not always give women the feeling that they are in the situation to make a real free choice. not so much because they are poorly informed, but because such decision is not solely based on self protection or risk avoidance. pregnant women generally want to give their child the best possible start in life, even if this leads to choices and behaviour which in other situations would be considered as not morally required (smajdor, 2011). if this altruistic attitude goes hand in hand with parallel social expectations and new technological possibilities, caution should be taken not to cause an unpleasant feeling of pressure, social or other, on the mothers involved. another important aspect of informed consent during the recruitment of patients for a trial, is the use of the term fetal this might be misleading, and at the best the term investigational or experimental treatment should be used. another aspect of the consent procedure is that fetal interventions are often presented as an alternative for termination of pregnancy (top). the latter already presupposes that the fetal intervention is therapeutic, in other words with a sufficiently high and sustainable chance for success. in fact, its outcome might not be known until after birth, and might even be worse than expected, and at that time the option for termination no longer exists. furthermore this way of presenting things might place undue pressure on parents to consent because they feel a moral obligation to do everything possible to avoid a termination, or, feel that they find themselves in a situation of nothing to lose. one solution to avoid such situation, would be to recruit only parents who express the intention not to opt for top (rodrigues.. our group has been recently involved in designing a trial, in particular on the prenatal management of fetuses with isolated congenital diaphragmatic hernia (cdh) (deprest., this condition can be diagnosed in the prenatal period, and there is now reasonable evidence that the individual prognosis can be predicted based on lung size and liver position (deprest., 2009). temporary fetoscopic endoluminal tracheal occlusion (feto) prevents egress of lung fluid, increasing pressure within the fetal airways, which triggers lung growth. the procedure can now be performed minimally invasively, with an inherent preterm prelabour membrane rupture (pprom and prematurity rate of 20%. when offered to fetuses with severe pulmonary hypoplasia (< 20% survival chances), there is an apparent increased survival up to 50%, without evidence of an increase in morbidity. the data are however poorly controlled and therefore unreliable and there is an urgent need for a trial. such trial unfortunately addresses a population where the termination rate in view of the predicted outcome, is very high. also many physicians have proposed fetal intervention as an alternative to top, which is not recommendable (rodrigues., 2011). we received however unexpected resistance when designing this trial, in particular in relation to the randomization of cases with an over 80% predicted mortality rate. both parents and physicians may have the perception that expectant management during pregnancy in this subset of fetuses, is an (unacceptable) attitude of losing an opportunity for improvement during pregnancy. conversely, prenatal intervention is perceived as therapy, whereas this is exactly what such a rct would be testing. during informative talks with ethicists, it was concluded that for an institution that offers fetal therapy for this population already more than 5 years, it would be difficult to deny this procedure to patients referred for it, except if they would participate in a trial with one expectant arm. in other words, patients would have the possibility of being treated in utero by choice, or opt for the trial. this is a de facto back - door, making sufficient trial recruitment difficult if not impossible. this situation describes the dramatic situation one gets in when one waits too long to set up a trial after introduction of a novel technique. the issue has now been solved, by leaving the decision to participate in the rct or opt for intervention outside the trial, in the hands of referring physicians or centers (rodrigues., 2011). in this scenario, referring fetal medicine centers counsel patients with severe or moderate cdh and decide whether or not to offer trial participation. already two years ago we have started a randomized trial in fetuses with moderate pulmonary hypoplasia (i.e. with predicted survival 30 - 60%). for those fetuses, we hypothesize that fetal intervention will reduce their morbidity (bronchopulmonary dysplasia), potentially increasing survival. at present there is evidence that in this group fetal therapy does not improve prognosis (harrison., 2003). all foetuses were born preterm, but had a better than expected lung function (keller., this trial was however conducted at a time that the fetal procedure was much more invasive, and carried a 100% preterm membrane rupture rate. since techniques have improved, and our ongoing experience meanwhile showed that percutaneous surgery lowers this to around 20 - 25% (jani., 2009). pain is a subjective experience occurring parallel to a physiologic response in reaction to impeding or actual tissue damage. nociception requires an intact sensory system, while an emotional reaction requires some form of consciousness. since the fetus can not tell us whether it feels pain and since pain can not be assessed using conventional objective measures, the concept of fetal pain has been questioned by some however there are many indirect indicators that suggest that the fetus at least can feel pain. demonstrated that preterm infants respectively fetuses display a number of stress responses during invasive procedures (anand., 1987). there is evidence that the mid - gestational fetus can respond to potentially noxious stimuli by mounting a distinct stress response. in analogy to what has been observed in neonates, prenatal stress may be expected to affect later neurodevelopment. consequently, means to manage fetal pain / stress response in utero during invasive fetal interventions have been explored (fisk., 2001). even if it remains yet unproven whether this results in improved neurodevelopment and improved long - term outcome, it is prudent to take pre - emptive action and manage potential painful our group has therefore adhered to a policy of efficient pain relief during fetal procedures and around the time of fetocide from 18 - 20 weeks onwards (de buck., 2008). sufentanil 1 - 2 g / kg or fentanyl 10 g / kg can be given intramuscularly or intravenously to the fetus. in the less common scenario in which the mother undergoes general anesthesia, the fetus should be sufficiently anesthetized through transplacental passage (van de velde., progress in the field of stem cell biology and gene transfer technologies is paving the way for novel treatment strategies. many of them can be diagnosed early in gestation, hence treated prior to birth (coutelle., 2005 ; toelen., 2010). cystic fibrosis (cf) is the quintessential example of a monogenetic yet lethal disease. as the disease can be diagnosed early in pregnancy and since it is caused by a single gene defect, the logic solution is to insert a copy of the wild type gene, at least into the organs that are most affected. the most important one is that postnatal gene therapy so far has failed for this condition. antenatal gene therapy would also prevent disease to develop, and most likely it is going to be technically easier mainly because the target organ is so much smaller. there is early experimental evidence that in utero gene therapy is effective in a number of genetic diseases. proof - of - principle of the above has been demonstrated in murine models (waddington., 2004). fetal stem cell therapy today is already a clinical reality, with the advent of successful in utero hematopoietic stem cell transplantation for severe combined immunodeficiency (westgren., 2002). they may benefit the fetus without engrafting, through paracrine effects, which are currently the subject of intensive research (aslam.,, it is possible to harvest amniotic fluid (af) with limited risk. from af, mesenchymal stem cells (af - msc) can now be isolated and expanded for a wide range of applications (gucciardo., 2009). they could be used for tissue engineering so that congenital birth defects can be more elegantly repaired. the interval between harvesting (midtrimester) and postnatal application would leave time enough for the laboratory to engineer an appropriate construct (fauza., 2001). another interesting aspect is that af - msc can be easily transduced making them an attracting source for combined autologous cell & gene therapy (grisafi., 2008). again, this may be a method of persisting exposure to growth or differentiation factors. this could then be achieved by the administration of transduced autologous af - msc, such that they (temporarily) over - express the factor of interest. it is obvious that fetal gene and cell therapy are of another dimension than the temporary use of drugs, or single surgical intervention. gene and cell therapy will cause complex and continuing interaction with the recipient. complex, because of the duration of the interaction and the inability of its reversal. continuing, because it will be difficult to anticipate when the therapeutic effect is stable, or even complete. also certain (side) effects may only become apparent later in life, and can be as drastic as a development of a tumor (waddington. because of potential post - trial events, any such clinical trial will be a permanent project, in other words a life - long experiment (petit - zeman, 2001 ; trommelmans, 2010). one must not only address typical issues such as minimization of the risks on an individual case but also analyze how the context of gene and cell therapy influences the concept and features of the experiment. this complexity complicates also the informed consent process (trommelmans., 2008). an informed consent for trials with fetal gene and/or cell therapy should not only pay attention to the immediate effect, but also deal with the principle of regeneration, its specific benefits and risks, and with the fact that living cells or duplicating organisms are used, and what their source is. in conclusion, the prenatal diagnosis of a condition that is eligible for fetal therapy, should prompt referral to a center familiar with management of the condition and proven expertise. when fetal therapy is justified, it should be offered with full respect for maternal choice and perception of potential risks. for therapies of unproven benefit, the absence of evidence must be disclosed, and therapy should be undertaken within well designed and approved trials. potential risks and eventual morbidities in case of therapeutic failure should be part of the counselling, neither should fetal therapy be presented as an alternative to termination of pregnancy. | the pregnant patient is a vulnerable subject, and even more so when a serious fetal condition is diagnosed. (invasive) fetal therapy should only be offered when there is a good chance that the life of the fetus will be saved, or irreversible damage by the disease or disability is prevented. following diagnosis of a potentially treatable condition, the patient needs to be referred to a center with sufficient expertise in diagnosis and all therapeutic options. preferences of the physician towards one or another antenatal intervention is not at stake prior to that moment. when fetal therapy is justified, it should be offered with full respect for maternal choice and individual assessment and perception of potential risks, and should be at the location where there is sufficient expertise. for therapies of unproven benefit, the absence of evidence must be disclosed, and therapy should only be undertaken with full voluntary consent of the mother. these ought to be undertaken within well designed and approved trials and only by experts in the treatment modality. potential risks and eventual morbidities in case of therapeutic failure should be part of the counselling, neither should fetal therapy be presented as an alternative to termination of pregnancy |
this study is an analysis of data collected as part of a multisite institutional review board approved study to investigate the role of angiogenesis - related markers in preterm infants who developed bronchopulmonary dysplasia (bpd). the research followed the tenets of the declaration of helsinki. in brief, infants were enrolled into the study within a week of birth. informed consent was obtained from the parents with explanation of the nature and possible consequences of the study. the plasma sample was centrifuged after phlebotomy, and the supernatant was removed, aliquoted, and placed in a freezer at 80c. at the conclusion of the study, a proteomic analysis was conducted on an aliquot using the somascan assay at the laboratories of somalogic, inc., we included nonanomalous premature infants enrolled at children 's hospital colorado (chco) or the university of colorado hospital (uch) who were born at < 31 weeks gestation or with a birth weight less than 1500 g per 2013 rop screening criteria. we merged these records (n = 84) to the corresponding record in our rop registry containing the results of the rop screening examinations on all infants who received care at chco or uch (2006 to present). clinically significant (high grade) rop was defined as type 1 or type 2 rop. type 1 rop was defined as stage 1 or 2 rop in zone i with plus disease, stage 3 in zone i with or without plus disease, or stage 2 or 3 rop in zone ii with plus disease. type 2 rop was defined as stage 1 or 2 rop in zone i without plus disease, or stage 3 rop in zone ii with no plus disease. low - grade rop was defined as rop not meeting type 1 or type 2 definitions. the screening of infants for rop followed standard guidelines and was defined by the international classification of retinopathy of prematurity. ultimately, 12 cases of clinically significant rop, 27 cases of low - grade rop, and 23 controls with no rop were included in the final analytic dataset. the somascan proteomic assay is described in detail elsewhere. in brief, a biological sample in each well of a 96-well plate was incubated with a mixture of the 1121 somamer reagents. two sequential bead - based immobilization and washing steps eliminated unbound or nonspecifically bound proteins and the unbound somamer reagents, leaving only protein target - bound somamer reagents. these remaining somamer reagents were isolated, and each reagent was quantified simultaneously on a custom agilent (santa clara, ca, usa) hybridization array. the amount of each somamer measured was quantitatively proportional to the protein concentration in the original sample. descriptive statistics were calculated and compared across groups using t - tests or tests for variables such as gestational age and birth weight at delivery, infant age at blood draw, sex, and select inflammation - related neonatal complications including culture - positive sepsis and necrotizing enterocolitis. in the first stage of the analysis, we concentrated on infants with the extreme phenotype of rop. concentrations for each of 1121 proteins were log (base 2) transformed and compared between infants who did (n = 12) and did not develop clinically significant rop (n = 23) using a logistic regression (p < 0.05). adjustments for multiple comparisons were not made given the exploratory focus of this study, but false discovery rate adjusted p values were calculated and are provided in the online supplement. in the second stage of the analysis, we compared levels of the highest - ranking proteins across infants with clinically significant, low - grade rop (n = 27), and no rop using an analysis of variance. clinically significant (high grade) rop was defined as type 1 or type 2 rop. type 1 rop was defined as stage 1 or 2 rop in zone i with plus disease, stage 3 in zone i with or without plus disease, or stage 2 or 3 rop in zone ii with plus disease. type 2 rop was defined as stage 1 or 2 rop in zone i without plus disease, or stage 3 rop in zone ii with no plus disease. low - grade rop was defined as rop not meeting type 1 or type 2 definitions. the screening of infants for rop followed standard guidelines and was defined by the international classification of retinopathy of prematurity. ultimately, 12 cases of clinically significant rop, 27 cases of low - grade rop, and 23 controls with no rop were included in the final analytic dataset. the somascan proteomic assay is described in detail elsewhere. in brief, a biological sample in each well of a 96-well plate was incubated with a mixture of the 1121 somamer reagents. two sequential bead - based immobilization and washing steps eliminated unbound or nonspecifically bound proteins and the unbound somamer reagents, leaving only protein target - bound somamer reagents. these remaining somamer reagents were isolated, and each reagent was quantified simultaneously on a custom agilent (santa clara, ca, usa) hybridization array. the amount of each somamer measured was quantitatively proportional to the protein concentration in the original sample. descriptive statistics were calculated and compared across groups using t - tests or tests for variables such as gestational age and birth weight at delivery, infant age at blood draw, sex, and select inflammation - related neonatal complications including culture - positive sepsis and necrotizing enterocolitis. in the first stage of the analysis, we concentrated on infants with the extreme phenotype of rop. concentrations for each of 1121 proteins were log (base 2) transformed and compared between infants who did (n = 12) and did not develop clinically significant rop (n = 23) using a logistic regression (p < 0.05). adjustments for multiple comparisons were not made given the exploratory focus of this study, but false discovery rate adjusted p values were calculated and are provided in the online supplement. in the second stage of the analysis, we compared levels of the highest - ranking proteins across infants with clinically significant, low - grade rop (n = 27), and no rop using an analysis of variance. the overall characteristics of the cohort and the differences in select variables across the rop groups are shown in table 1. gestational age and birth weight at delivery were significantly different between the infants across the rop categories. however, the birth weight z score (birth weight adjusted for gestational age) was not significantly different across the rop categories. differences in select risk factors and neonatal complications among infants who developed clinically significant, low - grade, and no retinopathy of prematurity in the first stage of the analysis, the concentrations of 1121 proteins were compared in infants who developed clinically significant rop to infants who did not develop rop. the significance (log10 p value) and the magnitude (odds ratio, or) for all the proteins significantly associated with rop are shown in table 2 and graphically in figure 1. the results for all proteins (n = 1121 proteins) included in the somascan analysis are shown in supplementary table s1. the unadjusted and the adjusted association of select proteins measured early in the neonatal period for clinically significant rop volcano plot displaying the results from the univariate tests comparing clinically significant rop and no rop for each protein. the significance (log10 p value) and the magnitude (or) for all the significant proteins are displayed graphically. proteins with the largest magnitude of difference between groups and smallest p value are named in the figure. proteins named in blue and in red were significantly lower and higher, respectively, in infants who developed rop we found that lower levels of 16 proteins were associated with a higher risk of an infant 's developing clinically significant rop (group 1, table 2). two of these proteins, superoxide dismutase (mn), mitochondrial (mnsod), and chordin - like protein 1 (crdl1), were clearly set apart from the other proteins as seen in figure 1. c - c motif chemokine 14 (hcc-1) was also a top - ranked protein in group 1. additionally, prolactin (prl), insulin - like growth factor - binding protein 7 (igfbp-7), and eotaxin were similarly ranked high by p value and or for rop. the remaining proteins in group 1 (table 2) were associated with a lower level of significance for rop. we found that higher levels of 12 proteins were associated with a higher risk for rop (group 2, table 2). the next most highly ranked proteins were hepatocyte growth factor - like protein (msp) and luteinizing hormone (lh). cystatin m, plasminogen, and proprotein convertase subtilisin / kexin type 9 (pcsk9) had high unadjusted ors for rop associated with a lower rank. the remaining proteins in group 2 (table 2) were associated with a further attenuation in the level of significance for rop. adjusted for gestational age, hcc-1 and carbonic anhydrase 6 had a borderline association with rop (table 2). none of the other proteins were statistically significantly associated with rop in the adjusted analysis (table 2). in the second stage of the analysis, we explored levels of the highly ranked proteins in infants who developed clinically significant, low - grade, or no rop. the results are also shown in figure 2 (box plots) for select proteins and for all of the highly ranked (table 2) proteins in supplementary figure s1. we demonstrate in the figures (1) a gradient across the groups (e.g., hcc-1 and prl) ; (2) a difference between the low - grade and clinically significant rop groups (e.g., igfbp-7 and mnsod) ; and (3) a difference between the low - grade and no rop groups (e.g., cystatin m and c - c - motif chemokine 2 [mcp-1 ]). concentrations of select proteins in infants with clinically significant, low - grade, and no rop distribution of select proteins in infants with clinically significant, low - grade, and no rop. the box indicates the iqr (25th75th percentile), and the median and mean are indicated by the lines and diamonds, respectively. the whiskers indicate data within 1.5 times the iqr, and points are data outside 1.5 times the iqr. iqr, interquartile range ; rfu, relative fluorescence unit ; clin sig, clinically significant rop. we used an innovative somascan proteomic assay technology to determine the proteins from a blood sample in the first week of life that place an infant at a higher risk of developing clinically significant rop. it is of interest that we found that lower levels of many proteins distinguished infants with and without clinically significant rop. an advantage of using this aptamer - based technology is that concentrations of low - abundant proteins can be measured. indeed, we uncovered proteins early in the neonatal period that were novel in their association with clinically significant rop (mnsod, crdl1, pcsk9), proteins with links to established signaling pathways for rop (igfbp-7), and some proteins such as mnsod that may be a target for a future therapeutic interventions. we also noted different patterns in the trend of concentrations of proteins across the clinically significant, low - grade, and no rop groups (fig. 2), we also found that infants at the lower extreme of gestational age and birth weight were at the highest risk of developing rop. superoxide dismutase, mitochondrial (mnsod), an antioxidant found in the mitochondria, was clearly distinguished from other proteins displayed in figure 1 : mnsod has a role in scavenging oxygen radicals that result from oxidative stress and provides the cell with a powerful defense against the deleterious effect of elevated levels of reactive oxygen species (ros) (reviewed in ref. an increased susceptibility to oxidative mitochondrial injury specifically in central nervous system neurons, cardiac myocytes, and other metabolically active tissues has been reported in a murine model of mnsod deficiency, after postnatal exposure to ambient oxygen concentrations. moreover, a role for oxidative stress has been proposed in rop (reviewed in ref. 1). indeed, it has been demonstrated that an increase in sod ameliorates oxygen - induced retinopathy in transgenic mice. furthermore, supplementation with liposome - encapsulated sod significantly increased retinal sod activity and reduced oxygen - induced retinopathy in a rat model. the results of our study suggest that low levels of mnsod may be an early neonatal marker of immaturity of the oxygen defense system that places the infant at risk for rop. chordin - like protein 1, a bone morphogenic protein-4 (bmp-4) antagonist, is also a prominent protein as shown in figure 1. investigated hypoxia inducible factor-1-driven expression of crdl1 in human pericytes and found that expression of crdl1 and vascular endothelial growth factor (vegf) was upregulated by hypoxia. chordin - like protein 1 complexed with bmp-4 to antagonize the antiangiogenic effects of bmp-4 on endothelial cells. we suggest that the low levels of crdl1 observed in our study in the first week of life may contribute to an antiangiogenic state. our suggestion would be consistent with the avascular state of the retina observed during the first phase of rop. indeed, rop is understood to have two phases, possibly preceded by a prephase of antenatal sensitization via inflammation. these phases have links with dysregulation of both neuronal and vascular development of the retina. in phase 1 of rop, there is a cessation in growth of the retinal blood vessels secondary to high oxygen levels that contribute to a downregulation in oxygen - regulated growth factors such as vegf. in contrast, phase 2 of rop is characterized by retinal neovascularization induced by hypoxia. during phase 2 of rop, the compromised retinal blood vessels can not supply enough oxygen to the developing retina. the metabolic demands of the retina increase, leading to increased hypoxia - driven local vegf production and retinal neovascularization. in addition to hyperoxia, phase i of rop is precipitated after a preterm delivery by the loss of factors normally provided by the mother in utero, including igf-1, which promotes vegf - mediated development of retinal blood vessels. in our study we found that lower levels of igf-1 and vegf placed an infant at risk for rop, but neither of these relationships with rop was statistically significant (supplementary table s1). however, another less well studied member of the igf family of proteins, namely, igfbp-7, emerged as important in our analysis. we found that levels of igfbp-7 were lower in infants who subsequently developed rop compared to infants with no rop. aligned with the results of our study, other authors have studied a murine model of oxygen - induced retinopathy and found that the igfbp-7 gene was downregulated in expression in retinas removed from hyperoxia chambers when compared to retinas exposed to states of normal oxygen concentrations. furthermore, other investigators have found ties between mutations of the igfbp-7 gene with a human disease characterized by familial retinal artery macroaneurysms (fram) and supravalvular pulmonic stenosis, suggesting a role for igfbp-7 in vasculogenesis and angiogenesis. indeed, it is biologically plausible that the immaturity in levels of igfbp-7 seen in our study may contribute to the abnormal vascular development seen in infants with rop. 1) included prl, a polypeptide hormone produced by the anterior pituitary that stimulates mammary gland development and lactation and has a role in angiogenesis and tumorigenesis. we also found lower levels of some proteins with ties to the inflammatory pathway, for example, hcc-1 and eotoxin. several proteins found at elevated levels were associated with an increased likelihood of developing rop (fig. fibroblast growth factor 19, a member of the fibroblast growth factor family, is a key regulator of energy metabolism. infants with elevated levels of msp, a protein with links to inflammation, were over eight times more likely to develop rop. indeed, it is suggested that the presence of infection or inflammation may modify the risk of rop. lutenizing hormone, a hormone that stimulates the testes and ovaries to synthesize steroids, was also elevated in infants who developed clinically significant rop. the significance of this finding is uncertain but perhaps represents an alteration in function of the hypothalamic other proteins identified in this group included cystatin - m, a cysteine protease inhibitor, which has a role in the process of desquamation or cell shedding, and plasminogen, the inactive precursor of the enzyme plasmin. proprotein convertase subtilisin / kexin type 9 was discovered in 2003 and is distinguished as a target for pharmaceutical intervention to reduce low - density lipoprotein - cholesterol (ldl - c). proprotein convertase subtilisin / kexin type 9 mutations are related to higher levels of ldl - c and an increased risk for cardiovascular disease. with definite links to vascular disease, this protein could potentially have a role in rop. the main limitation was the small sample size, which reduced our ability to conduct a more extensive analysis such as adequate adjustment for confounding variables, adjustment for multiple comparisons, and stratification by gestational age at delivery. the original study was powered for a different outcome (bpd) and utilized infants from additional sites for which we did not have rop outcomes. as expected, given the small sample size, adjustment for gestational age resulted in the loss of statistical significance of our highly ranked proteins with rop. we view gestational age as an outcome of pregnancy that is not modifiable once the infant is born. in contrast, the novel proteins discovered in this study are potential modifiable targets for therapeutic interventions in infants at risk for rop. this was the focus of our study, and it is important to note that even with the small sample size, we uncovered novel proteins early in the neonatal period with a large magnitude of association related to the subsequent development of rop. although adjustment for gestational age affected statistical significance of risk for rop, the magnitude of risk remained meaningful even if it was not statistically significant (table 2). these observations are important and deserve future investigation in an adequately powered study of infants at risk for rop to determine the independent relationship of gestational age and the individual proteins with rop. an additional limitation was that we conducted the proteomic analysis only on a single sample from the early neonatal period. it will be important in future studies to characterize protein levels and profiles at the time of the rop examination when the pathologic events in the retina are known to be different from those in the earlier phase of rop. notwithstanding these limitations, the results from this state - of - the - art proteomic analysis are informative, and we suggest validation of the results in a larger cohort of preterm infants. the findings of our pilot study related to the protein target mnsod were especially compelling and deserve further investigation. infants with lower levels of this protein may not be able to handle oxidative stress in the neonatal period. this result suggests that it is important to consider clinical interventions early in the neonatal period to attenuate the effects of oxygen stress in this vulnerable group of infants. | purposeretinopathy of prematurity (rop) is a vision - threatening disease associated with abnormal retinal vascular development. proteins from the insulin - like growth factor pathway are related to rop. however, there is a paucity of research on the role of other proteins in rop. the aim of this study was to identify plasma proteins related to clinically significant rop.methodswe measured 1121 plasma proteins in the early neonatal period in infants at risk for rop using an aptamer - based proteomic technology. the primary aim of the study was to compare plasma protein concentrations in infants who did (n = 12) and did not (n = 23) subsequently develop clinically significant rop using logistic regression. as a secondary aim, we examined patterns in the proteins across categories of clinically significant, low - grade, and no rop groups.resultslower levels of 16 proteins were associated with an increased risk of clinically significant rop. in this group, superoxide dismutase (mn), mitochondrial (mnsod), and chordin - like protein 1 (crdl1) were highly ranked. other proteins in this group included : c - c motif chemokine 14 (hcc-1), prolactin, insulin - like growth factor - binding protein 7 (igfbp-7), and eotaxin. higher levels of 12 proteins were associated with a higher risk for rop. fibroblast growth factor 19 (fgf-19) was the top - ranked protein target followed by hepatocyte growth factor - like protein (msp), luteinizing hormone (lh), cystatin m, plasminogen, and proprotein convertase subtilisin / kexin type 9 (pcsk9). we also noted different patterns in the trend of concentrations of proteins across the clinically significant, low - grade, and no rop groups.conclusionswe discovered plasma proteins with novel associations with clinically significant rop (mnsod, crdl1, pcsk9), proteins with links to established rop signaling pathways (igfbp-7), and proteins such as mnsod that may be a target for future therapeutic interventions. |
perivertebral leakage of cement during percutaneous vertebroplasty (pv) has been reported to occur frequently in up to 65% of treated osteoporotic vertebral compression fractures (ovcfs) [1, 2 ]. most of these leakages cause no clinical symptoms, but pulmonary embolism and neurological complications have occasionally been reported [3, 4 ]. vertos ii is a randomized controlled trial comparing pv and conservative therapy for ovcfs in 202 patients. in this trial, patients assigned to pv had a standard postprocedural computed tomography (ct) scan of the treated ovcf with the aim to assess the patterns of perivertebral cement leakage and its possible clinical impact. there is some concern that cement deposits may migrate to the lungs via the veins during follow - up ; sharp and elongated spike - like cement fragments might cause perforation of vessels or heart. in addition, local damage to the adjacent anatomical structures by the leaked cement may cause symptoms like soft tissue hematoma or radiculopathy [58 ]. in this study, we used baseline and follow - up ct to assess the incidence, anatomical location, and clinical impact of perivertebral cement leakage on short- and long - term in a large patient cohort. the study protocol of the vertos ii trial has been described in detail elsewhere. in short, vertos ii was an unmasked randomized controlled trial in five large teaching hospitals in the netherlands and one in belgium. the protocols of vertos ii and the present study were approved by the institutional review board at each participating centre. between october 2005 and june 2008, 202 patients were randomized for pv and conservative therapy. all patients assigned to pv had baseline postprocedural ct scans of the treated vertebral bodies. these 98 patients form the bases of the present study. during a mean follow - up of 22 months (median, 21 months ; range, 642 months), ten patients died, and six refused to complete the protocol of vertos ii. the remaining 82 patients were invited by telephone for a native ct scan of the treated vertebra to detect possible migration of the perivertebral cement leakages and evaluation of possible local pathology related to the cement leakage. there were 36 women (67%) and 18 men (33%) with a mean age of 74 years (median, 77 ; range, 5388 years). thirty - nine patients were treated for one ovcf, 11 patients for two, and four patients for three ovcfs in one session. during follow - up, four patients presented with a new ovcf and were treated again. one of these four patients had two additional pvs, for one ovcf each time. 1distribution of 54 treated osteoporotic compression fractures distribution of 54 treated osteoporotic compression fractures pv was performed on a single or biplane angiographic unit under fluoroscopic guidance. after local infiltration analgesia (lidocain 1%, braun, melsungen, germany), needles were bilaterally transpedicular inserted into the vertebral body. polymethylmethacrylate bone cement (osteo - firm, cook medical, bloomington, in, usa) was injected under continuous lateral fluoroscopy alternating both pedicles using 1-cm syringes. volume of injected cement in each treated vertebral body was recorded. immediately after the procedure, a ct scan of the treated ovcf was performed to evaluate perivertebral cement leakage. treated vertebrae were assigned into three location categories : t5t10, t11l2, and l3l5. the anatomical location of perivertebral venous cement leakage was recorded according to the plexus venosus vertebralis, a venous network that extends along the entire length of the vertebral column (fig. 2). in addition to the venous location, discal and soft tissue leakages were recorded. leakage into the anterior external venous plexus (a), basivertebral vein (b), anterior internal venous plexus (c), segmental vein (d), inferior caval vein, or (hemi)azygos vein (e) schematic representation of patterns of perivertebral venous cement leakage. leakage into the anterior external venous plexus (a), basivertebral vein (b), anterior internal venous plexus (c), segmental vein (d), inferior caval vein, or (hemi)azygos vein (e) chi - square test was used to correlate perivertebral cement leakage with the location of treated ovcfs into three categories. mean volume of injected cement in vertebrae with leakage was compared to mean volume of cement in vertebrae without leakage using the t test. the sponsors of the study had no role in study design, data collection, data analysis, data interpretation, writing of the report, or the decision to submit the paper for publication. the study protocol of the vertos ii trial has been described in detail elsewhere. in short, vertos ii was an unmasked randomized controlled trial in five large teaching hospitals in the netherlands and one in belgium. the protocols of vertos ii and the present study were approved by the institutional review board at each participating centre. between october 2005 and june 2008, 202 patients were randomized for pv and conservative therapy. all patients assigned to pv had baseline postprocedural ct scans of the treated vertebral bodies. these 98 patients form the bases of the present study. during a mean follow - up of 22 months (median, 21 months ; range, 642 months), ten patients died, and six refused to complete the protocol of vertos ii. the remaining 82 patients were invited by telephone for a native ct scan of the treated vertebra to detect possible migration of the perivertebral cement leakages and evaluation of possible local pathology related to the cement leakage. there were 36 women (67%) and 18 men (33%) with a mean age of 74 years (median, 77 ; range, 5388 years). thirty - nine patients were treated for one ovcf, 11 patients for two, and four patients for three ovcfs in one session. during follow - up, four patients presented with a new ovcf and were treated again. one of these four patients had two additional pvs, for one ovcf each time. after local infiltration analgesia (lidocain 1%, braun, melsungen, germany), needles were bilaterally transpedicular inserted into the vertebral body. polymethylmethacrylate bone cement (osteo - firm, cook medical, bloomington, in, usa) was injected under continuous lateral fluoroscopy alternating both pedicles using 1-cm syringes. volume of injected cement in each treated vertebral body was recorded. immediately after the procedure, a ct scan of the treated ovcf was performed to evaluate perivertebral cement leakage. treated vertebrae were assigned into three location categories : t5t10, t11l2, and l3l5. the anatomical location of perivertebral venous cement leakage was recorded according to the plexus venosus vertebralis, a venous network that extends along the entire length of the vertebral column (fig. 2). in addition to the venous location, discal and soft tissue leakages were recorded. leakage into the anterior external venous plexus (a), basivertebral vein (b), anterior internal venous plexus (c), segmental vein (d), inferior caval vein, or (hemi)azygos vein (e) schematic representation of patterns of perivertebral venous cement leakage. leakage into the anterior external venous plexus (a), basivertebral vein (b), anterior internal venous plexus (c), segmental vein (d), inferior caval vein, or (hemi)azygos vein (e) chi - square test was used to correlate perivertebral cement leakage with the location of treated ovcfs into three categories. mean volume of injected cement in vertebrae with leakage was compared to mean volume of cement in vertebrae without leakage using the t test. the sponsors of the study had no role in study design, data collection, data analysis, data interpretation, writing of the report, or the decision to submit the paper for publication. any perivertebral cement leakage was observed in 64 of 80 treated vertebrae (80% ; 95% ci, 70% to 87%). discal leakage was present in 22 vertebrae (34%), in eight vertebrae (13%) in combination with venous leakage. altogether, 56 of 64 vertebrae (88%) had cement leakage into the perivertebral venous system. cement in the anterior external venous plexus was observed in 46 of 56 vertebrae (82%), in 32 vertebrae (57%) in combination with cement in a segmental vein. five vertebrae (9%) had cement in the inferior caval vein and six (11%) in the azygos vein, all in combination with cement in a segmental vein and the anterior external venous plexus. cement in the basivertebral vein was present in 30 of 56 vertebrae (54%), in the anterior internal venous plexus in 33 (59%) and both in the basivertebral vein and anterior internal venous plexus in 26 (46%). three vertebrae (5%) had cement in the intervertebral vein, all in combination with cement in the anterior external venous plexus, basivertebral vein, and anterior internal venous plexus. comparison of follow - up ct scan (mean, 22 months ; median, 21 months ; range, 642 months) of treated vertebrae with baseline ct showed unchanged anatomical location of the perivertebral cement leakages in all vertebrae without late cement migration. chi - square test showed no statistical relation between location of the treated vertebra and the occurrence of perivertebral cement leakage (p = 0.64). mean volume of injected cement in 47 vertebrae with leakage was 4.5 1.8 cm, and in 33 vertebrae without leakage, this was 3.7 1.6 cm. this difference was significant (p = 0.04 ; 95% ci, 1.58% to 0.02%). any perivertebral cement leakage was observed in 64 of 80 treated vertebrae (80% ; 95% ci, 70% to 87%). discal leakage was present in 22 vertebrae (34%), in eight vertebrae (13%) in combination with venous leakage. altogether, 56 of 64 vertebrae (88%) had cement leakage into the perivertebral venous system. cement in the anterior external venous plexus was observed in 46 of 56 vertebrae (82%), in 32 vertebrae (57%) in combination with cement in a segmental vein. five vertebrae (9%) had cement in the inferior caval vein and six (11%) in the azygos vein, all in combination with cement in a segmental vein and the anterior external venous plexus. cement in the basivertebral vein was present in 30 of 56 vertebrae (54%), in the anterior internal venous plexus in 33 (59%) and both in the basivertebral vein and anterior internal venous plexus in 26 (46%). three vertebrae (5%) had cement in the intervertebral vein, all in combination with cement in the anterior external venous plexus, basivertebral vein, and anterior internal venous plexus. comparison of follow - up ct scan (mean, 22 months ; median, 21 months ; range, 642 months) of treated vertebrae with baseline ct showed unchanged anatomical location of the perivertebral cement leakages in all vertebrae without late cement migration. chi - square test showed no statistical relation between location of the treated vertebra and the occurrence of perivertebral cement leakage (p = 0.64). mean volume of injected cement in 47 vertebrae with leakage was 4.5 1.8 cm, and in 33 vertebrae without leakage, this was 3.7 1.6 cm. this difference was significant (p = 0.04 ; 95% ci, 1.58% to 0.02%). in this well - defined and large patient cohort from vertos ii, we found that during pv, perivertebral cement leakage occurred in more than half of the treated vertebrae. most leakages were in perivertebral venous structures, leakage into the disk or perivertebral soft tissues was infrequent. follow - up ct after almost 2 years showed that late migration of leaked cement deposits did not occur. clinically, patients remained asymptomatic ; there were no symptomatic pulmonary emboli, and radiculopathy or soft tissue hematoma did not occur. our findings suggest that standard postprocedural ct scan after pv is not warranted and should be confined to clinically symptomatic patients only. knowledge of the anatomy of the perivertebral veins is helpful in understanding the venous leakage patterns on ct. leakage more often occurs in the perivertebral venous plexus than in adjacent disks or perivertebral soft tissues. the venous complex along the vertebral column consists of three major intercommunicating networks [10, 11 ] : the internal and the external venous plexus and the basivertebral system. the basivertebral system is oriented horizontally in the centre of the upper half of the vertebral body. the basivertebral veins originate in the ventral third of the vertebral body and converge posteriorly to drain into the ventral part of the internal venous plexus, sometimes as a single vein and sometimes as two separate tributaries. the exiting point of the basivertebral vein on the dorsal surface of the vertebral body is located in the middle between the pedicles. the anterior internal venous plexus drains into the segmental veins that exit the spinal canal through the foramen, between the nerve root and the medial wall of the pedicles. this means that there is a direct venous connection between the bone marrow and the foraminal space. comparison of frequency of cement leakage between studies is hampered by differences in methods used. detection rates in studies using intraoperative fluoroscopy only instead of ct will be substantially lower since sensitivity of ct is much higher. in two studies about frequency of local cement leakage that used postprocedural ct for detection, rates of 63% and 81% were found, comparable to our 80% [12, 13 ]. cement leakage during pv seems to be largely inevitable according to the high reported rates in this study and in the literature. small leakages are without clinical consequences. with proper use of technique and fluoroscopy, clinical relevant cement leakage should be avoided. however, all patients remained asymptomatic, and late cement migration during follow - up did not occur. | introductionduring percutaneous vertebroplasty (pv), perivertebral cement leakage frequently occurs. there is some concern that cement deposits may migrate towards the lungs via the veins during follow - up. we used baseline and follow - up computed tomography (ct) to assess the incidence and extend of late cement migration in a large consecutive patient cohort.methodsvertos ii is a prospective multicenter randomized controlled trial comparing pv with conservative therapy for osteoporotic vertebral compression fractures (ovcfs). patients assigned to pv had baseline postprocedural ct scans of the treated vertebral bodies. after a mean follow - up of 22 months, 54 of 78 patients (69%) had follow - up ct. ct scans were analyzed and compared for perivertebral venous, discal, and soft tissue leakage.resultsperivertebral cement leakage occurred in 64 of 80 treated vertebrae (80% ; 95% ci, 70% to 87%). all patients remained asymptomatic. perivertebral venous leakage was present in 56 vertebrae (88%), mostly in the anterior external venous plexus (46 of 56, 82%). discal leakage occurred in 22 of 64 vertebrae (34%) and soft tissue leakage in two of 64 (4%). mean injected cement volume in vertebrae with leakage was higher (4.5 versus 3.7 cm3, p = 0.04). follow - up ct scan showed unchanged perivertebral cement leakages without late cement migration.conclusionperivertebral cement leaks during pv for ovcfs occurred frequently in the vertos ii trial. cement leakage occurred more frequently with higher injected volumes. however, all patients remained asymptomatic, and late cement migration during follow - up did not occur. standard postprocedural ct of the treated vertebral body in pv is not necessary. |
delayed graft function (dgf) is an important complication of kidney transplantation (ktx) that adversely affects allograft survival. despite substantial improvements in the field of ktx, the incidence of dgf is rising with the growing practice of accepting expanded criteria donors to increase transplantation rates [16 ]. delayed graft function predisposes kidney graft to acute and chronic rejection, contributes to progressive allograft dysfunction, and increases the risk of premature graft loss [711 ]. reliable biomarkers enabling early discrimination of dgf in ktx are lacking, which impairs timely therapeutic interventions. traditionally, acute graft dysfunction is diagnosed by measuring serum creatinine, but this parameter is an unreliable indicator of kidney function during an episode of acute injury. one of the most promising biomarkers of acute kidney injury is neutrophil gelatinase - associated lipocalin (ngal), which is released to blood from activated neutrophils during inflammatory processes. in steady situations, massive ngal quantities excreted in urine (ungal) usually indicate damage of proximal tubular cells [1315 ]. graft injury due to ischemia - reperfusion is an inevitable consequence of ktx procedure and can result in varying degrees of early graft dysfunction, which can be considered a form of posttransplantation acute kidney injury. for this reason, several studies investigated the utility of ngal for the diagnostic and prognostic of acute graft dysfunction following ktx [1627 ]. recently, the prognostic value of ungal on graft function at one - year after transplantation was also examined and presented conflicting findings [22, 28 ]. in order to support the usefulness of ungal as a reliable marker of graft injury and to clarify the role of this promising biomarker in the prediction of kidney function beyond the first week after transplant, we conducted a prospective study toevaluate longitudinal changes of ungal levels over the first week after ktx and identify factors associated with these changes;assess the performance of ungal in predicting dgf (defined as the requirement for dialysis within the first 7 days after transplantation);appraise the long - term prognostic value of ungal measured within one week posttransplantation on kidney allograft function, evaluated by one - year serum creatinine. evaluate longitudinal changes of ungal levels over the first week after ktx and identify factors associated with these changes ; assess the performance of ungal in predicting dgf (defined as the requirement for dialysis within the first 7 days after transplantation) ; appraise the long - term prognostic value of ungal measured within one week posttransplantation on kidney allograft function, evaluated by one - year serum creatinine. consecutive patients with end - stage renal disease, undergoing living or deceased ktx at centro hospitalar do porto, from december 2010 to may 2011 were prospectively enrolled. recruitment excluded patients less than 18 years old and those who required a combined pancreas or liver ktx. after transplant, urine samples for ngal determination were collected 3 to 6 h after surgery (ungal0 or baseline) ; on the following morning, nearly 8 to 12 h after graft reperfusion (ungal1 or first day) ; and then at second (ungal2), fourth (ungal4), and seventh days (ungal7), for a total of five samples for each patient. the same laboratory technician, who was blinded to patient information, performed ungal measurements using a two - step chemiluminescent microparticle immunoassay on a standardized clinical platform (architect, abbott diagnostics). serum creatinine levels were determined preoperatively, daily until hospital discharge, and at 1, 3, 6, and 12 months after transplantation to evaluate later graft function. cystatin c was measured with a particle enhanced immunonephelometric method (siemens diagnostics) at the same time points as ungal, except for baseline. delayed graft function was defined, according to united network for organ sharing, as the requirement for dialysis within the first seven days after ktx, due to an absence or irrelevant improvement in graft function. (non - dgf) if no dialysis was required during the first week after transplantation. acute rejection was defined as either biopsy - proven rejection or antirejection treatment without biopsy. estimated glomerular filtration rate (egfr) was calculated using the rule 's refitted mdrd formula, considered to have an improved diagnostic performance and better accuracy of the true gfr in ktx recipients. creatinine reduction rate (%) was calculated as the difference between serum creatinine at day 2 (or day 4) and day 1, divided by serum creatinine at day 1, multiplied by 100. graft function at one year was evaluated by the average of the two serum creatinine levels measured closer to one year after ktx (e.g., by the average values seen at 12 and 13 months). it was thought that this would reflect more accurately the usual graft function, since a single measure could be more easily inflated by acute situations, like a urinary infection for example. two grafts were lost at seventh and eighth months and the last serum creatinine presented by these patients prior to dialysis restart was considered as being the one - year creatinine. quantitative variables were summarized as mean and standard deviation (sd), or as median and 25th75th quartiles (interquartile range) for variables with skewed distribution. firstly, a cross - sectional bivariate analysis was done to compare groups and study the association between ungal and demographic / clinical variables. continuous variables were compared using either parametric (t - test) or nonparametric (mann - whitney) tests. associations between categorical variables were analyzed using the test and fisher 's exact test as appropriate. correlations between ungal and continuous variables were assessed using pearson correlation and ungal levels were log - transformed (ln) before analysis. spearman correlation was used to analyze ungal and serum creatinine reduction ratio on posttransplant days 2 and 4. secondly, we used a longitudinal analysis to study ungal kinetics and modelling it as a response variable on time. a linear mixed - effects model was used to study the association of dgf with serial changes of ungal (log - transformed), controlling for donor status (living / deceased), recipient 's age, time on dialysis, and time measurement of ungal. the interaction between dgf and ungal time measurement was included in the model, as such a significant interaction would suggest that dgf affects the ungal levels trajectory. thirdly, receiver - operating characteristics analysis was performed to estimate the sensitivity and specificity of ungal (as well as serum creatinine and cystatin c) to predict dgf. the optimal cut - off points were determined by maximizing the sum of sensitivity and specificity. fourthly, multivariable logistic regression analysis was undertaken to evaluate whether ungal levels were independently associated with dgf. pretransplant variables known to be associated with dgf and considered potential confounders were included in the models. fifthly, multivariable linear regression was used to describe the independent association of ungal with renal function at 12 months evaluated by serum creatinine, adjusted for the variables that usually predict graft function, including donor status, rehospitalizations, and acute rejection episodes throughout the first year. linear regression models used log - transformed ungal and serum creatinine levels. as in logistic models, all statistical analyses were done with spss version 20.0 and a significance level of 0.05 was considered. two recipients had renal artery thrombosis and were excluded in the first two posttransplantation days. therefore our study sample included 40 recipients. the first urine sample (ungal0) was obtained from 30 patients. on the following days, urine samples were collected from 35 patients at the first, second, and seventh days, and from 36 patients at the fourth day. only, one patient provided merely two urine samples and the remaining 39 subjects provided 3 or more urine samples (with 20 patients providing all five samples). daily median ungal levels did not differ significantly between male and female recipients, except for the seventh day where female ungal levels were significantly higher. concerning donor status, ungal levels were higher in deceased donor recipients at all - time points, but only statistically significant at second day. except for the seventh day, ungal levels were significantly and positively correlated with cold ischemia time (r = 0.45, p = 0.02 ; r = 0.36, p = 0.04 ; r = 0.56, p = 0.001 ; r = 0.46, p = 0.006, resp., at baseline, first, second, and fourth days). at most time points, ungal was positively and significantly correlated with recipient age (r = 0.39, p = 0.02 ; r = 0.39, p = 0.02 ; r = 0.44, p = 0.007 ; resp., at first, second, and seventh days) and pretransplant dialysis time (r = 0.48, p = 0.008 ; r = 0.37, p = 0.03 ; r = 0.43, p = 0.01 ; r = 0.33, p = 0.024 ; resp., at baseline, no significant correlation was found with hla mismatches and with donor age and serum creatinine. urinary ngal levels were significantly and positively correlated with serum creatinine at all - time points (data not shown). furthermore, except for ungal0, all the remaining ungal levels were significantly and negatively correlated with changes in serum creatinine between the second and first days, and also between the fourth and the first days : lower ungal values were associated with higher reductions rates in serum creatinine (data not shown). median length of hospitalization after transplantation was 12 days (iqr : 722) and ungal levels were highly correlated with length of hospital stay at all - time points (r = 0.48, p = 0.002 ; r = 0.64, p < 0.001 ; r = 0.79, p < 0.001 ; r = 0.77, p < 0.001 ; r = 0.82, p < 0.001, resp., at baseline, first, second, fourth, and seventh days). eighteen recipients (45%) had dgf, three of these were from living donors, and 22 (55%) had prompt graft function. concerning traditional predictors of dgf and except for cold ischemia time, no significant differences were found between dgf / non - dgf in relation to baseline characteristics and induction therapy (table 1). mean age was significantly higher in patients with dgf (56 (11) versus 43 (16) years in non - dgf recipients, p = 0.006). as expected, patients with dgf had higher serum creatinine levels (table 2) and lower creatinine reduction ratios on posttransplant days 2 and 4. similar to serum creatinine, median ungal concentrations were consistently higher in dgf group compared with non - dgf group at all measured time points (table 2 and figure 1). in patients with prompt graft function, the longitudinal changes of ungal were characterized by an initial phase with a rapid decline and then a phase with a slower decrease continuing throughout the posttransplant week. this pattern of changes was different in dgf recipients : ungal levels increased from baseline to the following morning after transplantation and remained elevated throughout most of the follow - up period. a linear mixed - effects model was used to study the association of dgf with longitudinal changes of ungal, controlling for variables found to be associated with ungal by bivariate analysis. pretransplant time on dialysis, time measurement of ungal, and dgf were independently associated with ungal levels. adjusting for the remaining variables, donor status and recipient age lost their statistical significance and were removed from the final model (table 3). delayed graft function was significantly associated with ungal levels, with prompt function recipients having on average lower levels of ungal at all - time points. according to our estimation, for a patient with dialysis time of approximately 4.1 years, the initial values of ungal (36 h after transplantation) are about 242 ng / ml higher in patients who went on to develop dgf, and these values will rise even more in the following days. a significant interaction between time of measurement and dgf confirmed that longitudinal changes of ungal levels depend on whether the recipient had dgf or not. to clarify the meaning of this interaction, figure 2 shows the predicted ungal trajectories over time for four hypothetical subjects : two recipients who developed dgf (one with 4 years of dialysis and one with 10 years), and two other patients with prompt graft function (similar time on dialysis, 4 and 10 years). the predicted ungal values were estimated using the coefficients estimates of table 3 (e.g., the predicted ungal values at the first day for a recipient with 4 years of dialysis with prompt function = exp [(5.46 2.14) + 0.94 + 0.4 + (0.076 4 years of dialysis) ] = 158 ng / ml). receiver - operating characteristic (roc) curves showed ungal on the first postoperative days were accurate in predicting dgf (tables 4 and 5). table 4 displays the derived sensitivities, specificities, and predictive values for ungal at the cutoff concentrations that provided the maximum sum of sensitivity and specificity. regarding the areas under the roc curves (auc), the ability of ungal to predict dgf was moderately accurate at baseline and first day, and highly accurate at second, fourth, and seventh days (table 5, figure 3). in the first two posttransplant days the diagnostic performance of ungal was better than of serum creatinine, and quite similar to that of cystatin c. the reduction in serum creatinine between first and second days resulted in auc = 0.78 [0.640.92 ] and was worse than ungal for dgf prediction. multivariable logistic regression analyses revealed that ungal levels remained independently associated with dgf at most time points, after adjusting for clinically relevant risk factors for dgf (table 6). furthermore, recipient age was the other significant independent predictor of dgf in almost all models. to be more clinically relevant, estimates of dgf risk were converted to every 50 ng / ml of increase in ungal or per each 5 years of increase in age, instead of estimates per each unit of increase. during the first year, 10 ktx recipients were rehospitalized accounting for a total of 19 hospital admissions. there was one rehospitalization in six patients, two in two patients, three in one patient, and six rehospitalizations in one patient with a psychological disorder and suicidal ideation. the causes of rehospitalization were infection in five admissions (mostly, urinary tract infection), renal dysfunction in six, and nonrenal causes in the remaining eight admissions (suicidal ideation, acute pulmonary edema, and neutropenia). excluding the recipient with several rehospitalizations due to psychological decompensation, the length of hospital stay of the remaining recipients admissions was 7 days, and no significant differences were found between recipients from living or deceased donors. ten recipients (25%) had an acute rejection episode during inpatient hospitalization for transplant surgery, and only one patient was rehospitalized one month after ktx with an acute rejection episode confirmed by biopsy. at one year after transplantation, all patients were alive but two grafts were lost. at this time, the median plasma creatinine was significantly higher in dgf group compared to non - dgf : 1.6 mg / dl [iqr : 1.22.5 ] versus 1.3 mg / dl [iqr : 1.01.5 ], p = 0.049. the correlation between ungal collected in the first week after ktx and serum creatinine at one year was explored. except for ungal collected within the first 24 h after transplantation, ungal levels were positively correlated with serum creatinine evaluated at time of discharge, and also at 1, 3, 6, and 12 months. likewise, ungal levels at days 2, 4, and 7 were inversely correlated with egfr at 6 and 12 months (data not shown). the prognostic value of early ungal values on long - term allograft function (one year after ktx) was tested by multivariable analysis. in multivariable linear regression models for serum creatinine at 12 months, ungal measured on the fourth and seventh days were independently associated with one - year graft function, adjusting for established variables that usually affect graft function, including acute rejection episodes and rehospitalizations that occurred during the first posttransplant year (table 7). the major finding of this study is that ungal is a promising biomarker for allograft dysfunction that can be easily and noninvasively assayed in the early posttransplant period. we prospectively evaluated ungal in a cohort of 40 kidney allograft recipients during the first posttransplant week. at all measured time points, ungal levels were consistently higher in patients who developed dgf, including the earliest levels obtained from the first urine sample collected approximately 3 to 6 h after transplant surgery. at this time, clinical diagnosis of dgf is yet not possible, but a simple and noninvasive test can already recognize kidney dysfunction and stratify patients according to likelihood of requiring posttransplant dialysis. it would be ideal to diagnose graft dysfunction with an early and highly sensitive biologic marker of renal tubular injury. one of the most promising markers is ngal, and our findings provide further information for the use of ungal as a diagnostic and prognostic tool for dgf. according to our estimation, ungal values shortly after transplant surgery will be much higher in patients who went on to develop dgf and will rise further in the following days. in contrast, patients with prompt function will have lower levels, which decrease consistently along the week. the kinetics of changes in these recipients compared to those who presented dgf is quite different. it seems that, not only the baseline levels, but also the pattern of ungal longitudinal changes can reflect graft dysfunction. the association between higher ngal levels and dgf after ktx has been previously published [16, 20, 22, 24, 25 ].. found initial levels of ungal higher in dgf patients, but on the following day a decrease was observed, as it happened with recipients with prompt function. recipients who went on to develop dgf had initial higher levels of ungal that rise further on the following posttransplant days, differing from patients with prompt graft function. it seems that, above and beyond the markedly higher levels of ungal in patients with graft dysfunction, the contrasting pattern of ungal longitudinal changes can distinguish recipients who will need dialysis in the first week posttransplantation. to the best of our knowledge, this is the first report that used linear mixed analysis in describing longitudinal changes of ungal in the first week following ktx. multiple observations of a variable on a particular patient are likely to be positively correlated, so they should not be treated as independent measurements. although models that take this design into consideration are more complicated, they are also more specific and powerful since they permit the study of changes over time. linear mixed analysis not only permits to model individual changes over time, but also is able to distinguish within - subject from between - subject sources of variation. in accordance with previously published data [16, 2022, 24 ], we confirmed the good performance of ngal in predicting graft dysfunction in the early posttransplant period. using roc analysis, our study also corroborates ungal as a good diagnostic marker on identifying patients with graft dysfunction and who subsequently required dialysis. the auc - roc for ungal was moderately accurate for dgf prediction within the first day after transplant, and it was excellent at day 2 and day 4. we also determined the paired sensitivity and specificity for the cutoff value of ungal, calculated to be closest to the left upper corner of the roc space to predict dgf. at 8 to 12 h after surgery, a cutoff of 286 ng / ml had 100% sensitivity and 76% specificity for the identification of dgf. within the second day, ungal levels higher than 277 ng / ml predicted dgf with a sensitivity of 93% and specificity of 90%. measured ngal in urine samples collected within the first 24 h following transplantation and reported an auc - roc of 0.9, similar to ours obtained 8 to 12 h after surgery. another study conducted in 91 recipients evaluated ungal within 6 h after transplantation and predicted subsequent dgf with an auc - roc = 0.81. urine was collected before transplant, at then at days 1, 3, 7, and 14, and ungal was measured at each time point. we report a superior performance of ungal level for predicting dgf over serum creatinine measured at the same time. urinary ngal measured at the first day predicted dgf with an auc - roc of 0.93, which is markedly better than an auc - roc = 0.76 shown by serum creatinine measured in the same day, and also than an auc - roc = 0.83 obtained from creatinine reduction ratio from first to second day, but quite similar to cystatin c (0.95), a marker considered more accurately to detect changes in renal function [3235 ]. furthermore, our analyses also revealed that ungal levels predicted dgf, even after adjusting for pretransplant variables known to be traditionally associated with dgf. besides dgf, the other factors that significantly influenced ungal levels were previous time on dialysis, recipient 's age at time of transplantation and cold ischemia time. mishra and coworkers have shown that the immunohistochemical staining intensity for ngal was strongly correlated with cold ischemia time and ngal expression was significantly increased in deceased donor biopsies. we found that ungal levels were higher in graft recipients from deceased donors, but only significantly higher at the second day. it is known that prolonged cold preservation of kidneys can lead to severe injury, which is critical in the success of deceased - donor kidney transplantation. however, there is a progressive effort of our transplant team to avoid prolonged cold preservation. maybe this attempt attenuated the effect of cold ischemic injury in kidneys from deceased donors, which become comparable to living donors concerning ungal values. an interesting finding of our study was that ungal levels at all - time points were correlated with length of hospital stay. it is well known that the occurrence of dgf prolongs the recipient 's hospital stay. and it is worthy of note to realize that patients with early higher levels of ungal will expect longer time of hospitalization, probably due to graft dysfunction. as other studies [1619, 24, 26, 37 ], we confirmed that ungal levels were inversely correlated with egfr and positively correlated with serum creatinine at each measured time point. we also showed that not only in the first week, but longer after that, ungal levels measured in the first seven days after ktx were still predictive of graft function throughout the first year after transplantation. even after adjusting for donor status, acute rejection episodes, hospitalizations occurred in the first year, and other known variables that usually affect graft function, ungal evaluated at days four and seven were predictive of one - year serum creatinine, which can be considered a surrogate marker of long - term graft survival [38, 39 ]. in contrast, hollmen and coworkers study did not find any correlation between ungal and renal function at one year. in their study, ungal collected in the first two weeks after transplantation was only correlated with renal function up to 3 months. our results do not corroborate this lack of correlation and are in agreement with a recent study that also associated perioperative ungal levels to one - year allograft function. second, we measured ungal at several time points within the first posttransplant week, and not at one single point. longitudinal studies have the advantage of providing detailed information about how a marker changes over time ; however the studies present some statistical complexities, since the customary assumption that all observations are independent usually does not hold. and this was the third strength of our study : the use of longitudinal methods to handle the serial changes of ungal. we used a commercially available kit for ungal determination (abbott architect ngal), which is simple to implement in routine practice and it is considered one of the best methods for detecting acute kidney injury. similarly to other authors [16, 22 ], we have chosen to measure ngal in urine, instead of blood, since ungal represents tubule damage in the kidney rather than filtration from blood [14, 41 ]. an increased level of ngal in urine usually indicates injury of proximal tubular cells and seems to be more specific compared to serum ngal, which can be produced by other organs and released into the circulation following a transplant surgery. other advantages of urinary diagnostics include the noninvasive nature of sample collection and the reduced number of interfering protein. however, despite the undoubtedly value of urinary markers of kidney injury, their use in transplant recipients can be also a drawback because of possible transient graft anuria, which may preclude the availability of urine and consequently the lack of sample to measure ngal. due to the shortcoming of urine biomarkers in anuric ktx recipients, some studies have evaluated the performance of serum / plasma ngal in predicting graft function recovery after ktx [21, 27 ]. as we did not measure serum / plasma ngal values, we could not compare their effectiveness in predicting dgf in our sample. in our study, 4 or 5 recipients were anuric in each measurement, resulting in 12% of our patients not having urine sample to determine ungal in that particular time point. the measurement of serum / plasma ngal could have been a valuable alternative in these recipients, since it could also be obtained noninvasively in patients who required dialysis during the transient period of anuria. similar to other areas in medicine, in kidney transplantation early diagnosis and timely intervention will improve outcomes. ischemic injury of the renal allograft is a critical early insult that increases the risk of acute tubular necrosis and long - term graft loss. if dgf could be detected in the early hours after surgical procedure, maybe a tailored and more individualized intervention could be achieved. perioperative fluid management must ensure the restoration and maintenance of the intravascular volume, in order to obtain an appropriate graft function. aggressive hydration has been recognized to be effective in avoiding dgf, but fluid overload may also precipice the need of dialysis with the risk of hipovolemia and consequent renal ischemia. early identification of dgf patients could allow to be more judicious and to modify postoperative fluid management in favor of maintaining just adequate filling pressures to maintain adequate intravascular volume and prevent fluid overload. regarding immunosuppression, the induction protocol chosen for this group of patients should have the associated effect of decreasing dgf rates, by suppressing leukocyte - rich vascular congestion and endothelial injury, and the introduction of calcineurin inhibitors could be avoided or delayed due to their vasoconstrictive properties. cytomegalovirus (cmv) infection has also direct and indirect effects on transplant graft function, and some previous evidence has been published relating the association between the use of ganciclovir and the lower occurrence of dgf. nowadays, the prophylaxis with valganciclovir should be other aspect taken into account in recipients that we know they will develop dgf, since this prophylaxis may do more than just delay the occurrence of cmv disease. several studies were done in renal transplantation to identify early biomarkers for the diagnosis of dgf. however, there is still no routine application of any of these markers in clinical transplantation. the present study clearly support that ungal represents an early marker of graft injury and is strongly associated with dialysis - based diagnosis of dgf and one - year graft function. other studies are necessary to clarify the genesis and sources of plasma and urinary ngal and validate the accuracy of ungal as a diagnostic marker of renal graft injury and predictor for dgf in assorted centres, across different practices and sets of variables. | urinary neutrophil gelatinase - associated lipocalin (ungal) has been suggested as potential early marker of delayed graft function (dgf) following kidney transplantation (ktx). we conducted a prospective study in 40 consecutive ktx recipients to evaluate serial changes of ungal within the first week after ktx and assess its performance in predicting dgf (dialysis requirement during initial posttransplant week) and graft function throughout first year. urine samples were collected on post - ktx days 0, 1, 2, 4, and 7. linear mixed and multivariable regression models, receiver - operating characteristic (roc), and areas under roc curves were used. at all - time points, mean ungal levels were significantly higher in patients developing dgf (n = 18). shortly after ktx (36 h), ungal values were higher in dgf recipients (on average + 242 ng / ml, considering mean dialysis time of 4.1 years) and rose further in following days, contrasting with prompt function recipients. day-1 ungal levels accurately predicted dgf (auc - roc = 0.93), with a performance higher than serum creatinine (auc - roc = 0.76), and similar to cystatin c (auc - roc = 0.95). multivariable analyses revealed that ungal levels at days 4 and 7 were strongly associated with one - year serum creatinine. urinary ngal is an early marker of graft injury and is independently associated with dialysis requirement within one week after ktx and one - year graft function. |
neurofibromatosis type 1 (nf1) is an autosomal dominant disease caused by mutations in the nf1 gene, mapped at chromosome 17q11.2, which produces an ubiquitous protein called neurofibromin. approximately one - half of the cases are familiar and the remainder are caused by de novo mutations in the nf1 gene. the estimated incidence of the disease is 1 in 2.5003.500 live births, independent of gender and ethnic background [15 ]. the diagnosis of nf1 is usually clinical and most of the affected individuals are identified in infancy or childhood. the clinical diagnosis is made when at least two of the national institute of health (nih) diagnostic criteria for nf1 are met. one of these criteria is skeletal lesions, such as sphenoid dysplasia or thinning of the long bone cortex with or without pseudoarthrosis. in addition to the classical signs and symptoms involving skeleton, nf1 patients are prone to osteomalacia, osteopenia, and osteoporosis of unknown etiology [712 ]. neurofibromin functions as a gtpase in mesothelial - derived tissues including blood cells, fibroblasts, and osteoprogenitor cells, leading to deregulation of osteoblast and osteoclast activity. however, bone constitution depends on the density and also mineral content of the bone. therefore, metabolic abnormalities may also contribute to a predilection for bone defects in nf1, like bone - regulating hormones (i.e., vitamin d). a few studies have suggested that nf1 patients are more commonly diagnosed with hypovitaminosis d when compared to the general population [912, 14, 15 ]. it increases the absorption of calcium from the small intestine and promotes its reabsorption back into bones, an essential process for proper bone metabolism. ultraviolet b light photoisomerizes provitamin d to vitamin d in the skin, which is transported to the liver and hydrolyzed to 25-hydroxy - vitamin d [25(oh)d ]. further hydroxylation of 25(oh)d to 1.25-dihydroxy - vitamin d [1.25(oh)2d ], the physiologically active form of vitamin d, occurs mainly in the kidney. in the clinic, 25(oh)d levels are used to assess vitamin d status since 1.25(oh)2d usually reflects serum calcium better than total vitamin d content. several factors interfere with serum vitamin d levels such as age, sun exposure, skin type, and disorders that interfere with vitamin d metabolism (hepatic, kidney, and intestinal disease). vitamin d insufficiency is associated with osteoporosis, bone fractures, decreased immune function, bone pain, and muscle weakness and possibly with propensity to cancer and cardiovascular disease [1821 ]. 1.25(oh)2d exerts its biological effects through binding to the vitamin d receptor (vdr), a nuclear receptor that acts as a transcription factor. calcium absorption occurs primarily in the duodenum where the vdr is expressed in the highest concentration, so the regulation of vdr gene is most important in high efficiency of calcium absorption. vitamin d receptor 's genotypes have been associated with the development of several bone diseases as well as multiple sclerosis (ms), osteoporosis, and vitamin d - dependent rickets type ii and other complex maladies. the gene encoding the vdr is mapped on the long arm of chromosome 12 (12q1214) and is composed of 9 exons, with an alternatively spliced promoter region. a series of polymorphisms in the vdr gene were reported to be linked to various biological processes. this alteration is characterized by a c / t transition located inside a start codon (atg), and when the c variant is present, an alternative start site is used, leading to the expression of a shorter vdr protein (424aa), which demonstrates increased biological activity compared to the longer one (427aa). this g / a polymorphism is located on intron 8 and is linked in a haplotype with variable - length poly a sequence within the 3 untranslated region, altering vdr mrna stability. therefore, presence of both foki and bsmi polymorphisms can result in decreased vdr receptor expression. we hypothesized that since vdr receptor mediates the effects of 1.25(oh)2d, its reduced expression may also reduce 1.25(oh)2d activity, even when normal vitamin d levels are present. low vitamin d levels or decreased vitamin d activity could impair calcium absorption in duodenum and consequently, the lack of calcium could decrease bone turnover. this alteration in bone metabolism may not be sufficient to cause the classical signs and symptoms involving the skeleton in nf1 patients but may have an association that influences their occurrence, acting together with deregulation of osteoblast and osteoclast activity. differences in vdr allele frequencies for foki and bsmi polymorphisms between nf1 patients and the general population or differences in vitamin d levels between groups could help to clarify this possible association. therefore, the aim of this study was to assess and compare 25(oh)d levels in a group of 45 patients with the clinical diagnosis of nf1 with 45 sex-, skin type-, and age - matched controls ' group. we sought to correlate clinical features of nf1 with serum vitamin d levels and to investigate whether foki and bsmi polymorphisms in the vdr gene were associated with hypovitaminosis d and the nf1 phenotype. secondly, we compared genotypic and allelic frequencies of foki and bsmi polymorphisms in the vdr gene between nf1 group and a control group. a consecutive series of nf1 patients seen at the genetics outpatient clinics of hospital de clnicas de porto alegre (hcpa), southern brazil (30 2 0 south, 51 12 0 west), from november 18 to december 20, 2009, were invited to participate in this study and enrolled after signature of informed consent. the minimum number of patients and controls to be enrolled was estimated at 22 in each group and was calculated using winpepi version 9.2 based on the findings of lammert. with a power of 90% and an alpha = 0.05. considering the possibility of differences in sun exposure between individuals from this study (recruited in the spring in southern brazil) and those of lammert. (recruited in germany during the winter, spring, or summer) and in order to have sufficient patients to allow clinical correlations, we set the group sizes at 45 individuals each. the group of cases consisted of adult individuals (above age 18 years) diagnosed with nf1 according to the criteria of the consensus development conference. controls were recruited from the companions of patients seen in the same genetics clinics and were matched to cases by sex, type of skin, and age (allowing a difference of 5 years at the most). exclusion criteria for both groups were age 30 ng / ml. plasma levels between 20 and 30 ng / ml were classified at the insufficiency status. to determine vdr genotype, genomic dna from 45 nf1 patients and a healthy control group of 150 patients analysis of the foki (rs2228570 ; t and c alleles) and bsmi (rs1544410 ; a and g alleles) polymorphisms in the vdr gene was performed by pcr - rflp in duplicate as described by monticielo. and was blinded for vitamin d status and clinical phenotype. the control group, constituted of 150 healthy individuals, was recruited from porto alegre and previously tested for the foki and bsmi polymorphisms with the same methodology as described above and tested in the same laboratory as the nf1 samples. all analyses were done using the statistical package spss version 18.0. for categorical variables the chi - square and fisher 's exact tests were used and for quantitative variables student 's t - test was used. clinical and demographic features of the patients and controls used to determine vitamin d status are summarized in tables 1 and 2. there was no significant difference between groups in age at assessment, sex, skin type (according to the fitzpatrick classification, avoidance of sun exposure), habit of smoking, or use of alcohol. as expected, patients with nf1 had an increased frequency of short stature and had been more often diagnosed with cancer when compared to controls. the mean body mass index (bmi) for nf1 patients was 24,61 and 24,20 for controls, showing no difference between groups for this measure. the mean and median 25(oh)d levels in nf1 patients were 25.25 ng / ml and 25.10 ng / ml (8.46), respectively, and 22.79 ng / ml and 21.90 ng / ml (6.28) in controls, respectively. there was no statistically significant difference in mean 25(oh)d levels between the nf1 and control groups (p = 0.074). in the nf1 group, 29 (64.4%) of the 45 individuals studied had levels of 25(oh)d below 30 ng / ml : vitamin d deficiency was observed in 11 (24.4%) and vitamin d insufficiency in 18 (40.0%) subjects. the minimum 25(oh)d level detected in this group was 5.27 ng / ml and maximum level was 41.3 ng / ml. in the control group, 39 (86.6%) of the 45 individuals studied had levels of 25(oh)d below 30 ng / ml : vitamin d deficiency was observed in 17 (37.7%) and vitamin d insufficiency in 22 (48.8%) subjects. the minimum 25(oh)d level detected in this group was 14.1 ng / ml and maximum level was 44.3 ng / ml. when we categorized 25(oh)d using a cutoff of 30 ng / ml, nf1 patients had more frequently normal 25(oh)d levels than controls. although this difference did not reach statistical significance, distinct distribution can be further observed in the 25(oh)d levels (ng / ml) histograms depicted in figure 1. we did not observe a more severe phenotype in nf1 patients with lower 25(oh)d levels (data not shown). when compared to a subset of 150 healthy, nf1 unaffected individuals recruited at the same hospital as the nf1 patients (as described by monticielo.), allelic and genotypic frequencies encountered in the patients did not differ significantly. these polymorphisms are in partial linkage disequilibrium and the haplotype frequencies also do not differ in a significant way between the two groups (p = 0.613). additionally, we compared 25(oh)d levels obtained from nf1 patients with their different foki and bsmi genotypes (table 4) and did not find any association. so far, seven studies assessed 25(oh)d levels in patients diagnosed with nf1 (table 5). among these, six were case - control studies and one was a descriptive study, all undertaken in the northern hemisphere (usa and europe). although biologically plausible, the association of nf1 with vitamin d deficiency remains controversial and has not been clearly demonstrated in all studies, corroborating our findings in a southern brazilian population. hypovitaminosis d might indeed be involved in the pathogenesis of bone, neurological, and skin disorders of nf1, since it has a significant role in calcium homeostasis and bone metabolism but it is also involved in the regulation of cell proliferation, differentiation, apoptosis, and angiogenesis. in this line, there is consistent evidence in favor of a role for vitamin d in the expression of genes related to decreased cell proliferation for both normal and cancer cells and induction of terminal cell differentiation [1921, 29 ]. however, only one group described an inverse association between increased number of neurofibromas and low plasma 25(oh)d levels, suggesting an effect of the vitamin levels on disease expression. against this hypothesis, stevenson and colleagues found no association between levels of 25(oh)d and the occurrence of optic gliomas or neurofibromas in nf1 patients. hockett and colleagues described in united kingdom a case - control study in which the overall mean of 25(oh)d levels in control group was within deficient range and showed no statistically significant difference with nf1 group. this deficient 25(oh)d value found in control population also occurs in our control group and may reflect poor sun exposure of these populations. in the 1990s, nakayama and colleagues suggested an improvement of two cardinal signs of nf1, neurofibromas (nf) and caf - au - lait spots (cls) in patients treated with vitamin d [30, 31 ]. in addition, yoshida. published a paper in which eight patients with the clinical diagnosis of nf1 were treated with intense light radio frequency combined with topical vitamin d, with improvement of the phenotype. such findings could be explained by the potent antiproliferative effect of vitamin d by inhibiting the transcription specific genes (i.e., c - fos oncogene, as observed in experimental studies with mice). finally, lammert. suggested that the lower vitamin d levels observed in nf1 patients relative to controls could be related to less exposure to sunlight in patients with greater visibility of the disease. the frequency of vitamin d deficiency in the nordic countries is higher than expected by both low sun exposure and low dietary intake of vitamin d precursors. this can easily be explained by geographic and cultural aspects of those countries. in brazil, a country with tropical and subtropical climates (depending on the geographic region), adequate 25(oh)d levels have been reported in the general population of the city of recife (8s) in the northeastern region. in the southeast part of the country, studies are controversial, showing normal 25(oh)d levels in the population of the state of so paulo (21s) but hypovitaminosis d in 42.4% in the population of minas gerais (19s). in the southernmost state of rio grande do sul (30s), probably due to its climatic conditions and the risk profile of most of the individuals studied to date (hospitalized patients), a high prevalence of hypovitaminosis d has been observed [3440 ]. in a cross - sectional study with resident physicians of hospital de clnicas de porto alegre (the same hospital from which the patients in this study derive), the mean serum level of 25(oh)d was 17.9 8.0 ng / ml and 57.4% of them presented 25(oh)d below 20 ng / ml. the high overall frequency of vitamin d deficiency and insufficiency observed in this study corroborates with previous reports that studied populations from southern brazil. the reasons why the overall frequency of hypovitaminosis d is so high in this study remain elusive and the lack of an observed difference between nf1 patients and controls may be related to the deficient and insufficient status of a significant proportion of individuals in the community. we can not exclude certain ascertainment biases such as the period of study (collection during the summer could definitively exclude lack of sun exposure as a factor) and acknowledge that the study has a limitation regarding sample size. however, the lower 25(oh)d levels consistently observed in controls, in terms of both mean values and distribution of individual 25(oh)d measurements, are against the hypothesis of an association of hypovitaminosis d and nf1. in addition our data, despite limited sample size, confirm previous results that differences between nf1 patients and controls are likely not major. finally, although functional data have been inconclusive for bsm1 vdr gene polymorphism, several small studies evaluating this polymorphism have reported significant associations with osteoporosis. some studies have shown a relationship between vdr polymorphisms and bone mineral density, serum 25(oh)d levels, and neoplastic and immune diseases [4145 ]. based on these articles,, 60.0% of studies reported a significant correlation between foki vdr gene polymorphism and osteoporosis risk. as expected, in our study, vdr gene polymorphisms foki and bsmi were not more common in vitamin d deficient or insufficient nf1 patients, suggesting that these biochemical phenotypes are not related to these genetic variants. as we hypothesized, vdr gene polymorphisms foki and bsmi could interfere in vitamin d activity, even when normal levels are present. the effects of vdr gene polymorphisms are in connection with each other, but the different haplotypes between the studied groups also did not reach statistical significance. the reasons for the heterogeneous results found in many association studies are numerous and varied. sample sizes, ascertainment differences, population, and trait genetic heterogeneities may be mentioned. in addition, in quantitative characteristics, most factors account for only a small proportion of the total genetic risk. in our patient series, the differences in vitamin d levels between cases and controls are not statistically significant ; however, the lowest vitamin d levels of the series are found in nf1 patients (5 individuals with levels under 15 ng / ml). curiously, the two patients with the lowest vitamin d levels (5.24 and 8.45 ng / ml) also have the largest number of cutaneous neurofibromas (50100 neurofibromas), although an association between nf1 phenotype severity and lower 25(oh)d levels was not demonstrated. in conclusion, there is no evidence of lower vitamin d levels in nf1 patients and no association between vdr gene polymorphisms and the occurrence of the disease in this group of nf1 patients from southern brazil. additional studies are necessary to definitively exclude or show a role for vdr polymorphisms and vitamin d levels on the skeletal signs and symptoms of nf1. | neurofibromatosis type 1 (nf1) patients are more likely to have vitamin d deficiency when compared to the general population. this study aimed to determine the levels of 25-oh - vitamin d [25(oh)d ] in individuals with nf1 and disease - unaffected controls and analyze foki and bsmi vdr gene polymorphisms in a case and in a control group. vitamin d levels were compared between a group of 45 nf1 patients from southern brazil and 45 healthy controls matched by sex, skin type, and age. genotypic and allelic frequencies of vdr gene polymorphisms were obtained from the same nf1 patients and 150 healthy controls. 25(oh)d deficiency or insufficiency was not more frequent in nf1 patients than in controls (p = 0.074). we also did not observe an association between foki and bsmi vdr gene polymorphisms and vitamin d levels in nf1 patients, suggesting that their deficient or insufficient biochemical phenotypes are not associated with these genetic variants. the differences between the groups in genotypic and allelic frequencies for foki and bsmi vdr gene polymorphisms were small and did not reach statistical significance. these polymorphisms are in partial linkage disequilibrium and the haplotype frequencies also did not differ in a significant way between the two groups (p = 0.613). |
in the auroral zone the ionosphere is more often disturbed than undisturbed, i.e. its densities will be larger than one expects based on the usual parameters such as solar zenith angle, season, and solar activity by which the ionosphere elsewhere can be characterised (e.g., iri, bilitza and reinisch, 2008). the model imaz (mckinnell and friedrich, 2007) is based on the first full solar cycle of data from the incoherent scatter radar eiscat (both uhf and vhf) together with just over 100 profiles from sounding rockets using radio wave propagation data. the height is restricted to 140 km for the simple pragmatic reason that up to that height (arguably) steady state behaviour of the ionosphere can be assumed. the geophysical conditions entered with each electron density profile are solar zenith angle, geomagnetic time, and solar activity. the influence expected due to season and latitude are accounted for by using pressure rather than altitude. imaz uses a local model based on falling sphere and lidar measurements obtained from measurements from the andya rocket range (69n ; friedrich., 2004). geomagnetic latitude is disregarded since all data are from the auroral zone, i.e. geomagnetic latitudes in the range from 61 to 69 but the geographic latitude ranges from 59 (ft. churchill) to almost 70 (oblique eiscat beams tilted to the north). because the auroral ionosphere behaves erratically, imaz uses two additional parameters to describe disturbances, namely the global geomagnetic index ap and the locally established riometer absorption. the magnetic disturbance represented by ap which is available for three hour time slots is due to currents flowing in the e - region. riometer absorption, on the other hand, is not only measured locally, but is available for exactly the same time slots in which the electron densities are measured. ionospheric absorption originates in the d - region (typically centred near 90 km). in a simplified definition a nn is a multi - dimensional, weighted interpolation routine. in order to assess the legitimate range of geophysical conditions the median values of the inputs to imaz and the upper and lower quartiles are important to keep in mind. the overwhelming majority of the data comes from eis - cat which has density thresholds somewhat below and above 10 m for vhf and uhf, respectively. similarly, small values of riometer absorption critically depend on a properly determined quiet day curve and are therefore considered uncertain. the net result is that the manually edited profiles have a lower boundary which only for large disturbances (large riometer absorption) reaches to low altitudes. figure 1 shows a contour plot of the number of usable electron density values as a function of riometer absorption and altitude. predictions for conditions inside the red line can be expect to be good from a model built on these data. predictions for conditions inside the red line can be expect to be good from a model built on these data. under quiet conditions, however, the ionosphere at high latitudes will behave as at other latitudes, i.e. only determined by the solar zenith angle and solar activity. figure 2 demonstrates the procedure with which to obtain tq electron densities, namely to establish the low density envelope and only allow it to vary with zenith angle and solar activity ; at night any variation after sundown at the specific height is ignored. the full procedure involved in the establishment of tq the nn of imaz was trained not only with the data displayed in fig. 1, but also with a tq counterpart for each measured value. the height - riometer area for useful predictions 2all available electron densities at a pressure level of 10 pa (typically 130 km). the dashed line is the solar zenith angle of the shadow at that particular altitude. the low - density envelope (the two red lines with a smooth transition) is considered to represent the true quiet electron densities (tq) as a function of solar zenith angle (egger, 2004).fig. all available electron densities at a pressure level of 10 pa (typically 130 km). the dashed line is the solar zenith angle of the shadow at that particular altitude. the low - density envelope (the two red lines with a smooth transition) is considered to represent the true quiet electron densities (tq) as a function of solar zenith angle (egger, 2004). imaz is a primarily meant to predict / model the lower auroral ionosphere where notably the d - region crucially hinges on rocket borne measurements of electron densities. the disturbance parameter which describes the d - region is riometer absorption. in fig. 4 the geophysical conditions are kept at the median values listed in table 1 and the season is somewhat arbitrarily chosen to be mid - april. in this time of the year both full night conditions (solar zenith angles > 98) and a reasonably large variation of daytime zenith angles occurs. the varied parameter of the displayed curves is riometer absorption between 0 and 5 db (at 27.6 mhz, x - mode), expected to be indicative of the 70 to 90 km altitude range. the curve labelled 0 db is identically with the true quiet as described in the introduction. unexpected features are that at some heights electron densities decrease with increasing riometer absorption. arguably riometer absorption is not a relevant parameter to describe the state of the e - region, whereas the decrease in the lower d - region may on the one hand simply be the result of insufficient number of data, but on the other hand also be due to the rather wide interpolation of imaz from tq to fairly disturbed conditions (cf. although a positive correlation of electron density and riometer absorption (dne / dlr > 0) does not necessarily have to prevail at all altitudes, we will address the in addition there is another definition of the valid range of the imaz predictions, namely whether the two disturbance parameters (lr and ap) can each be varied independently from the other. in fig. clearly large riometer absorption is usually associated with large ap, whereas large ap can occur without concurrently enhanced riometer absorption. the red line in that figure is a simple divider between the range which is well covered by ap and lr (covered range) from that where the combination of the parameters only provides insufficiently coverage (strange range). for the all - median conditions the riometer limit of 2.8 db is indicated in fig. 5 ; clearly the invalid behaviour occurs when approaching the strange range and beyond, as well as above 100 km which is not characterised by absorption. 4variation of electron densities according to imaz as a function of riometer absorption for otherwise median conditions (mid - april, f10.7 = 109, zenith angle 89, ap = 15).fig. 5electron densities at constant altitudes (pressure levels) as a function of riometer absorption for the same conditions as in fig. the lines are at 12 logarithmically spaced pressure levels per decade between 60 and 140 km.fig. 6riometer absorption concurrent with geomagnetic disturbance in the data that entered the imaz model.table 1range of geophysical parameters of the input data used for the imaz model.lower quartilemedianupper quartilesolar activity f10.772109139solar zenith angle, 7489104global magnetic index ap71527riometer absorption, db @ 27.6 mhz, x - mode0.160.290.56 variation of electron densities according to imaz as a function of riometer absorption for otherwise median conditions (mid - april, f10.7 = 109, zenith angle 89, ap = 15). electron densities at constant altitudes (pressure levels) as a function of riometer absorption for the same conditions as in fig. the lines are at 12 logarithmically spaced pressure levels per decade between 60 and 140 km. the disturbed high latitude ionosphere is due to additional ionisation by energetic electrons or protons. generally ionisation at lower altitudes is due to higher energies of these precipitating charged particles. although the spectral shape of the energetic particles will change (steepen or harden), nonetheless enhanced fluxes in a specific energy range will always also mean (more or less) enhanced fluxes in other parts of the spectrum, but certainly not lead to reduced fluxes. we therefore surmise that dne / dlr must always be positive with increasing lr. in order to force imaz to obey this behaviour, we form the derivative at all altitudes (or pressure levels), leave out negative values and limit the acceptable range to 90% of the riometer limit for the prevailing ap value. the gaps due to negative values are smoothed by cubic splines which allow zero, but not negative gradients (constant electron density). beyond the riometer limit the gradients are extrapolated to 10 db (or about 5 db at today s more common frequency of 38.2 mhz). figure 7 shows the electron density predictions for median conditions as in fig. 4, but with the modifications described above. 7electron densities as a function of riometer absorption for median conditions according to the modified imaz model (cf. electron densities as a function of riometer absorption for median conditions according to the modified imaz model (cf. intuitively the new profiles look more as one would expect, but there are other ways to check if the modified imaz indeed performs better. our d - region disturbance parameter is riometer absorption, i.e. the absorption of natural extraterrestrial radio sources due to the whole ionosphere. strictly speaking riometer absorption the contribution of the tq ionosphere is between 0.01 and 0.16 db (harrich., 2003). model electron densities representative for a particular riometer absorption should ideally absorb extraterrestrial radio signals by that amount. in fig. 8 we show the simulated integral absorption li (riometer values plus absorption due to the tq ionosphere) vs. the integral absorption entered for the imaz prediction, together with the corresponding electron density profiles. clearly the original imaz not only produces e - region densities that decrease with increasing riometer absorption, but perhaps more importantly the simulated absorption for large disturbances shows completely unrealistic values. 8variation of night - time electron densities according to the original and the modified imaz model (upper panel), and the resulting simulated integral absorption (lower panel). variation of night - time electron densities according to the original and the modified imaz model (upper panel), and the resulting simulated integral absorption (lower panel). large disturbances, i.e. electron densities significantly enhanced relative to tq, will still show a diurnal variation of the shape of the profile. this is to be expected owing to the different ion recombination chemistry, but also because the ionising spectra of energetic particles will in general have shapes that are typically different depending on the geomagnetic time. nonetheless, the simulated riometer (or integral) absorption should throughout the day lead to the same value as was the input to the model. figure 9 shows the diurnal variation of the simulated integral absorption for mid - april according to the original and the extended imaz for 3 db riometer absorption. during mid - day the (ideal) integral absorption is about 0.1 db larger than 3 db owing to the absorption due to the tq electron density. the original imaz produces large deviations from the ideal behaviour, notably at sunrise and sunset, whereas in the modified version there are still departures from the ideal behaviour, but considerably reduced. 9diurnal variation of electron densities at various heights for 3 db riometer absorption (median conditions, mid - april) according to the original and the extended imaz model (upper panel), and the corresponding integral absorption (lower panel). diurnal variation of electron densities at various heights for 3 db riometer absorption (median conditions, mid - april) according to the original and the extended imaz model (upper panel), and the corresponding integral absorption (lower panel). the empirical model imaz is as of today probably unchallenged not least because of the huge amount of data that it is based on. the mathematical procedure of artificial neural networks (nn) provides good results inside the so - called input space, i.e. for well - covered geophysical condition. for predicting extreme situations, notably for large riometer absorption, the nn results from within the input space were extrapolated to values insufficiently or not at all covered by data. the plausibility of these extrapolated results not only intuitively appear sensible, but also the simulated riometer absorption is reasonably close to the riometer absorption the profiles are meant to represent. as a further refinement / correction the sometimes large interpolation from true quiet electron densities to the measured ones was corrected. this is achieved by inhibiting that electron densities in the interpolated absorption range between tq and measured data decreases with increasing absorption. | the empirical ionospheric model of the auroral zone (imaz) is based on more than 100,000 electron density profiles measured by the european incoherent scatter radar eiscat combined with about 100 from sounding rockets. the mathematical procedure applied is a neural network (nn) which works fine as long as one requests predictions from inside the so - called input space, but predicting situations outside it, i.e. for conditions not or only poorly covered by data, are in general utterly unrealistic. an analytical procedure is presented which reasonably extrapolates the nn results for conditions inadequately covered by input data. |
of the many health conditions that are associated with obesity, type 2 diabetes is among the most prevalent (2). achieving and maintaining a healthy body weight is a primary strategy for the management of type 2 diabetes (3). participation in a face - to - face tailored lifestyle intervention that involves diet modification, increased physical activity, and behavior therapy, such as that of the action for health in diabetes (look ahead) trial intervention, can result in a degree of weight loss for overweight patients with diabetes that improves glycemic control and cardiovascular disease risk factors (4,5). however, most overweight or obese individuals with type 2 diabetes do not receive this degree of support for changes in diet and physical activity to promote weight loss in their clinical care partly due to constraints of time and training for most health - care providers and clinicians (6,7). the intervention in the present study was a commercial weight loss program that includes one - to - one behavioral counseling, a low - energy - density diet, prepackaged foods, and increased physical activity. in a randomized clinical trial, the program was shown to effectively promote weight loss in generally healthy adults compared with a usual care (uc) control condition, resulting in an average 1-year weight loss of 10% and an average 2-year weight loss of 7% (8). the effectiveness of this multifaceted intervention has not been previously examined in a randomized trial targeting individuals with type 2 diabetes who have high rates of cardiovascular disease morbidity and mortality as well as a high risk for secondary and tertiary medical complications if glycemic control is not achieved and maintained. although a deficit in total energy intake relative to expenditure is the most critical dietary factor that determines weight loss, increasing evidence suggests that macronutrient composition of the diet may also influence weight loss and metabolic response (9). in a few previous studies, effects on atherogenic dyslipidemia and glycemic control have been observed to be more favorable with a lower versus higher carbohydrate diet, after adjusting for weight loss, in individuals with insulin resistance or type 2 diabetes (1012). the first aim of the present study was to test in a randomized controlled trial whether participation in this structured weight loss program promotes greater 1-year weight loss and maintenance in overweight or obese adults with type 2 diabetes compared with uc conditions. a secondary aim was to describe the effect of participating in the program (vs. uc) on markers of glycemic control (fasting glucose, hemoglobin a1c [hba1c ]), cardiovascular disease risk factors (triglyceride, hdl cholesterol, c - reactive protein [crp ] levels), cardiopulmonary fitness, quality of life, and plasma carotenoids (a biomarker of vegetable and fruit intake). an exploratory aim was to examine whether there is a differential response to dietary macronutrient composition (higher vs. lower carbohydrate) in weight change and markers of glycemic control and cardiovascular disease risk. men and women were recruited and enrolled at two study sites (university of california, san diego [ucsd ] ; university of minnesota, minneapolis). participants were recruited through word of mouth, direct marketing letters mailed to large cohorts, radio advertisements, local e - mail subscription services, clinicaltrials.gov, social media, and flyers. eligibility criteria were a history of type 2 diabetes confirmed by a physician ; aged 18 years ; bmi 2545 kg / m ; not pregnant or breastfeeding or planning to become pregnant in the next year ; willing to participate in any of the study diet arms over a 1-year period ; no eating disorders, food allergies, or food intolerances ; no history of bariatric surgery ; and willing and able to perform a step test for assessing cardiopulmonary fitness. current active involvement in another diet intervention study or organized weight loss program ; weight loss > 10 lb in the past 3 months ; or having a history or presence of a significant psychiatric disorder or any other condition that, in the investigator s judgment, would interfere with participation in the trial disqualified participants. other exclusion criteria were hba1c > 11% (97 mmol / mol), fasting triglyceride level > 600 mg / dl, and serum creatinine level 1.4 mg / dl (women) or 1.5 mg / dl (men). participants were randomly assigned to a weight loss program with a higher carbohydrate, lower fat (lf) diet plan ; a weight loss program with a lower carbohydrate, higher fat (lc) diet plan ; or a uc program (supplementary fig. randomization was stratified by study site and bmi using a web - based application with a sequence generated by the study statistician. participants were reimbursed $ 25 for each data collection clinic visit, with incremental increases over the course of the study to compensate for rising fuel costs, but no compensation was provided for participation in the intervention or counseling sessions. institutional review boards at both universities approved the study protocol, and all participants provided written informed consent. participants in the two commercial weight loss program arms of the study received weight loss counseling and all program materials free of charge, including prepackaged foods. three entrees and one to two snacks were provided for 7 days / week during the initial weight loss phase (months 16) and for 5 days / week during a transition phase (months 79), and one entree and one snack daily was provided, as desired, during the maintenance phase (months 1012). participants were encouraged, especially during the initial period, to follow the menu plan with prepackaged foods (4176% of energy). the prepackaged foods provided more than one - half to two - thirds of energy intake for most participants and somewhat less for those at higher levels of dietary energy prescription during the initial period. grocery foods, such as vegetables, fruit, cereal / grain products, dairy products, lean meat, and unsaturated fat sources, were recommended to achieve the total prescribed energy and macronutrient intake. participants also were provided guidance for how to choose grocery and restaurant foods that would meet the meal plan to accommodate special occasions and other needs. one - to - one counseling sessions with trained program staff were offered for the 1-year period, with follow - up telephone and website / message board availability. weekly counseling visits were recommended during the first 9 months after which participants had the option to move from weekly to biweekly or monthly consultations. program materials encouraged basic diabetes self - management strategies, such as monitoring of blood glucose and symptoms of hypoglycemia and hyperglycemia, as well as tracking of food intake and physical activity. prepared foods, program materials, products, and counselors were provided by jenny craig, inc. both commercial weight loss program diet meal plans were reduced in energy relative to expenditure (typically 1,2002,000 kcal / day). the lf diet plan provided 60% energy from carbohydrates, 20% from fat, and 20% from protein. the lc diet plan provided 45% energy from carbohydrates, 30% from fat, and 25% from protein. both diet meal plans, strategies to reduce energy density of the diet, such as incorporating vegetables and water - rich foods in meals and snacks, were encouraged. increased physical activity was encouraged, with the goal of 30 min of physical activity on 5 days / week. program materials and counseling addressed attitudes about weight, food, and physical activity, and materials included recipes, guidance for eating in restaurants, digital videos and exercise equipment to increase physical activity, and online education and support. after randomization and at 6 months, participants assigned to uc received a 1-h individual weight loss counseling session with a dietitian. in the first session, participants were advised to consume a deficit of 5001,000 kcal / day to achieve a weight loss of 10% of initial weight. participants were encouraged to use web - based tracking programs that guide toward the macronutrient distribution recommended in the dietary guidelines for americans (2035% [average 30% ] of energy from fat, 4565% [average 55% ] from carbohydrates, and 1035% [average 15% ] from protein) (13). counseling and print materials encouraged strategies and skills for weight loss and maintenance (e.g., estimating portion sizes, self - monitoring). this session was followed by monthly check - in through e - mail or telephone calls, and progress was discussed in the follow - up counseling session. participants in uc also received a standardized checklist of recommendations for general diabetes care, including regular glucose monitoring, awareness of symptoms of hypoglycemia and hyperglycemia, and the importance of adherence to prescribed medications and good hygiene practices. at data collection clinic visits, weight, waist circumference, height (baseline only), and blood pressure were measured, and questionnaires [the beck depression inventory (14), 36-item short - form health survey quality - of - life questionnaire (15), and godin leisure - time exercise questionnaire (16) ] were collected by institution research staff who usually were unblinded. this test measures heart rate during the first 30 s of recovery from stepping, and although less accurate than measuring vo2max, the test has high reliability and is sensitive to change (17). fasting (6 h) blood samples were collected at each clinic visit. glucose, cholesterol, triglyceride, hdl cholesterol, and creatinine (at baseline screening visit only) levels were measured with the kodak ektachem analyzer system (johnson & johnson clinical diagnostics, rochester, ny). the advia centaur assay, a double - antibody immunoassay with chemiluminescent detection, was used for insulin quantification. hba1c was measured in washed erythrocytes with ion exchange high - performance liquid chromatography (d10 system, bio - rad laboratories, hercules, ca). high - sensitivity crp was assayed using a polystyrene - enhanced turbidimetric in vitro immunoassay (19,20). plasma carotenoid concentrations, an indicator of fruit and vegetable consumption, were measured by high - performance liquid chromatography (21). weight change, the primary study outcome, was analyzed as intention to treat, with baseline substitution for missing data. this approach assumes that participants who did not complete clinic visits or dropped out returned to their baseline weight and is recommended based on usual recidivism after weight loss (22). change over time (weight, laboratory values, blood pressure, and psychosocial variables) was examined in longitudinal mixed models, based on an interaction between study group and time, and controlled for sex. we also examined weight data for completers, recognizing a likely bias because dropouts may be less adherent and may exhibit weight rebound. to improve normality of distributions, log transformation was applied to laboratory values in analysis, but untransformed means are presented in text and tables for ease of interpretation. models for glucose, hba1c, and insulin were controlled for use of insulin and other diabetes medications. a subject - specific intercept, representing baseline levels of each modeled outcome, was included as a random effect in each model. all analyses were conducted with sas 9.3 (sas institute, cary, nc) statistical software. power calculations were based on data from a previous clinical trial of the weight loss program (8) and biochemical laboratory data in individuals with diabetes (4). using mean (sd) effect sizes of 6.8 (8.8) in the intervention groups and 2.0 (7.2) in the control group, there was 90% power for the primary aim with 75 participants per arm and a dropout rate of up to 20%. there was also 90% power to discern between - group hba1c differences of 0.5% (6 mmol / mol). men and women were recruited and enrolled at two study sites (university of california, san diego [ucsd ] ; university of minnesota, minneapolis). participants were recruited through word of mouth, direct marketing letters mailed to large cohorts, radio advertisements, local e - mail subscription services, clinicaltrials.gov, social media, and flyers. eligibility criteria were a history of type 2 diabetes confirmed by a physician ; aged 18 years ; bmi 2545 kg / m ; not pregnant or breastfeeding or planning to become pregnant in the next year ; willing to participate in any of the study diet arms over a 1-year period ; no eating disorders, food allergies, or food intolerances ; no history of bariatric surgery ; and willing and able to perform a step test for assessing cardiopulmonary fitness. current active involvement in another diet intervention study or organized weight loss program ; weight loss > 10 lb in the past 3 months ; or having a history or presence of a significant psychiatric disorder or any other condition that, in the investigator s judgment, would interfere with participation in the trial disqualified participants. other exclusion criteria were hba1c > 11% (97 mmol / mol), fasting triglyceride level > 600 mg / dl, and serum creatinine level 1.4 mg / dl (women) or 1.5 mg / dl (men). participants were randomly assigned to a weight loss program with a higher carbohydrate, lower fat (lf) diet plan ; a weight loss program with a lower carbohydrate, higher fat (lc) diet plan ; or a uc program (supplementary fig. randomization was stratified by study site and bmi using a web - based application with a sequence generated by the study statistician. participants were reimbursed $ 25 for each data collection clinic visit, with incremental increases over the course of the study to compensate for rising fuel costs, but no compensation was provided for participation in the intervention or counseling sessions. institutional review boards at both universities approved the study protocol, and all participants provided written informed consent. participants in the two commercial weight loss program arms of the study received weight loss counseling and all program materials free of charge, including prepackaged foods. three entrees and one to two snacks were provided for 7 days / week during the initial weight loss phase (months 16) and for 5 days / week during a transition phase (months 79), and one entree and one snack daily was provided, as desired, during the maintenance phase (months 1012). participants were encouraged, especially during the initial period, to follow the menu plan with prepackaged foods (4176% of energy). the prepackaged foods provided more than one - half to two - thirds of energy intake for most participants and somewhat less for those at higher levels of dietary energy prescription during the initial period. grocery foods, such as vegetables, fruit, cereal / grain products, dairy products, lean meat, and unsaturated fat sources, were recommended to achieve the total prescribed energy and macronutrient intake. participants also were provided guidance for how to choose grocery and restaurant foods that would meet the meal plan to accommodate special occasions and other needs. one - to - one counseling sessions with trained program staff were offered for the 1-year period, with follow - up telephone and website / message board availability. weekly counseling visits were recommended during the first 9 months after which participants had the option to move from weekly to biweekly or monthly consultations. program materials encouraged basic diabetes self - management strategies, such as monitoring of blood glucose and symptoms of hypoglycemia and hyperglycemia, as well as tracking of food intake and physical activity. prepared foods, program materials, products, and counselors were provided by jenny craig, inc. both commercial weight loss program diet meal plans were reduced in energy relative to expenditure (typically 1,2002,000 kcal / day). the lf diet plan provided 60% energy from carbohydrates, 20% from fat, and 20% from protein. the lc diet plan provided 45% energy from carbohydrates, 30% from fat, and 25% from protein. both diet meal plans, strategies to reduce energy density of the diet, such as incorporating vegetables and water - rich foods in meals and snacks, were encouraged. increased physical activity was encouraged, with the goal of 30 min of physical activity on 5 days / week. program materials and counseling addressed attitudes about weight, food, and physical activity, and materials included recipes, guidance for eating in restaurants, digital videos and exercise equipment to increase physical activity, and online education and support. after randomization and at 6 months, participants assigned to uc received a 1-h individual weight loss counseling session with a dietitian. in the first session, participants were advised to consume a deficit of 5001,000 kcal / day to achieve a weight loss of 10% of initial weight. participants were encouraged to use web - based tracking programs that guide toward the macronutrient distribution recommended in the dietary guidelines for americans (2035% [average 30% ] of energy from fat, 4565% [average 55% ] from carbohydrates, and 1035% [average 15% ] from protein) (13). counseling and print materials encouraged strategies and skills for weight loss and maintenance (e.g., estimating portion sizes, self - monitoring). this session was followed by monthly check - in through e - mail or telephone calls, and progress was discussed in the follow - up counseling session. participants in uc also received a standardized checklist of recommendations for general diabetes care, including regular glucose monitoring, awareness of symptoms of hypoglycemia and hyperglycemia, and the importance of adherence to prescribed medications and good hygiene practices. at data collection clinic visits, weight, waist circumference, height (baseline only), and blood pressure were measured, and questionnaires [the beck depression inventory (14), 36-item short - form health survey quality - of - life questionnaire (15), and godin leisure - time exercise questionnaire (16) ] were collected by institution research staff who usually were unblinded. the 3-min step test was used to assess aerobic fitness. this test measures heart rate during the first 30 s of recovery from stepping, and although less accurate than measuring vo2max, the test has high reliability and is sensitive to change (17). fasting (6 h) blood samples were collected at each clinic visit. glucose, cholesterol, triglyceride, hdl cholesterol, and creatinine (at baseline screening visit only) levels were measured with the kodak ektachem analyzer system (johnson & johnson clinical diagnostics, rochester, ny). the advia centaur assay, a double - antibody immunoassay with chemiluminescent detection, was used for insulin quantification. hba1c was measured in washed erythrocytes with ion exchange high - performance liquid chromatography (d10 system, bio - rad laboratories, hercules, ca). high - sensitivity crp was assayed using a polystyrene - enhanced turbidimetric in vitro immunoassay (19,20). plasma carotenoid concentrations, an indicator of fruit and vegetable consumption, were measured by high - performance liquid chromatography (21). weight change, the primary study outcome, was analyzed as intention to treat, with baseline substitution for missing data. this approach assumes that participants who did not complete clinic visits or dropped out returned to their baseline weight and is recommended based on usual recidivism after weight loss (22). change over time (weight, laboratory values, blood pressure, and psychosocial variables) was examined in longitudinal mixed models, based on an interaction between study group and time, and controlled for sex. we also examined weight data for completers, recognizing a likely bias because dropouts may be less adherent and may exhibit weight rebound. to improve normality of distributions, log transformation was applied to laboratory values in analysis, but untransformed means are presented in text and tables for ease of interpretation. models for glucose, hba1c, and insulin were controlled for use of insulin and other diabetes medications. a subject - specific intercept, representing baseline levels of each modeled outcome, was included as a random effect in each model. proportions of participants who stopped or decreased medications were compared with fisher exact test. statistical significance was two - sided without adjustment for multiple comparisons. all analyses were conducted with sas 9.3 (sas institute, cary, nc) statistical software. power calculations were based on data from a previous clinical trial of the weight loss program (8) and biochemical laboratory data in individuals with diabetes (4). using mean (sd) effect sizes of 6.8 (8.8) in the intervention groups and 2.0 (7.2) in the control group, there was 90% power for the primary aim with 75 participants per arm and a dropout rate of up to 20%. there was also 90% power to discern between - group hba1c differences of 0.5% (6 mmol / mol). the study sample comprised 227 men and women aged 2475 years (mean 56 years) (table 1) who were recruited between march and august 2012. during the study period, two participants (one lf and one lc) died, one of cardiovascular disease before the 6-month visit and the other of cancer before the 12-month visit. primary outcome data were obtained at study end from 90% of the participants who were randomized. 1). over the year of active involvement, counseling visits in the weight loss program intervention groups ranged from 1 to 69, with a median of 41 visits. characteristics of participants at study entry at baseline, mean (sd) weight was 105.5 (17.6) kg. at 6 months, those in the lf group had reduced initial weight by 8.6% (95% ci 7.210.0%), those in the lc group by 10.4% (8.912.0%), and those in uc group by 2.3% (1.33.2%) (table 2). participants in the intervention arms lost more weight than those in the uc arm (10.3 [95% ci 9.211.5 ] vs. 2.8 [1.64.1 ] kg, p < 0.001). at study end, maintained weight loss was greater in the intervention arms (8.2% of initial weight) than in the uc arm (2.5% of initial weight, p < 0.001). the lf and lc groups did not differ in weight loss at 12 months in the intention - to - treat analysis, although among the completers, lc lost more weight than lf (10.2 vs. 7.9%, p = 0.035). a majority (86 of 149) of participants in the weight loss program maintained at least a 5% loss of initial body weight at study end compared with less than one - quarter (18 of 76) of uc participants (p < 0.001). at study end, a 10% weight reduction was achieved by 38% of the weight loss program participants (57 of 149) and 9% of the uc participants (7 of 76, p < 0.001). at 6 months, diastolic blood pressure was lower in the weight loss program participants (77 [95% ci 7579 ] mmhg) than in the uc participants (82 [7885 ] mmhg, p = 0.006). body measurements and blood pressure, behavioral, and psychosocial measures at 6 months, participants in both weight loss program groups but not in the uc group reported increased moderate / vigorous physical activity of 1.5 h more than their baseline levels or than uc (p < 0.001 for each) (table 2). participants in all three groups had lower recovery heart rates after the step test at 6 months than they had at baseline (p < 0.001). weight loss program participants also had lower depression scores than uc participants (5 [95% ci 46 ] vs. 7 [59 ], p = 0.009) and better physical quality - of - life scores (80 [7783 ] vs. 72 [6778 ], p = 0.005) at 6 months (table 2). however, glycemic control markers (glucose, hba1c, and insulin) and triglyceride levels were lower in both lf and lc than in uc at 6 months (glucose 132 [95% ci 126138 ] vs. 148 [137160 ] mg / dl, p = 0.006 ; hba1c 6.4% [6.36.6% ] vs. 7.2% [6.87.6% ] [or 46 (4549) vs. 55 (5160) mmol / mol ], p < 0.001 ; insulin 21 [1824 ] vs. 29 [2137 ] iu / ml, p = 0.006 ; triglycerides 143 [130157 ] vs. 181 [160203 ] mg / dl, p < 0.001), and these differences were sustained at 12 months (glucose 141 [133149 ] vs. 159 [144174 ] mg / dl, p = 0.023 ; hba1c 6.9% [6.67.1% ] vs. 7.5% [7.17.9% ] or 52 [4954 ] vs. 58 [5463 ] mmol / mol, p = 0.001 ; insulin 21 [1825 ] vs. 25 [2030 ] iu / ml, p = 0.016 ; triglycerides 148 [134163 ] vs. 204 [173234 ] mg / dl, p participants in the lc diet group had lower mean glucose concentration (p = 0.037) and hba1c (p = 0.024) than those in the lf diet group at 6 months, and the hba1c difference between lc and lf was sustained at 12 months (p = 0.021) (table 3). at study end, 62% of weight loss program participants (83 of 133) and 45% of the uc participants (30 of 66) met the recommended hba1c general goal of < 7% (53 mmol / mol) for diabetes care (71% [47 of 66 ] and 54% [36 of 67 ] of lc and lf participants, respectively ; p = 0.037) (23). total and ldl cholesterol levels did not differ between the groups at either follow - up time point. compared with the uc group, the weight loss program groups had higher hdl cholesterol and total carotenoid levels and lower crp levels at study end (table 3). laboratory measurements self - reported medication use changed during the course of the study (table 4). eighteen percent of the participants (n = 41) used insulin at study entry, with a mean duration of 4 years. of these participants, 72% (21 of 29) in the weight loss program groups decreased or discontinued insulin use by study end compared with 8% (1 of 12) in the uc group. similarly, oral hypoglycemic, cholesterol - lowering, and blood pressure medication use was reduced or discontinued more often among the weight loss program participants than among the uc participants (p = 0.007, 0.024, and 0.032, respectively). only 4% of study participants reported any use of glucon - like peptide agonists during the trial, among whom three subjects stopped and two started these medications. a commercially available structured weight loss program involving diet modification, increased physical activity, and behavioral counseling produced weight loss and improved glycemic control in type 2 diabetes comparable with that achieved in a well - funded clinical trial (4). at 1 year, participants in the weight loss program intervention lost 8.2% of initial weight compared with a 2.5% weight loss in the control group. several cardiovascular disease risk factors also were favorably improved at 1 year in the weight loss intervention participants compared with control participants. data were available from 90% of participants at study end, so little ambiguity exists in drawing conclusions from this study, which is not typical for weight loss trials. structured, intensive weight loss and diet interventions are recognized as useful and recommended for managing type 2 diabetes, but the challenge of delivering this type of intervention in clinical practice is a recognized problem in diabetes management (3). findings from the current study suggest that clinicians can refer patients to and use a commercial weight loss program that is evidence based to optimize weight loss and diabetes care. the institute of medicine (24), american diabetes association (3), and american heart association (aha) (25) recommend the following spectrum of dietary composition for the general adult population : 2035% of energy (aha 2535%) from fat ; 4565% of energy (aha 5060%) from carbohydrates ; and 1035% of energy (at least 0.8 g / kg) from protein. dietary carbohydrate intake is the primary determinant of blood glucose values, and evidence suggests that the quantity, and perhaps quality, of carbohydrate sources can influence metabolic response to a weight loss diet in diabetes management (26,27). the lower and higher carbohydrate diets studied in this trial are both within the range of recommended intake. the moderately reduced level of carbohydrate intake examined as an exploratory aim in this study is likely to be sustainable, which is a concern with low - carbohydrate diets in both the general population (28,29) and patients with type 2 diabetes (11). in the look ahead study (n = 5,145), a weight loss and physical activity intervention that included liquid meal replacements and the option of weight loss medications, an average weight loss of 8.6% of initial weight at 1 year was achieved (4). in look ahead, the mean hba1c at 1 year was reduced from 7.3 to 6.6% (5649 mmol / mol) in the intervention group compared with 7.2% (55 mmol / mol) in the diabetes education control group. a few previous studies compared the effect of a very - low - carbohydrate diet (2024% of energy) to the more conventional low - fat diet in individuals with type 2 diabetes. similar weight loss but more favorable effects on lipids and glycemic control (although often transient) were observed, but declining adherence over even 1 year of study involvement and a higher attrition rate constrain interpretation of the results (10,11,30). the response to another commercially available weight loss program that includes prepackaged foods was examined in 100 obese patients with type 2 diabetes in a 6-month study (31). participants assigned to the weight loss program lost 7.8% of initial weight compared with 2.1% in a control group provided general diabetes management education, and hba1c declined from 7.6 to 6.9% (6052 mmol / mol) vs. 7.97.5% (6358 mmol / mol) in the control group. a role for meal replacement products, which are composite food products (beverages, snack bars, or ready - to - mix powders) has been proposed for promoting weight loss in diabetes management (32). in contrast with prepackaged portion - controlled regular food, those products contain essential nutrients but generally lack bioactive food components and do not illustrate how to make good choices in response to food exposures in grocery stores and restaurants. additionally, behavioral counseling, education, frequent contact, support, and increased physical activity, elements incorporated in the program examined in the current study, are determinants of successful long - term weight management (33,34) and are recommended to promote long - term weight management and glycemic control in diabetes care (3). although greater weight loss in response to a lower versus higher carbohydrate diet has been observed in insulin resistant, nondiabetic individuals in a few previous studies (35,36), intention - to - treat analysis did not reveal differential weight loss in response to the two levels of carbohydrate intake examined in the current study. previous studies comparing a very - low - carbohydrate diet with a low - fat diet in patients with type 2 diabetes also did not report differential effects on weight loss over 12 years (10,11,30). in those studies, the very - low - carbohydrate diet resulted in more favorable effects on cardiovascular disease risk factors (e.g., hdl cholesterol and triglyceride levels), as observed in the current study. a favorable effect on the level of crp, an inflammatory marker, also was observed in response to participation in the weight loss program in the current study. the target was a free - living population, so variability in adherence is likely. self - reported dietary data have well - recognized limitations in accuracy, which are characterized as substantial underreporting and misreporting among overweight and obese individuals. an implication of this limitation is that it is not known whether the more - favorable response in those assigned to a lower - carbohydrate diet may be due to better adherence or even greater weight loss, as was observed among participants for whom data were available at all time points. the intervention and prepackaged foods were provided without cost to the participants, as was also the case in look ahead and other weight loss and diet intervention studies (4,31), which may affect generalizability. compared with the cost of a comprehensive weight loss program, the medical costs of type 2 diabetes that is not optimally managed are considerable. a larger proportion of participants in the weight loss program (vs. the control condition) in the current study was able to reduce or discontinue diabetes, hypertension, and lipid - lowering medications and, thus, medical costs. although aimed toward prevention, the diabetes prevention program demonstrated that an intensive lifestyle intervention is cost - effective because of the high cost of medical care associated with diabetes (37). another limitation is that the weight loss program counselors were unblinded, although they were instructed to provide the program and services as delivered to paying customers. in summary, the structured weight loss program resulted in greater weight loss and improved glycemic control in overweight or obese individuals with type 2 diabetes compared with a uc control group receiving less intensive counseling. | objectiveto test whether a weight loss program promotes greater weight loss, glycemic control, and improved cardiovascular disease risk factors compared with control conditions and whether there is a differential response to higher versus lower carbohydrate intake.research design and methodsthis randomized controlled trial at two university medical centers enrolled 227 overweight or obese adults with type 2 diabetes and assigned them to parallel in - person diet and exercise counseling, with prepackaged foods in a planned menu during the initial phase, or to usual care (uc ; two weight loss counseling sessions and monthly contacts).resultsrelative weight loss was 7.4% (95% ci 5.79.2%), 9.0% (7.110.9%), and 2.5% (1.33.8%) for the lower fat, lower carbohydrate, and uc groups (p < 0.001 intervention effect). glycemic control markers and triglyceride levels were lower in the intervention groups compared with uc group at 1 year (fasting glucose 141 [95% ci 133149 ] vs. 159 [144174 ] mg / dl, p = 0.023 ; hemoglobin a1c 6.9% [6.67.1% ] vs. 7.5% [7.17.9% ] or 52 [4954 ] vs. 58 [5463 ] mmol / mol, p = 0.001 ; triglycerides 148 [134163 ] vs. 204 [173234 ] mg / dl, p < 0.001). the lower versus higher carbohydrate groups maintained lower hemoglobin a1c (6.6% [95% ci 6.36.8% ] vs. 7.2% [6.87.5% ] or 49 [4551 ] vs. 55 [5158 ] mmol / mol) at 1 year (p = 0.008).conclusionsthe weight loss program resulted in greater weight loss and improved glycemic control in type 2 diabetes. |
the term ultra - orphan disease describes in united kingdom the conditions with a disease prevalence of < 1 case per 50,000 population, while pnh incidence is 1 - 2 cases per million. the abnormality of the red blood cells (rbcs) in pnh predisposes them to intravascular complement - mediated hemolysis. the disorder is caused by somatic mutation in the x - linked phosphatidyl - inositol glycans class a (pig - a) gene. pig - a gene product is needed for biosynthesis of glycosyl - phosphatidyl - inositol anchor (gpa), a glycolipid moiety that adheres many proteins to the plasma membrane of the cells, on the membrane of the rbcs. a large number of membrane protein deficiencies have been found in pnh, specifically the complement regulatory proteins cd55 and cd59. cd55 inhibits c3 convertase and cd59 block the formation of the membrane attack complex (mac) by inhibiting incorporation of c9 into the mac. the loss of these regulatory proteins make rbcs more susceptible to both intravascular and extravascular hemolysis, but it is the intravascular hemolysis that contributes to the morbidity and mortality from in the disease. in pnh, free hemoglobin has enormous affinity for nitric oxide (no) and can severely deplete its plasma level to the point of causing symptoms ; it could manifest clinically as fatigue, abdominal pain, esophageal spasm, hemoglobinuria, and possibly thrombosis. pnh is variable, ranging from indolent to life threatening disease with a median survival rate of 10 to 15 years. thrombosis is the key cause of death in pnh patients in about 40% to 67% of cases. venous thrombosis can occur anywhere, including hepatic splenic, portal and cerebral veins. however, others may die of complications, such as bone marrow failure, meyelodysplastic syndrome, renal failure and leukemia. hepatic vein thrombosis is documented as one of the most common sites of thrombosis affecting pnh patients. the diagnosis of pnh is often difficult because the symptoms are often multifaceted and hemoglobinuria is absent in around 25% of cases. pnh is suspected in patients showing mild to severe anemia with moderate reticulocytosis, raised serum lactate dehydrogenase (ldh) and possibly mild jaundice, with negative coombs tests. conventional treatment of pnh involves mainly supportive measures aiming to control the clinical manifestations of the disease such as anticoagulants and blood transfusion. anticoagulants are the most common way to treat blood clots in patients with pnh and are usually administered on regular basis. yet, anticoagulants administration can be challenging, because pnh patients often have low platelet counts, and the international normalized ratio (inr) is extremely hazardous to be maintained in therapeutic range in severely thrombocytopenic pnh patients. eculizumab is a newly developed humanized monoclonal antibody (mab) derived from the murine anti - human c5 mab. the mab precisely binds the terminal complement fraction 5, thus inhibiting the cleavage to c5a and c5b, therefore blocking the formation of mac, which is the terminal effector mechanism lead to intravascular hemolysis of pnh rbcs. eculizumab has found to be highly efficient in reducing intravascular hemolysis ; treatment with eculizumab cuts the need for blood transfusions, reduced risks of thrombosis, and improves quality of life. although this patient has a bcs, portal vein stent and continuous high risk of thrombosis, she refused to take any anticoagulant since she started eculizumab over the last 4 years. up to date there is no established guideline to use eculizumab without anticoagulants despite its protective effect in pnh. eculizumab could be a lifesaving drug when pnh is complicated by sever thrombocytopenia which is a common complication of this disease. in 2006, a 39-year - old female was seen by the hepatologist because of abdominal pain, hepatosplenomegaly and thrombocytopenia. hydroxychloroquine was also commenced, based on her thrombocytopenia and bcs thrombosis. with trans - jugular intrahepatic portacaval the results of laboratory tests were as follows, white blood cells (wbc) count 2.510/l (normal 4 - 1010/l) ; hemoglobin (hb) level 8.4 g / l) ; platelet count 7210/l (normal 150 - 41010/l) ; inr 1.32 (normal 1.0) ; total protein level 78.3 g / l (normal 61 - 79 g / l) ; albumin level 51 g / l (normal 35 - 48 iu / l) ; alanine transaminase level, 10 iu / l (normal 10 - 60 iu / l), and aspartate amino - transferase level, 20 iu / l (normal 10 - 42 she was seen again by her hepatologist to stop the anticoagulant as she was planning to conceive. bone marrow for pancytopenia showed only 35% hypocellularity on trephine biopsy and peripheral blood test for pnh revealed deficient cd55 13.3%, cd59 14.1%. she required occasional blood transfusions after episodes of sever intravascular hemolysis with tea colored urine. a conventional treatment was given over 5 years in the form of anticoagulants, folic acid, oral iron supplements and blood transfusions. the laboratory results shown from 2006 up - to - date are summarized in table 1. in 2010 both her clinical and laboratory status deteriorated with severe pallor, lathery, feeling of sever fatigability shorting of breath on minimal exertion and hemoglobinuria. the eculizumab was commenced on early 2011, where her clinical manifestations improved dramatically over three weeks. although she was on high risk of thrombosis due to the bcs, portal vein stent and in spite of her need to continuous anticoagulant treatment, but she refused to take any anticoagulants since that time. about three weeks after stating eculizumab treatment her general fatigability, shortening of breath and the hemoglobin level are all improved. thrombosis is the main source of morbidity and mortality in pnh ; it occurs mostly in venous system in young patients without underlying atherosclerosis. in pnh the anticoagulants should be commenced quickly after diagnosis to prevent serious thrombosis, but unfortunately prophylactic anticoagulation is often dangerous to patients presenting with very low platelet counts. studies have shown that there is an intrinsic relationship between the complement system and the coagulation cascade that is thought to cause thrombosis in pnh. complement - mediated hemolysis, platelet activation, impairment of the fibrinolytic system, impaired no bioavailability, and inflammatory mediators are all anticipated mechanisms which though to be responsible of increased thrombotic threat in pnh patients. the deficiency of cd59, makes platelets more susceptible to be attacked by complement, due to increased sensitivity to aggregation by thrombin, thrombin generation, and increased thrombotic risk, both in arterial and venous blood vessel. activated platelets interact with neutrophils and could initiate thrombus formation by release of nucleosomes and neutrophil serine proteases, synergistically triggering factor x further and thus activating blood coagulation mainly through the extrinsic pathway. studies highlight decrease in thrombotic episodes after treating pnh patients with eculizumab (monoclonal antibody against the complement system). the antibody binds to the complement protein c5 and blocks its cleavage into c5a and c5b. therefore, treatment with eculizumab prevents c5b formation, which is necessary to form mac through binding to the complement proteins c6, c7, c8, and c9, which lead to thrombotic formation. bcs is common in patients with pnh, and anticoagulation therapy is the first choice for controlling this serious complication the anticoagulants therapy in the presence of low platelets predispose patient to high - risk of severe bleeding. the most adverse events reported for eculizumab treated pnh patients were nasopharyngitis, headache, back pain, and upper respiratory tract infections. eculizumab treatment in this pnh patient showed protective antithrombotic action without the use of anticoagulants for more than four years. this protective measure is extremely valuable especially in thrombocytopenic pnh cases when the use of anticoagulants become seriously hazardous. guidelines are needed after a randomized study to use eculizumab without anticoagulant agents, in order to avoid serious bleeding sequences in sever thrombocytopenic pnh patients. | paroxysmal nocturnal hemoglobinuria (pnh) is an ultra - orphan disease affecting all hematopoietic cell types. the abnormality of red blood cells in this disease predisposes to intravascular complement - mediated hemolysis. eculizumab is an orphan drug used to treat this rare disease. thrombosis is the key cause of death in pnh patients in about 40% to 67% of cases. we report the case of a woman presenting with pnh complicated with serious budd - chiari syndrome thrombosis and with a stent inserted in the portal vein. she refused to take any anticoagulant treatment since she commenced eculizumab 4 years before. no thrombotic events happened since that time. this case could add an extra benefit for eculizumab, which could be used as an anti - thromboembolic prophylactic agent in pnh, especially in patients with thrombocytopenia, where the use of anticoagulant agents is extremely hazardous. more randomized studies might establish the use of eculizumab without anticoagulants to avoid serious bleeding that could happen in thrombocytopenic pnh patients. |
. abundant availability of cellulose makes it an attractive raw material for producing many industrially important commodity products. sadly, much of the cellulosic waste is often disposed of by biomass burning, which is not restricted to developing countries alone, but is considered a global phenomenon. with the help of cellulolytic system, cellulose can be converted to glucose which is a multiutility product, in a much cheaper and biologically favourable process. cellulolysis is basically the biological process controlled and processed by the enzymes of cellulase system. cellulase enzyme system comprises three classes of soluble extracellular enzymes : 1, 4--endoglucanase, 1, 4--exoglucanase, and -glucosidase (-d - glucoside glucohydrolase or cellobiase). endoglucanase is responsible for random cleavage of -1, 4-glycosidic bonds along a cellulose chain. exoglucanase is necessary for cleavage of the nonreducing end of a cellulose chain and splitting of the elementary fibrils from the crystalline cellulose, and -1, 4-glucosidase hydrolyses cellobiose and water - soluble cellodextrin to glucose [1, 2 ]. only the synergy of the above three enzymes makes the complete cellulose hydrolysis to glucose [35 ] or a thorough mineralization to h2o and co2 possible. source for cellulase system extraction is best suitable from microbial system found in the gut of organisms thriving on cellulosic biomasses as their major feed. insects like termites (isopteran), bookworm (lepidoptera), and so forth, are found to have syntrophic symbiotic microflora in their guts responsible for cellulosic feed digestion [6, 7 ]. many microorganisms have been reported with cellulosic activities including many bacterial and fungal strains both aerobic and anaerobic. penicillium, aspergillus, and so forth, are some of the reported fungal species responsible for cellulosic biomass hydrolysation. cellulolytic bacterial species include trichonympha, clostridium, actinomycetes, bacteroides succinogenes, butyrivibrio fibrisolvens, ruminococcus albus, and methanobrevibacter ruminantium [8, 9 ]. cellulase due to its massive applicability has been used in various industrial processes such as biofuels like bioethanol [10, 11 ], triphasic biomethanation ; agricultural and plant waste management [13, 14 ] ; chiral separation and ligand binding studies. the present work concentrates on the isolation of cellulose - degrading bacteria from invertebrates such as termites, snails, caterpillars, and bookworms and assessment of their cellulolytic activity. the coculturing of cellulose - degrading bacteria and yeast was also carried out for simultaneous saccharification and fermentation of cellulose into ethanol. cellulose feeding organisms like termite, caterpillar, bookworm, and snail were collected for isolation of cellulose - degrading bacteria from woody habitats. guts of the collected organism were separately crushed in 0.9% saline solution under sterile condition. the macerated gut of the collected organisms was inoculated in a basal salt media (nano3 2.5 g ; kh2po4 2 g ; mgso4 0.2 g ; nacl 0.2 g ; cacl26h2o 0.1 g in a liter) containing filter paper (whatman filter paper no. 1 of area 70.541 cm) for the isolation of cellulolytic bacteria. these cultures were incubated for 7 days in a shaker incubator at 37c at 100 rpm. bacterial colonies capable of utilizing cellulose as sole source of carbon were isolated on cellulose agar media composed of kh2po4 0.5 g mgso4 0.25 g cellulose 2.0 g agar 15 g gelatin 2 g and distilled water ll and at ph 6.87.2. confirmation of cellulose - degrading ability of bacterial isolates was performed by streaking on the cellulose congo - red agar media with the following composition : kh2po4 0.5 g, mgso4 0.25 g, cellulose 2 g, agar 15 g, congo - red 0.2 g, and gelatin 2 g ; distilled water 1 l and at ph 6.87.2. the use of congo - red as an indicator for cellulose degradation in an agar medium provides the basis for a rapid and sensitive screening test for cellulolytic bacteria. colonies showing discoloration of congo - red were taken as positive cellulose - degrading bacterial colonies, and only these were taken for further study. cellulose - degrading potential of the positive isolates was also qualitatively estimated by calculating hydrolysis capacity (hc), that is, the ratio of diameter of clearing zone and colony. the selected cdb isolates were cultured at 37c at 150 rpm in an enzyme production media composed of kh2po4 0.5 g, mgso4 0.25 g, and gelatin 2 g, distilled water 1 l and containing whatman filter paper no.1 (1 6 cm strip, 0.05 g per 20 ml) and at ph 6.87.2. broth culture after three days of incubation period was subjected to centrifugation at 5000 rpm for 15 min at 4c. supernatant was collected and stored as crude enzyme preparation at 4c for further enzyme assays. pellet recovered after centrifugation of broth culture was subjected to gravimetric analysis in order to determine the residual cellulose of filter paper. total cellulose activity was determined by measuring the amount of reducing sugar formed from filter paper. endoglucanase (1 - 4 endoglucanase - ec 3.2.1.4) activity was assayed by measuring the amount of reducing sugar from amorphous cellulose. the enzyme activity was determined according to the methods recommended by the international union of pure and applied chemistry (iupac) commission on biotechnology. endoglucanase activity was determined by incubating 0.5 ml of supernatant with 0.5 ml of 2% amorphous cellulose in 0.05 m sodium citrate buffer (ph 4.8) at 50 for 30 min. fpc activity was determined by incubating 0.5 ml of supernatant with 1.0 ml of 0.05 m sodium citrate buffer (ph4.8) containing whatman no.1 filter paper strip1.0 6.0 cm (= 50 mg). after incubation for an hour at 50c, the reaction was terminated by adding 3 ml of 3, 5-dinitrosalicylic acid (dns) reagent to 1 ml of reaction mixture. in these tests, reducing sugars were estimated spectrophotometrically with 3, 5-dinitrosalicylic acid using glucose as standards. the enzymatic activity of total fpcase and endoglucanase were defined in international units (iu). one unit of enzymatic activity is defined as the amount of enzyme that releases 1 mol reducing sugars (measured as glucose) per ml per minute. a total of four isolates cdb 2, 7, 8, and 10 were grown in mixed culture using basal salt medium in two different sets, one containing filter paper and the other containing cellulose powder as substrate for production of cellulolytic enzyme and to initiate saccharification process. after completion of three days of incubation, the above culture broth was conditioned for coculturing of saccharomyces cerevisae by addition of filter - sterilized salt solution (kh2po4 0.4 g, mgso4 0.02 g, caco3 0.05 g, and nacl 0.01 g to 1 l culture broth). the simultaneous saccharification and fermentation was carried out at 27c for 5 days in stationary condition. at the end of incubation, cellulose degrading bacteria were enriched and isolated by inoculating filter paper in liquid medium with macerated guts from termite, bookworm, snail, and caterpillar separately. all bacterial culture showed growth as the medium turned cloudy and the filter paper became macerated. cellulolytic bacteria were also isolated from gut of insects by r. j. dillon and v. m. dillon., wenzel., delalibera., and ramrn.. a total of eight bacterial isolates found to be positive on screening media (cellulose congo - red agar) producing clear zone (as shown in figure 1) during aerobic incubation were as follows : cdb 1, 2, 8, and 9 from termite, cdb 6 and 10 from snail, cdb 3 from bookworm, and cdb 7 from caterpillar. the result showed that clearing zone and hc value ranged to bebetween 28.0 to 50.0 mm and 4.3 to 9.0 for all isolates (table 1). the range of hc value obtained is similar to range reported by lu. whereas hatami. found the hydrolytic value between 1.38 to 2.33 and 0.15 to 1.37 of cellulolytic aerobic bacterial isolates from farming and forest soil, respectively. a total of eight positive isolates (cdb1, 2, 3, 6, 7, 8, 9, and 10) were selected for enzyme production and their respective cellulolytic activity was estimated. enzyme assay for cellulase activity on filter paper was found to be highest for cdb 10 with 0.194 iu / ml, while for endoglucanase assay maximum activity was determined to be 0.400 iu / ml by cdb 8. the activities ranged from 0.012 to 0.196 iu / ml for fpcase and 0.1622 to 0.400 iu / ml for endoglucanase assay. the two isolates cdb8 and cdb10 exhibited the highest extracellular cellulase activities compared to other isolates as shown in activity assay performed for all isolates in figure 2. grown in a basic salt medium with glucose and cmc as sole carbon source separately. the maximum enzyme activities of a. anitratus culture supernatant were 0.48 and 0.24 u / ml for cmc and glucose, respectively. for branhamella sp., the maximum enzyme activities of the culture supernatant were 2.56 and 0.34 u / ml for cmc and glucose, respectively. the filter paper degradation was observed separately in cdb 2, 3, 6, 7, 8, 9, and 10 as shown in figure 3. gravimetric analysis shows that maximum and minimum rates of filter paper degradation were 65.7% and 55%, respectively, estimated at third day of incubation. figure 4 shows that cdb 8 has highest filter paper degradation rate of 65.7%. in a result documented by lu., the data for synergetic cellulose degradation detected in four groups of mixed cultures were only 23.5%, 26.3%, 19.4%, and 24.5%, respectively. reported the rates of paper degradation ranged from 31 to 60% after 10 days for mixed bacterial populations by gravimetric procedure. the experiment setup for simultaneous saccharification and fermentation of mixed bacterial culture (cdb, 2, 7, 8, and 10) with saccharomyces cerevisiae resulted in production of ethanol. this result expressed the high cellulolytic potential of these selected bacterial isolates for decomposition of cellulose and its fermentation for production of ethanol. also used whatman filter paper and cellulose powder as substrate in submerged fermentation for production of cellulolytic enzymes by bacillus sp. simultaneous saccharification and fermentation of ethanol were reported by several workers (lenziou. and eklund and zacchi). results indicated that significant synergistic cellulose degradation can be achieved in mixed culture system of cellulolytic bacteria and noncellulolytic yeast in which noncellulolytic yeast, saccharomyces cerevisiae utilizes the reducing sugar derived from cellulose degradation and converts it to ethanol. the bacterial isolates showed a potential to convert cellulose into reducing sugars which could be readily used in many applications like feed stock for production of valuable organic compounds ; for example in the present study this has been demonstrated by simultaneous saccharification and fermentation of cellulose into ethanol. | eight isolates of cellulose - degrading bacteria (cdb) were isolated from four different invertebrates (termite, snail, caterpillar, and bookworm) by enriching the basal culture medium with filter paper as substrate for cellulose degradation. to indicate the cellulase activity of the organisms, diameter of clear zone around the colony and hydrolytic value on cellulose congo red agar media were measured. cdb 8 and cdb 10 exhibited the maximum zone of clearance around the colony with diameter of 45 and 50 mm and with the hydrolytic value of 9 and 9.8, respectively. the enzyme assays for two enzymes, filter paper cellulase (fpc), and cellulase (endoglucanase), were examined by methods recommended by the international union of pure and applied chemistry (iupac). the extracellular cellulase activities ranged from 0.012 to 0.196 iu / ml for fpc and 0.162 to 0.400 iu / ml for endoglucanase assay. all the cultures were also further tested for their capacity to degrade filter paper by gravimetric method. the maximum filter paper degradation percentage was estimated to be 65.7 for cdb 8. selected bacterial isolates cdb 2, 7, 8, and 10 were co - cultured with saccharomyces cerevisiae for simultaneous saccharification and fermentation. ethanol production was positively tested after five days of incubation with acidified potassium dichromate. |
copper chloride (cucl, anhydrous, 99.99%), copper(ii) acetate monohydrate (c4h6cuo4h2o, 99.99% trace metals basis), cadmium iodide (cdi2, 99.990%), mercury bromide (hgbr2, 99.9%), oleylamine (om, > 70%), and octadecene (ode, 90%) were purchased from sigma - aldrich. elemental sulfur (99%) was obtained from strem chemicals, and methanol (anhydrous, 99.9%) and toluene (anhydrous, 99.8%) were from carlo erba reagents. briefly, a sulfur solution was prepared first by degassing a mixture of 0.160 g (5 mmol) of sulfur, 25 ml of ode, and 25 ml of om in a 100-ml three - neck flask at 130 c under vacuum for 30 min. the as - formed clear yellow solution was cooled to room temperature (rt) under n2 atmosphere, followed by addition of 0.248 g (2.5 mmol) of cucl and degassing at rt for an additional 60 min. the as - obtained dark green solution was then heated to 200 c with a ramp of 8 c / min, and it was then kept at this temperature for an additional 30 min, after which it was cooled to rt. to precipitate the ncs, methanol was added, and followed by centrifugation. all these reactions were performed at rt in a n2-filled glovebox. as a typical example of a reaction of cus with cd, and cd and ascorbic acid, 0.1 m solutions were prepared by respectively dissolving cdi2 (0.0146 g) and ascorbic acid (0.0352 g) in methanol (0.4 ml for cdi2 and 2 ml for ascorbic acid) at rt. then, 0.4 ml of cd solution and 2 ml of ascorbic acid solution were added in a vial containing 4.0 ml of covellite nc dispersion (0.01 m in cu ions, in toluene) under magnetic stirring. aliquots (1.5 ml) of the nc solution were collected at different reaction times to monitor the evolution of morphologies, optical spectra, and compositions. the aliquots and the final sample collected after 24 h were precipitated by addition of 1.5 ml of methanol followed by centrifugation at 3000 rpm for 20 min. for all aliquots, the supernatant was then carefully collected for inductively coupled plasma optical emission spectroscopy (icp oes) measurements, while the precipitate was dispersed in toluene for one additional cleaning cycle. the final precipitate was redispersed in toluene (0.5 ml) for subsequent characterization. the reactions with hg cations followed a similar procedure. the molar ratio of the guest cations (cd and hg) introduced in the reaction environment over the cu cations (from covellite cus), that is, the feed ratio, was equal to 1:1 in all the reactions, except for the cases in which a large excess of guest cations was probed. low - resolution tem measurements were carried out on a jeol jem-1011 microscope operating at 100 kv. the samples were prepared by drop - casting ncs solutions on carbon - coated 200-mesh copper grids. high - resolution tem (hrtem) images were acquired on a jeol jem-2200fs microscope equipped with a schottky gun working at 200 kv, a ceos spherical aberration corrector in the objective lens allowing for a spatial resolution < 1, and an in - column energy filter. the chemical composition of the ncs was determined by energy dispersive x - ray spectroscopy (eds) performed in scanning mode (stem) and by acquiring the spectra on a bruker quantax 400 system with a 60-mm xflash 6 t silicon drift detector (sdd). the quantification of the elements in the spectra was performed with the cliff lorimer method. for hrtem and stem - eds analyses the samples were prepared by drop - casting nc solutions onto ultrathin carbon - coated 300-mesh gold grids and inserted with a beryllium cup holder to avoid spurious copper signal. xrd analysis was performed on a panalytical empyrean x - ray diffractometer equipped with a 1.8 kw cu k ceramic x - ray tube and pixcel 2 2 area detector, and operating at 45 kv and 40 ma. the diffraction patterns were collected in air at room temperature using parallel - beam (pb) geometry and symmetric reflection mode. xrd data analysis was carried out using highscore 4.1 software from panalytical. oes was performed on an icap 6000 spectrometer (thermoscientific) for quantification of elemental composition of nc samples and of the supernatant solutions. the samples were decomposed in aqua regia (hcl / hno3 equal to 3:1 (v / v)) overnight prior to icp oes measurements. the samples were prepared in the glovebox by drop - casting a few microliters of nc solutions onto a graphite substrate (hopg, zyb quality, ntmdt), which was then transferred to the xps setup in an ad hoc transfer vessel to avoid air exposure. measurements were performed on a kratos axis ultra dld spectrometer, using a monochromatic al k source (15 kv, 20 ma). high - resolution narrow scans were performed at constant pass energy of 10 ev and steps of 0.1 ev. photoelectrons were detected at a takeoff angle of = 0 with respect to the surface normal. the pressure in the analysis chamber was maintained below 7 10 torr for data acquisition. the binding energy scale was internally referenced to the c 1s peak (be for c data were acquired at = 632.8 nm with a 50 objective using a nominal power of 25 mw and integration time of 120 s. uv vis - nir extinction spectra on the nc solutions were performed on a varian cary 5000 uv vis - nir spectrophotometer in the 3502000 nm range. the covellite structure is peculiar, since it is formed by a repetition, along the c axis, of a trilayer motif made of a layer of triangular cus3 units between two layers of cus4 tetrahedra. there is an equivalent structure for cuse, named klockmannite. on the other hand, no other metal ions are known to crystallize with sulfur (or with selenium) in the same structure, or in any structure that resembles covellite. in a previous work of ours, we evidenced how covellite ncs could easily incorporate cu cations, at room temperature, up to a stoichiometry around cu2s. during this incorporation, despite that some xrd reflections of covellite were maintained (albeit with a shift to lower angles), the overall structure underwent partial amorphization. we also demonstrated that the insertion of cu ions was charge - compensated by the acquisition of an equimolar amount of electrons, made possible by the oxidation of a fraction of cu ions remaining in the solution phase to cu. a logical extension of those findings was then to explore whether a similar reaction scheme could work with other metal ions too, and, if so, under what conditions such ions could react with covellite ncs and what would be the products of the reaction. for hg and cd cations studied here, the mechanism operative for the cu insertion case discussed above (part of cu ions in solution is oxidized to cu and provides electrons to charge - balance the entry of cu ions in the ncs) can not work (hg and cd are already at their highest oxidation state). this left room to other various possibilities : (i) the guest ions may be capable of replacing the cu ions in the covellite lattice, as in a standard ce reaction, but then the anion framework would have to reorganize considerably ; (ii) incorporation of the ions in the ncs would be feasible, provided it could be supported by a source of electrons in the reaction environment ; or (iii) a combinations of the two former mechanisms could be operative, for example there could be both incorporation and ce. our experiments, reported here, supported a combination of the two mechanisms. first, for both cations tested, when the reactions were performed in the absence of ascorbic acid, limited reactivity was found (we recall that the molar ratio of the guest cations (cd or hg) to cu ions from covellite cus, in all the reactions discussed in this work was 1:1, unless otherwise stated). table 1, second column, lists the m : cu ratios (m = cd, hg) in the cus ncs as found by elemental analysis (according to icp oes) on the samples purified after 24 h of reaction. in all samples, the fraction of cations incorporated in the cus ncs was low, around 5% for hg and 1% for cd. because of such low amount of cations incorporated, chemical quantification by icp oes analysis on a bulk sample of ncs was preferred to eds analysis, which is instead a local analysis and is performed on groups of ncs in the electron microscope. the limited reactivity of covellite ncs in the absence of ascorbic acid could be evidenced by the little change in the xrd patterns (which can still be indexed as covellite, see figure 1a), morphology (figure s1), and high - resolution xps (s 2p) (figure s6b, c) of ncs collected after 24 h of reaction with cd and hg cations without ascorbic acid. xrd patterns (a) and optical spectra (b) of as - synthesized covellite (cus) ncs, and ncs collected after mixing cus with cd (red) and hg (blue) for 24 h, in the absence of ascorbic acid. despite the low degree of incorporation of cations (which perhaps in some cases was just a surface adsorption phenomenon), damping and red - shift of the nir absorption band (the latter due to a localized surface plasmon resonance, lspr) was seen in the optical absorption spectra of the solutions of ncs at 24 h, with varying degree from cation to cation (figure 1b). this indicates that the nir lspr of covellite ncs is strongly sensitive to various environmental factors. similarly, djurleite (cu1.94s) ncs (composition close to cu2s) exhibited limited reactivity with cd and hg cations in the absence of reducing agent (figure s4a, table s2), except that their weak nir plasmon absorbance (due to the presence of cu vacancies) was further damped and red - shifted upon mixing the ncs with cations (figure s4b). for reactions of covellite (cus) carried out in the presence of ascorbic acid, however, much higher m : cu ratios (m = cd, hg) were found in the ncs (see table 1, third column and table s1, the latter reporting also the compositions as found by eds analysis). in contrast, the reactivity of djurleite (cu1.94s) ncs was not significantly increased by the presence of ascorbic acid for both cations (figure s4c and table s2), although the formation of additional hg2br2, in the hg case, complicated the xrd analysis : only 7% of hg and 0.3% of cd were detected in the resulting ncs after 24 h (table s2). the higher reactivity of the covellite ncs was also confirmed by xps analysis of the purified ncs (figure s6d, e). here, the spectral features in the s 2p region, which allows discrimination between sulfides and disulfides, were clearly supporting the almost complete absence of signal from disulfides in the final ncs, which are instead present in the initial covellite ncs due to the s s bonds were broken in the reacted ncs, we expect a significant reorganization of the crystal lattice for the reactions tested. the discussion that follows examines in detail the individual cation cases and reports, unless otherwise stated, the results of reactions on covellite ncs performed in the presence of ascorbic acid. tem images of the as - synthesized covellite cus ncs (a) and cd - incorporated ncs achieved by reacting covellite ncs with cd cations in the presence of ascorbic acid for 24 h (b). xrd patterns (c), raman spectra (d), and optical spectra (e) of samples shown in a and b. (f) hrtem image and (g) corresponding fft of a representative single cds / cu2xs nanoparticle collected at 4 h by reacting the as - synthesized covellite cus ncs with cd cations in the presence of ascorbic acid. (k m) fft of the single nps shown in h. (n) schematic illustration of the reaction of cus ncs with cd cations in the presence of ascorbic acid. panels a and b of figure 2 compare low - magnification tem images of the initial cus sample and of the same sample after 24 h incubation in a mixture of cd ions and ascorbic acid. the overall size and shape of the initial sample (and their relative distributions) were essentially preserved. size - distribution histograms of the initial and the final ncs, as well as tem images of initial and intermediate samples, are shown in figures s5a, b and s7a e, respectively. experimental xrd patterns of aliquots taken at 1, 2, 4, and 24 h evidenced the emergence of peaks belonging to the cds phase (figure s7f). the xrd pattern of the sample at 24 h, reported in figure 2c (top, to be compared to the pattern of the initial covellite nc, shown in c, bottom), carried strong signatures of cds, while the assignment of the remaining peaks was less straightforward. hrtem and eds analyses of the 4-h (intermediate) and 24-h samples revealed a mixture of nc structures. the predominant types of particles were heterostructures composed of domains that could be indexed as cds and cu2xs (0 < x < 1), respectively (figure 2f, g). in addition, there were entirely exchanged ncs, i.e. cds nanoplatelets, and platelets with phases possibly matching various cu2xs bulk phases, but which, according to eds analysis, contained a fraction of cd too (figure 2h m). in the 24-h sample an increasing degree of incorporation of cd was found in the ncs over reaction time, from 5% (with respect to cu) at 1 h, to 22% at 24 h, as evidenced by the icp analyses (see table 1 and table s1). we can hypothesize that the incorporation of cd ions in the covellite ncs, aided by the overall reducing environment, can locally initiate ce, with reorganization of the anion (sulfur) framework and the consequent formation of cds domains, a process that eventually can spread to the whole nc. the cu ions that are released from the cds - exchanged domains can diffuse to the not exchanged domains within the same nc. cu2xs heterostructures, such as the one displayed in figure 2f. on the other hand, the presence of cu2xs platelets can be rationalized by the incorporation of cu ions that had been previously released from the exchanged ncs to the solution phase. this is similar to what was found previously by us when treating covellite ncs with cu ions. these hypotheses were additionally backed by the experimental evidence that elemental analysis (by icp-oes) of the solution phase revealed no appreciable cu in the supernatant after ncs precipitated from the solution : therefore, even if cu ions were released in solution, they were unstable there and tended to react with the cus ncs / domains. partial support to the cus cu2xs transformation came also from the red - shift and strong damping of the nir absorbance as the reaction proceeded (figure 2e, see also figure s7h). this is in line with our previous work on the evolution of cus ncs to cu2xs, and is due to the decrease in the density of free carriers in the ncs that accompanies such transformation. (a) tem image of ncs collected at 24 h by reacting the covellite cus ncs with hg cations in the presence of ascorbic acid. (xrd patterns (b), raman spectra (c), and optical spectra (d) of as - synthesized covellite cus ncs and hg - incorporated samples shown in a. (e) hrtem image and (f) fft of a representative single hgs / cu2-xs nanoparticle collected at 4 h by reacting the as - synthesized covellite cus ncs with hg cations in the presence of ascorbic acid. (g, h) hrtem images of individual ncs collected at 24 h. (i, j) corresponding fft of the single ncs shown in h and g, respectively. (k) schematic illustration of the reaction of cus ncs with hg cations in the presence of ascorbic acid. the raman spectrum of the pristine cus ncs exhibited vibration modes at 472 and 266 cm (see also figure s7 g), which are in good agreement with the raman spectra of cus reported by ishii. and peiris. s vibrational mode, while the intensity of the initially intense peak at 472 cm, attributed to a s s stretching mode, decreased (relative to the peak at around 266 cm) as the stoichiometry evolved from cus to cu2xs (0 < x < 1). a broad peak around 300330 cm might be due to the silicon substrate, as its contribution was seen in all the samples analyzed (see figure s11 for the raman spectrum from the substrate only). after 24 h reaction with cd, a broad feature ranging from 220 to 350 cm emerged, which might be due to the overlapping modes of cu s and cd s (the longitudinal optical phonon mode of cds peaks at around 300 cm). in comparison, the initial raman peak at around 472 cm had lost considerable intensity, an indication that part of the copper sulfide phase was transformed to cds and most likely the remaining part had evolved to a copper sulfide phase richer in cu than the initial covellite ncs. we also carried out reactions using a large excess of cd ions (with a cd : cu feed ratio of 10:1). these experiments produced a sample in which the cd : cu : s ratios in the ncs were 0.39:1.1:1, that is, no complete cation exchange could be achieved (see figure s9c, d). this makes sense, if one considers that the concomitant introduction of cd ions and of electrons (provided by ascorbic acid) in the ncs can proceed as long as there are s s bonds that can be reduced. the s atoms involved in this bond type represent 66% of the overall number s atoms in covellite, and the rupture of each bond operated by two electrons permits the entry of one cd ion. therefore, the theoretical limit of incorporation of cd atoms would correspond to 33% of the total number of s and cu atoms in covellite, which is very close to the ratio found experimentally. clearly, in this case too, the incorporated cd ions trigger cation exchange reactions, with release of cu ions that could diffuse then to the not exchanged domains / ncs. it is noteworthy that even when working with such high cd : cu feed ratios (10:1) no cu could be detected in solution (that is, all cu ions stayed or were reinserted in the ncs). the reactivity of cus ncs toward hg cations in the absence of ascorbic acid was limited, although the incorporation of hg after 24 h could reach 5% (table 1), higher than that of cd. on the other hand, in analogy with the case of reaction with cd cations discussed earlier, a more pronounced reactivity with hg was seen in the presence of ascorbic acid. here again, both size and shape of the ncs were basically preserved (see figure 3a, figure s8a d, and s5c portraying additional images of intermediate samples and the size distribution histogram of the 24 h sample). however, the xrd pattern of the sample after 24 h reaction time (figure 3b), and those of the intermediate samples (see figure s8e), evidenced the formation of the hgs phase over time.. these peaks could be due to a mixture of cu2xs phases (0 < x < 1), although the diffraction peaks from hgs became predominant over time. in analogy with the reactions involving cd ions, negligible amounts of cu species were released to the solution, as revealed by elemental analysis (by icp oes), and can be interpreted along the same lines as for the reactions with cd. the incorporated amount of hg was higher here than for the cd case : it ranged from around 10% (relative to cu) at 1 h, to 20% at 24 h (see table 1 and table s1, the latter reporting also compositions as found by eds analysis). the phase transformation from covellite to cu2xs (0 < x < 1) and hgs was concomitantly accompanied by a marked red - shift and strong damping of nir absorption (figure 3d and figure s8f). according to hrtem and eds analysis, the sample was composed of a mixture of hgs / cu2xs heterostructures, often containing more than one hgs domain per nc (figure 3e, f) and fully exchanged hgs ncs, as well as cu2xs ncs (figure 3g j), the latter particles this time containing only a minor fraction of hg. the raman spectra of the 24-h sample was in line with the results discussed for the cd reaction, that is, with the most notable and interpretable change being the damping of the strong peak initially at 472 cm (figure 3c). overall, the reaction scheme (figure 3k) was therefore not much different from that involving the cd ions (figure 2n). in the reaction with excess hg cations (with a starting hg : cu feed ratio equal to 10:1), the final hg : cu : s molar ratios, as measured by icp, were around 0.6:1.1:1. the hg : cu ratio (0.6:1.1 = 0.55:1) was higher than the theoretical limit set by the fact that the hg incorporation should stop when all s s bonds are broken (0.33, see the cd case discussed earlier). this apparent inconsistency was clarified by xrd analysis (see figure s9c), according to which this sample contained an important contribution from a cuhgsbr phase. this is interesting, since this compound is usually synthesized by reacting hgs with cubr, while here it was formed by reacting cus with hgbr. this compound is, however, unstable under the electron beam, as by hrtem we could only unequivocally identify hgs, chalcocite, and covellite - like cu2xs ncs (figure s10). we have studied the incorporation of heavy metal cd and hg cations in covellite (cus) ncs at room temperature, in the presence of a mild reducing agent such as ascorbic acid. the incorporation of guest metal cations is promoted by the breaking of the s s bonds, operated by the reducing agent. a negligible fraction of cu species could be detected in the solution phase, due to the recapture of released cu by the not exchanged cus domains or by the remaining cus ncs, upon the incorporation of cd and hg cations. this is much different from the previously reported ce studies on various other copper chalcogenide ncs. this notable feature and the mechanism proposed in this study extend the knowledge on nanoscale chemical transformations. | we studied the structural and compositional transformations of colloidal covellite (cus) nanocrystals (and of djurleite (cu1.94s) nanocrystals as a control) when exposed to divalent cations, as cd2 + and hg2 +, at room temperature in organic solvents. all the experiments were run in the absence of phosphines, which are a necessary ingredient for cation exchange reactions involving copper chalcogenides, as they strongly bind to the expelled cu+ ions. under these experimental conditions, no remarkable reactivity was indeed seen for both cus and cu1.94s nanocrystals. on the other hand, in the covellite structure 2/3 of sulfur atoms form covalent s s bonds. this peculiarity suggests that the combined presence of electron donors and of foreign metal cations can trigger the entry of both electrons and cations in the covellite lattice, causing reorganization of the anion framework due to the rupture of the s s bonds. in cu1.94s, which lacks s s bonds, this mechanism should not be accessible. this hypothesis was proven by the experimental evidence that adding ascorbic acid increased the fraction of metal ions incorporated in the covellite nanocrystals, while it had no noticeable effect on the cu1.94s ones. once inside the covellite particles, cd2 + and hg2 + cations engaged in exchange reactions, pushing the expelled cu+ ions toward the not - yet exchanged regions in the same particles, or out to the solution, from where they could be recaptured by other covellite nanoparticles / domains. because no good solvating agent for cu ions was present in solution, they essentially remained in the nanocrystals. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.