text
stringlengths 198
630k
| id
stringlengths 47
47
| metadata
dict |
|---|---|---|
The present is an accumulative total of the past. So, if you want to really know about the present of a country, you need to delve deep into its age-long history.
Soekarno, the founding father of Indonesia, said,
A great nation is the nation that doesn’t forget its history
And learning about its past capitals – the central locations for the country’s politics and culture – will be a very helpful and significant approach.
The cities of Gyeongju, Gongju, Buyeo and Iksan were designated as the ancient capitals of Korea in accordance with the Special Act on the Preservation of Ancient Capitals decree enacted in March 2005.
For a city to become a capital, it must be some place that is well-suited for residence; a strategic location against foreign invasions; and an all-around convenient spot for overseeing the country. That’s why capitals are usually located near a big river, surrounded by mountains, and furnished with a broad expanse of fertile planes.
Gyeongju, Gongju, Buyeo and Iksan
<Jeonglim Saji 5 Floor Tower in Buyeo>
The Baekje Kingdom (18 BCE – 660 CE), one of the Three Kingdoms of Korea, together with Goguryeo and Silla, controlled some colonies in China and most of the western Korean Peninsula at its peak in the 4th century and was a significant regional sea power.
In the 5th century, Baekje retreated under the southward military threat of Goguryeo, and in 475 its capital moved to Ungjin (present-day Gongju). Gongju is home to numerous historic sites including Gongsanseong Fortress, Magoksa Five-story Stone Pagoda, and Seokjang-ri Old Stone Age Ruins.
In 538, King Seong moved the capital to Sabi (present-day Buyeo County), home to significant relics such as the five-storied stone pagoda of Jeongnimsa Temple site and Banwollu Tower.
<Seokguram Grotto in Gyeongju, a UNESCO World Heritage>
Gyeongju was the capital of the ancient kingdom of Silla (57 BC-935 AD) which ruled most of the Korean Peninsula between the 7th and 9th centuries. A vast number of archaeological sites and cultural properties from this period remain in the city. Among such historical treasures, Seokguram grotto, Bulguksa temple, Gyeongju Historic Areas and Yangdong Folk Village are designated as World Heritage Sites by UNESCO. The many major historical sites have helped Gyeongju to become one of the most popular tourist destinations in South Korea.
A Map of Korea’s Ancient Capitals
The Cultural Heritage Administration recently published a map of Korea’s ancient capitals in English as a tourist guide to important historical sites in Korea.
The “Ancient Capitals Tour” map is designed to be easy to carry and use. The map provides information on the history, geography, folklore, and contemporary situation of the four ancient capitals in South Korea: Gyeongju, Gongju, Buyeo and Iksan.
<Ancient Capitals Tour Map in English>
The map also provides useful tourist information, including guides to accommodations and public transportation. Maps will be distributed free of charge at cultural centers and tourism agencies.
Last weekend, we visited the Deoksu Palace at the heart of Seoul city. http://wn.com/Deoksu_PalaceIt was in rehab, so not so much we could see.. here are a bit of its pictures.. with the borrowed camera.. ㅋㅋㅋ.. | <urn:uuid:aecad713-4376-4ecc-99bf-0290bceb72ca> | {
"date": "2018-05-25T14:27:30",
"dump": "CC-MAIN-2018-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867094.5/warc/CC-MAIN-20180525141236-20180525161236-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9364122152328491,
"score": 3.234375,
"token_count": 771,
"url": "https://havban.wordpress.com/2011/01/04/wsk-korea%E2%80%99s-ancient-capitals/"
} |
On a lonely road, quite long ago, A traveler trod with a fiddle and a bow. While rambling through the country, rich and grand, He quickly saw the magic and the beauty of the land. For the wonder state we'll sing our song, And raise our voices loud and strong. For the woner state we'll shout, "Hoo-rah", And praise the opportunities we find in Arkansas.
Featured Composer of the Week:
JOHANN STRAUSS, JR. 1825 - 1899 Austria
Genre: Waltz Music
Listening Example: "The Beautiful Blue Danube" Waltz
The Danube River flowing through Vienna, Austria
Through the years, we’ve had many musical “kings”. There’s been Scott Joplin, the king of ragtime; John Philip Sousa, the march king; Elvis, the king of rock and roll; and Michael Jackson, the king of pop.
We have also had “The Waltz King”. Johann Strauss, Jr. was an Austrian composer of light dance music who helped make the waltz popular. He wrote over 500 waltzes and other types of dance music during the 19th century.
The "Waltz King"
The waltz is a ballroom dance in ¾ time. This means there are three beats in each measure. The waltz was the first ballroom dance performed in the “closed hold”, where the male partner holds the female dancer with his arm around her back and her hand on his shoulder. Like many new dances that come out, the waltz was considered a little ‘racy’ back then. To be considered proper, couples had to dance a certain distance apart from each other.
Strauss’s most popular and well-known waltz is The Blue Danube, named after the river that begins in Germany, flows through eastern Europe, and empties into the Black Sea.
Those of us with any knowledge of classical music should be able to recognize The Blue Danube, which is our listening example for today. Written in 1866, it was performed in 1867 at the Paris World’s Fair, where it became a big success. It is performed in our video by the Johann Strauss, Jr. orchestra.
Like other musicians of the 19th century, Johann Strauss, Jr. did not have his father’s support in his desire to become a musician. His father, who was a composer and orchestra leader, wanted his son to become a banker instead. It wasn’t that he was afraid of competition—he just didn’t want his son to endure the struggles that musicians often face. Nevertheless, as a child, Strauss Junior secretly studied the violin with a violinist of his father’s orchestra. When his father discovered his son secretly practicing one day, he gave the boy a paddling to discourage him. But with the support of his mother, Strauss, Jr. was eventually able to pursue his career as a composer. He made his musical debut at age 19, when his waltz music was praised by the press and music critics.
Strauss was born near Vienna, Austria and spent much of his adult life there. Vienna was an important city for musicians and other artists in the mid-1800’s. The Danube River flows through Vienna. Strauss helped to make the Viennese Waltz popular throughout Europe. Today, there are still important balls held in Vienna when the Viennese Waltz is danced.
The Vienna Opera Ball
The Viennese Waltz is a rotary dance where the dancers are constantly turning either toward the leader’s right, called natural, or toward the leader’s left, called reverse. The direction of rotation occasionally switches with non-rotating steps called ‘change’ steps. The gentleman guides the lady through these changes. A true Viennese waltz consists only of turns and change steps. Furthermore, in a properly danced Viennese Waltz, couples do not pass each other, but follow each other, turning continuously left and right while traveling counterclockwise around the floor.
LISTEN FOR . . . In order to remember music, sometime we must hear it several times. So today we will listen again to the main theme of The Blue Danube and watch dancers moving on the floor. Waltzes have long introductions lasting about 1-1/2 to 2 minutes. This allows the gentlemen time to find their partners and move into position on the dancefloor. The music is written to indicate when the dancing should begin. Waltzes also have contrasting sections to add variety to the music. Our video starts at the end of the introduction.
MUSIC LISTENING LINKS
The introduction lasts about 1:45 minutes. Towards the end the dancers take the floor. They've added a few fancy moves to their turns and then dance in a ballet fashion. Can you hear a different section of music that you like best?
Below is a medley (grouping) of Strauss waltz themes with their titles. Duration 7:00 minutes.
Listening Example: "Wine, Women and Song"
While Strauss’s career was defined by his Blue Danube Waltz, he wrote many other memorable waltzes such as The Emperor’s Waltz, Roses of the South; Wine, Women and Song; and Tales from the Vienna Woods.
During the 1860’s, his orchestra toured throughout Austria-Hungary, Germany, Poland, Russia and England. These international tours gave Strauss a lot of publicity and made him even more famous and popular with his fans. They also made the Viennese Waltz more popular.
Strauss soon enlisted the help of his brothers, Joseph and Eduard. They were also composers, but not as well-known as their brother. Joseph and Eduard conducted the orchestra performances so that Johann could spend more time in Vienna composing new music.
Waltz music is happy music that can make a person want to sway back and forth to the rhythm. If you feel like dancing it, you must be quick with your feet to follow the beat. The feet must constantly alternate steps: right-left-right, left-right-left, without any pauses in between.
1 - 2 - 3 - 1 - 2 - 3
right - left - right - left - right - left
LISTEN FOR . . . The “Wine, Women and Song” waltz is named after an old saying: “Who loves not wine, women and song, remains a fool his whole life long”. It combines calm, tranquil melodies and superb orchestration. The short, staccato notes help the music feel quick and light, which is what the waltzer must be.
MUSIC LISTENING LINKS
The video shows scenery from Austria. Duration 4 minutes.
Supplemental Listening “Tales from the Vienna Woods”, composed in 1868, is one of six waltzes by Strauss which featured a virtuoso part for zither, a stringed folk instrument. The waltz’s premiere that year reflected the growth the dance had made from its humble village origins to become one of the dances of fashionable Viennese society. The title recalls the folk music of the inhabitants of the Vienna Woods. Duration 10:00 minutes.
In 1872, Strauss and his orchestra toured the United States, gaining more popularity and fans. He was invited to Boston, MS, where he was the lead conductor of the World Peace Jubilee and International Music Festival. The jubilee was held to celebrate the end of the Franco-Prussian war between France, Germany and Prussia. This “monster concert” lasted 18 days and featured over 1000 performers. Strauss conducted a variety of performances there, including his Blue Danube waltz.
Austria experienced times of war and revolution, and as a young man, Strauss took interest in his country’s political movements. In 1889, he composed the Kaiser Waltz, or Emperor Waltz. Kaiser is the German word for emperor or ruler.
The Emperor Waltz was written when the Austrian emperor Franz Josef visited the German Kaiser Wilhelm II.
Strauss composed the music as a ‘toast of friendship’ extended by Austria to Germany. Strauss’ music publisher suggested the title Kaiser Waltz, since the title could refer to either monarch, and thus satisfy the vanity of both rulers.
'Toast of Friendship' between Austria and Germany
Since Strauss was Austrian, the cover for the original piano music bore the illustration of the Austrian Imperial Crown. It is an interesting fact that in the early 1900’s, the German Nazis ignored the fact that the Strauss family was of Jewish heritage. They thought his music sounded ‘so German’ that it should still be performed.
Austrian Imperial Crown
LISTEN FOR . . . The Emperor Waltz begins with a long introduction in a march style, suggesting the military aspect of the two countries. The waltz theme uses a rhythm technique that Chopin used--rubato. Rubato is where the tempo, or speed of the beat, gently pushes ahead, then relaxes. There are also dramatic changes in the dynamics—soft areas get suddenly loud. Instead of orchestral music, our video below is a piano duet. The music begins just as the march has ended and the Emperor Waltz theme begins. [1:49 – 3:13]
Click below to an orchestral version of Emperor Waltz with scenes of Vienna. Duration 10:45 minutes.
Click below to hear the entire Emperor Waltz as a piano duet. Duration 10:30 minutes.
Listening Example: Die Fledermaus Waltz
from the Operetta
Johann Strauss, Jr. Gala
Johann Strauss, Jr. is still honored every year. For over forty years, the Johann Strauss, Jr. Gala has entertained audiences with music, dancing and comedy. Dancers and orchestra dress in exquisite costumes of the period to provide romantic waltzes and lively polka dances.
For fifty years, the Vienna Philharmonic Orchestra has presented a New Year’s Day concert full of Strauss music. It is broadcast in over 80 countries.
Vienna Philharmonic Orchestra New Year's Day Concert
In addition to dances, Strauss also wrote operettas. These are light, comic operas which contained waltzes. When performed in the United States, operettas are sung in English so folks can understand them. When Mrs. Philpot taught at ASU, she played the piano accompaniment for several operettas, including Strauss’ most popular one, Die [dee] Fledermaus. Written in 1874, it became an instant hit. In English, Die Fledermaus means ‘the flying mouse’. Can you guess what that would be?
The Bat! The story is full of shenanigans as a man dresses up as a bat to attend a costume ball. A dance instructor from Memphis came over to teach the ASU opera singers how to waltz, and Mrs. Philpot got to learn, also.
During the waltz scene, performers must sing while they’re dancing. That takes a lot of energy and concentration! Even non-opera lovers may recognize Die Feldermaus Waltz because it is used in the film Batman Begins, when young Bruce Wayne begs his parents to leave.
LISTEN FOR . . . The waltz theme has a melody that seems to ‘spin around’. Perhaps it is to represent the turning in the dance; or the dizziness experienced by the dancers’ drinking too much champagne! Our first video shows the waltz scene from a stage production.
MUSIC LISTENING LINKS
Click below for a short excerpt from the operetta. Duration :28 seconds.
Click below to hear the music from the operetta with pictures of scenes from the operetta. Duration 4:30 minutes.
Weiner Elementary School, 313 N. Garfield St., Weiner, AR 72479 870-684-2252(o) 870-684-2684(f) (We are not responsible for any content on any page linked from our page) | <urn:uuid:421ce9bd-ba18-4f82-b631-df86612c9d24> | {
"date": "2018-02-22T05:03:34",
"dump": "CC-MAIN-2018-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891814002.69/warc/CC-MAIN-20180222041853-20180222061853-00256.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9610151648521423,
"score": 2.71875,
"token_count": 2588,
"url": "https://www.weinerelementary.org/johann-strauss-jr.html"
} |
When in doubt, check it out.
Knowing that a heart attack (myocardial infarction) has potential to cause cardiac arrest creates a strong case for early diagnosis and treatment. While you may have a heart attack, which can damage your heart muscle, it won't necessarily stop your heart if you recognize the symptoms and seek treatment early.
While many heart attack have symptoms that include persistent discomfort in the center of the chest, discomfort can also be located in other areas of the upper body including both arms, back, neck, jaw, and stomach. Heart attack symptoms may also include:
- Shortness of breath
- Cold sweats
- Dizziness or lightheadedness
- Numbness in your limbs
- Unexplained fatigue, weakness or anxiety
These symptoms should never be ignored, especially if you are already at risk for a heart attack.
While some risk factors are unavoidable, others can be mitigated with simple lifestyle changes. Heart attack risk factors include:
- Age and gender
- High blood pressure
- High cholesterol and low HDL levels
- Smoking and second-hand, which can nearly double the risk of heart attack
Many of the people who are hospitalized following a cardiac arrest said that they experienced heart attack symptoms days, weeks and even months before their cardiac arrest occurred.
So why didn't they go to the doctor? Some thought that the signs were too subtle to be a heart attack. Some thought the symptoms were related to something else like stress or being too active on the weekend. Still others didn't have time or thought it would cost too much for an EKG, stress test or angioplasty.
Early treatment for a heart attack may save your brain function and your heart muscle. It may also save you the cost of an ambulance ride, the cost of an extended stay in the intensive care unit, and save your family days of stress and worry as they wait. | <urn:uuid:a2e6ea8c-70ba-4990-b521-c78c0e44de64> | {
"date": "2017-05-23T20:34:08",
"dump": "CC-MAIN-2017-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-22/segments/1495463607702.58/warc/CC-MAIN-20170523202350-20170523222350-00471.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9539066553115845,
"score": 2.671875,
"token_count": 393,
"url": "http://ministryhealth.org/HC/Home/Winter2014/heartattack/whenindoubt.nws"
} |
An ultrasonic sensor is a device that works in much the same way as RADAR and SONAR. In fact, ultrasonic sensors mimic bats and other animals’ natural ability to use ultrasonic frequencies for navigation. Ultrasonic sensors broadcast a powerful, ultrasonic frequency, then detect the ultrasonic sound waves as they bounce off of objects and return to the sensor. They are almost always used to measure speed or direction and are very efficient at determining position.
How Ultrasonic Sensors Work
Ultrasonic sensors depend on two separate devices: an ultrasonic transducer and a detector. An ultrasonic transducer is any device that converts energy into an ultrasonic frequency. Though dog whistles and several other devices can convert mechanical energy into an ultrasonic frequency, ultrasonic transducers are usually made from piezoelectric crystals that can change size when a voltage is applied to them. When an alternating current is applied to a piezoelectric crystal, it vibrates extremely fast and produces an ultrasonic sound wave. The detector is also made of a piezoelectric crystal, but produces a voltage when an ultrasonic frequency comes in contact with it, effectively producing the opposite results. A sensor calculates the time that it takes in between broadcasting the ultrasonic frequency and receiving the incoming waves.
Ultrasonic sensors have many uses, but typically involve measuring speed, distance, or volume. They are used in navigation to determine the device and user’s location. Ultrasonic sensors detect wind speed and direction, and determine how much liquid is in a container by measuring the distance from the top of the container to the surface of the liquid. They are also used in humidifiers, burglar alarms, medical ultrasonography, and some forms of testing.
Ultrasonic sensors produce ultrasonic frequencies that humans cannot hear, making them ideal for quiet environments. They do not use much electricity, are simple in design, and are relatively inexpensive. Some piezoelectric crystals transmit and receive ultrasonic sound waves. Likewise, ultrasonic sensors can be used with both radio and sound waves.
Ultrasonic sensors do not have many disadvantages, but are limited in their capabilities. For example, density, consistency, and material can distort an ultrasonic sensor’s readings. | <urn:uuid:e989682a-9b31-486e-be5d-3f8dd3fbef73> | {
"date": "2017-10-24T02:07:56",
"dump": "CC-MAIN-2017-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187827853.86/warc/CC-MAIN-20171024014937-20171024034937-00356.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9199387431144714,
"score": 4.125,
"token_count": 467,
"url": "http://www.tech-faq.com/ultrasonic-sensors.html"
} |
Americans are going to make a choice between two men who would be president of these United State of America for the next four years.
There are many who believe that this election will be the most important election Americans have ever been involved in. I tend to agree with them.
But the choice Americans are being asked to make in this election didn’t begin with the election of Barack Hussein Obama in 2008, it started in the late 1800s in the state legislative halls of several states where a number of corrupt state legislators sold their vote to would be U.S. senators — who at that time were elected by the state legislators.
U.S. senators, elected by the state legislators, were supposed to be the state’s check on excessive federal intrusion. This corruption by state legislators led the populace to distrust government, much as many do today and led eventually to the passage of the 17th amendment, the amendment that ‘transformed’ America from a true republic to a partial republic; destroying the state’s check on excessive federal intrusion.
On Sept. 14, 1901, Theodore Roosevelt, leader of the fledging Progressive Party, became president following the assassination of President William McKinley.
Thus began the progressive era in America with what Roosevelt called his Square Deal. In 1908 Roosevelt backed liberal Republican William Howard Taft as president.
During Taft’s term both the 16th and 17th amendments to the Constitution took root and were later ratified, the 16th on Feb. 3, 1913, the 17th on April 8, 1913.
Incidentally, the slogan used to pass the 16th amendment is the same slogan used today by progressives (Democrats) to divide America — “Soak the Rich.”
In 1912 Woodrow Wilson, a Democrat progressive, was elected president and it fell to him to implement both of these new amendments, both of which “fundamentally transformed” America from what the founders had in mind to what we have today — big government that wants to control every decision every American makes, with redistribution of wealth its main focus today.
That focus is designed to destroy the America the founders gave this nation — individual imitative and personal freedom. Under Wilson the first tax bill was introduced on Oct. 3, 1913, and Americans have been groaning under ever increasing tax burdens ever since, with job creators paying the largest part of this load.
Under Wilson the Federal Reserve was created and implemented, the same body that now prints money at will.
Now, 100 years later, Americans, in retrospect, look back and see how today has come about. They can now see how Franklin Roosevelt, in the 1930s and until his death in 1945, used his New Deal to initiate the further transformation of America from small government to big government where government began to replace individual ruggedness with dependency on big government.
They can also look back to 1963 and another assassination, that of John F. Kennedy and see how his progressive VP, Lyndon Johnson, became president and implemented his own Great Society, the legislation that initiated the destruction of the ‘traditional family’ — the foundational unit for all civilized societies.
There are those who believe it was the role of Bill Clinton to make the final transformation from capitalism to socialism.
He failed and the unvetted Barack Obama was elected in 2008 by an adoring, but ill-informed electorate, to finalize the transformation. He has nearly succeeded — but the people finally woke up and now see the future under socialism in America.
And this is where America is today, the result of too many citizens voting for something that seemed very appealing but which, in the end, has led to the self-destruction of many nations.
Today’s political war is very real. In 1776 the war was to free Americans from the tyranny of King George III. Today this political war is to prevent the re-enslavement of America by its own government and to return America to those governing principles deeply embedded in America’s foundational documents by the Founders.
America is now seeing the consequences of America’s bad choices during the past 110 years in electing leaders whose agendas have led to the crisis America is in today.
Remember — the Nov. 6 election will have consequences. Vote — but vote fully informed.
Donald Conkey is a retired agricul tural economist in Woodstock. | <urn:uuid:88218b1d-90fb-4127-be5e-4fc410390a37> | {
"date": "2015-07-03T22:26:58",
"dump": "CC-MAIN-2015-27",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-27/segments/1435375096287.97/warc/CC-MAIN-20150627031816-00106-ip-10-179-60-89.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9739484190940857,
"score": 2.5625,
"token_count": 897,
"url": "http://www.cherokeetribune.com/view/full_story/20357557/article-Our-vote-is-important-as-choices-have-consequences"
} |
The three or so last decades of the 20th century seem to have invented “planetary mourning”: the deaths of JFK in 1963, De Gaulle in 1970, Elvis Presley in 1977, Princess Diana in 1997, Pope John Paul II in 2005 or Michael Jackson in 2009, have generated worldwide movements of collective mourning, with an abundance of official homage, crowds gathering and paying tribute in various forms to the person who had passed away. Anyone old enough to have fully grasped the importance of the event remembers where he/she was and what he/she was doing when he/she learnt the news of Kennedy’s assassination or of Diana’s car crash. But is it such a recent phenomenon? In 1901, the news of the death of Queen Victoria was received in a fashion similar in more aspects than one to that of Princess Diana 96 years later (“seas of flowers”, massive newspapers coverage, flags at half-mast even in New York City!).
Yet Antique civilizations already staged collective practices of mourning which, if they were not "global", were nonetheless collectively perceived at their own city-states' level. The Persians defeat became the subject of Aeschylus's eponymous tragedy; the battle of Thermopylae, the Varian disaster or the death of Augustus are among the other examples worth quoting.
In such a sense, the notion of "collective mourning" is ambiguous as it applies both to the loss of a person of particular distinction among its peers, and to an event impacting brutally a community, civic or not.
In consequence, "collective mourning" is not something specific to our contemporary world, even if the media overexposure which goes along the "global village" phenomenon gives it an unprecedented nature, historically speaking. On other occasions, if the term “planetary” is clearly hyperbolic, we can still talk of collective mourning on a really large scale: the death of the Polish President in April 2010 is clearly a very recent example. But such a topic is not meaningful for contemporary historians only.
“Planetary mourning” is just one of the aspects collective grief can take, and bereavement could of course hardly be “planetary” when the relevant technology was not there. Women's laments of the Antiquity opened up a long series of mourning practices, the modalities, rituals and practicalities of which can be addressed from a historical point of view.
Although the study of death has long been of special interest to medievalists far and wide, the theme of mourning has not benefited from a similar degree of scholarly attention. The institution of All Souls by the abbot of Cluny, the development of the practice of mortuary rolls, and the procession of mourners to the tombs all provide keys to understanding the collective handling of death. And yet, a good number of practices, notably secular ones, are less clearly established, and it is out task to define their existence, their history, their elements, juxtaposing literary, iconographic, and archaeological sources. Quite recently, modern historians have addressed the question of mourning and memory after the two World Wars, but this is a more specific and consequently restricted approach. This Conference is here to redress the balance, but we will also pay special attention to submittals from other fields: sociology, media studies, religious studies…, where scholars have been more daring.
This conference covers not only a long historical continuum from Antiquity, but also a vast geographical area, hoping to include also non-European practices, and numerous rituals, such as the turning of the bones in Madagascar. Among our interests will feature patterns of mourning; the people who feel concerned, and the degree to which they feel concerned; collective behaviours linked to mourning, spontaneous and/or ritualized ; the hows, wheres and whens of mourning crowds, in particular in urban environments; the way authorities tried to channel these crowds in order to avoid any suspicious behaviour.
Abstracts in French or English of 300 words (+ CV/resume) for a 20 minutes paper should be emailed to Christine Bousquet ([email protected]) and Manuel Royo [email protected] (copy to [email protected]) no later than 1st of july 2013 Authors of accepted papers will be responsible for their own travel costs and accommodation; registration fees (50 euros, discounted rates available for PhD and post-doctoral students) cover all meals and a volume per person of pre-conference proceedings. Proceedings will be eventually published in book form.
université François-Rabelais, Tours
3 rue des Tanneurs
Send comments and questions to H-Net
Webstaff. H-Net reproduces announcements that have been submitted to us as a
free service to the academic community. If you are interested in an announcement
listed here, please contact the organizers or patrons directly. Though we strive
to provide accurate information, H-Net cannot accept responsibility for the text of
announcements appearing in this service. (Administration) | <urn:uuid:2b285f2b-523a-4e32-a827-b18030018b8c> | {
"date": "2015-01-31T19:18:34",
"dump": "CC-MAIN-2015-06",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422122030742.53/warc/CC-MAIN-20150124175350-00237-ip-10-180-212-252.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9452154040336609,
"score": 2.78125,
"token_count": 1040,
"url": "http://www.h-net.org/announce/show.cgi?ID=203821"
} |
In order to improve your memory, try doing more aerobic exercise. Recent studies have shown that high intensity cardio workouts can actually help you grow more brain cells in your hippocampus, the portion of your brain responsible for memory. Some exercises that you may want to try include running, biking, kickboxing and swimming.
Take advantage of social networking sites to remember birthdays. Take the time to invite all your friends to join you on your social networking site, and be sure to ask them when their birthdays are and enter this information in the birthday reminder program provided so that you will always be notified in advance.
Sticky notes and lists are very popular for those people that have difficulty remembering important things. Make sure you place them in places you will look at frequently, for example next to your computer. Using sticky notes will make sure you don't forget to do something important.
To try to remember more things. You may want to create a catchy song. People find that putting important information into a song helps their memory. Try to find words that rhyme, and do not put anything too complicated into the song, as that could just end up confusing you more.
Keep a diary or calendar for appointments. This is extremely helpful in remembering important dates or events. Be consistent with it and keep it in the same place all the time. You should look at it every day to update it and to make sure there isn't anything you are forgetting.
If you constantly have trouble remembering certain things, find ways to eliminate the problem once and for all. For instance, if you can never remember where you placed your car keys, put a peg by your front door where you can hang your keys the minute you enter your house. Make a list of the items you most frequently forget and then figure out a simple way to remember each of the items on your list.
Exercise regularly as it can improve your memory functions and health. Physical exercises improve your physical look and they also increase the oxygen flow to the brain. A physically well kept body is less prone to catch memory loss causing illnesses and increases the useful brain chemicals' presence in the blood.
As discussed in the beginning of this article, Alzheimer's disease is a debilitating disease that affects your memory. Watching your mother or father's memory, deteriorate in-front of your eyes, can be one of the most painful experiences that life has to offer. Apply the advice from this article to help you and your family cope with this devastating disease. | <urn:uuid:bebf25e3-51ee-45ee-af60-2827a5a2d821> | {
"date": "2017-11-21T11:54:35",
"dump": "CC-MAIN-2017-47",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934806353.62/warc/CC-MAIN-20171121113222-20171121133222-00656.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9584150910377502,
"score": 3.28125,
"token_count": 502,
"url": "http://www.josephmontes.co/2017/08/do-you-have-good-memory-heres-how-you.html"
} |
PROGRESSIVISM and AMERICA'S TRADITION of NATURAL LAW and NATURAL RIGHTS
Ronald J. Pestritto, Hillsdale College
American Progressivism is an enduring topic for students of American politics and history because progressivism, at its core, presents a direct, philosophic challenge to the natural law tradition of America’s founding. A study of the key texts of American Progressivism will thus help us to place the role of the natural law tradition in American political and constitutional theory, particularly as related to the historical developments of the 20th century and in our own time.
What is progressivism? In the context of American history, it is the political orientation that gave rise to America’s original Progressive Era, which came in the last decades of the 19th century and the opening decades of the 20th, and whose principles of government inform contemporary political liberalism in the United States. It can be thought of as an argument to progress beyond the political principles of the American founding—and, in particular, to overcome the natural-law foundations of America’s original political order. It is an argument to enlarge vastly the scope of national government for the purpose of responding to a set of economic and social conditions that, progressives contended, could not have been envisioned at the founding and for which the founders’ limited, constitutional government was inadequate. The founders had posited what they had held to be a permanent understanding of just government, and they had derived this understanding of government from the “laws of nature and nature’s God,” as asserted in the Declaration of Independence. The progressives countered that the ends and scope of government were to be defined anew in each historical epoch. They coupled this perspective of historical contingency with a deep faith in historical progress, suggesting that, due to historical evolution, government was becoming less of a danger to the governed and more capable of solving the great array of problems besetting the human race. Historically, these ideas formed a common thread among the most important American thinkers from the 1880s into the 1920s and beyond, manifesting themselves in the writings and speeches of Theodore Roosevelt, Woodrow Wilson, Herbert Croly, John Dewey, Robert LaFollette, and several others.
The Progressive Era was the first major period in American political development to feature, as a primary characteristic, the open and direct criticism of the political and constitutional theory of the American founding. While criticism of certain of the founders’ ideas could be found during any period of American history, the Progressive Era was unique in that such criticism formed the backbone of the entire movement. In almost any progressive text that one may pick up, the reader is reminded that the Constitution is old, and that its principles were conceived in response to circumstances that have long ago been replaced by a whole new set of pressing social and economic ills.
The U.S. Constitution, as its framers understood it, was a means to an end. It was crafted and adopted for the sake of achieving the natural-law principles referred to in the Declaration of Independence. The progressives understood this very clearly as well, which is why many of the more theoretical works written by progressives feature sharp attacks on social compact theory and on the notion that the fundamental purpose of government is to secure the individual natural rights of citizens. While most of the founders and nearly all ordinary Americans did not subscribe to the radical epistemology of the social compact theorists, they did believe, in Lockean fashion, in natural law, and that men as individuals possessed rights by nature—rights that any just government was bound to uphold and that stood as inherent limits to the authority of government over individual liberty and property. The robust regulatory and redistributive aims of the progressive policy agenda were inevitably at odds with the natural-law theory of the founding. This basic fact makes understandable Woodrow Wilson’s admonition (in an address ostensibly honoring Thomas Jefferson) that, “if you want to understand the real Declaration of Independence, do not repeat the preface.” Do not, in other words, repeat that part of the Declaration that draws on the natural law and enshrines natural rights as the focal point of American government.
Wilson here would turn our attention away from the natural law and the timelessness of the Declaration’s conception of government, and would focus us instead on the litany of grievances made against George III. In other words, he would show the Declaration to be a merely practical document, to be understood as a specific, time-bound response to a set of specific historical circumstances. Once the circumstances change, so too must our conception of government. It is with this in mind that Wilson urged that “we are not bound to adhere to the doctrines held by the signers of the Declaration of Independence,” and that every Fourth of July, instead of a celebration of the timeless principles of the Declaration, should instead “be a time for examining our standards, our purposes, for determining afresh what principles, what forms of power we think most likely to effect our safety and happiness.” Like Wilson, Frank Goodnow (a progressive pioneer in constitutional and administrative theory) acknowledged that the founders’ system of government “was permeated by the theories of social compact and natural right,” and he complained that such theories were “worse than useless,” because they “retard development”—that is, that the natural-law protections for individual liberty and property inhibit the expansion of government. In contrast to the principle of natural rights that undergirded the American system, Goodnow praised political systems in Europe where, he explained, “the rights which [an individual] possesses are, it is believed, conferred upon him, not by his Creator, but rather by the society to which he belongs. What they are is to be determined by the legislative authority in view of the needs of that society. Social expediency, rather than natural right, is thus to determine the sphere of individual freedom of action.”
Goodnow, Wilson, and other progressives championed historical contingency against the Declaration’s talk of natural law and the permanent principles of just government. The natural-law understanding of government may have been appropriate, they conceded, as a response to the prevailing tyranny of that day, but, they argued, all government has to be understood as a product of its particular historical context. The great sin committed by the founding generation was not, then, its adherence to the doctrine of natural law, but rather its notion that that doctrine was meant to transcend the particular circumstances of that day. It was this very facet of the founders’ thinking that Abraham Lincoln recognized, and praised, in 1859 when he wrote of the Declaration and its primary author:
All honor to Jefferson—to the man who, in the concrete pressure of a struggle for national independence by a single people, had the coolness, forecast, and capacity to introduce into a merely revolutionary document, an abstract truth, applicable to all men and all times.
Recognizing the very same characteristic of the founders’ thought, John Dewey complained, by contrast, that the founding generation “lacked historic sense and interest,” and that it had a “disregard of history.” As if speaking directly to Lincoln’s praise of the founding, Dewey endorsed, instead, the doctrine of historical contingency. Natural law theory, Dewey argued,
blinded the eyes of liberals to the fact that their own special interpretations of liberty, individuality, and intelligence were themselves historically conditioned, and were relevant only to their own time. They put forward their ideas as immutable truths good at all times and places; they had no idea of historic relativity.
The idea of liberty was not frozen in time, Dewey argued, but had instead a history of evolving meaning. The history of liberalism, about which Dewey wrote in Liberalism and Social Action, was progressive—it told a story of the move from more primitive to more mature conceptions of liberty. Modern liberalism, therefore, represented a vast improvement over classical (or what Dewey called “early”) liberalism.
This coupling of historical contingency with the doctrine of progress (shared by all progressives to one degree or another) reveals how the progressive movement became the means by which German historicism was imported into the American political tradition. The influence of German political philosophy is evident not only from looking at the ideas espoused by progressives, but also from the historical pedigree of the most influential progressive thinkers. Almost all of them were either educated in Germany in the nineteenth century or had as teachers those who were. This fact reflects the sea of change that had occurred in American higher education in the second half of the nineteenth century, a time when most Americans who wanted an advanced degree went to Europe to get one. By 1900, the faculties of American colleges and universities had become populated with European PhDs, and the historical thinking that dominated Europe (especially Germany) in the nineteenth century came to permeate American higher education. Johns Hopkins University, founded in 1876, was established for the express reason of bringing the German educational model to the United States, and produced several prominent progressives, including Wilson, Dewey, and Frederick Jackson Turner.
Among other things, American progressives took from the Germans (and especially from the German philosopher G. W. F. Hegel and his disciples) their critique of natural law, individual rights, and social compact theory, and their organic or “living” notion of the national state. Wilson, in reflecting on what it meant to be a progressive, wrote of government as a “living thing,” which was to be understood according to “the theory of organic life.” This “living” notion of a constitution, Wilson contended, was far superior to the founders’ model, which had considered government a kind of “machine” that could be constantly limited through checks and balances. As a living entity, the progressives reasoned, government had to evolve and adapt in response to changing circumstances. While early American conceptions of national government had carefully circumscribed its power due to the perceived threat to natural liberties, progressives argued that history had brought about an improvement in the human condition, such that the will of the people was no longer in danger of becoming factious. Combined with a whole new host of economic and social ills that called out for a governmental remedy, progressives took this doctrine of progress and translated it into a call for a sharp increase in the scope of governmental power.
As a practical matter, this call led progressives to advocate both constitutional reform and an aggressive legislative and regulatory agenda. In keeping with the purpose of this web resource, my brief essay has focused on the more philosophic aspects of progressivism, because that is where progressivism’s encounter with the natural law tradition is most direct. On the more concrete side, readers are encouraged to study both the progressives’ critique of the constitutional separation of powers and the alternative solution that they proposed: the separation of politics and administration. By this latter formulation, progressives like Wilson and Goodnow meant that the national political institutions (Congress, the presidency, etc.) ought to be democratized and unified, bringing them into much closer contact with public opinion and facilitating their expression of the general public will. At the same time, since progressives believed that the most contentious political questions had been resolved by historical development (the Civil War had been decisive in this regard), the real work of government was not in politics, but in administration, that is, in figuring out the specific means of achieving what the people generally agreed they all wanted. It is in this way that progressivism became influential not only upon the development of our traditional political institutions, but also on the rise of the federal bureaucracy and the very significant role played by federal agencies in setting and enforcing national policy today.
It is also the case that so much could be said about progressivism’s massive influence on our party and electoral systems, and especially on the structure of state and local politics, where progressivist mechanisms such as the ballot initiative, the referendum, the recall, the short ballot, and the professionalization of local government with city managers and commissions have become a traditional part of our political life as Americans. But these, too, lie outside the scope of this essay and must remain matters to be independently pursued by the reader.
With respect to the key philosophic works of progressivism relating to the natural law tradition, I have drawn the reader’s attention to some of them in this essay, and some of these have been made available as a resource on this website.
Readers interested in a more in-depth introduction to American progressivism are directed to Ronald J. Pestritto and William J. Atto, “Introduction to American Progressivism,” in American Progressivism: A Reader, ed. Pestritto and Atto (Lexington Books, 2008), 1-32. Parts of this brief essay are based upon that longer work. American Progressivism is also a source for a wider selection of relevant progressive-era writings.
Woodrow Wilson, “An Address to the Jefferson Club of Los Angeles” May 12, 1911, in The Papers of Woodrow Wilson (herafter cited as PWW), 69 vols., ed. Arthur S. Link (Princeton University Press, 1966-1993), 23:34.
Woodrow Wilson, “The Author and Signers of the Declaration of Independence,” July, 1907, in PWW, 17:251.
Frank J. Goodnow, Social Reform and the Constitution (Macmillan, 1911), 1, 3.
Frank J. Goodnow, The American Conception of Liberty and Government (Brown University Colver Lectures, 1916), 11.
Abraham Lincoln to Henry L. Pierce and Others, April 6, 1859, in Abraham Lincoln: Speeches and Writings, 1859-1865, ed. Don E. Fehrenbacher (Library of America, 1989), 19.
John Dewey, Liberalism and Social Action (Prometheus Books, 2000), 40-41.
Woodrow Wilson, The New Freedom (Doubleday, Page & Company, 1913), 46-47. | <urn:uuid:94adefcb-e2f7-43c2-83d0-b62819ef33cc> | {
"date": "2014-10-23T04:29:21",
"dump": "CC-MAIN-2014-42",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507450097.39/warc/CC-MAIN-20141017005730-00026-ip-10-16-133-185.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9647772908210754,
"score": 3.4375,
"token_count": 2918,
"url": "http://www.nlnrac.org/print/101"
} |
Medical Tuesday Blog
One Hundred Million Killed
100 Years of Communism—and 100 Million Dead
The Bolshevik plague that began in Russia was the greatest catastrophe in human history.
Armed Bolsheviks seized the Winter Palace in Petrograd—now St. Petersburg—100 years ago this week and arrested ministers of Russia’s provisional government. They set in motion a chain of events that would kill millions and inflict a near-fatal wound on Western civilization.
The revolutionaries’ capture of train stations, post offices and telegraphs took place as the city slept and resembled a changing of the guard. But when residents of the Russian capital awoke, they found they were living in a different universe.
Although the Bolsheviks called for the abolition of private property, their real goal was spiritual: to translate Marxist- Leninist ideology into reality. For the first time, a state was created that was based explicitly on atheism and claimed infallibility. This was totally incompatible with Western civilization, which presumes the existence of a higher power over and above society and the state.
The Bolshevik coup had two consequences. In countries where communism came to hold sway, it hollowed out society’s moral core, degrading the individual and turning him into a cog in the machinery of the state. Communists committed murder on such a scale as to all but eliminate the value of life and to destroy the individual conscience in survivors.
But the Bolsheviks’ influence was not limited to these countries. In the West, communism inverted society’s understanding of the source of its values, creating political confusion that persists to this day.
In a 1920 speech to the Komsomol, Lenin said that communists subordinate morality to the class struggle. Good was anything that destroyed “the old exploiting society” and helped to build a “new communist society.”
This approach separated guilt from responsibility. Martyn Latsis, an official of the Cheka, Lenin’s secret police, in a 1918 instruction to interrogators, wrote: “We are not waging war against individuals. We are exterminating the bourgeoisie as a class. Do not look for evidence that the accused acted in word or deed against Soviet power. The first question should be to what class does he belong. It is this that should determine his fate.”
Such convictions set the stage for decades of murder on an industrial scale. In total, no fewer than 20 million Soviet citizens were put to death by the regime or died as a direct result of its repressive policies. This does not include the millions who died in the wars, epidemics and famines that were predictable consequences of Bolshevik policies, if not directly caused by them.
The victims include 200,000 killed during the Red Terror (1918-22); 11 million dead from famine and dekulakization; 700,000 executed during the Great Terror (1937-38); 400,000 more executed between 1929 and 1953; 1.6 million dead during forced population transfers; and a minimum 2.7 million dead in the Gulag, labor colonies and special settlements.
To this list should be added nearly a million Gulag prisoners released during World War II into Red Army penal battalions, where they faced almost certain death; the partisans and civilians killed in the postwar revolts against Soviet rule in Ukraine and the Baltics; and dying Gulag inmates freed so that their deaths would not count in official statistics.
If we add to this list the deaths caused by communist regimes that the Soviet Union created and supported—including those in Eastern Europe, China, Cuba, North Korea, Vietnam and Cambodia—the total number of victims is closer to 100 million. That makes communism the greatest catastrophe in human history.
The effect of murder on this scale was to create a “new man” supposedly influenced by nothing but the good of the Soviet cause. The meaning of this was demonstrated during the battle of Stalingrad, when Red Army blocking units shot thousands of their fellow soldiers who tried to flee. Soviet forces also shot civilians who sought shelter on the German side, children who filled German water bottles in the Volga, and civilians forced at gunpoint to recover the bodies of German soldiers. Gen. Vasily Chuikov, the army commander in Stalingrad, justified these tactics in his memoirs by saying “a Soviet citizen cannot conceive of his life apart from his Soviet country.” . . .
While the Soviet Union redefined human nature, it also spread intellectual chaos. The term “political correctness” has its origin in the assumption that socialism, a system of collective ownership, was virtuous in itself, without need to evaluate its operations in light of transcendent moral criteria.
When the Bolsheviks seized power in Russia, Western intellectuals, influenced by the same lack of an ethical point of reference that led to Bolshevism in the first place, closed their eyes to the atrocities. When the killing became too obvious to deny, sympathizers excused what was happening because of the Soviets’ supposed noble intentions.
Many in the West were deeply indifferent. They used Russia to settle their own quarrels. Their reasoning, as the historian Robert Conquest wrote, was simple: Capitalism was unjust; socialism would end this injustice; so socialism had to be supported unconditionally, notwithstanding any amount of its own injustice.
Today the Soviet Union and the international communist system that once ruled a third of the world’s territory are things of the past. But the need to keep higher moral values pre-eminent is as important now as it was in the early 19th century when they first began to be seriously challenged.
In 1909, the Russian religious philosopher Nikolai Berdyaev wrote that “our educated youth cannot admit the independent significance of scholarship, philosophy, enlightenment and universities. To this day, they subordinate them to the interests of politics, parties, movements and circles.”
If there is one lesson the communist century should have taught, it is that the independent authority of universal moral principles cannot be an afterthought, since it is the conviction on which all of civilization depends.
Mr. Satter is the author of “Age of Delirium: the Decline and Fall of the Soviet Union” (Yale). | <urn:uuid:0b79527f-9ae1-4a96-8ccd-f9287964c38d> | {
"date": "2019-07-20T22:17:51",
"dump": "CC-MAIN-2019-30",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195526714.15/warc/CC-MAIN-20190720214645-20190721000645-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9663365483283997,
"score": 2.921875,
"token_count": 1279,
"url": "http://medicaltuesday.net/one-hundred-million-killed/"
} |
Decoding the Structure of Bone
Wed, 04/17/2013 - 10:28am
The bones that support our bodies are made of remarkably complex arrangements of materials— so much so that decoding the precise structure responsible for their great strength and resilience has eluded scientists’ best efforts for decades.
But now, a team of researchers at MIT has finally unraveled the structure of bone with almost atom-by-atom precision, after many years of analysis by some of the world’s most powerful computers and comparison with laboratory experiments to confirm the computed results. The findings, from a team led by civil engineer and materials scientist Markus Buehler, are published this week in the journal Nature Communications.
Buehler, an associate professor of civil and environmental engineering (CEE) at MIT, said the riddle was to find how two different materials— a soft, flexible biomolecule called collagen and a hard, brittle form of the mineral apatite— combine to form something that is simultaneously hard, tough and slightly flexible.
The constituents are so different that “you can’t take these two materials individually and understand how bone behaves,” Buehler said. Hydroxyapatite is like chalk, he said: “It’s very brittle. If you try to bend it even a little, it breaks into pieces.” Collagen, on the other hand, is what gelatin is made of— the very epitome of a wobbly substance.
Neither material, on its own, could provide adequate structural support for the body. “It takes the best qualities of the two substances,” Buehler said. “But how this works is the big unknown.”
Fitting the pieces together
The key to bone’s properties, Buehler said, is in the exact way the two components fit together— which is what’s been so difficult for scientists to figure out. The molecules responsible for these properties can be probed by tools such as atomic force microscopes, but only in two dimensions: On the surface, or in thin slices. But bone is an intricate three-dimensional structure, and there has been no way to image such fine structures in all their complexity.
“It’s easy to get images of bone, but it’s hard to see exactly where the minerals are located inside the collagen,” said Shu-Wei Chang, a CEE graduate student who was a co-author of the paper.
That’s where the computers come in: Buehler explains that even a few years ago, the modeling required to deduce the internal structure of bone would have taken years of computer time on the most powerful computers. But newer supercomputers can carry out much more detailed computations in a few months. Still, it took several iterations, after studying the previous results and probing the material’s response to increasing pressure, to derive an answer, which the team was then able to confirm through comparisons with laboratory tests.
One key, they found, is that the hydroxyapatite grains are tiny, thin platelets just a few nanometers (billionths of a meter) across, and are deeply embedded in the collagen matrix. The two constituents are bound together by electrostatic interactions, which allows them to slip somewhat against each other without breaking.
The best of both
“In this arrangement of tiny hydroxyapatite grains embedded in the collagen matrix, the two materials can each contribute the best of their properties,” Buehler said. “Hydroxyapatite takes most of the forces in the material, whereas collagen takes most of the stretching.”
The new understanding of bone’s molecular structure and function could help in unraveling what goes wrong in certain diseases, including osteoporosis and brittle bone disease. “We can use this model to understand how a bone becomes more brittle,” said Arun Nair, a CEE postdoc who was the first author of the paper. For example, collagen is made up of thousands of amino acids, but “if only one of those amino acids is altered, it changes the way the minerals form” inside the bone, Nair said.
“That’s why this model is so critical,” he adds. Without it, you could observe how bone changes as a result of disease, but “you don’t know why. Now, we can see how a very tiny change...changes the way the mineral grows, or how the forces and deformation are distributed.”
Ultimately, this work could also lead to the synthesis of new bone-like materials, either as biomedical materials to substitute for bone or as new structural materials for engineering uses. “We hope we can replicate this in the lab,” Buehler said.
Sandra Shefelbine, an associate professor of mechanical and industrial engineering at Northeastern University who was not involved in this research, said, “This computational molecular model … is fundamental to understanding the molecular basis for the mechanics of bone. Computational models can give us insight at length scales that are difficult to probe in experiments.” The MIT team’s analysis “is exciting in that it provides the molecular basis for the interaction. … This work is cutting-edge in the field of molecular modeling of structural biological tissues.”
Postdoc Alfonso Gautieri was also part of the MIT team. The work was supported by the Office of Naval Research, the Army Research Office, the National Science Foundation (NSF) and the MIT-Italy Program. The research used high-performance computing resources from NSF’s XSEDE program, the CILEA Consortium, the LISA Initiative and the ISCRA Initiative. | <urn:uuid:3f112d1b-fe29-430f-9415-ac0eebec0072> | {
"date": "2016-05-01T17:29:55",
"dump": "CC-MAIN-2016-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860116878.73/warc/CC-MAIN-20160428161516-00064-ip-10-239-7-51.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9456107020378113,
"score": 3.65625,
"token_count": 1206,
"url": "http://www.biosciencetechnology.com/news/2013/04/decoding-structure-bone?et_cid=3201281&et_rid=544717611&type=headline"
} |
The bond between a parent and child is the earliest of the relationships a child will have throughout her life, and can affect her development, according to the Urban Child Institute. A positive and supportive attachment to a parent will help to protect the child from developing emotional and behavioral problems as she grows older. Cultural differences can affect the way a parent interacts with a child, but the UCI notes that parental responsiveness is key in any culture.
Responsiveness, according to the UCI, is the process by which a parent observes a child, interprets her vocalizations or other behavioral signals and takes action to meet the child’s needs. To be responsive, the parent should respond promptly, be receptive to the child’s behavior and respond in a way that is appropriate to the child’s needs. Responsive parenting, according to a study reported in a 2006 World Health Organization bulletin, resulted in increased social competence as well as fewer behavior problems by the time a child was 3 years old. Children who received responsive parenting also did better in school and showed evidence of a higher IQ and self-esteem.
Parenting style can be affected by culture, and there is some indication that in some cultures, a particular style of parenting is more effective. The same parenting style is not necessarily as effective in all cultures, however, according to research at the McClelland Institute at the University of Arizona. Authoritative parenting, which is high in warmth and responsiveness but moderate in control, is effective in white American families. In first-generation Chinese families, however, the authoritarian style -- which is lower in warmth and support but higher in control -- seems to be more effective.
Culture and Behavior
In parent focus groups conducted by the Centers for Disease Control and Prevention, parents from several different cultural backgrounds agreed on certain aspects of child behavior. African-American, American Indian, Latino, Asian and white parents all agreed that children should be obedient, polite, not interrupt and be honest, share and perform well in school. Each culture tended to emphasize certain aspects of a child’s behavior or upbringing, however. Asian and white parents valued self-control. African-American, American Indian and Latino fathers felt religion should be an important influence in their children’s lives.
Defining cultural differences in parenting can be a daunting task. Although we may speak of the Latino culture or the Asian/Pacific Islander culture, it is important to recognize that the first group has at least 50 subgroups and the second more than 60 subgroups. American Indians have more than 500 tribes and clans. The CDC notes that irrespective of culture, there are some commonalities in parenting practices. All parents agreed, for example, that misbehavior should be dealt with, and that if punishment was deemed necessary, the parent should not act from anger. | <urn:uuid:45469fbb-cd50-4247-8cdf-703cc1966f66> | {
"date": "2020-01-23T01:35:05",
"dump": "CC-MAIN-2020-05",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250608062.57/warc/CC-MAIN-20200123011418-20200123040418-00296.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9563823938369751,
"score": 3.59375,
"token_count": 572,
"url": "https://living.thebump.com/cultural-differences-affect-parenting-techniques-15060.html"
} |
The Lenten Fast: Its Rule and Spirit
by Fr. Ayman Kfouf
Great Lent 2012
I- Historical Background
Fasting is not new in the Church. Fasting had its origin in the life of our first parents Adam and Eve. Fasting was the first, and only, law given to Adam and Eve1.
The Old Testament provides an extensive record of fasts kept by the Jews as commanded by God2 and fasts, without specific commandment, in times of distress, grief or when asking for forgiveness3.
In the New Testament, the Lord Himself fasted for forty days4. He commanded His disciples to fast after His ascension5 and prescribed fasting as a spiritual weapon against evil6. After Christ’s ascension, the disciples continued to practice fasting, beside prayer, in every aspect of their apostolic lives7 and they handed down this tradition to their disciples to preserve and practice it after them.
The aforementioned scriptural examples of fasting inspired Christians to imitate them, thus fasting quickly became part of the regular Christian experience. Evidently, the earliest Christian documents show that fasting in the first five centuries took different shapes and passed through various phases of transformation until it evolved into its current form today.
The practice of fasting in the first and second centuries took the shape of complete abstention from food for a day or two8. During the third century, fasting was extended to a full week in preparation for Pascha (Easter). By the fourth century, fasting had transformed in form and length and had evolved from a one week preparation for Pascha into a forty day fast9.
In the year 330, as indicated by St. Athanasius in his Festal Letters, Lent had expanded to forty days and had taken on the symbolism of Jesus’ fasting in the wilderness for forty days and forty nights.
Holy Week was instituted sometime after the dedication of the Church of the Holy Sepulcher by Constantine (335), giving a total of seven weeks10 of fasting; forming “Lent” in its current shape.
Lent was an exclusive spiritual training for the catechumens in preparation for baptism before Pascha. Gradually, the sponsors (Godparents), family and friends of the catechumens started to participate in the preparation process of the catechumenate11. Therefore, fasting seven weeks prior to Pascha, “Lent” became a standard practice in the piety of the Church.
II- Development of Form and Rules of Fasting
As we noticed from its historical background, fasting gradually transformed from one or two day fast, in preparation for Pascha, to a full seven week fast, forming “Lent” as we know it today.
Christian fasting practices began expanding from their basic biblical roots in the early centuries of the church. In its first form, fasting was a complete abstention from food and drink until sunset. Later on, the Church established more rules pertaining to the length and the form of fasting, including a list of permissible and prohibited types of food12 during fasting periods13.
Monastics in early Christianity incorporated fasting as an essential element of ascetic life. The monastic communities kept the rules of fasting intact. They observed fasting in its first form, which took the form of a complete abstention from food and drink until the sunset. After the sunset, monastics were able to eat a light vegetarian meal14.
Christians adapted ascetic principles as models of pious life and tried to imitate their practices, especially the practices of the heroic monastic figures in early Christianity. However, taking into consideration the differences between the normal life of a pious Christian and the strict life of monastics, the church adapted more elastic rules to encourage Christians to fast. Therefore, Christians (non-monastics) were allowed to eat vegetarian food any time during the day, all week days, with exception of Fridays and Wednesdays. On Fridays and Wednesdays, Christians were called to abstain completely from eating until the sunset, or until they receive the Holy Communion in the Presanctified Liturgy.
The following chart contains the rules of fasting as followed in our Antiochian Orthodox Church today. Before you observe and follow these rules, please remember:
- These rules are means to an end. They are not an end by themselves.
- The level of strictness in fasting is best worked out in each Christian's own setting and spiritual state of being, therefore laity must council their spiritual father, pastor, who will determine their appropriate level and strictness of fasting.
- There are many exceptions to the rules given here, depending on the liturgical feasts that fall during Lent. Therefore, council your pastor, spiritual father, for details pertaining to exceptions.
|Fasting rules as followed in our Antiochian Archdiocese|
|Saturdays and Sundays of Great Lent||Abstain from meat, fish, dairy, eggs|
|Monday through Friday of Great Lent||Abstain from meat, fish, dairy, eggs, alcohol, oil|
|Feast of Annunciation of the Theotokos on March 25 of every year.||Abstain from meat, dairy, eggs. Fish is allowed.|
|Palm Sunday||Abstain from meat, dairy, eggs. Fish is allowed.|
Please note that there are many more strict fasting rules that are followed in monasteries, where complete abstinence from food and drink takes place for a certain period of time. Laity are encouraged to imitate such practices but only under the observation and supervision of their spiritual father, pastor.
III- Fasting, the Spirit of the Rule
Generally speaking, fasting is a voluntary denying abstention from certain foods and drinks or both for a certain period of time. However, there is a clear contradistinction between fasting or “νηστεία” (nistia) and hunger or “λιμός” (limos)15. Fasting is not measured by how much hunger “λιμός” we endure. Even though hunger is an important factor in fasting, it is not enough by itself. In addition to physical hunger, we are called to recognize our spiritual hunger and seek to feed it with repentance, prayer and almsgiving.
Fasting isn’t substituting certain kinds of foods for different kinds of food; like substituting fish for meat, soy milk for regular milk, non-dairy coffee creamer for dairy creamer, and the list goes on. Accordingly, fasting isn’t only changing our food, but also changing the direction of our life and redirecting it back towards God.
Fasting is not only abstaining from meat and dairy products, rather, fasting is to live in austerity and renounce the worldly pleasures. By doing so, and we become more able to feel compassionate with those who are in need, we will be able to save our resources and give back to the poor and hungry.
Fasting isn’t a virtue by itself. Fasting is a means to obtain virtues. We don’t fast because it gratifies God when we don’t eat for “the devil also never eats"16, neither do we fast because it gratifies God when we endure affliction and pain. Neither do we fast as an act of penance for our sins, because fasting is not a punishment; quite the opposite, fasting is a joyful act of love, through which we express our love, faith and obedience towards God.
Through fasting, we control our senses and our physical weakness from all that hinders the contemplation of God; and we become more free to commune with Him in prayer. St. Isaac the Syrian states: “Fasting, vigil and prayer are God’s holy pathway and the foundation of every virtue.”17
Fasting without prayer becomes a bodily punishment, a physical diet or a false ritual, and likewise prayer without fasting loses its power and misses its goal. Fasting without effort in virtue is wholly in vain, and likewise it is impossible to acquire virtues without fasting and prayer, for to acquire virtues is to reacquire the divine likeness of God18.
Great Lent is a time for self-examination and self-denial. It is a time renew and fortify our relationship with God and others through works of mercy, charity, visitation of the sick and assistance to the unfortunate. Lent is a time when we get closer to our family, relatives and friends. Lent is a time to reconcile hostility and hatred; a time to forgive and forget; a time for a new beginning.
IV- Practical Remarks on Fasting Today
- In no way should we fast in a manner to cause damage to our health or to an extent where we become unable to accomplish our daily tasks and work responsibilities.
- Very young children, pregnant woman, elderly people, nursing mothers and individuals with certain medical conditions are exempted from strict fasting unless they are advised otherwise by their doctor. That being said, people in these groups are encouraged to abstain from some kinds of food one or two days of the week, as much as they can tolerate.
- We should not fast “like the hypocrites”19, in a way to draw attention to ourselves. When we are invited to eat in others homes, we should accept what we are offered to eat raising no objections. If our fasting embarrasses others or causes them extra work, then our fasting has lost its value and missed its purpose.
- In today’s Orthodox world, we spend a considerable amount of time and efforts, during Lent, trying to find tasty Lenten recipes, which are of gourmet status or duplicate meat dishes using textured soy protein. By doing so, we delude ourselves that we are keeping the Fast, and instead of using fasting as a spiritual cure it becomes a burden that adds to our estrangement from God.
- Let us, then, fast not to fulfill a legalistic obligation, but to obtain the Holy Spirit of God and unite ourselves with our Savior. Let us take Lent as an opportunity to pause and meditate on the real meaning of fasting and its purpose.
- Finally let us always remember, that fasting, prayer, and almsgiving are three elements that can’t exist apart from each other.
Certainly, nothing is more expressing of the real meaning of fasting than the words of Saint John Chrysostom stating:
“Do you fast? Give me proof of it by your works. If you see a poor man, take pity on him. If you see a friend being honored, do not envy him. Do not let only your mouth fast, but also the eye and the ear and the feet and the hands and all the members of our bodies. Let the hands fast, by being free of avarice. Let the feet fast, by ceasing to run after sin. Let the eyes fast, by disciplining them not to glare at that which is sinful. Let the ear fast, by not listening to evil talk and gossip. Let the mouth fast from foul words and unjust criticism. For what good is it if we abstain from birds and fishes, but bite and devour our brothers? May He who came to the world to save sinners strengthen us to complete the fast with humility, have mercy on us and save us.”
1 “And the LORD God commanded the man, saying, Of every tree of the garden thou mayest freely eat: but of the tree of the knowledge of good and evil, thou shalt not eat of it: for in the day that thou eatest thereof thou shalt surely die” Genesis 2:16,17
2 Leviticus 16:29-31; 23:26-32; Numbers 29:7; Zechariah 8:19
3 see Judges 20:26; 1 Samuel 7:6; 2 Jonah 3:4–10; Psalm 35:11–13; 1 Kings 9:18
4 Mathew 4:2
5 Mathew 9:14,15
6 Matthew 17:21
7 Acts 14:23; Acts 27:33; 1 Corinthians 7:5; 2 Corinthians 6:5; 2 Corinthians 11:27
8 “For the controversy is not only concerning the day, but also concerning the very manner of the fast. For some think that they should fast one day, others two, yet others more; some moreover, count their day as consisting of forty hours day and night. And this variety in its observance has not originated in our time; but long before in that of our ancestors.” Epistle of St. Irenaeus to Victor: Philip Schaff, Rev. Henry Wallace, Nicene and Post-Nicene Fathers, Second Series, Vol. I, p. 243
9 The first reference to a forty day fast is in the Council of Nicaea (325) in Canon 5: “…And let these synods be held, the one before Lent, (that the pure Gift may be offered to God after all bitterness has been put away), and let the second be held about autumn.” The fifth canon of Nicaea makes what looks like a passing reference to Lent, thus suggesting it was an established season by the year 325.
10 Between East and West the number of weeks of Lent differed, with seven weeks being established in the East and six in the West by the mid-sixth century. The reason for the difference in the number of weeks between East and West was because in the West Saturday was a fast day along with Wednesday and Friday, while in the East Saturday was not a fast day except the Saturday of Holy Week, according to the Canons of the Church (Canon 66, Apostolic Fathers; Canon 55A Sixth Ecumenical Synod in 692 - Canon 18, Gangra Synod in 340-370). See: Rev. George Mastrantonis, THE GREAT LENT - A Week by Week Meaning.
11 "Those who believe in the truth of our teaching, first of all, promise to live according to that teaching. Then we teach them how to pray and entreat God with fasting for the forgiveness of their sins; and we the faithful pray and fast with them." See: Sara Parvis, Paul Foster, Justin Martyr and his worlds, p. 154
12 “The fast must not be broken on the fifth day of the last week in Lent [i.e., on Monday Thursday], and the whole of Lent be dishonored; but it is necessary to fast during all the Lenten season by eating only dry meats.” (Synod of Laodicea, Canon 50) See: Philip Schaff, Henry Wace, A Select Library of Nicene and Post- Nicene Fathers of the Christian Church: The seven ecumenical councils, p. 155
13 “If any bishop, presbyter, or deacon, or reader, or singer, does not fast the holy Quadragesimal (forty day) fast of Easter, or the fourth day, or the day of Preparation, let him be deposed, unless he be hindered by some bodily infirmity. If he be a layman, let him be excommunicated.” (Apostolic Canons, Canon 69) See: Philip Schaff, Henry Wace, A Select Library of Nicene and Post-Nicene Fathers of the Christian Church: The seven ecumenical councils, p. 598
14 “St. Athanasius’ classic depiction of Antony shows him eating bread and salt, with water, once a day in the evenings, and frequently foregoing these.” See: Robert C. Gregg, trans. and ed., Athanasius: The Life of Antony and the Letter to Marcellinus, Classics of Western Spirituality, p. 36
15 “In hunger and thirst, in fastings often” (2 Corinthians 11:27)
16 Lenten Triodion, Sunday of Forgiveness
17 St. Isaac the Syrian, Homilies 37, Ascetical Homilies, p. 171
18 St. John of Damascus wrote: “The expression according to the image, indicates rationality and freedom, while the expression according to the likeness indicates assimilation to God through virtue.” See: Timothy Ware, The Orthodox Church, p. 219
19 Mathew 6:16 | <urn:uuid:772740a3-9ee3-4c2a-b805-7278c0b121c5> | {
"date": "2016-10-25T01:45:37",
"dump": "CC-MAIN-2016-44",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719843.44/warc/CC-MAIN-20161020183839-00273-ip-10-171-6-4.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.956814706325531,
"score": 3.09375,
"token_count": 3398,
"url": "http://antiochian.org/content/lenten-fast-its-rule-and-spirit"
} |
Author Kate Mosse and academic John Mullan debated the relative merits of the 19th-century pioneer novelists. So who won?
Jane Austen v Emily Brontë, an Intelligence Squared debate, was also John Mullan v Kate Mosse, but for much of it the professor and the novelist seemed too well mannered, too eager to eschew negativity. Only Mosse was ready to make an occasional hostile point, broadly echoing Emily’s sister Charlotte’s famous verdict on Austen’s work (“a carefully fenced, highly cultivated garden” where Charlotte wanted “open country – fresh air”; an accurate portrait of “a commonplace face” where she wanted “a bright vivid physiognomy”), though tellingly not quoting it – too unsisterly? – as she complained of the limitations of the worlds of Emma and Pride and Prejudice.
Explaining his reluctance to be critical at the outset (“I love Wuthering Heights, and slightly love Kate too”), Mullan headed off Charlotte’s other accusation – “the Passions are perfectly unknown to her” – by using scenes from Persuasion and Emma, performed by actors, to show that Austen “does do feeling”. The somewhat defensive note of this argument disappeared as Mullan went on to extol Austen’s brilliance and “wonderful sentences”, pointed to the opening scene of Pride and Prejudice to suggest she was “the greatest writer of dialogue in English literature”. He went on to call her pioneering use of free indirect style “the most important invention in the history of the novel”.
If there was a barbed element in this celebration it was subtle and aimed primarily at Austen deniers. Like Mosse, Mullan recalled, he had found Austen “trivial” and “all about getting married” as a teenager, but lost this silly prejudice when around 26 – you have to be grownup, in other words, to “get her” (so only teenagers, or those hanging on to their teenageriness, the audience were led to infer, preferred Wuthering Heights). Yes, they were “courtship novels”, he conceded with a hint of donnish impatience, but this was just the “frame” and to condemn them for that was as callow as dismissing Shakespeare’s comedies for being comedies.
Mosse also deployed acted scenes deftly – Dominic West fans were given a tantalising glimpse of his Heathcliff – as she insisted she had been right, at 17, to feel that there must be “more” to fiction than “the pursuit of marriage”, and that Wuthering Heights was a multilayered demonstration of what else it could be: not only a love story but a social novel incorporating “all types of people”, a tale of ghosts and past and present, a “pantheistic” work linking us to the rest of nature and asking “what it means to be human”.
Central to the Women’s prize (formerly the Orange prize) co-founder’s case was the book’s liberation of both sexes – men “allowed to have feelings”, women not reduced to husband-hunters. By being more “ambitious”, Mosse concluded, Brontë “changed what it was possible for women to write, for women and men to be, and for men to write”. She turned out to have won the argument on the night, though not quite the vote. An audience poll at the end narrowly elected Austen as queen of English literature (51% to Brontë’s 47%), but as the pre-debate split had been 55% to 24% with 21% don’t knows, all the swing vote had gone to Brontë. | <urn:uuid:e2989b01-db33-435c-a62f-f6fc1b039d38> | {
"date": "2017-08-23T04:22:48",
"dump": "CC-MAIN-2017-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886117519.92/warc/CC-MAIN-20170823035753-20170823055753-00296.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9739567041397095,
"score": 2.515625,
"token_count": 838,
"url": "https://onehundredpages.wordpress.com/2014/03/10/jane-austen-v-emily-bronte-whos-the-queen-of-english-literature/"
} |
May is National High Blood Pressure Education Month!
According to the Centers for Disease Control and Prevention (CDC), "In the United States, nearly one in three adults has hypertension, but only about half (47%) of those have it under control."
Hypertension is another word for high blood pressure, and blood pressure is the force of blood against artery walls. If the blood pushes against the arteries too hard for too long, serious health problems can develop. In fact, high blood pressure is often called "the silent killer" because it has no symptoms but can seriously damage your brain, heart, and kidneys. The CDC revealed that "Each day in the United States, nearly 1,000 deaths are associated with hypertension." Moreover, roughly 67 million Americans already have high blood pressure.
To find out your blood pressure, all you need is a blood pressure test. You can have a test done at your doctor's office, and it's totally painless. Here's what to make of your blood pressure numbers...
- Less than 120: Normal
- 120-139: Prehypertension
- 140-159: Stage 1 High Blood Pressure
- 160 or More: Stage 2 High Blood Pressure
Diastolic Blood Pressure (Bottom Number)
- Less than 80: Normal
- 80-89: Prehypertension
- 90-99: Stage 1 High Blood Pressure
- 100 or More: Stage 2 High Blood Pressure
Remember, "High blood pressure usually has no symptoms, but it can cause serious problems such as stroke, heart failure, heart attack and kidney failure. You can control high blood pressure through healthy lifestyle habits and taking medicines, if needed" (U.S. National Library of Medicine).
And that, ladies and gentlemen, brings us to the point of this post. Today we're going to talk about 3 ways to reduce your risk of high blood pressure or bring your blood pressure back to normal if you've already got hypertension.
Tip #1: Skip Sodium
According to the National Heart, Lung, and Blood Institute, "you can take action to prevent high blood pressure by reducing sodium (salt) intake." The CDC backs up this claim, asserting "Most Americans consume too much sodium, and it raises blood pressure in most people." Reduce the salt in your diet by cutting back on frozen, canned, and restaurant foods (huge sources of sodium), and checking the Nutrition Facts panel on the foods you buy. Choose options with less salt. Remember, the Dietary Guidelines for Americans advises people to "Reduce daily sodium intake to less than 2,300 milligrams (mg) and further reduce intake to 1,500 mg among persons who are 51 and older and those of any age who are African American or have hypertension, diabetes, or chronic kidney disease."
Tip #2: Eat More Fruits and Vegetables
Of course, replacing sodium-rich foods with fresh fruits and vegetables isn't the only way you can use them to reduce your risk of hypertension. In fact, the CDC counsels people to "Eat a healthy diet that is high in fruits and vegetables and low in sodium, saturated fats, trans fat, and cholesterol" in order to reduce their risk of high blood pressure. Fruits and vegetables are loaded with healthful nutrients that reduce the risk of chronic disease, help with weight control, and even manage blood sugar. According to the study, Fruit and vegetable consumption and the risk of hypertension determined by self measurement of blood pressure at home, "It is well recognized that high fruit and vegetable consumption is associated with a reduction of blood pressure (BP) measured by conventional BP measurement in Western countries." After processing the data they collected, the authors of the study concluded "high-level consumptions of fruits, vegetables, potassium, and vitamin C are associated with a significantly lower risk of hypertension." So stock up on fresh fruits and vegetables today!
Tip #3: Stay Active
"Physical activity can help you maintain a healthy weight and lower your blood pressure. For adults, the Surgeon General recommends 2 hours and 30 minutes of moderate-intensity exercise, like brisk walking or bicycling, every week. Children and adolescents should get 1 hour of physical activity every day" (source).
What more do you need to know? Being physically active can help you reduce your risk of hypertension in two ways -- by directly helping lower your blood pressure, and by helping you manage your weight, which is another high blood pressure risk factor. According to the National Heart, Lung, and Blood Institute, "Being active and maintaining a healthy weight also can help you prevent high blood pressure." Talk with your doctor about fun ways to get active as soon as you can.
There's lots more to learn about blood pressure. Check out these great free sources of more information...
- Blood Pressure 101
- Blood Pressure Quiz
- Heart Disease Risk Factors
- Get Low: Make Low-Sodium Choices
- Medication and High Blood Pressure: A News Update
- Quiz: Are You Good to Your Heart?
- Stroke Risk Update: Breaking News
Around the Web
- Dietary Guidelines for Americans -- U.S. Department of Agriculture and the U.S. Department of Health and Human Services
- Fruit and vegetable consumption and the risk of hypertension determined by self measurement of blood pressure at home -- U.S. National Library of Medicine
- High Blood Pressure -- U.S. National Library of Medicine
- National High Blood Pressure Education Month -- Centers for Disease Control and Prevention
- Power Down in May for National Blood Pressure Education Month -- Centers for Disease Control and Prevention
- Preventing High Blood Pressure: Healthy Living Habits -- Centers for Disease Control and Prevention
- What is High Blood Pressure? -- National Heart, Lung, and Blood Institute
There are lots of National Blood Pressure Education Month resources and materials in the Nutrition Education Store. Here are some of the most popular options...
At Food and Health Communications Inc, we are here when you want to look your very best. | <urn:uuid:bcbc1a1d-f0bc-4123-969d-b85596e6a6d4> | {
"date": "2018-01-19T21:13:22",
"dump": "CC-MAIN-2018-05",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084888135.38/warc/CC-MAIN-20180119204427-20180119224427-00656.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9219070076942444,
"score": 3.375,
"token_count": 1227,
"url": "https://foodandhealth.com/3-tips-high-blood-pressure/"
} |
Designed in the British Arts and Crafts style, the ‘Fairacres’ Steam Plant Buiding is a single-storey wood frame building with a gabled roof that originally housed the apparatus for climate control in the greenhouses, formerly located to its north. The original rubble stone walls that formed the fo…
Designed in the British Arts and Crafts style, the ‘Fairacres’ Steam Plant Buiding is a single-storey wood frame building with a gabled roof that originally housed the apparatus for climate control in the greenhouses, formerly located to its north. The original rubble stone walls that formed the foundation for the greenhouses stand adjacent. The Steam Plant Building stands as a pendant to the Root House, which is to the north of the former greenhouses.
The outbuildings at 'Fairacres' are a rare surviving architecturally-designed ensemble of agricultural structures that exist in complementary harmony with the main estate house. Architect Robert Mackay Fripp (1858-1917), an outspoken advocate of Arts and Crafts design, was retained by the Ceperleys to design several original outbuildings on their estate.
The Ceperleys operated 'Fairacres' with staff, a farm manager and workers, including Chinese, to grow produce for themselves and for sale at local markets. The Steam Plant Building illustrates the market gardening activity of the area around Deer Lake and its importance to the Ceperley family, which valued a year-round supply of fresh fruit and vegetables for the kitchen and flowers for the house. It also illustrates the cultural and aesthetic values of the Ceperleys in retaining an architect to design a functional outbuilding using an accepted and contemporary architectural style. Built in 1908, the Steam Plant Building was significantly altered in the 1960s and restored to its original design in 2000.
Key elements that define the heritage character of the ‘Fairacres’ Steam Plant Building include its:
- overall spatial arrangement of the Steam Plant Building in relation to the former greenhouses and the Root House
- side gable roof with cedar shingle cladding.
- tall brick chimney indicitive of the building's original function.
- distinctive Arts and Crafts architectural features such as the shingle wall cladding with decorative shingling under window sills, deep eaves, and pebble-dashed concrete foundation walls
- six-paned wooden-sash casement windows
- simple functional interior features
- rubble stone walls that formed the foundation for the greenhouses | <urn:uuid:60ec9122-7291-463c-b454-8662c1a5555f> | {
"date": "2019-09-21T08:45:17",
"dump": "CC-MAIN-2019-39",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514574377.11/warc/CC-MAIN-20190921084226-20190921110226-00296.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9498540163040161,
"score": 2.859375,
"token_count": 520,
"url": "https://search.heritageburnaby.ca/permalink/landmark528"
} |
bilingual children is an everyday challenge for me. The English part they've
got down, but since I'm the only one in their lives that speaks to them in
Spanish on a regular basis, Spanish needs to be reinforced and encouraged as
much as possible. I never want them to feel like learning Spanish is a chore,
so I try to find ways to incorporate it into our lives that they find fun.
read bedtime books in Spanish, watch DVDs that have Spanish-language audio
tracks and use apps or video games that are in Spanish. Even though I do
my best to incorporate bilingualism into our lives, I still need to be reminded
that if I say something to them in English, it's a great idea to follow up with
it in Spanish as well. Enter our DIY bilingual word-a-day chalkboard.
girls love chalkboards, and, truth be told, so do I. Ever since childhood, a
chalkboard has represented a world of possibilities to me. Chalkboards are for
learning, playing, working out problems, drawing and expressing yourself; they
shouldn't just be relegated to the classroom. I love chalkboards so much that
I just happen to have chalkboard paint at the ready. Of course, if you already
have a chalkboard, you can use that, but making your own and including the
family in the process is part of the fun and gets them more invested in the
• We found a random piece
of board in our basement and painted it with chalkboard paint.
• Once the chalkboard
paint had dried, we used a hot glue gun to attach a ribbon on the board for
• The girls helped pick
out buttons from a bag of buttons we have to add a little playful
you've got the chalkboard all set up, place it in an area with high visibility
and add a different word to it in both its English and Spanish translations
every day and discuss that word with your kids. If your children are old enough
to write, you can have them write the word on the board themselves. If you need
inspiration for words, you can do a simple search for "free printable bilingual
flashcards" and have the words pre-printed and ready to go. It's a great way to
visually celebrate bilingualism in the home. | <urn:uuid:097e3928-80a4-4520-8d0d-94f72740c07a> | {
"date": "2018-08-15T14:37:37",
"dump": "CC-MAIN-2018-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221210133.37/warc/CC-MAIN-20180815141842-20180815161842-00016.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9593291282653809,
"score": 2.828125,
"token_count": 488,
"url": "https://mom.me/lifestyle/5623-diy-bilingual-word-day-chalkboard/"
} |
Coefficient of Conservatism:
Coefficient of Wetness:
DRYLAND BITTER CRESS
A variable circumpolar species, rarely found, except on rocky shores and ridges, limestone pavements, and “mountain” summits.
Except for one collection from a disturbed roadside on Drummond Island, which is 4.5 dm tall, our plants are not over 2.5 dm tall and often are as short as 1 dm; C. pensylvanica is often taller. | <urn:uuid:2ab39420-c91e-4547-88a5-7048544eec7b> | {
"date": "2018-02-20T03:45:59",
"dump": "CC-MAIN-2018-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891812873.22/warc/CC-MAIN-20180220030745-20180220050745-00256.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9060854911804199,
"score": 2.53125,
"token_count": 110,
"url": "http://michiganflora.net/species.aspx?id=631"
} |
WikipediaRead full entry
Rhaphiolepis umbellata is a species of flowering plant in the Rosaceae family, native to Korea and Japan. Growing to 1.5 m (5 ft) tall and wide, it is an evergreen shrub with glossy oval leaves, and scented white flowers, sometimes tinged with pink, in early summer.
This plant has gained the Royal Horticultural Society's Award of Garden Merit. It is used in Japan as an astringent and a dyeing agent. The bark contains (−)-catechin 7-O-β-d-glucopyranoside and (+)-catechin 5-0-β-d-glucopyranoside.
- "The Plant List: A Working List of All Plant Species".
- RHS A-Z encyclopedia of garden plants. United Kingdom: Dorling Kindersley. 2008. p. 1136. ISBN 1405332964.
- "RHS Plant Selector - Rhaphiolepis umbellata". Retrieved 30 May 2013.
- Flavanol glucosides from rhubarb and Rhaphiolepis umbellata. Gen-Ichiro Nonaka, Emiko Ezakia, Katsuya Hayashia and Itsuo Nishioka, Phytochemistry, Volume 22, Issue 7, 1983, Pages 1659–1661, doi:10.1016/0031-9422(83)80105-8
|This Rosales article is a stub. You can help Wikipedia by expanding it.| | <urn:uuid:64a6caef-8575-4d9c-bdbe-8461dcfbaa5d> | {
"date": "2014-09-19T04:28:06",
"dump": "CC-MAIN-2014-41",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657130067.43/warc/CC-MAIN-20140914011210-00064-ip-10-196-40-205.us-west-1.compute.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.7315995693206787,
"score": 2.59375,
"token_count": 330,
"url": "http://eol.org/pages/234378/overview"
} |
Imagine a lush, beautiful island with sandy beaches, jagged cliffs and tall pine trees supported by a local community with a simple, laid back way of life. Norfolk Island is such a place. This green island paradise is found in the middle of the South Pacific Ocean and is just 35 square kilometers in size with 32km of coast line.
Holidays on Norfolk Island feel like you have been isolated from the rest of the world. The buildings have colonial architecture, a heritage from its English ancestors.
On Norfolk Island you will not find any railways, port or harbours, or even any busy roads for that matter. There are eighty kilometers of lane ways across the island and cows still have the right of way. When supplies come by ship, jetties on either side of the Island are used to send small boats out to the bigger ships to ferry in 5 tonnes of supplies at a time.
Norfolk Island Holidays
Use our guide for comparing prices and facilities for Norfolk Island accommodation. Our accommodation location map is also very handy for holiday planning. Relax in clean fresh air with a hint of pine. Go for walks along the beach or wander through historical ruins. Sample a simpler way of life in lush, green surroundings.
Norfolk Island History
The first arrivals were probably from outlying New Zealand Islands judging by the crude stone tools and banana trees left behind. The New Zealand flax plant was also thought to have been introduced by these early travelers.
Years later the First Fleet arrived in Botany Bay, (New South Wales, Australia) in 1788, Lieutenant Philip Gidley King began selecting men and women whose fate it would be to colonize Norfolk Island. Convict settlements were established and abandoned till a group of rebellious men and beautiful Tahitians were given Norfolk Island as their home. [read more]
Norfolk Island Information
Located between Australia, New Caledonia and New Zealand, the symbol for Norfolk Island is the pine tree and this features on the territory's flag. Visitors to Norfolk Island can find ruins left over from convict settlements, over 170 native plants and ferns, and several types of sea birds that come to the island to breed.
Traditional Norfolk clothing has a colonial theme and most family names are English. Not all ancestors of the current Norfolk people are English, some ancestors were Polynesian. Visitors will notice a strong Polynesian influence on Norfolk Island, as seen in the local cuisine and the hula dance. [visitor information]
Did You Know
We've been publishing Australian travel websites since 1997. We have dozens of useful travel sites featuring major destinations and regions. Check out our wide variety of Sydney accommodation and Gold Coast accommodation. We promote popular regional destinations too, like offering Noosa accommodation for example. Please enjoy our websites, we'd love your feedback. | <urn:uuid:7e245f66-81d4-418c-8ef3-fc3c33f3262d> | {
"date": "2015-02-02T00:09:50",
"dump": "CC-MAIN-2015-06",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422122122092.80/warc/CC-MAIN-20150124175522-00201-ip-10-180-212-252.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9504897594451904,
"score": 3.046875,
"token_count": 573,
"url": "http://www.discovernorfolkisland.com/"
} |
Fort Ticonderoga will host its National History Day on Saturday, March 3, 2018 in the Mars Education Center. The 2018 theme is “Conflict and Compromise in History.” Students can participate in five categories: historical paper, exhibit, website, documentary, or performance. Students compete in two divisions: Junior (grades 6-8) and Senior (grades 9-12). Six northern New York counties are eligible to participate: Clinton, Essex, Franklin, Hamilton, St. Lawrence, and Warren.
The first and second place winners in each category and in both divisions advance to the New York State History Day contest in Cooperstown, New York, on Monday, April 23, 2018. The top finishers at the state level advance to the National History Day contest in College Park, Maryland, June 10-14, 2018.
“More than half of a million students from all 50 states participate annually in a program that develops the critical thinking skills necessary for success in today’s business world,” said Rich Strum, Director of Academic Programs at Fort Ticonderoga. “A recent study found that this project-based program has proven benefits such as increased test scores, greater aptitude for reading comprehension, and analytical skills.”
North Country teachers interested in learning more about History Day can contact North Country History Day Coordinator Rich Strum, Director of Academic Programs at Fort Ticonderoga, at [email protected].
America’s Fort is a registered trademark of the Fort Ticonderoga Association.
Photo: Students from Gouverneur Middle School participated in North Country History Day held at Fort Ticonderoga in March 2017. North Country students are working on their projects now in preparation for North Country History Day on Saturday, March 3, 2018, at Fort Ticonderoga. | <urn:uuid:03905453-f434-43c3-a651-52cc5a379af6> | {
"date": "2019-04-25T02:46:43",
"dump": "CC-MAIN-2019-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578678807.71/warc/CC-MAIN-20190425014322-20190425040322-00256.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9201233983039856,
"score": 2.6875,
"token_count": 382,
"url": "https://www.fortticonderoga.org/blog/north-country-history-day-presented-fort-ticonderoga-march-3-2018-conflict-compromise-history/"
} |
To receive the best care, you should always first consult your primary care doctor, and they might recommend you see a neurologist, or they might not be able to provide a satisfying answer for your concerns. It is good to be aware then of what a neurologist does and the symptoms they treat.
What Is a Neurologist?
A neurologist is a specialist who treats diseases in the brain and spinal cord (the central nervous system), peripheral nerves (nerves connecting the brain and spine to the organs, like the lungs or liver), and muscles. Neurological diseases can include headaches; epilepsy; stroke; movement disorders, such as tremor or Parkinson’s disease; and many others. Read more below about the most common symptoms of neurological disease.
Top 10 reasons you may want to see a neurologist:
- Headaches – Headaches are something we all experience. We can feel them stretching into our sinuses, across the top of our head, down through the muscles of the head, neck, and shoulders or along the base of the skull and brain. They can be caused by many conditions from a sinus infection to a throbbing toothache from a visit to the dentist. Symptoms of more serious headaches, including migraines, may be vomiting, a headache that becomes more severe or is continuous, a headache that comes on suddenly or pain that is worsened by strain, a headache that starts early in the morning, changes in vision, or even seizures. If your headache symptoms are severe enough, your primary care doctor may refer you to a neurologist.
- Chronic pain – Chronic pain is pain that lasts for months or even years. This pain can be the result of illness or injury, but when it lasts longer than the usual recovery time, it can become a symptom of a different problem. When this pain is not something your primary care physician can help you manage, you may choose to see a neurologist, especially if you have other symptoms along with the pain like weakness, numbness, or problems with bladder or bowel control.
- Dizziness – Dizziness can come in different varieties. Neurologists treat dizziness that is a symptom of vertigo or disequilibrium. Vertigo makes you feel as if you or the things around you are spinning; disequilibrium is difficulty keeping your balance. Your primary care doctor can help you decide if your dizziness is severe enough to see a neurologist.
- Numbness or tingling – Numbness or tingling can happen for many different reasons, some as simple as sitting in a way that cuts off your blood circulation or having not eaten. However, if this numbness continues, comes on suddenly, or only happens on one side of the body, it may be time to see a neurologist. Numbness or tingling symptoms like those described can also be signs of a stroke, in which case you need to get help very quickly. While your primary care doctor can help you evaluate these symptoms, if you think you are having a stroke, get immediate medical help.
- Weakness – Feelings of weakness that you should see a doctor for are different than tiredness or muscle aches after a long hike or lifting too many weights. Muscle weakness where you feel like it takes extra effort to move your arms and legs or make your muscles work is a symptom you should consult your doctor about. It could be caused by a more serious condition or disease of your nervous system, such as stroke.
- Movement problems – Problems moving, like difficulty walking, being clumsy, unintentional jerks or movements, tremors, or others, can be symptoms of a problem in your nervous system. You may want to see a neurologist if these movement problems interrupt your daily life, though something like a tremor can be a side effect of medication or anxiety. However, if your tremors also affect your daily activities, you may want to see a neurologist.
- Seizures – Seizures can be almost unnoticeable or very extreme. Symptoms of seizures can range from staring to loss of consciousness, jerking movements of the arms and legs, breathing problems, confusion, or loss of consciousness. While some seizures could be caused by low blood sugar or withdrawals from addictive substances, seizures that seem sudden or without any obvious cause are symptoms you should see your doctor about. Your primary care doctor can help you determine how serious your seizure is and if you should see a neurologist.
- Vision problems – Difficulty seeing can be caused by aging or by the nervous system. If the difficulty is sudden and happens in both eyes, you may want to have your vision evaluated. Either an eye doctor or your primary care doctor can advise you on whether you should see a neurologist about your vision problem.
- Memory problems or confusion – Problems speaking, extreme problems with memory, changes in personality, or confusion are all symptoms that could be caused by disorders or problems in the brain, spine, and nerves. Some of the symptoms may be due to learning disabilities or they may be caused by a disease like Alzheimer’s. Your primary care doctor can help you examine your symptoms and decide if you need to see a neurologist.
- Sleep problems – While we know many obvious causes of sleep problems, going to bed too late, having a condition like sleep apnea or anxiety, nightmares, or others, some sleep problems are neurological disorders. An example of this is narcolepsy, which is a chronic, genetic disorder with no known cause that affects the body’s central nervous system.
Many of these symptoms could be part of a disorder that is not neurological. Your primary care doctor is your greatest resource in helping you decide if you should see a neurologist. However, if your symptoms are severe enough (as in the case of stroke) or you are still not confidant in your primary doctor’s recommendations, you may choose to make an appointment with a neurologist. | <urn:uuid:752f869a-acbd-414e-9a99-c1477e17c9eb> | {
"date": "2015-05-23T01:18:34",
"dump": "CC-MAIN-2015-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-22/segments/1432207926964.7/warc/CC-MAIN-20150521113206-00259-ip-10-180-206-219.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.948150098323822,
"score": 3.28125,
"token_count": 1213,
"url": "http://healthcare.utah.edu/neurosciences/neurology/neurologist.php"
} |
Ali’iolani Hale means “House of the Heavenly King” in Hawaiian. It’s one of Honolulu’s must-see landmarks that houses the Supreme Court of Hawaii, the court administration offices, a law library, and the King Kamehameha V Judiciary History Center. Just outside is the King Kamehameha the Great Statue and directly across the street is Iolani Palace. In 1972, the building was listed on the US National Register of Historic Places. Look for the Ali’iolani Hale each week on Hawaii 5-0!
The Ali’iolani Hale was designed by Australian Thomas Rowe in an Italian Renaissance Revival as the royal palace for King Kamehameha V. In Hawaiian, “Ali’iolai” means “House of the heavenly King”, Ali’iolani was also one of the given names of Kamehameha V. On February 19, 1872 King Kamehameha V laid the cornerstone for the building that he had commissioned as a government office building not a palace. He died before the building was completed. It was dedicated in 1874 by King David Kalakaua.
Facts & Trivia
- Island: Oahu
- Duration: Drive-by Only
- Amenities: No amenities at this location on our tours.
- Insider Tip: Look for the King Kamehameha the Great Statue out front, and the Iolani Palace across the street!
- Fun Fact: A major reconstruction of Ali’iolani Hale went underway in 1911 after the wooden beams and floors were damaged by termites. Plus, the building was deemed unsafe because it was not fireproof.
- What to Expect: Nearby landmarks like Kawaiahao Church, Hawaii State Library, Honolulu Hale and the Hawaii State Capitol Building.
- Pop Culture: The building was used in three different episodes of LOST, twice as a court office and once as a university library. | <urn:uuid:3c4220ab-5b13-4a1d-be69-7f29934e05bb> | {
"date": "2018-06-21T17:53:05",
"dump": "CC-MAIN-2018-26",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267864256.26/warc/CC-MAIN-20180621172638-20180621192638-00336.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9592050909996033,
"score": 2.859375,
"token_count": 416,
"url": "https://www.discoverhawaiitours.com/aliiolani-hale/"
} |
Katherine von Bora
November 10, 1983, marked the five hundredth anniversary of the birth of Martin Luther. We have heard a great deal about this courageous reformer and his ministry. But I want to focus our attention now not on Luther the preacher and leader, but on Luther the husband and father; for I want you to meet Katherine von Bora, the nun who became Martin Luther's devoted wife. He called her "Kitty, my rib," and he loved her dearly.
Katherine was born January 29, 1499, at Lippendorf, Germany, about six miles south of Leipzig. When her mother died five years later, her father put Katherine into a boarding school, and then, when she was nine, placed her in the Cistercian convent at Nimbschen in Saxony. It was not an easy place for a little girl to grow up, but at least she had protection, food, and friends. On October 8, 1515, she was "married to Christ" and officially became a nun. Little did she realize that, two years later, a daring Wittenberg professor named Martin Luther would nail his ninety-five theses to the church door and usher in a religious movement that would change her life.
As the Reformation doctrine spread across Germany, numbers of monks and nuns became believers and sought to escape from their convents and monasteries. Some of the nuns who sought freedom were severely punished, and some who escaped were brought back into even worse bondage. Twelve nuns at the Nimbschen convent somehow got word to Luther that they wanted to get out, and he arranged for their escape.
On Easter evening, April 5, 1523, a brave merchant and his nephew, Henry and Leonard Koppe, drove a wagonload of barrels into the convent, put each of the twelve nuns into a barrel, and drove away. When a suspicious man asked Koppe what he was carrying in the barrels, he replied, "Herring." Three of the girls were returned to their homes, but the other nine were taken to Wittenberg where husbands would be found for them. Two years later all of them had husbands—except Katherine von Bora.
Luther did his best to match her with a godly husband, but all his attempts failed. The one man she really fell in love with ran off and married another girl. Luther urged her to marry Pastor Casper Glatz, but she refused. She was living with some of the leading citizens in Wittenberg and learning how to be a lady and manage a household, so those two years of waiting were not wasted. Finally, she let it be known that if Doctor Luther were to ask her to be his wife, she would not say no.
It was not that Luther was against marriage, but he knew that he was a marked man and that, if he married, he would only put his wife and family into great danger. He urged others to marry, if only to spite the devil and his teaching (the policy of Rome concerning married clergy). How could a man who was declared a heretic by the pope and an outlaw by the Kaiser take a wife and establish a home? But as the months passed, Luther weakened. He wrote to a friend, "If I can swing it, I'll take my Kate to wife ere I die, to spite the devil." Not the least of Luther's concerns were the economic factors involved in marriage. He accepted no payment or royalties for his books, his own income was unsteady and meager, and he was known for his generosity to anybody in need. If he wanted to deprive himself that was one thing, but did he have the right to force his wife to make such constant sacrifices?
On June 13, 1525, Dr. Martin Luther and Katherine von Bora were married in a private ceremony at the Black Cloister, the "converted monastery" where Luther lived. As per the custom, two weeks later there was a public ceremony at the church. A host of friends attended, and the couple received many choice gifts. Of course, the enemy immediately circulated slanderous stories about the couple, but few people believed them. One man even said that their first child would be the Antichrist.
Luther was forty-two years old and Katherine was twenty-five. Would the marriage succeed? History records the glorious fact that the marriage not only succeeded, but set a high standard for Christian family life for centuries to come. The church historian Philip Schaff wrote:
The domestic life of Luther has far more than a biographical interest. It is one of the factors of modern civilization. Without Luther's reformation clerical celibacy, with all its risks and evil consequences, might still be the universal law in all Western churches. There would be no married clergymen and clerical families in which the duties and virtues of conjugal, parental, and filial relations could be practiced. . . . Viewed simply as a husband-father, and as one of the founders of the clerical family, Luther deserves to be esteemed and honored as one of the greatest benefactors of mankind.
While we are at it, let's give some bouquets to Katherine too. It was not easy to convert a rundown cloister into a comfortable home. Nor was it easy to convert a hyperactive professor-preacher into a patient husband and father. She always called him Doctor Luther, but Luther had a number of pet names for his Katherine. "Kitty, my rib" is perhaps the best-known nickname, but he also called her Selbander, which is German for "better half." It was not unusual for him to refer to her as "my Lord Kate" or even "Doctor Katherine" (she was an excellent nurse and dispenser of herbal medicines). When he felt she was giving too many orders, he quietly called her Kette, the German word for "chain."
"There is a lot to get used to in the first year of marriage," said Luther, and no husband knew this better than he. Accustomed to planning his own day, Luther had to learn that another mind and heart were now involved in his schedule. "Wives usually know the art to ensnare a man with tears and pleadings," he wrote. "They can turn and twist nicely and give the best words."
But he had nothing to fear, for nobody was a better manager of a house or a home than Katherine Luther. She transformed the old cloister into a fairly comfortable house, and, like the energetic woman of Proverbs 31, she launched into various enterprises to feed and sustain her household. She kept cows for milk and butter and for making cheese that, said her guests, was better than what they purchased at the market. She started a piggery because her husband liked pork, and this gave Luther a new name for his wife: My Lord Kate, Mistress of the Pigsty.
She turned a neglected field into a productive garden and even planted an orchard. What produce she did not use herself, she sold or bartered at the market and used the income to purchase items for the home. She even stocked a pond with fish! "Have I not at home a fair wife," Luther said proudly, "or shall I say boss?" It was not long before the Black Cloister became a crowded and busy place. Catherine had not only her own children to care for— six of them—but also (at various times) her own niece and nephew, eleven of Martin's nieces and nephews, various students who boarded with them, and ever-present guests who came to confer with her famous husband. Before the Reformation, forty monks had lived in the Cloister; now, nearly as many joyful Christians lived there, learning to serve one another.
Luther wisely permitted his wife to be in charge of the management of the home. To begin with, he was far too busy to worry about such things, and, he had to admit, she did a far better job than he could do. Katherine not only cared for him and the household, but she ministered to the needs of people all over Wittenberg. She listened to their problems, gave them care and medicine in their sicknesses, counseled them in their sorrows, and advised them in their business affairs. The town recognized that the Luther household was an exemplary Christian home, and much of that success was due to Katherine.
It was not easy being married to Martin Luther. He would let his food get cold while he debated theology with his guests or answered the questions of students. "Doctor," said Katherine one day as the dinner grew cold, "why don't you stop talking and eat?" Luther knew she was right, but he still snapped back, "I wish that women would repeat the Lord's Prayer before opening their mouths!" One day he said, "All my life is patience! I have to have patience with the pope, the heretics, my family, and Kate."
But out of those mealtime conversations came one of Luther's finest books, The Table Talk of Martin Luther. Baker Books has reprinted the edition edited by Thomas S. Kepler, and I recommend it to you. As you read it, keep in mind that it was Katherine Luther who really made the book possible. It was at her table that these sparkling conversations were recorded—while the food grew cold. Luther called marriage "a school for character," and he was right. He realized that his own life was enriched because of the love of his wife and family. When I was teaching the history of preaching to seminary students, I reviewed Luther's philosophy of ministry and read many of his sermons, and I was impressed with the many allusions and illustrations drawn from the home. I was also impressed with Luther's Christmas sermons, and I wonder if they would have been as effective had he remained an unmarried man.
As in every home, there were times of trial and sorrow. The Luthers had six children: Hans (b. 1526), Elizabeth (b. 1527, d. 1528), Magdalene (b. 1529, d. 1542), Martin (b. 1531), Paul (b. 1533), and Margaret (b. 1534). Luther would arise at six each morning and pray with the children, and they would recite the Ten Commandments, the Creed, and the Lord's Prayer, and then sing a psalm (Luther himself was an excellent musician). He would then hurry off to preach or to lecture and would be busy the entire day.
But Luther was not a robust man, and he had many ailments that often struck him without warning. On several occasions, Katherine prepared to become a widow, but the Lord graciously healed her husband and restored him to her. In 1540, it was Katherine who was despaired of, her condition considered hopeless. Day and night her husband was at her side, praying for God's mercy on her and the children, and the Lord graciously answered. Six years later, it was Martin who was being nursed by Katherine, but his recovery was not to be, and on February 18, 1546, he entered into glory. I am sure that one of his first acts of worship in heaven was to thank God for Katherine.
Let me share two of my favorite stories about Katherine Luther. At family devotions one morning, Luther read Genesis 22 and talked about Abraham's sacrifice of Isaac. "I do not believe it!" said Katherine. "God would not have treated his son like that!" "But, Katie," Luther quietly replied, "He did!"
During one very difficult period, Luther was carrying many burdens and fighting many battles. Usually jolly and smiling, he was instead depressed and worried. Katherine endured this for days. One day, she met him at the door wearing a black mourning dress.
"Who died?" the professor asked.
"God," said Katherine.
"You foolish thing!" said Luther. "Why this foolishness!"
"It is true," she persisted. "God must have died, or Doctor Luther would not be so sorrowful."
Her therapy worked, and Luther snapped out of his depression. It is interesting to read Luther's letters to his wife and note the various ways he addressed her: "To the deeply learned Mrs. Katherine Luther, my gracious housewife in Wittenberg"; "To my dear housewife, Katherine Luther, Doctress, self-martyr at Wittenberg"; "To the holy, worrisome Lady, Katherine Luther, Doctor, at Wittenberg, my gracious, dear housewife"; "Housewife Katherine Luther, Doctress, and whatever else she may be"!
After Luther's death, the situation in Germany became critical and war broke out. Katherine had to flee Wittenberg, and when she returned, she found her house and gardens ruined and all her cattle gone. Then the plague returned, and Katherine and the children again had to flee. During that trip, she was thrown out of a wagon into the icy waters of a ditch, and that was the beginning of the end for her. Her daughter Margaret nursed her mother tenderly, even as her mother had nursed others, but there was no recovery. Katherine died on December 20, 1552, at Torgau, where she is buried in St. Mary's Church.
On her monument, you will read: "There fell asleep in God here at Torgau the late blessed Dr. Martin Luther's widow Katherine von Bora."
They could have added: "Many daughters have done virtuously, but thou excellest them all" (Prov. 31:29).
I suggest that we make either January 29 or June 13 "Pastors' Wives' Day," not only in honor of Katherine von Bora, but in honor of all pastors' wives everywhere—that great host of sacrificing women of God who make it possible for their husbands to minister. I salute these women who must often turn houses into homes, who carry the burdens of their people as well as their own, who do without that others may have, who cheerfully bear criticism, and who do it all to the glory of God.
By the way, what have you done lately to encourage your pastor's wife?
By Warren Wiersbe. Published by Baker Books. 2009. | <urn:uuid:8681afaa-1f0d-402a-aa44-1be0dd3b922e> | {
"date": "2014-12-20T09:39:45",
"dump": "CC-MAIN-2014-52",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1418802769642.136/warc/CC-MAIN-20141217075249-00067-ip-10-231-17-201.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9913862347602844,
"score": 2.796875,
"token_count": 2958,
"url": "http://www.haventoday.org/sample-chapter-martin-luther-gd-756.html"
} |
This course explores and compares Euclidean and non-Euclidean geometries and their axiomatic bases. Euclidean, finite, hyperbolic, spherical, and Taxicab geometries will be included. The approach is designed for teachers, with an emphasis on individual and group projects, applications, and the use of technology to explore geometric ideas. Prerequisites: At least an undergraduate minor in mathematics, with an undergraduate geometry course or experience teaching high school geometry, or consent of instructor.
Please contact Erick Hofacker, 214C North Hall, 715-425-4267, E-mail [email protected] for further information about this course. | <urn:uuid:356d8548-b044-4317-b7fd-438c1ac9a440> | {
"date": "2016-12-03T21:51:25",
"dump": "CC-MAIN-2016-50",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541140.30/warc/CC-MAIN-20161202170901-00400-ip-10-31-129-80.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8665379881858826,
"score": 2.6875,
"token_count": 144,
"url": "http://www.uwrf.edu/MATH/GraduateProgram.cfm?respOpt=TRUE"
} |
Coping with the news of a death of someone we know is always difficult. Sometimes it is anticipated such as when a friend or loved one has been ill, or it comes as unexpected news such as an accident.
But hearing about a suicide can cause many ambiguous feelings. Shock and upset at the initial news. It’s the unexpectedness of the news that can be so unsettling and hard to take in. We can’t quite seem to absorb the reality of what has happened – its feel unreal. We don’t know how to feel or what to think about it.
Then questions set in in an attempt to understand it–‘Why would they do this?’ ‘What were they thinking?’ to ‘How did I not see it?’, ‘what could I have done to prevent this?’. These are just some examples of the many questions that arise when somebody ends their life in unforeseen circumstances.
Stages of Grief:
While you may be aware of the “grief stages,” it’s truly different for each person. Some of the common emotions experienced by anyone who mourns are listed below. You may encounter some or all of them, and in no particular order…
- SHOCK and DENIAL: The daze we feel immediately after hearing of the death of someone we know is the mind’s first line of defence. It insulates us from processing the enormity of the situation, allowing us to function in a time of great distress.
- ANGER: It is common to feel anger toward the person we have lost. Many who mourn feel a sense of abandonment. Others feel anger toward a real or perceived culprit or God.
- BARGAINING: ’If only they had…’ ‘If I had done…’ ‘If only…’
- SADNESS: Once the “reactive” emotions have either passed or become manageable, the basic sadness that accompanies any loss moves to the forefront. This may be felt more acutely when we are confronted with reminders or special occasions. As we gradually learn to accept our loss and embrace happy memories of our lost loved one, we make room in our hearts for happiness to re-enter.
- ACCEPTANCE: This is the mourner’s goal, to accept this tragic event as something that cannot be changed. Only with acceptance, can you move on with our lives.
“You were a moment in life that comes and goes, a riddle, a rhyme that no one knows. A change of a heart, a twist of fate. Couldn’t fix it, it’s too late” Kodaline
Friends and family who have experienced a suicide face all the same emotions as with any death, but they also face a somewhat unique set of painful feelings on top of their grief…
- GUILT: Could we have, might we have, or should we have done something to prevent the suicide. This mistaken assumption is one of the hardest to let go of for people. We can also struggle if there are unreconciled aspects of the relationship such as an argument or unanswered call or text before the death. This can be particularly strong if we know that the person was struggling before they died.
- STIGMA: Society still mis-assigns a stigma to suicide, and it is largely misunderstood. People hold many strong views about suicide and those who choose it as a way of ending their pain.
- DISCONNECTION: When we lose a loved one to an illness or an accident, it is easier to retain happy memories of them. We somehow find it easier to accept the death as it was unavoidable or beyond our control. But with suicide, we struggle with accepting it was out of our hands – we can feel we should have noticed something-somehow intervened. Because our friend or classmate seems to have made a choice about ending their life, we can feel a little disconnected from happy memories we shared with them. We are in a state of conflict with them, and we are left to resolve that conflict alone.
How can we help each other cope with the death of a friend or loved one through suicide?
Normalise the grief. Allow ourselves to engage in the same rituals we would use to grieve any death. It may be helpful to remind ourselves that suicide is a tragic outcome of depression or another mental health or coping strategy that the person was struggling with and just could not find a way through.
Respect differences. Remind ourselves that everyone grieves in different ways and at a different pace and so how others may appear to be coping may not be what they are feeling on the inside.
Encourage openness and stay close. Talk openly about our friend or classmates to each other and support each other through the grief.
Plan ahead. Plan ways to mark their passing and share thoughts and memories with each other.
Make connections. Circulate information about college student support services, support groups and resources for coping with loss through suicide.
Need for reason. “What if” questions can arise after any death. After a suicide, these questions may be extreme and self-punishing — unrealistically questioning or blaming those left behind for failing to predict the death or to successfully intervene. In such circumstances, it is important to realise that there may not have been any outward signs and accept that this was a decision made, as difficult as this is to understand.
How can DIT help you?
The DIT Counselling Service, the DIT Chaplaincy Service and Staff Body are here to support all students going through bereavement. As students you can also help each other through watching out for each other and/or getting each other the help you need by contacting one of the services in DIT:
The DIT Counselling Service: 014023352/0860820543
The DIT Chaplaincy Service: (01) 402 3639 / (087) 7477110
Samaritans: 116 123
Aware.ie: 1800080 48 48
Pieta House: 1800 247 247 | <urn:uuid:b5bac880-8bb6-4d71-99db-b6881125d4d3> | {
"date": "2020-01-21T13:33:04",
"dump": "CC-MAIN-2020-05",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250604397.40/warc/CC-MAIN-20200121132900-20200121161900-00016.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9569482803344727,
"score": 2.828125,
"token_count": 1274,
"url": "http://edition.ie/2018/01/12/how-to-cope-when-someone-close-to-you-dies/"
} |
Allan Schwartz, LCSW, Ph.D. was in private practice for more than thirty years. He is a Licensed Clinical Social Worker in the states ...Read More
“Scientists at the University of Liverpool argue that anti-obesity drugs fail to provide lasting benefits for health and wellbeing because they tackle the biological consequences of obesity, and not the important psychological causes of over consumption and weight gain.”
How often have I seen just this type of headline, comment, research result and conclusion? It appears that, in the area of the behavioral sciences, medication alone cannot bring lasting change.
In the case of obesity, researchers in England decided that the reason anti obesity medications fail to bring lasting change is that they do not address the underlying psychological reasons for the weight gain. Even after physiological and nutritional factors are taken into consideration, there is more to weight loss than chemicals.
In my experience and that of many other psychiatrists, psychologists and clinical social workers, addressing underlying psychological dynamics and ways of thinking are necessary to bring real change to peoples’ lives.
I have worked with several people who suffered from obesity and found that the driving force that kept the weight on for many of them were sexual and emotional.
While it is often difficult to determine what came first, the excessive weight or depressed feeling, I have no doubt that depression and anxiety are powerful emotional forces in keeping some people obese. Does this seem strange to read?
Keep in mind that excessive weight, for at least some obese people, serves as a defense mechanism against intimacy. Yes, over weight people do have sex and do marry and raise children. At the same time, obesity keeps many other people at a distance. More than one obese woman who consulted me for psychotherapy and reported feeling threatened by uninvited male attention if they were thinner. In a few of these cases there was a history of sexual and physical abuse during childhood.
Feelings of depression, anxiety and panic can be the result of defense mechanisms. This is why many people placed on anti depressants medicines without psychotherapy do not get as good results as those who were in psychotherapy with or without medicines. I clearly remember being taught during my days of training that, yes, you can take symptoms away temporarily but what will you replace them with?
One of the important goals of psychotherapy is to replace symptomatic ways of thinking and behaving with healthy and adaptive ones. It makes no difference whether the therapy is psychodynamic, cognitive, group, family or marital. While medication can help by providing very depressed people with the energy they may not possess to engage in therapy, it is psychotherapy that leads to lasting change.
If you are depressed, obese, anxious or experience any number of the behavioral disorders, do not rely only on medication. Seek psychotherapy, wether of the psychodynamic or cognitive behavioral type.
Your comments, experiences and questions are welcome.
Allan N. Schwartz, PhD. | <urn:uuid:939dfb09-b08b-4f07-a142-a4da4fac689a> | {
"date": "2018-02-21T01:34:41",
"dump": "CC-MAIN-2018-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-09/segments/1518891813187.88/warc/CC-MAIN-20180221004620-20180221024620-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9636980891227722,
"score": 2.515625,
"token_count": 597,
"url": "https://www.mentalhelp.net/blogs/healing-is-it-just-a-matter-of-medication/"
} |
The short version of how scientists believe the Earth formed goes like this: Roughly 4.5 billion years ago, the solar system was a spinning disk of gas and dust that looked something like a record, and one groove in that record collapsed into a molten orb that became our planet. About 700 million years later, when Earth was crusty and dried-out, comets, asteroids and other watery space wanderers bombarded the world. In just tens or hundreds of thousands of years, these impacts deposited our life-giving water.
The question is where all that water came from. For decades, astrophysicists have suspected that the water in these small icy bodies originated in the center of the freezing-cold outer zone of planet-forming disks. Yet the waters temperaturejust above absolute zeromade it virtually impossible to detect, preventing scientists from confirming their suspicion.
But now a team of researchers has seen the signs. Using the Herschel Space Observatory, scientists have spied faint signature of water on the surface of an expansive and chilly region of a planet-forming disk spinning around the star TW Hydrae. The extremely faint finding is probably the tip of a colossal celestial iceberg, as a store of water amounting to thousands of Earth oceans probably hides in the center of the disk.
"We now have a glimpse at a very early stage in planetary systems we had only hypothesized to exist," says space scientist Diane Wooden of NASA Ames Research Center, who was not involved in the study. "This has been an extremely difficult signature to find."
The Search for Ice
TW Hydrae, located 175 light-years away from Earth, is between 5 million and 10 million years old. Compared with the 4.5-billion-year-old sun of ours, its practically an infant. The star is so young and so close to Earth that scientists look to it for a picture of what our own solar system looked like in its early years. Most captivating of all is TW Hydraes spinning disk of gas, dust, water and other planet-building materials; it stretches 200 astronomical units (AU) from the star (one AU is the sun-to-Earth distance). By comparison, the dwarf planet Pluto at its farthest orbital distance is only 49 AU from the sun.
But its not easy to find ice, even around a well-studied star. Water is easier to find when its hot, because water vapor emits strong signals that instruments called spectrometers can detect. TW Hydrae is hot enough to thaw the ice in the part of its planet-forming disk thats within three to five AU, so astronomers can see that easily. However, beyond TW Hydraes three to five AU border, called the snow line, the signal fades because water freezes. Scientists whod looked at the TW Hydrae system before couldnt detect that distant ice, and estimate how much of it might be around to form comets later in the star systems life.
In May 2009, astronomers got a new tool when the European Space Agency (ESA) launched the Herschel Space Observatory, an orbiting telescope designed to pick up the faintest signals from the coldest objects in space. The team behind this study, led by astrophysicist Michiel Hogerheijde of Leiden University in the Netherlands, pointed Herschel at TW Hydrae and opened the shutter for 18 hours.
"Before Herschel, this was simply not feasible. You have to get outside Earths atmosphere to see the water, so you go to space," Hogerheijde says. "The other space telescopes were not sensitive enough."
Although TW Hydraes disk is extremely cold beyond 100 AU (just 20 degrees above absolute zero), a weak influx of ultraviolet and X-ray light both from TW Hydrae and nearby stars can form fleeting water vapor molecules. When a molecule of water ice absorbs one of these wavelengths photons, the molecules two hydrogen and one oxygen atoms split into one hydrogen and one oxygen-hydrogen molecule. They quickly recombine, but Herschel can see the faint infrared radiation they emit (if it stares long enough, that is).
"Its like when you put an aluminum ball in the microwave. The microwave beam liberates electrons from the aluminum, which we see as sparks," Hogerheijde says.
To the teams surprise, the cold water vapor signal was three to five times weaker than expected. Yet by comparing the result to a laboratory benchmark, they estimated the icy grains deep inside the disk harbor as much water as 6500 Earth oceans.
Just Like Earth?
Wooden says the finding fills in a crucial missing piece of the puzzle of where the water in the solar system hid until Earth was ready to receive it in the form of comets and asteroids. It also supports planet-formation theories that suggest rocky planets like ours develop close to their parent star. Because water couldnt have survived on the young Earth, there had to be a way for it to come here later (and a reservoir in the outer solar system to provide it.)
"We can be more certain there really was a reservoir of icy bodies and comet material far away from the sun that supplied water to the inner Solar System," Wooden says.
The next question for Hogerheijde and his team is whether TW Hydrae is a typical watery example or an oddity. So he hopes to do similar stare-downs at three other nearby planet-forming disks to see how much water they hold.
"If these systems have the signal strength we think they do, correcting for distance, we should be able to make good detections," Hogerheijde says. | <urn:uuid:4c088f50-5222-4712-9eb4-e1dd559c166b> | {
"date": "2014-09-30T10:11:43",
"dump": "CC-MAIN-2014-41",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1412037662882.4/warc/CC-MAIN-20140930004102-00282-ip-10-234-18-248.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9467059969902039,
"score": 4.28125,
"token_count": 1149,
"url": "http://www.popularmechanics.com/science/space/deep/an-infant-star-system-with-thousands-of-oceans-worth-of-water-6520418"
} |
Are floods, tornados, and tire fires your thing? The new Wisconsin Emergency Management Images and Historic Materials contains images taken by emergency management officials in the aftermath of numerous disasters that have hit Wisconsin. Particularly signficant are images of the 1996 Oakfield tornado a F5 with estimated wind speeds of 265 mph. There were no fatalities in this event, but the damage amounted to $39.5 million in public/private property, and $900,000 in crop losses.
Also included in the collection are remarkable photographs of the 1965 Monroe tornado, which was just one event in the 12 hour rash of Midwest tornados known as the Palm Sunday outbreak.
The materials are a photographic record of the meteorological and climatological history of Wisconsin and offer an understanding of how natural disasters, and the efforts to mitigate their impacts, have transformed Wisconsin’s landscape and built environment over time. They also illustrate changes in emergency preparedness and response practices over time and the materials capture an important piece of Wisconsin history—traumatic events that triggered massive public response and recovery efforts and changed Wisconsin communities. | <urn:uuid:7fc1e665-423d-4362-b014-da557cfe2197> | {
"date": "2019-05-22T19:54:57",
"dump": "CC-MAIN-2019-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232256948.48/warc/CC-MAIN-20190522183240-20190522205240-00536.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9503912925720215,
"score": 2.84375,
"token_count": 219,
"url": "https://www.library.wisc.edu/digital-library-services/2014/12/03/tornados-floods-and-tire-fires-oh-my/"
} |
Irvine, Calif. -- UC Irvine College of Medicine researchers made a surprising find recently: Many drug addicts had a childhood history of attention-deficit disorder. And while this discovery may prove invaluable for treating ADD and drug abuse, it was how the researchers came across this link that immediately interested them.
The link was uncovered by chance while testing a software program called PCAD 2000--a program designed for the more limited purpose of detecting cognitive impairment.
While researchers warn that high rates of childhood ADD do not mean that the disorder causes drug addiction--only that ADD and addiction are somehow related--they do believe this indicates that the software may be more sensitive than other tests designed to screen for cognitive impairment.
Dr. Louis Gottschalk, professor of psychiatry, and his research team conducted the study, which appears in the December issue of the American Journal of Drug and Alcohol Abuse.
According to Gottschalk, who co-invented the software, while the program worked just as well as traditional tests for detecting confusion, muddled thinking or other cognitive dysfunctions in the patients, PCAD 2000 uncovered something the traditional methods appeared to miss: Nearly 30 percent of the patients had ADD as children.
Gottschalk and his colleagues reached this conclusion by comparing results from more than 100 men who were in drug abuse recovery programs at UCI Medical Center and the Long Beach Veterans Affairs Medical Center in Long Beach. The software analyzes speech and written content for patterns that indicate any number of disorders showing cognitive impairment. Except for the finding on ADD, the software matched the results of the other tests.
The findings suggest that the software could be used in place of other traditional tests to quickly and effectively determine cognitive impairment in patients.
"The software was performing just as well as all the other tests used on cognitive impairment," Gottschalk said. "But the software's findings on ADD surprised us. Only further research can tell us whether ADD may cause drug addiction later in life, or if addiction and ADD may have some other, more fundamental cause."
Gottschalk has been fine-tuning his cognitive impairment software for more than 40 years. In 1988, he revealed his software was used to determine that former President Ronald Reagan suffered from cognitive impairment. More recently, he used the software to analyze the cognition of Theodore Kaczynski, the convicted Unabomber.
For more information on Gottschalk's work and the PCAD 2000 software, see the Web site at http://www.gb-software.com.
A complete archive of press releases is available on the World Wide Web at http://www.today.uci.edu.
The above story is based on materials provided by University Of California - Irvine. Note: Materials may be edited for content and length.
Cite This Page: | <urn:uuid:401cda21-0a47-4a99-9872-362830ead773> | {
"date": "2015-02-01T16:46:11",
"dump": "CC-MAIN-2015-06",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-06/segments/1422121744242.57/warc/CC-MAIN-20150124174904-00020-ip-10-180-212-252.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9532856941223145,
"score": 2.859375,
"token_count": 574,
"url": "http://www.sciencedaily.com/releases/2002/11/021126072117.htm"
} |
The first experimental drug that fights both conventional and drug-resistant forms of tuberculosis is advancing to late-stage clinical testing, researchers said, raising hope for a new way to stem the growing threat of drug-resistant TB.
The trial, financed in part by the Bill & Melinda Gates Foundation, will test the safety and effectiveness of a new three-drug cocktail known as PaMZ that in mid-stage testing helped to significantly reduce treatment times.
In a statement announcing the trial, Microsoft co-founder Bill Gates, co-chair of the Gates Foundation, said the treatment could "reduce the time required to cure drug-resistant TB from two years to just six months" and sharply cut the cost of a cure in low-income countries. He called on other funding groups to back the trial, which is estimated to cost $US58 million.
The World Health Organisation estimates that 8.6 million people developed TB in 2012 and 1.3 million died from the disease. According to the WHO, half a million people became sick with dangerous superbug strains of tuberculosis in 2012, and as many as 2 million people worldwide may be infected with drug-resistant TB by 2015.
The trial, set to begin in November, will span some 50 study sites across Africa, Asia, Eastern Europe and Latin America.
If successful, the oral treatment would eliminate the need for injectable drugs and reduce the cost of multiple-drug-resistant TB therapy in some countries by more than 90 per cent in those patients whose TB is sensitive to the three drugs.
The therapy also promises to be compatible with commonly used treatments for human immunodeficiency virus or HIV, helping the millions of people infected with both TB and HIV, the virus that causes AIDS.
Jan Gheuens, who manages the TB drug program for the Gates Foundation, said the study's results could be ready by 2017, and if the findings are positive, approval could be expected by the end of 2018.
Dr Mel Spigelman, chief executive officer of the TB Alliance, a non-profit research group that will conduct the study, said the treatment will only be effective in about a third of patients with multiple-drug resistant TB or MDR-TB.
But even at that rate, he said the therapy could help "revolutionize" treatment because currently, only about 15 percent of patients with MDR-TB get treatment, and only half of those are cured.
Standard treatment for TB usually includes a mix of four drugs over a period of six months. MDR-TB can take 18 to 24 months to treat.
The trial announcement followed the successful approval of Johnson & Johnson's drug, bedaquiline, in 2012 for the treatment of drug-resistant TB. This was the first new TB drug in more than 40 years.
Last fall, the European Medicines Agency's Committee for Medicinal Products for Human Use recommended granting conditional marketing approval for delamanid, a treatment for drug-resistant TB being developed by Japan's Otsuka. | <urn:uuid:8d6928e5-90a0-4335-b84c-3f76444db762> | {
"date": "2015-12-02T05:38:00",
"dump": "CC-MAIN-2015-48",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448399326483.8/warc/CC-MAIN-20151124210846-00070-ip-10-71-132-137.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9525138735771179,
"score": 2.640625,
"token_count": 615,
"url": "http://www.afr.com/business/health/biotechnology/gatesbacked-tb-drug-to-enter-latestage-testing-20140423-i70bc"
} |
Public space & the right to the city
- It is essential to promote social inclusion by providing spaces for people of all socio‑economic backgrounds to use and enjoy. Quality public spaces such as libraries and parks can supplement housing as study and recreational spaces for the urban poor.
- There is a need to ensure that there is an equitable distribution of public spaces within cities. Through the provision of quality public spaces in cities can reduce the economic and social segregation that is prevalent in many developed and developing cities. By ensuring the distribution, coverage and quality of public spaces, it is possible to directly influence the dynamics of urban density, to combine uses and to promote the social mixture of cities’ inhabitants.
- Rights and duties of all the public space stakeholders should be clearly defined. Public spaces are public assets as a public space is by definition a place where all citizens are legitimate to be and discrimination should be tackled there. Public space has the capacity to gather people and break down social barriers. Protecting the inclusiveness of public space is a key prerequisite for the right to the city and an important asset to foster tolerance, conviviality and dialogue.
- Public spaces in slums are only used to enable people to move. There is a lack of public space both in quantity and quality leading to high residential density, high crime rates, lack of public facilities such as toilets or water, difficulties to practice outdoor sports and other recreational activities among others.
- EXAMPLE: Corridors of freedom, Johannesburg, South Africa
This project illustrates the new vision of making public space an asset accessible to every citizen, in particular the poor. As a result of the apartheid spatial legacy, parks and public facilities were all concentrated in higher income neighbourhood while townships remain dense areas with almost no open green spaces. The corridors of freedom is an attempt to re-connect urban areas with access to recreational spaces and freedom of movement. While Apartheid policies created the green areas between townships to segregate, the corridors of freedom look to link them. (More information here) | <urn:uuid:db60fbda-38a9-403a-9455-2e08523cc27c> | {
"date": "2019-04-23T10:52:50",
"dump": "CC-MAIN-2019-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578596571.63/warc/CC-MAIN-20190423094921-20190423120921-00456.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9373287558555603,
"score": 3.734375,
"token_count": 416,
"url": "https://www.beta.uclg-planning.org/public-space-right-city"
} |
Network security is a critical part of a secure virtualization infrastructure. Refer to the following recommended practices for securing the network:
Ensure that remote management of the system takes place only over secured network channels. Tools such as SSH and network protocols such as TLS or SSL provide both authentication and data encryption to assist with secure and controlled access to systems.
Ensure that guest applications transferring sensitive data do so over secured network channels. If protocols such as TLS or SSL are not available, consider using one like IPsec.
Configure firewalls and ensure they are activated at boot. Only those network ports needed for the use and management of the system should be allowed. Test and review firewall rules regularly.
5.2.1. Securing Connectivity to Spice
The Spice remote desktop protocol supports SSL/TLS which should be enabled for all of the Spice communication channels (main, display, inputs, cursor, playback, record). | <urn:uuid:8a546194-3305-470c-9cc7-9725f4a5be2f> | {
"date": "2019-12-12T13:24:59",
"dump": "CC-MAIN-2019-51",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540543850.90/warc/CC-MAIN-20191212130009-20191212154009-00216.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9055392742156982,
"score": 2.734375,
"token_count": 189,
"url": "https://access.redhat.com/documentation/en-us/red_hat_enterprise_linux/6/html/virtualization_security_guide/sect-virtualization_security_guide-network_security_in_a_virtualized_environment-network_security_recommended_practices"
} |
Pests and Diseases
The Effect of Phylloxera on Grape Vines
Phylloxera is an extremely small aphid-like insect that feeds on grape roots. Although there are 27 known species of the pest, only one of these attacks vineyards. The insect has a complex life cycle that can only be countered by grafting Vitis vinifera cuttings onto Native American rootstocks. Once a vineyard is infected, there is no effective treatment.
The History of Phylloxera in California
California wine consumption and production have both been adversely affected by the History of Phylloxera. This pest has destroyed Vitis vinifera vineyards all over the world since the mid 19th century. Under the right conditions, it can infest and threaten a vineyard within three years.
The Effect of Pierces Disease on Grape Vines
Pierces Disease is an incurable malady that is caused by a bacterium named Xylella fastidiosa. It is carried by an insect called the glassy winged sharpshooter. Pierces Disease attacks the xylem in plants which are vessels that carry nutrients and water.
Glassy Winged Sharpshooter
The glassy winged sharpshooter carries Pierces Disease, a major threat to vineyards. The primary methods of combating the spread of this insect are quarantine, pesticides and a wasp that naturally feeds on the sharpshooter. It’s one of the major vectors that spreads disease to vineyards and is a huge problem for vineyard managers in certain regions.
Powdery Mildew’s Effect on Grape Vines
Also known as odium, powdery mildew can be a tricky vineyard disease to treat. Although vines naturally produce a substance called resveratrol to combat this scourge, powdery mildew constantly develops resistance to treatments.
The Effect of Downey Mildew on Grape Vines
Downy mildew causes yellow and brown patches to form on or near the veins of leaves. It grows on the backside of the vine’s leaf and is greyish-white in color. Rain and humidity spread spores, and downey mildew attacks both shoots and grape clusters.
The Role of Black Rot on Grape Vines
When the shoots have grown to about 10 inches long, black rot becomes a threat to vineyards. Certain fungicide sprays are usually used to combat this problem, but it can develop resistance to these treatments over time.
> Related Articles | <urn:uuid:2d29446c-ba24-4558-a11b-68b0e9b8ebe9> | {
"date": "2014-09-01T07:40:43",
"dump": "CC-MAIN-2014-35",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-35/segments/1409535917463.1/warc/CC-MAIN-20140901014517-00412-ip-10-180-136-8.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9371954202651978,
"score": 3.546875,
"token_count": 520,
"url": "http://www.calwineries.com/learn/grape-growing/pests-and-diseases"
} |
Middle and high school students often don’t know or acknowledge the health risks associated with e-cigarettes, says Matt Aiello, the dean of students at Lake Zurich High School.
“In many cases, students will minimize it. They don’t see it as big of a deal as the adults do,” Aiello said. “When I was young, we heard over and over again the ills of cigarettes. I feel the campaign to inform youth (about e-cigarettes) hasn’t been as consistent.”
Lake Zurich High will kick off its own campaign against vaping by hosting a panel discussion Monday, 7 to 8:30 p.m. in the school library. It will feature experts from Lake Zurich and beyond, and an opportunity for the audience to ask questions about e-cigarettes.
E-cigarettes are battery-powered devices that vaporize liquids called e-juice, which usually contain nicotine and other chemicals. According to the World Health Organization, the e-cigarette industry has grown from one manufacturer in China in 2005 to a $3 billion global business with 466 brands in 2014.
One reason health risks associated with e-cigarettes are not as well known among students is because there haven’t been as many scientific studies done compared to traditional tobacco products.
“That’s just because really hasn’t been enough time,” said Danielle Ryan, a community health specialist with the Lake County Health Department. “We know cigarettes are bad for your health conclusively because of all the years of research there have been. Unfortunately, it’s (e-cigarettes) just a newer product.”
Ryan, one of the speakers at the event, said the health department is not waiting to dissuade teenagers from vaping. The health department has been proactive in encouraging Lake County communities to raise to 21 the age to purchase tobacco products, including e-cigarettes.
The chemicals in e-juice can be harmful to users when vaporized, said Ryan, who is part of the health department’s Tobacco-Free Lake County effort. She added that nicotine, which is found in most e-cigarettes, is addictive and can affect brain development in youth.
Lake Zurich High’s Aiello said school officials want the panel discussion to be the first step in a longer campaign against vaping in Lake Zurich Unit District 95. He said the issue will be studied this summer.
Aiello said officials hope their efforts will reduce the number of students who vape. Some students have been caught trying to vape in class, he added.
“We want to get out ahead of it, to try to do things proactively in order to best support our students,” Aiello said. “We’ve got amazing kids here and we just want to help them make the right decisions.”
Read more at http://www.dailyherald.com | <urn:uuid:82398728-6634-4f7c-a7d7-6a8b5ed43795> | {
"date": "2018-12-10T14:57:11",
"dump": "CC-MAIN-2018-51",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823348.23/warc/CC-MAIN-20181210144632-20181210170132-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9597790837287903,
"score": 3.03125,
"token_count": 608,
"url": "https://vietvaping.com.vn/2018/04/13/dist-95-to-host-discussion-about-dangers-of-vaping-e-cigarettes/"
} |
Having organic farmed meat and milk is better for your health than non-organic produce, because it contains around 50 per cent more omega-3 fatty acids, according to a major study published in the British Journal of Nutrition today.
An international team of researchers, from universities and scientific institutes in nine countries, examined the nutritional merits of organic versus non-organic milk and meat.
Some 196 studies on milk and 67 on meat were reviewed in the largest study of its kind, which found that the benefits also extend to organic milk products such as butter, cheese, and yoghurt.
Organic milk contains 40 per cent more conjugated linoleic acid (CLA) - which is linked to a reduced risk of cardiovascular disease, certain cancers and obesity. And although it has lower levels of the essential mineral iodine, it has higher concentrations of iron and Vitamin E.
Researchers also found that organic meat had slightly lower concentrations of two saturated fats linked to heart disease.
The greater use of grazing, with animals eating a more natural grass-based diet, is a key reason for the differences, according to lead researcher Professor Carlo Leifert, from Newcastle University’s school of agriculture, food and rural development.
“Several of these differences stem from organic livestock production and are brought about by differences in production intensity, with outdoor-reared, grass-fed animals producing milk and meat that is consistently higher in desirable fatty acids such as the omega-3s, and lower in fatty acids that can promote heart disease and other chronic diseases,” he said.
Lord Melchett, the Soil Association’s policy director, helped review and edit the published study, which was funded by the European Commission, with financial and technical support from the Sheepdrove Trust.
One of the researchers, Chris Seal, Professor of food and human nutrition at Newcastle University, commented: “Omega-3s are linked to reductions in cardiovascular disease, improved neurological development and function, and better immune function.” He added: “But getting enough in our diet is difficult. Our study suggests that switching to organic would go some way towards improving intakes of these important nutrients.”
This builds on a study published by the same research team in 2014, which revealed that organic fruit and vegetables contained up to 60 per cent more antioxidants than non-organic crops.
Commenting on the latest findings on the benefits of organic produce, Helen Browning, chief executive of the Soil Association, said: “This research confirms what many people have always thought was true -what you feed farm animals and how you treat them affects the quality of the food - whether it’s milk, cheese or a cut of meat.”
She added: “Following research in 2014 confirming nutritional differences between organic and non-organic crops like fruit and vegetables – we can now say for certain that organic farming makes organic food different.”
But Ian Givens, professor of food chain nutrition at the University of Reading, urged caution: “The differences between organic and conventionally farmed produce should be evaluated as part of the whole human diet. When they are, most differences are very small indeed.”
And meat and milk remain “poor sources of polyunsaturated fatty acid and contain large amounts of potentially harmful saturated and trans fats,” commented Tom Sanders, professor emeritus of nutrition and dietetics at King's College London. | <urn:uuid:3f7c57b1-e029-4e35-8186-895b46b2f9c3> | {
"date": "2017-08-20T13:19:04",
"dump": "CC-MAIN-2017-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886106754.4/warc/CC-MAIN-20170820131332-20170820151332-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.954981803894043,
"score": 2.96875,
"token_count": 705,
"url": "http://healthintegrations.com/blog/2016/02/16/organic-food-healthier-than-farmed-products-says-new-research---by-jonathan-owen"
} |
Submitted by Russell Orban
The Consolidated Appropriations Act, 2014, Public Law No. 113-76 (Jan. 17, 2014) funds the federal government until September 30, 2014. This legislation followed the groundbreaking Bipartisan Budget Act of 2013, Public Law No. 113-67 (Dec. 26, 2013). Together, these laws reflect a significant departure from the recent past. Normally, the budget agreement sets the boundaries for federal government spending in the upcoming fiscal year and the details are then supplied by the Appropriations Committees. The Bipartisan Budget Act set levels for both FY2014 and FY2015—the period from October 1, 2013 to September 30, 2015. This gives Congress a head start on its spending process for FY2015 and will postpone budget-deficit skirmishes until after the next election. Many important things remain undecided, but it is encouraging that Congress has found some common ground.
During the budget process, the House and Senate decide how much the federal government will spend in an upcoming year. Targets are based on Presidential requests and Congressional committees’ advice about agency needs. Allocations are made to each appropriation subcommittee, and Congress has four or five months to agree on how to spend the allotted money. The President’s role in the process comes from his power to veto appropriations bills.
Without a budget, no appropriations guidelines were set and gridlock ensued. Disagreements over spending cuts, raising revenues and allocating money resulted in stalemate, automatic sequestration cuts, and a government shutdown.
Since that time, both sides have worked out a compromise that spends less than the President requested but more than what originally passed. Here are some thoughts on what the two laws do and what they don’t do:
What the Budget Act and the Consolidated Appropriations Act do—
- Prevent another government shutdown. By passing a bill that prescribes spending amounts for the rest of the fiscal year, Congress avoided another shutdown in January.
- Meet budget targets. The Bipartisan Budget Act set a discretionary spending ceiling of $1. 012 trillion for 2014, and the Consolidated Appropriations Act met that goal. This is $191 billion less that the President requested, but it marks the fourth straight year of reduced government spending. That has not happened for over 60 years.
- Set spending levels for two years. The Budget Agreement makes it possible for the Appropriations Committees to get an early start on 2015 spending priorities and (hopefully) work out differences ahead of time. Setting budget targets moves the endless budget deficit debate off center stage.
- Reduce the impact of “sequestration.” Republicans and Democrats agree that sequestration is arbitrary and wasteful. The Budget Agreement reduces sequestration in 2014 and 2015 by $63 billion, postpones portions of those cuts, and finds ways to “pay for” any increased spending. The legislation reflects agencies’ latest priorities with flexibility to make intelligent reductions instead of blind, across-the-board cuts. | <urn:uuid:84c54414-f74a-462b-96aa-4fcc86a1be46> | {
"date": "2019-04-19T07:15:35",
"dump": "CC-MAIN-2019-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578527148.46/warc/CC-MAIN-20190419061412-20190419083412-00456.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9433529376983643,
"score": 3.5,
"token_count": 607,
"url": "https://www.contractorsperspective.com/tag/sequestration/"
} |
Tagamet is sometimes prescribed to treat hives, itching and stress ulcers. It functions as a H2-blocker, which acts by helping to reduce the level of acid in the stomach. The drug was first approved by the FDA in 1977 and is also available in generic form as Cimetidine. Tagamet for warts is prescribed by many doctors and healthcare professionals around the world, as it has been proven to reduce viral warts. This medication is available in both prescription and over-the-counter form.
The potential for Tagamet to treat resistant warts was first recognized in the early 1990s. At this point, Tagamet was only available on prescription. It is theorized that Tagamet stimulates the immune system, forcing it to reject the wart.
Warts most usually occur on the fingers and hands but can also appear elsewhere on the body. Most warts appear as grainy, small growths of skin which can also feature patterns of tiny black dots. These dots are clotted blood vessels.
Warts are caused by HPY (human papillomavirus). This virus is incredibly common, and there are over 150 different strains of it, although only a small number of them cause warts to form on the hands. Some strains of HPV are transmitted through sexual contact. For the most part, however, the HPV virus is spread by casual contact of the skin or via the touching of shared objects like washcloths or towels.
The virus spreads via cracks in the skin, such as scrapes or hangnails. Biting of the fingernails can also cause warts to spread throughout the fingertips and in and around the nail.
Each person has a unique immune system which responds to the virus differently. This means that not everybody who encounters the virus will go on to develop warts.
Some people may be at increased risk of developing warts, including:
People who fall into these categories may simply not have built up an immunity to the virus or might otherwise have a compromised immune system which causes them to be more susceptible to attack, and Tagamet could be useful in helping them to defeat the HPV virus.
Tagamet is routinely used to treat viral warts. It is often prescribed by doctors and recommended by pharmacists and other healthcare professionals as it stops the action of histamine in the stomach, and this helps to moderate the immune system of the body. Tagamet is known to stimulate the population of T-lymphocyte, which is known to be important in controlling certain viral infections. While anecdotal evidence exists, there are no peer-reviewed studies to suggest that Tagamet for warts is a proven treatment.
Sometimes, a doctor may prescribe a course of Tagamet for warts in addition to a topical over-the-counter wart removal product. This combination of treatments has been proven to be effective when OTC treatments alone don’t have an effect on existing warts.
Some healthcare professionals speculate that Tagamet for warts could be used as a preventative measure, although it is much more commonly used routinely for the reduction of warts.
Most healthcare professionals agree that a dose of 30mg to 40mg of Tagamet is suitable for the treatment of warts.
Before using Tagamet for warts, patients should advise their doctor if they have ever suffered from the following conditions:
Patients should also advise their doctor whether they smoke, or if they otherwise have any trouble swallowing before they take Tagamet.
Unless instructed by a doctor, patients should avoid taking Tagamet for warts for any longer than two weeks at a time. Additionally, patients should heed the advice of their doctor and take the full course of this medication, even if their warts appear to have fully subsided. Ceasing treatment too early could potentially delay the healing process.
Tagamet could potentially cause drowsiness or dizziness. Patients are therefore advised to refrain from driving or operating machinery until it has been established that the drug does not cause any issues.
Tagamet for warts is not recommended for children under the age of 12.
While Tagamet is unlikely to cause harm to an unborn fetus, patients who are pregnant or intending on becoming pregnant should inform their doctor prior to taking this medicine. Tagamet can pass into breast milk and could potentially cause problems for breastfeeding babies. Patients who are currently breastfeeding are advised to avoid Tagamet use.
Patients who experience any of the following side effects while using Tagamet should consult their doctor or healthcare provider as soon as possible:
Patients are advised to inform their doctor about all non-prescription, prescription, dietary, herbal, illegal, recreational or nutritional drugs or supplements they may be taking. The following medicines are known to interact negatively with Tagamet, and it is therefore ill-advised to combine them:
Patients are also advised not to mix alcohol with Tagamet, as this could cause excess drowsiness or dizziness.
While sometimes it might be impossible to avoid coming into contact with the human papilloma virus, there are several steps which patients can take to prevent them appearing as well as preventing them from spreading to other parts of the body. The following simple guidelines should be observed by those who wish to avoid contracting more warts: | <urn:uuid:3af68e1b-f6df-4d48-a1f2-12f87ff12843> | {
"date": "2018-10-19T06:38:23",
"dump": "CC-MAIN-2018-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583512332.36/warc/CC-MAIN-20181019062113-20181019083613-00416.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9643955230712891,
"score": 3.171875,
"token_count": 1093,
"url": "https://healthery.com/tagamet-for-warts/"
} |
AS THE PROCESSION OF THE EARLY CHURCH moves
from the pages of the New Testament and on into the succeeding centuries of her
his-tory, it is helpful to trace her growth and development in terms of
specific categories. Therefore, let us look first at a category important for
all Christian people: doctrine. Did she maintain the truth of God as given by
Christ and His Apostles? Second, what about worship? Is there a discernible way
in which the people of God have offered a sacrifice of praise and thanksgiving
to Him? Third, we will consider Church government. What sort of government did
the Church have?
1. Doctrine: Not only did the Church
begin under the teaching of the Apostles, but she was also instructed to "stand
fast and hold the traditions which you were taught, whether by word or our
epistle" (II Thessalonians ).
The Apostle Paul insisted that those matters delivered by him and his fellow
Apostles, both in person, and in the writings that would come to be called the
New Testament, be adhered to carefully. Thus followed such appropriate warnings
as "in the name of our Lord Jesus Christ... withdraw from every brother
who walks disorderly and not according to the tradition which he received from
us" (II Thessalonians 3:6). The doctrines taught by Christ and His
disciples are to be safeguarded by "the Church of the living God, the
pillar and ground of the truth" (I Timothy ) and are not open for reinterpretation.
Midway through the first century, a dispute
over adherence to Old Testament laws arose in Antioch. The matter could not be settled there, and outside
help was needed. The leaders of the AntiochianChurch, the community which had earlier dispatched Paul and
Barnabas as missionaries, brought the matter to Jerusalem for consideration by the Apostles and elders there.
The matter was discussed, debated, and a written decision was forthcoming.
It was James, the brother of the Lord,
and the first bishop of Jerusalem,
who gave the solution to the problem. This settlement, agreed to by all
concerned, at what is known as the Council of Jerusalem (Acts 15), set the
pattern for the use of Church councils in the centuries ahead to settle
doctrinal and moral issues that arose (in accordance with Matthew 18:17). Thus,
in the history of the Church we find scores of such councils, and on various
levels, to settle matters of dispute, and to deal with those who do not adhere
to the Apostolic faith.
In addition to this well-known controversy,
the first three hundred years of Christian history were also marked by the appearance
of certain heresies or false teachings such as secret philosophic schemes only
for initiates (Gnosticism), wild prophetic programs (Montanism), and grave
errors regarding the three Persons of the Trinity (Sabellianism).
Then, in the early fourth century, a heresy
with potential for Church-wide disruption appeared and was propagated by Arius,
a presbyter in Alexandria (Egypt). He denied the eternality of the Son of God,
claiming, contrary to the Apostles' doctrine, that the Son was a created being
who came into existence at a point in time and thus was not truly God. This
serious error crept through the Church like a cancer. Turmoil spread almost
everywhere. To solve the problem, the first Church-wide, or ecumenical, council
met in Nicea in A.D. 325 to consider this doctrine. Some 318 bishops, along
with priests and deacons, rejected the new teaching of Arius and his associates
and upheld the Apostles' doctrine of Christ, confirming "there never was a
time when the Son of God was not," and issued a definition of the
Apostolic teaching concerning Christ in what we today call the Nicene Creed.
Between the years 325 and 787, seven such
Church-wide conclaves were held, all dealing first and foremost with some
specific challenge to the Apostolic teaching about Jesus Christ. These are
known as the Seven Ecumenical Councils, meeting in the cities of Nicea, Ephesus, Chalcedon,
For the first thousand years of Christian
history, the entire Church, save for the heretics, embraced and defended the
New Testament Apostolic faith. There was no division. And this one faith,
preserved through all these trials, attacks, and tests, this one Apostolic
faith, was called the Orthodox faith.
2. Worship: Doctrinal purity was
tenaciously maintained. But true Christianity is far more than adherence to a
set of correct beliefs alone. The life of the Church is centrally expressed in
her worship or adoration of God the Father, Son and Holy Spirit. It was Jesus
Himself Who told the woman at the well, "the hour is coming, and now
is, when the true worshippers will worship the Father in spirit and truth; for
the Father is seeking such to worship Him" (John 4:23).
At the Last Supper, Jesus instituted the Eucharist,
Communion, when He took bread and wine, blessed them, and said to His
disciples, "This is My body which is given for you; do this in
remembrance of Me" and, "This cup is the new covenant in My
blood, which is shed for you" (Luke 22:19-21). From New Testament
books such as the Acts and Corinthians we know that the faithful received Holy
Communion each Lord's Day (Acts 20:7-11). And also from such first and second
century sources as the Didache and Saint Justin Martyr, we learn that the
Eucharist was at the very center of Christian worship.
And just as the Law, the Psalms, and the
Prophets were read in the synagogues of the Jews, so the Church also
immediately gave high priority to the public reading of Scripture and to
preaching in her worship, along with the Eucharistic meal.
Even before the middle of the first century,
Christian worship was known by the term liturgy, which means literally
"the common work" or "common service." The early liturgy of
the Church's worship was composed of the two essential parts: (1) the liturgy
of the word, including hymns, Scripture reading, and preaching; and (2) the
liturgy of the faithful, composed of intercessory prayers, the kiss of peace,
and the Eucharist. Virtually from the beginning, the liturgy had a definable
shape or form which continues to this day.
Modern Christians advocating freedom from the
liturgy in worship are usually shocked to learn that such spontaneity was never
the practice in the ancient Church! A basic pattern or shape of Christian
worship was observed from the start. And as the Church grew and matured, that
structure matured as well. Hymns, Scripture readings, and prayers were
intertwined in the basic foundation. A clear, purposeful procession through the
year, honoring in word, song, and praise the birth, ministry, death,
resurrection, and ascension of the Lord Jesus Christ, and marking crucial
issues in Christian life and experience, was forthcoming. The Christian life
was lived in reality in the worship of the Church. Far from being routine, the
worship of the historic Church participated in the unfolding drama of the
richness and mystery of the Gospel itself!
Further, specific landmarks in our salvation
and walk with Christ were practiced. Baptism and Chrismation were there from
the first day of the Church. Marriage, Anointing of the sick, Confession of
sins, and Ordination to the ministry of the Gospel were recognized and
practiced. The Christians understood these to be great mysteries in which grace
and power from God were being given to people according to the individual need
of each person. The Church saw these events as holy moments in her life and
called them her mysteries or sacraments.
3. Government: No one seriously
questions whether or not the Apostles led the Church at her beginnings. They
had been given the commission to preach the Gospel (Matthew 28:23) and the
authority to forgive or retain sins (John ).
Theirs was by no means a mission of only preaching. They built the Church
itself under Christ's headship! To govern it, three definite and permanent
offices, as taught in the New Testament, were in evidence.
a. The office of bishop. The Apostles
themselves were the first bishops in the Church. Even before Pentecost, after
Judas had turned traitor, Peter declared in applying Psalm 109:8, "Let
another take his office (bishopric)" (Acts ). The word office or bishopric refers to the
office of a bishop, and its use obviously indicates a role of the Apostles as
bishops. Some have mistakenly argued that the office of bishop was a later,
"human" invention. Quite to the contrary, the Apostles were the New
Testament bishops, and they appointed bishops to succeed them to oversee the
Church in each locality.
Occasionally, the objection is still heard
that the office of bishop and presbyter were originally identical. It is true
that the terms are sometimes used interchangeably in the New Testament while
the Apostles were present, but it was the understanding of the entire early
Church that, with the death of the Apostles, the offices of bishop and
presbyter were distinct. Ignatius of Antioch, consecrated bishop by A.D. 70 in
the church from which Paul and Barnabas had been sent out, writes just after
the turn of the century that bishops appointed by the Apostles, surrounded by
their presbyters, were everywhere in the Church.
b. The office of presbyter. Elders or
presbyters are mentioned very early in the life of Church in the book of Acts
and in the Epistles. It is evident that in each place a Christian community
developed, elders were appointed by the Apostles to pastor the people.
As time passed, presbyters were referred to
as "priests," in view of the fact that the Old Covenant priesthood
had been fulfilled in Christ and that the Church is corporately a priesthood of
believers. The priest was understood as an intermediary between God and the
people and as a dispenser of grace.
c. The office of deacon. The third
order or office in the government of the New Testament Church was the deacon.
At first the Apostles fulfilled this office themselves. But with the rapid
growth of the Church, seven initial deacons were selected, as reported in Acts
6, to help carry the responsibility of service to those in need. It was one of
these deacons, Saint Stephen, who became the first martyr of the Church.
Through the centuries, the deacons have not
only served the material needs of the Church, but also have held a key role in
the liturgical life of the Church. Often called "the eyes and ears of the
bishop," many deacons have become priests and ultimately entered the
The authority of the bishops, presbyters, and
deacons was not understood in those early centuries as being apart from the
people, but always from among the people. But the people of God were called to
submit to those who ruled over them (Hebrews , I Peter 5:5), and they were also called to give
their agreement to the direction of the leaders for the Church. On a number of
occasions in history, that "Amen" was not forthcoming, and the
bishops of the Church took note and changed course. Later in history, some
Church leaders departed from the ancient model and usurped authority for
themselves. This brought the ancient model into question. However the problem
was not in the model but in the deviation from it.
It should also be mentioned that it was out
of the ministry and life of the Apostles that the people of God, the laity,
were established in the Church. Far from being a herd of observers, the laity
are vital in the effectiveness of the Church. They are the recipients and
active users of the gifts and grace of the Spirit. Each one of the laity has a
role in the life and function of the Church. Each one is to supply something to
the whole (I Corinthians 12:7). And it is the responsibility of the bishops,
the priests, and the deacons to be sure that this is a reality for the laity.
The worship of the Church at the close of its
first 1,000 years had substantially the same shape from place to place. The
doctrine was the same. The whole Church confessed one creed, the same in every
place, and had weathered many attacks. The government of the Church was
recognizably one everywhere. And this One Church was the Orthodox Church. | <urn:uuid:8c454d49-097a-4927-8cc7-45012d04ae64> | {
"date": "2018-04-21T23:08:59",
"dump": "CC-MAIN-2018-17",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125945459.17/warc/CC-MAIN-20180421223015-20180422003015-00256.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9759536385536194,
"score": 3.34375,
"token_count": 2771,
"url": "http://www.orthodoxphotos.com/readings/ntc/second.shtml"
} |
For more mythbusting and social media science, don’t forget to register for my Science of Social Media webinar.
Over the past few years I’ve developed two models of contagious content: R0 (pronounced: R Naught) and Zarrella’s Hierarchy of Contagiousness. Because of the way these two systems work, I put a lot of emphasis on reach building activities (getting lots of followers, likes and views) and metrics (number of followers and likes). Based on the reaction I’ve seen to some of my recent work challenging the hegemony of “engaging in the conversation,” I’ve come to understand that I may not have fully explained why number of followers is such a key metric.
Before an individual can share a piece of your content, three things have to happen. First, they have to be exposed to it (following you on Twitter or a fan of your page on Facebook). Second, they have to actually become aware of that content (I follow something like 8,000 people on Twitter and don’t see anywhere near everything they Tweet). Third, and finally, they must be motivated by something in that content to share it. Together, these three elements make up my hierarchy of contagiousness.
The conversion rate at each part of the hierarchy can be expressed as a percentage, the number of people who will complete that part of the process. And the three rates taken together represent R0. Here, R0 stands for reproduction rate, a concept taken from the study of infectious diseases called epidemiology. It is the number of new cases of an infection that a single infection will cause. If I have a cold and I give that cold to two people and each of them give it to two more people, the R0 of that cold is two (or 200%). The R0 of most biological pathogens is above one, but I’ve never found an idea with a sustained R0 above one. Given a large enough population and a long enough time, the R0 of every idea falls below one and the idea stops spreading.
Below is a simple graphic explaining my viral math with my hierarchy of contagiousness, the accompanying formula and some example numbers alongside.
If you have 10,000 followers on Twitter and you Tweet to all of them, you are exposing 100% of them to your content. (The exposure rate is 100% for most platforms, but for some, like email, you can segment your audience and only send to a small percentage). Let us assume 1% of them actually read your Tweet (an educated guess at an awareness rate based on observed click through, ReTweet and reply rates). That means your Tweet has the chance to motivate 100 people to ReTweet it. Assuming it succeeds with 1% of those users (another educated guess), your content will get one ReTweet.
Obviously, these percentages are made up and vary wildly, but try plugging a few of your recent pieces of content in and do the math backwards to estimate your R0. If you have 20,000 followers and a Tweet of yours got 16 ReTweets, you have a 0.08% R0. You can then assume that for every 1,250 new followers you ad, you would have gotten one more ReTweet.
As marketers, we can optimize at each step of this process, by building reach (number of followers) for “exposure,” using tactics like contra-competitive timing and personalization for the “awareness” step, and learning about viral triggers for the last “motivation” stage. Awareness and motivation tend to be the trickiest to optimize for, but they’re certainly worth it. However, the easiest is reach. Get more followers or likes, and you’ll get more shares (and in turn, more followers and likes).
I’ve found that some users are more influential than others, and this is generally means they themselves have a larger reach. But there aren’t very many things you can do as a marketer to attract a huge number of highly followed influencers to your content beyond the same tactics that you would use to attract a huge number of “normal” users. And I’ve also found that some users (like lebolukewarm in this example) can have influence larger than their reach would suggest, but it’s impossible to target these one-off, contextually influential users. You can only increase your sheer follower numbers and thereby increase the likelihood that you have users like lebolukewarm following you.
The number of followers (or Facebook likes, or blog subscribers) you have is the best measure of your social media reach. It’s elegant and easy to compare to your competitors. There are other, more complex (and expensive) ways to measure reach, but they aren’t much more useful than follower count. Your goal with reach metrics is not to measure every single possible edge case, but rather to measure most of your reach and monitor trends in it. The question you need to answer is simple, are you building your reach, or losing it?
And don’t get fooled by fake, hypothetical straw men arguments. If someone tells you that they’d rather have 100 “highly engaged” followers than 10,000 less “engaged” followers, ignore them. In reality, if you have 10,000 followers you’ll have a decent number of “engaged” listeners. (Unless you’re doing something really shady to get those followers.) In the vast majority of real cases, someone with 10,000 followers has more reach and influence than someone with 100. | <urn:uuid:be7ed918-9bcd-4066-a404-e6641cf17fb2> | {
"date": "2014-04-18T18:11:16",
"dump": "CC-MAIN-2014-15",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609535095.7/warc/CC-MAIN-20140416005215-00403-ip-10-147-4-33.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9542883634567261,
"score": 2.6875,
"token_count": 1178,
"url": "http://danzarrella.com/viral-math-r-naught-and-zarrellas-hierarchy-of-contagiousness.html"
} |
Antitrust law refers to the extensive category of federal and state laws that aim to ensure that enterprises operate honestly and fairly. The objective of these laws is to create a level playing field in the free market and disallow organizations from wielding excessive power.
Antitrust law perceives a trust as a large group of companies that work with each other or in combination to create a monopoly or control the market. The Interstate Commerce Act of 1887, the Sherman Act of 1890, the Federal Trade Commission Act of 1914 and the Clayton Act of 1914 are the most significant antitrust laws in the US.
The prudent lawyers at SBEMP (Slovak, Baron, Empey, Murphy & Pinkney) law firm provides professional legal advice and services to clients in Palm Springs, Palm Desert, Rancho Mirage, Inland Empire, Orange County, San Diego, New Jersey, New York, and surrounding locations.
Need for Antitrust Laws
Antitrust laws disallow companies from indulging in specific activities aimed at developing monopolies. These regulations prohibit what some people perceive as deceptive trade practices that companies may want to employ to stay ahead of the competition. In other words, antitrust regulations forbid companies from using dirty poker to beat the competition.
What do antitrust laws disallow?
Antitrust regulations do not ban a company from holding a large market share if they achieve this by legitimate means. These laws ban any acts that are aimed at developing a monopoly using unfair strategies. The courts use the “rule of reason” test to establish whether an activity is illegal. They consider the business decision’s impact on the market.
Laws and court cases offer more direction
Courts offer more direction on the types of behaviors that constitute antitrust contraventions as government bodies, and private entities bring lawsuits against alleged violators.
The courts state that specific acts such as group boycotts, group agreements, or price fixing to control business activities in particular markets amount to antitrust activity by default. But no two cases are identical. In every case, the court has to understand exactly what transpired and arrive at a decision.
The Sherman Act is the fundamental law that disallows antitrust behavior. Courts can hand out civil and criminal penalties including up to ten years imprisonment and a fine of $1 million for each offense. Companies can also be levied with a fine that amounts to twice the amount of profits that they garnered from the illegal activity.
The Clayton Act, which is an antitrust Act that emerged soon after the Sherman Act, specifically identified unlawful behaviors. For instance, the Clayton Act disallows an intermingled directorship where one individual is in charge of making business decisions for two or more rival entities.
How does an organization know if they are contravening an antitrust law?
It is not always apparent on the surface whether a company is in violation of antitrust law. This aspect involves the specificities of each case. The courts and regulating bodies have to understand the facts of the case to arrive at a decision.
It is a wise move for companies to seek reliable legal counsel as they strategize significant changes such as mergers and acquisitions to ensure that they remain on the right side of antitrust laws.
Knowledgeable lawyers at the SBEMP law firm serve clients from Palm Springs, Palm Desert, Rancho Mirage, Inland Empire, Orange County, San Diego, New Jersey, New York, and nearby locations for a range of legal practice areas.
For more information or to request a consultation please contact the law offices of SBEMP (Slovak, Baron, Empey, Murphy & Pinkney) by clicking here.
SBEMP LLP is a full service law firm with attorney offices in Palm Springs (Palm Desert, Inland Empire, Rancho Mirage), CA; Costa Mesa (Orange County), CA; San Diego, CA; Princeton, NJ; and New York, NY.
DISCLAIMER: This blog post does not constitute legal advice, and no attorney-client relationship is formed by reading it. This blog post may be considered ATTORNEY ADVERTISING in some states. Prior results do not guarantee a similar outcome. Additional facts or future developments may affect subjects contained within this blog post. Before acting or relying upon any information within this newsletter, seek the advice of an attorney | <urn:uuid:af02b828-a215-40b8-adf6-4236813eefa1> | {
"date": "2019-05-20T15:08:55",
"dump": "CC-MAIN-2019-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232256040.41/warc/CC-MAIN-20190520142005-20190520164005-00096.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9308764338493347,
"score": 3.046875,
"token_count": 872,
"url": "https://sbemp.com/what-is-anti-trust-law/"
} |
This fascinating selection of photographs traces some of the many ways in which the West Highland Extension has changed and developed over the last century. The Mallaig extension was approved in 1894 to provide a continuation of the West Highland route for the benefit of the fishing industry on Scotland's west coast. It revived, more ambitiously, the Fort William to Roshaven line lost in 1889. Crossing the famous Glenfinnan viaduct, the line touches at Loch Eilt, Loch Ailort, Loch-nan-Uamh, Arisaig and Morar, giving wonderful views of the coastline and the Small Isles. The Jacobite service to Mallaig is now a major tourist attraction. Dr John McGregor uses a wide selection of period and modern photographs to bring the history and dramatic landscape of the Mallaig Extension to life for the reader. | <urn:uuid:37e248c3-caac-4a31-9143-911d24542baf> | {
"date": "2018-09-24T06:30:06",
"dump": "CC-MAIN-2018-39",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267160145.76/warc/CC-MAIN-20180924050917-20180924071317-00536.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8947979211807251,
"score": 2.671875,
"token_count": 173,
"url": "https://www.scottishbookstore.com/west-highland-extension-45850"
} |
Press Release 09-224
Report Says Musicians Hear Better Than Non-Musicians
Music appreciation could help children with language-based learning disabilities
Back to article | Note about images
When tested against non-musicians, musicians demonstrated faster neural timing, enhanced representation of speech harmonics, and less degraded response morphology in noise. The finding is the first biological evidence that musicians have a perceptual advantage for "speech-in-noise."
Credit: © 2009 Jupiter Images Corporation | <urn:uuid:32d51eac-d7ac-478e-8ec8-148d17f949c4> | {
"date": "2013-12-05T10:12:48",
"dump": "CC-MAIN-2013-48",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2013-48/segments/1386163043499/warc/CC-MAIN-20131204131723-00002-ip-10-33-133-15.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9168543815612793,
"score": 2.78125,
"token_count": 97,
"url": "http://www.nsf.gov/news/news_images.jsp?cntn_id=115958&org=SBE"
} |
The Victoria and George Crosses are the highest military and civil decorations of the United Kingdom, awarded for gallantry. The Victoria Cross, introduced in 1856, is awarded to members of the armed forces of various Commonwealth countries for valour in the face of the enemy, while the George Cross was introduced during World War II so that civilians could also be awarded for acts of heroism, or conspicuous courage in circumstances of extreme danger. There have been 1,356 Victoria Crosses awarded, and there have been 404 recipients of the George Cross since 1940.
The Imperial War Museum is opening the Lord Ashcroft Gallery in November 2010 to showcase not only their large collection of Victoria and George crosses, but also Lord Ashcroft's collection, which he has loaned to the Museum for 10 years. The gallery will therefore contain the largest collection of VCs and GCs in the world. The museum envisages around 150,000 visitors a year.
This fully illustrated book contains the stories of over 80 recipients: a mixture of individuals - including men, women and children from different countries - who performed their acts of heroism across the last century and a half.
"The stories [are] inspirational, well worth a read as they challenge us to be as gallant if we were ever put in such situations." C. Peter Chen, www.ww2db.com (February 2011) | <urn:uuid:e7793e84-3105-475c-8690-664034e73cb9> | {
"date": "2014-12-20T05:13:11",
"dump": "CC-MAIN-2014-52",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1418802769392.53/warc/CC-MAIN-20141217075249-00123-ip-10-231-17-201.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9661175608634949,
"score": 3.3125,
"token_count": 276,
"url": "http://www.randomhouse.com/book/203435/extraordinary-heroes-by-ruth-sheppard-and-the-imperial-war-museum/9781849083898"
} |
A new paper posted today on ScienceXpress (from Science magazine), by Thomas Karl, Director of NOAA’s Climate Data Center, and several co-authors, that seeks to disprove the “hiatus” in global warming prompts many serious scientific questions.
The main claim by the authors that they have uncovered a significant recent warming trend is dubious. The significance level they report on their findings (.10) is hardly normative, and the use of it should prompt members of the scientific community to question the reasoning behind the use of such a lax standard.
In addition, the authors’ treatment of buoy sea-surface temperature (SST) data was guaranteed to create a warming trend. The data were adjusted upward by 0.12°C to make them “homogeneous” with the longer-running temperature records taken from engine intake channels in marine vessels.
As has been acknowledged by numerous scientists, the engine intake data are clearly contaminated by heat conduction from the engine itself, and as such, never intended for scientific use. On the other hand, environmental monitoring is the specific purpose of the buoys. Adjusting good data upward to match bad data seems questionable, and the fact that the buoy network becomes increasingly dense in the last two decades means that this adjustment must put a warming trend in the data.
The extension of high-latitude arctic land data over the Arctic Ocean is also questionable. Much of the Arctic Ocean is ice-covered even in high summer, meaning the surface temperature must remain near freezing. Extending land data out into the ocean will obviously induce substantially exaggerated temperatures.
Additionally, there exist multiple measures of bulk lower atmosphere temperature independent from surface measurements which indicate the existence of a “hiatus”. If the Karl et al., result were in fact robust, it could only mean that the disparity between surface and mid-tropospheric temperatures is even larger that previously noted.
Getting the vertical distribution of temperature wrong invalidates virtually every forecast of sensible weather made by a climate model, as much of that weather (including rainfall) is determined in large part by the vertical structure of the atmosphere.
Instead, it would seem more logical to seriously question the Karl et al. result in light of the fact that, compared to those bulk temperatures, it is an outlier, showing a recent warming trend that is not in line with these other global records.
And finally, even presuming all the adjustments applied by the authors ultimately prove to be accurate, the temperature trend reported during the “hiatus” period (1998-2014), remains significantly below (using Karl et al.’s measure of significance) the mean trend projected by the collection of climate models used in the most recent report from the United Nation’s Intergovernmental Panel on Climate Change (IPCC).
It is important to recognize that the central issue of human-caused climate change is not a question of whether it is warming or not, but rather a question of how much. And to this relevant question, the answer has been, and remains, that the warming is taking place at a much slower rate than is being projected.
The distribution of trends of the projected global average surface temperature for the period 1998-2014 from 108 climate model runs used in the latest report of the U.N.’s Intergovernmental Panel on Climate Change (IPCC)(blue bars). The models were run with historical climate forcings through 2005 and extended to 2014 with the RCP4.5 emissions scenario. The surface temperature trend over the same period, as reported by Karl et al. (2015, is included in red. It falls at the 2.4th percentile of the model distribution and indicates a value that is (statistically) significantly below the model mean projection.
Karl, T. R., et al., Possible artifacts of data biases in the recent global surface warming hiatus. Scienceexpress, embargoed until 1400 EDT June 4, 2015.
“It is also noteworthy that the new global trends are statistically significant and positive at the 0.10 significance level for 1998-2012…”
Both the UAH and RSS satellite records are now in their 21st year without a significant trend, for example | <urn:uuid:c8f277f7-fc95-4d4d-b1ee-eb8b98d6345b> | {
"date": "2015-07-29T02:47:04",
"dump": "CC-MAIN-2015-32",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042985647.51/warc/CC-MAIN-20150728002305-00283-ip-10-236-191-2.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9462893009185791,
"score": 3.015625,
"token_count": 860,
"url": "http://www.cato.org/blog/tags/climate-change?page=1"
} |
Chemists at the University of Maryland, College Park, have developed a new, highly selective way to detect chemical weapons. The system uses molecules that are fluorescent in the presence of even small amounts of lethal phosphate esters.
The research is outlined in the December 2 edition of the peer reviewed Journal of the American Chemical Society, which is published by the world's largest scientific society, based in Washington, D.C.
The most common chemical weapons attack acetylcholine esterase, an enzyme in the human body which controls muscle contraction. Many current detectors employ the enzyme itself and are very sensitive. However, they also detect benign chemicals that inhibit acetylcholine esterase, including many pesticides.
To better target just dangerous substances, the new method uses molecules made to react specifically with volatile fluoro- and cyano- phosphate esters. They are the active ingredients in nerve agents like SARIN, which was used by terrorists in a 1995 Japanese subway attack. "Our molecules will selectively detect the phosphate esters that would injure you or me. Our molecules are more specific," claims University of Maryland chemist Robert S. Pilato, Ph.D.
For safety, Pilato's laboratory is testing the molecules against chemical weapon mimics. These phosphate esters react identically to warfare agents, but have vapor pressures too low to amass a lethal dose. The scientists engineered their molecules so that reaction with those gases produced another molecule that fluoresces.
In order to detect the fluorescence, the sensor molecule is immobilized in a polymer matrix which could be used to coat fiber optics. Says Pilato: "The next step is to take those polymer immobilized molecules and screen them against the real McCoy."
A nonprofit organization with a membership of more than 155,000 chemists and chemical engineers, the American Chemical Society publishes scientific journals and databases, convenes major research conferences, and provides educational, science policy and career programs in chemistry. Its main offices are in Washington, D.C., and Columbus, Ohio.
The above story is based on materials provided by American Chemical Society. Note: Materials may be edited for content and length.
Cite This Page: | <urn:uuid:2f935bdc-5449-4418-9761-397fe119027c> | {
"date": "2014-10-25T12:11:12",
"dump": "CC-MAIN-2014-42",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414119648148.32/warc/CC-MAIN-20141024030048-00165-ip-10-16-133-185.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9445104002952576,
"score": 2.96875,
"token_count": 442,
"url": "http://www.sciencedaily.com/releases/1998/12/981203073348.htm"
} |
(NEW YORK) -- More and more doctors are recommending that teen girls receive the vaccination for human papilloma virus, or HPV. But a study, published in the April issue of Pediatrics, shows parents are still fearful, and many don't intend to vaccinate their adolescent daughters.
According to MedPage Today, study authors reported in an analysis of the National Immunization Survey of Teens that more than 40 percent of parents responded in 2010 that they did not intend to vaccinate their teen daughters with the HPV vaccine.
Reporting that parent responses were not particularly similar for two other vaccines aimed at adolescents, the study authors concluded that there may be a "need for interventions beyond clinician recommendation."
According to the study findings, when parents were asked why they did not intend to vaccinate their children for HPV, the parents most frequently responded with concerns about safety. Parents who reported safety concerns or worries about side effects rose from 4.5 percent in 2008 to 7.7 percent in 2009 to 16.4 percent in 2010.
Copyright 2013 ABC News Radio | <urn:uuid:5df1d193-7952-497c-ba0a-51f50e492ffe> | {
"date": "2013-05-20T11:54:14",
"dump": "CC-MAIN-2013-20",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368698924319/warc/CC-MAIN-20130516100844-00000-ip-10-60-113-184.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9696412086486816,
"score": 2.5625,
"token_count": 213,
"url": "http://www.kvor.com/common/more.php?m=58&ts=1369050854&article=7C37EAA6904A11E286DEFEFDADE6840A&mode=2"
} |
Source: FOIA Lawsuits by TRAC
The FOIA requires federal departments and agencies to make available requests of all official documents, not covered by a handful of exemptions such as for law enforcement, privacy and protection of commercial secrets. When requested documents aren’t made available as required by law, requestors often go to federal court seeking a judicial order to compel production.
“The 919 FOIA cases filed in the period fiscal year 2014 – 2015 also far outnumber those filed during the last two years of the previous Bush administration. There were only 562 such matters filed during fiscal year 2007 – 2008, yielding a 64 percent increase for the most recent period,” TRAC said announcing the results of its analysis.
The Syracuse University research unit was founded by former New York Times investigative reporter David Burnham in 1989.
A total of 2,609 FOIA lawsuits were filed during Obama’s administration from 2009 to 2015, compared to 2,091 filed during the Bush administration from 2002 through 2008. The highest annual total of the Bush years was 387 in 2005.
“This is the most transparent administration in history,” Obama said in 2013 during a Google Plus Fireside Chat. “I can document that this is the case. Every visitor that comes into the White House is now part of the public record. Every law we pass and every rule we implement we put online for everyone to see.”
Obama did begin posting information to the Internet about White House visitors but only after a lawsuit was filed by the nonprofit government watchdog Judicial Watch.
Critics have frequently reminded Obama of his transparency claim, a fact TRAC noted, “the administration’s record has been a contentious matter ever since President Obama’s first days in office, when both he and Attorney General Eric Holder made sweeping claims about the ambitious FOIA policies they would follow in the years ahead.”
“In a short memorandum to the heads of all Executive Branch departments and agencies, the president said the Freedom of Information Act ‘should be administered with a clear presumption: in the face of doubt, openness prevails.’”
TRAC also cautioned, however, that an increase in the number of FOIA lawsuits being filed isn’t necessarily an indicator of less government transparency during a particular presidential administration.
“Because of possible changes in public attitudes about the public’s right to obtain government records, its willingness to challenge government’s failure to provide transparency, as well as changes in the Freedom of Information law and case law, the increase in federal FOIA court filings does not necessarily mean that the current administration is more or less secretive than those of the past,” TRAC said.
“But the rising counts well may indicate that this administration has not lived up to the ambitious open government promises made when President Obama first came to the White House,” TRAC said.
Content created by The Daily Caller News Foundation is available without charge to any eligible news publisher that can provide a large audience. For licensing opportunities of our original content, please contact [email protected]. | <urn:uuid:c47b6f09-9224-4d59-aea9-98883e42e0ec> | {
"date": "2017-08-22T15:00:16",
"dump": "CC-MAIN-2017-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886110792.29/warc/CC-MAIN-20170822143101-20170822163101-00336.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9588543176651001,
"score": 2.515625,
"token_count": 632,
"url": "http://tennesseewatchman.com/2016/01/06/record-number-of-foia-lawsuits-filed-against-obama/"
} |
Lectins , your gut, your health
Those lectins! They have been controversial for sure, particularly with the exploitation of how “dangerous” they are according to Dr. Gundry. Lectins are carbohydrate binding proteins present in most plants, especially seeds and tubers like cereals, potatoes, and beans (Freed, 1999). In the past several decades, it has been demonstrated that lectins are toxic and inflammatory, and resistant to cooking and digestive enzymes. And they are present in abundance in our food!
One thing is particularly interesting is the association of dietary lectin and auto-immunity. Lectin are becoming of increasing interest to scientists for their anti-nutrient effects, particularly damage to GI-tract an precipitation of immune system reactivity (Rix, 2016). The link with auto-immunity comes from the ability for lectins to play a part in destruction of the mucosal lining of the GI tract, inhibiting repair mechanisms, as well as entering systemic circulation where they can elicit an inflammatory immune response (Rix, 2016). Interesting, it is thought that the involvement of lectins in the development of intestinal permeability can assist with the presentation of the virus to the immune system, facilitating molecular mimicry. One very popular lectin is wheat gliadin, which is linked celiac disease. Lectins stimulate class II HLA antigens on cells that do not normally display them, such as pancreatic islet and thyroid cells. Lectins can also cause the discharge of histamine from the gastric mast cells, which can stimulate gastric acid secretion, which is not a good thing in the context of H. pylori.
It is interesting that we do have biological systems in place to protect us from lectins, but that can be destroyed by enzymes (such as neuraminidase) present in microorganisms such as influenza and streptococci. “This may explain why diabetes and rheumatoid arthritis tend to occur as sequelae of infections” (Freed, 1999).
So, having established that lectins can be detrimental to human health, there are different therapeutic dietary options available. A diet low in lectins, such as a paleo diet may be helpful. I personally have found the Plant Paradox very helpful for my gut issues. There are also agents that can block lectins. Wheat lectin, for example, is blocked by the sugar N-acetyl glucosamine (NAG) and its polymers (Freed, 1999). NAG can bind to lectins of wheat, potato and peanuts, which may be a useful prophylactic remedy for lectin diseases such as insulin dependent diabetes, rheumatoid arthritis. Dr. Gundry has an interesting (and expensive) product called Lectin Lock, that contains NAG, bladderwrack, D-mannose, okra extract, mucin, MSM, sodium alginate and vegetable peptase. These ingredients are though to bind to lectins to reduce their damaging impact on the gut.
Here is an Amazon link to order Lectin Lock
Freed, D. L. (1999). Do dietary lectins cause disease? BMJ, 318(7190), 1023-1024.
Rix, J. (2016). Beyond gluten: dietary lectins, a new frontier in auto-immunity. Retrieved (2018, June 9) from https://www.ihcan-mag.com/beyond-gluten-dietary-lectins-a-new-frontier-in-auto-immunity/ | <urn:uuid:299e0dea-1a39-44f5-a7c3-9594145e49af> | {
"date": "2019-11-22T18:56:44",
"dump": "CC-MAIN-2019-47",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496671411.14/warc/CC-MAIN-20191122171140-20191122200140-00296.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9413167238235474,
"score": 3.140625,
"token_count": 740,
"url": "https://naturalhealthachiever.com/blog/2018/06/11/lectins-your-gut-your-health/"
} |
The Laney P' chart is similar to a traditional P chart. Both charts monitor the proportion of defective items that are produced by your process. However, if your data exhibit overdispersion or underdispersion, a Laney P' chart may more accurately distinguish between common-cause variation and special-cause variation.
Overdispersion can cause a traditional P chart to show an increased number of points outside the control limits. Underdispersion can cause a traditional P chart to show too few points outside of the control limits. The Laney P' chart adjusts for these conditions. For more information, go to Overdispersion and underdispersion.
Red points indicate subgroups that fail at least one of the tests for special causes and are not in control. If the same point fails multiple tests, then the point is labeled with the lowest test number to avoid cluttering the graph. If the chart shows out-of-control points, investigate those points.
Out-of-control points can influence the estimates of process parameters and prevent control limits from truly representing your process. If out-of-control points are due to special causes, then consider omitting these points from the calculations. For more information, go to Specify subgroups to estimate parameters for Laney P' Chart.
Consider the following example of a Laney P' chart. The Sigma Z value (approximately 2.2) is greater than 1, which indicates that the control limits on the Laney P' chart are wider than those on a traditional P chart to adjust for overdispersion. The proportion of defectives for subgroup 31 is out of control. When you hold the pointer over a red point, you can get more information about the subgroup. You should identify any special causes that may contribute to the unusually high proportion of defective items for that subgroup. | <urn:uuid:08b11b07-8ad3-483b-9ec6-fb1fc287e779> | {
"date": "2017-12-13T22:29:55",
"dump": "CC-MAIN-2017-51",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948531226.26/warc/CC-MAIN-20171213221219-20171214001219-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9035468101501465,
"score": 2.6875,
"token_count": 381,
"url": "https://support.minitab.com/en-us/minitab/18/help-and-how-to/quality-and-process-improvement/control-charts/how-to/attributes-charts/laney-p-chart/interpret-the-results/key-results/"
} |
Earth’s magnetic north pole is shifting more than scientist earlier expected and the movement appears to be accelerating. This, some fear, can cause havoc to the countless number of navigation systems that depend on the planet’s magnetic field as a point of reference.
But does that mean navigation systems like Waze and Google Maps are no longer accurate?
Our planet’s magnetic north has been moving so much in the last few years that the National Oceanic and Atmospheric Administration had to issue an earlier than planned update to its World Magnetic Model.
The model is updated every five years to ensure that GPS system and compass remain accurate. The next major update was scheduled to happen in 2020 but had was done earlier on February 4, 2019 due to the rapid movements of the magnetic poles.
The World Magnetic Model tracks our planet’s magnetic field and is crucial to almost all navigation systems used today – this includes, Waze and Google Maps as well as maritime and aeronautical navigation.
However, you don’t have to worry as the effect on navigation systems are minimal. The only exception is if you’re using navigation in the Arctic and northern Canada. If you are, then the effects of the shifting magnetic north pole can be pronounced.
For now, as scientist are still able to track the magnetic field and the World Magnetic Model is updated regularly, your navigation should be fine.
Cause of the erratic movement is still a mystery
Over the past few decades the position of the Earth’s magnetic north has been shifting erratically between Siberia and Canada.
“It’s moving at about 50 km (30 miles) a year,” Ciaran Beggan, a scientist from the British Geological Survey in Edinburgh, Scotland, told Reuters. “It didn’t move much between 1900 and 1980, but it’s really accelerated in the past 40 years.”
What is causing the rapid movements in the Earth’s magnetic field is a mystery for scientists but there are two possibilities: One is the shifting magnetic field could be caused by a powerful geomagnetic pulse that might have thrown that magnetic field out of its rhythm. The second possibility is that a stream of liquid iron flowing at high speed deep within the Earth’s core could be affecting the planet’s magnetic field.
Whatever the case may be, rest assured that we can continue to trust our navigation systems to take us where we need be, accurately. | <urn:uuid:ad1dabf9-70e2-44d2-b22b-a90c5602deb0> | {
"date": "2019-02-22T05:13:52",
"dump": "CC-MAIN-2019-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247513222.88/warc/CC-MAIN-20190222033812-20190222055812-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9511708617210388,
"score": 3.3125,
"token_count": 507,
"url": "https://www.soyacincau.com/2019/02/07/earth-magnetic-north-pole-moving/"
} |
Argumentative essay detailed writing guide including essay structure patterns, introduction and conclusion techniques, useful examples, tips and best practices. Writing a argumentative essay conclusion - let the top writers to do your essays for you stop receiving unsatisfactory grades with these custom term paper recommendations dissertations and essays at most attractive prices. Introductions and conclusions are crucial in persuasive writing they put the facts to be cited into a coherent structure and give them meaning even more important , they make the argument readily accessible to readers and remind them of that purpose from start to end think of it this way as the writer of an essay, you're. Examples of conclusion paragraphs for an argumentative essay as an example of a conclusion that contains the necessary academic components to be correct, here are two conclusion paragraphs that you can use as examples when writing your own each one should contain the following elements: the conclusion must. Technique #2: raise a counter-argument, then debunk it bring up a point someone might make against your essay then say why that person is wrong tip #1: make sure you're using a counter-argument that you can debunk tip #2: be careful not to contradict or disprove your original thesis technique. A good introduction in an argumentative essay acts like a good opening statement in a trial just like a lawyer, a writer must present the issue at hand, give background, and put forth the main.
About your argument why does what you've written matter what can you say in your conclusion to help convince your readers that they should care about your ideas and argument asking yourself the “so what” question as you write your essay can also help you dig below the surface of your ideas. For the gre argument essay, learn how to craft your intro, body, conclusion, and more, while also getting essay writing tips and essay prompt samples. The purpose of the argumentative mode, sometimes called the persuasive mode, is to change the way a reader thinks or behaves a writer achieves this purpose by convincing a reader of the truth and logic in a particular argument he or she is presenting in the essay in order to be convincing, a writer should address more.
One of the most important functions of the conclusion is to provide context for your argument your reader may finish your essay without a problem and understand your argument without understanding why that argument is important your introduction might point out the reason your topic matters, but your conclusion should. An argumentative essay can be one of the hardest essays to write given that many people are stuck in their ways, some readers may not be willing to consider alternative theories to their own an audience (readers) will be supportive (agrees with stand of author), wavering (on the fence), or hostile ( completely.
In this lesson you will learn how to conclude your essay by restating your claim and adding your own thoughts that support your claim and wrap up your essay. So much is at stake in writing a conclusion this is, after all, your last chance to persuade your readers to your point of view, to impress yourself upon them as a writer and thinker and the impression you create in your conclusion will shape the impression that stays with your readers after they've finished the essay. | <urn:uuid:c97d7368-5bbd-4363-b33a-f1b0a79e0839> | {
"date": "2018-06-23T21:19:11",
"dump": "CC-MAIN-2018-26",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-26/segments/1529267865250.0/warc/CC-MAIN-20180623210406-20180623230406-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9361989498138428,
"score": 3.09375,
"token_count": 645,
"url": "http://sfhomeworkddrs.n2g.us/argumentative-essay-conclusion.html"
} |
Growth factor signaling is essential for pattern formation, growth, differentiation, and maintenance of stem cell pluripotency. Nodal-related signaling factors are required for axis formation and germ layer specification from sea urchins to mammals. Maternal transcripts of the zebrafish Nodal factor, Squint (Sqt), are localized to future embryonic dorsal. The mechanisms by which maternal sqt/nodal RNA is localized and regulated have been unclear. Here, we show that maternal control of Nodal signaling via the conserved Y box-binding protein 1 (Ybx1) is essential. We identified Ybx1 via a proteomic screen. Ybx1 recognizes the 3’ untranslated region (UTR) of sqt RNA and prevents premature translation and Sqt/Nodal signaling. Maternal-effect mutations in zebrafish ybx1 lead to deregulated Nodal signaling, gastrulation failure, and embryonic lethality. Implanted Nodal-coated beads phenocopy ybx1 mutant defects. Thus, Ybx1 prevents ectopic Nodal activity, revealing a new paradigm in the regulation of Nodal signaling, which is likely to be conserved.https://doi.org/10.7554/eLife.00683.001
In many organisms, embryonic development is controlled in part by RNAs that are deposited into the egg as it forms inside the mother. These ‘maternal RNAs’ may localize to particular regions of the egg or embryo, where they are then exclusively translated into protein and carry out their specific function. This helps to establish asymmetry in the developing organism—that is, to produce tissues that will eventually become the top or bottom, front or back, and left or right of the organism.
One such maternal RNA encodes Nodal, a key signaling molecule that is conserved across vertebrate and some invertebrate organisms. In zebrafish, the equivalent RNA is called squint, and plays an important role in embryonic development. The squint RNA deposited by the mother localizes to the dorsal region—the embryo’s back—and signals that region to make dorsal tissues, but how squint is regulated is not well understood. Now, Kumari et al. identify a protein that controls the positioning of squint RNA, and find that it can also prevent this RNA from being translated into protein.
The squint RNA contains a ‘dorsal localization element’ that recruits it to the dorsal cells of the embryo by the 4-cell stage (i.e., within two cell divisions after the egg is fertilized). Kumari et al. identified a protein called Ybx1 that could bind to this element: this protein may help to correctly position RNAs in many other organisms, including fruit flies and mammals. Strikingly, embryos formed abnormally when their maternally derived Ybx1 protein was mutant, and these mutations also prevented the squint RNA from localizing properly. This suggests that maternally derived Ybx1 protein directly regulates the squint RNA.
As well as positioning the squint RNA correctly, the embryo must translate this RNA into protein at the right time. In embryos with mutant maternal Ybx1 protein, the Squint protein could be detected at the 16-cell stage, whereas in wild-type embryos this protein is not translated until the 256-cell stage; this indicates that Ybx1 protein might normally repress the translation of the squint RNA. Indeed, Kumari et al. found that Ybx1 binds to another protein—eIF4E—that recruits mRNAs to the ribosome (the cell’s translational machinery). Ybx1 might therefore prevent eIF4E from associating with other components of the ribosomal complex, and initiating the translation of the squint RNA, until additional signals have been received. It will be interesting to determine how widespread this regulatory mechanism is in other organisms.https://doi.org/10.7554/eLife.00683.002
Nodal factors are secreted signaling proteins of the transforming growth factor-β family, with essential functions in axis formation and germ layer specification during embryonic development in sea urchins, snails, ascidians, frogs, fish, and mammals (Jones et al., 1995; Collignon et al., 1996; Erter et al., 1998; Feldman et al., 1998; Rebagliati et al., 1998; Sampath et al., 1998; Hudson and Yasuo, 2005; Shen, 2007; Constam, 2009; Grande and Patel, 2009; Duboc et al., 2010). Nodal signaling has also been shown to be important for maintaining human ES cell pluripotency (James et al., 2005; Vallier et al., 2005). Misregulated Nodal signaling has been found associated with tumor metastases (Topczewska et al., 2006). Therefore, understanding the mechanisms that regulate Nodal signaling is crucial.
Nodal signaling is regulated by transcription factors such as DRAP1, FoxH1 and Oct4 (Sirotkin et al., 2000; Cao et al., 2008). Signal transduction occurs by binding of Nodal ligands to the receptor complex, and activation of downstream Smad effectors (Shen, 2007; Schier, 2009). Feedback regulation of Nodal signaling is mediated by the Lefty antagonists (Cheng et al., 2000; Meno et al., 2001; Branford and Yost, 2002; Feldman et al., 2002). Work in Xenopus, zebrafish, and humans showed that Nodal signaling is regulated by miRNAs, but the precise mechanism is unknown (Schier, 2009; Luo et al., 2012). Nodal signaling is also influenced by secretion, endocytosis, lysosomal degradation, post-translational modifications, and processing of the ligands (Zhang et al., 2004; Shen, 2007; Tian et al., 2008; Constam, 2009). Spatially restricted translation of exogenous xCR1 reporters in frogs has been suggested (Zhang et al., 2009). But so far, a direct role for translational control in regulation of Nodal signaling has not been uncovered.
We showed previously that maternal RNA encoding the zebrafish Nodal factor, Squint (Sqt), is localized to two cells by the 4-cell stage, and predicts embryonic dorsal (Gore et al., 2005). RNA localization is an important mechanism that generates asymmetry in cells and organisms. For example, bicoid RNA localization in Drosophila oocytes and embryos is required for specification of anterior cell fates, and localization of maternal pem-1 and macho-1 RNAs determines the posterior end of ascidian embryos (Nishida and Sawada, 2001; Sardet et al., 2003; St Johnston and Nüsslein-Volhard, 1992). Mechanisms to ensure correct transport of the RNA and inhibition of translation until the RNA reaches its destination are essential for this process (Johnstone and Lasko, 2001; Martin and Ephrussi, 2009). In addition, translational control is an important step for regulation of some RNAs. For instance, a proportion of maternal nanos RNA is uniformly distributed in the cytoplasm of Drosophila embryos but is not translated, and Nanos protein is only synthesized from localized nanos RNA at the posterior pole (Gavis and Lehmann, 1994; Smibert et al., 1996; Bergsten and Gavis, 1999; Crucs et al., 2000). In zebrafish embryos, transport of maternal sqt/nodal RNA to future dorsal is dependent on the microtubule cytoskeleton (Gore et al., 2005). However, how maternal sqt RNA is regulated until it reaches future dorsal was not known.
To understand global regulation of sqt/nodal we carried out a screen for sqt 3′UTR-binding proteins, and show here, that the conserved Y box-binding protein 1 (Ybx1) binds the 3′ untranslated region (UTR) in sqt RNA. Genetic analysis of ybx1 mutants shows that maternal Ybx1 function is essential for embryonic development. Loss of Ybx1 function causes mis-localization of sqt RNA and precocious Sqt protein translation, leading to premature and uncontrolled Nodal signaling, and embryonic lethality. Thus, maternal Ybx1 is required for translational control of Nodal signaling. Since the 3′UTR of mammalian nodal RNAs can localize in fish embryos, it is likely that this control mechanism of translational repression is conserved. Our results identify a new mode of regulation of Nodal signaling, and highlight the role of maternal factors in regulation of growth factor signaling and cell-type specification in vertebrates.
The dorsal localization element (DLE) of sqt RNA resides in the first 50 nucleotides of the sqt 3′UTR, and encompasses sequence and structural elements (Gilligan et al., 2011). To identify the proteins that specifically recognize the DLE, 100-nucleotide long radioactive probes spanning the sqt 3′UTR were used for RNA gel-shift assays with zebrafish whole embryo extracts (Figure 1A,B). We observed a number of binding activities in gel-shift assays with sqt probes (Figure 1B). The DLE-containing sqt1 probe was bound by an activity, which we named sqt-RNA Binding Factor 1 (SRBF1; arrow in Figure 1B). Competition gel-shift assays with control gfp, vg1 and cyclops RNA show that SRBF1 preferentially binds the sqt DLE (Figure 1C,D). RNA-cross-linking assays show that SRBF1 is approximately 48–50 kDa (Figure 1—figure supplement 1). To precisely map the SRBF1 binding site, a 10-nucleotide sqt1 deletion series was tested for binding. Whereas deletions in the coding sequence did not affect SRBF1 binding, deletions 1–4 (Δ1–Δ4, Figure 1C,E) abolish, or significantly reduce binding to the sqt1 probe. The SRBF1 binding site overlaps with sequences required for dorsal localization of sqt RNA (i.e., Δ1 and Δ2; [Gilligan et al., 2011], and Figure 1C,E). Thus, SRBF1 is the activity that binds to the sqt DLE.
To identify SRBF1, we purified it by column chromatography, and screened individual fractions by gel mobility-shift and RNA cross-linking assays (Figure 2A). A 48 kDa factor that co-fractionated with SRBF1 activity (Figure 2B,C) was identified by mass spectrometry to be the conserved nucleic acid binding protein, Y box-binding protein 1 (Ybx1). Ybx1 contains a ‘cold shock’ domain (CSD; Figure 2—figure supplement 1A,B), similar to bacterial cold shock protein CspA (Eliseeva et al., 2012). Ybx1 homologs are associated with localized RNAs in Drosophila, Ciona, and Xenopus, and mutations in mouse Ybx1 cause lethality (Bouvet et al., 1995; Wilhelm et al., 2000; Tanaka et al., 2004; Eliseeva et al., 2012). Ybx1 contains a conserved actin binding domain (ABD), also found in Drosophila Ypsilon schachtel (Yps) (Figure 2—figure supplement 1A). The dimerization domain (DD) and non-canonical nuclear localization signal (NLS) are conserved amongst the vertebrate Ybx1 proteins (Figure 2—figure supplement 1A) (Eliseeva et al., 2012).
Ybx1 is an abundant RNA-binding protein, with many functions. Therefore, to confirm if Ybx1 is SRBF1, ybx1 cDNA sequences were cloned, and recombinant Ybx1 (rYbx1) was tested for sqt DLE-binding in gel-shift assays. Embryonic SRBF1 and rYbx1 bind to sense sqt1 RNA, but not to control gapdh, or to antisense sqt1 probes (Figure 2D). Control Escherichia coli lysate did not bind to sqt1 or gapdh probes, and recombinant zebrafish Lin28A, that also contains a cold shock domain (Moss et al., 1997), did not bind the sqt DLE (Figure 2D and Figure 2—figure supplement 2A). Semi-quantitative competition gel-shift assays show that embryonic SRBF1 and rYbx1 bind to sqt DLE sequences with the same specificity (Figure 2—figure supplement 2B). However, rYbx1 does not bind to the UTRs of other localized RNAs, such as vg1 and wnt8a (Figure 2—figure supplement 2C). To determine if Ybx1 forms protein–RNA complexes in vivo with sqt RNA, we performed RNA-immunoprecipitation (RNA-IP) with embryo lysates, and RT-PCR to detect sqt. RNA-IP with anti-Ybx1 antibodies shows a sqt product, whereas control (RT-) and RNA-IP using IgG antibodies do not show any product (Figure 2E). Under the same conditions, gapdh and wnt8a RNA are not detected. Therefore, Ybx1 specifically binds to sqt RNA in early embryos, and has all the characteristics of SRBF1.
To identify the regions of Ybx1 that bind the sqt DLE sequence and confer specificity to the interactions, we made a series of deletions that removed each of the various domains (single-stranded DNA-binding domain, ssDBD; RNA-binding domain 1,2, RNP1,2; cold shock domain, CSD; dimerization domain, DD; actin binding domain, ABD; nuclear localization signal, NLS) individually, and one that removes the entire C-terminal half of the protein (Figure 2F). We also made point mutations affecting three amino acid positions (K44Q, F54A and H67Q) that are (1) conserved between bacterial cold shock proteins and Ybx1, (2) shown to be required for RNA binding in bacterial cold shock proteins (Schröder et al., 1995; Manival et al., 2001), and (3) suggested by NMR of human Ybx1 to be in contact with RNA (Kloks et al., 2002) (Figure 2—figure supplement 1B). We find that the C-terminal half of the protein, the ABD, and the NLS are dispensable for sqt RNA binding (Figure 2F,G, Figure 2—figure supplement 1A and data not shown). By contrast, mutations within or overlapping the CSD and RNP domains abolish RNA binding (Figure 2F–H). Mutations in the DD also affect binding to RNA. The K44Q, H67Q and V94I mutant proteins were still able to bind the DLE-containing probe at the concentrations shown, whereas the F54A and V83F mutations completely abolished sqt RNA binding (Figure 2F,H). These results show that while Ybx1 binds the sqt DLE mainly via its cold-shock domain, other regions such as the DD, RNP and ssDBD are also required for binding to sqt RNA.
Expression of ybx1 RNA is ubiquitous, at all embryonic stages, and western blots show maternal and zygotic Ybx1 protein expression (Figure 3—figure supplement 1). To obtain mutants affecting ybx1, we generated zinc finger nuclease (ZFN) deletions and screened ENU-induced mutations by TILLING. The ybx1sg8 ZFN allele results in truncated Ybx1 protein lacking the C-terminus (Ybx1Δ197–310; Figure 3A). By TILLING, ybx1V83F (referred henceforth as ybx1sa42) and ybx1V94I were identified (Figures 2F and 3A). RNA gel-shift assays show that recombinant Ybx1sa42 (rYbx1V83F) has no detectable DLE-binding, whereas recombinant Ybx1sg8 protein (rYbx1Δ197–310), which has the RNA-binding CSD, binds the sqt DLE (Figures 2H and 3B). Therefore, ybx1sa42 affects the RNA-binding CSD of Ybx1, whereas ybx1sg8 likely encodes a truncated Ybx1 peptide.
Homozygous ybx1sa42 and ybx1sg8 mutant embryos are viable and fertile at 28.5°C, the normal ambient temperature for zebrafish. Extracts of embryos from homozygous ybx1sa42 females (Mybx1sa42) lack detectable gel-shift activity with sqt1 probes (Figure 3C). Mybx1sa42 mutant embryos develop normally at 28.5°C. However, at 23°C, by early blastula stages, marginal cells in Mybx1sa42 mutants lose cell membranes and a large syncytial layer forms over the yolk (black arrowheads in Figure 3E). Mybx1sa42 embryos fail to initiate gastrulation, arrest and do not survive, whereas control embryos from homozygous males (Pybx1) survive and develop normally. Mybx1sg8 mutant embryos divide normally till 16-cells, but subsequent cleavages are aberrant, the embryos fail to develop normally, and arrest (Figure 3E). Thus, maternal Ybx1 is required for embryonic development.
Injection of ybx1 mRNA into embryos did not rescue Mybx1 mutants (data not shown). Therefore, we generated stable ybx1-2a-gfp transgenic lines harboring genomic ybx1 sequences fused with viral 2a peptide and GFP sequences (Figure 3D,E). Zygotic expression of Ybx1-2a-GFP from paternally inherited Tg(ybx1-2a-gfp) transgenes (PTg) did not rescue Mybx1 mutant embryos (n = 345), although a few embryos initiate gastrulation (Figure 3E,F). By contrast, maternal expression of Ybx1-2a-GFP (MTg) from two independent transgenic insertions rescued Mybx1 mutants (Figure 3E,F). MTg expression allowed mutant embryos to undergo gastrulation and survive (Figure 3F; n > 200 embryos for each line). Thus, maternal expression of Ybx1 is essential for gastrulation and normal development.
Since Ybx1 was identified as a sqt DLE-binding protein, we examined sqt RNA localization in mutant embryos. In Mybx1sa42 embryos at 28.5°C, there is a lag in sqt RNA transport at the 1-cell stage, but sqt localization is comparable to wild-type and control embryos by 4-cells (Figure 4A) (Gore and Sampath, 2002; Gore et al., 2005). At 23°C, sqt RNA localization in Mybx1sa42 embryos is aberrant at 1-cell and 4-cell stages, forming aggregates in the yolk, that fail to localize to future dorsal cells (Figure 4A). Transport of sqt RNA is also disrupted in Mybx1sg8 embryos (Figure 4—figure supplement 1A). To determine if Ybx1 functions generally in localization of maternal RNAs, we examined if other maternal transcripts were localized correctly in Mybx1 mutants. Localization of cortical (vasa, eomesa), axial streamer (snail1a, cyclin B1), and vegetal (wnt8a, grip2) RNAs is unaffected in Mybx1sa42 mutants (Figure 4A and Figure 4—figure supplement 1A,B). Therefore, Ybx1 does not generally affect all RNA distribution, and amongst the maternal RNAs examined, only sqt localization is disrupted in early Mybx1 embryos. Maternal Ybx1-2a-GFP expression rescues sqt localization in mutant embryos in contrast to PTg expression (Figure 4A). Thus, consistent with Ybx1 binding to the sqt DLE, maternal Ybx1 function is required for sqt RNA localization.
Ybx1 can function as a transcriptional, post-transcriptional, or translational regulator (Eliseeva et al., 2012). To determine whether these processes are affected in mutant embryos, we examined sqt RNA expression (Figure 4B,C). Quantitative Real-Time PCR shows that sqt RNA levels are marginally reduced in Mybx1 mutants compared to controls (Figure 4B). In wild-type embryos maternal sqt RNA is non-polyadenylated until the 16-cell stage (Lim et al., 2012), but in Mybx1 embryos, polyA-sqt is detected even at the 1-cell stage, indicating precocious poly-adenylation (Figure 4C). We observed un-spliced sqt RNA in control eggs and embryos (Gore et al., 2007; Lim et al., 2012 and Figure 4C), in contrast to a previous report (Bennett et al., 2007). RT-PCRs to detect sqt intron 1 and intron 2 show that splicing of both introns is accelerated in Mybx1 embryos compared to controls (Figure 4C). These results show that regulated processing of sqt pre-mRNA requires maternal Ybx1 function.
To determine if Sqt protein translation is affected in mutant embryos, RNA encoding Sqt-GFP fusion protein was injected, and GFP expression was examined at various stages. Remarkably, Sqt-GFP is observed in 16-cell-stage Mybx1 embryos, whereas in controls, Sqt-GFP is only detected in blastulae (Figure 5A), consistent with the requirement for the Nodal receptors and co-receptor, Oep, from late blastula stages for signaling (Gritsman et al., 2000; Hagos and Dougan, 2007). Furthermore, Sqt-GFP levels are elevated in Mybx1 embryos compared to controls (Figure 5B). Control GFP and Wnt8a-GFP expression is similar in mutant and control embryos, indicating that translation of other proteins is not affected (Figure 5—figure supplement 1A,B). Sqt protein expression is premature in Mybx1 embryos. Therefore, maternal Ybx1 is required to repress Sqt translation in early embryos.
To determine how Ybx1 regulates translation of sqt RNA, we examined if Ybx1 forms complexes in vivo with translation initiation factors and sqt RNA. Extracts from wild-type embryos were immunoprecipitated with antibodies to Ybx1, eIF4G or eIF4E, followed by western blot, and RT-PCR to detect sqt RNA. Co-immunoprecipitation assays show that Ybx1 interacts with eIF4E but not with eIF4G, and RNA-IP experiments show that sqt RNA is detected in pull-downs with antibodies towards Ybx1, eIF4G and eIF4E. In contrast, gapdh and wnt8a RNA can be detected in RNA-IP with the eIF4G and eIF4E proteins, but not with Ybx1. Hence, Ybx1 binds sqt RNA and the 5′ 7-methyl-guanosine cap binding protein eIF4E, but is not found in translation initiation complexes with gapdh and wnt8a RNA (Figure 5C,D). Ybx1 has been shown to interact with the 5′ cap complex and inhibit translation by displacing eIF4G (Nekrasov, 2003). Taken together, these results provide evidence for Ybx1 in regulation of sqt translation by binding to the translation initiation machinery and the 3′UTR of sqt RNA.
Since Sqt protein is translated prematurely in Mybx1 mutants, we then determined when Nodal signaling is activated in mutant embryos by examining phosphorylation of the downstream effector, Smad2 (ten Dijke and Hill, 2004). Consistent with premature Sqt-GFP translation, endogenous Smad2 is phosphorylated in 64-cell stage Mybx1 embryos, whereas in control embryos, phospho-Smad2 expression is detected only at late blastula/early gastrula stages (Figure 6A). Quantification of phospho-Smad2 levels shows premature and elevated levels of Nodal signaling in Mybx1 (Figure 6B). Thus, Nodal signaling is precociously activated at cleavage stages in mutant embryos.
Analysis of target genes of various signaling pathways shows that expression of Nodal targets (gsc, ntl, bon and sqt) is increased in Mybx1 embryos by the 512-cell stage (Figure 6C). Expression of the extra-embryonic Yolk Syncytial Layer (YSL) genes, mxtx2 and hhex, is also significantly elevated. By contrast, expression of the Wnt targets boz and vox, the FGF target spry4, and the enveloping layer (EVL) gene cldE, is either unchanged or marginally reduced in Mybx1 mutants compared to controls (Figure 6C,D). The YSL expression domain of the Nodal target genes sqt and gsc is expanded in Mybx1, as is YSL expression of mxtx2, whereas in control Pybx1 embryos sqt expression is restricted to a few cells, and gsc and mxtx2 are typically not detected (Figure 6D). We found no difference in lft2, boz, vox or vent expression between Mybx1 and control embryos (Figure 6C,D and data not shown). Thus, early Wnt and FGF signaling targets are not affected in Mybx1 mutants, whereas expression of many Nodal target genes is precocious and their levels increased.
YSL expression of mxtx2 is increased in Mybx1 embryos (Figure 6C,D). Accordingly, marginal cells lose cell membranes by early blastula stages, and syncytial nuclei accumulate over the yolk (arrowheads in Figure 3E and yellow boxed area in Figure 6E). The margin between the blastoderm and YSL, evident by E-cadherin immunolocalization in control embryos, is not clearly demarcated in Mybx1 embryos. Increased numbers of YSL nuclei (YSN) were observed in Mybx1sa42 and Mybx1sg8 embryos (white arrowheads in Figure 6E), and sometimes, nearly 50 YSN were observed at the 512–1000 cell stage. ∼50% of Mybx1 embryos have more than 13 nuclei, whereas control embryos show few or no YSN (Figure 6F). The premature formation and increased numbers of YSN leads to substantially fewer cells in the blastoderm, failure to initiate epiboly, and embryonic lethality. These phenotypes are rescued by maternal ybx1-2a-gfp transgenes (Figure 6F). Thus, the extra-embryonic YSL forms precociously and is expanded in Mybx1.
Ybx1 is a multi-functional regulator of many target genes. This raises the question of whether the phenotypes observed in Mybx1 mutants are a direct consequence of Sqt/Nodal translation and diffusion from the yolk in the absence of Ybx1 function, or due to other potential effects of Ybx1. To directly determine the effects of excess Nodal protein from the yolk, we implanted Affi-gel beads that were pre-soaked in either control BSA protein or purified mouse Nodal protein, into the yolk of wild-type embryos, and examined YSN (schematic in Figure 7A). Bead implantation itself did not disrupt morphogenesis or development (Figure 7A). Control BSA bead-implanted embryos showed 1 tier of YSL (with 4–5 nuclei; n = 17, Figure 7B,C), similar to wild-type embryos (Kimmel and Law, 1985). By contrast, most Nodal bead-implanted embryos showed more YSN (75%, n = 32 embryos; arrowhead in Figure 7B,C). Therefore, Nodal diffusion from the yolk is sufficient for YSL expansion. Nodal bead implantation in the yolk of MZoep mutant embryos, which cannot respond to Nodal signals (Schier, 2009), did not affect the YSL (0%, n = 13; Figure 7B,C). Thus, excess Nodal signaling from the yolk directly induces premature and expanded extra-embryonic YSL. Similar YSL expansion and gastrulation defects were reported in lefty-1;lefty-2 double-morphants, where Nodal signaling is deregulated in the absence of the Lefty inhibitors (Branford and Yost, 2002; Feldman et al., 2002). Taken together, these results suggest that the Mybx1 phenotypes are likely due to precocious, unregulated and elevated Nodal signaling by de-repression of Sqt translation.
However, expanded YSL could also arise from defects in late cytokinesis during early embryogenesis, leading to aberrant syncytial layer formation (Yabe et al., 2009). To distinguish between these possibilities, we blocked Nodal signaling in Mybx1 mutants by two strategies. Firstly, we injected capped mRNA encoding inhibitor Lefty1 into Mybx1 embryos to block Nodal signaling. Injections in control Pybx1 embryos were used to assess the efficacy of the RNA. Immunostaining with antibodies to detect E-cadherin in cell membranes and DAPI staining to detect nuclei show that that the expanded YSL phenotype in Mybx1 embryos is suppressed by injection of lefty1 RNA, but not with lacZ RNA (Figure 8A). The margin between the blastoderm and YSL, which is not clearly demarcated in Mybx1 embryos, is restored upon injection of lefty1 RNA (Figure 8A). The majority of Mybx1 mutant embryos injected with lacZ RNA fail to initiate gastrulation and none complete gastrulation. In contrast, more than 50% of mutant embryos injected with lefty1 RNA initiate epiboly movements and of these, ∼80% complete gastrulation, and survive till prim5 stages (Figure 8B). Lefty1 RNA-injected Mybx1sa42 mutant embryos do not manifest cytokinesis failure or YSL defects even at the restrictive temperature. Therefore, the YSL defects and the failure to initiate gastrulation in Mybx1 mutant embryos are due to excessive Nodal signaling and not a result of cytokinesis defects.
Secondly, we generated ybx1;sqt compound mutants. Embryos mutant for the sqtcz35 allele express maternal sqt RNA that is localized, but the mutant Sqt protein is truncated and non-functional (Feldman et al., 1998; Bennett et al., 2007; Lim et al., 2012). The sqtcz35 mutation selectively abolishes Sqt signaling without affecting the early functions of maternal sqt RNA or activity of other zebrafish Nodals. We did not recover any ybx1;sqt double homozygous adults (N > 120 fish), but interestingly, most embryos from ybx1sa42/ybx1sa42;sqtcz35/+ intercrosses, which are essentially Mybx1 but where some have reduced Sqt or no Sqt, undergo gastrulation at 23°C unlike Mybx1 single mutants (Figure 8C,D). Mybx1;Zsqt compound mutants show phenotypes typical of reduced Nodal activity such as those observed in MZmidway mutant embryos, or upon complete loss of Nodal activity (Figure 8—figure supplement 1) (Thisse et al., 2000; Schier, 2009; Slagle et al., 2011). Similar to Mybx1 embryos injected with lefty RNA, YSL expansion is not observed in Mybx1;Zsqt mutants (data not shown) and these embryos go through gastrulation. These findings demonstrate that the Mybx1 mutant phenotypes are a direct consequence of precocious and deregulated maternal Sqt/Nodal signaling.
In this study, we have provided the first direct evidence of translational control of Nodal signaling by a key maternal factor, Ybx1, and demonstrated that it is essential for embryonic development. Our use of a temperature-sensitive ybx1 allele, that allows selective and conditional disruption of maternal Ybx1 function at early stages, shows that Nodal signaling is the only pathway affected at these stages in the mutants. This allele can potentially be a used as a tool to identify other genes and processes regulated by Ybx1.
Ybx1 is an abundant molecule and neither the RNA nor protein is spatially restricted. How, then, is Ybx1 binding specificity achieved? It is possible that other regions of Ybx1 than the CSD, and other factors in the Ybx1–RNP complex confer specificity to the interactions. Such context-dependent specificity has been observed for many transcription factor complexes and other RNA-binding proteins as well. For example, a bipartite RNA recognition module in Lin28 (which contains a CSD) binds to two distinct regions of let-7 RNA to regulate its biogenesis, and two distinct RNA-binding domains in fragile X mental retardation protein (FMRP), recognize distinct RNA elements (Tong et al., 2000; Nam et al., 2011). In support of this possibility, we find that in addition to the residues in the CSD, the DD, RNP and ssDBD domains of Ybx1 are also required for binding to sqt RNA, and likely confer specificity to the interactions. By contrast, the CSD-containing Lin28 protein does not bind to the sqt DLE. Furthermore, the ybx1sg8 mutation, which deletes the Ybx1 C-terminus, which is thought to be a protein interaction domain (Wolffe, 1994), results in more severe phenotypes and earlier lethality than ybx1sa42. It is likely that the residues lacking in the truncated Ybx1sg8 peptide are also important for its functions.
Our findings show that a major function of maternal Ybx1 is to regulate Nodal signaling via its effects on sqt RNA localization, processing, and translation. Maternal sqt RNA is largely non-polyadenylated at early cleavage stages, and polyA-containing sqt RNA is normally detected from the 16-cell stage (Lim et al., 2012). In Mybx1 embryos, polyA-sqt RNA is detected even at the 1-cell stage, indicating premature polyadenylation. Regulating the length of the polyA tail is known to mediate translational control of the RNA; for example, cyclin A RNA is stored in Drosophila oocytes with short polyA tails (Morris et al., 2005). Ybx1 interacts with the translation initiation factor eIF4E and the sqt 3′UTR. Interactions of 3′UTR binding proteins with translation initiation factors, such as the CPEB-Maskin-eIF4E complex, has been shown in translational control of maternal RNAs in Xenopus oocytes. Maskin binds the cap-binding factor eIF4E, and prevents interactions between eIF4G and eIF4E, which is required for recruitment of the 40S ribosome subunit to the 5′end of mRNAs, and thereby represses translation (Cao and Richter, 2002). Similarly, in Drosophila oocytes, cup binds eIF4E and Bruno to regulate oskar RNA translation (Nakamura et al., 2004). Mammalian YB1 prevents eIF4G from binding to eIF4E, and blocks initiation of translation (Nekrasov et al., 2003). Binding of Ybx1 to the sqt 3′UTR and eIF4E likely prevents eIF4G and eIF4E complex formation, and in Mybx1 mutants, in the absence of Ybx1 function, Sqt translation occurs precociously. Thus, Ybx1 binding to the translation initiation factors and the sqt 3′UTR can lead to translational repression of sqt RNA.
Consistent with Ybx1 being a DLE-binder, sqt RNA localization is disrupted in Mybx1, and many Sqt/Nodal target genes (including sqt) show precocious and elevated expression. Surprisingly, the Nodal target lefty2 is not detected in mutant embryos. Therefore, lefty2 expression requires factors or inputs that are missing in Mybx1. The lack of feedback inhibition in the absence of Lefty2 together with elevated Sqt/Nodal levels likely exacerbates deregulated Nodal signaling in Mybx1. The YSL expansion and gastrulation defects in Mybx1 mutants can be rescued by blocking Nodal signaling via lefty overexpression or by using the sqtcz35 genetic background that lacks the signaling functions of Sqt, indicating that these phenotypes arise from excess Nodal signaling. Interestingly, Mybx1;Zsqt compound mutant embryos are similar to cyc;sqt double mutants (Feldman et al., 1998), suggesting that maternal Ybx1 may have additional functions in regulation of Nodal signaling. We also found that Wnt signaling targets are not induced in Mybx1 mutants, where wnt8a RNA localization and Wnt8a-GFP protein expression are normal, but maternal sqt RNA is mis-localized. Therefore, the response to the maternal Wnt signal requires dorsal localization of maternal sqt RNA. This supports our previous findings, where over-expression of localized non-coding sqt RNA increased dorsal β-Catenin nuclei numbers and elevated Wnt target gene expression, and mis-localization of sqt RNA by morpholinos that also block Sqt translation resulted in loss of dorsal β-Catenin accumulation (Lim et al., 2012).
We had previously shown that human NODAL 3′UTR fused with lacZ localizes dorsally in zebrafish (Gore et al., 2005). This was surprising since mammalian embryos are thought to undergo regulative development. Moreover, Nodal RNA is not localized in early mouse embryos (Robertson et al., 2003; Cheong and Sampath, unpublished observations). Ybx1 binds the DLE, and regulates localization and translation of sqt. The sqt DLE, therefore, encompasses a localization and translational control element. This suggests that the mammalian NODAL 3′UTR may also harbor a translational control module. Our finding that maternal sqt/nodal must be translationally repressed, and that deregulated maternal Nodal signaling is catastrophic, shows that this is an essential control mechanism. Translational control is a new paradigm in regulation of this pathway. It will be interesting to see if this mechanism regulates Nodal signaling in other organisms or biological processes. Since human NODAL and ALK7 receptors are expressed in the ovary and placenta, and elevated NODAL is associated with pre-eclamptic placentas (Nadeem et al., 2011), precise regulation of maternal Nodal signaling is likely to be important for human placentation. Moreover, uncontrolled and deregulated Nodal signaling has been associated with metastasizing tumors, underscoring the importance of precise and timely regulation of Nodal signaling. Finally, Nodal signaling is essential for maintaining stem cell pluripotency, and current methods to generate and maintain embryonic stem cell (ESC) and induced pluripotent stem cells (iPSC) rely upon transcription factors. Our finding that Nodal signaling is maternally regulated by translational repression could allow modulation of these important therapeutic cells by this new mechanism.
Embryos were homogenized in 1/10 vol lysis buffer (20 mM Tris pH 8.0, 100 mM NaCl, 0.1 mM EDTA, 1 mM 6-aminohexanoic acid, 1 mM PMSF, 25% glycerol) to make extracts. Debris was pelleted by centrifugation (20,000×g, 4°C, 1 min), and supernatants flash frozen in 50 µl aliquots in liquid N2. 100 nucleotide long probes spanning the 3′UTR of sqt, wnt8a (Lu et al., 2011) and vg1 (Bally-Cuif et al., 1998) were synthesized and used in RNA gel-shift assays. Templates for the probes were generated by PCR with an extended phage T3 RNA polymerase promoter (AATTAACCCTCACTAAAGGGAGAA) appended to the 5′end of the 5′primer, and gel-purified. Primers are listed in Supplementary file 1. Radioactively labeled probes were transcribed with T3 RNA polymerase (Promega, Madison, WI), mixed with extracts, and used in electrophoretic mobility-shift assays. For the competition gel-shift assays ∼0.1 ng of radioactive probe was competed with 5–80 ng of unlabeled RNA. RNA cross-linking reactions were essentially the same as RNA gel-shifts, except that the reactions were UV-cross-linked for 5 min in a Stratalinker (Stratagene, La Jolla, CA), digested with RNase A (0.5 µg) for 1 hr at 37°C, and separated on an SDS-PAGE gradient gel (7%, 29:1 acrylamide:bisacrylamide to 12%, 19:1 acrylamide:bisacrylamide) at ∼5 mA/1 mm gel overnight, dried, and auto-radiographed.
Extracts were made as above, and flash frozen in 2 ml aliquots. Chromatography was performed on an Akta purifier (GE Healthcare, Little Chalfont, UK). 200–500 mg of protein extract was injected through a 0.2 µm syringe filter (Minisart; Sartorious, Göttingen, Germany) to a pre-equilibrated heparin HiTrap column (GE Healthcare) and eluted with a (NH4)2SO4 gradient. Fractions were collected and assayed by gel-mobility shift with sqt1 probes. Positive fractions were pooled and loaded onto coupled octyl sepharose and phenyl sepharose columns. In the conditions used, SRBF1 passes through octyl sepharose and binds to the phenyl sepharose column. The columns were uncoupled, and SRBF1 was eluted from the phenyl sepharose column with a (NH4)2SO4 gradient. Positive fractions were pooled, dialyzed, and loaded onto a 1 ml heparin HiTrap column (GE Healthcare), eluted with a NaCl gradient, collecting 1 ml fractions. We used 1–5 µl of each fraction for gel-shifts or RNA cross-linking assays. Fractions were concentrated and loaded on an SDS-PAGE gradient gel. The gel was stained with colloidal Coomassie blue (Kang et al., 2002) and the 48 kDa band was excised and analyzed by mass spectrometry.
The coding sequence of ybx1 was amplified by PCR (with primers including restriction sites, for NcoI and BamHI or BglII) from zebrafish ovary or embryo cDNA, restriction digested, and cloned into pTrcHISa. Mutations were made by site-directed mutagenesis (Zheng et al., 2004). Template plasmid was amplified by PCR with partially overlapping forward and reverse primers (Supplementary file 1) using Vent Polymerase (NEB, Ipswich, MA), digested with DpnI, and transformed into XL1blue cells.
Libraries of ENU-mutagenized zebrafish were screened for point mutations in the coding region of ybx1 (Winkler et al., 2011). A region encompassing exons two to four of zebrafish ybx1 (chromosome 8: 49299968 to 49308225; Ensembl Zv9) was amplified by nested PCR using primers listed in Supplementary file 1. Sanger sequencing of PCR fragments was performed with universal M13 forward sequencing primer. Primary hits were amplified and re-sequenced independently and verified. Mutant ybx1sa42 zebrafish (which harbor a V83F amino acid substitution) were propagated further and bred to homozygosity. For generating deletions in ybx1 we used a pair of zinc finger nucleases recognizing exon 5 of ybx1 (Toolgen Inc., Seoul, South Korea) (Doyon et al., 2008; Meng et al., 2008). Capped mRNA was synthesized from linearized plasmids, and 25 pg RNA of each zinc finger nuclease pair was injected in 1-cell-stage AB wild-type embryos. Injected embryos were raised to adulthood and progeny screened for mutations in the ybx1 locus by PCR and sequencing. We identified several small deletions at the target site. The ybx1sg8 allele used in this study has a 5-nucleotide deletion in exon 5 of ybx1, which leads to a frame-shift after amino acid 197 and premature termination after amino acid 205.
Wild-type, ybx1sa42, ybx1sg8, sqtcz35 and oeptz57 fish were maintained at 28.5°C, and embryos obtained by natural mating using standard procedures, in accordance with institutional animal care regulations (Westerfield, 2007). Embryos from homozygous ybx1sa42 females were collected, incubated at 28.5°C until the first cell division, and then shifted to 23°C for observing the temperature-sensitive phenotype. A few homozygous ybx1sa42 females yield embryos that manifest a range of phenotypes, some of which survive at 23°C. In this study, homozygous ybx1sa42 females that yielded 100% embryos arrested at gastrula stages were used in all experiments. Embryos from homozygous ybx1 males and wild-type females (Pybx1), are indistinguishable from wild-type embryos, and were used as controls. For examining ybx1;sqt double mutant phenotypes, embryos from matings of ybx1sa42/sa42;sqtcz35/+ fish were incubated at 28.5°C until the 4-cell stage to allow sqt RNA localization, shifted to 23°C until the 128-cell stage, and subsequently returned to 28.5°C until observation at gastrula and prim5 stages. The genotypes of mutants were determined by PCR using primers listed in Supplementary file 1.
Capped synthetic lefty1 RNA was synthesized from linearized plasmid using the mMessage mMachine SP6 kit (Invitrogen, Carlsbad, CA). 2 pg aliquots of lefty1 RNA were injected into Mybx1sa42 mutant or Pybx1sa42 control embryos at the 1-cell stage. Capped lacZ RNA was injected as a control. The embryos were incubated at 28.5°C until the 4-cell stage to allow sqt RNA localization, shifted to 23°C until the 256-cell stage, and subsequently returned to 28.5°C until observations at gastrula and prim5 stages.
An 8.26 kb ybx1 genomic fragment was amplified by PCR, fused with the viral peptide 2a and gfp sequences, cloned into pMDs6 plasmid and co-injected with Ac II transposase mRNA into ybx1sa42 embryos at the 1-cell stage (Emelyanov et al., 2006). Injected embryos were raised to adulthood, and progeny were screened for GFP expression. Two independent Tg(ybx1-2a-gfp) transgenic lines were used in this study.
RNA-IP was carried out using embryos lysates (Niranjanakumari et al., 2002). 20 mpf embryos were cross-linked in formaldehyde, and lysed. Anti-Ybx1 (4F12, Sigma, St. Louis, MO), anti-eIF4G (#2469, Cell Signaling Technology, Danvers, MA) and anti-eIF4E (#2067, Cell Signaling Technology) antibodies were bound to protein A/G beads (Calbiochem, EMD Millipore, Billerica, MA), incubated with wild-type embryo lysate at 4°C, washed, and eluted. Half of the eluate was used to detect proteins by western blot and the remainder was used for RNA extraction using TRIzol reagent (Invitrogen), followed by RT-PCR to detect sqt, wnt8a, and gapdh (primer details in Supplementary file 1).
E. coli BL21 cells were transformed with plasmids encoding wild-type and mutant Ybx1. Expression of recombinant protein in lysates was detected by Western blots with an anti-6xHis antibody (1:2500; sc50973, Santa Cruz Biotechnology Inc., Dallas, TX), and equal amounts of E. coli lysates were used in gel-shift assays. To detect Sqt translation, Pybx1sa42 and Mybx1sa42 embryos were injected with 20 pg sqt-GFP RNA. Whole embryo lysates (50 µg) were separated on an 8% SDS-PAGE gel, transferred to High bond-C Extra Membrane (GE Healthcare), and immunoblotting was performed using anti-GFP primary antibodies (1:2500; ab290, Abcam, Cambridge, UK) and HRP-conjugated anti-rabbit IgG secondary antibodies (1:10,000; DAKO, Glostrup, Denmark). Endogenous phospho-Smad2 was detected using anti-pSmad2 primary antibodies (1:1000; #3101, Cell Signaling Technology), and HRP-conjugated anti-rabbit IgG secondary antibodies (1:5000; DAKO). Endogenous Ybx1 expression in embryos was detected using a mouse anti-Ybx1 antibody (1:1000; 4F12, Sigma), and HRP-conjugated anti-mouse IgG secondary antibody (1:10,000; DAKO). Anti-eIF4E (1:2000; #2067, Cell Signaling Technology) and anti-eIF4G (1:2000; #2469, Cell Signaling Technology) antibodies were used in co-immunoprecipitation assays and western blots to detect interactions with Ybx1.
1-cell and 4-cell stage embryos were fixed in buffer containing 4% paraformaldehyde, 4% sucrose, and 120 µM calcium chloride in 0.1M phosphate buffer (pH 7.2). Blastula stage embryos were fixed in 4% paraformaldehyde/PBS. Fixed embryos were processed for whole mount in situ hybridization (Tian, 2003) to detect claudinE, cyclinb1, eomesodermin, goosecoid, mxtx2, squint, vasa, vox, wnt8a, and ybx1 expression (Stachel et al., 1993; Yoon et al., 1997; Howley and Ho, 2000; Melby et al., 2000; Gore et al., 2005; Siddiqui et al., 2010; Hong et al., 2011; Lu et al., 2011; Du et al., 2012; Lim et al., 2012).
We used anti-E-cadherin antibodies to detect cell membrane adhesions. Control or mutant embryos at the 1000-cell stage were fixed in 4% paraformaldehyde/PBS, and processed for fluorescence immunohistochemistry using rabbit polyclonal anti-E-cadherin antibodies (gift from CP Heisenberg) and Alexa-488-conjugated goat anti-rabbit secondary antibodies (Molecular Probes, Eugene, OR). For detecting nuclei, embryos were fixed with 4% parafomaldehyde/PBS, washed in PBS containing Tween-20 (PBST), incubated with 500 pg/ml DAPI, and washed with PBST. To label yolk syncytial nuclei in live embryos, 4 nl of 0.5 mM SYTOX orange (Invitrogen) was injected into the yolk of 64-cell stage embryos. Labeled nuclei were scored at 512-1K cell stages.
Affi-Gel blue beads (50–100 mesh; Bio-Rad Laboratories Inc., Hercules, CA) were pre-soaked in Bovine Serum Albumin (BSA; 100 µg/ml; NEB, Ipswich, MA) or mouse Nodal protein (125-250 µg/ml; R&D systems, Minneapolis, MN) for 30 min. Single Affigel beads were implanted into the yolk of dechorionated 32-cell stage embryos by making a small incision in the yolk with a tungsten needle, and nudging the bead into the yolk with pair of fine forceps. For DAPI or SYTOX staining, implanted embryos were cultured in 30% Danieau’s buffer, and processed as described above.
Maternal nodal and zebrafish embryogenesisE1–E2, Nature, 450, discussion E2–4, 10.1038/nature06314.
Role for mRNA localization in translational activation but not spatial restriction of nanos RNADevelopment 126:659–669.
The lefty-related factor Xatv acts as a feedback inhibitor of nodal signaling in mesoderm induction and L-R axis development in xenopusDevelopment 127:1049–1061.
Nodal signaling patterns the organizerDevelopment 127:921–932.
Nodal-related signals induce axial mesoderm and dorsalize mesoderm during gastrulationDevelopment 121:3651–3662.
Identification and mechanism of regulation of the zebrafish dorsal determinantProc Natl Acad Sci USA 108:15876–15880.https://doi.org/10.1073/pnas.1106801108
Control of early anterior-posterior patterning in the mouse embryo by TGF-β signalling1351–1357, Philos Trans R Soc Lond B Biol Sci, 358, discussion 1357, 10.1098/rstb.2003.1332.
Mutational analysis of the putative nucleic acid-binding surface of the cold-shock domain, CspB, revealed an essential role of aromatic and basic residues in binding of single-stranded DNA containing the Y-box motifMol Microbiol 16:699–708.https://doi.org/10.1111/j.1365-2958.1995.tb02431.x
Nodal signaling: developmental roles and regulationDevelopment 134:1023–1034.https://doi.org/10.1242/dev.000166
The tight junction component Claudin E is required for zebrafish epibolyDevelopmental dynamics: an official publication of the American Association of Anatomists 239:715–722.https://doi.org/10.1002/dvdy.22172
Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafishDevelopment 117:1261–1274.
The zebrafish book. A Guide for the laboratory use of Zebrafish (Danio rerio) (5th ed.)Eugene: University of Oregon Press.
Mutant generation in vertebrate model organisms by TILLINGMethods Mol Biol 770:475–504.https://doi.org/10.1007/978-1-61779-210-6_19
Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cellsDevelopment 124:3157–3165.
Spatially restricted translation of the xCR1 mRNA in Xenopus embryosMol Cell Biol 29:3791–3802.https://doi.org/10.1128/MCB.01865-08
Ruth LehmannReviewing Editor; New York University School of Medicine, United States
eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see review process). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.
Thank you for choosing to send your work entitled “An essential role for maternal control of nodal signaling” for consideration at eLife. Your article has now been peer reviewed and we regret to inform you that your work will not be considered further for publication at this time. Your submission has been evaluated by 3 reviewers, one of whom is a member of our Board of Reviewing Editors, and a Senior editor, and the decision was reached after discussions between the reviewers. Although the work is of interest, we regret to inform you that the consensus of the reviewers is that the findings at this stage are too preliminary for publication by eLife.
The following individual responsible for the peer review of your submission has agreed to reveal her identity: Ruth Lehmann, Reviewing editor.
While this is an extensive analysis starting with an RNA binding sequence, identifying a transacting factor and finally connecting this transacting factor to the regulation of the target RNA, the results have to be considered in view of what we learn new about Ybx1 protein and the developmental process that is addressed. For example, it is important to note that Ybx1 has had several different names over the years including p54 and Frgy and since it's discovery in the early ’80s (if not before) has been characterized as a fairly ubiquitous sequence-nonspecific RNA binding protein of relatively unclear function. Some authors liken it to be an “RNA histone” whereas others think that it stabilizes mRNA by binding RNA in a cap-dependent manner. It is also a transcription factor and binds a “Y box.” Thus the protein has a long and checkered history and, like TAR RNA binding protein, often is identified in screens because of its abundance and its apparent ability to bind nucleic acids with little specificity. Thus all reviewers feel that additional experimental evidence would need to be provided to make the paper suitable for eLife.
The major points that would need to be addressed are:
1) More direct evidence for a specific molecular role of Ybx1 in squint regulation. Otherwise this study will not go beyond the many other papers on Ybx1 and will just be another description of Ybx1 binding to RNA. Here are some suggestions: A) provide quantitative binding assays that demonstrate specificity. B) Provide evidence regarding the mechanism for how Ybx1 inhibits translation. Indeed, there is no convincing direct evidence in this manuscript that Ybx1 really does regulate squint mRNA translation, this is important given this protein's long checkered history. Also see for example evidence for Ybx1 promoting rather than repressing translation in cancer cells during EMT (Evdokimova, et al., (2009). Or C) provide evidence supporting the mechanisms by which Ybx1 suppresses splicing of sqt RNA in the cytoplasm. This is an intriguing observation, but evidence for “cytoplasmic splicing” is at best debatable (see König et al., (2007) versus Steitz et al. (2008)). Data provided in the manuscript are also compatible with a role of Ybx1 in transcription.
You would need to specifically address any of these points and provide novel insight into the function of Ybx1 for any further consideration.
2) You conclude that sqt is the major target of Ybx1. The maternal-effect phenotype of Ybx1 is interpreted as an expansion of the YSL. A functional correlate via Nodal/Sqt signaling is provided by the finding that Nodal beads implanted into wild-type embryos affect YSL but not when transplanted into oep mutants. However, the phenotype can also be interpreted as a defect in late cytokinesis during early embryogenesis, leading to an aberrant ectopic syncytium. Mybx1sg8 mutants exhibit rounded cells as well as loose cells in the chorionic space (Figure 3E), which are very characteristic of defects in late cytokinesis (sometimes embryos with these defects also become overtly abnormal at about the third cell cycle). The later defect in Mybx1sa42 is also characteristic of weaker versions of these phenotypes. Although the manuscript concludes that the early cleavage stage defects in Mybx mutants is caused by an enlarged YSL, the possibility that these defects are simply a cause of an aberrant syncytium due to defects in early cytokinesis is not well substantiated. Similarly, while it is plausible that excess nodal signaling is behind the overt “syncytial” phenotypes of the Mybx1 mutants, an alternative possibility is that targets other than nodal are also misregulated, resulting in defects in cell division. The transplanted bead experiments do not preclude this possibility. A crucial and absolutely critical experiment to test this would be a Mybx1, MZoep double mutant.
3) The most apparent early defect observed in Mybx1 mutants is that of mRNA transport along what appear to be axial streamers, from the ooplasm in the yolk to the blastodisc where the mRNA becomes localized. Is this the primary phenotype, rather than the proposed precocious translation? Is the effect truly specific to transport of maternal nodal mRNA? Figure 4–figure supplement 1 A states that Wnt8a transport can also be affected. It may be that the defect mostly affects ooplasmic transcripts that need to be transported to the forming blastodisc. Do the control mRNAs encompass all known pathways of mRNA localization, in particular those transported animally through axial streaming? If the Mybx1, MZoep double mutant shows a clear oep phenotype, these additional hypotheses should be at least discussed in the text.https://doi.org/10.7554/eLife.00683.019
- Pooja Kumari
- Patrick C Gilligan
- Shimin Lim
- Karuna Sampath
- Patrick C Gilligan
- Shimin Lim
- Shimin Lim
- Long Duc Tran
- Robin Philp
- Sylke Winkler
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
We thank the Sampath laboratory, Mohan Balasubramanian, Tom Carney, Steve Cohen, Ray Dunn, Iain Drummond, Aniket Gore, Greg Jedd, Katsutomo Okamura, and Pernille Rorth for comments and suggestions; EU FP6 Integrated Project: Zebrafish Models for Human Development and Disease, and the Sanger Institute Zebrafish Mutation Resource for ybx1sa42; Bruno Reversade for mNodal protein; Carl-Philipp Heisenberg and Ong Sin Tiong for antibodies; TLL facilities; Helen Quach, Cherish Tay, and Quek Mei Xing for technical assistance. The TILLING facility of the MPI CBG/CRT Dresden and the Sanger Institute Zebrafish Mutation Resource were supported by the ZF-MODELS Integrated Project (contract number LSHG- CT-2003-503496 of the European Commission). The Sanger Institute Zebrafish Mutation resource is also sponsored by the Wellcome Trust (grant number WT 077047/Z/05/Z).
Animal experimentation: This study was performed in strict accordance with the recommendations of the Institutional Animal Care and Use Committee at the Temasek Life Sciences Laboratory, Singapore.
- Ruth Lehmann, Reviewing Editor, New York University School of Medicine, United States
- Received: February 27, 2013
- Accepted: August 6, 2013
- Version of Record published: September 10, 2013 (version 1)
© 2013, Kumari et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited. | <urn:uuid:bab2887d-c84c-436c-80f9-e8790ecb1871> | {
"date": "2018-08-17T16:41:31",
"dump": "CC-MAIN-2018-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221212639.36/warc/CC-MAIN-20180817163057-20180817183057-00296.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9038728475570679,
"score": 2.828125,
"token_count": 14017,
"url": "https://elifesciences.org/articles/00683"
} |
1.If South-East becomes North, North-East becomes West and so on. What will West become?
2.A man walks 5 km toward south and then turns to the right. After walking 3 km he turns to the left and walks 5 km. Now in which direction is he from the starting place?
3.Rahul put his timepiece on the table in such a way that at 6 P.M. hour hand points to North. In which direction the minute hand will point at 9.15 P.M. ?
4.K is 40 m South-West of L. If M is 40 m South-East of L, then M is in which direction of K?
5.A man walks 2 km towards North. Then he turns to East and walks 10 km. After this he turns to North and walks 3 km. Again he turns towards East and walks 2 km. How far is he from the starting point?
A. 10 km
B. 13 km
C. 15 km
D. None of these
6. The length and breadth of a room are 8 m and 6 m respectively. A cat runs along all the four walls and finally along a diagonal order to catch a rat. How much total distance is covered by the cat?
7.Ravi left home and cycled 10 km towards South, then turned right and cycled 5 km and then again turned right and cycled 10 km. After this he turned left and cycled 10 km. How many kilometers will he have to cycle to reach his home straight?
A. 10 km
B. 15 km
C. 20 km
D. 25 km
8.Reena walked from A to B in the East 10 feet. Then she turned to the right and walked 3 feet. Again she turned to the right and walked 14 feet. How far is she from A?
A. 4 feet
B. 5 feet
C. 24 feet
D. 27 feet
9.One morning after sunrise Nivedita and Niharika were talking to each other face to face at Dalphin crossing. If Niharika’s shadow was exactly to the right of Nivedita, Which direction Niharika was facing?
D. Data is inadequate
10.Amit started walking positioning his back towards the sun. After some time, he turned left, then turned right and towards the left again. In which direction is he going now?
A. North or South
B. East or West
C. North or West
D. South or West | <urn:uuid:4aa43c7f-aa84-4bc6-9cbf-7a33d7448b9e> | {
"date": "2017-08-17T21:14:12",
"dump": "CC-MAIN-2017-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886104160.96/warc/CC-MAIN-20170817210535-20170817230535-00536.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9621589183807373,
"score": 3.46875,
"token_count": 530,
"url": "http://fullysolved.com/problems-on-directions/"
} |
The kindergarten children have discovered a new land...
They have traversed, explored, surveyed and mapped the labyrinth- strolling, walking, striding, marching, jumping, crawling and rolling over the rugged terrain- over hills and mountains, through valleys and ravines, forests and jungles, crunching over frosty artic tundra and wading through dewy streams.
They have unearthed important ancient archeological artifacts: coins, buttons, stones, crystals, sweet wrappers, pottery, wax and other treasures; discovered and studied native inhabitants: birds, beetles, spiders and ants and have even found evidence of a new species- the fast-food-fox.
Outside play is transformed: from running up and down, racing, shouting, screaming and chasing to play that is at once more purposeful and more imaginative, more thoughtful and more co-operative. There is more pottering too. The play feels more held, the children are relaxed and at ease here. They are settling themselves in- building dens, fairy houses and nests, staking their claim, making their mark, hanging their hats from the trees.
The labyrinth has provided a long ramble in the country, in a small urban space, offering possibilities for the type of physical play, movement and exercise that is so vital to healthy development:
‘It is important for a young child to have opportunities to say “YES” to physical challenges. By being physical the child is stimulated in her curiosity and she can discover her surroundings. By exploring the body’s challenges and possibilities the child gets to know itself. From very early on it is important for children to have opportunities to go for long walks and become inspired by their natural surroundings and experience the changing seasons. It is essential to let children crawl, jump, dance, play with mud and so on. All these things help children to develop and give them a natural confidence. Movement helps children to test and know themselves better. This way a child can meet other children in inspiration, in play and in care for each other.’
Janni Nicol, quoting Helle Heckmann, Kindling: The Journal for Steiner Waldorf Early Childhood Care and Education (UK) Autumn/Winter 2011
Adults and children view the form, scale and function of the labyrinth differently. For us it is a man-made path that we walk on festivals, a bit difficult to get round with our big feet, especially in wellies, and perhaps a nuisance to maintain. The children do not see it as an entire structure, and for them it does not have a set purpose, a correct route, a beginning or an end, or even a fixed size. It can be huge for them- or tiny, microcosm or universe. As it changes with the seasons it both sustains and shifts their interest. It is different every day- a different world every day. They do not know why it is there, or how it came about, and they don’t ask.
Perhaps inspired by the labyrinth, or by watching the school children re-shape the garden, the children have been making beautiful, intricate arrays and patterns of their own, from objects that they have found ‘lying around’ (thank you Harriet!)- twigs, pinecones, logs, hay, and of course, mud- creating sculptures that are Andy Goldsworthy-worthy.
They have also started to tunnel…
by Jacqui Armour, Kindergarten assistant. | <urn:uuid:8f1576fc-792d-4651-a1ad-8feb0b7cffaa> | {
"date": "2019-02-20T03:24:33",
"dump": "CC-MAIN-2019-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247494424.70/warc/CC-MAIN-20190220024254-20190220050254-00416.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9594413638114929,
"score": 3.109375,
"token_count": 711,
"url": "http://norwichsteinerschool.co.uk/from-the-land-of-the-labyrinth/1047/"
} |
Chaco Culture NHP Intentional Site Reburial Program
Chaco Canyon's Chetro Ketl, with subterranean levels exposed through archeological excavation (photo by Robert Blanchette, 2006)
Chetro Ketl reburied to protect masonry walls and wooden beams (photo by Robert Blanchette, 2006)
The monumental masonry structures and cultural landscape of Chaco Culture NHP are a lasting testimony to the complex civilization that flourished in the 9-12th centuries AD in what is now the southwestern United States. They are also, sadly, a witness to the cumulative impact of decades of exposure on the scientific and interpretive values of archaeological remains. Beginning in the late 1980s, the NPS embarked on an ambitious and far reaching program in intentional site reburial in an effort to stem the tide of deterioration and loss. The lessons learned from this experience serve as both a warning and a guide to similar efforts at other sites.
Intentional site reburial is an effective, practical, and economical treatment for the most threatened structures with the greatest visitation and is a sustainable and relatively low-tech solution to some of the more complex structural problems (for example, see Thorne 1989, 1990, 1991; Burch 2004). Although difficult to calculate cost comparisons, the one-time costs for reburying an average room in an ancient Puebloan site like the ones in Chaco Canyon as part of developing the intentional site reburial program are estimated to be up to 5 times the cost of a single routine in-kind fabric treatment. However, the more fragile sections need repair treatment on average every 2 to 5 years. Without considering inflation or other factors such as rising labor and equipment costs, savings are realized within 10 to 20 years, and 'fabric savings' are immediate.
Nevertheless, intentional site reburial is often problematic for those whose mandate it is to interpret sites to the public. Park staff, therefore, consulted with the public and with special interest groups. This is a routine part of the decision making process for national parks, required by federal environmental laws. During the consultation process the State Historic Preservation Office and the interested public expressed support for long-term preservation, provided access to the resources was not severely limited, and agreed that partial site reburial was an appropriate measure. Consultation with Native American tribes, who are descendants of the people who built and used the structures, revealed a strong preference for benign neglect as the appropriate treatment (that is, to allow the structures to gradually 'return to the earth'). Recognizing, however, that the Park has a legal mandate to protect and preserve the ruins, they accepted the proposed intentional site reburial plan as a relatively passive intervention to their ancestral places and preferable to treatment-oriented interventions.
Chaco Canyon NM was established, in the words of the 1907 presidential proclamation, '...to preserve the extensive prehistoric communal ruins…of extraordinary interest because of their number and their great size...' Research, survey, and excavation have revealed that the prehistoric Chaco cultural system extended far beyond the monument boundaries. In 1980, the US Congress designated Chaco as a National Historical Park, and expanded the boundaries and protection mandate to over 40 major Chaco sites located throughout the Four-Corners region of New Mexico, Colorado, Utah and Arizona. In 1987 Chaco Culture National Historical Park (hereafter referred to as 'the Park,' 'Chaco,' or 'Chaco Canyon') was inscribed as a World Heritage Site.
Chaco is located in northwestern New Mexico, a high cool desert environment (average elevation is 1900m) with high diurnal temperature variations and an average annual precipitation (rain and snow) of about 22cm.
The preservation program at Chaco
There are over 4,000 sites recorded within the park. These sites represent some 10,000 years of almost continuous use or occupation with an intense period of building between 850-1150AD. Of the 4,000 sites, only 40 have been excavated, and none completely, and these are included among the approximately 150 structures that comprise the core of the preservation program. The remaining sites are 'passively' maintained through monitoring, fencing, and other types of access restriction.
The recorded sites encompass tens of thousands of rock art images, masonry habitations, earthen architectural mounds, adobe structures, seasonal camps, stone cut stairways, constructed roadways, and water control features, including architectural monuments known as 'Great Houses.' These huge masonry structures have 1-2 hectare footprints, with enclosed plazas and associated earthen architectural platforms and roads or causeways. The buildings were constructed up to 5 stories high, with substantial timber roofs and subterranean structures, towers, and elevated rooms. As a result of the massive masonry construction, these 1000 year old structures retain walls up to 12 meters high. The remarkable preservation afforded by the arid climate, remote location, and protection of the sites by the original descendants, contributed to the National Park and World Heritage designations. Due to the number and size of these structures, however, preservation has become increasingly problematic to achieve.
For the 150 structures in the preservation program to be maintained in good (i.e. stable) condition preventive fabric treatment on average cyclic schedules of 2-3 years is required. Thus, a minimum of about 15,000 of the total 46,000 sq m of exposed masonry requires some type of preventive treatment each year.
From the 1920s through the early 1980s preservation methods impacted fabrics of the ruins in a variety of ways. Deeply excavated rooms next to unexcavated ones resulted in drainage problems, severe horizontal loading on the walls, and accelerated loss of mortar and stone on the exposed surface. Moisture infiltration into walls, in combination with freeze-thaw cycles and salt crystallization, accelerated stone and mortar erosion, particularly at wall bases and tops of walls. To counteract these trends, harder and more durable mortars replaced the mud mortars in an attempt to extend the period between repair cycles. But under many conditions, particularly in wall bases, these cement-based hard mortars, incompatible with the soft sandstone and original mud mortars, led to severe consequences in the long-run. Large sections of the structural sandstone elements began to fail, and entire sections of walls eroded and collapsed. The repetitive fabric treatments were significantly affecting the authenticity and integrity of structures.
Re-thinking the preservation options
Concerns over the impacts of preservation to the architectural, archeological and cultural integrity of the structures prompted a review and analysis in the 1980s of the preservation program. The review identified a set of alternatives that could provide practical and effective protection to the exposed fabric. These were:
- Continue the maintenance regime based on replacement of eroded elements, with recognition that these would need constant and, in some cases, progressively more frequent replacement.
- Construct protective roofs and other types of shelters.
- Research and test new additives for mortars and reversible preservation techniques that are non-invasive and low impact. This alternative requires facilities and expertise not available at the Park.
- Remove some of the resources from the active preservation program and include them in the category of benign neglect. This decision can only apply to sites with no visitor access, because visited sites require maintenance and stabilization for safety of the visitors and protection of the resource from visitors.
- Rebury the most fragile or inaccessible portions of excavated structures and improve drainage, thus providing reversible long-term protection. This option is most likely to preserve the architectural, cultural, and archeological integrity.
Park management determined that all of these alternatives were viable treatments, but intentional site reburial responded most comprehensively to the overall assessment of significance, condition and management context. This would be the focus of the preservation program as a whole. Partial site reburial would be undertaken at selected visited sites, including the Great Houses, and 14 excavated sites with no visitor access would be reburied to their level prior to excavation. Partial intentional site reburial was not considered appropriate for every Great House. Pueblo Bonito, the type site and cultural icon of Chaco Canyon, was judged to be far too significant in the public mind to consider even partial intentional site reburial (although minor backfilling is being undertaken to reduce differential fill levels between adjacent rooms).
The decision to focus on intentional site reburial as a conservation strategy engendered the need for a research and testing component, which took the form of a long-term collaborative project between the NPS and the Getty Conservation Institute (GCI), beginning in 1990. The goals of the research and testing program were to document the efficacy of intentional site reburial, define the optimal intentional site reburial environment for the variety of architectural elements, test materials and methods for mitigating the impact of differential fills and basal erosion, to apply the results of research and testing in an implementation project, and finally to disseminate the findings more widely.
Documenting the efficacy of intentional site reburial
Given the scale of intentional site reburial contemplated at Chaco, there was a clear need to demonstrate and document the efficacy of intentional site reburial as a preservation strategy. To this end, five rooms were selected at Pueblo Bonito that had been filled either immediately (intentionally through backfilling) or within a few years (through backfill and natural processes of wind-blown sand) after their excavation in the late 19th or early 20th centuries (Dowdy and Taylor 1993). Selection was also based on the existence of good photographic documentation for purposes of evaluation. These rooms were partially re-excavated in 1992 to determine the condition of original fabric after nearly a century in a reburied environment. The results demonstrated unambiguously the beneficial effects of intentional site reburial on preservation of stone, mortars, and plasters, but they also brought forth problems (in particular, the deterioration of wood) that would need to be addressed if intentional site reburial was to afford maximum preservation of original fabric.
It was found that the upper 30cm or so of fill, subject to wet/dry and freeze/thaw cycles, provided only partial protection. Below this level, preservation was somewhat variable, relating to the length of exposure before intentional backfilling or natural processes of deposition, but in general the mortars, plaster, stone, and floor features were in good to excellent condition. In contrast, the walls exposed above the fills had lost almost all of their original mortar and plaster, and revealed stone erosion, loss of construction detail such as chinking patterns, and replacement fabric. Walls were a composite of masonry, wood, and a type of wattle and daub construction. Nearly one hundred years after their excavation and backfilling, the earthen render and mortar were in excellent condition, but the wood in the construction had suffered decay. Wood buried near the surface (the top of the wall was encountered just below the fill surface) suffered from rot and termite infestation, while more deeply buried wood was decayed but in better condition. Moisture in the fills (determined from carbide meter and converted to weight %) was highly variable, but tended to increase with depth, from dry conditions at the ground surface through 5 wt. % at the midpoint to 7.4 wt. % in the deepest part of trenches. Moisture and shallow burial conditions played a key role in deterioration.
Intentional site reburial testing
On-going site testing is a crucial component of the intentional site reburial program. Testing includes as a basic goal the definition of the range of suitable fill environments and materials for buried architectural wood. Testing a range of intentional site reburial and drainage alternatives was necessary to address the variety of unique conditions in the buildings, such as existing protective roofs over intact original roofs, the importance of interpreting the juxtaposition of subterranean rooms and elevated towers, and the requisite to maintain, as far as possible, the form and outline of the structures.
The major problem associated specifically with partial site reburial is a consequence of differential fills (i.e. different levels of fill in adjacent rooms) and migration of moisture through the fill. A primary objective in the NPS-GCI testing program was to evaluate the performance and effectiveness of geosynthetic products, specifically geodrains (i.e. composites consisting of a water-conducting core wrapped in permeable geotextiles), as a means of eliminating or significantly reducing moisture in the fill under circumstances of differential fills. Tests were implemented in 1991 to address two common situations at Chaco: where original (never excavated) fill existed, which could not be trenched; and where differential fills could not be equalized for interpretive reasons, but could be trenched. The former utilized a horizontal area geodrain covered with gravel; the latter utilized a vertical geodrain in contact with the wall of the room. Geodrains were constructed on site using Enkamat 7020 as the drainage core, wrapped with geotextile (Enkafilter E43). (For further details and graphics on the application of geodrains at Chaco Culture NHP, see Demas, Lin, Agnew, and Taylor, 1993).
The horizontal geodrain was effective in removing rain water and preventing snow melt from penetrating the fill and remains in place. The vertical geodrain, however, failed to function as a drain (even when tested by the addition of water to the adjacent soil) due, it is believed, to insufficient hydrostatic (pore water) pressure from the wet soil in contact with the hydrophobic (water-repellent) polypropylene fibers of the geotextile wrapped drain. These drainage materials are subject to a threshold hydrostatic pressure, which must be exceeded to force water through the geotextile into the core of the drain. This threshold 'entry pressure' is small enough not to be significant for conventional geotechnical drainage applications but large enough to prevent the drain from functioning as intended in the vertical application. Although the threshold entry pressure may be only slightly greater than zero, the pressure in pore water migrating due to soil suction or gravity does not exceed zero (personal communication, E. Kavazanjian; see also Kavazanjian, 2004). In circumstances such as the vertical geodrain application at Chaco, an easily wetted (hydrophilic) geotextile (of which we were unaware at the time) would be required for the vertical geodrain to function as intended.
The vertical drain was removed since it was not functioning as intended under the circumstances of insufficient hydrostatic pressure. Consideration was given, however, to leaving it in place to continue to act as a capillary break, that is, a void space to prevent capillary continuity between soil and wall, thereby limiting moisture in the walls deriving from lateral migration. Partial intentional site reburial raises the evaporative zone to a new (higher) level in the masonry structures, leading over time to erosional loss through crystallization of soluble salts. Though expensive in materials and labor, and required on both sides of a wall (assuming soil on both sides), the geodrain should perform a capillary break function when dealing with this consequence of partial intentional site reburial. Based on present knowledge of the depth of infiltration of moisture in Chaco soils, a capillary break of depth 0.75m should mitigate basal erosion.
Careful consideration was given to implementing these and other tests on-site, understanding that some might not be successful. Other testing at Chaco included reversible and temporary methods of capping walls to protect them from infiltration of snow melt, and measures for mitigating capillary rise in walls leading to basal erosion. Although many of the basic principles have been developed in other testing simulations, or in laboratory experiments, the practical, real-time testing proved invaluable.
Status of the Intentional Site Reburial Program at Chaco Culture NHP
Through the Vanishing Treasures Initiative of the NPS, sixteen major excavated structures in the park have been partially reburied over the past 12 years. Some 6,000 sq m of masonry has been reburied, representing about one-eighth of all exposed masonry. The replacement of eroded mortar and stone is now more manageable and the required treatments less invasive. The intentional site reburial plan proposes in the next 5 years to partially rebury an additional 8 to10 excavated structures resulting in about one quarter of the total exposed fabric in the Park being reburied.
Although visitors have noticed a change in appearance of the structures, most understand the need for long-term preservation. The rationale and location of site reburials are incorporated into interpretive talks, but the full interpretive and educational potential of the intentional site reburial program at Chaco has yet to be fully realized. There are plans to add exhibits in the visitor's center and update guidebooks with respect to intentional site reburial interventions, but the goal on site has always been to strictly limit modern intrusions into the cultural landscape and therefore signage and interpretive panels on site are not being considered.
Intentional site reburial design has been fairly simple in concept and premised on two basic principles. The first is to equalize fill levels within the structures wherever possible; this alleviates problems associated with lateral pressure and moisture infiltration. The second is to design drainage systems that effectively remove surface moisture and keep the site reburial fill as dry as possible. Geotextiles are used as horizon markers to indicate where the intentional site reburial fill begins, and bulk fills are locally available soils.
This system has worked well for the majority of structures where fills could be equalized and the primary fabric to be reburied is stone and mortar. In cases where equalization of fills could not be achieved, testing of geodrain systems was undertaken.
This Project in Parks article was abstracted by Karen Mudar from "The Chaco Canyon Reburial Programme" by Dabney Ford, Martha Demas, Neville Agnew, Robert Blanchette, Shin Maekawa, Michael Romero Taylor, and Katherine Dowdy. Conservation and Management of Archaeological Sites, Vol. 6(3-4): 177-202.
This abstracted version, as well as use of the full article, is provided with the kind permission of Maney Publishing, 1 Carlton House Terrace, London SW1Y 5DB, UK; www.maney.co.uk.
Burch, Rachel (Ed.)
2004 Special Issue on Site Reburial. Conservation and Management of Archaeological Sites, Volume 6 (3-4).
Dowdy, K. and M.R. Taylor
1993 Investigations into the benefits of site burial in the preservation of prehistoric plasters in archaeological ruins In 7a Conferência Internacional sobre o Estudo e Conservacão da Arquitectura de Terra: comunicações: Terra 93. Direcção Geral Dos Edifícios e Monumentos Nacionais, Lisboa.
Demas, M., P-M. Lin, N. Agnew, and M. Taylor
1993 New materials for ancient sites: the application of geosynthetics to the conservation of cultural sites. Geosynthetics '93. Conference Proceedings, vol. 2 (March 31-April 1, 1993, Vancouver, BC, Canada). Industrial Fabrics Association International, St. Paul, MN.
2004 The use of geosynthetics for archaeological site reburial. Conservation and Management of Archaeological Sites, Vol. 6 (3-4):377-394.
Thorne, Robert M.
1989 Intentional Site Burial: A Technique to Protect Against Natural or Mechanical Loss. Technical Brief No.5. DOI Departmental Consulting Archeologist/NPS Archeology Program, National Park Service, Washington, DC (http://www.nps.gov/archeology/PUBS/TECHBR/tch5.htm)
1990 Revegetation: The Soft Approach to Archeological Site
Technical Brief No.8. DOI Departmental Consulting Archeologist/NPS Archeology Program, National Park Service, Washington, DC (http://www.nps.gov/archeology/PUBS/TECHBR/tch8.htm)
1991 Site Stabilization Information Sources. Technical Brief No.12. DOI Departmental Consulting Archeologist/NPS Archeology Program, National Park Service, Washington, DC (http://www.nps.gov/archeology/PUBS/TECHBR/tch12A.htm) | <urn:uuid:2c8c20f1-e9c5-4e6a-b15b-e1ed9f261086> | {
"date": "2015-07-28T13:29:26",
"dump": "CC-MAIN-2015-32",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-32/segments/1438042981921.1/warc/CC-MAIN-20150728002301-00341-ip-10-236-191-2.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.934184730052948,
"score": 3.171875,
"token_count": 4273,
"url": "http://www.nps.gov/archeology/sites/npSites/chacoReburial.htm"
} |
An Oceana Canada-commissioned study, Oceans of Opportunity: The economic case for rebuilding northern cod, found that a healthy northern cod fishery could provide 16 times more jobs and five times more economic value than today. With low fishing pressure and favourable environmental conditions, the fishery could recover in as few as 11 years, supporting 26,000 jobs and increasing its value to $233 million in today’s dollars.
More than a quarter of a century ago, northern cod was often referred to as “Newfoundland currency,” because it supported massive fisheries, drove economies and fed millions. It would have been hard to imagine that any human action could have devastated the sheer size and strength of what seemed like endless abundance. That is, until the cod fishery collapsed in the early 1990s.
Today, the northern cod population is in the critical zone, the level at which serious harm is occurring to the stock and where conservation action is crucial. Policy created by Fisheries and Oceans Canada states that when a stock is in the critical zone, conservation objectives should be prioritized and fishing mortality should be kept at the lowest possible level. Despite this, and the fact that northern cod is still under moratorium, the commercial fishery harvested more than 9,000 tonnes last year and an unknown amount was fished recreationally.
On the cusp of the 2019 northern cod fishing quota announcement by Fisheries and Oceans Canada, the findings highlighted in the new study underscore the importance of setting science-based quotas and reveal the long-term cost of delaying recovery.
This year, northern cod showed a slight increase in biomass leading to calls for higher fishing quotas, but it is far too early in the population’s fragile recovery to ramp up fishing pressure. This study shows that the long-term potential of the fishery vastly outweighs any limited returns we might get from it being overfished now. The good news is, northern cod has a tremendous potential to bounce back to healthy levels and once again support a lucrative, sustainable fishery.
Canada’s fisheries are in trouble and there is an urgent need for the government to intensify its efforts to rebuild them. Only 34 per cent of our fisheries are considered healthy and more than 13 per cent are critically depleted, including northern cod. The loss of fish jeopardizes social and economic well-being and the health of our oceans. Intervention is needed now, including putting in place rebuilding plans to see these critical stocks sustainably managed back towards a healthy state.
Oceana Canada is calling on Fisheries and Oceans Canada to set a quota that supports recovering the population to healthy level and ensures the long-term viability of the fishery.
Read the full report, Oceans of Opportunity: The economic case for rebuilding northern cod. | <urn:uuid:b3c94104-7055-402b-9a54-afe3e99c2ad5> | {
"date": "2019-10-18T09:44:22",
"dump": "CC-MAIN-2019-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986679439.48/warc/CC-MAIN-20191018081630-20191018105130-00416.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9562711119651794,
"score": 2.703125,
"token_count": 566,
"url": "https://oceana.ca/en/blog/northern-cod-fishery-could-provide-16x-more-jobs-and-5x-more-economic-value"
} |
Widely prevalent in the tropics and the subtropics, dengue fever is caused by viral infection, transmitted through the bite of a mosquito, the female Aedes aegypti. It is a day-biting mosquito which breeds well in collected rain water or freshwater and feeds on human blood to produce eggs. Also referred to as ‘break bone’ fever, its critical and severe form is called as dengue hemorrhagic fever. The symptoms of dengue begin surfacing within four to six days of infection. Few top symptoms to pay heed to for early diagnosis and treatment are:-
#Sudden Onset Of High Fever
The infected person exhibits a sudden onset of extremely high temperature which can reach as high as 41°C and possibly accompanied by convulsions and other complications. Low heart rate and low blood pressure may also be experienced as a direct consequence of the fever. Characteristic rashes also cover the entire body except the face. A standard dengue fever lasts for about six to seven days . This fever is often confused with chikungunya viral infection but a blood test sets the record straight. Prolonged fever along with other symptoms and low blood platelet count complicates to dengue hemorrhagic fever. Its manifesting symptoms are hypovolaemia, sudden increase in vascular permeability and abnormal blood clotting mechanism. Being fatal, this could lead to death.
#Severe Headache With Pain Behind The Eyes
High fever is often accompanied with severe headache (localized to the forehead) and extreme pain behind the eyes which is medically referred to as retro-orbital pain. The pain is so intense that patients find it difficult to flap the eyelids and even feel foggy and dizzy. Classic Dengue has a higher severity of headache than the hemorrhagic fever.
#Intense Body, Joint And Muscle Pain
Referred to as myalgias and arthralgias respectively, the pain in the legs and joints are so intense that dengue fever has popularly been nicknamed as break-bone fever or bone-crusher disease. The ache can initiate within a few hours of infection and is often accompanied with overall body ache which can be extremely uncomfortable and debilitating. Unusually intense pain makes it quite difficult for the patient to rest in any comfortable position.
#Swollen Lymph Nodes And Glands
The lymphatic glands produce antigens and the immune cells (white blood cells) to kill and remove any infectious germs that attack the body. This is done at the lymph nodes which are spread throughout the body. Fighting the dengue virus, causes the lymph nodes, especially of the neck region to swell and become tender. Some patient find it spread throughout their body.
Being a viral disease, there is no specific treatment or vaccine available for this fatal disease. Early diagnosis and management of the symptoms is the ideal treatment path available. Critical cases require hospitalization and treatment with intravenous fluids and sometimes even blood transfusions. Keeping the surroundings clean and preventing the breeding of the mosquitoes is the winning path in combating dengue fever. | <urn:uuid:a20add0e-a06d-4485-a91d-6dbc313a989c> | {
"date": "2018-10-17T20:11:09",
"dump": "CC-MAIN-2018-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583511216.45/warc/CC-MAIN-20181017195553-20181017221053-00376.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9414342641830444,
"score": 3.609375,
"token_count": 638,
"url": "https://www.itmlab.com/top-5-symptoms-of-dengue/"
} |
from the GNU version of the Collaborative International Dictionary of English
- n. any one of several species of beetles which are injurious to the leaves or branches of the grapevine. Among the more important species are the grapevine fidia (see Fidia), the spotted Pelidnota (see Rutilian), the vine fleabeetle (Graptodera chalybea), the rose beetle (see under Rose), the vine weevil, and several species of Colaspis and Anomala.
Sorry, no etymologies found.
Sorry, no example sentences found. | <urn:uuid:5e90a4d2-8dff-4a74-8b9f-73a449ea62e7> | {
"date": "2017-08-22T17:02:42",
"dump": "CC-MAIN-2017-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-34/segments/1502886112533.84/warc/CC-MAIN-20170822162608-20170822182608-00616.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8239757418632507,
"score": 2.546875,
"token_count": 123,
"url": "https://wordnik.com/words/vine%20beetle"
} |
much of our conception of mental disorders is wrapped up in the "biggies", things like schizophrenia and bipolar disorder that tend to result in dramatic deviations from "normal" behaviour [even though they sometimes don't] and reasoning. but really, that's just the top layer of the crazy tiramisu. there are many further classifications of thought and mood disorders that don't get spoken about as much, but which may affect far larger numbers of people. they also tend to be more controversial, because they are less evident. someone who refuses to eat and bathe or speaks to people who aren't there or who cuts themselves because they believe that they have bugs living under their skin is obviously in need of help. someone who is prone to wild exaggeration or who thinks only of themselves often seems more in need of a boot to the head. ultimately, the fear is that behaviour which is merely odd or eccentric can be labeled as disordered thought, which obviously raises a lot of questions about the limits of individuality. i'm not going to get into the arguments for and against, that's for another day [and should probably involve a lot more voices besides mine]. this is just a quick introduction.
generally speaking, personality disorders are a group of symptoms established over the long term in an adult personality that affects or compromises an individual's thought patterns and interactions with and beliefs about the outside world. so what the hell does that mean?
I PROBABLY CAN'T ANSWER THAT QUESTION, BUT THERE'S MORE TO READ...
well, the crux of the matter seems to be where one draws the boundaries of normal or rational behaviour and the value of moderation. if you accept that one should be moderately social, moderately trusting, moderately emotional, moderately independent and moderately empathetic then it stands to reason that behaviour that falls outside the bounds of "moderation" is abnormal. of course, you then have to establish a standard of normalcy, which will obviously have some dependence on dominant cultural values and open a whole can of social worms that i said in the opening paragraph i was going to try to avoid. i hope this serves as an example of the complexity of the issue.
personality disorders are grouped into "clusters" both by the american psychiatric association and the world health organisation. the clusters are delineated by the perceived core elements of the disorders, although there is also a category reserved for personality disorders "not otherwise specified" [i.e., "something is wrong with you, but we don't have a name for it yet"]. furthermore, the w.h.o. has a classification for mixed personality disorders [i.e., "you have a whole lot of things wrong with you"].
the a.p.a. names their clusters [the w.h.o. doesn't] ::
a. odd or eccentric disorders [remember what i said at the beginning about stigmatising certain behaviour?]
b. dramatic, emotional or erratic disorders
c. anxious or fearful disorders
navigating the waters of these personality disorders can get very rough very quickly. for starters, the naming of the disorders themselves seems to be some sort of psychiatric trap. among the disorders in cluster "a", you have both schizotypal AND schizoid personality disorder [although the w.h.o. only lists the latter]. those are two different disorders, the first characterised by abnormal [loaded term, i know] or eccentric thought, superstitious or irrational beliefs and the second by social withdrawal, marked introversion and apathy. and both are very different from schizophrenia. of course, all three can share symptoms. and you can have both schizophrenia and a comorbid personality disorder [schizo squared?]. confused yet? no?
how about defining obsessive-compulsive disorder versus obsessive compulsive personality disorder? the first is an axis i condition, where a person feels forced for reasons they can't always explain to perform certain rituals, avoid certain things, or follow certain guidelines. the personality disorder variant is extremely similar, manifesting as a strict adherence to order and process, often at the expense of flexibility and efficiency. the main difference between the two? in the axis i disorder, the subject finds their compulsions frightening or unpleasant. an individual with the personality disorder variant believes that their methods are correct. good luck figuring out where the dividing line falls on that one. if i need to get up in the morning and start my day by making a detailed list of everything i need to do, even on days when i don't want to, because i think it's the right thing to do, does that mean i have obsessive-compulsive disorder or obsessive-compulsive personality disorder? or does it just make me well-organised?
theoretically, the difference between being charmingly eccentric and in need of help falls at the point where one's eccentricities start controlling and interfering with everyday life. if i make a to-do list every morning when i get up, that's one thing. if i wake up two hours late and still can't leave the house without taking the time to write out my list, or if i spend the entire day too anxious to do anything because i'm afraid of not knowing what i'm supposed to be doing, that's a problem. in general, then, we can say that one's level of flexibility is what's at question, but it's not always so easy to sort things into one pile or another. and that's assuming that, as a subject, i even perceive that i have a problem. most people with personality disorders actually believe quite the opposite; they think that they see things more clearly and accurately than others. which raises the question of who gets to decide when a behavioural quirk becomes problematic. if i don't think i have a problem, should that be good enough? would it be good enough if i were a drug addict? it's a very slippery slope.
in keeping with the somewhat vague criteria for defining personality disorders, their causes are likewise somewhat difficult to predict. there does seem to be some genetic predisposition, in that people with a family history of mental disorders of any kind are more likely to produce children with personality disorders, but no one has come up with a reason why. childhood experiences seem to be a major factor, whether it means some sort of abuse, neglect or general instability, which could technically mean that personality disorders are actually a long-term effect of post-traumatic stress disorder, the brain's way of orienting itself towards the world in reaction to extreme stress. and then there's the fact that personality disorders seem to disproportionately affect those who have "low socioeconomic status". so on top of all the other misery it brings into your life, being poor may make you crazy.
as tricky as they are to define, personality disorders are even trickier to treat. medications may help manage some of the acute symptoms of the disorder, but therapy, usually structured to identify the causes of disordered thought patterns and to "train" the mind to think in a different, less damaging way, is thought to be the route to a permanent recovery. i say that it is "thought to be", because the fact is that there is comparatively little research on personality disorders, so theories about a cure are still highly, well, theoretical. [this may be a side effect of those who may have disorders not admitting that they do. if i don't believe i have a problem, why would i present myself for treatment or analysis?]
if this all seems excessively complicated, it's because it probably is. and it warrants further discussion and study. but for today, we'll leave off there. more on the subject at a later time.
[you can see the full article where the chart above came from here.] | <urn:uuid:ed13936b-7694-4b55-b6a5-19f10c6d782f> | {
"date": "2016-05-26T04:43:34",
"dump": "CC-MAIN-2016-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-22/segments/1464049275645.9/warc/CC-MAIN-20160524002115-00176-ip-10-185-217-139.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9656814932823181,
"score": 2.59375,
"token_count": 1587,
"url": "http://morelikespace.blogspot.com/2011/09/mental-health-mondays-personality.html"
} |
Late Triassic silicic volcanism in the southeast Queensland segment of the New England Fold. Belt is preserved within a complex of co-magmatic granites, rhyolites and ignimbrite within a collapse cauldron, and an adjacent rhyolite dome complex that may be a sag caldera. The collapse cauldron is a 50km by 35km ovoid structure oriented transverse to the regional NNW structural fabric. Basement to the cauldron comprises Palaeozoic meta-sediments of the Coastal Block, and meta-volcanics of the Gympie Group. The cauldron is traversed by the Perry Lineament, which offsets the eastern third of the cauldron 8 km sinistrally. This lineament is a complex series of upright faults that are aligned with the eastern margin of the Middle Triassic Esk Trough, to the south. The cauldron thus occupies a unique location at the intersection of four basement terranes and situated across a regional fault structure.
The rhyolite dome complex predates the collapse cauldron, and comprises three cryptodome complexes. One of these complexes intrudes an ignimbrite sheet, and is interpreted to be a vent area for that ignimbrite. Extrusive rock types within the collapse cauldron include intra-caldera quartz ignimbrite and associated bedded rhyolite breccias, and pre-eruption rhyolite and dacite domes and lavas. The eastern section of the cauldron exposes successively deeper levels within the roof zone of the cauldron into the granite magma chamber that fed eruption. Granite comprises a heterogeneous complex of biotite granite, porphyritic biotite granite, rhyolite and aplite, and peripheral intrusive rhyolite domes. A texturally homogeneous pluton of weakly porphyritic biotite granite is interpreted to be a resurgent granite emplaced soon after eruption. The ring structure of the cauldron is marked by a dyke of porphyritic biotite granite or rhyolite up to 200m in width. A stock of alkali granite straddles the northeastern segment of the ring fracture, and intrudes at least 400m into intracaldera quartz ignimbrite.
Trace element variations within the granite types show the effects of, and constrain possible, petrogenetic processes. Granites, rhyolites and ignimbrites display distinct calc-alkaline isotope and trace element geochemistry, including high Ba/La and Th/Ta and depletions in HFS elements. Strontium isotope data give a calculated age of 221.8±0.6Ma with lsr=0.70357. Chondrite-normalized REE plots show steep LREE and flat HREE profiles and moderate europium anomalies. LaN, ranges from 85-110 for granite and rhyolite, and LaN/YbN from 5-10. δ18O averages 8.0 ±0.5 per mill, and εNd, falls within a narrow range averaging +4.2. The alkali granite displays A-type characteristics and identical isotopic compositions to biotite granite and rhyolite. Incompatible element contents are, however, too high to be produced by fractional crystallisation from any observed biotite granite composition. Ignimbrite and granite intruding the ring fracture display ternary minimum mineralogies, but are enriched in Ba, Eu and alkalies relative to typical granite and rhyolite. These characteristics cannot be explained by simple crystal fractionation, and require enrichment of alkali feldspar in the melt prior to eruption.
The isotope data plot close to the mantle array and within the field of island arc basalts and sub-continental mantle. ISr is more primitive than Late Permian l-type granites of the New England Batholith, but similar to the isotope compositions of Early Triassic andesites which occur throughout the central New England Fold Belt. Batch partial melting models for biotite granites support the proposal that the granites were produced by 20% partial melting of an andesitic crust. The origin of the alkali granite is less clear, but partial melting calculations do not support an origin by second-stage partial melting of the residual andesitic crust. An origin by fractional crystallisation from basaltic magma contaminated by andesitic crust is proposed. Evidence that contamination of basaltic magmas occurred is found within coeval mafic lavas that are exposed outside the boundary of the cauldron, and which erupted between the silicic eruptions of the Gayndah Centre and Mungore Cauldron.
Late Triassic silicic volcanism in the New England Fold Belt, including that preserved within the Mungore Cauldron and adjacent Gayndah Centre, is interpreted to have developed during the transition of the Mesozoic eastern Australian margin from a compressional destructive plate margin to an extensional margin. This period heralded continental fragmentation that culminated in the Cretaceous opening of the Tasman Sea. | <urn:uuid:0abe31a4-d221-40de-b810-90e74dae1a57> | {
"date": "2014-10-30T12:15:20",
"dump": "CC-MAIN-2014-42",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414637897717.20/warc/CC-MAIN-20141030025817-00121-ip-10-16-133-185.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8744750618934631,
"score": 2.578125,
"token_count": 1066,
"url": "http://espace.library.uq.edu.au/view/UQ:284087"
} |
In 1959, James Ngugi travelled west from his village in Kenya to attend Makerere University in Kampala, Uganda. Both countries were still British colonies but a great independence movement was underway on the continent.
Before 1950, there were just four independent countries in all of Africa. Six more would become independent in the 1950s.
The peak would be in 1960, with 17 countries declaring their independence.
The Kenya that James Ngugi was leaving was a white settler colony with a state of emergency in effect. War was happening, known as the Mau Mau Rebellion. The Uganda that he saw on arrival was nearly purely African, still a colony but with civil liberties and no war.
Events were moving rapidly. He went to Uganda as a colonial student but graduated in a free country, as a citizen of another free country, Kenya.
Ngugi wa Thiong'o: one of Africa's greatest writers
As part of the change sweeping Africa, that student would change his "colonial" name to Ngugi wa Thiong'o and go on to become one of Africa's greatest writers.
In an interview with CBC News, Ngugi, now 72, reflected on the early '60s at Makerere. There was "tremendous hope" then as he and other students joined the students who came from one country after another to celebrate their homelands' independence.
Ngugi wrote his first play, The Black Hermit, as "a contribution to Uganda's celebration of independence" in 1962. "Ngugi speaks for the continent" was the headline on the review in Makerere's student newspaper.
The first volume of Ngugi's memoirs, Dreams in a Time of War, has just been published. That title, he said, "captures the hope we felt despite the harsh reality around us." He is now writing the volume that covers the 1960s.
Well aware of the problems of the last 50 years, Ngugi says the 1960 independence was still a "tremendous achievement" after the many years of colonial rule.
Canada's 1960 coverage of Africa
Canadian media were caught up with the excitement of Africa in 1960. A feature in Toronto's Star Weekly opened: "Africa, long known as the Dark Continent, is now bright with the glow of smouldering unrest and the flame of open revolt and violence."
A feature in the Toronto Telegram began much the same: "Africa, vast, rich and for centuries a slumbering giant, is bursting its chains."
The coverage was not without its own colonial attitudes. The Star Weekly's Bill Stephenson wrote that, "Above all, the turbulent continent is divided by the often impenetrable ignorance, superstition and illiteracy."
How Europe underdeveloped Africa
Richard Dowden, director of the Royal African Society in London, has spoken to some of the then young administrators the colonial powers sent to Africa in 1950s. Their main order was "don't spend any money." Little was done to train the African professionals who would be needed to run an independent state.
In his book Africa: Altered States, Ordinary Miracles, Dowden writes about another problem: how colonial rule had damaged and discredited Africans' traditional leadership and political system. Traditional rulers had become identified with imperial rule and Africa's new nationalist leaders knew they would need to be replaced. "In colonial times, no one was brought up to be a leader. The bosses were the whites," Dowden said in an interview with CBC News.
Then there were the borders Europeans drew across Africa, ignoring existing ethnic areas, sowing the seeds for decades of ethnic violence.
Not all countries had independence movements, especially those with few European settlers and therefore little removal from the land. "Independence came to their inhabitants as a surprise, not as liberation," Dowden wrote in Africa.
"The pressure to leave quickly came from the U.S., who wanted Europe to disgorge its empires, largely because the trade was tied into them and America wanted those markets," Dowden told CBC News.
Also, after the Second World War, Europe was exhausted. Dowden describes the European thinking at the time as, "Let's just go; let's just forget this whole imperial project and leave."
On the other hand, independence also coincided with a boom in commodities. That meant some new African states were relatively well off. "There was a lot of money flowing into Africa so independence felt good. In an economic sense, they were doing better," Dowden said. It would not last.
The first African Writers Conference
For Ngugi wa Thiong'o, a conference he attended in 1962 both concretized his hopes and served as a metaphor of what happened afterwards to independent Africa.
It was the first African Writers Conference, with most of the prominent writers from east, west and south Africa participating at Makerere University. Chinua Achebe, Wole Soyinka, Ezekiel Mphahlele, Lewis Nkosi and writers from abroad like Langston Hughes were there. It was a huge moment, for Africa and for Ngugi.
Ngugi was then at work on his first two novels, Weep Not, Child and The River Between, but still a Makerere student. "Imagine a young student like myself beginning to write … being in this gathering of these writers," he said in an interview. "In that conference, one could feel the optimism that swept the continent."
But soon after, most of those writers "could already see certain social developments that they felt betrayed that hope."
Ngugi's own story is representative. He felt that although Africa was achieving political independence, economic justice for ordinary people was missing. "That was what many of us felt and expressed in our writings."
Ngugi's arrest and exile
In 1977, Ngugi, a major literary figure, was detained at a maximum security prison in Kenya after a production of his play, I Will Marry When I Want, upset the dictatorship.
In prison he wrote Devil on the Cross, the first modern novel in the Gikuyu language. He had to write it on toilet paper. (That was not as difficult as it sounds, given the stiff quality of the toilet paper.)
A prisoner of conscience campaign by Amnesty International forced his release a year later but he could not resume his university teaching. While on a trip abroad in 1982 promoting Devil on the Cross, he learned of plans for him to be killed upon his return to Kenya, so he went into exile, first in the U.K. and then in the U.S., where he still lives.
The story is told that when his next novel, Matigari, was published, Kenyan dictator Daniel Arap Moi issued an arrest warrant for the novel's central character. When Moi learned the character was fictional, he ordered that all copies of the novel in Kenya be seized instead.
African turning points
In the middle of Ngugi's journey from arrest to exile, the last of Africa's colonies, Zimbabwe, achieved real independence in 1980. It was the 41st country to declare independence since the start of the Year of Africa 20 years before.
(Of course, there was still apartheid in South Africa and its occupation of Namibia. 1960 was also the year of the Sharpeville massacre in South Africa, in which 70 anti-apartheid demonstrators were killed, and the year the African National Congress was banned.)
1980 was a transitional time for Africa in other ways, too. The 1979 oil price shock marked an end to the long commodities boom and the AIDS virus was about to unleash its fury in Africa.
All this was in the midst of an economic downturn. Morton Jerven, assistant professor of international studies at Simon Fraser University, writes that between 1975 and 1995, "growth did fail in the majority of African economies." Per capita incomes declined by 3.7 per cent from 1980 to 1987. In 1987, average indebtedness for African countries was half of GDP.
Problems with corruption, political leadership, lack of economic diversification and inequality continue to plague Africa. However, economic growth (and commodity price rises) had returned to Africa just before the turn of the century, and continued until the 2008 global economic crisis. From 2003 to 2008, growth averaged more than six per cent. In 2008, the World Bank published a report titled Africa at a Turning Point?
Africa's poverty gap
Peter Lewis of Johns Hopkins University sees a syndrome of "growth without prosperity" in Africa. "Despite Africa's improving record of growth, there has been limited evidence of poverty reduction or improved equity in the region's highly skewed economies," he writes in the May issue of Current History.
For Ngugi wa Thiong'o, many positive things are happening on the continent but "there are many gaps and we have to meet their challenges." The poverty gap and the gap between Africa and the West means for Ngugi, "real change will be when we can see genuine economic and social development for ordinary people."
Ngugi said his latest novel, Wizard of the Crow, "describes more or less the present conditions of Africa in the world and the possibilities of a new Africa and a new world."
Ngugi wa Thiong'o in Toronto June 12-13
The Luminato arts festival in Toronto has two events featuring African writer Ngugi wa Thiong'o.
Saturday, June 12 he is on a panel with Nigerian-Canadian author Carole Enahoro and Zimbabwe's Brian Chikwava.
The Sunday event has him on a panel with Kenyan playwright Binyavanga Wainaina and Doctors Without Borders' James Orbinski.
When Richard Dowden considers those possibilities, he remembers his first of what would be many visits to Africa. In 1971, in Malawi, he recalls a time of immense optimism, "a great sense of pride in the new nation." The feeling was "we're creating these wonderful new worlds."
Today he sees several hopeful signs for Africa.
Economic demand from Asia, and especially China, has broken the European stranglehold on African commerce.
There is a new professional class in Africa, including people from the African Diaspora who have returned, bringing new skills and new ways of doing things. "The civil servants are much better now and Africa is better governed as a result," Dowden said. In internet cafés, one can see people looking for things that will improve their lives, for educational tools.
Dowden also said mobile phones have transformed politics, social life and businesses in Africa. The continent has mostly skipped over landlines so, "suddenly, communication is very easy in Africa."
Looking back on the 50 years since the Year of Africa, Dowden said, "The most damaging thing that colonialism did to Africa was not political or economic or the borders, or anything else, it was a blow to Africa's self-belief, the idea that the only way to become 'developed' … is to become like the white man. That was so damaging to the psyche of Africa and I think that's what's changed." | <urn:uuid:b438b770-2d6b-429b-9199-fd7318cb4dad> | {
"date": "2015-04-27T14:17:10",
"dump": "CC-MAIN-2015-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246658376.88/warc/CC-MAIN-20150417045738-00262-ip-10-235-10-82.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9781861901283264,
"score": 2.78125,
"token_count": 2293,
"url": "http://www.cbc.ca/news/world/1960-the-year-of-africa-1.909381"
} |
Allen Zderad from Minnesota is now able to see his wife again after ten years of being blind due to a bionic eye.
The 68-year-old man started having serious vision problems around 20 years ago due to a condition known as retinitis pigmentosa, a degenerative eye disease which affects the retina.
Allen Zderad, who worked as a chemist when, was declared effectively blind a decade ago.
The man continued his hobby of woodwork by developing his sense of touch and spatial relationships.
Mayo Clinic researcher and ophthalmologist Dr. Raymond Iezzi Jr. had been working on the Second Sight Argus II retinal prosthesis system when he reached out to Allen Zderad.
Dr. Raymond Iezzi Jr. considered Allen Zderad a suitable candidate for a bionic implant.
During the process, the ophthalmologist fitted 60 electrodes into Allen Zderad’s eye.
The electrodes work by interacting with a special camera attached to the patient’s glasses and a separate computer pack capable of sending information to the electrodes embedded in Allen Zderad’s retina, which then sends signals straight to the optic nerve.
After implant, Allen Zderad, a grandfather of ten, explains that he can’t make out detail, but he can now make out shapes and outlines.
[youtube b1_efoktiAg 650]
Last month, the Food Drug Administration (FDA) was supposed to approve the Argus II Retinal Prosthesis System by California developer Second Sight, now those in the U.S. who would qualify for the device wait with bated breath as February roars on.
A first of its kind technology, first bionic eye Argus II was already approved for use in Europe in 2011 and is the culmination of 20 years of scientific research into the delicate and deeply complex sight organ.
The implant and eyewear duo will most benefit patients with an inherited form of degenerative blindness that destroys the retina called retinitis pigmentosa, which affects about 3,000 people in the U.S.
Sufferers of the disease experience a gradual retinal generation and an accompanying loss of vision that eventually leads to blindness.
By implanting a series of electrodes inside the eye, the Argus II prosthesis will make up for the failing retina by itself transmitting information about lightness and darkness, for instance, to the brain.
A second aspect of the Argus II is the eyeglass headset.
Patients wear eyeglasses mounted with cameras that then transmit data about what is in front of them to a small wearable computer.
From there, the information is transmitted wirelessly to the implant and the brain is sent a series of electrical impulses the patient eventually learns to interpret as light, dark, and shapes.
“No one really thought it would be possible because the tissue around the eye is so soft and delicate,” Dr. Mark Humayun, of the Keck School of Medicine at USC told the Wall Street Journal.
“If we continue to develop this type of technology and begin to understand the new electrical language of pulses to the brain, to the eye, we can apply it to other parts of the body and we can change our world and how we relate to it,” continued Dr. Mark Humayun, who has been working on the technology for 25 years and is co-creator the Argus II.
A first of its kind technology, first bionic eye Argus II was already approved for use in Europe in 2011 and is the culmination of 20 years of scientific research into the delicate and deeply complex sight organ
One early patient, Elias Konstantopoulos of Glen Burnie, Maryland, had lost his sight completely to retinitis pigmentosa and sought help from the Argus II researchers.
After undergoing the implantation in 2011, Elias Konstantopoulos was able to distinguish between dark and light and used that ability to help him maneuver through space.
His hope is to one day see the face of his grandson, Anthony.
Neither Elias Konstantopoulos nor any of the other recipients of the Argus II in the U.S. and Europe thus far are able to see completely normally.
However, researchers say some of the Argus II recipients are able to identify letters just a few inches tall.
Dr. Mark Humayun says the device’s reliance on an external computer is key to its future success and usefulness.
“Software upgrades will allow us to do more for people – because the implants don’t need to change, the glasses can be enhanced with software upgrades.”
Mark Humayun sees a future where thanks to his device, once-blind patients will see in various colors and even, he says, in digital zoom, just like “your iPhone”.
A bionic eye which is powered by light has been invented by scientists at Stanford University in California.
Implants currently used in patients need to be powered by a battery.
The new device, described in the journal Nature Photonics, uses a special pair of glasses to beam near infrared light into the eye.
This powers the implant and sends the information which could help a patient see.
Diseases such as age-related macular degeneration and retinal pigmentosa result in the death of cells which can detect light in the eye.
Eventually this leads to blindness.
A bionic eye which is powered by light has been invented by scientists at Stanford University in California
Retinal implants stimulate the nerves in the back of the eye, which has helped some patients to see.
Early results of a trial in the UK mean two men have gone from being totally blind to being able to perceive light and even some shapes.
However, as well as a fitting a chip behind the retina, a battery needs to be fitted behind the ear and a cable needs to join the two together.
The Stanford researchers say their method could be a step forward by “eliminating the need for complex electronics and wiring”.
A retinal implant, which works in a similar way to a solar panel, is fitted in the back of the eye.
A pair of glasses fitted with a video camera records what is happening before a patient’s eyes and fires beams of near infrared light on to the retinal chip.
The creates an electrical signal which is passed on to nerves.
Natural light is 1,000 times too weak to power the implant.
The researchers said: “Because the photovoltaic implant is thin and wireless, the surgical procedure is much simpler than in other retinal prosthetic approaches.
“Such a fully integrated wireless implant promises the restoration of useful vision to patients blinded by degenerative retinal diseases.”
The implant has not been tested in people, but has been shown to work in rats. | <urn:uuid:e5587499-0e53-4497-b3ce-b1ced44c71d8> | {
"date": "2018-09-26T01:09:13",
"dump": "CC-MAIN-2018-39",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267162809.73/warc/CC-MAIN-20180926002255-20180926022655-00216.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9506591558456421,
"score": 2.796875,
"token_count": 1423,
"url": "https://www.bellenews.com/tag/bionic-eye/"
} |
One-per-centers have been around for a long time, probably since the late Neolithic period, when nomadic hunter-gatherers settled into farming communities. The concept of private property—of land that could be handed down to one’s heirs—and the advent of metallurgy, which created durable symbols of prestige, contributed to social stratification.
In the southern Levant (contemporary Israel), during the Chalcolithic period (the Copper Age—4500-3600 B.C.E.), the élite of a culture about whom little is known, except that they were “masters of fire”—coppersmiths and craftsmen with a rich symbolic life—took their privilege to the grave with them. Ordinary mortals were simply interred, but the bodies of tribal worthies were exposed to the elements, which cleansed their bones, then buried with pomp. An absorbing show of their funerary treasures, which are part of a massive hoard unearthed by Israeli archeologists, in 1961, from a cave in the Galilean highlands, is now on view at the Institute for the Study of the Ancient World, on East Eighty-fourth Street. The pièce de résistance, visiting America for the first time, is an elegant band of blackened copper, seven inches high and almost seven in diameter. Its upper rim is encircled with spiky figures: a hilt-shaped cross; two long-necked birds, which might be vultures; and two stylized gates or grilles, surmounted by horns. The actual function of this object, in life or death, is mysterious, but it has the aspect of a diadem (its circumference is that of a smallish man’s hat), and the show’s organizers are calling it “the world’s oldest crown.”
Crowns have been worn by rulers and divinities of both sexes since prehistoric times. The salient features of alpha malehood—manes, antlers, gorgeous plumage, and, above all, literally, the sun’s corona—have inspired their design. Napoleon’s imperial crown was a wreath of golden laurel leaves, the classical world’s homage to a victor of games or war. Christ’s crown of thorns mocked his claim of being the king of the Jews. When three cobras appear on the marble diadem of a Hellenistic queen, she is probably Cleopatra. The word “diadem” comes from the Greek noun for “band,” or “fillet,” but the later, more elaborate crowns of Christendom are castellated, like a turret. Paul VI, the last Pope to be crowned, in 1963 (his successors have opted for inauguration), wore a dome-shaped “tiara” that resembled a basilica. The ancient “crown” from Galilee may also symbolize a sacred building—a close or an enceinte.
If you’re not entitled to a crown by birth or election, you might still get one through a lucky marriage. Tiaras are synonymous with romance for millions of little girls, and there is a brisk trade in the plastic-and-rhinestone variety ($15) in the lobby of the Broadway Theatre, where Rodgers and Hammerstein’s “Cinderella” is playing to full houses of would-be little princesses. Queen Elizabeth, in the meantime, is reported to be lending her grandson’s wife a wardrobe of sparkly toppers for the upcoming royal visit to Australia. (She is also said to have told the former Kate Middleton that she should lower her hemlines.) No one needs to tell the noble Grantham ladies how to dress, and the delicious Buckingham Palace scene, in the season finale of “Downton Abbey,” featured a veritable riot of diamond headgear—Georgian, Victorian, Edwardian, and Art Deco. (For twenty-five hundred dollars, you can rent Lady Mary’s “star tiara,” all forty-five carats of it, for your own special occasion, though it’s only yours for a day.)
The “world’s oldest crown” may not be a crown at all—it might have been the stand for an urn, or something else entirely. But the culture that created it had a keen sense of female dignity. The show also includes several bone-and-ivory figurines with violin-shaped silhouettes; an exquisitely slim little Venus with a prominent nose and a neatly incised pubis; a breasted ossuary that was probably the receptacle for a revered woman’s bones; and a clay libation vessel that depicts an enthroned Copper Age Madonna, though perhaps what she’s sitting on is a birthing stool. The ochre striations on her body seem to represent her flowing hair and clothes; her bearing is regal, and her head is crowned. Not with a diadem, however—with something more familiar to Cinderella before she met her Prince Charming: a buttermilk churn.
Photograph: Clara Amit/Israel Antiquities Authority | <urn:uuid:0f3ed146-1a66-4b51-9b14-6698312523f5> | {
"date": "2017-02-25T02:11:37",
"dump": "CC-MAIN-2017-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171646.15/warc/CC-MAIN-20170219104611-00588-ip-10-171-10-108.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.951240599155426,
"score": 3.078125,
"token_count": 1104,
"url": "http://www.newyorker.com/online/blogs/culture/2014/03/the-worlds-oldest-crown"
} |
Problem 1: The volume V and paper surface area of a conical paper cup are given by:
For V = 10 in 3 , compute the value of the radius, r that minimizes the area A. What is the corresponding value of the height, h? What is the minimum amount that r can vary from its optimal value before the area increases by 10%.
No products are associated with this question.
hi Suman Koirla, try this :
The Volume is given by : V=(1/3)*r²*h, and the surface A=pi*r*sqrt(r²+h²)
for V=10 m^3, we search for r that minimizes the Surface , :
Min(A) , SUBject to V=10
we have : h=3*V/pi*r² then : A=pi*r*sqrt(r²+90/pi²*r^4) .
Min(A) means the dA/dr=0=......=4*pi*r^3-180 /(2*sqrt(pi*r^4+90/r²))=0
Fast way to find R :
syms r A=(pi^2*r^2+90/r^2)^1/2 ezplot(A) S=subs(A,-6:0.1:6); % AXIS based on the first graph min(S)
1)so the minimum value for S=29.83 meter is R=1.89 ( FROM THE GRapH )
2) The corresponding value for h=3*10/(pi*1.89)=5.0525 meter .
Are you required to use a minimizer? The question can be solved analytically with a tiny amount of algebra together with some small calculus.
3)What is the minimum amount that r can vary from its optimal value before the area increases by 10% ( with fixed h ) :
Given S=29.83 m² and h=5.05 m, we have the new surface S2 :
__________ S2=S+0.1*S=32.81 m²=pi*r*\/ r²+h² .
S2²=pi².r^4 + pi²r²h² , make it as equation of 4th order :
r^4 + r² . h² -S2²/pi² = 0 ==> r^4 + 25.50 *r² - 109.7 = 0
We use the command "root" :
the Polynomial is a*r^4 + b*r^3 + c*r^2 + b*r + d = 0
a=1; b=0; c=25.50; d=-109.7
R_amount = roots([1 0 25.50 0 -109.7]) R_amount =
0.0000 + 5.4084i 0.0000 - 5.4084i 1.9366 -1.9366
The reasonable answer is the third one, R=1.9366 the amount change is
DELTA_R=1.9366-1.89=0.04 meter . | <urn:uuid:1028aaf6-1eeb-4bab-86c0-b1a929115b79> | {
"date": "2014-03-17T02:08:23",
"dump": "CC-MAIN-2014-10",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394678704396/warc/CC-MAIN-20140313024504-00006-ip-10-183-142-35.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.7699574828147888,
"score": 3.03125,
"token_count": 691,
"url": "http://www.mathworks.com/matlabcentral/answers/68627"
} |
Monitor for Leafrollers and Other Caterpillars
Bloomtime applications of Bacillus thuringiensis for peach twig borer help to keep leafroller and other caterpillar populations under control. Leafroller damage is not a problem for prunes grown for the dried market, but needs to be monitored on fresh market prunes so that prompt action can be taken if damaging populations develop.
Monitor for the presence of caterpillars from the beginning of bloom (green fruitworm) through petal fall (leafrollers), looking for any species that may cause fruit damage. Carefully check young leaves and shoots for the presence of peach twig borer and leafroller larvae and leaf damage. Use a beating tray to catch green fruitworm larvae that drop from the tree as you shake blossom clusters.
Use the photos below to identify caterpillars that are present in the orchard at this time of year. Names link to more information on identification and management. | <urn:uuid:ce72a991-fbd3-4af4-9c40-6e81511f299e> | {
"date": "2015-12-01T12:54:35",
"dump": "CC-MAIN-2015-48",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398467979.1/warc/CC-MAIN-20151124205427-00283-ip-10-71-132-137.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8890872001647949,
"score": 2.890625,
"token_count": 193,
"url": "http://ipm.ucdavis.edu/PMG/C606/m606bpcatroller.html"
} |
Ten lost technologies
Published on August 31st, 2010 | by Admin0
2. Roman Cement
Modern concrete was developed in the 1700s, and today the simple mixture of cement, water, sand, and rocks is the most widely used building material in the world. But the recipe developed in the 18th century wasn’t the first time concrete was invented. In fact, concrete was widely used throughout antiquity by the Persians, Egyptians, Assyrians, and Romans. The Romans in particular made extensive use of concrete, and they were responsible for first perfecting the recipe by mixing burnt lime with crushed rocks and water. Their mastery of its use allowed them to build many of their most famous structures, among them the Pantheon, the Colosseum, the aqueducts, and the Roman Baths.
How was it Lost?
Like so many technologies of the Greeks and Romans, the recipe for concrete was lost during the descent into the Dark Ages, but just why remains a mystery. The most popular theory is that the recipe was something of a trade secret among stonemasons, and that the method for making cement and concrete died along with those who knew it. Perhaps even more interesting than the disappearance of Roman cement are the particular qualities that separate it from more modern Portland cement, which is the most common type of cement used today. Structures built with Roman cement, like the Colosseum, have managed to weather thousands of years of punishment from the elements and remain standing, but buildings constructed with Portland cement have been known to wear down much faster. This has been theorized to be the result of different chemicals that the Romans added to their cement, among them milk and even blood. These were said to create air bubbles within the concrete that helped the material to expand and contract in the heat and cold without damaging itself. | <urn:uuid:bd6a0480-6968-44a9-a45c-f2e7f69e6ff3> | {
"date": "2016-09-29T23:48:31",
"dump": "CC-MAIN-2016-40",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738661962.7/warc/CC-MAIN-20160924173741-00082-ip-10-143-35-109.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9846842885017395,
"score": 2.703125,
"token_count": 376,
"url": "http://www.ablogabouthistory.com/2010/08/31/ten-lost-technologies/"
} |
Curious? See how we do our work
Although it is true that rebar and electrical conduits produce similar reactions on the data screen, in most cases, yes, we can determine the difference. We are able to differentiate between the two materials by determining the rebar pattern (spacing and elevation).
If the pattern is broken, in all likelihood, the rupture is from the presence of a conduit. We have an extremely high success rate in applications in which we are asked to find electrical conduits in supported slabs or in slabs-on-grade prior to saw cutting or core drilling.
Additionally, GP Radar Scanning now has the capability of using electro-magnetic induction to determine the location of conduits in the concrete. If we are able to “induct” a tone onto the metal conduit we can locate it with pinpoint accuracy. We can also locate the conduit if it has “live” electrical power or telecommunications running through it.
With both GPR and EM Induction we provide one of the most comprehensive and accurate conduit locating services available.
GPR can tell the area where the void is occurring as well as clearly identify its boundaries. GP Radar Scanning cannot, however, determine the depth from the top of the void to the bottom of the void.
In post-tensioned structures, we typically find one mat of support bar near the base of the slab. This mat of support bar is generally consistently spaced and remains at a constant elevation. When we use the Ground Penetrating Radar to determine the location of post-tension cables, we usually find them above the mat of support bar, and they usually are “draped” through the slab. The elevation of the cable is usually high near the beams and column lines and drapes lower through the span between beam and column lines.
Our ability to accurately and consistently locate post tension cables comes from a combined 50+ years of experience with GPR. The GP Radar Scanning technician will leave you feeling confident in the survey findings and in your ability to drill or cut without issue.
No, we cannot. We can generally find the utility without much difficulty, but we cannot determine if the piping is gas, or water, etc. We can often trace the utility to valve, meter, control box, or other type of signifying marker, thereby determining the utility. Additionally, we have the ability to provide the elevation of the utility and can cross check it with as-build plans to confirm the plans are without error.
In most circumstances, we can have a technician on your site within 24 hours.
GP Radar Scanning provides nationwide Ground Penetrating Radar services with offices in over 50 different geographic locations from coast to coast. Simply put, we are willing to do what it takes to accomplish your project goals, including travel.
You would be hard pressed to find a similar company. Most companies providing Ground Penetrating Radar System services use Ground Penetrating Radar as a supplemental source of revenue. GP Radar Scanning uses it as its only source of revenue. We are using the technology on different projects every single day, and we have established a reputation for providing a reliable and value-added service.
Each of our technicians goes through a training course provided by our supplier, GSSI, Inc. We also pair each trainee with an experienced technician until the trainee has demonstrated the consistent ability to work on a comparable level to an experienced technician providing technical expertise and the ability to get through difficult Ground Penetrating Radar applications.
Yes. We regularly use our equipment to scan for the location of rebar in concrete columns and walls. On occasion we are also asked to scan from the underside of a floor to mark out the reinforcing steel and any embedded conduits. This is most common when a customer wants to set anchors into a floor for large piping.
Yes, we buy used equipment from other GPR companies. Contact us today as we would be happy to see the equipment and negotiate a deal.
Our typical survey output is to simply paint and pin flag our findings directly on the surface. For most applications this is sufficient as the excavation/digging will commence within a few days of our service. However, for some this may not be enough. GP Radar Scanning now has the capability to provide you with a GPS map of your utilities. We can output our survey results directly into a Google Earth image or provide you with a CAD file overlay. Please contact us to discuss pricing and mapping options that your project may need.
Yes, Ground Penetrating Radar can be used to determine the precise location of unmarked graves for site planning purposes. While older grave sites can be harder to locate because of material deterioration, in most cases we can accurately map where these grave sites are found.
This answer depends on the type of application in which you are interested. For concrete applications we can typically penetrate to a depth of 18-24”. We use a 1500/1600MHz antenna for concrete scanning applications. For utility locating needs on grass, asphalt or concrete we can generally penetrate anywhere from 6-10’. For these types of applications we use a 400MHz antenna. Since GP Radar Scanning is committed to providing the most accurate and comprehensive GPR surveying services, we also have the ability to use larger antennas for greater depth penetration. Please contact your local GP Radar Scanning representative for more information.
Extremely accurate! Again, our accuracy is dependent upon the type of application in which you are interested. We have found that when scanning with the 1500/1600 MHz antenna (most concrete applications) we are +/- ¼” to the center of the object we are locating and ½” +/- to the actual depth.
We have found that when surveying with the 400 MHz antenna (most utility locating applications) we are +/- 6” to the center of the object we are locating and +/- 10% to the actual depth. Soil moisture conditions and other factors affect the accuracy for the 400 MHz antenna, and these accuracy results are based on over 50+ years of GPR experience.
We, at GP Radar Scanning , pride ourselves on customer service and our ability to meet your inflexible scheduling needs. We are willing to work nights and weekends, or any other time, in order to help you accomplish the goals of your project. Please contact your local GP Radar Scanning representative for rates and schedule availability.
Need concrete scanning or utility locating for your next dig or excavation project? Call GP Radar Scanning. The experts in scanning and locating. Call 0487 266 114
Curious? See how we do our work
We can help you, see our faq | <urn:uuid:671cb5db-542d-488d-962f-030c814246f2> | {
"date": "2019-08-20T13:00:25",
"dump": "CC-MAIN-2019-35",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027315329.55/warc/CC-MAIN-20190820113425-20190820135425-00016.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9358595013618469,
"score": 2.5625,
"token_count": 1358,
"url": "https://www.gpradarscanning.com.au/faq/"
} |
Between the Internet and misinformed friends and daycare providers (maybe even Grandma), there’s plenty of nonsense floating around about rules when feeding children. Let’s explore some of the biggest ones.
Myth one: Children need special, kid-friendly foods.
Reality check: Kids can learn to eat almost everything parents do.
Some experts blame the food industry for its brilliant marketing, convincing us that little ones will only eat kiddie foods — highly-processed, sugary, salty and bland foods, or so-called fast foods.
It’s also a myth that they prefer bland food. Children brought up in Mexico or India eat spicy food starting when they are toddlers.
Allow your little one to experiment with food. You may think of this as “wasting” it, or bad manners, but playing with and even spitting out food is part of the overall sensory experience. Remember, many of the foods he’s tasting are brand new to him. Even the same food prepared in a different way — such as cooked carrots versus raw — can be totally foreign to a little one.
Myth two: Parents decide how much a child should eat.
Reality check: It’s the job of the parent to provide healthful food. And it’s the job of the child to decide how much to eat, according to renowned feeding specialist, Ellyn Satter (www.EllynSatter.com).
Part of the problem? Many adults don’t know what a proper portion looks like for themselves. So they may need even more help identifying the right amount for their children.
Myth three: Children need constant snacks.
Reality check: While some snacking is beneficial, kids today typically engage in all-day-long eating. According to a recent study on 31,000 children ages 2 to 18, they’re eating an average of three snacks every day, with desserts and sweetened beverages being the major source of calories.
What should your child’s snack consist of?
“Snacks shouldn’t be so-called ‘snack foods.’ They should be foods you would serve at any other meal, not a pile of orange fish-shaped crackers and a sugary juice drink,” says registered dietician Elizabeth Ward, a mom of three and author of “The Complete Idiot’s Guide to Feeding Your Baby and Toddler.” She says a quarter of a sandwich and half a glass of milk or 100 percent orange juice would be a better choice.
Myth four: Sugar-sweetened foods cause “hyper” kids.
Reality check: Contrary to the opinion of some parents and teachers, sugar does not cause hyperactivity.
Children who indulge in sugary treats during parties may appear to get wilder than usual. But there are no scientific studies to prove that sugar equals hyperactivity. In fact, sugars — like all carbohydrates — actually have a slight calming effect. It’s actually the holiday, birthday party or special activity that tends to get kids overly excited. [Editor’s note: For more information about the reported links between candy and hyperactivity, see “How to Create Healthy Easter Baskets” in our April 2011 issue. www.webfam
Myth five: Veggie haters have nutrient deficiencies.
Reality check: “Veggies are not the end all, be all,” says Jill Castle, RD, a child nutrition expert who blogs at Just the Right Byte, and a mother herself. Many fruits supply the vitamins, minerals and phytonutrients that kids need to grow well.
“While we want kids to eat a variety of both fruits and vegetables, this is a work in progress. In the meantime, make sure fruit options make an appearance at meals and snacks — you’ll please your child and ease your worries,” Castle says.
Still, it doesn’t hurt to serve vegetables in a child-friendly manner. Serve them raw, cut into attractive shapes, call them fun names, or serve alongside a dip.
Christine M. Palumbo, RD, practices nutrition in Naperville, IL. She invites your questions and column ideas. Contact her at Chris@Chri
1 medium banana, sliced lengthwise
1/3 cup non-fat strawberry yogurt
1/3 cup non-fat vanilla yogurt
2 tablespoons chopped walnuts
DIRECTIONS: Place the banana, sliced lengthwise, in a bowl. Top with the non-fat strawberry yogurt and non-fat vanilla yogurt. Sprinkle with chopped walnuts.
NUTRITION: 332 calories, 10 grams protein, 55 grams carbohydrate, 4 grams fiber, 11 grams fat, 1 gram saturated fat, 100 milligrams sodium.
From “When to Eat What,” by Heidi Reichenberger McIndoo, MS, RD, LDN. Copyright © 2011, F+W Media, Inc. Used by permission of Adams Media, a division of F+W Media, Inc. All rights reserved.
©2011 Community News Group | <urn:uuid:50728eed-7b28-4366-8cf9-545b2e6317bd> | {
"date": "2019-03-24T10:15:52",
"dump": "CC-MAIN-2019-13",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912203409.36/warc/CC-MAIN-20190324083551-20190324105551-00536.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9172267317771912,
"score": 2.8125,
"token_count": 1066,
"url": "https://www.nyparenting.com/stories/2011/8/fp_goodsenseeating_2011_08.html?utm_medium=web&utm_campaign=module&utm_source=similar&utm_content=intra"
} |
We usually don’t give much thought to the breaths we take, making it easy to take our lung health for granted. But, lung and respiratory problems don’t always show up with obvious symptoms. UnityPoint Health specialist, Hamad Azam, M.D., answers common concerns related to lung cancer, COPD and smoking.
According to the National Cancer Institute (NCI), lung cancer claims the most lives of any cancer in the United States. Symptoms of lung cancer can be difficult to identify in its early stages.
“Lung cancer can be asymptomatic in early stages, which is why lung cancer screening is important,” Dr. Azam says. “Generally, by the time a patient develops symptoms, lung cancer is in advanced stage. The best thing we can do is diagnose lung cancer as early as possible and provide surgical cure.”
Knowing your risk for lung cancer greatly increases your chances of catching it early – or preventing it in the first place. The NCI lists the following risk factors for lung cancer:
- Smoking cigarettes, cigars or pipes (including secondhand smoke)
- Family history
- Environmental risks (such as radon)
Dr. Azam says providers use these risk factors when determining who to screen early for lung cancer.
“If we wait for symptoms to develop, it can almost be too late in the disease process. Staging is very important for prognosis. We routinely screen for lung cancer in high-risk populations. Patients between ages 55-79 with more than 30-pack year history of smoking should get CT chest lung cancer screening. Also, we do a lot of counseling about quitting smoking,” Dr. Azam says.
While smoking is the number one risk factor for lung cancer, Dr. Azam says possible for non-smokers to develop lung cancer as well.
Chronic Obstructive Pulmonary Disease (COPD)
Cancer isn’t the only lung health risk. Chronic obstructive pulmonary disease, more commonly known as COPD, can greatly impact someone’s quality of life.
“COPD is a chronic lung disease, which is usually irreversible lung damage from chronic tobacco smoke exposure, symptoms include shortness of breath which usually will worsens as the stage advances, cough with sputum production,” Dr. Azam says.
The American Lung Association labels COPD as “preventable and treatable.” Dr. Azam says there are steps providers can help patients take to manage the disease.
“First, we look at what might be causing COPD, such as smoking cigarettes (more than 10-15-pack-per-year), passive smoking exposure and history of alpha-1 antitrypsin deficiency. From there, we usually do lung function test to determine the stage of COPD. For treatment of COPD, we start with patient education. Patients should know the disease process and future expectations. Stopping smoking, or smoking cessation, is the most important step to prevent further decline in lung function. Additionally, bronchodilators, inhaled steroids and long-acting bronchodilators can help symptoms control,” Dr. Azam says.
Talking to Your Provider about Lung Health
Lung function declines with age and is usually an extremely slow process. However, if you have a history of smoking and shortness of breath, it’s never too early to talk to your provider.
“Minor decline in lung function may not have any symptoms, but we can’t emphasize enough the importance of stopping smoking. We always want to help our patients to quit smoking, including discussing smoking cessation programs, like motivation, counseling and medications,” Dr. Azam says.
If you have questions about your overall lung health or feel you might qualify for a lung cancer screening, contact your UnityPoint Health primary care provider or pulmonologist.
comments powered by | <urn:uuid:08435344-fcfb-4ab4-8d98-93f63c3995e8> | {
"date": "2018-05-22T00:31:43",
"dump": "CC-MAIN-2018-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794864572.13/warc/CC-MAIN-20180521235548-20180522015548-00256.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9366174340248108,
"score": 2.6875,
"token_count": 818,
"url": "http://www.unitypoint.org/livewell/article.aspx?id=2dbeb838-11b2-47d5-9cc7-95c8a9f28631&Lung+Health%3A+Understanding+Your+Risk+for+Cancer+and+COPD"
} |
Let us not get embroiled in Florence’s aversion to nursing being recognised as an accredited profession. Instead let us celebrate one of her finer contributions to nursing, namely statistics. Evidence based practice is part of our mantra in nursing, yet if we reflect on our specialty areas and ask ourselves, “how much of what we do in our daily practice is evidence based?” I wonder what our answer would be?
Florence is a role model, she was involved in the early development of statistical representations to change the status quo in health governance, and use the information for the purpose of clinical practice developments. There are many areas in today’s healthcare setting that could benefit from increased nursing scope of practice and highly trained nurses such as in health prevention and chronic illness management where a specialist nurse could perform at or above the level of a doctor (more nurse practitioners please!). Florence would measure and provide data to support this notion.
This post was inspired after international nurse’s day on 12th May (Florence’s birth date) and taking time to reflect on what this day means to nursing from a retrospective and prospective look into nursing. Long gone is the handmaiden role but nursing must ensure we are central in the ‘big data’ revolution to contribute to policy and health changes. Mortality, quality data, reports and audits are part of Florence’s legacy to take us into the future. Accurate record keeping, standardisation, infection control and co-ordination of healthcare are still as relevant today.
Engagement and making data simpler to understand was another of Florence’s skills. Visualisation like using pie charts enabled Florence to convey the data results in simpler form to increase the impact factor when presenting research findings to administrators, healthcare professionals and politicians.
“Florence’s use of data is so clear, it is impossible to ignore”
Florence Nightingale: Joy of Stats
Florence Nightingale: Pie charts & the Lady with the Lamp
Maindonald, J., & Richardson, A. M. (2004). This passionate study: A dialogue with Florence Nightingale. Journal of Statistics Education, 12(1), 1-4.
McDonald, L. (2001). Florence Nightingale and the early origins of evidence-based nursing. Evidence based nursing, 4(3), 68-69.
Neuhauser, D. (2003). Florence Nightingale gets no respect: as a statistician that is. Quality and Safety in Health Care, 12(4), 317-317. | <urn:uuid:b982f371-ed11-4670-9a4d-dd9cfee0a984> | {
"date": "2018-09-21T19:30:54",
"dump": "CC-MAIN-2018-39",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267157503.43/warc/CC-MAIN-20180921190509-20180921210909-00336.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9254888892173767,
"score": 2.8125,
"token_count": 532,
"url": "https://nursingeducationnetwork.net/2016/06/29/visualisation-stats-by-florence/"
} |
An intelligent facility design can inhibit the entry, growth and spread of harmful microorganisms during food production. Pablo Coronel, Director Food Processing, and Dennis Collins, Architectural Practice Manager, CRB, look at the layout, construction materials and environmental controls
It is important to plan a large enough space to accommodate
the current production level and future growth potential
Producing safe, quality food products depends on many factors, starting with the design and construction of the manufacturing facilities. If the environment in which these foods are produced is not clean and does not promote cleanliness, the food products are at risk of contamination and of being poor quality.
There are many reasons why cleanliness and food safety should be the primary focus when designing and constructing a food manufacturing facility. Any product that does not meet the high-quality standards of consumers will not only alienate customers, but will also negatively impact a company’s reputation and bottom line.
Contaminated foods also pose a threat to public health, so it is imperative to have a clean design that will inhibit the entry, growth and spread of harmful microorganisms. This is accomplished through an intelligent layout of facilities, careful selection of materials and construction techniques, proper air handling, pressurisation and temperature control.
When starting to design the facility layout, it is important to have the final product in mind, and to consider both the ingredients and the process
Creating a clean design starts with the food itself. The type of product that is produced will drive the design decisions. For example, refrigerated products require very different staging, production, warehousing, environmental controls and cleaning procedures than baked goods.
When starting to design the facility layout, it is important to have the final product in mind, and to consider both the ingredients and the process.
Segregation may be necessary based on the risk of cross-contamination. Raw ingredients cannot be mixed with the final product and some ingredients contain allergens that should not come into contact with other products. Another consideration, which may necessitate space segregation, is whether wet-cleaning or dry-cleaning is required. It is also key to consider how materials, personnel, waste and air will move through the facility. Each should flow from areas of high risk to low risk.
A careful design and proper barriers will prevent raw ingredients, airborne pathogens and personnel in a low-risk area from crossing back into areas of higher risk.
Next, points of entry to the facility should be separated from production and packaging areas. Docks can pose a hazard to a clean environment if they are not designed properly. First, they should be high enough off the ground to deter rodents from entering the facility. Second, since there is potential for outside contaminants to enter while the dock is open, they should not open directly into production areas; the same goes for exterior doors. And third, the drivers and truck crews must not be allowed into production areas, so breakrooms and restrooms should be considered.
Finally, the most common layout mistake is not allocating a large enough warehouse space. When a facility runs out of warehouse space, finished products or materials usually get stored in other areas. This creates contamination risks and fire hazards, so it is important to plan a large enough space to accommodate the current production level and future growth potential.
The right materials and construction methods ensure the cleanliness of a facility. They should reduce areas that collect dust, debris and bacteria and make necessary cleaning easy.
The first consideration is the flooring. The material should be impermeable and washable so that dust and debris either cannot collect or can be easily removed. If a flooring material has too many joints, it is too difficult to keep clean. Most facilities have sealed concrete floors with either an epoxy or urethane coating. Drains also need to be placed strategically in the floor so cleaning solutions, water and debris can be washed away.
Another common place where contaminants like mould and dirt collect is the joint where walls meet the floor. Typically, a 4-6 inch high seamless coved or cant base is created with the flooring material. This aids cleaning, and prevents dirt and dust buildup.
The wall materials are equally important because any sort of cavity or joint can create a potential harbour for contaminants. Food facilities commonly use insulated metal wall panels for their lack of cavities and limited number of joints; the same principle applies to ceilings. Therefore, many facilities do not have ceilings but rather an open space with structural detailing that reduces areas for dust to collect.
Tube steel beams or girders with plating on the sides eliminate dust ledges. Precast construction is another option. Using precast concrete planks for roof decking also eliminates cavities in the decking and reduces the number of joints.
Finally, consider how the equipment will be installed. If it rests on the floor, it creates spaces that are difficult to clean. Equipment can either be raised off the floor or hung from the ceiling.
In addition to keeping the surfaces in the facility clean, environmental conditions are also key to ensuring food safety and quality. The right air quality, pressurisation and temperature will help inhibit harmful contaminants.
Incoming air must be filtered to remove dirt, spores and microorganisms from the outside environment. Some facilities require further filtration, such as high-efficiency particulate air (HEPA), to prevent the ingress of additional microbial contaminants.
Temperature plays a very important role in food processing facilities. Not only is it imperative to keep cold products cold and to heat raw products to cook them; proper ventilation, for example to cool down a baking facility, allows the staff and machines to run more efficiently.
Allowances should be planned to maintain the correct level of humidity in the production and storage areas to prevent contamination. Humidity encourages the growth of microorganisms, so dryer air helps prevent this growth. For example, if food products are heated with steam, ventilation must be in place to evacuate the steam from the process areas. Otherwise, it can turn to condensation that collects on the food products, potentially jeopardising their integrity and safety.
Finally, positive air pressure is crucial in clean food production facilities. This means that the air pressurisation matches the level of cleanliness of each area so that air from a ‘dirty’ area cannot flow to a ‘clean’ area. This should also keep outside air from entering processing areas.
Even the best designed facility can have issues with food quality and safety if the operators within the facility are not trained to follow proper procedures. Management must allocate enough resources to continually train personnel, especially if frequent turnover occurs. Design can compensate for human errors in some ways, but training is essential.
Design must include soft or hard barriers to keep people from moving against the flow of the facility to prevent cross-contamination. Hurdles like railings around hand and shoe washing stations and gowning areas help slow people down, making them think twice about the procedures they must follow. Even little things, like colour coding the floors to indicate areas that require different levels of care help make workers more aware.
Ultimately, food can only be as clean as the facility in which it is produced. Facility design is important to ensure cleanliness and enable easier long-term maintenance.
Food contamination can be prevented by focusing on proper layout, appropriate construction materials and building methods as well as correct environmental controls.
This article appeared in the September issue of Cleanroom Technology. | <urn:uuid:83b2f79f-a777-47ac-9fb1-58ad523154c8> | {
"date": "2019-05-24T11:08:53",
"dump": "CC-MAIN-2019-22",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257605.76/warc/CC-MAIN-20190524104501-20190524130501-00336.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9399316906929016,
"score": 3.0625,
"token_count": 1517,
"url": "https://www.cleanroomtechnology.com/news/article_page/Setting_the_scene_for_contamination_control/147265"
} |
One of the world’s best loved and iconic animals has been keeping a secret. It turns out kangaroos may be the world’s only “pentapedal” animals, effectively having five legs.
Before you start taking a close look at stills of Skippy the bush kangaroo, it’s not a secret limb – the fifth “leg” is the animal’s tail. Unlike the tails of other animals, the kangaroo’s tail functions as a leg, pushing it forward as it walks.
For instance, females that fall pregnant while they still have a young joey in their pouch can halt the embryo’s development until the joey leaves, which can be 235 days later. They also use very little energy and water compared with similar grazing animals like sheep.
And then there’s the tails. “Animals have discovered many uses for their tails but, as far as we know, this is the first use of one as a leg,” says Max Donelan of Simon Fraser University in Burnaby, Canada.
Donelan and his colleagues trained five red kangaroos to walk through a chamber paved with force plates, which measured the downward forces exerted by the animals as they moved. By combining this with video footage, the team calculated how much work each limb did during a walking cycle.
To walk, kangaroos first lean forward and plant their forelimbs on the ground. Next they bring forward their larger hindlimbs, before releasing their forelimbs from the ground. It is at this point that their tail comes into play. Curled up and in contact with the ground, it flexes forward against the ground and straightens, lifting and accelerating the animal forward. This means the front limbs can make ground contact again for the start of the next cycle (see video).
Video: Kangaroo uses tail as fifth leg
Donelan found that the propulsive force from the tail was as large as that from the other limbs combined. “They do as much mechanical work with their tail as we do with one of our legs when we walk,” says Donelan.
Not just a crutch
That is a surprise. “The tail is anatomically quite different from human legs,” says Donelan. It is made up of more than 20 vertebrae, rather than a few leg bones. It also evolved to swing on branches rather than push on the ground, he says.
But in retrospect, there were clues. The tail muscles are larger than those of the front limbs. They are also rich in mitochondria, the energy powerhouses of cells.
Most scientists had assumed kangaroos only used their tails for resting on and balance, almost like a crutch, says Donelan. “This is indeed one of its roles, but we also discovered that it was being used to propel and power motion.” It also serves as a prop to stop the animal falling backwards when the hind legs are lifted.
Other large kangaroos, such as the two species of grey kangaroo, are probably also pentapedal, says Donelan. But he says the smaller wallabies probably aren’t, as they appear to drag their tails. It’s also unlikely any other animals, either living or extinct, walk with five legs. Donelan says there are many fossilised footprints, and none show signs of a pentapedal gait.
If he’s right, kangaroos hop to the beat of their own drum.
Journal reference: Biology Letters, DOI: 10.1098/rsbl.2014.0381 | <urn:uuid:edec7248-f59f-45e3-853b-7f0249825aba> | {
"date": "2018-04-21T08:02:11",
"dump": "CC-MAIN-2018-17",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-17/segments/1524125945082.84/warc/CC-MAIN-20180421071203-20180421091203-00376.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9707688689231873,
"score": 3.609375,
"token_count": 773,
"url": "https://www.newscientist.com/article/dn25829-zoologger-meet-the-only-animal-with-five-legs/"
} |
Italy in World War 1
On April 26 1915 Italy entered into the London Pact between the Kingdom of Italy, United Kingdom, France and Russia.
According to the terms of the London Pact, Italy was to leave the triple Alliance and declare war against Germany and Austro-Hunagary in exchange for territorial gains. Italy was promised Trieste,
Istria, and the City of Zara
The lands promised to Italy constituted the bulk of what was known Italia irredenta, namely Unredeamed Italy. It was a political slogan used by Italian militarists to refer to regions outside of Italy which were primarily ethnically Italian but had not been incorporated with Italy after the Unification. Many Italians regarded it as their national destiny to reclaim these territories from the Austro-Hungarian Empire.
The sentiment of the Italian people was expressed by an editorial in the Idea Nazionale, which on May 10 declared:
VICE ADMIRAL H.R.H. THE DUKE OF THE ABRUZZI
The King of Italy and the Prince of Wales.ToList
When the Prince was on the Italian front, he asked permission to visit a trench which was being heavily shelled. The King bluntly refused. "I want no historic incidents here," he remarked dryly.
Italy desires war: (1) In order to obtain Trent, Trieste, and Dalmatia. The country desires it. A nation which has the opportunity to free its land should do so as a matter of imperative necessity.... (2) ... in order to conquer for ourselves a good strategic frontier in the North and East.... (3) ... because to-day, in the Adriatic, in the Balkan Peninsula, the Mediterranean, and Asia, Italy should have all the advantages it is possible for her to have, and without which her political, economic, and moral power would diminish in proportion as that of others increased.... If we would be a great Power we must accept certain obligations: one of them is war....
Back -- Next | <urn:uuid:44a8ba6d-3cbd-4dae-ae69-2b743b867f4e> | {
"date": "2017-10-22T17:24:27",
"dump": "CC-MAIN-2017-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187825399.73/warc/CC-MAIN-20171022165927-20171022185927-00556.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9749362468719482,
"score": 3.9375,
"token_count": 417,
"url": "http://www.worldwar1gallery.com/italianfront/index2.html"
} |
…we can smell like a dogs claims scientist!
Scientist from New Jersey's Rutgers University of America says that the sniffing power of humans is not less than dogs, rats and other animals! In a review published, neuroscientist John P. McGain told how he broke this myth that humans can not smell like dogs or other animals! John said, the truth is that humans are good at sniffing!
So far, it has been believed that the smell of human beings is much less than dogs. But a scientist from New Jersey’s Rutgers University of America says that the sniffing power of humans is not less than dogs, rats and other animals. In a review published, neuroscientist John P. McGain told how he broke this myth that humans can not smell like dogs or other animals. John said, “the truth is that humans are good at sniffing.”
This myth was started by Paul Brock, a French physician in the 19th century. Paul researched the human brain and used to tell how it is different from animals. He argued that the large allfactor bulb (a part of the bulb’s shape in the brain) present in the brains of the animals help them to smell more and far, whereas the larger part of the human brain (frontal lobe) keep away from the smell. Other scientists simplified their theory without having to test. After this, in 1924 an important textbook was told that due to the revolution of thinking of the human, the allfactor bulbs of their brain shrank and almost become useless.
Now Dr. McGain says that there are different problems for animals in different environments, according to which they have to fall. They say that we can do a lot with our nose. Like dogs, we can also reach scars following the scent (or smell). Some scientists also say that if a person has a scent of sniffing, he can also find his life partner through sweating, blood or urination. Anyone can also know the fear or pressure. Although there are no proven proofs. | <urn:uuid:6c88f164-a7f6-466f-8c2c-6cad92a8959d> | {
"date": "2017-11-22T11:01:40",
"dump": "CC-MAIN-2017-47",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934806569.66/warc/CC-MAIN-20171122103526-20171122123526-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9717790484428406,
"score": 2.859375,
"token_count": 418,
"url": "http://theinsiderstory.com/we-can-smell-like-a-dogs-claims-scientist/"
} |
This week we looked at the beginnings of the Vietnam war under Kennedy and Johnson, up until the significant troop buildups of 1965.
One of my main goals with this unit is to avoid finger-pointing. Hindsight is so often 20/20. In truth the conflict in Vietnam posed questions that no one would wish to answer. Vietnam’s dilemmas give no good answers, only hopefully less bad solutions. When I think of the controversy surrounding the conflict, I am reminded of a comment of a monk named Columba Cary-Elwes, who wrote to a friend and professional historian in 1940,
I find we live in so criticizing an age that I spend my time summing people up — public figures, judging the motives of their actions and though I had the whole thing mapped out before me, as God must have, and I certainly have not. We are always being given vulgar and crude and unkind judgments of people and peoples in the newspaper, and it becomes second nature. I am going to try and not get caught up in this perfidious habit. This arose out of Fr. Dunstan’s reminder that we are “near nothing” and we ourselves must try and imitate God, who is infinitely merciful.
We ourselves bear culpability for what happened in Vietnam, but to understand this we need to understand events in Europe in the aftermath of W.W. II England led the way in divesting themselves of their colonial empire. To be fair, England emerged from the war with its reputation generally intact, whereas France humiliated itself in its capitulation to the Nazi’s. Much of our modern image of France comes from this singularity, but for the previous 1000 years, France had the pre-eminent military in Europe, with luminaries such as Charlemagne, William the Conqueror, St. Joan of Arc, and Napoleon to their credit. Their post-war agenda did not leave room for looking any weaker than they already appeared. They were keeping their empire, thank you very much. That included Indochina.
Some within Indochina looked to the U.S. for aid in their bid for independence. After all, we too rebelled at one point from a European colonial power. We declined. Truman felt it more important to appease France (who wanted very much to join NATO to keep them out of the communist fold). Unfortunately for us, (though not perhaps for the Vietnamese), this came back to bite us when France lost in Indochina and left NATO anyway. A possible golden opportunity slipped away.
Historians debate the nature of this turning point in Asia. Some assert that if FDR had lived, he would have made a different choice. There are some intriguing quotes from FDR about how Europe was basically dead and how Asia represented the future. But all we can do is speculate.
In the aftermath the U.N. created four nations, Cambodia, Laos, North and South Vietnam. The division between north and south was certainly artificial, done for political reasons and not historical or cultural ones. Was Vietnam within the purview of our strategic interests? What kind of aid should we give them?
To understand our commitment to Vietnam, we need to go back to the Korean conflict. Many believe now, and believed at the time, that our neglect to publicly proclaim our commitment to South Korea may have encouraged the North to invade. We wanted to learn from the past, and so Eisenhower made our commitment to South Vietnam plain. This, we hoped, would forestall an invasion from the north.
Well, it failed to do, which left us with a series of terrible dilemmas.
- We could let South Vietnam collapse. But what about then, our pledge to defend it?
- We could give aid to the South and try and “prop them up.” But how much aid should we give, and what form should it take? Moreover, would the aid we gave them really solve the problems that South Vietnam had?
Johnson and his advisors knew full well that any aid to South Vietnam might be counter-productive. We couldn’t keep them on life-support forever. But eventually a new idea emerged. Perhaps military engagement might force the South to get its act together. If that didn’t happen, our military involvement might at least slow the North down and create a level playing field between the two nations. While the South might not be better off, at least the North wouldn’t pose as much of a threat.
Such is the logic of war. What I hope the students recognize is that not every story needs a dastardly villain. Sometimes nations, as well as individuals, face only a series of bad choices, and have to make the best of it. This, however, is not to say that the U.S. did in fact make the best of a bad situation, as we shall see.
We also looked at the 1960 presidential debate between John Kennedy and Richard Nixon, important for many reasons in our political history. Most that heard the debate on the radio thought Nixon won. Those that watched on TV (the majority) believed Kennedy won. We saw a brief clip of the debate and discussed why that might be the case.
- Nixon wore no makeup, while Kennedy did
- Nixon looked much less comfortable on camera. He shifted his eyes and smiled awkwardly. Of course it’s not hard to miss his infamous sweating (towards the end of the clip).
- Nixon wore a blase grey suit, Kennedy the classic politician dark blue.
This may also have helped originate many common tactics of candidates in debates, where candidates try to “stay on message” no matter what the question. If you watch the clip, you see this perhaps more with Kennedy than Nixon.
Many of us lament the current state of our political discourse, and nearly all would agree that our modern presidential debates hardly dignify the word. But the reality of our situation raises some interesting questions:
- In the modern era, to what extent do we need presidents to be “actors,” and project a certain image? Should it be an unwritten qualification for leadership?
- TV is an inherently visual medium, and thus does not do well communicating written or spoken words (this was one of Neil Postman’s point in his Amusing Ourselves to Death). Whether we like this or not, it is a reality of our culture and not likely to change soon. Do we adjust the way we think of politics because of it?
- If this concern for image has at least some legitimacy, what has it cost us as a democracy?
Thursday we switched gears and looked at the changes in music as a mirror for the changes in culture between W.W. II – Mid – 60’s. I wanted the students to see our transition from broad based group oriented culture to a more individual/niche orientation. Think for example of Glenn Miller. He headlines, but the band is the star, and not him. The music aims for a broad acceptance of broad cross-section of the population. Culture in general happened on a big, broad scale. Think of Cecil B. DeMille movies with their grand sets and dramatic scores, or Fred Astaire pictures with their big dance numbers. Fewer African-Americans were bigger stars than Cab Calloway, but look how quickly he steps aside for the Nicholas brothers incredible dancing in this clip (certainly worth watching in its entirety — Fred Astaire himself called this the greatest dance number ever filmed):
Here is Fred Astaire himself in perhaps his most famous clip, a tribute to Bojangles.
The swing music of Glenn Miller, most popular in the 1940’s, showcased the big, broad, ensemble sound.
Overall, the theme here is akin to the summer movie blockbuster. Go big or go home.
As we move into the late 50’s this begins to change, and we see this change first beginning in jazz music. Ornette Coleman comes up with a different idea of what a musical note is. Coleman’s ensemble allowed for the musicians to each put their own individual, emotional interpretation on the music.
Thelonious Monk’s angular rhythms hit anything but the broad middle. He created a sound totally his own.
In general, we see soloists rise in prominence in music, and this will presage the rise of individuals in society as a whole. We should be careful. The difference between an ensemble based sound and a preference for solos is not a moral one, so much as a change of emphasis. We exist as members of groups and as individuals. Both have importance, and our cultural expressions reflect both of these realities. But, the change in emphasis does reflect broader changes in general.
We also saw how the niche of blues music morphs into the mainstream with rock and roll. Artists like Elvis and the Beatles obviously gained huge followings. But some of the British groups like The Who and The Kinks foreshadow disenchantment with the prevailing ethos. Listen to “Everybody’s Going to be Happy,” and you can feel the intensity. It’s not, “Everyone’s Going to be HAPPY! (YAY!) but “EVERYONE’S Going to be Happy.” The Who appear to be harbingers of zany disregard for everything. The song is called “Happy Jack,” and there are happy-sounding “la-la-la’s,” but the mood of the song gives a different message.
The music no longer aims for the broad middle. As W.B. Yeats wrote in his famous poem, “the center cannot hold.” Why did this happen, and what will be the results? We will explore these questions next week. | <urn:uuid:f6aa6a8e-f860-435a-bf6c-77750f7bd754> | {
"date": "2018-03-18T11:30:29",
"dump": "CC-MAIN-2018-13",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257645613.9/warc/CC-MAIN-20180318110736-20180318130736-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9654546976089478,
"score": 2.59375,
"token_count": 2029,
"url": "https://astickinthemud.com/2017/05/20/11th-grade-the-center-cannot-hold/"
} |
Laptop computers commonly heat up a little in normal operation. Electronic components, including large capacity batteries, become warm in use. Your laptop should never become too hot to handle though.
When a laptop turns hot to the touch or starts to sound like a jet engine, it’s likely beginning to overheat.
Modern laptops use nearly silent fans to cool components and keep the system comfortable and safe to use. In some cases, the sound the computer makes is the best tool you have to diagnose its running condition. Excessive heat causes the fans to work harder and faster to compensate. This jet engine sound is one of the first clues you have to indicate all may not be well.
Why So Hot
Because of their compact size and portability, laptop computers are particularly prone to overheating problems. Their tiny footprint puts electronic parts closer together, creates less room for cooling vents and adds a heat generating battery which introduces more heat into the system.
Most laptops have small fans that suck in cool air, passing it over metal fins to exchange heat from the case. The resulting hot air exhaust is expelled through vents back into the room. This process prevents heat building up inside the machine. The constant air cycle keeps the laptop running cool no matter the workload placed on it.
This process can be interrupted by any number of factors during operation. Alongside cool air, computer fans can also suck in dust, stray hairs, even cigarette smoke. Smoke in particular contains thick tar which coats the fins, fan blades, and internal components.
Foreign debris inside the machine prevents components from working at their best. Tar, dust, and hair slows down the internal fan and coats the heat generating components and cooling fins. This coating prevents air exchange and keeps components warm as if they were under a blanket.
Causes of Overheating
Sometimes the way a laptop is used can cause it to overheat too. Resting a laptop on thick carpets, blankets, or soft furnishings can block vents, preventing the fans from sucking cold air in or blowing hot air out.
Leaving the machine running on carpet or furnishings, particularly for extended periods of time, can cause overheating issues and introduce extra dust into the components too.
The best place to rest a laptop while in use is on a hard surface such as a desk, table, or lap tray. This allows air free access to the vents and helps prevent dust and hair from getting inside the machine.
As the computer starts running hotter for longer, its fan will attempt to compensate by running faster and more often. This results in the “jet engine” noise many users report when their computer is struggling to keep up.
Unfortunately, once dust, hair, or tar has already found its way into the machine it is notoriously difficult to clean out. The only way to reset the machine to run cool and quiet is to disassemble the base and clean out its components.
Much like a car engine, computer components have a designed temperature range in which they can safely and reliably operate without any issues. Extended periods of running above the temperature they are designed for can cause damage, sudden failures, and drastically shorten the designed lifespan of the computer.
Often times seemingly random blue screen computer crashes can be traced back to components that have been overheating inside the computer. As heat builds up, vulnerable components start to fail, sometimes temporarily, in the hotter temperatures.
By the time the computer is rebooted and cooled down the issue is seemingly resolved. Back in operation, the computer heats up once more and eventually crashes again. These irregular crashes are highly inconvenient and can sometimes cause data loss too.
However, these symptoms are minor compared to a complete write-off of the machine. For some users, the first sign that their machine is too hot to run safely is when the motherboard is burnt out or their data storage has been irreparably lost. | <urn:uuid:bc430891-7527-4473-ba44-2ee9108bda14> | {
"date": "2019-07-20T20:57:55",
"dump": "CC-MAIN-2019-30",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195526670.1/warc/CC-MAIN-20190720194009-20190720220009-00016.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9367361664772034,
"score": 3.296875,
"token_count": 790,
"url": "https://businesstechmanagement.com/is-your-laptop-running-hot-and-loud/"
} |
May 10, 2013 by David Taylor
When a new drug is placed on the market it is universally recognised that all the potential side-effects, both positive and adverse, will not have emerged during the extensive clinical trials. Consequently patients who take the new drug are kept under surveillance. This procedure is known as pharmacovigilance. The recognition, at the end of the last century, that most drugs will leave detectable residues in the aquatic environment, following use by the patient, has led to an appreciation that some form of ecological pharmacovigilance might also be desirable.
My former colleagues and I at AstraZeneca have just published a paper in the journal Drug Safety that addresses some of the challenges that this represents.
Ecopharmacovigilance (EPV) is a developing science and it is currently very unclear what it might mean in practice. We have performed a comparison between pharmacovigilance (PV) and EPV and have identified that there are similarities, but also some important differences that must be considered before any practical implementation of EPV.
The biggest difference and greatest challenge concerns signal detection in the environment and the difficulty of identifying cause and effect. We reflect on the dramatic vulture decline in Asia, which was caused by the veterinary use of diclofenac, versus the relative difficulty in identifying the specific causes of intersex fish in European rivers. We explore what EPV might mean in practice and have identified that there are some practical measures that can be taken to assess environmental risks across product life cycle, particularly after launch of a new drug, to ensure that our risk assessments and scientific understanding of pharmaceuticals in the environment remain scientifically
and ecologically relevant. These include:
- Tracking environmental risks after launch of the product, via literature monitoring for emerging data on exposure and effects
- Using Environmental Risk Management Plans (ERMPs) as a centralized resource to assess and manage the risks of a drug throughout its life cycle
- Further research, testing or monitoring in the environment when a risk is identified
- Keeping a global EPV perspective
- Increasing transparency and availability of environmental data for medicinal products.
These measures will help to ensure that any significant environmental issues associated with pharmaceuticals in the environment (PIE) are identified in a timely way, and can be managed appropriately.
From our blog
October 16, 2018 by Ed Stutt
October 12, 2018 by Dean Leverett | <urn:uuid:8fe8be4b-727d-4d7d-b21f-30d636c881ca> | {
"date": "2018-10-18T05:39:12",
"dump": "CC-MAIN-2018-43",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583511703.70/warc/CC-MAIN-20181018042951-20181018064451-00136.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9531575441360474,
"score": 2.828125,
"token_count": 551,
"url": "http://wca-environment.com/blog/blog-archive/blog-archive-2013/implementing-ecopharmacovigilance-practice-challenges-and-potential-opportunities"
} |
Gales, Joseph, Jr.
10 Apr. 1786–21 July 1860
Joseph Gales, Jr., editor and publisher, was born in Eckington, England, the eldest son of Joseph and Winifred Marshall Gales. He began school in Sheffield, England, where his father had established himself as a printer and newspaper publisher. From his mother, a classics scholar and novelist, he learned to read Latin fluently and to appreciate literature. In 1795, the family fled England for America, victims of the political unrest afflicting England during the French Revolution. Settled in Philadelphia, young Joseph resumed his education. In 1799 the family moved to Raleigh, when the elder Gales accepted an offer to publish a Jeffersonian newspaper in the new capital city of North Carolina.
The senior Gales had hoped that his son would receive a strong academic education in addition to training as a printer. With that end in mind, he enrolled Joseph in The University of North Carolina in the fall of 1800. But because of an altercation involving one of the literary societies on the campus, young Gales was expelled the next year. He returned to Raleigh and entered newspaper work with his father. There he improved his shorthand skill and knowledge of printing. In 1806, his father sent him to Philadelphia to work with William Young Birch, a printer and close friend of the elder Gales. Upon completion of this training Joseph received a diploma from the Typographical Society of Philadelphia.
In 1807 Samuel Harrison Smith offered to sell the National Intelligencer, the first newspaper established in Washington, D.C. The chance to gain control of the "Court Paper" of the Jeffersonian Republicans appealed to the elder Joseph Gales, who had known Smith while living in Philadelphia. He wrote Smith and asked if he would accept his son Joseph as a partner, with the understanding that if the young man proved able he would assume full ownership. Young Gales was only twenty-one, and his father felt he needed more experience before undertaking the task of editing and publishing a newspaper on his own. Smith hesitated, for he wished to retire altogether from newspaper work; but as he received no better offer he accepted. In the summer of 1807 Joseph Gales, Jr., joined the staff of the National Intelligencer. Three years later, in August 1810, he assumed full control.
Gales was a short man, five feet two inches in height. He had a large head, with a broad face and thick black hair. His complexion was dark, his face dominated by black, piercing eyes. Harrison Gray Otis, the Massachusetts Federalist, wrote his wife that Gales "has very much the face & manner of a Malay." His employer's wife, Margaret Bayard Smith, in whose home he lived during his first years with the Intelligencer, thought the young man to be a "country bumpkin" and attempted to "soften" his manners. But another early acquaintance described him as "affable and easy," gracious, and exceedingly polite.
The National Intelligencer was one of the more important newspapers published in the United States, a reputation it enjoyed during its more than fifty years of existence. Under Smith's direction it had become the semiofficial voice of the presidency, a function it continued to serve through the administration of James Monroe. By the nation's newspapers, the Intelligencer was regarded as the basic source for news of the national government. When young Gales assumed control, the paper was issued as a triweekly.
In October 1812, Gales was joined in publishing the Intelligencer by his brother-in-law, William Winston Seaton. Seaton, a Virginian, had married Sarah Gales, the oldest daughter of Joseph Gales, Sr., in April 1809. Three months before that, in January, he had become associated with the elder Gales as coeditor of the Raleigh Register. The addition of Seaton to the staff of the Intelligencer lightened the work of Gales. On several occasions before this he had called on his father to help him report the affairs of Congress. Now these brothers-in-law divided the labor; in reporting the debates in Congress, performed exclusively by the two until 1820, Gales covered the Senate and Seaton the House. Then on 1 Jan. 1813 they began a daily edition, continuing to publish the triweekly for national circulation. During the War of 1812 the Intelligencer's office was sacked by the British in their raid on Washington, the only private establishment so treated. Gales's support of the war was given as the reason by Admiral Sir George Cockburn, the British commander. During this time the editors were on duty with the American forces defending Washington.
Gales married Sarah Juliana Maria Lee, the daughter of Theodorick Lee and niece of "Light Horse Harry" Lee, on 14 Dec. 1812 in Winchester, Va. They had no children but adopted a niece of Mrs. Gales named Juliana. Before he married Gales had selected a spot for a country home some two miles from the center of Washington. But until commercial development drove them out, the couple lived on Ninth Street not far from the Intelligencer office at Seventh and D streets, N.W. Eckington, the name Gales chose for his country estate, became the center for lavish entertaining as well as a refuge for the editor. Both the Gales and Seaton families were among the social elite of Washington. Numbered among Gales's close friends were Henry Clay, Daniel Webster, and Nicholas Biddle.
In its early years the Intelligencer supported the Jeffersonian Republicans. But with the disarray into which that party fell in 1824, Gales turned first to John Quincy Adams, and then, with the opening of the Jacksonian period, to Henry Clay and the Whig party. With the rise of the slavery controversy and the drift toward disunion, Gales tried to follow a neutral course. For nearly his whole career he argued for a policy of moderation regarding the slavery issue, urging the Northern states to leave the solution up to slaveholders and the Southern states. But toward nullification and secession, from the Hartford Convention on, Gales was implacably opposed. This stand in the 1850s threatened the very life of the Intelligencer, for a majority of the paper's subscribers lived in the South.
Gales was usually given credit for the "sound conservatism" of the Intelligencer's editorials. Daniel Webster wrote that Gales "knows more about the history of this government than all the political writers of the day put together." It was Webster's opinion that the editorials printed in the Intelligencer and widely reprinted by newspapers in all sections of the nation helped win support for the Webster-Ashburton Treaty in 1842. James Polk believed Gales's refusal editorially to oppose ratification of the treaty with Mexico was an important factor in securing acceptance of that treaty in 1848.
Beginning in 1825, Gales and Seaton began the Register of Debates in Congress, an annual record of congressional proceedings. To many people this series, which continued through 1837, was the most valuable publishing contribution made by the two editors of the Intelligencer. Of equal importance, however, were the American State Papers, the first volume issued in 1832, a collection of the major documents dealing with foreign relations, Indian affairs, and other matters. This thirty-eight-volume series has been termed by one historian "the high-water mark of historical publication . . . up to the period of the Civil War." Another publishing venture of note undertaken by Gales and Seaton was the Annals of Congress. The first two volumes, published in 1832, were edited by Joseph Gales, Sr., who had retired as editor of the Raleigh Register and moved to Washington. Publication was resumed in 1849. It was completed in 1856, totaling forty-four volumes.
These publishing activities of Gales and Seaton were heavily subsidized by Congress, a testament to the political friendships enjoyed by the editors. Indeed, it was this patronage that enabled the Intelligencer to remain in business while operating as an opposition newspaper. Yet the paper was never a financial success. Neither Gales nor Seaton was a good enough financier to build up the business side of the Intelligencer. During the Jacksonian period the editors were heavily indebted to the United States Bank, an institution they warmly supported along with the American System of Henry Clay.
Both Gales and Seaton were active in the affairs of Washington, Seaton more so than Gales. From 1827 to 1830 Gales served as mayor of the city. He was also active in the American Colonization Society and a member of the first Unitarian church organized in the nation's capital. Though Gales no longer reported the debates in the Senate, Webster asked him to report his debate with Hayne in 1830.
Physically, Joseph Gales, Jr., was never a strong man. In fact, it was an extended illness suffered in 1812 that led to the decision by Gales and his father to invite Seaton to become a partner in publishing the Intelligencer. There were further bouts with sickness, and by the early 1850s Gales was badly crippled. Nevertheless, he lived to be seventy-four. His funeral, held at his home Eckington, was a state occasion. President Buchanan and his cabinet attended as a body, along with other dignitaries. Schools and stores were closed. He was buried in the Congressional Cemetery. Seaton survived him by six years and the Intelligencer by nine.
William E. Ames, A History of the National Intelligencer (1972).
Clarence C. Carter, "The United States and Documentary Historical Publication," Mississippi Valley Historical Review 25 (1938).
Robert N. Elliott, Jr., The Raleigh Register, 1799–1863 (1955).
Joseph and Winifred Gales, Reminiscences (Southern Historical Collection, University of North Carolina, Chapel Hill).
Frederick Hudson, Journalism in the United States from 1690 to 1872 (1873).
Frank L. Mott, American Journalism (1940).
Josephine Seaton, William Winston Seaton of the "National Intelligencer " (1871).
"Gales Family." N.C. Highway Historical Marker H-99, N.C. Office of Archives & History. http://www.ncmarkers.com/Markers.aspx?sp=Markers&k=Markers&sv=H-99 (accessed August 9, 2013).
Gales Family Papers, 1815-1939 (collection no. 02652-z). The Southern Historical Collection. Louis Round Wilson Special Collections Library. University of North Carolina at Chapel Hill. http://www2.lib.unc.edu/mss/inv/g/Gales_Family.html (accessed August 9, 2013).
"Joseph Gales, Jr. (1786–1860)" United States Senate Catalog of Fine Art. Government Printing Office. 156-159. http://www.gpo.gov/fdsys/pkg/GPO-CDOC-107sdoc11/pdf/GPO-CDOC-107sdoc11-2-46.pdf (accessed August 9, 2013).
"Funeral of Joseph Gales." The New York Times. July 27, 1860. http://www.nytimes.com/1860/07/27/news/funeral-of-joseph-gales.html (accessed August 9, 2013).
Clark, Allen C. "Joseph Gales, Junior, Editor and Mayor." Records of the Columbia Historical Society, Washington, D.C. 23, (1920). 86-145. http://www.jstor.org/stable/40067140
Healy, George Peter Alexander. "Joseph Gales." circa 1844. United States Senate. http://www.senate.gov/artandhistory/art/artifact/Painting_31_00016.htm (accessed August 9, 2013).
1 January 1986 | Elliott, Robert N. | <urn:uuid:891b0b92-fc50-4b21-9a8d-a9ccb15b6840> | {
"date": "2016-06-25T05:36:09",
"dump": "CC-MAIN-2016-26",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392099.27/warc/CC-MAIN-20160624154952-00046-ip-10-164-35-72.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9716017246246338,
"score": 2.609375,
"token_count": 2524,
"url": "http://ncpedia.org/node/6006/backlinks"
} |
You’ve probably never noticed, but on the back of any package of cotton swabs there’s a written warning that is some version of this:
“Caution: Do not enter the ear canal. Entering the ear canal could result in injury.”
If you have a package of cotton swabs, go check it out for yourself.
You see, it’s not just doctors, audiologists, and hearing specialists who advise against the use of cotton swabs to clean the ears—even the manufacturers of cotton swabs think it’s a bad idea!
But why, if the use of cotton swabs is such a widely used method of ear cleaning, should it be avoided? Why are the manufacturers so insistent that you don’t use their own product in this way?
We’re glad you asked: the following are four good reasons to never use cotton swabs to clean your ears again.
1. Earwax is invaluable
Earwax has a couple of useful functions aside from being gross. It has antibacterial properties to prevent infections, it works as an insect repellent to keep bugs out of your ears, and it helps to lubricate the ear canal, which prevents dried out, itchy skin.
2. Cotton Swabs drive earwax up against the eardrum
Using cotton swabs is actually dangerous. When you force any foreign object into the ear canal, you’re pushing most of the earwax up against the eardrum. This can rupture the eardrum or can bring on an impaction that will result in hearing loss.
3. Earwax removes itself
The ear is fashioned to eliminate its own earwax. The natural motions of your jaw—from talking, eating, or yawning—will move the earwax to the external ear. All that’s required on your part is normal showering and cleaning the outer ear with a washcloth.
4. Excessive earwax removal causes dryness
Earwax has lubricating and antibacterial qualities, so if you eliminate too much, you’ll have a dry, itchy sensation and will be more vulnerable to infections.
What to do instead
There are a variety of commercialized (and do-it-yourself) solutions you can use to flush out your ears, which is considerably safer than inserting foreign objects into the ear canal. But bear in mind, if you’re having problems with excessive earwax or you’re having trouble hearing, it’s usually best to seek the advise of a hearing professional.
Hearing professionals are extensively trained in the structure and function of the ear, and can diagnose any issues you may have with earwax buildup or hearing loss. It’s always a wise course of action to rule out more severe problems, and if cleaning is all that’s required, you’ll get the assurance of knowing that it’s being done correctly. | <urn:uuid:1556937d-8a17-4e4f-ace3-8841efdfb9e8> | {
"date": "2019-02-16T20:33:14",
"dump": "CC-MAIN-2019-09",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247481111.41/warc/CC-MAIN-20190216190407-20190216212407-00376.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.93096923828125,
"score": 2.6875,
"token_count": 626,
"url": "https://www.brightaudiology.com/4-reasons-stop-using-cotton-swabs-clean-ears/"
} |
There could be at least two unknown planets hidden well beyond Pluto, whose gravitational influence determines the orbits and strange distribution of objects observed beyond Neptune. This has been revealed by numerical calculations made by researchers at the Complutense University of Madrid and the University of Cambridge. If confirmed, this hypothesis would revolutionise solar system models.
Astronomers have spent decades debating whether some dark trans-Plutonian planet remains to be discovered within the solar system. According to the calculations of scientists at the Complutense University of Madrid (UCM, Spain) and the University of Cambridge (United Kingdom) not only one, but at least two planets must exist to explain the orbital behaviour of extreme trans-Neptunian objects (ETNO).
The most accepted theory establishes that the orbits of these objects, which travel beyond Neptune, should be distributed randomly, and by an observational bias, their paths must fulfil a series of characteristics: have a semi-major axis with a value close to 150 AU (astronomical units or times the distance between the Earth and the Sun), an inclination of almost 0° and an argument or angle of perihelion (closest point of the orbit to our Sun) also close to 0° or 180°.
Yet what is observed in a dozen of these bodies is quite different: the values of the semi-major axis are very disperse (between 150 AU and 525 AU), the average inclination of their orbit is around 20° and argument of Perihelion -31°, without appearing in any case close to 180°.
"This excess of objects with unexpected orbital parameters makes us believe that some invisible forces are altering the distribution of the orbital elements of the ETNO and we consider that the most probable explanation is that other unknown planets exist beyond Neptune and Pluto," explains Carlos de la Fuente Marcos, scientist at the UCM and co-author of the study.
"The exact number is uncertain, given that the data that we have is limited, but our calculations suggest that there are at least two planets, and probably more, within the confines of our solar system," adds the astrophysicist.
To carry out the study, which is published as two articles in the journal 'Monthly Notices of the Royal Astronomical Society Letters', the researchers have analysed the effects of the so-called 'Kozai mechanism', related to the gravitational perturbation that a large body exerts on the orbit of another much smaller and further away object. As a reference they have considered how this mechanism works in the case of comet 96P/Machholz1 under the influence of Jupiter.
Two problems to solve
Despite their surprising results, the authors recognise that their data comes up against two problems. On the one hand, their proposal goes against the predictions of current models on the formation of the solar system, which state that there are no other planets moving in circular orbits beyond Neptune.
However, the recent discovery by the ALMA radio telescope of a planet-forming disk more than 100 astronomical units from the star HL Tauri, which is younger than the Sun and more massive, suggests that planets can form several hundred astronomical units away from the centre of the system.
On the other hand, the team recognises that the analysis is based on a sample with few objects (specifically 13), but they point out that in the coming months more results are going to be published, making the sample larger. "If it is confirmed, our results may be truly revolutionary for astronomy," says de la Fuente Marcos.
Last year two researchers from the United States discovered a dwarf planet called 2012 VP113 in the Oort cloud, just beyond our solar system. The discoverers consider that its orbit is influenced by the possible presence of a dark and icy super-Earth, up to ten times larger than our planet.
Carlos de la Fuente Marcos, Raúl de la Fuente Marcos, Sverre J. Aarseth. "Flipping minor bodies: what comet 96P/Machholz 1 can tell us about the orbital evolution of extreme trans-Neptunian objects and the production of near-Earth objects on retrograde orbits". Monthly Notices of the Royal Astronomical Society 446(2):1867-1873, 2015.
C. de la Fuente Marcos, R. de la Fuente Marcos. "Extreme trans-Neptunian objects and the Kozai mechanism: signalling the presence of trans-Plutonian planets? Monthly Notices of the Royal Astronomical Society Letters 443(1): L59-L63, 2014. | <urn:uuid:fc6fe797-f688-4cfc-a3d2-1f915413afa4> | {
"date": "2016-10-21T13:18:45",
"dump": "CC-MAIN-2016-44",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718278.43/warc/CC-MAIN-20161020183838-00221-ip-10-171-6-4.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9032103419303894,
"score": 3.640625,
"token_count": 939,
"url": "https://www.eurekalert.org/pub_releases/2015-01/f-sf-tos011515.php"
} |
A lot of the people who have sent me dragonfly swarm reports have expressed an interest in identifying the dragonflies they’re seeing in their yards. I think this warrants a post on where to find information about dragonfly identification! Today I’ll cover some of the books I really love and some of the best online resources you can use. I’ll also tell you what you can do if you’re stuck and need the advice of an expert to help you figure out the dragonflies that you’ve seen. I’m a scientist, so I have a lot of technical books that I can use to help me identify dragonfly species very precisely using a microscope and other special tools, but this post is meant to help people who are not dragonfly experts to find accessible information. I hope you will find this useful!
I am a huge book lover, so I personally turn to books whenever I want to ID a dragonfly or damselfly that I’ve seen. I have several favorites, but I use two over and over again because they are so thorough and include ALL of the species in a particular area. Dragonflies Through Binoculars by Sidney Dunkle is a great source of information about the North American dragonflies. It includes photos, descriptions, distribution maps, and flight dates for each of the species. It also does a great job of highlighting the distinguishing characteristics so you can tell species apart even if they are very similar in appearance. This is a great book and I always take it with me when I travel. The only downsides are that the book doesn’t include the damselflies and it it now 10 years old, so some of the information might be slightly out of date. The book I turn to again and again when I want to have all of the dragonflies and damselflies in one place is Dragonflies and Damselflies of the West by Dennis Paulson. This book shares all of the great features of Dunkle’s book, but it is is newer and includes the damselflies. I LOVE the behavioral information in this book! However, if you live outside of the western part of the US and Canada, this book isn’t going to be as useful. Luckily, dragonflies are popular, so there are a lot of great resources out there! Your best bet is getting on Amazon and searching for either dragonfly or odonata and your state or country. There are tons of local guides available, so it’s definitely worth looking for one for your area!
There are several great online resources, but I am particularly fond of Odonata Central. Odonata Central is an amazing website! It include up-to-date information about flight seasons, distributions, characteristics, etc. Even if you know nothing about the dragonflies you’re seeing, Odonata Central is an excellent resource. For example, to see a list of every species in your area, you can click on the checklist link at the top of the page. The website will guide you to your location (in the US, you can get information for your county) and a list of all of the species in your area will appear. You’ll also see links for photos, maps, and information about each species on the list. By clicking through the images and reading the descriptions, you will likely be able to identify the species in your area. The best part: this works for almost any location, including areas outside of North America.
Many, many people (including Odonata Central) have photo galleries of dragonflies online and simply scrolling through photos can take you a long way toward identifying the species you see in your area. I love the Digital Dragonfly website’s image gallery, though not all American species are included. Because I live in southern Arizona, I also frequently check websites such as Arizona Odonates and California Dragonflies and Damselflies for photos and identification information. To find websites with information about your local dragonflies and damselflies, check out the links page at Ode News or the links page at Odonata Central. They both have comprehensive lists of good, reliable information available online.
If, after you have tried the field guides and scrolled through photo galleries, you just can’t decide whether your dragonfly is a neon skimmer or a flame skimmer, where can you turn? There are two great resources available at your disposal. The first is BugGuide. In addition to great photo galleries, you can also submit photos of dragonflies or damselflies and request an ID. Bug Guide is a network of insect and spider enthusiasts who volunteer their time helping people ID bugs they’ve seen. When you submit an ID request, one of the many Bug Guide users will likely know which species you’ve seen an give you an ID! To get the most specific response, take a photo of at least the back and the side of the dragonfly or damselfly as clearly as you can because the characteristics that distinguish species are most often in these areas. Then upload your photos to the Bug Guide by clicking ID Request at the top of the page and following the instructions. Most people get responses to their inquiries within a few days.
Did you know that there are entomologists all over the US trained to help non-entomologists identify insects? Land grant universities are often required to maintain research collections of various groups of organisms (including insects, snakes, fish, crustaceans, plants, etc) and to provide outreach to the public. If you have a land grant university in your area, you likely have someone who can help you ID insects and provide information about them at the university. The Cooperative Extension service is the main outreach component of most land grant universities and nearly every county in the US has an office. The Cooperative Extension service employs a large number of entomologists, so give your county office a call! If your county’s entomologist can’t ID a dragonfly for you, he or she likely knows a person who can. And finally, Odonata Central maintains a member directory that includes many dragonfly experts and/or enthusiasts around the world. If you click on View All at the top of the page and search for your location, you might be able to find a odonatologist nearby who can answer your dragonfly ID questions and give you more information about your local species. That said, tracking down their contact info might not be easy in every case.
As I said earlier, dragonflies are very popular insects, so there are tons of resources available! In fact, the volume of information available can be overwhelming if you don’t know where to begin. Hopefully, this post will direct you to the best resources available and make it as easy as possible to figure out which dragonfly species you’ve been seeing. Good luck!
I’m getting away from dragonflies for the next few posts, but check back near the end of October for a summary of the results of my dragonfly swarm data collection effort this summer. I’ve collected more reports than I ever thought I would, so it should be an interesting read!
Unless otherwise stated, all text, images, and video are copyright © 2010 DragonflyWoman.wordpress.com | <urn:uuid:24d32049-d79e-4ef7-bc46-7bec823f701a> | {
"date": "2014-10-20T04:23:36",
"dump": "CC-MAIN-2014-42",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1413507441801.11/warc/CC-MAIN-20141017005721-00028-ip-10-16-133-185.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.936720073223114,
"score": 2.515625,
"token_count": 1499,
"url": "http://thedragonflywoman.com/2010/09/"
} |
Human Growth Hormone HGH
Human Growth Hormone HGH
HGH stands for Human Growth Hormone. In every human body, there is hormone production but the quantity may differ from person to person and case to case. For instance, the production is less in older people and more in pregnant ladies. If the hormones production is reduced, then the body starts facing some hormone-related problems. Hence, HGH medicines are consumed. It helps in reducing old age problems also.
HGH is a natural protein created by an organ called pituitary gland that is at the bottom of the brain. It is responsible for body growth during growing years and metabolism. The secretion of hormones is maximum till teenage and is reduced after 30 and goes on reducing there after.
Like other body proteins, hormones are on a rise during youth and as we grow older, the secretion is reduced. As a replacement for hormones, types of compounds such as estrogen, progesterone and testosterone are used to make old people feel healthy. Even HGH protein is used in a similar way.
Excessive secretion of hormones in kids is a reason for increase in their height. As age increases, the secretion reduces and this directly results in certain body related issues. Various studies are conducted on the HGH intake by adults. The medicines increases energy, reduces body fat, makes heart resistant to diseases, bones becomes stronger, rejuvenates skin, improves memory, develops immune system further and there are many more benefits of HGH.
To reduce aging process, people have now started considering Human Growth Hormone replacement therapy. Under this therapy, the individual is injected a dose of HGH or made to consume HGH Releasers. These are a type of HGH supplements that’s made of amino acids and other vitamins. It helps in the process of hormones secretion, which in turn does a whole lot of good to the body, keeping it younger and healthier.
Human Growth Hormone Deficiency
A disorder known as Growth Hormone (GH) deficiency affects the pituitary gland (also called as master gland) located at the bottom of brain that generates growth and other hormones. If the master gland falls short of adequate growth hormone production, growth is adversely affected.
Growth hormone is essential for children to grow normally. The role of the growth hormone in adults is to maintaining the necessary levels of body fat, muscle and bone. Inadequate or no growth hormone in adults leads to emotional problems like tiredness and lack of motivation, and sometimes affects cholesterol level as well.
Deficiency in growth hormone occurs due to inadequate or absence of secretion of growth hormone. The conditions responsible for this may either be congenital which occurs from birth or acquired which results after birth. The cause of congenital growth hormone deficiency could be due to an abnormal pituitary gland or another syndrome altogether.
Problems owing to deficiency in HGH can vary for different ages. Children are vulnerable to the major symptoms of HGH deficiency, which are short stature, growth failure and late puberty. Adult cases prove more elusive in detection of the deficiency effects, which can include lack of bone mass, strength, and energy, apart from... Full Human Growth Hormone Deficiency article...
|Home | Info | Resources | Contact | Sitemap
© human-growth-hormone-hgh.net All rights reserved | <urn:uuid:b23d16f3-0c61-4d9f-b2c3-af4b040fdf37> | {
"date": "2015-07-04T08:22:14",
"dump": "CC-MAIN-2015-27",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-27/segments/1435375096579.89/warc/CC-MAIN-20150627031816-00246-ip-10-179-60-89.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9419140219688416,
"score": 2.921875,
"token_count": 690,
"url": "http://www.human-growth-hormone-hgh.net/"
} |
The occupational structure, refers to the distribution of population working in different
sectors. It showed no variation throughout the British rule. :
The following are the salient features of India’s pre-independence occupational structure
(i) Predominance of Agriculture Under the colonial rule, India was basically an agrarian economy, with nearly 85% of its workforce engaged directly or indirectly in agriculture. Due
to massive poverty and widespread illiteracy during the colonial rule, a large proportion of the population was engaged in farming and related activities to earn their subsistence.
(ii) Lack of Opportunities in Industry Only a small proportion of population was employed in
manufacturing sector. Nearly 10 % of the total workforce was engaged in manufacturing and industrial sector.
(iii) Unequal Distribution Among Sectors The three sectors of Indian economy, i.e., agricultural, industrial and service sector were unequal in terms of occupational structure.
While the agricultural sector employed majority of the workforce, the other two sectors were not contributing much to employment with 10 % of the workforce in industries and 15-20 % in service sector.
(iv) Regional Imbalance There was regional variation in the occupational structure of India. On
the one land, the Madras Presidency (comprising of present day states qf Tamil Nadu, Andhra Pradesh, Kerala and Karnataka), Bombay and Bengal experienced a fall in the agricultural workforce and increase in occupational share of manufacturing and services. On the other hand, states like Orissa, Rajasthan and Punjab experienced a rise in the agricultural workforce. | <urn:uuid:8c1a763e-0901-491e-95a9-9881caaccdc7> | {
"date": "2017-06-25T10:38:28",
"dump": "CC-MAIN-2017-26",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320489.26/warc/CC-MAIN-20170625101427-20170625121427-00417.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9376049041748047,
"score": 3,
"token_count": 318,
"url": "http://ask.learncbse.in/t/highlight-the-salient-features-of-indias-pre-independence-occupational-structure/15598"
} |
Key: "S:" = Show Synset (semantic) relations, "W:" = Show Word (lexical) relations
Display options for sense: (gloss) "an example sentence"
- S: (n) leg (a human limb; commonly used to refer to a whole limb but technically only the part of the limb between the knee and ankle)
- S: (n) leg (a structure in animals that is similar to a human leg and used for locomotion)
- S: (n) leg (one of the supports for a piece of furniture)
- S: (n) branch, leg, ramification (a part of a forked or branching shape) "he broke off one of the branches"
- S: (n) leg (the limb of an animal used for food)
- S: (n) peg, wooden leg, leg, pegleg (a prosthesis that replaces a missing leg)
- S: (n) leg (a cloth covering consisting of the part of a pair of trousers that covers a person's leg)
- S: (n) leg ((nautical) the distance traveled by a sailing vessel on a single tack)
- S: (n) stage, leg (a section or portion of a journey or course) "then we embarked on the second stage of our Caribbean cruise" | <urn:uuid:c853e433-6317-4a3a-9c19-693fa8dba9ba> | {
"date": "2015-10-08T22:00:46",
"dump": "CC-MAIN-2015-40",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-40/segments/1443737904854.54/warc/CC-MAIN-20151001221824-00116-ip-10-137-6-227.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.8991516828536987,
"score": 3.953125,
"token_count": 284,
"url": "http://wordnetweb.princeton.edu/perl/webwn?o2=&o0=1&o8=1&o1=1&o7=&o5=&o9=&o6=&o3=&o4=&s=leg&i=9&h=10000000000000"
} |
Campylobacters, Salmonellas, and Indicator Bacteria in the Lune Estuary
Estuaries are increasingly being used for recreational purposes. The Lune estuary at Lancaster, for example, is a centre for water skiing and jet skiing. Such sports can only be done at high-water, which unfortunately coincides with the discharge of sewage effluent into the estuary from Lancaster’s effluent treatment works (ETW). There is a risk, therefore, of exposure to high levels of faecal microorganisms with the consequent risk of disease3,6,8. We have shown that Campylobacter occurs in the Lune estuary at levels above the infective dose, especially in winter and autumn4. In the past, water sports were almost exclusively a summer pastime, nowadays however, such activities continue throughout the winter, when bacteria survive for longer.
KeywordsFaecal Coliform Indicator Bacterium Faecal Indicator Recreational Purpose Faecal Streptococcus
Unable to display preview. Download preview PDF. | <urn:uuid:fce746ab-4e89-4c51-a89c-1a37f9f10df5> | {
"date": "2018-08-18T03:56:09",
"dump": "CC-MAIN-2018-34",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-34/segments/1534221213264.47/warc/CC-MAIN-20180818021014-20180818041014-00696.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.915424108505249,
"score": 2.8125,
"token_count": 222,
"url": "https://link.springer.com/chapter/10.1007/978-1-4757-9558-5_32"
} |
Name: Energetically Autonomous Tactical Robot (EATR)
How it works: The idea of a lawnmower powered by grass clippings is an old one, but this bot may put the theory in action. EATR will harvest its own biofuel in the form of leaves, twigs or other vegetable matter with its manipulator arm. Sensors and smart recognition software allow it to distinguish between vegetation and rock or metal. The fuel is shredded and fed into an external combustion engine called Cyclone. Fuel and air circulate rapidly in a combustion chamber, burning at temperatures of up to 1200 F. The heat is used to produce high-pressure steam to drive a piston. The energy can be used to drive the tracks, power other systems or recharge batteries. EATR should be able to travel 100 miles on about 150 pounds of vegetation.
Only limited by: Availability of organic material for fuel. | <urn:uuid:d5bacf6c-7d36-4d64-ba26-f109563c524a> | {
"date": "2014-04-16T22:31:08",
"dump": "CC-MAIN-2014-15",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-15/segments/1397609525991.2/warc/CC-MAIN-20140416005205-00027-ip-10-147-4-33.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9254648089408875,
"score": 2.9375,
"token_count": 187,
"url": "https://www.popularmechanics.com/technology/engineering/robots/autonomous-robots-power-themselves-eater"
} |
|Order Product||Testimonials||What is Neuropathy||Causes of Neuropathy||Frequently Asked Questions|
Nerve Pain and Nerve Damage
Nerve pain (often called “neuralgia”) is pain that follows the path of a nerve.
Neuralgia is frequently caused by nerve damage (called “neuropathy”) as a result of the side effect of drugs and medications, illness and disease, chemicals and chemotherapy, medical conditions such as diabetes, as well as damage caused during surgery and physical injury.
Unfortunately, drugs and medications only treat the symptoms and usually do nothing to address the underlying causes. The good news is that cutting-edge science and nutrition have come together to create a truly monumental and natural breakthrough for people who are affected by nerve damage.
Now, you can safely and naturally reduce, or entirely eliminate, the pain caused by nerve damage, without the need for additional drugs or medications.
Our goal is to educate you and make you aware of this new and absolutely miraculous and unique product.
I encourage you to read further, learn, ask lots of questions and use health professionals for advice. But make your own decisions!
A Different Approach - Live Customer Assistance
The staff of Wellness Support Network have many years of experience working with individuals and diabetics who have been suffering with neuropathy. We believe in live communication.
We contact our customers on a regular basis, either by phone or email, and provide them with guidance on their diet, exercise, and progress on an individual-by-individual basis. We assist them in working out solutions to problems unique to their own case, to ensure they get the results we promise.
People are individuals and deserve help on an individual basis. This is what we are about and why our customers know we care!
You hold in your hands an opportunity to significantly improve your health. Your most important decision is to take action and take control of your health.
Order your WSN® Nerve Support Formula below and experience the results for yourself.
| Home | Product Information | Order Product | Testimonials | What is Neuropathy |
| Causes of Neuropathy |Frequently Asked Questions | What do the Doctors Say? | Clinical Studies |
| Newsletter Archives | About Us | Privacy | Contact Us |
|The Food and Drug Administration has not evaluated these claims pertaining to these medical foods. These medical foods are intended for the dietary management of neuropathy and not intended to "diagnose, treat, cure or prevent any disease," because only a drug can legally make such a claim.| | <urn:uuid:59ef29ed-3589-4e90-82b8-df7f195ec194> | {
"date": "2014-03-11T08:02:33",
"dump": "CC-MAIN-2014-10",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1394011155657/warc/CC-MAIN-20140305091915-00006-ip-10-183-142-35.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9384562373161316,
"score": 2.609375,
"token_count": 534,
"url": "http://www.realfoodnutrients.com/neuropathy/nerve-pain.htm"
} |
Sydney's Aboriginal Past
Investigating the Archaeological and Historical Records
written by Val Attenbrow
UNSW Press | ISBN 9781742231167
Paperback – 264 pages
Member’s price: $53.96
Usually ships within 2–11 business days.
This second edition of Sydneys Aboriginal Past draws on the latest historical, archaeological, geological, environmental and linguistic research, as well as oral evidence of present-day Aboriginal people, to reveal the diversity of Aboriginal life in the Sydney region before, during and for the first thirty years of British settlement. Val Attenbrow describes the different Aboriginal groups and how they lived; the resources available; the foods they ate and their means of obtaining them; their tools, weapons and equipment, and how they were made; where they camped; their shelters, clothing and personal adornment; their beliefs, ceremonial life and rituals; as well as their designs and images. | <urn:uuid:42225e2c-4b59-468b-a9e5-ec9a09f2b78f> | {
"date": "2014-03-08T13:47:29",
"dump": "CC-MAIN-2014-10",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-10/segments/1393999654667/warc/CC-MAIN-20140305060734-00006-ip-10-183-142-35.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.94871586561203,
"score": 2.640625,
"token_count": 193,
"url": "http://www.artgallery.nsw.gov.au/shop/item/9781742231167/"
} |
Definition - What does Utkata mean?
Utkata is a Sanskrit word meaning “fierce,” “proud,” “immense,” “difficult,” “wild” or “frightening.” It is well-known in yoga as the root word for two important yoga asanas: utkatasana and utkata konasana. As a word and a concept, utkata reminds yogis of the need to build strength, determination and discipline through yoga asanas.
Additional asans with utkata in their name include: parivrtta utkatasana, utthita utkata parsvakonasana, parivrtta utkata konasana and utthita parivrtta utkatasana.
Yogapedia explains Utkata
Utkatasana is known in English as chair pose, but it is a challenging standing posture that builds strength in the lower body.
Utkata konasana is a wide-legged squat where the arms are raised to
shoulder height. The fierce meaning of utakata in this context refers to
the power and fiery strength it builds, and the fierce angle between
the legs and the ground.
Fierce postures such as utkatasana and utkata konasana cultivate both physical and mental power. They create heat in the body and encourage stability and grounding. As well as helping to strengthen the muscles, these fierce standing postures can help the yogi find the inner power to overcome obstacles. | <urn:uuid:3b01c44c-4702-4935-9f2f-cfc393e24a06> | {
"date": "2019-03-21T23:46:44",
"dump": "CC-MAIN-2019-13",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912202588.97/warc/CC-MAIN-20190321234128-20190322020128-00216.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9136388897895813,
"score": 3.03125,
"token_count": 338,
"url": "https://www.yogapedia.com/definition/6571/utkata"
} |
March of Dimes
|This article is a stub. You can help by expanding it.|
The March of Dimes is a voluntary health organization concerned with birth defects.
- Dr. Jennifer L. Howse - President
Studies on pregnant & infant animals
Addiction, xenotransplantation & sensory deprivation
Human studies have clearly demonstrated the negative effects of tobacco, alcohol and drug abuse on pregnancy. Nevertheless, the March of Dimes continues to fund painful animal testing on animals and their infants. The March of Dimes has funneled millions into nicotine, alcohol and cocaine addiction experiments, sensory deprivation and xenotransplantation (transplanting organs from one species to another). Research includes:
- Sewing shut the eyes of newborn kittens for one year before killing them.
- Keeping newborn kittens in complete darkness for 3 to 5 months before killing them.
- Removing fetal kittens from the uterus and implanting them with pumps which inject a nerve destroying drug. They are then implanted back into the uterus and killed after birth.
- Implanting electric pumps into the backs of pregnant rats to inject nicotine.
- Injecting pregnant rats with cocaine.
- Injecting newborn possums with alcohol and decapitating them any where from between one hour and 32 weeks later (at which point, sexual organs are removed.)
- Transplanting organs from pigs to baboons (who die within hours) and transplanting organs from guinea pigs to rats.
- Destroying the ear drums of unborn lambs and killing mother sheep and lambs just before birth to examine their brains.
Increasing rate of birth defects
The Birth Defects Monitoring Program (BDMP) monitors birth defects using data collected when newborn infants are discharged from hospital. The BDMP was initiated by the Centers for Disease Control (CDC) in 1974. In 1990, researchers looking for trends examined records for 38 types of birth defects from 1979-80 through 1986-87. During this seven-year period, of the 38 types of birth defects, 29 increased; two decreased; and seven remained stable (meaning they changed less than 2% per year during the period).
Approximately 25% of all infant deaths could be eliminated with better pre-natal services. Infant deaths would decrease by 10 to 25% if women gave up smoking during pregnancy. Alcohol abuse during pregnancy is the leading cause of preventable birth defects.
National Officers (2008)
Accessed May 2010:
- Kenneth A. May - Chair of the Board
- Mark Selcow - Vice Chair of the Board
- David R. Smith - Vice Chair of the Board
- Carol Evans - Vice Chair of the Board
- Thomas A. Russo - Treasurer
- LaVerne H. Council - Secretary
- Jennifer L. Howse - President
- Jane Massey - Executive Vice President; Chief Operating Officer
- Alan R. Fleischman - Medical Director
- Lisa Bellsey - Senior Vice President & General Counsel ; Assistant Secretary
- Richard E. Mulligan - Senior Vice President & Chief Financial Officer; Assistant Treasurer
Articles & sources
- Animal testing
- Bank of America
- Centers for Disease Control
- Eliot Spindel
- Humane Movement
- National Primate Research Center System
- People for the Ethical Treatment of Animals
- Pharmaceutical industry
- Ten Worst Laboratories
- Miriam Buhl
- People for the Ethical Treatment of Animals March of Crimes web page, accessed June 2009
- People for the Ethical Treatment of Animals The March Of Dimes' Crimes Against Animals Web page, accessed June 2009
- Peter Montaque Birth Defects: Part 1, Rachel's Environment & Health Weekly, #410, October 1994
- The March Of Dimes' Crimes Against Animals, PETA.org, accessed June 2009
- Put Your Money Where Your Mouth Is, PETA.org, accessed February 2009
- 2008 Annual Report, March of Dimes, accessed May 10, 2010.
- Heather Moore Dying for a Cigarette, Impact Press, February-March 2002
<tdo>resource_id=29160 resource_code=mod search_term=March of Dimes</tdo> | <urn:uuid:2c0e878c-0239-45d9-b7bf-2d12a3897329> | {
"date": "2016-09-28T01:46:14",
"dump": "CC-MAIN-2016-40",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738661289.57/warc/CC-MAIN-20160924173741-00182-ip-10-143-35-109.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.900263249874115,
"score": 3.296875,
"token_count": 870,
"url": "http://www.sourcewatch.org/index.php/March_of_Dimes"
} |
Term originally introduced in the late 1930s by Matthes (1939) to describe a broad interval of the late Holocene during which significant glacial advances were observed. In the climatological literature the LIA has now come to be used to characterize a more recent, shorter recent interval from around A.D. 1300 to 1450 until A.D. 1850 to 1900 during which regional evidence in Europe and elsewhere suggest generally cold conditions. Variations in the literature abound with regard to the precise definition, and the term is often used by paleoclimatologists and glaciologists without formal dates attached. The attribution of the term at regional scales is complicated by significant regional variations in temperature changes due to the the influence of modes of climate variability such as the North Atlantic Oscillation and the El Nino/Southern Oscillation. Indeed, the utility of the term in describing past climate changes at regional scales has been questioned [see e.g. Jones, P.D., Mann, M.E., Climate Over Past Millennia, Reviews of Geophysics, 42, RG2002, doi: 10.1029/2003RG000143, 2004 and references therein.] A number of myths or exaggerations can still be found in the literature with regard to the details of this climate period [see Jones and Mann, 2004]. These include the citation of frost fairs on the River Thames as evidence of extreme cold conditions in England. Thames freeze-overs (and sometimes frost fairs) only occurred 22 times between 1408 and 1814 [Lamb, 1977] when the old London Bridge constricted flow through its multiple piers and restricted the tide with a weir. After the Bridge was replaced in the 1830s the tide came further upstream and freezes no longer occurred, despite a number of exceptionally cold winters. Winter 1962/3, for example, was the third coldest winter recorded in instrumental records extending back to 1659, yet the river only froze upstream of the present tidal limit. It is also sometimes claimed that the extreme cold of the “Little Ice Age” impeded the navigation of a Northwest Passage in the Canadian Arctic during the early 19th century. However, an exhaustive study of 19th century explorer logs for the region yields no evidence of conditions that would be considered unusually cold by modern standards.
See also “Medieval Warm Period”. | <urn:uuid:752abdcb-cc26-4560-90c6-2d143b1516d8> | {
"date": "2016-10-01T10:32:31",
"dump": "CC-MAIN-2016-40",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-40/segments/1474738662705.84/warc/CC-MAIN-20160924173742-00082-ip-10-143-35-109.ec2.internal.warc.gz",
"int_score": 4,
"language": "en",
"language_score": 0.9484933614730835,
"score": 3.6875,
"token_count": 481,
"url": "http://www.realclimate.org/index.php?p=32&wpmp_switcher=desktop"
} |
Lead author Dr. Rachel Moon, chairwoman of the AAP SIDS task force said the policy statement and technical report provide global recommendations for education and safety related to SIDS risk reduction.
Important recommendations include:
-- Breastfeeding is recommended and is associated with a reduced risk of SIDS.
-- Infants should be immunized. Evidence suggests that immunization reduces the risk of SIDS by 50 percent.
-- Bumper pads should not be used in cribs because of their potential risk of suffocation, strangulation or entrapment. Keep soft objects out of the crib including pillows, blankets and bumper pads.
-- Always place baby on his or her back.
-- Always use a firm sleep surface, not sitting devices.
-- The baby should sleep in the same room as the parents, but not in the same bed.
-- Keep soft objects out of the crib including pillows, blankets and bumper pads.
-- Wedges and positioners should not be used.
-- Pregnant women should receive regular prenatal care.
-- Don't smoke during pregnancy or after birth.
-- Offer a pacifier at nap time and bedtime.
-- Avoid covering the infant's head or overheating.
-- Do not use home monitors or commercial devices marketed to reduce the risk of SIDS.
The findings are published online ahead of the November print edition of the journal Pediatrics and presented at the AAP National Conference & Exhibition in Boston.
CDC: Get your flu vaccine | <urn:uuid:7d5bfdd1-2694-45d8-a606-a1db528dc95b> | {
"date": "2014-09-19T20:29:37",
"dump": "CC-MAIN-2014-41",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-41/segments/1410657132007.18/warc/CC-MAIN-20140914011212-00272-ip-10-196-40-205.us-west-1.compute.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9182196259498596,
"score": 2.9375,
"token_count": 304,
"url": "http://www.upi.com/Health_News/2011/10/19/Baby-sleep-guidelines-No-crib-bumpers/UPI-99731318999275/"
} |
Place: United Kingdom, Germany
Subject: biography, physics
German-born British physicist who pioneered quantum mechanics, the mathematical explanation of the behaviour of an electron in an atom. His version of quantum mechanics had a short reign as the most popular explanation and was soon displaced by the equivalent and more convenient wave mechanics of Erwin Schrödinger, which is in use today. The importance of Born's work was eventually recognized, however, with the award of the 1954 Nobel Prize for Physics, which he shared with German physicist Walther Bothe (1891-1957). (Bothe's share of the award was for his work on the detection of cosmic rays and was not connected with Born's achievements in quantum mechanics.) Born also made important advances in the understanding of the dynamics of crystal lattices.
Born was born in Breslau, Germany (now Wrocław, Poland) on 11 December 1882 into a wealthy Jewish family. His father was professor of anatomy at the University of Breslau, which Born later attended as well as the University of Göttingen, gaining his doctorate in physics and astronomy at Göttingen in 1907.
After periods of military service and various academic positions in Göttingen and Berlin, Born was appointed professor of physics at Frankfurt am Main in 1919. During this period, he became an expert on the physics of crystals. Following a meeting with Fritz Haber, who developed the Haber process for the synthesis of ammonia, Born became aware that little was known about the calculation of chemical energies. Haber encouraged Born to apply his work on the lattice energies of crystals (the energy given out when gaseous ions are brought together to form a solid crystal lattice) to the formation of alkali metal chlorides. Born was able to determine the energies involved in lattice formation, from which the properties of crystals may be derived, and thus laid one of the foundations of solid-state physics.
In 1921, Born moved from Frankfurt to the more prestigious university at Göttingen, again as professor. Most of his research was then concerned with quantum mechanics, in particular with the electronic structure of atoms. He made Göttingen a leading centre for theoretical physics and together with his students and collaborators - notably Werner Heisenberg - he devised a system called matrix mechanics that accounted mathematically for the position of the electron in the atom. He also devised a technique, called the Born approximation method, for computing the behaviour of subatomic particles that is of great use in high-energy physics.
In 1933, with the rise to power of Adolf Hitler, Born left Germany for Cambridge, England, and in 1936 he became professor of natural philosophy at Edinburgh University. He became a British citizen in 1939, and remained at Edinburgh until 1953, when he retired to Germany. The following year, Born received his Nobel Prize which, somewhat ironically, was for his discovery published in 1926 that the wave function of an electron is linked to the probability that the electron is to be found at any point. Born died at Göttingen on 5 January 1970.
Born was inspired by Niels Bohr to seek a mathematical explanation for Bohr's discovery that the quantum theory applies to the behaviour of electrons in atoms. In 1924 Born coined the term ‘quantum mechanics’ and the following year built on conceptual work by Werner Heisenberg to relate the position and momentum of the electron in a system called matrix mechanics. Wolfgang Pauli immediately used the system to calculate the hydrogen spectrum and the results were correct. But about a year after this discovery, in 1926, Erwin Schrödinger expressed the same theory in terms of wave mechanics, which was not only more acceptable mathematically but enabled physicists to visualize the position of the electron as a wave motion around the nucleus, unlike Born's purely mathematical treatment. Born, however, was able to use wave mechanics to make a statistical interpretation of the quantum theory and expressed the probability that an electron will be found at a particular point as the square of the value of the amplitude of the wave at that point. This was the discovery for which he was belatedly awarded a Nobel Prize.
Artigos Relacionados ao Credo
German, b: 11 December 1882, Breslau, Poland. d: 5 January 1970, Göttingen, Germany. Cat: Physicist; Philosopher of science. Ints: ...
Max Born was the son of a professor of anatomy at the University of Breslau and, following the death of his mother when he was...
He shared the 1954 Nobel Prize with W. Bothe for his work in statistical mechanics. Born and Heisenberg developed matrix... | <urn:uuid:fe7d6755-4ecb-46a4-af30-350e924e9544> | {
"date": "2019-07-20T23:44:20",
"dump": "CC-MAIN-2019-30",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-30/segments/1563195526714.15/warc/CC-MAIN-20190720214645-20190721000645-00456.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9709070324897766,
"score": 3.484375,
"token_count": 962,
"url": "https://search.credoreference.com/content/topic/born_max_1882_1970?locale=pt"
} |
Every year some British Columbians will be affected by unexpected events that may require them to leave their homes for a period of time. In some instances, they will come back to a substantial or total loss of their property.
The better prepared we are before disaster strikes, the faster we can recover with minimal financial loss. We all have a responsibility to ensure our own safety and resilience.
This online guide is brought to you by the insurance brokers of B.C. It provides tips that will help you prevent property loss where possible, and recover quickly when the unexpected happens. Assess your level of risk so that you can plan accordingly.
What portions of your home or furnishings would be affected by a water leak, sewer backup or overland flood? Learn steps you can take to reduce your risk.
Do you have working smoke detectors and an escape plan? If you live close to forest or grassland areas, be FireSmart.
B.C. has, on average, one earthquake per year of magnitude 6 or more – the same magnitude of the earthquake that devastated Christchurch, New Zealand, in 2011.
For the more than one million British Columbians who live in strata properties, resilience means working with neighbours to protect shared property.
Have an emergency plan, and supplies, so that you can survive in place or evacuate with the essentials you and your family will need. Engage your neighbours in developing a plan for your strata building or neighbourhood. | <urn:uuid:b3a96640-2c9b-4bb6-997d-c410b5da92ce> | {
"date": "2019-11-11T20:30:56",
"dump": "CC-MAIN-2019-47",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496664437.49/warc/CC-MAIN-20191111191704-20191111215704-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9357443451881409,
"score": 2.53125,
"token_count": 297,
"url": "https://www.bcbroker.ca/rebound/"
} |
A very interesting irony in the global agriculture sector today is that India will become the largest beef exporter globally in 2012. However, they do have the largest cowherd (and dairy herd) on earth. This discussion always brings a flurry of questions as perceptions of India’s strong vegetarianism and bovine religious views would project a very different story. In a limited amount of space here today, we hope to break it down in a clear way.
First of all, Brahman cattle are and remain sacred in the Hindu religion. These cattle are classified as Bos Indicus and are used for meat production in many other countries. In fact the famous Nelore cattle of Brazil originated from India. But India has more bovines as well. Water buffalo are abundant in India, are often referred to as Carabou (or Carabeef), and do not hold the religious stigma. They are used for dairy cattle and plow animals. These comprise the “new” beef export sector in India. Indians consume very small quantities of beef as the Hindu religion prohibits it. But while the Hindu’s comprise 80% of the population (970 million), there are also 161 Muslims (16%) that eat beef, although in smaller quantities than non-Indian Muslims. India’s overall beef consumption of about 9 lbs/capita (vs. 55 lbs/capita in the U.S.)
As global beef prices have surged higher, enterprising Indians have found great value in exporting beef from the water buffalo (dairy) sector. These exports are destined mainly to selected Southeast Asian countries and the Middle East. The beef is a very low quality and averaged US$1.26/lb thus far in 2012 versus U.S. exports at US$2.69/lb. Key Indian beef markets in order this year are (% of total): Vietnam (26%), Malaysia (10%), S. Arabia (8%), Egypt (7%) and Jordan (7%). India has endemic Foot-and-Mouth disease in cattle and is prohibited to most key U.S. markets including Canada, Mexico, Japan, S. Korea, Taiwan, H. Kong, and others. In fact the top 10 U.S. beef export markets include only two in common with India’s top ten markets: Vietnam and Eqypt. Only three top-10 markets are common between India and Brazil: Iran, S. Arabia, and Egypt.
Bottom Line: Global beef economics will drive further export growth. India’s gap as the largest beef exporter on earth will widen for years to come. India does not pose a direct threat to other key exporters, but will displace smaller volumes in lesser, lower-end markets around the globe. With developing countries driving global populations higher, there will likely be plenty of room for all key beef suppliers into the future. | <urn:uuid:5801d1d1-4d87-492e-bcb7-8e57f1c70085> | {
"date": "2019-12-08T23:43:47",
"dump": "CC-MAIN-2019-51",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540515344.59/warc/CC-MAIN-20191208230118-20191209014118-00136.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9446991086006165,
"score": 2.625,
"token_count": 588,
"url": "https://www.globalagritrends.com/blogs/the_biggest_beef_exporter_on_earth"
} |
About Cancer Diseases
Cancer is when the cells start to grow out of control. The cancer cells keep on growing and making new cells. They crowd out normal cells. This causes problems in the part of the body where the cancer started. Cancer cells can also spread to other parts of the body. For instance, cancer cells in the lung can travel to the bones and grow there. When cancer cells spread, it’s called metastasis. When lung cancer spreads to the bones, it’s still called lung cancer. To doctors, the cancer cells in the bones look just like the ones from the lung. It’s not called bone cancer unless it started in the bones. Cancer can start any place in the body.
It starts when cells grow out of control and crowd out normal cells. This makes it hard for the body to work the way it should.Cancer can be treated very well for many people. In fact, more people than ever before lead full lives after cancer treatment.Radiation is also used to kill or slow the growth of cancer cells. It can be used alone or with surgery or chemo. Radiation treatment is like getting an x-ray. Sometimes it’s given by putting a “seed” inside the cancer to give off the radiation.If you’re having these feelings, you’re not alone.
Thoughts and beliefs like this are common for people with cancer. You need to know that cancer is not a punishment for your past actions. Try to not blame yourself or focus on looking for ways you might have prevented cancer. Cancer is not your fault, and there’s almost never a way to find out what caused it. Instead, focus on taking good care of yourself now.Tobaccoo use is the cause of about 22% of cancer deaths.Another 10% is due to obesity, poor deity, lack of physical activities and excessive drinking of alcohol. Other factors include certain infections, exposure to ionizing rediation and environmental pollutants.caused a particular cancer because the various causes do not have specific fingerprints.
Since everyone has a small chance of developing lung cancer as a result of air pollution or radiation. The cancer may have developed for one of those reasons.Cancer, also called malignancy, is an abnormal growth of cells. There are more than 100 types of cancer, including breast cancer, skin cancer, lung cancer, colon cancer, prostate cancer, and lymphoma. Symptoms vary depending on the type. Cancer treatment may include chemotherapy, radiation, and surgery. | <urn:uuid:e4930ffc-8bbd-4b91-b1c2-1b2559020da1> | {
"date": "2018-01-18T09:54:35",
"dump": "CC-MAIN-2018-05",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-05/segments/1516084887224.19/warc/CC-MAIN-20180118091548-20180118111548-00056.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9529479742050171,
"score": 3.390625,
"token_count": 521,
"url": "http://www.asiafm99.com/cancer-diseases.html"
} |
Civil War: Fort Sumter Photo Gallery and related media
Civil War: Fort Sumter
Bombardment of Fort Sumter
In April of 1861, the newly-developed Confederacy demanded the evacuation of the Federal Fort Sumter. When this demand was refused, the South's batteries opened fire, forcing a Union surrender.
Related Photo Galleries (8)
Civil War: Fort Sumter
Civil War: Fort Sumter(9 Photos)
Explore Fort Sumter, South Carolina, where the first shots of the Civil War were fired.
Civil War: Union Military Leaders
Civil War: Union Military Leaders(13 Photos)
View images of Union leaders from the Civil War, like Abraham Linoln and Ulysses S. Grant, and learn more about the roles they played in this bloody engagment.
Civil War: Antietam
Civil War: Antietam(12 Photos)
Explore the Battle of Antietam--one of the bloodiest of the Civil War-- through photographs of soldiers, the battlefield and monuments.
Civil War: Confederate Leaders
Civil War: Confederate Leaders(13 Photos)
View images of Confederate leaders from the Civil War, like Robert E Lee and Stonewall Jackson, and learn more about the roles they played protecting the southern states.
Civil War: Battles of Bull Run
Civil War: Battles of Bull Run(10 Photos)
Learn about the two battles of Bull Run through paintings and photographs of the participants, the battlefield and the surrounding areas.
Civil War: Gettysburg
Civil War: Gettysburg(12 Photos)
Explore the historic Civil War battle of Gettysburg through photographs of the battlefield, the soldiers, and the memorials.
American Revolution: Events and Battles
American Revolution: Events and Battles(12 Photos)
Explore Revolutionary battle sites such as Lexington, Concord and Yorktown, and learn how the events that took place there shaped the course of the war.
American Revolution: Key Military Figures
American Revolution: Key Military Figures(10 Photos)
View images of key military figures from the American Revolution, and learn what role they played in this war of independence.
Related Videos (10)
The AlamoVideo Clip (2:37)
Video Clip (2:37)
Find out why the battle of the Alamo still captures the imaginations of Americans after more than two centuries.
First Battle of Bull Run
First Battle of Bull RunVideo Clip (2:08)
Video Clip (2:08)
The first major land battle of the Civil War, near Manassas, Virginia is a decisive Confederate victory, ending hopes of a quick end to the conflict.
Last Stand of the Confederacy
Last Stand of the ConfederacyVideo Clip (3:21)
Video Clip (3:21)
In march of 1865, Confederate forces made a valiant last stand against General Sherman's advancing troops, but were undone by the most unlikely of errors
Battle of Fredericksburg
Battle of FredericksburgVideo Clip (2:26)
Video Clip (2:26)
General Burnside takes Fredericksburg but experiences a disastrous defeat when attacking Confederate forces entrenched in the high ground above the town.
The Battle of Gettysburg
The Battle of GettysburgVideo Clip (2:38)
Video Clip (2:38)
For three days in July 1863, Union and Confederate forces clash at Gettysburg in one of the most pivotal battles of the Civil War.
Eisenhower Leads America
Eisenhower Leads AmericaVideo Clip (3:21)
Video Clip (3:21)
This five-star general and 34th U.S. president launched the Space Race and created the federal interstate highway system.
The Last of the Sioux
The Last of the SiouxVideo Clip (3:48)
Video Clip (3:48)
Resistant to government regulated reservations, the Sioux retreated into the Black Hills until a final massacre at Wounded Knee.
Ask HISTORY: What does it mean to "draw a line in the sand"?
Ask HISTORY: What does it mean to "draw a line in the sand"?Video Clip (2:32)
Video Clip (2:32)
Where does this common expression come from? Get the full story.
Ask Steve: Tet Offensive
Ask Steve: Tet OffensiveVideo Clip (1:14)
Video Clip (1:14)
In this video from Ask Steve, the tet offensive is understood to be the turning point in the Vietnam War. After the shock of the North Vietnamese's attack on the South the tet offensive became a political disaster.
Attack on Pearl Harbor
Attack on Pearl HarborVideo Clip (1:50)
Video Clip (1:50)
On December 7, 1941, Japan launches a surprise attack on American soil at Pearl Harbor.
Related Speeches & Audio (10)
Franklin D. Roosevelt Delivers D-Day Prayer
Franklin D. Roosevelt Delivers D-Day PrayerAudio Clip (3:37)
Audio Clip (3:37)
In a national radio broadcast on June 6, 1944, as 160,000 Allied troops land in Normandy in an attempt to liberate France, President Franklin D. Roosevelt asks America to join him in a prayer.
General Howell Recounts Civil War Experience
General Howell Recounts Civil War ExperienceAudio Clip (6:29)
Audio Clip (6:29)
In a recorded interview in 1947, 101-year-old General Julius Howell recalls fighting as a Confederate soldier during the Civil War and the moment he heard about Lincoln’s assassination.
Franklin D. Roosevelt's War Progress Report
Franklin D. Roosevelt's War Progress ReportAudio Clip (0:57)
Audio Clip (0:57)
In his progress report on World War II on July 28, 1943, President Franklin D. Roosevelt informs the nation that "the first crack in the Axis has come" as Italian Premier Mussolini falls from power.
Franklin D. Roosevelt Reports on Teheran and Cairo Conferences
Franklin D. Roosevelt Reports on Teheran and Cairo ConferencesAudio Clip (2:36)
Audio Clip (2:36)
Following the 1943 Big Four meetings in Teheran and Cairo, President Franklin D. Roosevelt delivers a Christmas Eve broadcast promising the nation that they can look forward to peace, though at a high cost.
John F. Kennedy on Coup in South Vietnam
John F. Kennedy on Coup in South VietnamAudio Clip (6:06)
Audio Clip (6:06)
On October 29, 1963, President John F. Kennedy meets with the National Security Council to discuss whether to support the overthrow of South Vietnam's President Ngo Dinh Diem. During the secretly recorded conversation, Secretary of State Dean Rusk and the president craft a detailed plan involving Henry Cabot Lodge, ambassador to South Vietnam, Gen. Paul D. Harkins and the general of the South Vietnamese military, hoping to avoid setting off a civil war in the country.
Nixon on Vietnam War
Nixon on Vietnam WarAudio Clip (3:34)
Audio Clip (3:34)
On March 26, 1971, President Richard Nixon holds a meeting in the Oval Office with his National Security Council to discuss the war in Vietnam. The meeting is secretly recorded. Among the many topics he raises, Nixon recounts a prior conversation with House majority leader Hale Boggs on setting a date for the final withdrawal of U.S. forces.
Franklin D. Roosevelt on American Progress in World War II
Franklin D. Roosevelt on American Progress in World War IIAudio Clip (1:00)
Audio Clip (1:00)
With the United States now entered into World War II, President Franklin D. Roosevelt uses the occasion of Washington’s birthday to broadcast to the nation on February 23, 1942, an outline of America’s progress in the war.
LeMay and Kennedy Argue Over Cuban Missile Crisis
LeMay and Kennedy Argue Over Cuban Missile CrisisAudio Clip (1:42)
Audio Clip (1:42)
In a secretly recorded meeting on October 19, 1962, President John F. Kennedy discusses the Cuban missile crisis with his military advisors. After criticizing Kennedy’s call to blockade the island as too weak a response, Gen. Curtis LeMay, Air Force chief of staff, tells the president that his refusal to invade Cuba would encourage the Soviets to move on Berlin.
Reagan Speaks on 40th Anniversary of D-Day
Reagan Speaks on 40th Anniversary of D-DayAudio Clip (0:41)
Audio Clip (0:41)
On June 6, 1984, in Normandy, France, President Ronald Reagan honors the heroes of D-Day, a pivotal moment during World War II.
Allies Liberate Bastogne
Allies Liberate BastogneAudio Clip (1:27)
Audio Clip (1:27)
In a broadcast on December 29, 1944, Gen. Anthony C. McAuliffe recounts the 101st Airborne’s victory against overwhelming odds at Bastogne, Belgium.
Most Popular Videos on History.com
Keep up with the latest History shows, online features, special offers and more.Sign up | <urn:uuid:a2ebc85b-5c09-482e-a6ec-735a7ae4b7bf> | {
"date": "2014-07-23T20:35:03",
"dump": "CC-MAIN-2014-23",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1405997883466.67/warc/CC-MAIN-20140722025803-00152-ip-10-33-131-23.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.8586248159408569,
"score": 3.34375,
"token_count": 1916,
"url": "http://www.history.com/photos/civil-war-fort-sumter/photo2"
} |
Hanukkah Latkes: Increasing Our Dependence on Oil?
The fried potato pancakes called latkes are the traditional food of Hanukkah, the Jewish holiday which begins this year on the night of December 21. Explanations about the connection between the Eastern European potato pancakes and the commemoration of a battle against the ancient Assyrians generally involve a comparison of cooking oil and lamp fuel. An equally tenuous association between the triangular cookies called hamentashen and the tri-cornered hat of the biblical villain Haman are part of the Purim holiday tradition.
In 1946, Jewish intellectuals at the University of Chicago started what would become an annual event called the Great Latke-Hamantash Debate to explore the meanings of those two holiday foods. Over the years, topics have included historian Hanna Gray's assertion that "Renaissance humanism grew out of the revival of the latke" and Michael Silverstein's linguistic deconstruction--he pointed out that the English translation of the letters on the sides of the Hanukkah dreidl spell out T-U-M-S. Presenters have also included philosopher Martha Nussbaum and Nobel Prize winner Milton Friedman. At the Harvard debate in 2007, Lawyer Alan Dershowitz accused the fried latke of increasing U.S. dependence on oil.
Over the years, the absurdist event has replicated and spread to numerous campuses including Harvard, Princeton and M.I.T. The latke debates follow in a long tradition of Jewish humor mimicking Talmudic study. In 2005, a book titled The Great Latke-Hamantash Debate which includes a compendium of debate topics was published by the University of Chicago Press.
At this year's 62nd Annual Latke-Hamantash Debate at the University of Chicago, it was noted that the round shape of the latke resembled the letter "O" and could therefore be associated with Barack Obama and a new spirit of diversity. Bumper stickers mimicking Obama's campaign graphics were handed out to attendees promising "Potatoes for Change: Latkes '08."
Julia's Crispy Latkes
Here's Julia Walsh's recipe for basic crispy latkes. If you're more ambitious, you can find recipes for butternut squash latkes and all sorts of gourmet latkes in the December Bon Appetit.
2 large russet potatoes, washed
1 large onion, peeled
1 egg, lightly beaten
Eighth of a cup flour
2 teaspoons kosher salt
Pepper to taste
Shred the potatoes and then pour them into a mixing bowl. Shred the onion, making sure to drain excess liquid before adding to the potatoes in the bowl. Add the egg, flour, salt and pepper and mix well.
Pour oil into a frying pan to the depth of one inch and heat on medium high heat. The oil is hot enough when a small shred of potato bubbles loudly. Take a handful of potato mixture and squeeze out excess moisture, then form it into a patty. Drop into the hot oil and flatten with a metal spatula. Cook for about 7-10 minutes on each side, or until it reaches the preferred shade of brown. Serve hot. Traditional toppings are sour cream and applesauce, but latkes are also excellent with meat and gravy.
Makes 6 to 8.
-- Robb Walsh
Photos by Julia Walsh | <urn:uuid:8cd410b1-c6fc-496d-8e80-1630ace7a7a4> | {
"date": "2015-04-19T14:25:51",
"dump": "CC-MAIN-2015-18",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246639121.73/warc/CC-MAIN-20150417045719-00103-ip-10-235-10-82.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9337821006774902,
"score": 2.71875,
"token_count": 699,
"url": "http://blogs.houstonpress.com/eating/2008/12/hanukkah_latkes_increasing_our.php"
} |
Dr. Charles Alexander Eastman (Sioux: Ohiyesa, February 19, 1858 - January 8, 1939) was a Native American author, physician and reformer. He was active in politics and helped found the Boy Scouts of America.
Ohiyesa was born on a reservation near Redwood Falls, Minnesota. He was the son of the Dakota Many Lightnings and his mixed-blood wife, Mary Nancy Eastman, who died at his birth. Mary Eastman was the daughter of the painter Captain Seth Eastman. During the Minnesota Uprising of Dakota in 1862-63, Ohiyesa was cared for by paternal relatives who fled into North Dakota and Manitoba. When he was later reunited with his father, now using the name Jacob Eastman, and older brother John, the Eastman family established a homestead in Dakota Territory.
With his father's encouragement, Eastman attended mission and preparatory schools and graduated from Dartmouth College in 1886. He graduated from Boston University, with a medical degree, in 1889. Eastman worked as agency physician for the Indian Health Service on the Pine Ridge Reservation, and later at the Crow Creek Reservation, both in South Dakota. He also established a private medical practice. Between 1894-97, Eastman established 32 Indian groups of the Young Men's Christian Association (YMCA). In 1899, he helped recruit students for the Carlisle Indian School in Pennsylvania. In 1910, along with Ernest Thompson Seton of the Woodcraft Indians and Daniel Carter Beard of the Sons of Daniel Boone, Eastman helped found the Boy Scouts of America.
Eastman was active in politics, particularly in matters dealing with Indian rights. He served as a lobbyist for the Dakota between 1894 and 1897. In 1903, President Theodore Roosevelt assigned Eastman the responsibility for revising the allotment method of dividing tribal lands. In 1923-25, Eastman served under Calvin Coolidge as an Indian inspector. He was also a member of the Committee of One Hundred, a reform panel examining federal institutions and activities dealing with Indian nations. In 1925, the Bureau of Indian Affairs asked him to investigate the death and burial location of Sacagawea, the woman who accompanied the Lewis and Clark Expedition in 1805. He determined that she died of old age at the Wind River Indian Reservation in Wyoming on April 9, 1884, although later historians believe it more likely that she died as a result of an illness in 1812.
Eastman was the recipient of the first Indian Achievement Award in 1933.
Eastman was married to Elaine Goodale, and had six children. Goodale briefly served as superintendent of Indian education in the Dakota Territory, and was a well known poet.
Eastman published the autobiographical Indian Boyhood in 1902, recounting his first fifteen years of life among the Sioux during the waning years of the nineteenth century. He also wrote The Soul of the Indian (1911) and From the Deep Woods to Civilization (1916).
- List of writers from peoples indigenous to the Americas
- Native American Studies
This article might use material from a Wikipedia article, which is released under the Creative Commons Attribution-Share-Alike License 3.0.
* Notice to all users: You can export our search engine to your blog, website, facebook or my space. | <urn:uuid:fd5612a8-78d3-4ce2-a5fd-82dbcbd810ea> | {
"date": "2018-03-17T22:20:54",
"dump": "CC-MAIN-2018-13",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257645362.1/warc/CC-MAIN-20180317214032-20180317234032-00656.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9743279814720154,
"score": 2.84375,
"token_count": 675,
"url": "http://www.bookyards.com/en/author/page/432/Charles%20A.%20Eastman"
} |
A handout image released by the European Southern Observatory shows a cluster of stars known as Messier 15 snapped by Hubble Space Telescope. This cluster, located some 35,000 light-years away in the constellation of Pegasus, is one of the oldest globular clusters known, with an age of around 12 billion years. / European Southern Observatory, AFP/Getty Images
Let others pursue the fattest grouse or the most massive buck. A new breed of 21st-century hunters is on the chase, their weapon the most advanced telescopes, their prey bigger than the solar system.
For the past few years, scientists have been engaged in a fierce competition to bag the most distant galaxies in the cosmos, galaxies that existed less than a billion years after the Big Bang, the colossal explosion that founded the universe. Records have been set, broken and broken again, while astrophysicists joust over which early galaxies are real and which are embarrassing errors.
The contest is more than a "fast and furious race," as one scientific paper called it. The quest for the farthest galaxies has shed light on the evolution of the young universe but now researchers hope to pinpoint the onset of "cosmic dawn," when starlight from newborn galaxies first bathed the universe.
"The Holy Grail right now is to find that moment and to find the very earliest galaxies," says astrophysicist Richard Ellis of Caltech. "We've been pushing the frontiers further and further back."
Snaring a distant galaxy is a lot harder than netting the most elusive fish. The farthest galaxies are, to human eyes, "literally invisible," says the University of Texas-Austin astrophysicist Steven Finkelstein, whose team holds one distance record. He explains that when light from far-off galaxies travels to telescopes in our neck of the cosmic woods, any visible light is transformed along the way into a light "redder than our eyes can see," though it's visible to the right kind of cameras and telescopes.
Such "redshifted" light spends billions of years journeying to the vicinity of Earth. The information encoded in the light gives scientists a picture of galaxies as they were billions of years ago - essentially the baby pictures of the universe. The farther away the galaxy, the further back in time we see.
"Telescopes are time machines (that) let us peer back into the past," says astrophysicist Garth Illingworth of the University of California-Santa Cruz, via e-mail. "The light from distant objects takes so long to reach us that we see them when they were much younger."
For years, scientists could peer back no further than roughly 12 billion years ago, when the universe was about 780 million years old. Finally, in 2009, astronauts fitted the Hubble Space Telescope with a new camera, called Wide Field Camera 3, that revolutionized the galaxy-hunting business. Wide Field 3 is far more efficient than its predecessor on the Hubble, and it can see very red light, just the right color for detecting the most distant galaxies.
When Wide Field 3 produced its first batch of data in 2009, competing groups of scientists pounced on it and quickly found dozens of galaxies much deeper in time than seen before.
Researchers have serious scientific objectives in seeking out distant objects, but there's also "the thrill of the chase," agrees Illingworth in an interview. "We do love getting the highest redshift one" - meaning the farthest galaxy - but "you're lucky if the record lasts for six months. Then you've got to go back and do it again."
"There has to be a scientific reason for doing it. Otherwise it's just a stunt," astronomer Mark Dickinson of the Tucson-based National Optical Astronomy Observatory says of hunting distant galaxies. But "there's the horse-race aspect of it, and that's good fun."
Researchers have discovered roughly 200 galaxies that were in existence less than 780 million years after the Big Bang, according to research by Illingworth and his colleagues. Along the way, researchers have relentlessly pushed back toward the beginning of it all. At first, the farthest galaxies detected were at 650 million years since the Big Bang, then only 500 million years, and now even 450 million years or less, though those figures are the subject of debate.
The problem is that the competition, and the difficulty of trying to identify star clusters billions of miles away, can lead to mistakes.
"There are plenty of cautionary tales out there about distant galaxies that have proven to be wrong," Finkelstein says. There's the galaxy reported, to great fanfare, at roughly 600 million years after the Big Bang, a date since proven wrong. Or the record-holder estimated at a mere 380 million years, which scientists refer to as having a "redshift" of 11 or 12, that new research shows may actually be at just under 3,300 million years after the Big Bang.
"The jury may still be out" on that one, says Arizona State University astrophysicist James Rhoads, "but to be honest, I'm putting a case of beer against redshift 11."
While debate continues on the record-holder, everyone can agree that the distant galaxies amassed so far have helped illuminate the childhood of the universe. For example, scientists now believe that the hydrogen fog that permeated the early universe was cleared by the starlight from "huge numbers of really rather faint, small galaxies," not a few ultra-large galaxies, Illingworth says. "This was somewhat unexpected." He describes the galaxies at that time as close-packed, perhaps colliding with one another to trigger bursts of star formation.
"If one were back there, it would be a very different sight looking out into the night sky," he says. "You'd see small, bright, blue clumps all over the place."
Though there's still much to learn, Hubble can't help much more. It has looked about as far back as it can possibly see, and now researchers are waiting eagerly for the opening of an array of new ground-based telescopes and for the 2018 launch of NASA's James Webb Space Telescope, which should allow researchers to detect galaxies not long after the Big Bang.
"We won't be satisfied until we get there," Ellis says. "We need to go just that little bit further back, and we're very close."
Copyright 2015 USATODAY.com
Read the original story: Scientists close in on finding most far-out galaxies | <urn:uuid:b4567e62-0449-43f0-9069-bcd8ba038d9e> | {
"date": "2015-11-25T09:26:49",
"dump": "CC-MAIN-2015-48",
"file_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-48/segments/1448398445033.85/warc/CC-MAIN-20151124205405-00271-ip-10-71-132-137.ec2.internal.warc.gz",
"int_score": 3,
"language": "en",
"language_score": 0.9598506093025208,
"score": 3.34375,
"token_count": 1334,
"url": "http://archive.floridatoday.com/usatoday/article/3466709?odyssey=mod_sectionstories&from=global"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.