Unnamed: 0
int64 0
350k
| ApplicationNumber
int64 9.75M
96.1M
| ArtUnit
int64 1.6k
3.99k
| Abstract
stringlengths 7
8.37k
| Claims
stringlengths 3
292k
| abstract-claims
stringlengths 68
293k
| TechCenter
int64 1.6k
3.9k
|
|---|---|---|---|---|---|---|
348,600 | 16,806,088 | 2,852 | An axial ventilator has multiple fan wheel blades (2) arranged around an axis of rotation (RA) in a blade ring. At least one of the fan wheel blades (2) has an inner section (3) located on the radial inside. A blade edge section (4) directly adjoins the inner section (3) and borders a blade edge (5). The at least one fan wheel blade (2) has a local projection (6) over a radial extension of the blade edge section (4). The local projection (6) is formed as an extension of the chord length of the fan wheel blade. The projection locally enlarges the fan wheel blade (2) in the blade edge section (4). An average angle of attack (α) of the fan wheel blade (2), in relation to a plane of rotation (RE), of the fan wheel (1), is larger than an average angle of attack (β) of the projection (6), in relation to the plane of rotation (RE). | 1. An axial ventilator fan wheel with multiple fan wheel blades arranged around an axis of rotation in a blade ring, at least one of the fan wheel blades comprises:
an inner section located on the radial inside and a blade edge section directly adjoining the inner section and bordering a blade edge; the at least one fan wheel blade comprises a local projection over a radial extension of the blade edge section, the projection is formed in extension of a chord length of the fan wheel blade and locally enlarges the fan wheel blade in the blade edge section; and an average angle of attack (α) of the fan wheel blade, in relation to a plane of rotation of the fan wheel, is larger than an average angle of attack (β) of the projection, in relation to the plane of rotation (RE). 2. The fan wheel according to claim 1, wherein the angle of attack (β) of the projection, in relation to the plane of rotation, has a value between 2-15°, in particular, between 4-10°. 3. The fan wheel according to claim 1, wherein the fan wheel blades end freely and are free of connections at the respective radial blade edges. 4. The fan wheel according to claim 1, wherein the blade edge section, adjoining the blade edge, of the at least one fan wheel blade is defined in an outer region of the fan wheel blade, such that 0.7≤LS/LD≤1, in particular 0.85≤LS/LD≤0.95 applies, and LD is a maximum radius of the fan wheel blade and LS is a radius of the fan wheel blade up to the blade edge section. 5. The fan wheel according to claim 1, wherein a chord length of the fan wheel blade is locally enlarged in relation to the inner section by the projection in a direction perpendicular to the axis of rotation, such that 1.05≤L1/L2≤1.4, in particular 1.1≤L1/L2≤1.3 applies, and L1 is a maximum chord length of the fan wheel blade in the blade edge section and L2 is a chord length of the fan wheel blade at the border between the inner section and the blade edge section. 6. The fan wheel according to claim 1, wherein the at least one fan wheel blade comprises a blade front edge and a blade rear edge, and the projection is formed on the blade front edge. 7. The fan wheel according to claim 6, wherein the blade rear edge has a convexly rounded, arc-shaped profile. 8. The fan wheel according to claim 1, wherein the projection is formed in one piece with the fan wheel blade. 9. The fan wheel according to claim 1, wherein the projection comprises a tip pointing in the circumferential direction, the tip is spaced apart radially inward in relation to a maximum outer radius of the fan wheel blade. 10. The fan wheel according to claim 9, wherein the tip is offset radially outward off-center in the blade edge section. 11. The fan wheel according to claim 9, wherein the tip is rounded. 12. The fan wheel according to claim 1, wherein the fan wheel blades each comprise a winglet on the radial outer blade edge. 13. The fan wheel according to claim 6, wherein the fan wheel blades have a greater average blade thickness in the region of the projection than in the remaining region of the fan wheel blade. 14. The fan wheel according to claim 1, wherein the fan wheel blade comprise a radial center section around a radial center of the respective fan wheel blade and the fan wheel blade has a maximum chord length in the center region. 15. The fan wheel according to claim 1, wherein all fan wheel blades of the fan wheel are formed identically. 16. An axial ventilator comprising a fan wheel according to claim 1. | An axial ventilator has multiple fan wheel blades (2) arranged around an axis of rotation (RA) in a blade ring. At least one of the fan wheel blades (2) has an inner section (3) located on the radial inside. A blade edge section (4) directly adjoins the inner section (3) and borders a blade edge (5). The at least one fan wheel blade (2) has a local projection (6) over a radial extension of the blade edge section (4). The local projection (6) is formed as an extension of the chord length of the fan wheel blade. The projection locally enlarges the fan wheel blade (2) in the blade edge section (4). An average angle of attack (α) of the fan wheel blade (2), in relation to a plane of rotation (RE), of the fan wheel (1), is larger than an average angle of attack (β) of the projection (6), in relation to the plane of rotation (RE).1. An axial ventilator fan wheel with multiple fan wheel blades arranged around an axis of rotation in a blade ring, at least one of the fan wheel blades comprises:
an inner section located on the radial inside and a blade edge section directly adjoining the inner section and bordering a blade edge; the at least one fan wheel blade comprises a local projection over a radial extension of the blade edge section, the projection is formed in extension of a chord length of the fan wheel blade and locally enlarges the fan wheel blade in the blade edge section; and an average angle of attack (α) of the fan wheel blade, in relation to a plane of rotation of the fan wheel, is larger than an average angle of attack (β) of the projection, in relation to the plane of rotation (RE). 2. The fan wheel according to claim 1, wherein the angle of attack (β) of the projection, in relation to the plane of rotation, has a value between 2-15°, in particular, between 4-10°. 3. The fan wheel according to claim 1, wherein the fan wheel blades end freely and are free of connections at the respective radial blade edges. 4. The fan wheel according to claim 1, wherein the blade edge section, adjoining the blade edge, of the at least one fan wheel blade is defined in an outer region of the fan wheel blade, such that 0.7≤LS/LD≤1, in particular 0.85≤LS/LD≤0.95 applies, and LD is a maximum radius of the fan wheel blade and LS is a radius of the fan wheel blade up to the blade edge section. 5. The fan wheel according to claim 1, wherein a chord length of the fan wheel blade is locally enlarged in relation to the inner section by the projection in a direction perpendicular to the axis of rotation, such that 1.05≤L1/L2≤1.4, in particular 1.1≤L1/L2≤1.3 applies, and L1 is a maximum chord length of the fan wheel blade in the blade edge section and L2 is a chord length of the fan wheel blade at the border between the inner section and the blade edge section. 6. The fan wheel according to claim 1, wherein the at least one fan wheel blade comprises a blade front edge and a blade rear edge, and the projection is formed on the blade front edge. 7. The fan wheel according to claim 6, wherein the blade rear edge has a convexly rounded, arc-shaped profile. 8. The fan wheel according to claim 1, wherein the projection is formed in one piece with the fan wheel blade. 9. The fan wheel according to claim 1, wherein the projection comprises a tip pointing in the circumferential direction, the tip is spaced apart radially inward in relation to a maximum outer radius of the fan wheel blade. 10. The fan wheel according to claim 9, wherein the tip is offset radially outward off-center in the blade edge section. 11. The fan wheel according to claim 9, wherein the tip is rounded. 12. The fan wheel according to claim 1, wherein the fan wheel blades each comprise a winglet on the radial outer blade edge. 13. The fan wheel according to claim 6, wherein the fan wheel blades have a greater average blade thickness in the region of the projection than in the remaining region of the fan wheel blade. 14. The fan wheel according to claim 1, wherein the fan wheel blade comprise a radial center section around a radial center of the respective fan wheel blade and the fan wheel blade has a maximum chord length in the center region. 15. The fan wheel according to claim 1, wherein all fan wheel blades of the fan wheel are formed identically. 16. An axial ventilator comprising a fan wheel according to claim 1. | 2,800 |
348,601 | 16,806,080 | 2,852 | A method and a system for producing a change in a medium. The method places in a vicinity of the medium an energy modulation agent. The method applies an initiation energy to the medium. The initiation energy interacts with the energy modulation agent to directly or indirectly produce the change in the medium. The energy modulation agent has a normal predominant emission of radiation in a first wavelength range outside of a second wavelength range (WR2) known to produce the change, but under exposure to the applied initiation energy produces the change. The system includes an initiation energy source configured to apply an initiation energy to the medium to activate the energy modulation agent. | 1. A method for producing a change in a medium or body, comprising:
(1) placing in a vicinity of the medium or body at least one energy modulation agent configured to emit radiation into the medium or body upon interaction with an initiation energy; and (2) applying the initiation energy from an energy source to the medium or body, wherein the applied initiation energy interacts with the energy modulation agent to directly or indirectly produce the change in the medium or body by said emitted radiation, and wherein said energy modulation agent has a normal predominant emission of radiation in a first wavelength range (WR1) outside of a second wavelength range (WR2) known to produce said change, but under exposure to said applied initiation energy produces said change. | A method and a system for producing a change in a medium. The method places in a vicinity of the medium an energy modulation agent. The method applies an initiation energy to the medium. The initiation energy interacts with the energy modulation agent to directly or indirectly produce the change in the medium. The energy modulation agent has a normal predominant emission of radiation in a first wavelength range outside of a second wavelength range (WR2) known to produce the change, but under exposure to the applied initiation energy produces the change. The system includes an initiation energy source configured to apply an initiation energy to the medium to activate the energy modulation agent.1. A method for producing a change in a medium or body, comprising:
(1) placing in a vicinity of the medium or body at least one energy modulation agent configured to emit radiation into the medium or body upon interaction with an initiation energy; and (2) applying the initiation energy from an energy source to the medium or body, wherein the applied initiation energy interacts with the energy modulation agent to directly or indirectly produce the change in the medium or body by said emitted radiation, and wherein said energy modulation agent has a normal predominant emission of radiation in a first wavelength range (WR1) outside of a second wavelength range (WR2) known to produce said change, but under exposure to said applied initiation energy produces said change. | 2,800 |
348,602 | 16,806,101 | 2,852 | The present invention relates to a microscope of which visibility, controllability and operability can be improved. In the microscope, an optical path and optical path of an image forming system are set so as to be perpendicular to each other when viewed from the top. In other words, in this microscope, there exists an ocular optical system that guides light, which propagates the optical path to optical path of the image forming system, to a user. The optical path is formed in a direction perpendicular to a direction of the light from a sample emitted from the ocular optical system to the user. The present invention can be applied to an inverted microscope. | 1. A microscope comprising:
a first optical path that extends in a first direction and guides an illumination light from a light source to a second optical path, the second optical path that extends in a second direction and guides the illumination light from the first optical path to a third optical path, the third optical path that extends in a third direction and guides the illumination light from the second optical path to a sample, a fourth optical path that extends in the third direction and guides an observation light from the sample to a fifth optical path, the fifth optical path that extends in the second direction and guides the observation light from the fourth optical path to a sixth optical path, and the sixth optical path that extends in the third direction and guides the observation light from the fifth optical path to a seventh optical path, wherein a travel direction of the illumination light on the second optical path is opposite to that of the observation light on the fifth optical path, a travel direction of the illumination light on the third optical path is opposite to that of the observation light on the fourth optical path, when the microscope is viewed in a direction from a front part to a back part by a user of the microscope, which is an orthogonal direction to the second direction, the second direction is a left to right or right to left direction, and the seventh optical path guides the observation light from the sixth optical path to an ocular in the front part of the microscope, and is directed to the user. | The present invention relates to a microscope of which visibility, controllability and operability can be improved. In the microscope, an optical path and optical path of an image forming system are set so as to be perpendicular to each other when viewed from the top. In other words, in this microscope, there exists an ocular optical system that guides light, which propagates the optical path to optical path of the image forming system, to a user. The optical path is formed in a direction perpendicular to a direction of the light from a sample emitted from the ocular optical system to the user. The present invention can be applied to an inverted microscope.1. A microscope comprising:
a first optical path that extends in a first direction and guides an illumination light from a light source to a second optical path, the second optical path that extends in a second direction and guides the illumination light from the first optical path to a third optical path, the third optical path that extends in a third direction and guides the illumination light from the second optical path to a sample, a fourth optical path that extends in the third direction and guides an observation light from the sample to a fifth optical path, the fifth optical path that extends in the second direction and guides the observation light from the fourth optical path to a sixth optical path, and the sixth optical path that extends in the third direction and guides the observation light from the fifth optical path to a seventh optical path, wherein a travel direction of the illumination light on the second optical path is opposite to that of the observation light on the fifth optical path, a travel direction of the illumination light on the third optical path is opposite to that of the observation light on the fourth optical path, when the microscope is viewed in a direction from a front part to a back part by a user of the microscope, which is an orthogonal direction to the second direction, the second direction is a left to right or right to left direction, and the seventh optical path guides the observation light from the sixth optical path to an ocular in the front part of the microscope, and is directed to the user. | 2,800 |
348,603 | 16,806,119 | 2,852 | The disclosed technology includes an on-demand water heater which uses an electric heat source to heat the water. The on-demand water heater can have a low fluid capacity heating chamber which has an inlet and an outlet, an electric heat source for heating the water, and a controller to control the electric heat source and maintain the temperature of the water at a predetermined temperature setting. The on-demand water heater can be powered by a direct current power source. The on-demand water heater can also utilize a solar thermal system to provide additional heat to the water. | 1. A direct current (DC) electric fluid heating system comprising:
a DC electric fluid heating device comprising:
a heating chamber having a fluid inlet and a fluid outlet, the heating chamber being configured to hold a fluid and having a low fluid capacity;
an electric heat source for heating the fluid;
a flow sensor configured to detect a fluid flow;
a temperature sensor configured to detect a fluid temperature; and
a controller configured to:
receive flow data from the flow sensor, the flow data indicative of the fluid flow;
receive temperature data from the temperature sensor, the temperature data indicative of the fluid temperature;
determine whether a heat output of the electric heat source should be adjusted based on at least two of the flow data, the temperature data, and a temperature setting; and
output instructions for modulating an amount of DC power supplied to the electric heat source from a DC power source in response to determining that the heat output of the electric heat source should be adjusted. 2. The DC electric fluid heating system of claim 1, wherein the DC electric fluid heating device is portable. 3. The DC electric fluid heating system of claim 1, wherein the low fluid capacity is no more than 5 gallons. 4. The DC electric fluid heating system of claim 1, wherein the low fluid capacity is no more than 2 gallons. 5. The DC electric fluid heating system of claim 1, wherein the DC power source comprises a photovoltaic energy system. 6. The DC electric fluid heating system of claim 1, wherein the DC power source comprises an energy storage device. 7. The DC electric fluid heating system of claim 6, wherein the energy storage device is a battery. 8. The DC electric fluid heating system of claim 1 further comprising a solar thermal fluid heating system in fluid communication with the DC electric fluid heating device, the solar thermal fluid heating system configured to receive solar energy, convert solar energy to supplemental heat, and transfer at least some of the supplemental heat to the fluid. 9. The DC electric fluid heating system of claim 8 further comprising a storage tank configured to store the fluid. 10. The DC electric fluid heating system of claim 9, wherein the DC electric fluid heating device is configured to receive fluid from the storage tank and provide heated fluid to the storage tank. 11. The DC electric fluid heating system of claim 1, wherein the controller is configured to monitor the flow data and the temperature data to determine a fluid usage pattern associated with fluid demanded from the DC electric fluid heating system. 12. The DC electric fluid heating system of claim 1 further comprising a proximity sensor located near a point of use that is in fluid communication with the DC electric heating device,
wherein the controller is configured to receive proximity data indicating a user is near the point of use, the controller configured to output instructions for increasing a heat output of the electric heat source based at least in part on the proximity data. 13. The DC electric fluid heating device of claim 1, wherein the electric heat source comprises a resistive heating element. 14. The DC electric fluid heating device of claim 1, wherein the electric heat source comprises a heat pump. 15. The DC electric fluid heating device of claim 1, wherein the DC electric fluid heating device is configured operate using power received directly from an alternating current power source. 16. A method for controlling a fluid heating system, the method comprising:
receiving flow data from a flow sensor, the flow data being indicative of a flow of a fluid in relation to a fluid heating system that is powered by a direct current (DC) power source; receiving temperature data from a temperature sensor, the temperature data being indicative of a temperature of the fluid; responsive to determining that the flow data indicates a positive flow, outputting instructions for an electric heat source to heat the fluid in a low fluid capacity heating chamber by modulating an amount of DC power supplied to the electric heat source from the DC power source; responsive to determining the temperature data indicates the temperature of the fluid should be adjusted, outputting instructions to modulate the amount of DC power supplied to the electric heat source to adjust a heat output of the electric heat source. 17. The method of claim 16 further comprising outputting instructions to transition between receiving DC power from the DC power source and receiving alternating current (AC) power from an AC power source. 18. The method of claim 16, wherein:
the fluid heating system is in fluid communication with a solar thermal system configured to preheat the fluid upstream of the fluid heating system, the temperature sensor is a first temperature sensor located upstream of the electric heat source and downstream of the solar thermal system, the temperature data is first temperature data that is indicative of the temperature of the fluid at a location of the first temperature sensor, and the method further comprises:
receiving second temperature data from a second temperature sensor, the second temperature data being indicative of a location of the second temperature sensor; and
outputting instructions for adjusting the amount of DC power supplied to the electric heat source based at least in part on the first temperature data, the second temperature data, and the temperature setting. 19. The method of claim 16, wherein:
the temperature sensor is a first temperature sensor of a plurality of temperature sensors, and the method further comprises:
receiving temperature data from each of the plurality of temperature sensors; and
outputting instructions for adjusting the amount of DC power supplied to the electric heat source, the instructions being based at least in part on the temperature data received from each of the plurality of temperature sensors. 20. A direct current (DC) electric fluid heating system comprising:
a low fluid capacity heating chamber; an electric heat source configured to receive DC power from a DC power source; a controller comprising:
one or more processors; and
memory having stored thereon instructions that, when executed by the one or more processors, directs the controller to:
receive flow data from a flow sensor, the flow data being indicative of a flow of a fluid in relation to the DC electric fluid heating system;
receive temperature data from a temperature sensor, the temperature data being indicative of a temperature of the fluid;
responsive to determining that the flow data indicates a positive flow, output instructions for an electric heat source to heat the fluid in a low fluid capacity heating chamber by modulating an amount of DC power supplied to the electric heat source from the DC power source; and
responsive to determining the temperature data indicates the temperature of the fluid should be adjusted, output instructions to modulate the amount of DC power supplied to the electric heat source to adjust a heat output of the electric heat source. | The disclosed technology includes an on-demand water heater which uses an electric heat source to heat the water. The on-demand water heater can have a low fluid capacity heating chamber which has an inlet and an outlet, an electric heat source for heating the water, and a controller to control the electric heat source and maintain the temperature of the water at a predetermined temperature setting. The on-demand water heater can be powered by a direct current power source. The on-demand water heater can also utilize a solar thermal system to provide additional heat to the water.1. A direct current (DC) electric fluid heating system comprising:
a DC electric fluid heating device comprising:
a heating chamber having a fluid inlet and a fluid outlet, the heating chamber being configured to hold a fluid and having a low fluid capacity;
an electric heat source for heating the fluid;
a flow sensor configured to detect a fluid flow;
a temperature sensor configured to detect a fluid temperature; and
a controller configured to:
receive flow data from the flow sensor, the flow data indicative of the fluid flow;
receive temperature data from the temperature sensor, the temperature data indicative of the fluid temperature;
determine whether a heat output of the electric heat source should be adjusted based on at least two of the flow data, the temperature data, and a temperature setting; and
output instructions for modulating an amount of DC power supplied to the electric heat source from a DC power source in response to determining that the heat output of the electric heat source should be adjusted. 2. The DC electric fluid heating system of claim 1, wherein the DC electric fluid heating device is portable. 3. The DC electric fluid heating system of claim 1, wherein the low fluid capacity is no more than 5 gallons. 4. The DC electric fluid heating system of claim 1, wherein the low fluid capacity is no more than 2 gallons. 5. The DC electric fluid heating system of claim 1, wherein the DC power source comprises a photovoltaic energy system. 6. The DC electric fluid heating system of claim 1, wherein the DC power source comprises an energy storage device. 7. The DC electric fluid heating system of claim 6, wherein the energy storage device is a battery. 8. The DC electric fluid heating system of claim 1 further comprising a solar thermal fluid heating system in fluid communication with the DC electric fluid heating device, the solar thermal fluid heating system configured to receive solar energy, convert solar energy to supplemental heat, and transfer at least some of the supplemental heat to the fluid. 9. The DC electric fluid heating system of claim 8 further comprising a storage tank configured to store the fluid. 10. The DC electric fluid heating system of claim 9, wherein the DC electric fluid heating device is configured to receive fluid from the storage tank and provide heated fluid to the storage tank. 11. The DC electric fluid heating system of claim 1, wherein the controller is configured to monitor the flow data and the temperature data to determine a fluid usage pattern associated with fluid demanded from the DC electric fluid heating system. 12. The DC electric fluid heating system of claim 1 further comprising a proximity sensor located near a point of use that is in fluid communication with the DC electric heating device,
wherein the controller is configured to receive proximity data indicating a user is near the point of use, the controller configured to output instructions for increasing a heat output of the electric heat source based at least in part on the proximity data. 13. The DC electric fluid heating device of claim 1, wherein the electric heat source comprises a resistive heating element. 14. The DC electric fluid heating device of claim 1, wherein the electric heat source comprises a heat pump. 15. The DC electric fluid heating device of claim 1, wherein the DC electric fluid heating device is configured operate using power received directly from an alternating current power source. 16. A method for controlling a fluid heating system, the method comprising:
receiving flow data from a flow sensor, the flow data being indicative of a flow of a fluid in relation to a fluid heating system that is powered by a direct current (DC) power source; receiving temperature data from a temperature sensor, the temperature data being indicative of a temperature of the fluid; responsive to determining that the flow data indicates a positive flow, outputting instructions for an electric heat source to heat the fluid in a low fluid capacity heating chamber by modulating an amount of DC power supplied to the electric heat source from the DC power source; responsive to determining the temperature data indicates the temperature of the fluid should be adjusted, outputting instructions to modulate the amount of DC power supplied to the electric heat source to adjust a heat output of the electric heat source. 17. The method of claim 16 further comprising outputting instructions to transition between receiving DC power from the DC power source and receiving alternating current (AC) power from an AC power source. 18. The method of claim 16, wherein:
the fluid heating system is in fluid communication with a solar thermal system configured to preheat the fluid upstream of the fluid heating system, the temperature sensor is a first temperature sensor located upstream of the electric heat source and downstream of the solar thermal system, the temperature data is first temperature data that is indicative of the temperature of the fluid at a location of the first temperature sensor, and the method further comprises:
receiving second temperature data from a second temperature sensor, the second temperature data being indicative of a location of the second temperature sensor; and
outputting instructions for adjusting the amount of DC power supplied to the electric heat source based at least in part on the first temperature data, the second temperature data, and the temperature setting. 19. The method of claim 16, wherein:
the temperature sensor is a first temperature sensor of a plurality of temperature sensors, and the method further comprises:
receiving temperature data from each of the plurality of temperature sensors; and
outputting instructions for adjusting the amount of DC power supplied to the electric heat source, the instructions being based at least in part on the temperature data received from each of the plurality of temperature sensors. 20. A direct current (DC) electric fluid heating system comprising:
a low fluid capacity heating chamber; an electric heat source configured to receive DC power from a DC power source; a controller comprising:
one or more processors; and
memory having stored thereon instructions that, when executed by the one or more processors, directs the controller to:
receive flow data from a flow sensor, the flow data being indicative of a flow of a fluid in relation to the DC electric fluid heating system;
receive temperature data from a temperature sensor, the temperature data being indicative of a temperature of the fluid;
responsive to determining that the flow data indicates a positive flow, output instructions for an electric heat source to heat the fluid in a low fluid capacity heating chamber by modulating an amount of DC power supplied to the electric heat source from the DC power source; and
responsive to determining the temperature data indicates the temperature of the fluid should be adjusted, output instructions to modulate the amount of DC power supplied to the electric heat source to adjust a heat output of the electric heat source. | 2,800 |
348,604 | 16,806,106 | 3,752 | A delivery unit for dispensing adhesive having a housing, a melting apparatus arranged within the housing for melting the adhesive, a distributing device for dispensing molten adhesive in at least one line connectable to the distributing device, and a pump for conveying the molten adhesive through the distributing device, wherein the housing has a plurality of outer side faces, two of the outer side faces are of a flat configuration and arranged perpendicular to a support plane of the delivery unit on a base and substantially at a right angle to each other, and wherein the distributing device, in a region in which the line is connectable to a connector of the distributing device, has a boundary surface of a flat configuration. The two outer side faces are arranged at a distance apart with the boundary surface therebetween forming an obtuse angle with each of the two outer side faces. | 1. A delivery unit for dispensing adhesive, comprising a housing, a melting apparatus arranged within the housing for melting the adhesive, a distributing device for dispensing molten adhesive in at least one line connectable to the distributing device, and a pump for conveying the molten adhesive through the distributing device, wherein the housing has a plurality of outer side faces, wherein two of the outer side faces are of a flat configuration and are arranged perpendicular to a support plane of the delivery unit on a base and substantially at a right angle to each other, wherein the distributing device, in a region in which the line is connectable to a connector of the distributing device, has a boundary surface of flat configuration, wherein the two outer side faces are arranged at a distance apart and between the two outer side faces is arranged the boundary surface, which forms an obtuse angle with a respective one of the two outer side faces. 2. The delivery unit as claimed in claim 1, wherein the two outer side faces are arranged at an angle of 80-100° to each other. 3. The delivery unit as claimed in claim 1, wherein the boundary surface is arranged perpendicular to the support plane. 4. The delivery unit as claimed in claim 1, wherein the distributing device, in the region of the boundary surface, borders the housing in the region of the two outer side faces. 5. The delivery unit as claimed in claim 1, wherein the boundary surface is arranged at an angle of 125° to 145° to the respective one of the two outer side faces. 6. The delivery unit as claimed in claim 1, wherein the housing has a front side face, a rear side face, a right side face and a left side face, and wherein the rear side face and the right side face are arranged perpendicular to each other, the right side face and the left side face are arranged parallel to each other, and the front side face and the right side face are arranged perpendicular to each other. 7. The delivery unit as claimed in claim 6, wherein one of the two outer side faces is the right side face or the left side face, and the other of the two outer side faces is the rear side face. 8. The delivery unit as claimed in claim 1, wherein a longitudinal axis of the connector of the distributing device is arranged perpendicular to the boundary surface. 9. The delivery unit as claimed in claim 1, wherein the connector of the distributing device comprises a threaded hole in the distributing device. 10. The delivery unit as claimed in claim 1, wherein the connector of the distributing device comprises a plug-in connector protruding over the boundary surface for secured mounting of the line. 11. The delivery unit as claimed in claim 10, wherein a socket region, facing away from the boundary surface, of the plug-in connector, has a longitudinal axis, which is arranged perpendicular to the boundary surface or is arranged at an angle of 40° to 60° to the boundary surface. 12. The delivery unit as claimed in claim 1, wherein a plurality of plug-in connectors are provided that each protrude over the boundary surface and which, given identical angular arrangement with respect to the boundary surface, are identically oriented. 13. The delivery unit as claimed in claim 1, wherein the distributing device, in the region of the boundary surface, has a plurality of connectors, and wherein to the respective connector a corresponding line is connectable. 14. The delivery unit as claimed in claim 1, wherein the distributing device has, at an angle to the boundary surface, at least one further flat boundary surface, and wherein the distributing device has in the region of the further flat boundary surface one or more connectors, and wherein the boundary surface and the further flat boundary surface border one another. 15. The delivery unit as claimed in claim 14, wherein the further flat boundary surface is arranged at an acute angle to the support plane of 40° to 70°. 16. The delivery unit as claimed in claim 2, wherein the two outer side faces are arranged at an angle of 90° to each other. 17. The delivery unit as claimed in claim 5, wherein the boundary surface is arranged at an angle of 135° to the respective one of the two outer side faces. 18. The delivery unit as claimed in claim 11, wherein the longitudinal axis is arranged at an angle of 45° to the boundary surface. 19. The delivery unit as claimed in claim 14, wherein the boundary surface and the further flat boundary surface border one another. 20. The delivery unit as claimed in claim 15, wherein the further flat boundary surface is arranged at an acute angle to the support plane of 45°. | A delivery unit for dispensing adhesive having a housing, a melting apparatus arranged within the housing for melting the adhesive, a distributing device for dispensing molten adhesive in at least one line connectable to the distributing device, and a pump for conveying the molten adhesive through the distributing device, wherein the housing has a plurality of outer side faces, two of the outer side faces are of a flat configuration and arranged perpendicular to a support plane of the delivery unit on a base and substantially at a right angle to each other, and wherein the distributing device, in a region in which the line is connectable to a connector of the distributing device, has a boundary surface of a flat configuration. The two outer side faces are arranged at a distance apart with the boundary surface therebetween forming an obtuse angle with each of the two outer side faces.1. A delivery unit for dispensing adhesive, comprising a housing, a melting apparatus arranged within the housing for melting the adhesive, a distributing device for dispensing molten adhesive in at least one line connectable to the distributing device, and a pump for conveying the molten adhesive through the distributing device, wherein the housing has a plurality of outer side faces, wherein two of the outer side faces are of a flat configuration and are arranged perpendicular to a support plane of the delivery unit on a base and substantially at a right angle to each other, wherein the distributing device, in a region in which the line is connectable to a connector of the distributing device, has a boundary surface of flat configuration, wherein the two outer side faces are arranged at a distance apart and between the two outer side faces is arranged the boundary surface, which forms an obtuse angle with a respective one of the two outer side faces. 2. The delivery unit as claimed in claim 1, wherein the two outer side faces are arranged at an angle of 80-100° to each other. 3. The delivery unit as claimed in claim 1, wherein the boundary surface is arranged perpendicular to the support plane. 4. The delivery unit as claimed in claim 1, wherein the distributing device, in the region of the boundary surface, borders the housing in the region of the two outer side faces. 5. The delivery unit as claimed in claim 1, wherein the boundary surface is arranged at an angle of 125° to 145° to the respective one of the two outer side faces. 6. The delivery unit as claimed in claim 1, wherein the housing has a front side face, a rear side face, a right side face and a left side face, and wherein the rear side face and the right side face are arranged perpendicular to each other, the right side face and the left side face are arranged parallel to each other, and the front side face and the right side face are arranged perpendicular to each other. 7. The delivery unit as claimed in claim 6, wherein one of the two outer side faces is the right side face or the left side face, and the other of the two outer side faces is the rear side face. 8. The delivery unit as claimed in claim 1, wherein a longitudinal axis of the connector of the distributing device is arranged perpendicular to the boundary surface. 9. The delivery unit as claimed in claim 1, wherein the connector of the distributing device comprises a threaded hole in the distributing device. 10. The delivery unit as claimed in claim 1, wherein the connector of the distributing device comprises a plug-in connector protruding over the boundary surface for secured mounting of the line. 11. The delivery unit as claimed in claim 10, wherein a socket region, facing away from the boundary surface, of the plug-in connector, has a longitudinal axis, which is arranged perpendicular to the boundary surface or is arranged at an angle of 40° to 60° to the boundary surface. 12. The delivery unit as claimed in claim 1, wherein a plurality of plug-in connectors are provided that each protrude over the boundary surface and which, given identical angular arrangement with respect to the boundary surface, are identically oriented. 13. The delivery unit as claimed in claim 1, wherein the distributing device, in the region of the boundary surface, has a plurality of connectors, and wherein to the respective connector a corresponding line is connectable. 14. The delivery unit as claimed in claim 1, wherein the distributing device has, at an angle to the boundary surface, at least one further flat boundary surface, and wherein the distributing device has in the region of the further flat boundary surface one or more connectors, and wherein the boundary surface and the further flat boundary surface border one another. 15. The delivery unit as claimed in claim 14, wherein the further flat boundary surface is arranged at an acute angle to the support plane of 40° to 70°. 16. The delivery unit as claimed in claim 2, wherein the two outer side faces are arranged at an angle of 90° to each other. 17. The delivery unit as claimed in claim 5, wherein the boundary surface is arranged at an angle of 135° to the respective one of the two outer side faces. 18. The delivery unit as claimed in claim 11, wherein the longitudinal axis is arranged at an angle of 45° to the boundary surface. 19. The delivery unit as claimed in claim 14, wherein the boundary surface and the further flat boundary surface border one another. 20. The delivery unit as claimed in claim 15, wherein the further flat boundary surface is arranged at an acute angle to the support plane of 45°. | 3,700 |
348,605 | 16,806,079 | 3,752 | According to one embodiment, a semiconductor memory device includes a memory cell, a first voltage generator and a second voltage generator. The memory cell is provided above a substrate. The first voltage generator is provided between the substrate and the memory cell. The first voltage generator is configured to generate a first voltage to be supplied to the memory cell. The second voltage generator is provided between the substrate and the memory cell. The second voltage generator is configured to generate the first voltage and have a circuit configuration equivalent to the first voltage generator. | 1. A semiconductor memory device comprising:
a memory cell above a substrate; a first voltage generator between the substrate and the memory cell, the first voltage generator being configured to generate a first voltage to be supplied to the memory cell; and a second voltage generator between the substrate and the memory cell, the second voltage generator being configured to generate the first voltage and having a circuit configuration equivalent to the first voltage generator. 2. The semiconductor memory device according to claim 1, further comprising:
a word line electrically connected to a gate of the memory cell; a bit line electrically connected to an end of the memory cell; a first row logic control circuit between the substrate and the memory cell, the first row logic control circuit being configured to select the word line based on a row address and control a voltage to be supplied to the selected word line; a second row logic control circuit between the substrate and the memory cell, the second row logic control circuit having a circuit configuration equivalent to the first row logic control circuit; a first column logic control circuit between the substrate and the memory cell, the first column logic control circuit being configured to select the bit line based on a column address and control a voltage to be supplied to the selected bit line; and a second column logic control circuit between the substrate and the memory cell, the second column logic control circuit having a circuit configuration equivalent to the first column logic control circuit. 3. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators include one of a high voltage generator configured to generate a higher voltage than a power supply voltage supplied from outside and a low voltage generator configured to generate a lower voltage than the power supply voltage. 4. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators are provided in a first semiconductor chip, the memory cell is provided in a second semiconductor chip, and the first and second semiconductor chips each have a pad, and the pad of the first semiconductor chip and the pad of the second semiconductor chip are bonded together. 5. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators are arranged on a surface region of the substrate, and the memory cell is arranged above the first and second voltage generators. 6. The semiconductor memory device according to claim 1, wherein
when the first voltage generator is in an operating state, the second voltage generator is in a non-operating state, and when the second voltage generator is in an operating state, the first voltage generator is in a non-operating state. 7. The semiconductor memory device according to claim 6, comprising a plurality of memory cells including the memory cell, wherein which one of the first voltage generator and the second voltage generator is set to an operating state is selected based on information stored in the memory cells. 8. The semiconductor memory device according to claim 1, further comprising:
a plurality of first conductive layers stacked in a first direction above the substrate; and a pillar penetrating through the first conductive layers in the first direction, wherein the memory cell is at a portion where any one of the first conductive layers and the pillar intersect. 9. A semiconductor memory device comprising:
a memory cell above a substrate; a first circuit on a portion of the substrate between the substrate and the memory cell, the first circuit being configured to supply a voltage to the memory cell; a test pattern on a central side of the substrate from the first circuit and including a pad; and an insulating layer on the pad, wherein the pad is not electrically connected to an external terminal. 10. The semiconductor memory device according to claim 9, further comprising
at least one of an alignment mark used in a photolithography technique and a dimension measurement mark, the alignment mark and the dimension measurement mark being on a central side of the substrate from the first circuit. 11. The semiconductor memory device according to claim 9, further comprising:
a word line electrically connected to a gate of the memory cell; a bit line electrically connected to an end of the memory cell; a first row logic control circuit between the substrate and the memory cell, the first row logic control circuit being configured to select the word line based on a row address and control a voltage to be supplied to the selected word line; a second row logic control circuit between the substrate and the memory cell, the second row logic control circuit having a circuit configuration equivalent to the first row logic control circuit; a first column logic control circuit between the substrate and the memory cell, the first column logic control circuit being configured to select the bit line based on a column address and control a voltage to be supplied to the selected bit line; and a second column logic control circuit between the substrate and the memory cell, the second column logic control circuit having a circuit configuration equivalent to the first column logic control circuit. 12. The semiconductor memory device according to claim 9, further comprising:
a plurality of first conductive layers stacked in a first direction above the substrate; and a pillar penetrating through the first conductive layers in the first direction, wherein the memory cell is at a portion where any one of the first conductive layers and the pillar intersect. | According to one embodiment, a semiconductor memory device includes a memory cell, a first voltage generator and a second voltage generator. The memory cell is provided above a substrate. The first voltage generator is provided between the substrate and the memory cell. The first voltage generator is configured to generate a first voltage to be supplied to the memory cell. The second voltage generator is provided between the substrate and the memory cell. The second voltage generator is configured to generate the first voltage and have a circuit configuration equivalent to the first voltage generator.1. A semiconductor memory device comprising:
a memory cell above a substrate; a first voltage generator between the substrate and the memory cell, the first voltage generator being configured to generate a first voltage to be supplied to the memory cell; and a second voltage generator between the substrate and the memory cell, the second voltage generator being configured to generate the first voltage and having a circuit configuration equivalent to the first voltage generator. 2. The semiconductor memory device according to claim 1, further comprising:
a word line electrically connected to a gate of the memory cell; a bit line electrically connected to an end of the memory cell; a first row logic control circuit between the substrate and the memory cell, the first row logic control circuit being configured to select the word line based on a row address and control a voltage to be supplied to the selected word line; a second row logic control circuit between the substrate and the memory cell, the second row logic control circuit having a circuit configuration equivalent to the first row logic control circuit; a first column logic control circuit between the substrate and the memory cell, the first column logic control circuit being configured to select the bit line based on a column address and control a voltage to be supplied to the selected bit line; and a second column logic control circuit between the substrate and the memory cell, the second column logic control circuit having a circuit configuration equivalent to the first column logic control circuit. 3. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators include one of a high voltage generator configured to generate a higher voltage than a power supply voltage supplied from outside and a low voltage generator configured to generate a lower voltage than the power supply voltage. 4. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators are provided in a first semiconductor chip, the memory cell is provided in a second semiconductor chip, and the first and second semiconductor chips each have a pad, and the pad of the first semiconductor chip and the pad of the second semiconductor chip are bonded together. 5. The semiconductor memory device according to claim 1, wherein
the first and second voltage generators are arranged on a surface region of the substrate, and the memory cell is arranged above the first and second voltage generators. 6. The semiconductor memory device according to claim 1, wherein
when the first voltage generator is in an operating state, the second voltage generator is in a non-operating state, and when the second voltage generator is in an operating state, the first voltage generator is in a non-operating state. 7. The semiconductor memory device according to claim 6, comprising a plurality of memory cells including the memory cell, wherein which one of the first voltage generator and the second voltage generator is set to an operating state is selected based on information stored in the memory cells. 8. The semiconductor memory device according to claim 1, further comprising:
a plurality of first conductive layers stacked in a first direction above the substrate; and a pillar penetrating through the first conductive layers in the first direction, wherein the memory cell is at a portion where any one of the first conductive layers and the pillar intersect. 9. A semiconductor memory device comprising:
a memory cell above a substrate; a first circuit on a portion of the substrate between the substrate and the memory cell, the first circuit being configured to supply a voltage to the memory cell; a test pattern on a central side of the substrate from the first circuit and including a pad; and an insulating layer on the pad, wherein the pad is not electrically connected to an external terminal. 10. The semiconductor memory device according to claim 9, further comprising
at least one of an alignment mark used in a photolithography technique and a dimension measurement mark, the alignment mark and the dimension measurement mark being on a central side of the substrate from the first circuit. 11. The semiconductor memory device according to claim 9, further comprising:
a word line electrically connected to a gate of the memory cell; a bit line electrically connected to an end of the memory cell; a first row logic control circuit between the substrate and the memory cell, the first row logic control circuit being configured to select the word line based on a row address and control a voltage to be supplied to the selected word line; a second row logic control circuit between the substrate and the memory cell, the second row logic control circuit having a circuit configuration equivalent to the first row logic control circuit; a first column logic control circuit between the substrate and the memory cell, the first column logic control circuit being configured to select the bit line based on a column address and control a voltage to be supplied to the selected bit line; and a second column logic control circuit between the substrate and the memory cell, the second column logic control circuit having a circuit configuration equivalent to the first column logic control circuit. 12. The semiconductor memory device according to claim 9, further comprising:
a plurality of first conductive layers stacked in a first direction above the substrate; and a pillar penetrating through the first conductive layers in the first direction, wherein the memory cell is at a portion where any one of the first conductive layers and the pillar intersect. | 3,700 |
348,606 | 16,806,082 | 3,752 | A processor may receive a request for storage in a blockchain network. The request may include information as to a specific storage that is required. The processor may commit the request to the blockchain network. The processor may provide the request to one or more proposing entities. The processor may receive, from the one or more proposing entities, respective proposals in response to the request for storage. The processor may determine which of the respective proposals best match the information included in the request. The processor may automatically accept the best matched proposal. | 1. A method for smart cloud object storage management, the method comprising:
receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 2. The method of claim 1, further comprising:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 3. The method of claim 2, further comprising:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 4. The method of claim 3, further comprising:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 5. The method of claim 1, further comprising:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 6. The method of claim 1, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. 7. The method of claim 6, wherein the request further includes a size of storage needed and a number of replicas to be stored in the storage. 8. A system for smart cloud object storage management, the system comprising:
a memory; and a processor in communication with the memory, the processor being configured to perform operations comprising: receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 9. The system of claim 8, wherein the operations further comprise:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 10. The system of claim 9, wherein the operations further comprise:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 11. The system of claim 10, wherein the operations further comprise:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 12. The system of claim 8, wherein the operations further comprise:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 13. The system of claim 8, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. 14. The system of claim 13, wherein the request further includes a size of storage needed and a number of replicas to be stored in the storage. 15. A computer program product for smart cloud object storage management, the computer program product comprising a computer readable storage medium having program instructions embodied therewith, the program instructions executable by a processor to cause the processors to perform a function, the function comprising:
receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 16. The computer program product of claim 15, further comprising:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 17. The computer program product of claim 16, further comprising:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 18. The computer program product of claim 17, further comprising:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 19. The computer program product of claim 15, further comprising:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 20. The computer program product of claim 15, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. | A processor may receive a request for storage in a blockchain network. The request may include information as to a specific storage that is required. The processor may commit the request to the blockchain network. The processor may provide the request to one or more proposing entities. The processor may receive, from the one or more proposing entities, respective proposals in response to the request for storage. The processor may determine which of the respective proposals best match the information included in the request. The processor may automatically accept the best matched proposal.1. A method for smart cloud object storage management, the method comprising:
receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 2. The method of claim 1, further comprising:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 3. The method of claim 2, further comprising:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 4. The method of claim 3, further comprising:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 5. The method of claim 1, further comprising:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 6. The method of claim 1, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. 7. The method of claim 6, wherein the request further includes a size of storage needed and a number of replicas to be stored in the storage. 8. A system for smart cloud object storage management, the system comprising:
a memory; and a processor in communication with the memory, the processor being configured to perform operations comprising: receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 9. The system of claim 8, wherein the operations further comprise:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 10. The system of claim 9, wherein the operations further comprise:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 11. The system of claim 10, wherein the operations further comprise:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 12. The system of claim 8, wherein the operations further comprise:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 13. The system of claim 8, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. 14. The system of claim 13, wherein the request further includes a size of storage needed and a number of replicas to be stored in the storage. 15. A computer program product for smart cloud object storage management, the computer program product comprising a computer readable storage medium having program instructions embodied therewith, the program instructions executable by a processor to cause the processors to perform a function, the function comprising:
receiving, by a processor, a request for storage in a blockchain network, wherein the request includes information as to a specific storage that is required; committing the request to the blockchain network; providing the request to one or more proposing entities; receiving, from the one or more proposing entities, respective proposals in response to the request for storage; determining which of the respective proposals best match the information included in the request; and accepting, automatically, the best matched proposal. 16. The computer program product of claim 15, further comprising:
utilizing a natural language processing (NLP) technique to analyze the respective proposals; and comparing the analyzed respective proposals to the information included in the request. 17. The computer program product of claim 16, further comprising:
transitioning one or more nodes in the blockchain network into recommendation nodes, wherein the recommendation nodes incorporate the NLP technique; and communicating the recommendation nodes with one or more endorsing nodes in the blockchain network, wherein the one or more endorsing nodes utilize respective recommendations from the recommendation nodes to further assist in determining the best matched proposal. 18. The computer program product of claim 17, further comprising:
storing the best matched proposal in the blockchain network; identifying that a second request for storage in the blockchain network has been received; determining, utilizing the recommendation nodes, that the second request is within a threshold limit of the request; and accepting, automatically, the best matched proposal for the second request. 19. The computer program product of claim 15, further comprising:
adding the best matched proposal to the blockchain network; displaying the best matched proposal to each of the one or more proposing entities; and providing the one or more proposing entities with an option to adapt their respective proposals to the best matched proposal. 20. The computer program product of claim 15, wherein the request further includes a compliance requirement for storage, wherein the compliance requirement indicates one or more necessities for storage. | 3,700 |
348,607 | 16,806,114 | 3,633 | System for assisting in reducing the spread of fire between adjacent rooms in a building proximate to the ceiling thereof includes an elongated header track, at least one elongated filler constructed at least partially of compressible or elastic material and at least one fire-blocker constructed at least partially of fire retarding material. | 1. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling so that said at least one layer of fire-blocker is generally proximate the ceiling, wherein each said layer of filler in the system is sandwiched between two layers of fire-blocker. 2. The system of claim 1 wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 3. The system of claim 1 wherein each said layer of fire-blocker has an inner side closest to said header track when said layer of fire-blocker is positioned in at least one of said gaps and an outer side farthest from said header track when said layer of fire-blocker is positioned in at least one of said gaps. 4. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker occupy only part of at least one said gap. 5. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the ceiling. 6. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the upper end of at least one of the wall boards. 7. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are placed upon and not affixed to the upper end of at least one of the wall boards. 8. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be stuffed into at least one said gap and completely fill said at least one gap. 9. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling so that said at least one layer of fire-blocker is generally proximate the ceiling, wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, and wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 10. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface so that said at least one layer of filler is generally proximate the ceiling; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling, wherein each said layer of fire-blocker in the system is sandwiched between two layers of filler. 11. The system of claim 10 wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 12. The system of claim 10 wherein each said layer of filler has an inner side closest to said header track when said layer of filler is positioned in at least one of said gaps and an outer side farthest from said header track when said layer of filler is positioned in at least one of said gaps. 13. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker occupy only part of at least one said gap. 14. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the ceiling. 15. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the upper end of at least one of the wall boards. 16. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are placed upon and not affixed to the upper end of at least one of the wall boards. 17. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be stuffed into at least one said gap and completely fill said at least one gap. | System for assisting in reducing the spread of fire between adjacent rooms in a building proximate to the ceiling thereof includes an elongated header track, at least one elongated filler constructed at least partially of compressible or elastic material and at least one fire-blocker constructed at least partially of fire retarding material.1. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling so that said at least one layer of fire-blocker is generally proximate the ceiling, wherein each said layer of filler in the system is sandwiched between two layers of fire-blocker. 2. The system of claim 1 wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 3. The system of claim 1 wherein each said layer of fire-blocker has an inner side closest to said header track when said layer of fire-blocker is positioned in at least one of said gaps and an outer side farthest from said header track when said layer of fire-blocker is positioned in at least one of said gaps. 4. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker occupy only part of at least one said gap. 5. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the ceiling. 6. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the upper end of at least one of the wall boards. 7. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are placed upon and not affixed to the upper end of at least one of the wall boards. 8. The system of claim 1 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be stuffed into at least one said gap and completely fill said at least one gap. 9. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling so that said at least one layer of fire-blocker is generally proximate the ceiling, wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, and wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 10. A system for reducing the spread of fire between adjacent rooms in a building having a common ceiling, the rooms being separated by a wall having at least one vertical wall board coupled to a plurality of vertical studs, each wall board and vertical stud having upper and lower ends, the system comprising:
an elongated header track having a base configured to be coupled to the ceiling and first and second spaced-apart flanges extending downwardly therefrom, said flanges each having an inner side and an outer side, wherein the upper end of each vertical stud extends between said flanges, the upper end of each vertical stud being spaced downwardly from said base of said header track to form a space therebetween and allow for relative movement between the wall and the ceiling, further wherein the upper end of each wall board abuts said outer side of one of said flanges and is spaced downwardly from the ceiling to form a gap therebetween and allow for relative movement between the wall board and the ceiling; at least one layer of elongated filler constructed at least partially of compressible or elastic material and configured to be disposed within at least one said gap formed between at least one wall board and the ceiling, said at least one layer of elongated filler having a top surface and a bottom surface so that said at least one layer of filler is generally proximate the ceiling; and at least one layer of fire-blocker constructed at least partially of fire retarding material and being disposed adjacent to said top surface of said at least one layer of elongated filler and in layered relationship with at least one said layer of elongated filler within at least one said gap formed between at least one wall board and the ceiling, wherein each said layer of fire-blocker in the system is sandwiched between two layers of filler. 11. The system of claim 10 wherein each said layer of fire-blocker and each said layer of filler has a width and first and second side edges, wherein said width of each said layer of fire-blocker is substantially the same as said width of each said layer of filler. 12. The system of claim 10 wherein each said layer of filler has an inner side closest to said header track when said layer of filler is positioned in at least one of said gaps and an outer side farthest from said header track when said layer of filler is positioned in at least one of said gaps. 13. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker occupy only part of at least one said gap. 14. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the ceiling. 15. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be affixed to the upper end of at least one of the wall boards. 16. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are placed upon and not affixed to the upper end of at least one of the wall boards. 17. The system of claim 10 wherein said at least one layer of filler and said at least one layer of fire-blocker are configured to be stuffed into at least one said gap and completely fill said at least one gap. | 3,600 |
348,608 | 16,806,099 | 3,633 | A wave energy converter comprises a power generator, characterized by an axial length along a longitudinal axis; the power generator being configured to tilt about a horizontal axis perpendicular to the longitudinal axis. The tilt results in a conversion of kinetic energy, present in a group of water waves causing the tilt, to electrical energy. The axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves. The power generator generates power independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion. | 1. A wave energy converter comprising:
a power generator characterized by an axial length along a longitudinal axis, the power generator being configured to tilt about a horizontal axis perpendicular to the longitudinal axis, such that the tilt results in a conversion of kinetic energy, present in a group of water waves causing the tilt, to electrical energy; wherein the axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves; and wherein the wave energy converter generates power independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion. 2. The wave energy converter of claim 1,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the wave energy converter is configured to self-orient with respect to the group of waves such that the longitudinal axis of the power generator lies perpendicular to the primary axis. 3. The wave energy converter of claim 1,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves; and wherein the power generator delivers at least part of the electrical energy to a load within, or attached to, a device that floats on or near the top surface of the body of water. 4. The wave energy converter of claim 1,
wherein the waves are characterized by an average wave period; and wherein the power generator comprises:
an electromagnetic generator configured such that as the wave energy converter tilts in response to wave motion, kinetic energy is converted to electrical energy through approximately one half of each average wave period. 5. The wave energy converter of claim 1,
wherein the power generator comprises an electromagnetic generator including a gearbox. 6. The wave energy converter of claim 1,
wherein the power generator is configured to convert kinetic energy in the waves to electrical energy without involving any intervening hydraulic mechanism. 7. The wave energy converter of claim 1,
wherein the power generator comprises:
a pinion of a rack and pinion mechanism, the pinion being coupled to an electromagnetic generator and to a carriage;
a track comprising a rack of the rack and pinion mechanism and auxiliary tracks positioned adjacent and parallel to the rack, the auxiliary tracks oriented to lie parallel to the longitudinal axis of the wave energy converter; and
wheels coupled to the carriage, such that in response to the wave energy converter being tilted about a horizontal axis perpendicular to the longitudinal axis of the wave energy converter, the carriage moves, supported by the wheels, along the auxiliary tracks. 8. The wave energy converter of claim 1,
wherein the track further comprises a barrier configured to confine and stabilize movement of the carriage on the sliding door tracks. 9. A wave energy converter system comprising:
a plurality of interconnected wave energy converters; wherein each of the interconnected wave energy converters comprises a power generator characterized by an axial length along a longitudinal axis, and configured to tilt about a horizontal axis perpendicular to the longitudinal axis, such that the tilt results in the power generator converting kinetic energy, present in a group of water waves causing the tilt, to electrical energy; wherein the axial length of each of the interconnected wave energy converters is less than approximately one quarter of the average wavelength expected to be encountered in a corresponding dominant sub-group of waves within the corresponding group; and wherein the wave energy converter system generates power independent of whether or not any of the interconnected wave energy converters is tethered to any solid object at a position that is fixed independent of water motion. 10. The wave energy converter system of claim 9,
wherein each power generator is configured to convert kinetic energy in the waves to electrical energy without depending on any intervening hydraulic mechanism. 11. The wave energy converter system of claim 9,
wherein the group of waves causing one of the plurality of wave energy converters to tilt also causes each of the remaining ones of the plurality of wave energy converters to tilt; wherein the plurality of interconnected wave energy converters float on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the plurality of wave energy converters self-orient en masse with respect to the group of waves such that the longitudinal axis of each of the power generators lies perpendicular to the primary axis. 12. The wave energy converter system of claim 9,
wherein for each wave energy converter, the group of waves causing that energy converter to tilt is a local group of waves, wave fronts of the local group being oriented along or parallel to a primary axis; and wherein each wave energy converter is configured to self-orient with respect to the corresponding local group of waves such that the longitudinal axis of the wave energy converter lies perpendicular to the corresponding primary axis. 13. The wave energy converter system of claim 9,
wherein interconnections between adjacent wave energy converters comprise water-filled segments. 14. A method of wave energy conversion, the method comprising:
deploying a wave energy converter, characterized by an axial length along a longitudinal axis, on a top surface of a body on water; and operating the power generator to make use of tilt, imposed on the wave energy converter by a group of waves moving through the body of water, to convert kinetic energy, present in the group of waves, to electrical energy; wherein the axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves; and wherein power is generated independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion. 15. The method of claim 14,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the wave energy converter is configured to self-orient with respect to the group of waves such that the longitudinal axis of the wave energy converter lies perpendicular to the primary axis. 16. The method of claim 14 additionally comprising:
delivering at least part of the electrical energy to a load within, or attached to, a device that floats on or near the top surface of the body of water. 17. The method of claim 16,
wherein the load comprises at least one of an illumination system, a navigation system, and a sensing system. 18. The method of claim 17,
wherein the load comprises a sensing system configured to monitor wave dynamics. 19. The method of claim 14,
wherein the power generator comprises:
a pinion of a rack and pinion mechanism, the pinion being coupled to an electromagnetic generator and to a carriage;
a track comprising a rack of the rack and pinion mechanism and auxiliary tracks positioned adjacent and parallel to the rack, the auxiliary tracks oriented to lie parallel to the longitudinal axis of the wave energy converter; and
wheels coupled to the carriage, such that in response to the wave energy converter being tilted about a horizontal axis perpendicular to the longitudinal axis of the wave energy converter, the carriage moves, supported by the wheels, along the auxiliary tracks. 20. The method of claim 19,
wherein the power generator further comprises:
an electromagnetic generator coupled to a load of adjustable electrical resistance by an electrical pick up; and
wherein operating the power generator comprises adjusting the adjustable electrical resistance of the load in response to characteristics of the group of waves, such that a range of motion of the carriage along the longitudinal axis of the wave energy converter is optimized. | A wave energy converter comprises a power generator, characterized by an axial length along a longitudinal axis; the power generator being configured to tilt about a horizontal axis perpendicular to the longitudinal axis. The tilt results in a conversion of kinetic energy, present in a group of water waves causing the tilt, to electrical energy. The axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves. The power generator generates power independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion.1. A wave energy converter comprising:
a power generator characterized by an axial length along a longitudinal axis, the power generator being configured to tilt about a horizontal axis perpendicular to the longitudinal axis, such that the tilt results in a conversion of kinetic energy, present in a group of water waves causing the tilt, to electrical energy; wherein the axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves; and wherein the wave energy converter generates power independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion. 2. The wave energy converter of claim 1,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the wave energy converter is configured to self-orient with respect to the group of waves such that the longitudinal axis of the power generator lies perpendicular to the primary axis. 3. The wave energy converter of claim 1,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves; and wherein the power generator delivers at least part of the electrical energy to a load within, or attached to, a device that floats on or near the top surface of the body of water. 4. The wave energy converter of claim 1,
wherein the waves are characterized by an average wave period; and wherein the power generator comprises:
an electromagnetic generator configured such that as the wave energy converter tilts in response to wave motion, kinetic energy is converted to electrical energy through approximately one half of each average wave period. 5. The wave energy converter of claim 1,
wherein the power generator comprises an electromagnetic generator including a gearbox. 6. The wave energy converter of claim 1,
wherein the power generator is configured to convert kinetic energy in the waves to electrical energy without involving any intervening hydraulic mechanism. 7. The wave energy converter of claim 1,
wherein the power generator comprises:
a pinion of a rack and pinion mechanism, the pinion being coupled to an electromagnetic generator and to a carriage;
a track comprising a rack of the rack and pinion mechanism and auxiliary tracks positioned adjacent and parallel to the rack, the auxiliary tracks oriented to lie parallel to the longitudinal axis of the wave energy converter; and
wheels coupled to the carriage, such that in response to the wave energy converter being tilted about a horizontal axis perpendicular to the longitudinal axis of the wave energy converter, the carriage moves, supported by the wheels, along the auxiliary tracks. 8. The wave energy converter of claim 1,
wherein the track further comprises a barrier configured to confine and stabilize movement of the carriage on the sliding door tracks. 9. A wave energy converter system comprising:
a plurality of interconnected wave energy converters; wherein each of the interconnected wave energy converters comprises a power generator characterized by an axial length along a longitudinal axis, and configured to tilt about a horizontal axis perpendicular to the longitudinal axis, such that the tilt results in the power generator converting kinetic energy, present in a group of water waves causing the tilt, to electrical energy; wherein the axial length of each of the interconnected wave energy converters is less than approximately one quarter of the average wavelength expected to be encountered in a corresponding dominant sub-group of waves within the corresponding group; and wherein the wave energy converter system generates power independent of whether or not any of the interconnected wave energy converters is tethered to any solid object at a position that is fixed independent of water motion. 10. The wave energy converter system of claim 9,
wherein each power generator is configured to convert kinetic energy in the waves to electrical energy without depending on any intervening hydraulic mechanism. 11. The wave energy converter system of claim 9,
wherein the group of waves causing one of the plurality of wave energy converters to tilt also causes each of the remaining ones of the plurality of wave energy converters to tilt; wherein the plurality of interconnected wave energy converters float on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the plurality of wave energy converters self-orient en masse with respect to the group of waves such that the longitudinal axis of each of the power generators lies perpendicular to the primary axis. 12. The wave energy converter system of claim 9,
wherein for each wave energy converter, the group of waves causing that energy converter to tilt is a local group of waves, wave fronts of the local group being oriented along or parallel to a primary axis; and wherein each wave energy converter is configured to self-orient with respect to the corresponding local group of waves such that the longitudinal axis of the wave energy converter lies perpendicular to the corresponding primary axis. 13. The wave energy converter system of claim 9,
wherein interconnections between adjacent wave energy converters comprise water-filled segments. 14. A method of wave energy conversion, the method comprising:
deploying a wave energy converter, characterized by an axial length along a longitudinal axis, on a top surface of a body on water; and operating the power generator to make use of tilt, imposed on the wave energy converter by a group of waves moving through the body of water, to convert kinetic energy, present in the group of waves, to electrical energy; wherein the axial length is less than approximately one quarter of the average wavelength expected to be encountered in a dominant sub-group of waves within the group of waves; and wherein power is generated independent of whether or not the wave energy converter is tethered to any solid object at a position that is fixed independent of water motion. 15. The method of claim 14,
wherein the wave energy converter floats on or near a top surface of a body of water through which the group of waves moves, wave fronts of the group being oriented along or parallel to a primary axis; and wherein the wave energy converter is configured to self-orient with respect to the group of waves such that the longitudinal axis of the wave energy converter lies perpendicular to the primary axis. 16. The method of claim 14 additionally comprising:
delivering at least part of the electrical energy to a load within, or attached to, a device that floats on or near the top surface of the body of water. 17. The method of claim 16,
wherein the load comprises at least one of an illumination system, a navigation system, and a sensing system. 18. The method of claim 17,
wherein the load comprises a sensing system configured to monitor wave dynamics. 19. The method of claim 14,
wherein the power generator comprises:
a pinion of a rack and pinion mechanism, the pinion being coupled to an electromagnetic generator and to a carriage;
a track comprising a rack of the rack and pinion mechanism and auxiliary tracks positioned adjacent and parallel to the rack, the auxiliary tracks oriented to lie parallel to the longitudinal axis of the wave energy converter; and
wheels coupled to the carriage, such that in response to the wave energy converter being tilted about a horizontal axis perpendicular to the longitudinal axis of the wave energy converter, the carriage moves, supported by the wheels, along the auxiliary tracks. 20. The method of claim 19,
wherein the power generator further comprises:
an electromagnetic generator coupled to a load of adjustable electrical resistance by an electrical pick up; and
wherein operating the power generator comprises adjusting the adjustable electrical resistance of the load in response to characteristics of the group of waves, such that a range of motion of the carriage along the longitudinal axis of the wave energy converter is optimized. | 3,600 |
348,609 | 16,806,100 | 3,633 | A vehicular vision system includes a camera module having a housing that houses at least (i) electronic circuitry disposed at a main printed circuit board (PCB) and (ii) an imager assembly. The imager assembly includes an imager, an imager PCB and a lens barrel. Electronic circuitry is disposed at an upper side and at a lower side of the main PCB. The lower side of the main PCB faces a lower housing portion and the upper side of the main PCB faces an upper housing portion. A flexible cable electrically connects electronic circuitry disposed at the imager PCB with electronic circuitry disposed at the main PCB. An electronic component of electronic circuitry disposed at the main PCB is in thermal conductivity with a thermal element, which is in thermal conductivity with the lower housing portion to enhance heat transfer from the electronic component to the lower housing portion. | 1. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 2. The vehicular vision system of claim 1, wherein said thermal element comprises a sil pad. 3. The vehicular vision system of claim 1, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 4. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive paste. 5. The vehicular vision system of claim 1, wherein said flexible cable carries low-voltage differential signaling (LVDS) signals conveying image data captured by said imager to an image processor disposed at said main PCB. 6. The vehicular vision system of claim 1, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 7. The vehicular vision system of claim 1, wherein said flexible cable connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 8. The vehicular vision system of claim 1, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 9. The vehicular vision system of claim 8, wherein, with said camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said camera module may be detached for replacement or service with the bracket remaining attached at the windshield. 10. The vehicular vision system of claim 9, wherein the bracket attaches at the in-cabin side of the windshield via direct adhesive attachment. 11. The vehicular vision system of claim 10, wherein said imager views through an aperture of said upper housing portion of said camera housing, and wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing to exterior of said camera housing. 12. The vehicular vision system of claim 11, wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing at an acute angle relative to said main PCB. 13. The vehicular vision system of claim 11, wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. 14. The vehicular vision system of claim 13, wherein the bracket comprises the stray light shield. 15. The vehicular vision system of claim 13, wherein the stray light shield is separate from the bracket. 16. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive pad. 17. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said lower side of said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 18. The vehicular vision system of claim 17, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said lower side of said main PCB to said lower housing portion of said camera housing. 19. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive paste. 20. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive pad. 21. The vehicular vision system of claim 17, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 22. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; and wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 23. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive paste. 24. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive pad. 25. The vehicular vision system of claim 22, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 26. The vehicular vision system of claim 22, wherein said flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 27. The vehicular vision system of claim 22, wherein, with the camera module mounted at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. | A vehicular vision system includes a camera module having a housing that houses at least (i) electronic circuitry disposed at a main printed circuit board (PCB) and (ii) an imager assembly. The imager assembly includes an imager, an imager PCB and a lens barrel. Electronic circuitry is disposed at an upper side and at a lower side of the main PCB. The lower side of the main PCB faces a lower housing portion and the upper side of the main PCB faces an upper housing portion. A flexible cable electrically connects electronic circuitry disposed at the imager PCB with electronic circuitry disposed at the main PCB. An electronic component of electronic circuitry disposed at the main PCB is in thermal conductivity with a thermal element, which is in thermal conductivity with the lower housing portion to enhance heat transfer from the electronic component to the lower housing portion.1. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 2. The vehicular vision system of claim 1, wherein said thermal element comprises a sil pad. 3. The vehicular vision system of claim 1, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 4. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive paste. 5. The vehicular vision system of claim 1, wherein said flexible cable carries low-voltage differential signaling (LVDS) signals conveying image data captured by said imager to an image processor disposed at said main PCB. 6. The vehicular vision system of claim 1, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 7. The vehicular vision system of claim 1, wherein said flexible cable connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 8. The vehicular vision system of claim 1, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 9. The vehicular vision system of claim 8, wherein, with said camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said camera module may be detached for replacement or service with the bracket remaining attached at the windshield. 10. The vehicular vision system of claim 9, wherein the bracket attaches at the in-cabin side of the windshield via direct adhesive attachment. 11. The vehicular vision system of claim 10, wherein said imager views through an aperture of said upper housing portion of said camera housing, and wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing to exterior of said camera housing. 12. The vehicular vision system of claim 11, wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing at an acute angle relative to said main PCB. 13. The vehicular vision system of claim 11, wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. 14. The vehicular vision system of claim 13, wherein the bracket comprises the stray light shield. 15. The vehicular vision system of claim 13, wherein the stray light shield is separate from the bracket. 16. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive pad. 17. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said lower side of said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 18. The vehicular vision system of claim 17, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said lower side of said main PCB to said lower housing portion of said camera housing. 19. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive paste. 20. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive pad. 21. The vehicular vision system of claim 17, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 22. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; and wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 23. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive paste. 24. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive pad. 25. The vehicular vision system of claim 22, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 26. The vehicular vision system of claim 22, wherein said flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 27. The vehicular vision system of claim 22, wherein, with the camera module mounted at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. | 3,600 |
348,610 | 16,806,078 | 3,633 | A vehicular vision system includes a camera module having a housing that houses at least (i) electronic circuitry disposed at a main printed circuit board (PCB) and (ii) an imager assembly. The imager assembly includes an imager, an imager PCB and a lens barrel. Electronic circuitry is disposed at an upper side and at a lower side of the main PCB. The lower side of the main PCB faces a lower housing portion and the upper side of the main PCB faces an upper housing portion. A flexible cable electrically connects electronic circuitry disposed at the imager PCB with electronic circuitry disposed at the main PCB. An electronic component of electronic circuitry disposed at the main PCB is in thermal conductivity with a thermal element, which is in thermal conductivity with the lower housing portion to enhance heat transfer from the electronic component to the lower housing portion. | 1. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 2. The vehicular vision system of claim 1, wherein said thermal element comprises a sil pad. 3. The vehicular vision system of claim 1, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 4. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive paste. 5. The vehicular vision system of claim 1, wherein said flexible cable carries low-voltage differential signaling (LVDS) signals conveying image data captured by said imager to an image processor disposed at said main PCB. 6. The vehicular vision system of claim 1, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 7. The vehicular vision system of claim 1, wherein said flexible cable connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 8. The vehicular vision system of claim 1, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 9. The vehicular vision system of claim 8, wherein, with said camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said camera module may be detached for replacement or service with the bracket remaining attached at the windshield. 10. The vehicular vision system of claim 9, wherein the bracket attaches at the in-cabin side of the windshield via direct adhesive attachment. 11. The vehicular vision system of claim 10, wherein said imager views through an aperture of said upper housing portion of said camera housing, and wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing to exterior of said camera housing. 12. The vehicular vision system of claim 11, wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing at an acute angle relative to said main PCB. 13. The vehicular vision system of claim 11, wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. 14. The vehicular vision system of claim 13, wherein the bracket comprises the stray light shield. 15. The vehicular vision system of claim 13, wherein the stray light shield is separate from the bracket. 16. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive pad. 17. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said lower side of said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 18. The vehicular vision system of claim 17, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said lower side of said main PCB to said lower housing portion of said camera housing. 19. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive paste. 20. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive pad. 21. The vehicular vision system of claim 17, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 22. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; and wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 23. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive paste. 24. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive pad. 25. The vehicular vision system of claim 22, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 26. The vehicular vision system of claim 22, wherein said flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 27. The vehicular vision system of claim 22, wherein, with the camera module mounted at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. | A vehicular vision system includes a camera module having a housing that houses at least (i) electronic circuitry disposed at a main printed circuit board (PCB) and (ii) an imager assembly. The imager assembly includes an imager, an imager PCB and a lens barrel. Electronic circuitry is disposed at an upper side and at a lower side of the main PCB. The lower side of the main PCB faces a lower housing portion and the upper side of the main PCB faces an upper housing portion. A flexible cable electrically connects electronic circuitry disposed at the imager PCB with electronic circuitry disposed at the main PCB. An electronic component of electronic circuitry disposed at the main PCB is in thermal conductivity with a thermal element, which is in thermal conductivity with the lower housing portion to enhance heat transfer from the electronic component to the lower housing portion.1. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 2. The vehicular vision system of claim 1, wherein said thermal element comprises a sil pad. 3. The vehicular vision system of claim 1, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 4. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive paste. 5. The vehicular vision system of claim 1, wherein said flexible cable carries low-voltage differential signaling (LVDS) signals conveying image data captured by said imager to an image processor disposed at said main PCB. 6. The vehicular vision system of claim 1, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 7. The vehicular vision system of claim 1, wherein said flexible cable connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 8. The vehicular vision system of claim 1, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 9. The vehicular vision system of claim 8, wherein, with said camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said camera module may be detached for replacement or service with the bracket remaining attached at the windshield. 10. The vehicular vision system of claim 9, wherein the bracket attaches at the in-cabin side of the windshield via direct adhesive attachment. 11. The vehicular vision system of claim 10, wherein said imager views through an aperture of said upper housing portion of said camera housing, and wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing to exterior of said camera housing. 12. The vehicular vision system of claim 11, wherein said lens barrel protrudes through the aperture of said upper housing portion of said camera housing at an acute angle relative to said main PCB. 13. The vehicular vision system of claim 11, wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. 14. The vehicular vision system of claim 13, wherein the bracket comprises the stray light shield. 15. The vehicular vision system of claim 13, wherein the stray light shield is separate from the bracket. 16. The vehicular vision system of claim 1, wherein said thermal element comprises a thermally conductive pad. 17. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein, with the camera module attached at the in-cabin side of the windshield, said imager views through the windshield forward of the equipped vehicle; wherein said main PCB has an upper side and a lower side; wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said lower side of said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; and wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing. 18. The vehicular vision system of claim 17, wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said lower side of said main PCB to said lower housing portion of said camera housing. 19. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive paste. 20. The vehicular vision system of claim 17, wherein said thermal element comprises a thermally conductive pad. 21. The vehicular vision system of claim 17, wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 22. A vehicular vision system, the vehicular vision system comprising:
a camera module configured for mounting at an in-cabin side of a windshield of a vehicle equipped with said vehicular vision system; wherein said camera module comprises a camera housing having an upper housing portion and a lower housing portion; wherein said camera housing, with said upper housing portion connected to said lower housing portion, houses at least (i) electronic circuitry disposed at a main printed circuit board (main PCB) and (ii) an imager assembly; wherein said imager assembly comprises an imager; wherein said imager comprises a two dimensional array of rows and columns of photosensing elements; wherein said imager comprises at least one million photosensing elements; wherein said imager assembly comprises a lens barrel that houses at least one lens; wherein said imager assembly comprises an imager printed circuit board (imager PCB); wherein electronic circuitry disposed at said imager PCB of said imager assembly comprises said imager; wherein said main PCB has an upper side and a lower side; wherein electronic circuitry of said main PCB is disposed at said upper side of said main PCB and at said lower side of said main PCB; wherein said lower side of said main PCB faces said lower housing portion and said upper side of said main PCB faces said upper housing portion; wherein a flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB; wherein an electronic component of electronic circuitry disposed at said main PCB is in thermal conductivity with a thermal element; wherein said thermal element is in thermal conductivity with said lower housing portion of said camera housing and, during operation of said camera module, enhances heat transfer from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; wherein said camera housing comprises fins configured to dissipate heat transferred from the electronic component of electronic circuitry disposed at said main PCB to said lower housing portion of said camera housing; and wherein said camera housing is configured for mounting the camera module at a bracket attached at the in-cabin side of the windshield of the equipped vehicle, and wherein, with the camera module mounted at the bracket attached at the in-cabin side of the windshield of the equipped vehicle, said imager views forward of the equipped vehicle through the windshield. 23. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive paste. 24. The vehicular vision system of claim 22, wherein said thermal element comprises a thermally conductive pad. 25. The vehicular vision system of claim 22, wherein said imager assembly is at least partially disposed above said upper side of said main PCB, and wherein said imager views through an aperture of said upper housing portion of said camera housing. 26. The vehicular vision system of claim 22, wherein said flexible cable electrically connects electronic circuitry disposed at said imager PCB with electronic circuitry disposed at said main PCB at said lower side of said main PCB. 27. The vehicular vision system of claim 22, wherein, with the camera module mounted at the in-cabin side of the windshield of the equipped vehicle, a stray light shield is disposed between the camera module and the windshield, said imager viewing forward of the equipped vehicle via the stray light shield. | 3,600 |
348,611 | 16,806,095 | 3,633 | A vehicular vision system includes a camera module having a camera and a circuit board. With the camera module mounted at a vehicle windshield, the camera has a field of view forward of the vehicle and through the vehicle windshield. The camera includes an imager and a lens, with the lens accommodated in a lens barrel. The camera captures image data when operated. The camera is electrically connected to circuitry established at the circuit board via a flexible electrical connection. Circuitry of the circuit board (i) provides electrical power to the camera via the flexible electrical connection, (ii) controls the camera via the flexible electrical connection and (iii) receives image data from the camera via the flexible electrical connection. With the camera module mounted at the windshield, the circuit board is tilted at an angle relative to a longitudinal axis of the lens barrel of the camera. | 1. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera; and an image processor, wherein said image processor is operable to process image data captured by said camera for a vehicle headlamp control system of the vehicle. 2. The vehicular vision system of claim 1, wherein, with said camera module mounted at the in-cabin portion of the windshield, the longitudinal axis of said lens barrel of said camera is at or close to horizontal. 3. The vehicular vision system of claim 1, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is parallel to an inner surface of the in-cabin portion of the windshield local to where said camera module is mounted. 4. The vehicular vision system of claim 1, wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements. 5. The vehicular vision system of claim 1, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 6. The vehicular vision system of claim 5, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield. 7. The vehicular vision system of claim 5, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to horizontal that is greater than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to horizontal. 8. The vehicular vision system of claim 7, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. 9. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to horizontal that is greater than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to horizontal; and wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera. 10. The vehicular vision system of claim 9, comprising an image processor operable to process image data captured by said camera. 11. The vehicular vision system of claim 10, wherein said image processor comprises part of a driver assistance system of the vehicle. 12. The vehicular vision system of claim 11, wherein said driver assistance system comprises at least two selected from the group consisting of (i) a vehicle headlamp control system of the vehicle, (ii) a lane departure warning system of the vehicle, (iii) an object detection system of the vehicle, (iv) a traffic sign recognition system of the vehicle and (v) a distance determining system operable to determine a distance to a leading vehicle. 13. The vehicular vision system of claim 9, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 14. The vehicular vision system of claim 13, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield. 15. The vehicular vision system of claim 14, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. 16. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield; and an image processor, wherein said image processor is operable to process image data captured by said camera for a driving assistance system of the vehicle. 17. The vehicular vision system of claim 16, wherein said driving assistance system comprises at least two selected from the group consisting of (i) a vehicle headlamp control system of the vehicle, (ii) a lane departure warning system of the vehicle, (iii) an object detection system of the vehicle, (iv) a traffic sign recognition system of the vehicle and (v) a distance determining system operable to determine a distance to a leading vehicle. 18. The vehicular vision system of claim 16, wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera. 19. The vehicular vision system of claim 16, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 20. The vehicular vision system of claim 19, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. | A vehicular vision system includes a camera module having a camera and a circuit board. With the camera module mounted at a vehicle windshield, the camera has a field of view forward of the vehicle and through the vehicle windshield. The camera includes an imager and a lens, with the lens accommodated in a lens barrel. The camera captures image data when operated. The camera is electrically connected to circuitry established at the circuit board via a flexible electrical connection. Circuitry of the circuit board (i) provides electrical power to the camera via the flexible electrical connection, (ii) controls the camera via the flexible electrical connection and (iii) receives image data from the camera via the flexible electrical connection. With the camera module mounted at the windshield, the circuit board is tilted at an angle relative to a longitudinal axis of the lens barrel of the camera.1. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera; and an image processor, wherein said image processor is operable to process image data captured by said camera for a vehicle headlamp control system of the vehicle. 2. The vehicular vision system of claim 1, wherein, with said camera module mounted at the in-cabin portion of the windshield, the longitudinal axis of said lens barrel of said camera is at or close to horizontal. 3. The vehicular vision system of claim 1, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is parallel to an inner surface of the in-cabin portion of the windshield local to where said camera module is mounted. 4. The vehicular vision system of claim 1, wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements. 5. The vehicular vision system of claim 1, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 6. The vehicular vision system of claim 5, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield. 7. The vehicular vision system of claim 5, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to horizontal that is greater than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to horizontal. 8. The vehicular vision system of claim 7, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. 9. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to horizontal that is greater than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to horizontal; and wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera. 10. The vehicular vision system of claim 9, comprising an image processor operable to process image data captured by said camera. 11. The vehicular vision system of claim 10, wherein said image processor comprises part of a driver assistance system of the vehicle. 12. The vehicular vision system of claim 11, wherein said driver assistance system comprises at least two selected from the group consisting of (i) a vehicle headlamp control system of the vehicle, (ii) a lane departure warning system of the vehicle, (iii) an object detection system of the vehicle, (iv) a traffic sign recognition system of the vehicle and (v) a distance determining system operable to determine a distance to a leading vehicle. 13. The vehicular vision system of claim 9, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 14. The vehicular vision system of claim 13, wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield. 15. The vehicular vision system of claim 14, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. 16. A vehicular vision system, said vehicular vision system comprising:
a camera module configured for mounting at an in-cabin portion of a windshield of a vehicle; wherein said camera module comprises a camera and a circuit board; wherein, with said camera module mounted at the in-cabin portion of the windshield, said camera has a field of view forward of the vehicle and through the windshield of the vehicle; wherein said camera comprises an imager and a lens, wherein said lens is accommodated in a lens barrel having a longitudinal axis; wherein the imager of said camera comprises a CMOS imaging array having a plurality of photosensing elements arranged in at least 640 columns of photosensing elements and at least 480 rows of photosensing elements; wherein said camera captures image data when operated; wherein said camera is electrically connected to circuitry established at said circuit board via a flexible electrical connection; wherein circuitry of said circuit board (i) provides electrical power to said camera via the flexible electrical connection, (ii) controls said camera via the flexible electrical connection and (iii) receives image data from said camera via the flexible electrical connection; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board is tilted at an acute angle relative to the longitudinal axis of said lens barrel of said camera; wherein, with said camera module mounted at the in-cabin portion of the windshield, said circuit board subtends an angle relative to the in-cabin portion of the windshield that is less than an angle subtended by the longitudinal axis of said lens barrel of said camera relative to the in-cabin portion of the windshield; and an image processor, wherein said image processor is operable to process image data captured by said camera for a driving assistance system of the vehicle. 17. The vehicular vision system of claim 16, wherein said driving assistance system comprises at least two selected from the group consisting of (i) a vehicle headlamp control system of the vehicle, (ii) a lane departure warning system of the vehicle, (iii) an object detection system of the vehicle, (iv) a traffic sign recognition system of the vehicle and (v) a distance determining system operable to determine a distance to a leading vehicle. 18. The vehicular vision system of claim 16, wherein, with said camera module mounted at the in-cabin portion of the windshield, at least a portion of said circuit board is disposed at the windshield rearward of said lens of said camera. 19. The vehicular vision system of claim 16, wherein the windshield of the vehicle, as mounted in the vehicle, has a rake angle of at least 20 degrees. 20. The vehicular vision system of claim 19, wherein the rake angle of the windshield of the vehicle is less than 40 degrees. | 3,600 |
348,612 | 16,806,125 | 3,633 | An automatic braking system and method are provided for controlling the automatic operation of a pneumatic (air) brake system installed on commercial highway vehicles and the like, particular heavy trucks and buses. When a possible collision is detected or an object is detected in proximity to at least one side and/or end of the vehicle, the system automatically operates the existing, factory installed air braking system of the vehicle to avoid a collision or mitigate the collision impact by concurrently pressurizing each of the rear and front pneumatic service brakes of the vehicle. Pressing the existing vehicle brake pedal deactivates the automatic braking system, thereby permitting the driver to take over control of braking at any time. | 1. An automatic braking system for a vehicle having pneumatic brakes and a vehicle brake pedal, the system comprising:
a) an actuation apparatus comprising at least one solenoid operated pneumatic valve, wherein the solenoid operated pneumatic valve comprises a solenoid, wherein said valve opens and remains open when the solenoid is energized, and closes and/or remains closed when the solenoid is not energized; b) a collision warning device directly or indirectly electrically connected to said at least one solenoid operated pneumatic valve, wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle, wherein said collision warning device causes the solenoid of said at least one solenoid operated pneumatic valve to be energized when said closure time is at or below a pre-set time to collision value and causes each solenoid to remain energized until said closure time is above said pre-set time to collision value or until the vehicle brake pedal is pressed; c) a first air pressure reservoir pneumatically connected to said at least one solenoid operated pneumatic valve; d) front pneumatic brakes pneumatically connected to said at least one solenoid operated pneumatic valve, said front pneumatic brakes comprising a left front brake assembly and a right front brake assembly; and e) rear pneumatic brakes pneumatically connected to said at least one solenoid operated pneumatic valve, said rear pneumatic brakes comprising a left rear pneumatic brake unit and a right rear pneumatic brake unit, wherein each pneumatic brake unit comprises at least one pneumatic brake assembly;
wherein opening the at least one solenoid operated pneumatic valve activates automatic braking, wherein when the at least one solenoid operated pneumatic valve is open, air flows from the first air pressure reservoir through the at least one solenoid operated pneumatic valve and then concurrently flows to all of the front pneumatic brake assemblies and rear pneumatic brake assemblies, thereby concurrently engaging the front pneumatic brake assemblies and engaging pneumatic brake assemblies of the rear pneumatic brake units, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 2. The automatic braking system of claim 1 further comprising a left front anti-lock braking system control module pneumatically connected to the left front brake assembly and a right front anti-lock braking system control module pneumatically connected to the right front brake assembly, wherein said left front anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the left front brake assembly, and wherein said right front anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the right front brake assembly. 3. The automatic braking system of claim 2 wherein a front brake 2-way valve is pneumatically connected to the solenoid operated pneumatic valve and to each of the left front brake assembly and said right front brake assembly, wherein air is distributed to said left front brake assembly and said right front brake assembly by passing through a front connector gate, wherein said front brake 2-way valve is separately pneumatically connected to a front brake control valve and thereby allows air from the solenoid operated pneumatic valve to flow to the front pneumatic brake assemblies, and alternatively allows air from the front brake control valve to flow to the front pneumatic brake assemblies. 4. The automatic braking system of claim 1 wherein the left rear brake unit comprises at least two brake assemblies, and the right rear brake unit comprises at least two brake assemblies, and wherein the rear pneumatic brakes further comprise a left rear anti-lock braking system control module pneumatically connected to each brake assembly of the left rear brake unit and a right rear anti-lock braking system control module pneumatically connected to each brake assembly of the right rear brake unit, wherein said left rear anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the left rear brake unit, and wherein said right rear anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the right front brake unit. 5. The automatic braking system of claim 1 further comprising a rear brake 2-way valve pneumatically connected to said solenoid operated pneumatic valve and separately pneumatically connected to a rear brake control valve, and further comprising a rear relay valve pneumatically connected to said rear brake 2-way valve, said rear relay valve being separately pneumatically connected to each of said rear pneumatic brake units, wherein said rear brake 2-way valve allows air from the solenoid operated pneumatic valve to flow to the rear pneumatic brake units after said air first passes through the rear relay valve, or alternatively allows air from the rear brake control valve to flow to the rear pneumatic brake units after first passing through the rear relay valve. 6. The automatic braking system of claim 1 wherein said actuation apparatus comprises only one solenoid operated pneumatic valve. 7. The automatic braking system of claim 1 wherein said actuation apparatus comprises a plurality of solenoid operated pneumatic valves, wherein each of said plurality of solenoid operated pneumatic valves has at least one air output port, wherein the diameter of the air output ports of each solenoid operated pneumatic valve is different than the diameter of the one air output ports of all other solenoid operated pneumatic valves, and wherein each of said plurality of solenoid operated pneumatic valves is energized at a different closure time value. 8. The automatic braking system of claim 7 wherein said actuation apparatus comprises a first solenoid operated pneumatic valve, a second solenoid operated pneumatic valve, a third solenoid operated pneumatic valve and a fourth solenoid operated pneumatic valve, wherein the diameter of the air output ports of said first solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the second solenoid operated pneumatic valve; wherein the diameter of the air output ports of said second solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the third solenoid operated pneumatic valve; and wherein the diameter of the air output ports of said third solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the fourth solenoid operated pneumatic valve; and wherein the first solenoid operated pneumatic valve is energized at a greater closure time than the second solenoid operated pneumatic valve, wherein the second solenoid operated pneumatic valve is energized at a greater closure time than the third solenoid operated pneumatic valve, and wherein the third solenoid operated pneumatic valve is energized at a greater closure time than the fourth solenoid operated pneumatic valve. 9. The automatic braking system of claim 3 wherein said front brake control valve is pneumatically connected to said first air pressure reservoir. 10. The automatic braking system of claim 5 further comprising a connection gate pneumatically connected to both said rear brake control valve and said rear brake 2-way valve, wherein said connection gate is pneumatically located between said rear brake control valve and said rear brake 2-way valve. 11. The automatic braking system of claim 1 wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle by transmitting and receiving radar signals, sonar signals, laser signals, or a combination thereof. 12. The automatic braking system of claim 1 wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle by using a motion detecting, optical vision system without transmitting and receiving signals. 13. The automatic braking system of claim 5 wherein when the vehicle brake pedal is pressed, all open solenoid operated pneumatic valves close and air from the rear brake control valve is passed through the rear brake 2-way valve and transported to the brake assemblies of the rear pneumatic brake units. 14. The automatic braking system of claim 1 wherein electrical functions of the vehicle are controlled by a Controller Area Network Bus (CAN Bus) protocol, wherein the collision warning device is electrically connected to and electrically communicates with said CAN Bus, and wherein the collision warning device is directly connected to the solenoid operated pneumatic valves. 15. The automatic braking system of claim 1 wherein the vehicle further comprises a left turn signal and a right turn signal, wherein activating either of said left turn signal or said right turn signal causes deactivation of the automatic braking system. 16. The automatic braking system of claim 1 further comprising an electro-magnetic retarder mounted on a rear axle or on a drive shaft of the vehicle. 17. The automatic braking system of claim 1 wherein the solenoid operated pneumatic valve has a first output port pneumatically connected to the rear pneumatic brakes, a second output port pneumatically connected to the front pneumatic brakes, an input port pneumatically connected to said first air pressure reservoir, and an exhaust port. 18. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port has a diameter of about 3.0 mm or less. 19. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port has a diameter of from about 1.0 mm to about 2.5 mm. 20. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port have the same diameter. 21. An automatic braking system for a vehicle having pneumatic brakes and a vehicle brake pedal, the system comprising:
a) an actuation apparatus comprising at least one solenoid operated pneumatic valve, wherein the solenoid operated pneumatic valve comprises a solenoid, wherein said valve opens and remains open when the solenoid is energized, and closes and/or remains closed when the solenoid is not energized; b) one or more collision warning devices, each collision warning device being directly or indirectly electrically connected to the solenoid operated pneumatic valve, and each collision warning device comprising one or more sensors that continuously monitor for the presence of obstacles in proximity of at least one side and/or end of the vehicle, wherein each collision warning device causes the solenoid of said solenoid operated pneumatic valve to be energized when an obstacle is detected in proximity of at least one side and/or end of the vehicle and causes the solenoid to remain energized until said obstacle is no longer detected or until the vehicle brake pedal is pressed; c) a first air pressure reservoir pneumatically connected to said solenoid operated pneumatic valve; d) front pneumatic brakes pneumatically connected to the solenoid operated pneumatic valve, said front pneumatic brakes comprising a left front brake assembly and a right front brake assembly; and e) rear pneumatic brakes pneumatically connected to the solenoid operated pneumatic valve, said rear pneumatic brakes comprising a left rear pneumatic brake unit and a right rear pneumatic brake unit, wherein each pneumatic brake unit comprises at least one pneumatic brake assembly;
wherein opening the solenoid operated pneumatic valve activates automatic braking, wherein when the solenoid operated pneumatic valve is open, air flows from the first air pressure reservoir through the solenoid operated pneumatic valve and then concurrently flows to each of the rear pneumatic brake assemblies and optionally to each of the front pneumatic brake assemblies, thereby engaging the pneumatic brake assemblies of the rear pneumatic brake units and optionally engaging the front pneumatic brake assemblies concurrently with the rear pneumatic brake assemblies, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 22. A method of automatic braking of a moving vehicle that has pneumatic brakes and a vehicle brake pedal, the method comprising the steps of:
a) monitoring for the presence of obstacles that are either:
(i) in proximity of at least one side and/or end of the vehicle; or
(ii) within a pre-set time to collision value in front of the vehicle;
b) activating automatic braking when an object is either:
(i) detected in proximity of at least one side and/or end of the vehicle; or
(ii) detected within said pre-set time to collision value in front of the vehicle;
wherein automatic braking is activated by energizing at least one solenoid operated pneumatic valve which opens said energized solenoid operated pneumatic valve and initiates flow of air from an air pressure reservoir through said open solenoid operated pneumatic valve, wherein said air then flows concurrently to each of a front left pneumatic brake assembly, a front right pneumatic brake assembly, to rear left brake assemblies that form a rear left pneumatic brake unit and to rear right brake assemblies that form a pneumatic brake unit, thereby causing the concurrent engaging of all of said brakes assemblies; and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 23. An automatic braking system for a vehicle having pneumatic brakes, which vehicle has a vehicle brake pedal and a plurality of wheels, each of said wheels being connected to a brake assembly and each of said wheels having a wheel sensor connected to the brake assembly of said wheel, the system comprising:
a) an actuation apparatus comprising a plurality of solenoid operated pneumatic valves, wherein each solenoid operated pneumatic valve comprises a solenoid and wherein each solenoid operated pneumatic valve opens and remains open when its solenoid is energized and closes and/or remains closed when its solenoid is not energized, wherein each solenoid operated pneumatic valve is pneumatically paired with one of said anti-lock braking system control modules; b) a collision warning device directly or indirectly electrically connected said solenoid operated pneumatic valves of the actuation apparatus, wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle, wherein said collision warning device causes the concurrent energizing of the solenoid of each solenoid operated pneumatic valve when said closure time is at or below a pre-set time to collision value, and causes each solenoid to remain independently energized unless i) or ii) or iii):
i) said closure time increases to a value above said pre-set time to collision value, thereby de-energizing all of the solenoids of all of the solenoid operated pneumatic valves, thereby causing all of the solenoid operated pneumatic valves to concurrently close, thereby deactivating all automatic braking; or
ii) at least one of said wheel sensors detects that the brake assembly it is connected to has locked, thereby de-energizing the solenoid of the solenoid operated pneumatic valve that is connected to the locked brake assembly independently of the other wheels, thereby closing the solenoid operated pneumatic valve connected to the locked brake assembly, thereby deactivating automatic braking for the locked brake assembly; or
iii) the vehicle brake pedal is pressed;
c) a first air pressure reservoir pneumatically connected to each solenoid operated pneumatic valve; and
wherein opening the solenoid operated pneumatic valves activates automatic braking, wherein when the solenoid operated pneumatic valves are open, air flows from the first air pressure reservoir concurrently through each solenoid operated pneumatic valve and then concurrently flows toward all brake assemblies, thereby causing the concurrent engaging of all of said brake assemblies, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to concurrently de-energize, thereby causing each of said open solenoid operated pneumatic valves to concurrently close, and thereby deactivating all automatic braking. | An automatic braking system and method are provided for controlling the automatic operation of a pneumatic (air) brake system installed on commercial highway vehicles and the like, particular heavy trucks and buses. When a possible collision is detected or an object is detected in proximity to at least one side and/or end of the vehicle, the system automatically operates the existing, factory installed air braking system of the vehicle to avoid a collision or mitigate the collision impact by concurrently pressurizing each of the rear and front pneumatic service brakes of the vehicle. Pressing the existing vehicle brake pedal deactivates the automatic braking system, thereby permitting the driver to take over control of braking at any time.1. An automatic braking system for a vehicle having pneumatic brakes and a vehicle brake pedal, the system comprising:
a) an actuation apparatus comprising at least one solenoid operated pneumatic valve, wherein the solenoid operated pneumatic valve comprises a solenoid, wherein said valve opens and remains open when the solenoid is energized, and closes and/or remains closed when the solenoid is not energized; b) a collision warning device directly or indirectly electrically connected to said at least one solenoid operated pneumatic valve, wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle, wherein said collision warning device causes the solenoid of said at least one solenoid operated pneumatic valve to be energized when said closure time is at or below a pre-set time to collision value and causes each solenoid to remain energized until said closure time is above said pre-set time to collision value or until the vehicle brake pedal is pressed; c) a first air pressure reservoir pneumatically connected to said at least one solenoid operated pneumatic valve; d) front pneumatic brakes pneumatically connected to said at least one solenoid operated pneumatic valve, said front pneumatic brakes comprising a left front brake assembly and a right front brake assembly; and e) rear pneumatic brakes pneumatically connected to said at least one solenoid operated pneumatic valve, said rear pneumatic brakes comprising a left rear pneumatic brake unit and a right rear pneumatic brake unit, wherein each pneumatic brake unit comprises at least one pneumatic brake assembly;
wherein opening the at least one solenoid operated pneumatic valve activates automatic braking, wherein when the at least one solenoid operated pneumatic valve is open, air flows from the first air pressure reservoir through the at least one solenoid operated pneumatic valve and then concurrently flows to all of the front pneumatic brake assemblies and rear pneumatic brake assemblies, thereby concurrently engaging the front pneumatic brake assemblies and engaging pneumatic brake assemblies of the rear pneumatic brake units, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 2. The automatic braking system of claim 1 further comprising a left front anti-lock braking system control module pneumatically connected to the left front brake assembly and a right front anti-lock braking system control module pneumatically connected to the right front brake assembly, wherein said left front anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the left front brake assembly, and wherein said right front anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the right front brake assembly. 3. The automatic braking system of claim 2 wherein a front brake 2-way valve is pneumatically connected to the solenoid operated pneumatic valve and to each of the left front brake assembly and said right front brake assembly, wherein air is distributed to said left front brake assembly and said right front brake assembly by passing through a front connector gate, wherein said front brake 2-way valve is separately pneumatically connected to a front brake control valve and thereby allows air from the solenoid operated pneumatic valve to flow to the front pneumatic brake assemblies, and alternatively allows air from the front brake control valve to flow to the front pneumatic brake assemblies. 4. The automatic braking system of claim 1 wherein the left rear brake unit comprises at least two brake assemblies, and the right rear brake unit comprises at least two brake assemblies, and wherein the rear pneumatic brakes further comprise a left rear anti-lock braking system control module pneumatically connected to each brake assembly of the left rear brake unit and a right rear anti-lock braking system control module pneumatically connected to each brake assembly of the right rear brake unit, wherein said left rear anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the left rear brake unit, and wherein said right rear anti-lock braking system control module is pneumatically located between the solenoid operated pneumatic valve and the right front brake unit. 5. The automatic braking system of claim 1 further comprising a rear brake 2-way valve pneumatically connected to said solenoid operated pneumatic valve and separately pneumatically connected to a rear brake control valve, and further comprising a rear relay valve pneumatically connected to said rear brake 2-way valve, said rear relay valve being separately pneumatically connected to each of said rear pneumatic brake units, wherein said rear brake 2-way valve allows air from the solenoid operated pneumatic valve to flow to the rear pneumatic brake units after said air first passes through the rear relay valve, or alternatively allows air from the rear brake control valve to flow to the rear pneumatic brake units after first passing through the rear relay valve. 6. The automatic braking system of claim 1 wherein said actuation apparatus comprises only one solenoid operated pneumatic valve. 7. The automatic braking system of claim 1 wherein said actuation apparatus comprises a plurality of solenoid operated pneumatic valves, wherein each of said plurality of solenoid operated pneumatic valves has at least one air output port, wherein the diameter of the air output ports of each solenoid operated pneumatic valve is different than the diameter of the one air output ports of all other solenoid operated pneumatic valves, and wherein each of said plurality of solenoid operated pneumatic valves is energized at a different closure time value. 8. The automatic braking system of claim 7 wherein said actuation apparatus comprises a first solenoid operated pneumatic valve, a second solenoid operated pneumatic valve, a third solenoid operated pneumatic valve and a fourth solenoid operated pneumatic valve, wherein the diameter of the air output ports of said first solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the second solenoid operated pneumatic valve; wherein the diameter of the air output ports of said second solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the third solenoid operated pneumatic valve; and wherein the diameter of the air output ports of said third solenoid operated pneumatic valve are smaller than the diameter of the air output ports of the fourth solenoid operated pneumatic valve; and wherein the first solenoid operated pneumatic valve is energized at a greater closure time than the second solenoid operated pneumatic valve, wherein the second solenoid operated pneumatic valve is energized at a greater closure time than the third solenoid operated pneumatic valve, and wherein the third solenoid operated pneumatic valve is energized at a greater closure time than the fourth solenoid operated pneumatic valve. 9. The automatic braking system of claim 3 wherein said front brake control valve is pneumatically connected to said first air pressure reservoir. 10. The automatic braking system of claim 5 further comprising a connection gate pneumatically connected to both said rear brake control valve and said rear brake 2-way valve, wherein said connection gate is pneumatically located between said rear brake control valve and said rear brake 2-way valve. 11. The automatic braking system of claim 1 wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle by transmitting and receiving radar signals, sonar signals, laser signals, or a combination thereof. 12. The automatic braking system of claim 1 wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle by using a motion detecting, optical vision system without transmitting and receiving signals. 13. The automatic braking system of claim 5 wherein when the vehicle brake pedal is pressed, all open solenoid operated pneumatic valves close and air from the rear brake control valve is passed through the rear brake 2-way valve and transported to the brake assemblies of the rear pneumatic brake units. 14. The automatic braking system of claim 1 wherein electrical functions of the vehicle are controlled by a Controller Area Network Bus (CAN Bus) protocol, wherein the collision warning device is electrically connected to and electrically communicates with said CAN Bus, and wherein the collision warning device is directly connected to the solenoid operated pneumatic valves. 15. The automatic braking system of claim 1 wherein the vehicle further comprises a left turn signal and a right turn signal, wherein activating either of said left turn signal or said right turn signal causes deactivation of the automatic braking system. 16. The automatic braking system of claim 1 further comprising an electro-magnetic retarder mounted on a rear axle or on a drive shaft of the vehicle. 17. The automatic braking system of claim 1 wherein the solenoid operated pneumatic valve has a first output port pneumatically connected to the rear pneumatic brakes, a second output port pneumatically connected to the front pneumatic brakes, an input port pneumatically connected to said first air pressure reservoir, and an exhaust port. 18. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port has a diameter of about 3.0 mm or less. 19. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port has a diameter of from about 1.0 mm to about 2.5 mm. 20. The automatic braking system of claim 17 wherein each of said first outlet port and second outlet port have the same diameter. 21. An automatic braking system for a vehicle having pneumatic brakes and a vehicle brake pedal, the system comprising:
a) an actuation apparatus comprising at least one solenoid operated pneumatic valve, wherein the solenoid operated pneumatic valve comprises a solenoid, wherein said valve opens and remains open when the solenoid is energized, and closes and/or remains closed when the solenoid is not energized; b) one or more collision warning devices, each collision warning device being directly or indirectly electrically connected to the solenoid operated pneumatic valve, and each collision warning device comprising one or more sensors that continuously monitor for the presence of obstacles in proximity of at least one side and/or end of the vehicle, wherein each collision warning device causes the solenoid of said solenoid operated pneumatic valve to be energized when an obstacle is detected in proximity of at least one side and/or end of the vehicle and causes the solenoid to remain energized until said obstacle is no longer detected or until the vehicle brake pedal is pressed; c) a first air pressure reservoir pneumatically connected to said solenoid operated pneumatic valve; d) front pneumatic brakes pneumatically connected to the solenoid operated pneumatic valve, said front pneumatic brakes comprising a left front brake assembly and a right front brake assembly; and e) rear pneumatic brakes pneumatically connected to the solenoid operated pneumatic valve, said rear pneumatic brakes comprising a left rear pneumatic brake unit and a right rear pneumatic brake unit, wherein each pneumatic brake unit comprises at least one pneumatic brake assembly;
wherein opening the solenoid operated pneumatic valve activates automatic braking, wherein when the solenoid operated pneumatic valve is open, air flows from the first air pressure reservoir through the solenoid operated pneumatic valve and then concurrently flows to each of the rear pneumatic brake assemblies and optionally to each of the front pneumatic brake assemblies, thereby engaging the pneumatic brake assemblies of the rear pneumatic brake units and optionally engaging the front pneumatic brake assemblies concurrently with the rear pneumatic brake assemblies, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 22. A method of automatic braking of a moving vehicle that has pneumatic brakes and a vehicle brake pedal, the method comprising the steps of:
a) monitoring for the presence of obstacles that are either:
(i) in proximity of at least one side and/or end of the vehicle; or
(ii) within a pre-set time to collision value in front of the vehicle;
b) activating automatic braking when an object is either:
(i) detected in proximity of at least one side and/or end of the vehicle; or
(ii) detected within said pre-set time to collision value in front of the vehicle;
wherein automatic braking is activated by energizing at least one solenoid operated pneumatic valve which opens said energized solenoid operated pneumatic valve and initiates flow of air from an air pressure reservoir through said open solenoid operated pneumatic valve, wherein said air then flows concurrently to each of a front left pneumatic brake assembly, a front right pneumatic brake assembly, to rear left brake assemblies that form a rear left pneumatic brake unit and to rear right brake assemblies that form a pneumatic brake unit, thereby causing the concurrent engaging of all of said brakes assemblies; and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to de-energize, thereby causing all of said open solenoid operated pneumatic valves to close, and thereby deactivating automatic braking. 23. An automatic braking system for a vehicle having pneumatic brakes, which vehicle has a vehicle brake pedal and a plurality of wheels, each of said wheels being connected to a brake assembly and each of said wheels having a wheel sensor connected to the brake assembly of said wheel, the system comprising:
a) an actuation apparatus comprising a plurality of solenoid operated pneumatic valves, wherein each solenoid operated pneumatic valve comprises a solenoid and wherein each solenoid operated pneumatic valve opens and remains open when its solenoid is energized and closes and/or remains closed when its solenoid is not energized, wherein each solenoid operated pneumatic valve is pneumatically paired with one of said anti-lock braking system control modules; b) a collision warning device directly or indirectly electrically connected said solenoid operated pneumatic valves of the actuation apparatus, wherein the collision warning device continuously monitors the presence of obstacles in front of the vehicle and continuously calculates a closure time of the vehicle with a detected obstacle, wherein said collision warning device causes the concurrent energizing of the solenoid of each solenoid operated pneumatic valve when said closure time is at or below a pre-set time to collision value, and causes each solenoid to remain independently energized unless i) or ii) or iii):
i) said closure time increases to a value above said pre-set time to collision value, thereby de-energizing all of the solenoids of all of the solenoid operated pneumatic valves, thereby causing all of the solenoid operated pneumatic valves to concurrently close, thereby deactivating all automatic braking; or
ii) at least one of said wheel sensors detects that the brake assembly it is connected to has locked, thereby de-energizing the solenoid of the solenoid operated pneumatic valve that is connected to the locked brake assembly independently of the other wheels, thereby closing the solenoid operated pneumatic valve connected to the locked brake assembly, thereby deactivating automatic braking for the locked brake assembly; or
iii) the vehicle brake pedal is pressed;
c) a first air pressure reservoir pneumatically connected to each solenoid operated pneumatic valve; and
wherein opening the solenoid operated pneumatic valves activates automatic braking, wherein when the solenoid operated pneumatic valves are open, air flows from the first air pressure reservoir concurrently through each solenoid operated pneumatic valve and then concurrently flows toward all brake assemblies, thereby causing the concurrent engaging of all of said brake assemblies, and wherein pressing the vehicle brake pedal causes the solenoid of each open solenoid operated pneumatic valve to concurrently de-energize, thereby causing each of said open solenoid operated pneumatic valves to concurrently close, and thereby deactivating all automatic braking. | 3,600 |
348,613 | 16,806,076 | 3,633 | For three-dimensional topography measurement of a surface of an object patterned illumination is projected on the surface through an objective. A relative movement between the object and the objective is carried out, and plural images of the surface are recorded through the objective by a detector. The direction of the relative movement includes an oblique angle with an optical axis of the objective. Height information for a given position on the surface is derived from a variation of the intensity recorded from the respective position. Also, patterned illumination and uniform illumination may be projected alternatingly on the surface, while images of the surface are recorded during a relative movement of the object and the objective along an optical axis of the objective. Uniform illumination is used for obtaining height information for specular structures on the surface, patterned illumination is used for obtaining height information on other parts of the surface. | 1. A system for optical three-dimensional topography measurement of a surface of an object, the system comprising:
a source of patterned illumination; a source of uniform illumination; an objective, arranged to direct both the patterned illumination and the uniform illumination to the surface of the object; a detector arranged and configured for recording a plurality of images of the surface of the object through the objective; and a computer connected to the detector that is configured to determine height information for a position on the surface of the object based on differences in light intensity of the plurality of images, wherein the light intensity changes along a direction including at least a component along an optical axis of the objective. 2. The system of claim 1, wherein the source of patterned illumination includes a light source and a pattern mask. 3. The system of claim 2, wherein the pattern mask has a checkerboard pattern or a pinhole array. 4. The system of claim 2, wherein the pattern mask is a grating. 5. The system of claim 4, wherein the grating is an amplitude grating or a phase grating. 6. The system of claim 4, wherein the grating is a line grating or a sinusoidal grating or a cross-line grating. 7. The system of claim 4, wherein the grating is a blazed grating. 8. The system of claim 1, wherein a beam splitter is arranged in such a way that an imaging path between the objective and the detector and at least one of an illumination path between the source of patterned illumination and the objective and an illumination path between the source of uniform illumination and the objective pass through the beam splitter. 9. The system of claim 8, wherein both the illumination path between the source of patterned illumination and the objective and the illumination path between the source of uniform illumination and the objective pass through the beam splitter. 10. The system of claim 8, wherein the objective is positioned to correct diffraction caused by the beam splitter. 11. The system of claim 2, wherein the pattern mask and the detector are in conjugate planes. 12. The system of claim 1, wherein the direction of the relative movement is parallel to the optical axis of the objective. | For three-dimensional topography measurement of a surface of an object patterned illumination is projected on the surface through an objective. A relative movement between the object and the objective is carried out, and plural images of the surface are recorded through the objective by a detector. The direction of the relative movement includes an oblique angle with an optical axis of the objective. Height information for a given position on the surface is derived from a variation of the intensity recorded from the respective position. Also, patterned illumination and uniform illumination may be projected alternatingly on the surface, while images of the surface are recorded during a relative movement of the object and the objective along an optical axis of the objective. Uniform illumination is used for obtaining height information for specular structures on the surface, patterned illumination is used for obtaining height information on other parts of the surface.1. A system for optical three-dimensional topography measurement of a surface of an object, the system comprising:
a source of patterned illumination; a source of uniform illumination; an objective, arranged to direct both the patterned illumination and the uniform illumination to the surface of the object; a detector arranged and configured for recording a plurality of images of the surface of the object through the objective; and a computer connected to the detector that is configured to determine height information for a position on the surface of the object based on differences in light intensity of the plurality of images, wherein the light intensity changes along a direction including at least a component along an optical axis of the objective. 2. The system of claim 1, wherein the source of patterned illumination includes a light source and a pattern mask. 3. The system of claim 2, wherein the pattern mask has a checkerboard pattern or a pinhole array. 4. The system of claim 2, wherein the pattern mask is a grating. 5. The system of claim 4, wherein the grating is an amplitude grating or a phase grating. 6. The system of claim 4, wherein the grating is a line grating or a sinusoidal grating or a cross-line grating. 7. The system of claim 4, wherein the grating is a blazed grating. 8. The system of claim 1, wherein a beam splitter is arranged in such a way that an imaging path between the objective and the detector and at least one of an illumination path between the source of patterned illumination and the objective and an illumination path between the source of uniform illumination and the objective pass through the beam splitter. 9. The system of claim 8, wherein both the illumination path between the source of patterned illumination and the objective and the illumination path between the source of uniform illumination and the objective pass through the beam splitter. 10. The system of claim 8, wherein the objective is positioned to correct diffraction caused by the beam splitter. 11. The system of claim 2, wherein the pattern mask and the detector are in conjugate planes. 12. The system of claim 1, wherein the direction of the relative movement is parallel to the optical axis of the objective. | 3,600 |
348,614 | 16,806,075 | 3,633 | This disclosure provides a method and apparatus for connecting insulated wires to electrical components. More specifically, an apparatus that includes a wire guide designed to assist with the alignment of wires prior to termination of the wires to electrical components is disclosed. In an embodiment, the wire guide includes a body portion and a latching portion. The body portion includes at least one wire opening and is configured to mechanically secure one or more insulated wires in a desirable position. The latching portion is configured to secure the wire guide to a corresponding device such as an insulation displacement contact connector. A wire guide allows for insulated wires to be quickly and reliably positioned and secured relative to one another in order to safely and efficiently electrically and mechanically connect each insulated wire to a corresponding electrical component. | 1. A wire guide comprising:
a body portion comprising a wire opening, wherein the wire opening extends entirely through the body portion; and a latching portion connected to the body portion, wherein the latching portion comprises a latching prong configured to mechanically engage a corresponding portion of an electrical connector to secure the wire guide to the electrical connector. 2. The wire guide of claim 1, wherein the body portion consists of a single piece of electrically-insulative material. 3. The wire guide of claim 1, wherein the wire opening extends from a first surface of the body portion to a second surface of the body portion. 4. The wire guide of claim 3, wherein the latching portion comprises a second latching prong, wherein the first latching prong extends from a third surface of the body portion to a distal end of the first prong, and the second prong extends from a fourth surface of the body portion to a distal end of the second prong. 5. The wire guide of claim 4, wherein the first latching prong, the second latching prong, and the wire opening extend in generally the same direction. 6. The wire guide of claim 5, wherein the first latching prong and the second latching prong extend from the body portion to a distance past the second surface. 7. The wire guide of claim 5, wherein the first latching prong comprises a knob located on the distal end of the first prong that extends from the distal end of the first prong toward the second latching prong, and the second latching prong comprises a knob located on the distal end of the second prong that extends from the distal end of the second prong toward the first latching prong. 8. The wire guide of claim 3, wherein the at least one wire opening is circularly shaped and comprises a diameter, and wherein the diameter is constant as the wire opening extends from the first surface to the second surface. 9. The wire guide of claim 8, wherein the wire opening comprises retention ribs. 10. The wire guide of claim 9, wherein the retention ribs extend within the wire opening from the second surface toward the first surface within the wire opening. 11. The wire guide of claim 3, wherein the first surface extends along a first plane and the second surface extends along a second plane, and wherein the first plane and the second plane are parallel. 12. A system comprising:
an electrical connector comprising:
a housing comprising a wire alignment opening, an electrical contact opening, and a latch-receiving portion;
an electrical contact comprising a contact portion and a base portion;
wherein the wire alignment opening and the electrical contact opening perpendicularly intersect at an intersection within the housing;
wherein the wire alignment opening is configured to receive an insulated wire and align the insulated wire with the electrical contact opening at the intersection, and the electrical contact opening is configured to receive the contact portion;
a wire guide comprising:
a body portion comprising a wire opening, wherein the wire opening extends entirely through the body portion; and
a latching portion connected to the body portion, wherein the latching portion comprises a latching prong configured to mechanically engage the latch-receiving portion of the electrical connector to secure the wire guide to the electrical connector. 13. The system of claim 12, wherein the at least one wire opening is configured to align with the wire alignment opening. 14. The system of claim 12, wherein the latching portion comprises a second latching prong and the latch-receiving portion comprises a first notch on a first side of the housing and a second end notch located on a second side of the housing, wherein the first side is opposite of the second side. 15. A method of guiding a wire comprising:
inserting a first wire entirely through a wire opening in a wire guide; aligning a first surface of the wire guide with an electrical connector; manipulating the wire guide to insert the first wire into a first wire opening of the electrical connector; and joining a latching portion of the wire guide to a latch-receiving portion of the electrical connector. 16. The method of claim 15 further comprising:
inserting a second wire entirely through a second wire opening of the wire guide; and
manipulating the wire guide to insert the second wire opening of the electrical connector. 17. The method of claim 16 further comprising:
inserting a first electrical contact into the electrical connector, wherein the inserting causes a contact portion of the first electrical contact to electrically and mechanically connect to the first wire. 18. The method of claim 17, further comprising:
inserting a second electrical contact into the electrical connector, wherein the inserting of the second electrical contact causes a contact portion of the second electrical contact to electrically and mechanically connect to the second wire. 19. The method of claim 17, wherein the joining the latching portion and the latch-receiving portion comprises:
aligning a first latching prong with a first edge of a first side of the electrical connector; aligning a second latching prong with a second edge of a second side of the electrical connector; and joining the electrical connector and the wire guide together. 20. The method of claim 19, wherein joining the housing and the wire guide together causes a first knob of the first latching prong to enter a first notch on the first side on the electrical connector and causes a second knob of the second latching prong to enter a second notch on the second side of the electrical connector, and wherein the first side is opposite from the second side. | This disclosure provides a method and apparatus for connecting insulated wires to electrical components. More specifically, an apparatus that includes a wire guide designed to assist with the alignment of wires prior to termination of the wires to electrical components is disclosed. In an embodiment, the wire guide includes a body portion and a latching portion. The body portion includes at least one wire opening and is configured to mechanically secure one or more insulated wires in a desirable position. The latching portion is configured to secure the wire guide to a corresponding device such as an insulation displacement contact connector. A wire guide allows for insulated wires to be quickly and reliably positioned and secured relative to one another in order to safely and efficiently electrically and mechanically connect each insulated wire to a corresponding electrical component.1. A wire guide comprising:
a body portion comprising a wire opening, wherein the wire opening extends entirely through the body portion; and a latching portion connected to the body portion, wherein the latching portion comprises a latching prong configured to mechanically engage a corresponding portion of an electrical connector to secure the wire guide to the electrical connector. 2. The wire guide of claim 1, wherein the body portion consists of a single piece of electrically-insulative material. 3. The wire guide of claim 1, wherein the wire opening extends from a first surface of the body portion to a second surface of the body portion. 4. The wire guide of claim 3, wherein the latching portion comprises a second latching prong, wherein the first latching prong extends from a third surface of the body portion to a distal end of the first prong, and the second prong extends from a fourth surface of the body portion to a distal end of the second prong. 5. The wire guide of claim 4, wherein the first latching prong, the second latching prong, and the wire opening extend in generally the same direction. 6. The wire guide of claim 5, wherein the first latching prong and the second latching prong extend from the body portion to a distance past the second surface. 7. The wire guide of claim 5, wherein the first latching prong comprises a knob located on the distal end of the first prong that extends from the distal end of the first prong toward the second latching prong, and the second latching prong comprises a knob located on the distal end of the second prong that extends from the distal end of the second prong toward the first latching prong. 8. The wire guide of claim 3, wherein the at least one wire opening is circularly shaped and comprises a diameter, and wherein the diameter is constant as the wire opening extends from the first surface to the second surface. 9. The wire guide of claim 8, wherein the wire opening comprises retention ribs. 10. The wire guide of claim 9, wherein the retention ribs extend within the wire opening from the second surface toward the first surface within the wire opening. 11. The wire guide of claim 3, wherein the first surface extends along a first plane and the second surface extends along a second plane, and wherein the first plane and the second plane are parallel. 12. A system comprising:
an electrical connector comprising:
a housing comprising a wire alignment opening, an electrical contact opening, and a latch-receiving portion;
an electrical contact comprising a contact portion and a base portion;
wherein the wire alignment opening and the electrical contact opening perpendicularly intersect at an intersection within the housing;
wherein the wire alignment opening is configured to receive an insulated wire and align the insulated wire with the electrical contact opening at the intersection, and the electrical contact opening is configured to receive the contact portion;
a wire guide comprising:
a body portion comprising a wire opening, wherein the wire opening extends entirely through the body portion; and
a latching portion connected to the body portion, wherein the latching portion comprises a latching prong configured to mechanically engage the latch-receiving portion of the electrical connector to secure the wire guide to the electrical connector. 13. The system of claim 12, wherein the at least one wire opening is configured to align with the wire alignment opening. 14. The system of claim 12, wherein the latching portion comprises a second latching prong and the latch-receiving portion comprises a first notch on a first side of the housing and a second end notch located on a second side of the housing, wherein the first side is opposite of the second side. 15. A method of guiding a wire comprising:
inserting a first wire entirely through a wire opening in a wire guide; aligning a first surface of the wire guide with an electrical connector; manipulating the wire guide to insert the first wire into a first wire opening of the electrical connector; and joining a latching portion of the wire guide to a latch-receiving portion of the electrical connector. 16. The method of claim 15 further comprising:
inserting a second wire entirely through a second wire opening of the wire guide; and
manipulating the wire guide to insert the second wire opening of the electrical connector. 17. The method of claim 16 further comprising:
inserting a first electrical contact into the electrical connector, wherein the inserting causes a contact portion of the first electrical contact to electrically and mechanically connect to the first wire. 18. The method of claim 17, further comprising:
inserting a second electrical contact into the electrical connector, wherein the inserting of the second electrical contact causes a contact portion of the second electrical contact to electrically and mechanically connect to the second wire. 19. The method of claim 17, wherein the joining the latching portion and the latch-receiving portion comprises:
aligning a first latching prong with a first edge of a first side of the electrical connector; aligning a second latching prong with a second edge of a second side of the electrical connector; and joining the electrical connector and the wire guide together. 20. The method of claim 19, wherein joining the housing and the wire guide together causes a first knob of the first latching prong to enter a first notch on the first side on the electrical connector and causes a second knob of the second latching prong to enter a second notch on the second side of the electrical connector, and wherein the first side is opposite from the second side. | 3,600 |
348,615 | 16,806,117 | 3,633 | Example systems, apparatuses and methods are disclosed for gear reduction. An example system comprises a second gear configured to be disposed in mesh with a first gear coupled to an input shaft. The system further comprises a carrier housing configured to be fixably disposed within the second gear. The system further comprises a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear. The second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation. | 1. A system for gear reduction, the system comprising:
a second gear configured to be disposed in mesh with a first gear coupled to an input shaft; a carrier housing configured to be fixably disposed within the second gear; a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation, and wherein the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common gear interaction plane. 2. The system of claim 1, wherein the first gear is an input shaft drive gear. 3. The system of claim 1, wherein the second gear is a sun gear. 4. The system of claim 1, wherein the third gear is an planet gear. 5. The system of claim 1, wherein the fourth gear is a stationary gear. 6. The system of claim 1, wherein the fifth gear is an opposing gear of the fourth gear. 7. The system of claim 1, wherein the system further comprises the first gear. 8. The system of claim 1, wherein the system further comprises a sixth gear coupled to the fifth gear and configured to be disposed in mesh with a seventh gear coupled to a sensing device. 9. The system of claim 8, wherein the sensing device is a rotary position sensing device. 10. The system of claim 8, wherein the system further comprises the seventh gear. 11. The system of claim 10, wherein the anti-backlash gear is a first anti-backlash gear, and wherein the system further comprises a second anti-backlash gear coupled to the seventh gear and configured to be disposed in mesh with the sixth gear. 12. The system of claim 10, wherein the common gear interaction plane is a first gear interaction plane, and wherein the sixth gear and the seventh gear are configured to be disposed along a second gear interaction plane different from the first gear interaction plane. 13. The system of claim 1, wherein the first gear and the second gear are configured to form a first gear reduction stage. 14. The system of claim 13, wherein the second gear, the third gear, the fourth gear, and the fifth gear are configured to form a second gear reduction stage different from the first gear reduction stage. 15. The system of claim 1, wherein the first gear is configured to be disposed along a first axis of rotation, and wherein the common axis of rotation is a second axis of rotation different from the first axis of rotation. 16. The system of claim 15, wherein the third gear is configured to be disposed along a third axis of rotation different from the first axis of rotation and the second axis of rotation. 17. An apparatus for gear reduction, the apparatus comprising:
a second gear configured to be disposed in mesh with a first gear coupled to an input shaft; a carrier housing configured to be fixably disposed within the second gear; a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation, wherein the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common gear interaction plane. 18. A method for manufacturing an apparatus for gear reduction, the method comprising:
providing a first gear, wherein the first gear is coupled to an input shaft; mounting a second gear to the first gear, wherein the second gear is in mesh with the first gear; mounting a carrier housing within the second gear; mounting a third gear within the carrier housing; mounting a fourth gear to the third gear, wherein the fourth gear is in mesh with the third gear, and wherein the third gear is rotatable about the fourth gear; mounting an anti-backlash gear to the third gear, wherein the anti-backlash gear is coupled to the fourth gear and in mesh with the third gear; and mounting a fifth gear to the third gear, wherein the fifth gear is in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are disposed along a common axis of rotation, and wherein the first gear, the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are disposed along a common gear interaction plane. 19. The method of claim 18, wherein the anti-backlash gear is a first anti-backlash gear, and wherein the method further comprises:
mounting a sixth gear to the fifth gear, wherein the sixth gear is coupled to the fifth gear; mounting a seventh gear to the sixth gear, wherein the seventh gear is in mesh with the sixth gear, and wherein the seventh gear is coupled to a sensing device; and mounting a second anti-backlash gear to the seventh gear, wherein the second anti-backlash gear is coupled to the seventh gear, and wherein the second anti-backlash gear is in mesh with the sixth gear. 20. An apparatus manufactured according to the method of claim 18. | Example systems, apparatuses and methods are disclosed for gear reduction. An example system comprises a second gear configured to be disposed in mesh with a first gear coupled to an input shaft. The system further comprises a carrier housing configured to be fixably disposed within the second gear. The system further comprises a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear. The second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation.1. A system for gear reduction, the system comprising:
a second gear configured to be disposed in mesh with a first gear coupled to an input shaft; a carrier housing configured to be fixably disposed within the second gear; a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation, and wherein the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common gear interaction plane. 2. The system of claim 1, wherein the first gear is an input shaft drive gear. 3. The system of claim 1, wherein the second gear is a sun gear. 4. The system of claim 1, wherein the third gear is an planet gear. 5. The system of claim 1, wherein the fourth gear is a stationary gear. 6. The system of claim 1, wherein the fifth gear is an opposing gear of the fourth gear. 7. The system of claim 1, wherein the system further comprises the first gear. 8. The system of claim 1, wherein the system further comprises a sixth gear coupled to the fifth gear and configured to be disposed in mesh with a seventh gear coupled to a sensing device. 9. The system of claim 8, wherein the sensing device is a rotary position sensing device. 10. The system of claim 8, wherein the system further comprises the seventh gear. 11. The system of claim 10, wherein the anti-backlash gear is a first anti-backlash gear, and wherein the system further comprises a second anti-backlash gear coupled to the seventh gear and configured to be disposed in mesh with the sixth gear. 12. The system of claim 10, wherein the common gear interaction plane is a first gear interaction plane, and wherein the sixth gear and the seventh gear are configured to be disposed along a second gear interaction plane different from the first gear interaction plane. 13. The system of claim 1, wherein the first gear and the second gear are configured to form a first gear reduction stage. 14. The system of claim 13, wherein the second gear, the third gear, the fourth gear, and the fifth gear are configured to form a second gear reduction stage different from the first gear reduction stage. 15. The system of claim 1, wherein the first gear is configured to be disposed along a first axis of rotation, and wherein the common axis of rotation is a second axis of rotation different from the first axis of rotation. 16. The system of claim 15, wherein the third gear is configured to be disposed along a third axis of rotation different from the first axis of rotation and the second axis of rotation. 17. An apparatus for gear reduction, the apparatus comprising:
a second gear configured to be disposed in mesh with a first gear coupled to an input shaft; a carrier housing configured to be fixably disposed within the second gear; a third gear configured to be disposed within the carrier housing; a fourth gear configured to be disposed in mesh with the third gear, wherein the third gear is further configured to rotate about the fourth gear; an anti-backlash gear coupled to the fourth gear and configured to be disposed in mesh with the third gear; and a fifth gear configured to be disposed in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common axis of rotation, wherein the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are configured to be disposed along a common gear interaction plane. 18. A method for manufacturing an apparatus for gear reduction, the method comprising:
providing a first gear, wherein the first gear is coupled to an input shaft; mounting a second gear to the first gear, wherein the second gear is in mesh with the first gear; mounting a carrier housing within the second gear; mounting a third gear within the carrier housing; mounting a fourth gear to the third gear, wherein the fourth gear is in mesh with the third gear, and wherein the third gear is rotatable about the fourth gear; mounting an anti-backlash gear to the third gear, wherein the anti-backlash gear is coupled to the fourth gear and in mesh with the third gear; and mounting a fifth gear to the third gear, wherein the fifth gear is in mesh with the third gear, wherein the second gear, the fourth gear, the anti-backlash gear, and the fifth gear are disposed along a common axis of rotation, and wherein the first gear, the second gear, the third gear, the fourth gear, the anti-backlash gear, and the fifth gear are disposed along a common gear interaction plane. 19. The method of claim 18, wherein the anti-backlash gear is a first anti-backlash gear, and wherein the method further comprises:
mounting a sixth gear to the fifth gear, wherein the sixth gear is coupled to the fifth gear; mounting a seventh gear to the sixth gear, wherein the seventh gear is in mesh with the sixth gear, and wherein the seventh gear is coupled to a sensing device; and mounting a second anti-backlash gear to the seventh gear, wherein the second anti-backlash gear is coupled to the seventh gear, and wherein the second anti-backlash gear is in mesh with the sixth gear. 20. An apparatus manufactured according to the method of claim 18. | 3,600 |
348,616 | 16,806,136 | 3,652 | Lift assemblies and methods of operating same. A lift assembly for a vehicle includes at least one support member having a longitudinal axis lying on a plane and which is configured for attachment to the vehicle. A mast having a proximal end, a distal end, and a mast axis is pivotably coupled with the at least one support member at the mast proximal end. At least one gear arrangement is coupled between the at least one support member and the mast proximal end. The mast is pivotable relative to the at least one support member about an axis parallel with the plane through an angular displacement greater than 90 degrees. A boom is pivotably coupled with the mast proximate the mast distal end, and a first lift line is coupled with the boom. | 1. A lift assembly for a vehicle, the lift assembly comprising:
at least one support member, the support member having a longitudinal axis lying on a plane, the at least one support member configured for attachment to the vehicle; a mast having a proximal end and a distal end, the mast having a mast axis, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end; at least one gear arrangement coupled between the at least one support member and the mast proximal end; wherein the mast is pivotable relative to the at least one support member about an axis parallel with the plane through an angular displacement greater than 90 degrees; a boom pivotably coupled with the mast proximate the mast distal end; and a first lift line coupled with the boom. 2. The lift assembly of claim 1, wherein the gear arrangement comprises a curved surface disposed at the proximal end of the mast and a plurality of gear teeth disposed on the curved surface, wherein the plurality of gear teeth are in mating engagement with a worm coupled with the at least one support member. 3. The lift assembly of claim 2, wherein the curved surface is provided on a block that is coupled with the at least one support member, and further comprising a rod extending from the block internal to the mast, wherein the mast is rotatable relative to the longitudinal axis of the rod. 4. The lift assembly of claim 1, wherein the gear arrangement is driven by an electric motor in operative electronic communication with a controller. 5. The lift assembly of claim 4, wherein the controller and electric motor are powered by the vehicle. 6. The lift assembly of claim 1, further comprising a support strut having a first end and an opposite second end, wherein the first end is slidably coupled with the mast and the second end is pivotably connected with the boom, and wherein the first end has a path of travel along the mast between a lower position, at which the first end is disposed away from the distal end of the mast, and an upper position, at which the first end is proximate the distal end of the mast. 7. The lift assembly of claim 6, further comprising a second lift line extending from a pin coupled with the support strut first end, through a pulley coupled with the mast proximate the mast distal end, and to a winch coupled with the mast. 8. The lift assembly of claim 7, wherein operation of the winch in a first direction causes the boom to pivot relative to the mast. 9. The lift assembly of claim 6, further comprising at least one stop bar pivotably coupled with the mast, wherein the stop bar is normally biased to a position that prevents translation of the strut first end from the upper position to the lower position, and wherein the stop bar permits translation of the strut first end from the lower position to the upper position. 10. The lift assembly of claim 9, wherein the at least one stop bar is pivotable relative to the mast in response to actuation of an electromagnet. 11. The lift assembly of claim 1, wherein the mast is pivotable relative to the at least one support member about the axis parallel with the plane through an angular displacement of about 135 degrees. 12. A method of operating a lift assembly for a vehicle, the method comprising:
providing a lift assembly comprising:
at least one support member, the at least one support member having a longitudinal axis;
a mast having a proximal end and a distal end, the mast having a mast axis, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end via at least one first gear;
a boom pivotably coupled with the mast proximate the mast distal end; and
a lift line coupled with the boom;
coupling the lift assembly with a roof rack of the vehicle; and turning the at least one first gear to cause the mast to pivot from a first position, at which the mast axis and the longitudinal axis extend along parallel planes, to a second position, at which the mast axis extends along a plane that is disposed at an angle to the plane along which the longitudinal axis extends, wherein the angle exceeds 90 degrees. 13. The method of claim 12, wherein the coupling operation comprises securing a plurality of clamps to the roof rack. 14. The method of claim 12, comprising providing electronic communication between a controller and the lift assembly. 15. The method of claim 14, wherein the turning operation comprises actuating an electric motor to rotate a worm. 16. The method of claim 14, comprising operating an electric motor to cause the boom to pivot relative to the mast. 17. The method of claim 14, comprising rotating the mast about the mast axis relative to the at least one support member by operating an electric motor coupled with at least one second gear. 18. A method of operating a lift assembly for a vehicle, the vehicle being disposed on a non-level surface, the method comprising:
providing a lift assembly comprising:
at least one support member;
a plurality of jacks coupled with the at least one support member;
a mast having a proximal end and a distal end, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end via at least one gear;
a boom pivotably coupled with the mast proximate the mast distal end; and
a lift line coupled with the boom;
coupling the lift assembly with a roof rack of the vehicle such that the plurality of jacks are disposed between the roof rack and the at least one support member; actuating at least one of the plurality of jacks to level the at least one support member relative to a horizontal plane; and turning the at least one gear to level the mast relative to a vertical plane disposed at a right angle to the horizontal plane. 19. The method of claim 18, wherein the vehicle roof rack comprises a pair of cross members, and wherein a longitudinal axis of the mast extends through one of the cross members when the mast is leveled relative to the vertical plane. 20. The method of claim 18, further comprising a hinge disposed between the roof rack of the vehicle and each of the plurality of jacks. 21. The method of claim 18, further comprising a first bubble level disposed on the mast and a second bubble level disposed on the at least one support member. | Lift assemblies and methods of operating same. A lift assembly for a vehicle includes at least one support member having a longitudinal axis lying on a plane and which is configured for attachment to the vehicle. A mast having a proximal end, a distal end, and a mast axis is pivotably coupled with the at least one support member at the mast proximal end. At least one gear arrangement is coupled between the at least one support member and the mast proximal end. The mast is pivotable relative to the at least one support member about an axis parallel with the plane through an angular displacement greater than 90 degrees. A boom is pivotably coupled with the mast proximate the mast distal end, and a first lift line is coupled with the boom.1. A lift assembly for a vehicle, the lift assembly comprising:
at least one support member, the support member having a longitudinal axis lying on a plane, the at least one support member configured for attachment to the vehicle; a mast having a proximal end and a distal end, the mast having a mast axis, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end; at least one gear arrangement coupled between the at least one support member and the mast proximal end; wherein the mast is pivotable relative to the at least one support member about an axis parallel with the plane through an angular displacement greater than 90 degrees; a boom pivotably coupled with the mast proximate the mast distal end; and a first lift line coupled with the boom. 2. The lift assembly of claim 1, wherein the gear arrangement comprises a curved surface disposed at the proximal end of the mast and a plurality of gear teeth disposed on the curved surface, wherein the plurality of gear teeth are in mating engagement with a worm coupled with the at least one support member. 3. The lift assembly of claim 2, wherein the curved surface is provided on a block that is coupled with the at least one support member, and further comprising a rod extending from the block internal to the mast, wherein the mast is rotatable relative to the longitudinal axis of the rod. 4. The lift assembly of claim 1, wherein the gear arrangement is driven by an electric motor in operative electronic communication with a controller. 5. The lift assembly of claim 4, wherein the controller and electric motor are powered by the vehicle. 6. The lift assembly of claim 1, further comprising a support strut having a first end and an opposite second end, wherein the first end is slidably coupled with the mast and the second end is pivotably connected with the boom, and wherein the first end has a path of travel along the mast between a lower position, at which the first end is disposed away from the distal end of the mast, and an upper position, at which the first end is proximate the distal end of the mast. 7. The lift assembly of claim 6, further comprising a second lift line extending from a pin coupled with the support strut first end, through a pulley coupled with the mast proximate the mast distal end, and to a winch coupled with the mast. 8. The lift assembly of claim 7, wherein operation of the winch in a first direction causes the boom to pivot relative to the mast. 9. The lift assembly of claim 6, further comprising at least one stop bar pivotably coupled with the mast, wherein the stop bar is normally biased to a position that prevents translation of the strut first end from the upper position to the lower position, and wherein the stop bar permits translation of the strut first end from the lower position to the upper position. 10. The lift assembly of claim 9, wherein the at least one stop bar is pivotable relative to the mast in response to actuation of an electromagnet. 11. The lift assembly of claim 1, wherein the mast is pivotable relative to the at least one support member about the axis parallel with the plane through an angular displacement of about 135 degrees. 12. A method of operating a lift assembly for a vehicle, the method comprising:
providing a lift assembly comprising:
at least one support member, the at least one support member having a longitudinal axis;
a mast having a proximal end and a distal end, the mast having a mast axis, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end via at least one first gear;
a boom pivotably coupled with the mast proximate the mast distal end; and
a lift line coupled with the boom;
coupling the lift assembly with a roof rack of the vehicle; and turning the at least one first gear to cause the mast to pivot from a first position, at which the mast axis and the longitudinal axis extend along parallel planes, to a second position, at which the mast axis extends along a plane that is disposed at an angle to the plane along which the longitudinal axis extends, wherein the angle exceeds 90 degrees. 13. The method of claim 12, wherein the coupling operation comprises securing a plurality of clamps to the roof rack. 14. The method of claim 12, comprising providing electronic communication between a controller and the lift assembly. 15. The method of claim 14, wherein the turning operation comprises actuating an electric motor to rotate a worm. 16. The method of claim 14, comprising operating an electric motor to cause the boom to pivot relative to the mast. 17. The method of claim 14, comprising rotating the mast about the mast axis relative to the at least one support member by operating an electric motor coupled with at least one second gear. 18. A method of operating a lift assembly for a vehicle, the vehicle being disposed on a non-level surface, the method comprising:
providing a lift assembly comprising:
at least one support member;
a plurality of jacks coupled with the at least one support member;
a mast having a proximal end and a distal end, wherein the mast is pivotably coupled with the at least one support member at the mast proximal end via at least one gear;
a boom pivotably coupled with the mast proximate the mast distal end; and
a lift line coupled with the boom;
coupling the lift assembly with a roof rack of the vehicle such that the plurality of jacks are disposed between the roof rack and the at least one support member; actuating at least one of the plurality of jacks to level the at least one support member relative to a horizontal plane; and turning the at least one gear to level the mast relative to a vertical plane disposed at a right angle to the horizontal plane. 19. The method of claim 18, wherein the vehicle roof rack comprises a pair of cross members, and wherein a longitudinal axis of the mast extends through one of the cross members when the mast is leveled relative to the vertical plane. 20. The method of claim 18, further comprising a hinge disposed between the roof rack of the vehicle and each of the plurality of jacks. 21. The method of claim 18, further comprising a first bubble level disposed on the mast and a second bubble level disposed on the at least one support member. | 3,600 |
348,617 | 16,806,108 | 3,652 | Various embodiments of the present application are directed towards a group III-V device including a rough buffer layer. The rough buffer layer overlies a silicon substrate, a buffer structure overlies the rough buffer layer, and a heterojunction structure overlies the buffer structure. The buffer structure causes band bending and formation of a two-dimensional hole gas (2DHG) in the rough buffer layer. The rough buffer layer includes silicon or some other suitable semiconductor material and, in some embodiments, is doped. A top surface of the rough buffer layer and/or a bottom surface of the rough buffer layer is/are rough to promote carrier scattering along the top and bottom surfaces. The carrier scattering reduces carrier mobility and increases resistance at the 2DHG. The increased resistance increases an overall resistance of the silicon substrate, which reduces substrate loses and increases a power added efficiency (PAE). | 1. A semiconductor device comprising:
a substrate; a group III-V buffer structure overlying the substrate; a group III-V heterojunction structure overlying the group III-V buffer structure; a pair of source/drain electrodes overlying the group III-V heterojunction structure; a gate electrode overlying the group III-V heterojunction structure, laterally between the source/drain electrodes; and a rough buffer layer between the substrate and the group III-V buffer structure, wherein the rough buffer layer directly contacts the substrate and the group III-V buffer structure respectively at a first interface and a second interface, wherein the first interface is rough throughout and/or the second interface is rough throughout, and wherein the rough buffer layer shares a common semiconductor element with the substrate. 2. The semiconductor device according to claim 1, wherein the first or second interface has a wavy profile alternating between randomly sized bumps. 3. The semiconductor device according to claim 1, wherein a thickness of the rough buffer layer varies throughout the rough buffer layer. 4. The semiconductor device according to claim 3, wherein the thickness of the rough buffer layer has a maximum thickness value and a minimum thickness value, and wherein the maximum thickness value is about 1.2-5.1 times the minimum thickness value. 5. The semiconductor device according to claim 1, wherein the first and second interfaces are rough throughout. 6. The semiconductor device according to claim 1, wherein the rough buffer layer comprises monocrystalline silicon doped with carbon, magnesium, zinc, arsenic, or phosphorous. 7. The semiconductor device according to claim 1, wherein the group III-V buffer structure comprises:
an aluminum nitride layer overlying and directly contacting the rough buffer layer; and a graded aluminum gallium nitride layer overlying the aluminum nitride layer and having an atomic percentage of aluminum that is graded from top to bottom. 8. A semiconductor device comprising:
a silicon substrate; a group III-V buffer structure overlying the silicon substrate; a group III-V heterojunction structure overlying the group III-V buffer structure; a pair of source/drain electrodes overlying the group III-V heterojunction structure; a gate electrode overlying the group III-V heterojunction structure, laterally between the source/drain electrodes; a buffer layer between the silicon substrate and the group III-V buffer structure; and a two-dimensional hole gas (2DHG) in the buffer layer, wherein a top surface of the buffer layer and/or a bottom surface of the buffer layer is/are configured to scatter mobile holes in the 2DHG to reduce carrier mobility at the 2DHG. 9. The semiconductor device according to claim 8, wherein the top and bottom surfaces of the buffer layer have a plurality of randomly sized bumps arranged throughout. 10. The semiconductor device according to claim 8, wherein one of the top and bottom surfaces of the buffer layer is rough compared to another one of the top and bottom surfaces of the buffer layer. 11. The semiconductor device according to claim 8, wherein the buffer layer comprises silicon doped with an n-type dopant, and wherein the silicon substrate is substantially devoid of the n-type dopant. 12. The semiconductor device according to claim 8, wherein the group III-V buffer structure comprises a group III-V layer consisting essentially of aluminum and nitride, and wherein the group III-V layer overlies and directly contacts the buffer layer. 13. The semiconductor device according to claim 12, wherein the buffer layer consists essentially of doped silicon. 14. A method for forming a semiconductor device, the method comprising:
depositing a rough buffer layer over and directly contacting a top surface of a substrate, wherein the depositing of the rough buffer layer roughens the top surface of the substrate; depositing a seed buffer layer over and directly contacting the rough buffer layer; forming heterojunction structure overlying the seed buffer layer; forming a pair of source/drain electrodes on the heterojunction structure; and forming a gate electrode on the heterojunction structure, laterally between the source/drain electrodes. 15. The method according to claim 14, wherein the rough buffer layer is deposited in a first process chamber, and wherein the seed buffer layer is deposited in a second process chamber different than the first process chamber. 16. The method according to claim 14, wherein the depositing of the rough buffer layer comprises metal organic chemical vapor deposition (MOCVD) using a first precursor comprising silicon and a second precursor comprising carbon, magnesium, or zinc. 17. The method according to claim 14, wherein the depositing of the rough buffer layer is performed by a silicon epitaxial tool and forms the rough buffer layer comprising silicon doped with arsenic or phosphorous. 18. The method according to claim 14, wherein the rough buffer layer and the seed buffer layer are deposited in a common process chamber. 19. The method according to claim 18, wherein the rough buffer layer and the seed buffer layer are deposited by a shared metal organic chemical vapor deposition (MOCVD) process, and wherein the shared MOCVD process comprises:
introducing a first precursor, but not a second precursor, into the common process chamber to form the rough buffer layer; and after forming the rough buffer layer, introducing both the first and second precursors into the common process chamber to form the seed buffer layer. 20. The method according to claim 14, wherein the seed buffer layer induces formation of a two-dimensional hole gas (2DHG) along the top surface of the substrate. | Various embodiments of the present application are directed towards a group III-V device including a rough buffer layer. The rough buffer layer overlies a silicon substrate, a buffer structure overlies the rough buffer layer, and a heterojunction structure overlies the buffer structure. The buffer structure causes band bending and formation of a two-dimensional hole gas (2DHG) in the rough buffer layer. The rough buffer layer includes silicon or some other suitable semiconductor material and, in some embodiments, is doped. A top surface of the rough buffer layer and/or a bottom surface of the rough buffer layer is/are rough to promote carrier scattering along the top and bottom surfaces. The carrier scattering reduces carrier mobility and increases resistance at the 2DHG. The increased resistance increases an overall resistance of the silicon substrate, which reduces substrate loses and increases a power added efficiency (PAE).1. A semiconductor device comprising:
a substrate; a group III-V buffer structure overlying the substrate; a group III-V heterojunction structure overlying the group III-V buffer structure; a pair of source/drain electrodes overlying the group III-V heterojunction structure; a gate electrode overlying the group III-V heterojunction structure, laterally between the source/drain electrodes; and a rough buffer layer between the substrate and the group III-V buffer structure, wherein the rough buffer layer directly contacts the substrate and the group III-V buffer structure respectively at a first interface and a second interface, wherein the first interface is rough throughout and/or the second interface is rough throughout, and wherein the rough buffer layer shares a common semiconductor element with the substrate. 2. The semiconductor device according to claim 1, wherein the first or second interface has a wavy profile alternating between randomly sized bumps. 3. The semiconductor device according to claim 1, wherein a thickness of the rough buffer layer varies throughout the rough buffer layer. 4. The semiconductor device according to claim 3, wherein the thickness of the rough buffer layer has a maximum thickness value and a minimum thickness value, and wherein the maximum thickness value is about 1.2-5.1 times the minimum thickness value. 5. The semiconductor device according to claim 1, wherein the first and second interfaces are rough throughout. 6. The semiconductor device according to claim 1, wherein the rough buffer layer comprises monocrystalline silicon doped with carbon, magnesium, zinc, arsenic, or phosphorous. 7. The semiconductor device according to claim 1, wherein the group III-V buffer structure comprises:
an aluminum nitride layer overlying and directly contacting the rough buffer layer; and a graded aluminum gallium nitride layer overlying the aluminum nitride layer and having an atomic percentage of aluminum that is graded from top to bottom. 8. A semiconductor device comprising:
a silicon substrate; a group III-V buffer structure overlying the silicon substrate; a group III-V heterojunction structure overlying the group III-V buffer structure; a pair of source/drain electrodes overlying the group III-V heterojunction structure; a gate electrode overlying the group III-V heterojunction structure, laterally between the source/drain electrodes; a buffer layer between the silicon substrate and the group III-V buffer structure; and a two-dimensional hole gas (2DHG) in the buffer layer, wherein a top surface of the buffer layer and/or a bottom surface of the buffer layer is/are configured to scatter mobile holes in the 2DHG to reduce carrier mobility at the 2DHG. 9. The semiconductor device according to claim 8, wherein the top and bottom surfaces of the buffer layer have a plurality of randomly sized bumps arranged throughout. 10. The semiconductor device according to claim 8, wherein one of the top and bottom surfaces of the buffer layer is rough compared to another one of the top and bottom surfaces of the buffer layer. 11. The semiconductor device according to claim 8, wherein the buffer layer comprises silicon doped with an n-type dopant, and wherein the silicon substrate is substantially devoid of the n-type dopant. 12. The semiconductor device according to claim 8, wherein the group III-V buffer structure comprises a group III-V layer consisting essentially of aluminum and nitride, and wherein the group III-V layer overlies and directly contacts the buffer layer. 13. The semiconductor device according to claim 12, wherein the buffer layer consists essentially of doped silicon. 14. A method for forming a semiconductor device, the method comprising:
depositing a rough buffer layer over and directly contacting a top surface of a substrate, wherein the depositing of the rough buffer layer roughens the top surface of the substrate; depositing a seed buffer layer over and directly contacting the rough buffer layer; forming heterojunction structure overlying the seed buffer layer; forming a pair of source/drain electrodes on the heterojunction structure; and forming a gate electrode on the heterojunction structure, laterally between the source/drain electrodes. 15. The method according to claim 14, wherein the rough buffer layer is deposited in a first process chamber, and wherein the seed buffer layer is deposited in a second process chamber different than the first process chamber. 16. The method according to claim 14, wherein the depositing of the rough buffer layer comprises metal organic chemical vapor deposition (MOCVD) using a first precursor comprising silicon and a second precursor comprising carbon, magnesium, or zinc. 17. The method according to claim 14, wherein the depositing of the rough buffer layer is performed by a silicon epitaxial tool and forms the rough buffer layer comprising silicon doped with arsenic or phosphorous. 18. The method according to claim 14, wherein the rough buffer layer and the seed buffer layer are deposited in a common process chamber. 19. The method according to claim 18, wherein the rough buffer layer and the seed buffer layer are deposited by a shared metal organic chemical vapor deposition (MOCVD) process, and wherein the shared MOCVD process comprises:
introducing a first precursor, but not a second precursor, into the common process chamber to form the rough buffer layer; and after forming the rough buffer layer, introducing both the first and second precursors into the common process chamber to form the seed buffer layer. 20. The method according to claim 14, wherein the seed buffer layer induces formation of a two-dimensional hole gas (2DHG) along the top surface of the substrate. | 3,600 |
348,618 | 16,806,130 | 1,749 | The invention relates to a toroidal forming drum and a process for building tyres. The toroidal forming drum (23) is expanded within a shaped carcass sleeve (12), for supporting the carcass sleeve (12) against an abutment surface (“S”) externally provided by the forming drum (23). An elementary semi-finished product (54 a, 54 b) is applied around the shaped carcass sleeve (12), by pressing said elementary semi-finished product (54 a, 54 b) towards the abutment surface (“S”). The abutment surface (“S”) has circumferential rows of solid portions (40) alternated with hollow portions (41). The solid portions (40), arranged along axially opposite circumferential edges of the abutment surface (“S”), have a transverse size comprised between 10% and 60% of a transverse size presented by the solid portions (40) arranged in proximity to an axial centreline plane of the abutment surface (“S”). | 1-37. (canceled) 38. A process for building tyres, comprising:
building a carcass sleeve, shaping the carcass sleeve according to a toroidal configuration to form a shaped carcass sleeve, engaging a toroidal forming drum within the shaped carcass sleeve, for supporting the shaped carcass sleeve against a radially external abutment surface provided by the forming drum, and applying at least one elementary semi-finished product around the shaped carcass sleeve, by pressing the elementary semi-finished product towards the abutment surface; wherein the abutment surface has circumferential rows of solid portions alternated with hollow portions; and wherein the solid portions arranged along axially opposite circumferential edges of the abutment surface have a transverse size between 10% and 60% of a transverse size presented by the solid portions arranged in proximity to an axial centreline plane of the abutment surface. 39. The process as claimed in claim 38, wherein the transverse size of the solid portions arranged along axially opposite circumferential edges of the abutment surface are between 20% and 50% of the transverse size presented by the solid portions arranged in proximity to the axial centreline plane of the abutment surface. 40. The process as claimed in claim 39, wherein the hollow portions of each circumferential row are circumferentially offset with respect to the hollow portions of axially adjacent circumferential rows. 41. The process as claimed in claim 40, wherein the carcass sleeve comprises at least one carcass ply and a pair of anchoring annular structures engaged at axially opposite ends of the at least one carcass ply. 42. The process as claimed in claim 41, wherein the shaped carcass sleeve engaged with the forming drum has axially opposite end flaps projecting cantilevered with respect to the abutment surface. 43. The process as claimed in claim 42, wherein the elementary semi-finished product is applied according to axially contiguous circumferential coils, in order to form a component of the tyre. 44. The process as claimed in claim 43, wherein the elementary semi-finished product is pressed against the abutment surface by a localised thrust action against a surface portion of the elementary semi-finished product. 45. The process as claimed in claim 44, wherein the thrust action is exerted by pressing an applicator roller against the elementary semi-finished product while the forming drum rotates around a geometric rotation axis thereof. 46. The process as claimed in claim 45, wherein the localised thrust action is applied against an action area having a transverse size smaller than a transverse size of the hollow portions. 47. The process as claimed in claim 46, wherein the transverse size of the action area can be measured against the abutment surface in a radial plane of the forming drum. | The invention relates to a toroidal forming drum and a process for building tyres. The toroidal forming drum (23) is expanded within a shaped carcass sleeve (12), for supporting the carcass sleeve (12) against an abutment surface (“S”) externally provided by the forming drum (23). An elementary semi-finished product (54 a, 54 b) is applied around the shaped carcass sleeve (12), by pressing said elementary semi-finished product (54 a, 54 b) towards the abutment surface (“S”). The abutment surface (“S”) has circumferential rows of solid portions (40) alternated with hollow portions (41). The solid portions (40), arranged along axially opposite circumferential edges of the abutment surface (“S”), have a transverse size comprised between 10% and 60% of a transverse size presented by the solid portions (40) arranged in proximity to an axial centreline plane of the abutment surface (“S”).1-37. (canceled) 38. A process for building tyres, comprising:
building a carcass sleeve, shaping the carcass sleeve according to a toroidal configuration to form a shaped carcass sleeve, engaging a toroidal forming drum within the shaped carcass sleeve, for supporting the shaped carcass sleeve against a radially external abutment surface provided by the forming drum, and applying at least one elementary semi-finished product around the shaped carcass sleeve, by pressing the elementary semi-finished product towards the abutment surface; wherein the abutment surface has circumferential rows of solid portions alternated with hollow portions; and wherein the solid portions arranged along axially opposite circumferential edges of the abutment surface have a transverse size between 10% and 60% of a transverse size presented by the solid portions arranged in proximity to an axial centreline plane of the abutment surface. 39. The process as claimed in claim 38, wherein the transverse size of the solid portions arranged along axially opposite circumferential edges of the abutment surface are between 20% and 50% of the transverse size presented by the solid portions arranged in proximity to the axial centreline plane of the abutment surface. 40. The process as claimed in claim 39, wherein the hollow portions of each circumferential row are circumferentially offset with respect to the hollow portions of axially adjacent circumferential rows. 41. The process as claimed in claim 40, wherein the carcass sleeve comprises at least one carcass ply and a pair of anchoring annular structures engaged at axially opposite ends of the at least one carcass ply. 42. The process as claimed in claim 41, wherein the shaped carcass sleeve engaged with the forming drum has axially opposite end flaps projecting cantilevered with respect to the abutment surface. 43. The process as claimed in claim 42, wherein the elementary semi-finished product is applied according to axially contiguous circumferential coils, in order to form a component of the tyre. 44. The process as claimed in claim 43, wherein the elementary semi-finished product is pressed against the abutment surface by a localised thrust action against a surface portion of the elementary semi-finished product. 45. The process as claimed in claim 44, wherein the thrust action is exerted by pressing an applicator roller against the elementary semi-finished product while the forming drum rotates around a geometric rotation axis thereof. 46. The process as claimed in claim 45, wherein the localised thrust action is applied against an action area having a transverse size smaller than a transverse size of the hollow portions. 47. The process as claimed in claim 46, wherein the transverse size of the action area can be measured against the abutment surface in a radial plane of the forming drum. | 1,700 |
348,619 | 16,806,105 | 1,749 | The present disclosure relates to the field of semiconductor technologies, and discloses semiconductor apparatus and manufacturing methods for the same. In some implementations, a method may include: providing a substrate structure which includes: a substrate, one or more fins located on the substrate and extending along a first direction, and an isolation region located around one of the fins, an upper surface of the isolation region being lower than an upper surface of the fin, the isolation region including a first isolation region and a second isolation region, where the first isolation region is located on a side surface of the fin that is in the first direction, and the second isolation region is located on a side surface of the fin that is in a second direction that is different from the first direction; forming, on the substrate structure, a sacrificial layer having an opening, the opening exposing an upper surface of the first isolation region and exposing a part, which is located above the first isolation region, of the side surfaces of the fin adjacent to the first isolation region; filling the opening with an insulating material to form a third isolation region on the first isolation region, an upper surface of the third isolation region being higher than the upper surface of the fin; and removing the sacrificial layer. | 1. A semiconductor apparatus, comprising:
a substrate; a fin located on the substrate and extending along a first direction; and an isolation region located around the fin, where an upper surface of the isolation region is lower than an upper surface of the fin, the isolation region comprising:
a first isolation region located on a side surface of the fin that is in the first direction, and
a second isolation region located on a side surface of the fin that is in a second direction that is different from the first direction; and
a third isolation region located on the first isolation region, where an upper surface of the third isolation region is higher than the upper surface of the fin. 2. The apparatus according to claim 1, wherein:
the third isolation region covers an end portion of the fin adjacent to the first isolation region. 3. The apparatus according to claim 1, further comprising:
a protection layer between the third isolation region and the fin. 4. The apparatus according to claim 1, further comprising:
a first gate structure on the fin, and a second gate structure on the third isolation region. 5. The apparatus according to claim 4, further comprising:
a source region and a drain region that are formed by means of epitaxial growth of a semiconductor material on both sides of the first gate structure. 6. The apparatus according to claim 4, wherein:
the first gate structure comprises a first gate dielectric layer on the surface of the fin, a first gate on the first gate dielectric layer, a first hard mask layer on the first gate, and a first spacer on side walls of the first gate dielectric layer, the first gate and the first hard mask layer; and the second gate structure comprises a second gate on the third isolation region, a second hard mask layer on the second gate, and a second spacer on side walls of the second gate and the second hard mask layer, the second spacer covering the end portion of the fin adjacent to the third isolation region. | The present disclosure relates to the field of semiconductor technologies, and discloses semiconductor apparatus and manufacturing methods for the same. In some implementations, a method may include: providing a substrate structure which includes: a substrate, one or more fins located on the substrate and extending along a first direction, and an isolation region located around one of the fins, an upper surface of the isolation region being lower than an upper surface of the fin, the isolation region including a first isolation region and a second isolation region, where the first isolation region is located on a side surface of the fin that is in the first direction, and the second isolation region is located on a side surface of the fin that is in a second direction that is different from the first direction; forming, on the substrate structure, a sacrificial layer having an opening, the opening exposing an upper surface of the first isolation region and exposing a part, which is located above the first isolation region, of the side surfaces of the fin adjacent to the first isolation region; filling the opening with an insulating material to form a third isolation region on the first isolation region, an upper surface of the third isolation region being higher than the upper surface of the fin; and removing the sacrificial layer.1. A semiconductor apparatus, comprising:
a substrate; a fin located on the substrate and extending along a first direction; and an isolation region located around the fin, where an upper surface of the isolation region is lower than an upper surface of the fin, the isolation region comprising:
a first isolation region located on a side surface of the fin that is in the first direction, and
a second isolation region located on a side surface of the fin that is in a second direction that is different from the first direction; and
a third isolation region located on the first isolation region, where an upper surface of the third isolation region is higher than the upper surface of the fin. 2. The apparatus according to claim 1, wherein:
the third isolation region covers an end portion of the fin adjacent to the first isolation region. 3. The apparatus according to claim 1, further comprising:
a protection layer between the third isolation region and the fin. 4. The apparatus according to claim 1, further comprising:
a first gate structure on the fin, and a second gate structure on the third isolation region. 5. The apparatus according to claim 4, further comprising:
a source region and a drain region that are formed by means of epitaxial growth of a semiconductor material on both sides of the first gate structure. 6. The apparatus according to claim 4, wherein:
the first gate structure comprises a first gate dielectric layer on the surface of the fin, a first gate on the first gate dielectric layer, a first hard mask layer on the first gate, and a first spacer on side walls of the first gate dielectric layer, the first gate and the first hard mask layer; and the second gate structure comprises a second gate on the third isolation region, a second hard mask layer on the second gate, and a second spacer on side walls of the second gate and the second hard mask layer, the second spacer covering the end portion of the fin adjacent to the third isolation region. | 1,700 |
348,620 | 16,806,102 | 1,749 | A semiconductor device includes a first Static Random Access Memory (SRAM) array including a first SRAM cell and a second SRAM array including a second SRAM cell. The first SRAM cell includes a first pull-down (PD) device including a single fin N-type FinFET. The single fin N-type FinFET includes a first gate dielectric having a first thickness. The second SRAM cell includes a second PD device including a multiple fin N-type FinFET. The multiple fin N-type FinFET includes a second gate dielectric having a second thickness. The first thickness is greater than the second thickness. | 1. A semiconductor device comprising:
a first Static Random Access Memory (SRAM) array comprising a first SRAM cell, wherein the first SRAM cell comprises:
a first pull-down (PD) device comprising a single fin N-type FinFET, the single fin N-type FinFET comprising a first gate dielectric, wherein the first gate dielectric has a first thickness; and
a first pull-up (PU) device comprising a first single fin P-type FinFET; and
a second SRAM array comprising a second SRAM cell, wherein the second SRAM cell comprises:
a second PD device comprising a multiple fin N-type FinFET, the multiple fin N-type FinFET comprising a second gate dielectric, wherein the second gate dielectric has a second thickness, and wherein the first thickness is greater than the second thickness; and
a second PU device comprising a second single fin P-type FinFET. 2. The device of claim 1, wherein the first SRAM cell has a first X-pitch in an X direction, wherein the second SRAM cell has a second X-pitch in the X direction, and wherein the ratio of the second X-pitch to the first X-pitch is in a range of 1.1 to 1.5. 3. The device of claim 1, wherein the first SRAM cell has a first Y-pitch in a Y direction, wherein the second SRAM cell has a second Y-pitch in the Y direction, and wherein the first Y-pitch is equal to the second Y-pitch. 4. The device of claim 1, wherein the difference between the first thickness and the second thickness is in a range of 1 Å to 6 Å. 5. The device of claim 1, wherein the first PD device has a first work function metal (WFM) layer, wherein the second PD has a second WFM layer, and wherein the first WFM layer is thicker than the second WFM layer. 6. The device of claim 5, wherein the first WFM layer has a thicker layer of TiN or a thicker layer of tungsten-nitride-carbon (WN—C) than the second WFM layer. 7. The device of claim 1, wherein the first PD device has a first threshold voltage (Vt), wherein the second PD device has a second Vt, and wherein the first Vt is higher than the second Vt. 8. A semiconductor device comprising:
a first high density (HD) Static Random Access Memory (SRAM) array comprising a first HD SRAM cell, wherein the first HD SRAM cell comprises:
a first pull-down (PD) device comprising a first single fin N-type FinFET, the first single fin N-type FinFET comprising a first work function metal (WFM) layer, wherein the first WFM layer has a first thickness; and
a first pull-up (PU) device comprising a first single fin P-type FinFET; and
a high current (HC) SRAM array comprising a HC SRAM cell, wherein the HC SRAM cell comprises:
a second PD device comprising a multiple fin N-type FinFET, wherein the multiple fin N-type FinFET comprises a second work function metal (WFM) layer, wherein the second WFM layer has a second thickness, and wherein the first thickness is greater than the second thickness; and
a second PU device comprising a second single fin P-type FinFET. 9. The device of claim 8, wherein the first PU device has a third WFM layer, wherein the second PU device has a fourth WFM layer, and wherein the third WFM layer is thinner than the fourth WFM layer. 10. The device of claim 8, wherein the first single fin N-type FinFET comprises a first gate dielectric, wherein the first gate dielectric has a first thickness, and wherein the multiple fin N-type FinFET comprises a second gate dielectric, wherein the second gate dielectric has a second thickness, wherein the first thickness is greater than the second thickness. 11. The device of claim 10 further comprising a second HD SRAM array comprising a second HD SRAM cell, wherein the second HD SRAM cell comprises:
a third pull-down (PD) device comprising a second single fin N-type FinFET, the second single fin N-type FinFET comprising a third gate dielectric, wherein the third gate dielectric has a third thickness. 12. The device of claim 11, wherein the third thickness is the same as the second thickness. 13. The device of claim 11, wherein the third thickness is thinner than the first thickness by at least 1 Å. 14. The device of claim 11, wherein the second HD SRAM cell has the same cell pitches as the first HD SRAM cell. 15. The device of claim 11, wherein the second HD SRAM cell has the same cell layout as the first HD SRAM cell. 16. A method of forming Static Random Access Memory (SRAM) arrays, the method comprising:
patterning a first fin, a second fin, and a third fin extending from a substrate; depositing a first gate dielectric to a first thickness over the first fin; depositing a second gate dielectric to a second thickness over the second fin and the third fin, the second thickness being less than the first thickness; forming a first pull-down (PD) device from the first fin, the first PD device is in a first SRAM array, and the first PD device is a single fin finFET; forming a second PD device from the second fin and the third fin, the second PD device is in a second SRAM array different from the first SRAM array; forming a first plurality of conductive lines and vias over the first PD device; and forming a second plurality of conductive lines and vias over the second PD device. 17. The method of claim 16, wherein forming the first PD device comprises forming a first work function metal (WFM) layer over the first fin, wherein forming the second PD device comprises forming a second WFM layer over the second fin and the third fin, and wherein the first WFM layer is thicker than the second WFM layer. 18. The method of claim 17, wherein the first WFM layer comprises a layer of TiAl disposed on a layer of TiN or tungsten-nitride-carbon (WN—C). 19. The method of claim 17, wherein the second WFM layer comprises a layer of TiAl disposed on a layer of TiN or tungsten-nitride-carbon (WN—C). 20. The method of claim 17, wherein the first SRAM array is a high density SRAM array, and wherein the second SRAM array is a high current SRAM array. | A semiconductor device includes a first Static Random Access Memory (SRAM) array including a first SRAM cell and a second SRAM array including a second SRAM cell. The first SRAM cell includes a first pull-down (PD) device including a single fin N-type FinFET. The single fin N-type FinFET includes a first gate dielectric having a first thickness. The second SRAM cell includes a second PD device including a multiple fin N-type FinFET. The multiple fin N-type FinFET includes a second gate dielectric having a second thickness. The first thickness is greater than the second thickness.1. A semiconductor device comprising:
a first Static Random Access Memory (SRAM) array comprising a first SRAM cell, wherein the first SRAM cell comprises:
a first pull-down (PD) device comprising a single fin N-type FinFET, the single fin N-type FinFET comprising a first gate dielectric, wherein the first gate dielectric has a first thickness; and
a first pull-up (PU) device comprising a first single fin P-type FinFET; and
a second SRAM array comprising a second SRAM cell, wherein the second SRAM cell comprises:
a second PD device comprising a multiple fin N-type FinFET, the multiple fin N-type FinFET comprising a second gate dielectric, wherein the second gate dielectric has a second thickness, and wherein the first thickness is greater than the second thickness; and
a second PU device comprising a second single fin P-type FinFET. 2. The device of claim 1, wherein the first SRAM cell has a first X-pitch in an X direction, wherein the second SRAM cell has a second X-pitch in the X direction, and wherein the ratio of the second X-pitch to the first X-pitch is in a range of 1.1 to 1.5. 3. The device of claim 1, wherein the first SRAM cell has a first Y-pitch in a Y direction, wherein the second SRAM cell has a second Y-pitch in the Y direction, and wherein the first Y-pitch is equal to the second Y-pitch. 4. The device of claim 1, wherein the difference between the first thickness and the second thickness is in a range of 1 Å to 6 Å. 5. The device of claim 1, wherein the first PD device has a first work function metal (WFM) layer, wherein the second PD has a second WFM layer, and wherein the first WFM layer is thicker than the second WFM layer. 6. The device of claim 5, wherein the first WFM layer has a thicker layer of TiN or a thicker layer of tungsten-nitride-carbon (WN—C) than the second WFM layer. 7. The device of claim 1, wherein the first PD device has a first threshold voltage (Vt), wherein the second PD device has a second Vt, and wherein the first Vt is higher than the second Vt. 8. A semiconductor device comprising:
a first high density (HD) Static Random Access Memory (SRAM) array comprising a first HD SRAM cell, wherein the first HD SRAM cell comprises:
a first pull-down (PD) device comprising a first single fin N-type FinFET, the first single fin N-type FinFET comprising a first work function metal (WFM) layer, wherein the first WFM layer has a first thickness; and
a first pull-up (PU) device comprising a first single fin P-type FinFET; and
a high current (HC) SRAM array comprising a HC SRAM cell, wherein the HC SRAM cell comprises:
a second PD device comprising a multiple fin N-type FinFET, wherein the multiple fin N-type FinFET comprises a second work function metal (WFM) layer, wherein the second WFM layer has a second thickness, and wherein the first thickness is greater than the second thickness; and
a second PU device comprising a second single fin P-type FinFET. 9. The device of claim 8, wherein the first PU device has a third WFM layer, wherein the second PU device has a fourth WFM layer, and wherein the third WFM layer is thinner than the fourth WFM layer. 10. The device of claim 8, wherein the first single fin N-type FinFET comprises a first gate dielectric, wherein the first gate dielectric has a first thickness, and wherein the multiple fin N-type FinFET comprises a second gate dielectric, wherein the second gate dielectric has a second thickness, wherein the first thickness is greater than the second thickness. 11. The device of claim 10 further comprising a second HD SRAM array comprising a second HD SRAM cell, wherein the second HD SRAM cell comprises:
a third pull-down (PD) device comprising a second single fin N-type FinFET, the second single fin N-type FinFET comprising a third gate dielectric, wherein the third gate dielectric has a third thickness. 12. The device of claim 11, wherein the third thickness is the same as the second thickness. 13. The device of claim 11, wherein the third thickness is thinner than the first thickness by at least 1 Å. 14. The device of claim 11, wherein the second HD SRAM cell has the same cell pitches as the first HD SRAM cell. 15. The device of claim 11, wherein the second HD SRAM cell has the same cell layout as the first HD SRAM cell. 16. A method of forming Static Random Access Memory (SRAM) arrays, the method comprising:
patterning a first fin, a second fin, and a third fin extending from a substrate; depositing a first gate dielectric to a first thickness over the first fin; depositing a second gate dielectric to a second thickness over the second fin and the third fin, the second thickness being less than the first thickness; forming a first pull-down (PD) device from the first fin, the first PD device is in a first SRAM array, and the first PD device is a single fin finFET; forming a second PD device from the second fin and the third fin, the second PD device is in a second SRAM array different from the first SRAM array; forming a first plurality of conductive lines and vias over the first PD device; and forming a second plurality of conductive lines and vias over the second PD device. 17. The method of claim 16, wherein forming the first PD device comprises forming a first work function metal (WFM) layer over the first fin, wherein forming the second PD device comprises forming a second WFM layer over the second fin and the third fin, and wherein the first WFM layer is thicker than the second WFM layer. 18. The method of claim 17, wherein the first WFM layer comprises a layer of TiAl disposed on a layer of TiN or tungsten-nitride-carbon (WN—C). 19. The method of claim 17, wherein the second WFM layer comprises a layer of TiAl disposed on a layer of TiN or tungsten-nitride-carbon (WN—C). 20. The method of claim 17, wherein the first SRAM array is a high density SRAM array, and wherein the second SRAM array is a high current SRAM array. | 1,700 |
348,621 | 16,806,077 | 1,749 | A surgical stapling device includes a mounting assembly that is pivotably supported on a distal portion of a housing about a pivot axis and movable between a non-articulated position and an articulated position. A drive assembly includes a flexible body having a working end and an articulation assembly includes an active articulation link that is coupled to the mounting assembly and movable between a retracted position and an advanced position to pivot the mounting assembly about the pivot axis. A gate assembly defines a channel that receives the flexible body of the drive assembly. The active articulation link is positioned to engage the gate assembly when the active articulation link moves between its retracted and advanced positions to move the gate assembly to a position to increase the bending radius of the flexible body of the drive assembly. | 1. A surgical stapling device comprising:
a body portion including a housing, a mounting assembly, a drive assembly, an articulation assembly, and a gate assembly, the housing including a proximal portion and a distal portion, the mounting assembly being pivotably supported on the distal portion of the housing about a pivot axis between a non-articulated position and an articulated position, the drive assembly including a flexible body having a working end, the drive assembly being movable within the housing from a retracted position to an advanced position, the articulation assembly including an active articulation link having a proximal portion and a distal portion, the distal portion of the active articulation link being coupled to the mounting assembly and movable between retracted and advanced positions to pivot the mounting assembly about the pivot axis, the gate assembly defining a channel, the flexible body of the drive assembly extending through the channel of the gate assembly, wherein the active articulation link is positioned to engage the gate assembly when the active articulation link moves between its retracted and advanced positions to move the gate assembly to a position to increase a bending radius of the flexible body of the drive assembly. 2. The stapling device of claim 1, wherein the gate assembly is pivotably supported within the housing. 3. The stapling device of claim 2, wherein the gate assembly includes an upper gate and a lower gate. 4. The stapling device of claim 3, wherein each of the upper and lower gates includes an elongate body and a U-shaped member supported on a distal portion, wherein the U-shaped members of the upper and lower gates define the channel. 5. The stapling device of claim 4, wherein the elongate body of each of the upper and lower gates includes a pivot member, the pivot members pivotably connecting the upper and lower gates within the housing. 6. The stapling device of claim 5, wherein each of the U-shaped members of the upper and lower gates includes an engagement member, the active articulation link being positioned to engage one of the engagement members of the upper or lower gates. 7. The stapling device of claim 6, wherein the articulation link includes a passive articulation link, the passive articulation link having a distal portion coupled to the mounting assembly such that pivotal movement of the mounting assembly about the pivot axis causes movement of the passive articulation link between retracted and advanced positions. 8. The stapling device of claim 7, further including a blowout plate supported on each side of the elongate body of the drive assembly, each of the blowout plates having a distal end supported on the mounting assembly at a position distally of the pivot axis and a proximal end supported within the housing proximally of the pivot axis. 9. The stapling device of claim 7, further including a stabilization mechanism, the stabilization mechanism being engaged with the active and passive articulation links and being configured to urge the mounting assembly to the non-articulated position. 10. The stapling device of claim 1, further including a stabilization mechanism engaged with the articulation assembly, the stabilization mechanism being positioned to urge the mounting assembly to the non-articulated position. 11. The stapling device of claim 1, further including a tool assembly supported on the mounting assembly. 12. The stapling device of claim 11, wherein the tool assembly includes a cartridge assembly and an anvil assembly. 13. The stapling device of claim 12, wherein the tool assembly is configured to receive the working end of the device assembly. 14. The stapling device of claim 1, wherein the distal portion of the active articulation link includes a hook and the mounting assembly includes a finger, and the hook is positioned to engage the finger when the active articulation link is moved towards the advanced position to assist in articulation of the mounting assembly. 15. The stapling device of claim 14, wherein the active articulation link includes a first active articulation link and a second active articulation link that is pivotably coupled to the first active articulation link. 16. The stapling device of claim 7, wherein the distal portion of the active articulation link and the passive articulation link each include a hook and the mounting assembly includes fingers, the hooks being positioned to engage a respective one of the fingers when the respective active and passive articulation links are moved towards the advanced position to assist in articulation of the mounting assembly. 17. The stapling device of claim 7, wherein the active articulation link includes a first active articulation link and a second active articulation link that is pivotably coupled to the first active articulation link, and the passive articulation link includes a first passive articulation link and a second passive articulation link that is pivotably coupled to the first passive articulation link. | A surgical stapling device includes a mounting assembly that is pivotably supported on a distal portion of a housing about a pivot axis and movable between a non-articulated position and an articulated position. A drive assembly includes a flexible body having a working end and an articulation assembly includes an active articulation link that is coupled to the mounting assembly and movable between a retracted position and an advanced position to pivot the mounting assembly about the pivot axis. A gate assembly defines a channel that receives the flexible body of the drive assembly. The active articulation link is positioned to engage the gate assembly when the active articulation link moves between its retracted and advanced positions to move the gate assembly to a position to increase the bending radius of the flexible body of the drive assembly.1. A surgical stapling device comprising:
a body portion including a housing, a mounting assembly, a drive assembly, an articulation assembly, and a gate assembly, the housing including a proximal portion and a distal portion, the mounting assembly being pivotably supported on the distal portion of the housing about a pivot axis between a non-articulated position and an articulated position, the drive assembly including a flexible body having a working end, the drive assembly being movable within the housing from a retracted position to an advanced position, the articulation assembly including an active articulation link having a proximal portion and a distal portion, the distal portion of the active articulation link being coupled to the mounting assembly and movable between retracted and advanced positions to pivot the mounting assembly about the pivot axis, the gate assembly defining a channel, the flexible body of the drive assembly extending through the channel of the gate assembly, wherein the active articulation link is positioned to engage the gate assembly when the active articulation link moves between its retracted and advanced positions to move the gate assembly to a position to increase a bending radius of the flexible body of the drive assembly. 2. The stapling device of claim 1, wherein the gate assembly is pivotably supported within the housing. 3. The stapling device of claim 2, wherein the gate assembly includes an upper gate and a lower gate. 4. The stapling device of claim 3, wherein each of the upper and lower gates includes an elongate body and a U-shaped member supported on a distal portion, wherein the U-shaped members of the upper and lower gates define the channel. 5. The stapling device of claim 4, wherein the elongate body of each of the upper and lower gates includes a pivot member, the pivot members pivotably connecting the upper and lower gates within the housing. 6. The stapling device of claim 5, wherein each of the U-shaped members of the upper and lower gates includes an engagement member, the active articulation link being positioned to engage one of the engagement members of the upper or lower gates. 7. The stapling device of claim 6, wherein the articulation link includes a passive articulation link, the passive articulation link having a distal portion coupled to the mounting assembly such that pivotal movement of the mounting assembly about the pivot axis causes movement of the passive articulation link between retracted and advanced positions. 8. The stapling device of claim 7, further including a blowout plate supported on each side of the elongate body of the drive assembly, each of the blowout plates having a distal end supported on the mounting assembly at a position distally of the pivot axis and a proximal end supported within the housing proximally of the pivot axis. 9. The stapling device of claim 7, further including a stabilization mechanism, the stabilization mechanism being engaged with the active and passive articulation links and being configured to urge the mounting assembly to the non-articulated position. 10. The stapling device of claim 1, further including a stabilization mechanism engaged with the articulation assembly, the stabilization mechanism being positioned to urge the mounting assembly to the non-articulated position. 11. The stapling device of claim 1, further including a tool assembly supported on the mounting assembly. 12. The stapling device of claim 11, wherein the tool assembly includes a cartridge assembly and an anvil assembly. 13. The stapling device of claim 12, wherein the tool assembly is configured to receive the working end of the device assembly. 14. The stapling device of claim 1, wherein the distal portion of the active articulation link includes a hook and the mounting assembly includes a finger, and the hook is positioned to engage the finger when the active articulation link is moved towards the advanced position to assist in articulation of the mounting assembly. 15. The stapling device of claim 14, wherein the active articulation link includes a first active articulation link and a second active articulation link that is pivotably coupled to the first active articulation link. 16. The stapling device of claim 7, wherein the distal portion of the active articulation link and the passive articulation link each include a hook and the mounting assembly includes fingers, the hooks being positioned to engage a respective one of the fingers when the respective active and passive articulation links are moved towards the advanced position to assist in articulation of the mounting assembly. 17. The stapling device of claim 7, wherein the active articulation link includes a first active articulation link and a second active articulation link that is pivotably coupled to the first active articulation link, and the passive articulation link includes a first passive articulation link and a second passive articulation link that is pivotably coupled to the first passive articulation link. | 1,700 |
348,622 | 16,806,127 | 1,749 | A particle detection element includes: a casing having a gas flow passage; an electric charge generating unit that imparts charges generated by a discharge to particles in a gas introduced into the casing to thereby form charged particles; a collecting electrode that is disposed inside the casing so as to be exposed to the gas flow passage and collects a collection target that is the charged particles or the charges not imparted to the particles; and a plurality of exposed electrodes including the collecting electrode and exposed to the gas flow passage. The casing has a short circuit-preventing structure disposed on a connection surface that is part of an inner circumferential surface exposed to the gas flow passage. The connection surface connects at least two of the plurality of exposed electrodes to each other, and the short circuit-preventing structure includes at least one of a recess and a protrusion. | 1. A particle detection element used to detect particles in a gas, the particle detection element comprising:
a casing having a gas flow passage through which the gas passes; an electric charge generating unit that imparts charges generated by a discharge to the particles in the gas introduced into the casing to thereby form charged particles; a collecting electrode that is disposed inside the casing so as to be exposed to the gas flow passage and collects a collection target that is the charged particles or the charges not imparted to the particles; and a plurality of exposed electrodes that include the collecting electrode and are exposed to the gas flow passage, wherein the casing has a short circuit-preventing structure disposed on a connection surface that is part of an inner circumferential surface exposed to the gas flow passage, the connection surface connecting at least two of the plurality of exposed electrodes to each other, the short circuit-preventing structure including at least one of a recess and a protrusion. 2. The particle detection element according to claim 1,
wherein the exposed electrodes include an electric field generating electrode that is disposed inside the casing and generates an electric field that causes the collection target to move toward the collecting electrode, wherein the casing has a partition that partitions the gas flow passage into a plurality of branched flow passages, wherein the collecting electrode and the electric field generating electrode are each exposed to one of the plurality of branched flow passages, and wherein the casing has the short circuit-preventing structure on the connection surface that is a portion connecting the collecting electrode and the electric field generating electrode to each other. 3. The particle detection element according to claim 2,
wherein the collecting electrode and the electric field generating electrode form a pair of electrodes, and the particle detection element comprises a plurality of the pairs of electrodes disposed such that each of the plurality of pairs of electrodes is disposed in a corresponding one of the plurality of branched flow passages, and wherein the connection surface for at least one of the plurality of pairs of electrodes disposed in the respective branched flow passages has the short circuit-preventing structure. 4. The particle detection element according to claim 1,
wherein the casing is a layered body including a plurality of layers stacked on top of each other, and wherein the at least one of the recess and the protrusion is connected to a surrounding portion thereof on the connection surface at a step portion that is a step between two adjacent layers of the plurality of layers. 5. The particle detection element according to claim 1, further comprising a heating unit that heats the connection surface of the casing. 6. The particle detection element according to claim 1,
wherein the exposed electrodes include an electric field generating electrode that is disposed inside the casing and generates an electric field that causes the collection target to move toward the collecting electrode, wherein, in a cross section perpendicular to a center axis of the gas flow passage, the inner circumferential surface of the casing has a polygonal shape, wherein the inner circumferential surface includes; a collecting electrode-disposed surface which is a surface forming a side of the polygonal shape and on which the collecting electrode is disposed; and an electric field generating electrode-disposed surface which is a surface forming a side of the polygonal shape and on which the electric field generating electrode is disposed, and wherein the short circuit-preventing structure is disposed on a connection side surface that is part of the connection surface, which part connects the collecting electrode-disposed surface to the electric field generating electrode-disposed surface. 7. A particle detector comprising:
the particle detection element according to claim 1; and a detection unit that detects the particles based on a physical quantity that varies according to the collection target collected by the collecting electrode. | A particle detection element includes: a casing having a gas flow passage; an electric charge generating unit that imparts charges generated by a discharge to particles in a gas introduced into the casing to thereby form charged particles; a collecting electrode that is disposed inside the casing so as to be exposed to the gas flow passage and collects a collection target that is the charged particles or the charges not imparted to the particles; and a plurality of exposed electrodes including the collecting electrode and exposed to the gas flow passage. The casing has a short circuit-preventing structure disposed on a connection surface that is part of an inner circumferential surface exposed to the gas flow passage. The connection surface connects at least two of the plurality of exposed electrodes to each other, and the short circuit-preventing structure includes at least one of a recess and a protrusion.1. A particle detection element used to detect particles in a gas, the particle detection element comprising:
a casing having a gas flow passage through which the gas passes; an electric charge generating unit that imparts charges generated by a discharge to the particles in the gas introduced into the casing to thereby form charged particles; a collecting electrode that is disposed inside the casing so as to be exposed to the gas flow passage and collects a collection target that is the charged particles or the charges not imparted to the particles; and a plurality of exposed electrodes that include the collecting electrode and are exposed to the gas flow passage, wherein the casing has a short circuit-preventing structure disposed on a connection surface that is part of an inner circumferential surface exposed to the gas flow passage, the connection surface connecting at least two of the plurality of exposed electrodes to each other, the short circuit-preventing structure including at least one of a recess and a protrusion. 2. The particle detection element according to claim 1,
wherein the exposed electrodes include an electric field generating electrode that is disposed inside the casing and generates an electric field that causes the collection target to move toward the collecting electrode, wherein the casing has a partition that partitions the gas flow passage into a plurality of branched flow passages, wherein the collecting electrode and the electric field generating electrode are each exposed to one of the plurality of branched flow passages, and wherein the casing has the short circuit-preventing structure on the connection surface that is a portion connecting the collecting electrode and the electric field generating electrode to each other. 3. The particle detection element according to claim 2,
wherein the collecting electrode and the electric field generating electrode form a pair of electrodes, and the particle detection element comprises a plurality of the pairs of electrodes disposed such that each of the plurality of pairs of electrodes is disposed in a corresponding one of the plurality of branched flow passages, and wherein the connection surface for at least one of the plurality of pairs of electrodes disposed in the respective branched flow passages has the short circuit-preventing structure. 4. The particle detection element according to claim 1,
wherein the casing is a layered body including a plurality of layers stacked on top of each other, and wherein the at least one of the recess and the protrusion is connected to a surrounding portion thereof on the connection surface at a step portion that is a step between two adjacent layers of the plurality of layers. 5. The particle detection element according to claim 1, further comprising a heating unit that heats the connection surface of the casing. 6. The particle detection element according to claim 1,
wherein the exposed electrodes include an electric field generating electrode that is disposed inside the casing and generates an electric field that causes the collection target to move toward the collecting electrode, wherein, in a cross section perpendicular to a center axis of the gas flow passage, the inner circumferential surface of the casing has a polygonal shape, wherein the inner circumferential surface includes; a collecting electrode-disposed surface which is a surface forming a side of the polygonal shape and on which the collecting electrode is disposed; and an electric field generating electrode-disposed surface which is a surface forming a side of the polygonal shape and on which the electric field generating electrode is disposed, and wherein the short circuit-preventing structure is disposed on a connection side surface that is part of the connection surface, which part connects the collecting electrode-disposed surface to the electric field generating electrode-disposed surface. 7. A particle detector comprising:
the particle detection element according to claim 1; and a detection unit that detects the particles based on a physical quantity that varies according to the collection target collected by the collecting electrode. | 1,700 |
348,623 | 16,806,129 | 1,749 | Embodiments of the inventive concept include a portable ion concentration apparatus including a controller, a storage section to store one or more data samples, an amplifier circuit, and a chemical field effect transistor (CHEMFET). The CHEMFET and the amplifier circuit can indicate a quantity of nitrate levels in a sample media or a reference media. The controller can process the indication of the quantity of nitrate levels, and generate the one or more data samples based at least on the indication of the quantity of nitrate levels. The portable ion concentration apparatus can include an in-field analysis apparatus, an in-field measurement apparatus, or an in-soil monitoring apparatus. A measurement logic section can determine an ion concentration based on a sensitivity slope M or a polynomial fit. Also disclosed is a method for measuring ion concentration with a standard deviation correction. | 1. A computer-implemented method for measuring ion concentration with a standard deviation correction, comprising:
calibrating an ion concentration apparatus by performing:
receiving, by an ion concentration apparatus, a first sample measurement from sample media;
receiving, by the ion concentration apparatus, a first reference measurement from reference media;
comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor;
applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 2. The computer-implemented method of claim 1, further comprising,
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 3. The computer-implemented method of claim 1, further comprising:
continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 4. The computer-implemented method of claim 1, further comprising:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit; providing the ion concentration information of the ion to a controller, causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 5. The computer-implemented method of claim 4, further comprising:
storing one or more ion concentrations corresponding to the reference media; sensing a temperature of at least one of the sample media or the reference media; wirelessly transmitting the one or more ion concentrations to a display device. 6. The computer-implemented method of claim 5, further comprising:
causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. 7. The computer-implemented method of claim 1, further comprising:
correcting, for at least one of inherent nitrate, contamination of the sample media or a sample-to-sample drift; wherein the sample media include soil and water. 8. One or more non-transitory computer-readable storage media storing one or more computer instructions which, when executed by one or more processors, cause the one or more processors to perform:
calibrating an ion concentration apparatus by performing:
receiving, by an ion concentration apparatus, a first sample measurement from sample media;
receiving, by the ion concentration apparatus, a first reference measurement from reference media;
comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor;
applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 9. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 10. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 11. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit; providing the ion concentration information of the ion to a controller, causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 12. The one or more non-transitory computer-readable storage media of claim 11, storing additional instructions for:
storing one or more ion concentrations corresponding to the reference media;
sensing a temperature of at least one of the sample media or the reference media;
wirelessly transmitting the one or more ion concentrations to a display device. 13. The one or more non-transitory computer-readable storage media of claim 12, storing additional instructions for:
causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. 14. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
correcting, for at least one of inherent nitrate, contamination of the sample media or a sample-to-sample drift; wherein the sample media include soil and water. 15. A portable ion concentration apparatus, comprising:
a controller; an ion concentration measurement device coupled to the controller; wherein the ion concentration measurement device and the controller are configured to perform: calibrating an ion concentration apparatus by performing: receiving, by an ion concentration apparatus, a first sample measurement from sample media; receiving, by the ion concentration apparatus, a first reference measurement from reference media; comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor; applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 16. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform:
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 17. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform: continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 18. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit;
providing the ion concentration information of the ion to a controller,
causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 19. The portable ion concentration apparatus of claim 18, wherein the ion concentration measurement device and the controller are further configured to perform:
storing one or more ion concentrations corresponding to the reference media;
sensing a temperature of at least one of the sample media or the reference media;
wirelessly transmitting the one or more ion concentrations to a display device. 20. The portable ion concentration apparatus of claim 19, wherein the ion concentration measurement device and the controller are further configured to perform: causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. | Embodiments of the inventive concept include a portable ion concentration apparatus including a controller, a storage section to store one or more data samples, an amplifier circuit, and a chemical field effect transistor (CHEMFET). The CHEMFET and the amplifier circuit can indicate a quantity of nitrate levels in a sample media or a reference media. The controller can process the indication of the quantity of nitrate levels, and generate the one or more data samples based at least on the indication of the quantity of nitrate levels. The portable ion concentration apparatus can include an in-field analysis apparatus, an in-field measurement apparatus, or an in-soil monitoring apparatus. A measurement logic section can determine an ion concentration based on a sensitivity slope M or a polynomial fit. Also disclosed is a method for measuring ion concentration with a standard deviation correction.1. A computer-implemented method for measuring ion concentration with a standard deviation correction, comprising:
calibrating an ion concentration apparatus by performing:
receiving, by an ion concentration apparatus, a first sample measurement from sample media;
receiving, by the ion concentration apparatus, a first reference measurement from reference media;
comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor;
applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 2. The computer-implemented method of claim 1, further comprising,
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 3. The computer-implemented method of claim 1, further comprising:
continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 4. The computer-implemented method of claim 1, further comprising:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit; providing the ion concentration information of the ion to a controller, causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 5. The computer-implemented method of claim 4, further comprising:
storing one or more ion concentrations corresponding to the reference media; sensing a temperature of at least one of the sample media or the reference media; wirelessly transmitting the one or more ion concentrations to a display device. 6. The computer-implemented method of claim 5, further comprising:
causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. 7. The computer-implemented method of claim 1, further comprising:
correcting, for at least one of inherent nitrate, contamination of the sample media or a sample-to-sample drift; wherein the sample media include soil and water. 8. One or more non-transitory computer-readable storage media storing one or more computer instructions which, when executed by one or more processors, cause the one or more processors to perform:
calibrating an ion concentration apparatus by performing:
receiving, by an ion concentration apparatus, a first sample measurement from sample media;
receiving, by the ion concentration apparatus, a first reference measurement from reference media;
comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor;
applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 9. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 10. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 11. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit; providing the ion concentration information of the ion to a controller, causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 12. The one or more non-transitory computer-readable storage media of claim 11, storing additional instructions for:
storing one or more ion concentrations corresponding to the reference media;
sensing a temperature of at least one of the sample media or the reference media;
wirelessly transmitting the one or more ion concentrations to a display device. 13. The one or more non-transitory computer-readable storage media of claim 12, storing additional instructions for:
causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. 14. The one or more non-transitory computer-readable storage media of claim 8, storing additional instructions for:
correcting, for at least one of inherent nitrate, contamination of the sample media or a sample-to-sample drift; wherein the sample media include soil and water. 15. A portable ion concentration apparatus, comprising:
a controller; an ion concentration measurement device coupled to the controller; wherein the ion concentration measurement device and the controller are configured to perform: calibrating an ion concentration apparatus by performing: receiving, by an ion concentration apparatus, a first sample measurement from sample media; receiving, by the ion concentration apparatus, a first reference measurement from reference media; comparing, by the ion concentration apparatus, the first reference measurement to a nominal reference value to determine, by the ion concentration apparatus, a first correction factor; applying, by the ion concentration apparatus, the first correction factor to the first sample measurement to automatically generate and store a first corrected measurement. 16. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform:
receiving a second sample measurement from the sample media; receiving a second reference measurement from the reference media; comparing the second reference measurement to the first reference measurement to automatically determine a second correction factor; applying the second correction factor to the first sample measurement to generate and store a second corrected measurement; receiving a third sample measurement from the sample media; receiving a third reference measurement from the reference media; comparing the third reference measurement to the second reference measurement to automatically determine a third correction factor; applying the third correction factor to the first sample measurement to automatically generate and store a third corrected measurement. 17. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform: continuing an automatic correction of one or more additional sample measurements to correct contamination of active sensor environmental interfaces with solids. 18. The portable ion concentration apparatus of claim 15, wherein the ion concentration measurement device and the controller are further configured to perform:
receiving, by a sensor module, ion concentration information of ion from an amplifier circuit;
providing the ion concentration information of the ion to a controller,
causing the controller to process the ion concentration information of the ion and generate one or more data samples based at least on the ion concentration information of the ion. 19. The portable ion concentration apparatus of claim 18, wherein the ion concentration measurement device and the controller are further configured to perform:
storing one or more ion concentrations corresponding to the reference media;
sensing a temperature of at least one of the sample media or the reference media;
wirelessly transmitting the one or more ion concentrations to a display device. 20. The portable ion concentration apparatus of claim 19, wherein the ion concentration measurement device and the controller are further configured to perform: causing the display device to visibly present the ion concentration information of the ion associated with at least one of the sample media or the reference media. | 1,700 |
348,624 | 16,806,110 | 1,749 | One or more techniques and/or computing devices are provided for moving a consistency group having a replication relation. For example, a first consistency group of storage objects (e.g., files, logical unit numbers (LUNs), etc.) within first storage may have a replication relationship with a second consistency group within second storage (e.g., the second consistency group is maintained as a synchronously replicated copy of the first consistency group). A volume copy operation, a single file move on demand command, a single file restore command, or other functionality is used to move the first consistency group from the first storage to third storage, such as for load balancing, to create a moved first consistency group within the third storage. A new replication relationship is established between the moved first consistency group and the second consistency group, and the moved first consistency group and the second consistency group are resynchronized. | 1. A method, comprising:
in response to operations targeting a first consistency group being fenced, creating a snapshot of a second consistency group having a replication relationship with the first consistency group; unfencing the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented; utilizing storage item move functionality to move the first consistency group as a moved first consistency group; utilizing a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and utilizing the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 2. The method of claim 1, wherein the first consistency group is moved to first storage as the moved first consistency group. 3. The method of claim 2, wherein the second dirty region log is stored within the first storage. 4. The method of claim 2, comprising:
transferring the dirty region log to the first storage. 5. The method of claim 1, comprising:
creating a second snapshot of the moved first consistency group, wherein the second snapshot captures the dirty region log and the second dirty region log. 6. The method of claim 1, comprising:
draining inflight operations, targeting the first consistency group, before creating the snapshot. 7. The method of claim 1, comprising:
creating a new replication relationship between the moved first consistency group and the second consistency group. 8. The method of claim 1, comprising:
creating the snapshot in response to quiescing the replication relationship. 9. A non-transitory machine readable medium having stored thereon machine executable code, which when executed by a machine, causes the machine to:
in response to operations targeting a first consistency group being fenced, create a snapshot of a second consistency group having a replication relationship with the first consistency group; unfence the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented; utilize storage item move functionality to move the first consistency group as a moved first consistency group; utilize a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and utilize the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 10. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
drain inflight operations, targeting the first consistency group, before creating the snapshot. 11. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
quiesce the replication relationship so that operations, targeting the first consistency group, are not split and synchronously replicated to the second consistency group. 12. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
cutover client access from the first consistency group to the moved first consistency group as storage items are moved from the first consistency group to the moved first consistency group. 13. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
create a second snapshot of the moved first consistency group, wherein the second snapshot captures the dirty region log and the second dirty region log. 14. The non-transitory machine readable medium of claim 13, wherein the machine executable code causes the machine to:
mark the second snapshot as a pseudo common snapshot. 15. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
create a new replication relationship between the moved first consistency group and the second consistency group. 16. The non-transitory machine readable medium of claim 15, wherein the machine executable code causes the machine to:
delete the replication relationship between the first consistency group and the second consistency group. 17. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
move a sync cache for utilization by the moved first consistency group. 18. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
move an inflight tracker for utilization by the moved first consistency group, wherein the inflight tracker captures inflight operations targeting the first consistency group 19. A computing device comprising:
a memory comprising machine executable code; and a processor coupled to the memory, the processor configured to execute the machine executable code to cause the processor to:
in response to operations targeting a first consistency group being fenced, create a snapshot of a second consistency group having a replication relationship with the first consistency group;
unfence the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented;
utilize storage item move functionality to move the first consistency group as a moved first consistency group;
utilize a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and
utilize the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 20. The computing device of claim 19, wherein the machine executable code cases the processor to:
create a new replication relationship between the moved first consistency group and the second consistency group. | One or more techniques and/or computing devices are provided for moving a consistency group having a replication relation. For example, a first consistency group of storage objects (e.g., files, logical unit numbers (LUNs), etc.) within first storage may have a replication relationship with a second consistency group within second storage (e.g., the second consistency group is maintained as a synchronously replicated copy of the first consistency group). A volume copy operation, a single file move on demand command, a single file restore command, or other functionality is used to move the first consistency group from the first storage to third storage, such as for load balancing, to create a moved first consistency group within the third storage. A new replication relationship is established between the moved first consistency group and the second consistency group, and the moved first consistency group and the second consistency group are resynchronized.1. A method, comprising:
in response to operations targeting a first consistency group being fenced, creating a snapshot of a second consistency group having a replication relationship with the first consistency group; unfencing the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented; utilizing storage item move functionality to move the first consistency group as a moved first consistency group; utilizing a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and utilizing the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 2. The method of claim 1, wherein the first consistency group is moved to first storage as the moved first consistency group. 3. The method of claim 2, wherein the second dirty region log is stored within the first storage. 4. The method of claim 2, comprising:
transferring the dirty region log to the first storage. 5. The method of claim 1, comprising:
creating a second snapshot of the moved first consistency group, wherein the second snapshot captures the dirty region log and the second dirty region log. 6. The method of claim 1, comprising:
draining inflight operations, targeting the first consistency group, before creating the snapshot. 7. The method of claim 1, comprising:
creating a new replication relationship between the moved first consistency group and the second consistency group. 8. The method of claim 1, comprising:
creating the snapshot in response to quiescing the replication relationship. 9. A non-transitory machine readable medium having stored thereon machine executable code, which when executed by a machine, causes the machine to:
in response to operations targeting a first consistency group being fenced, create a snapshot of a second consistency group having a replication relationship with the first consistency group; unfence the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented; utilize storage item move functionality to move the first consistency group as a moved first consistency group; utilize a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and utilize the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 10. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
drain inflight operations, targeting the first consistency group, before creating the snapshot. 11. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
quiesce the replication relationship so that operations, targeting the first consistency group, are not split and synchronously replicated to the second consistency group. 12. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
cutover client access from the first consistency group to the moved first consistency group as storage items are moved from the first consistency group to the moved first consistency group. 13. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
create a second snapshot of the moved first consistency group, wherein the second snapshot captures the dirty region log and the second dirty region log. 14. The non-transitory machine readable medium of claim 13, wherein the machine executable code causes the machine to:
mark the second snapshot as a pseudo common snapshot. 15. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
create a new replication relationship between the moved first consistency group and the second consistency group. 16. The non-transitory machine readable medium of claim 15, wherein the machine executable code causes the machine to:
delete the replication relationship between the first consistency group and the second consistency group. 17. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
move a sync cache for utilization by the moved first consistency group. 18. The non-transitory machine readable medium of claim 9, wherein the machine executable code causes the machine to:
move an inflight tracker for utilization by the moved first consistency group, wherein the inflight tracker captures inflight operations targeting the first consistency group 19. A computing device comprising:
a memory comprising machine executable code; and a processor coupled to the memory, the processor configured to execute the machine executable code to cause the processor to:
in response to operations targeting a first consistency group being fenced, create a snapshot of a second consistency group having a replication relationship with the first consistency group;
unfence the operations and utilizing a dirty region log to track dirty data resulting from the operations being implemented;
utilize storage item move functionality to move the first consistency group as a moved first consistency group;
utilize a second dirty region log to track dirty data resulting from client access to the moved first consistency group; and
utilize the dirty region log, the second dirty region log, and the snapshot to resynchronize the moved first consistency group and the second consistency group. 20. The computing device of claim 19, wherein the machine executable code cases the processor to:
create a new replication relationship between the moved first consistency group and the second consistency group. | 1,700 |
348,625 | 16,806,093 | 1,749 | A method comprises removing a first deck of a plurality of decks and a second deck of the plurality of decks from an autorack. The method further comprises removing one or more of a plurality of posts of the autorack and coupling a cross-brace assembly to one or more of the plurality of posts, wherein the cross-brace assembly is coupled to the one or more of the plurality of posts at a location above an existing brace bay of the autorack. The method also comprises coupling the second deck of the plurality of decks to the autorack at a location above or below the cross-brace assembly. | 1. A method comprising:
removing a first deck of a plurality of decks from an autorack; removing a second deck of the plurality of decks from the autorack; coupling a cross-brace assembly to two or more of a plurality of posts of the autorack, wherein the cross-brace assembly is coupled to the two or more of the plurality of posts at a location above an existing brace bay of the autorack; coupling the second deck of the plurality of decks to the autorack at a location above or below the cross-brace assembly. 2. (canceled) 3. (canceled) 4. The method of claim 1, wherein coupling the cross-brace assembly to the two or more of the plurality of posts comprises:
coupling at least one brace of the cross-brace assembly to a first post of the plurality of posts; and coupling the at least one brace of the cross-brace assembly to a second post of the plurality of posts. 5. The method of claim 1, wherein coupling the cross-brace assembly to the two or more of the plurality of posts comprises:
coupling a first bolting plate of the cross-brace assembly to a first post of the plurality of posts at a location above the existing brace bay of the autorack; coupling a second bolting plate of the cross-brace assembly to the first post of the plurality of posts at a location above the first bolting plate; coupling a third bolting plate of the cross-brace assembly to a second post of the plurality of posts at a location above the existing brace bay of the autorack; and coupling a fourth bolting plate of the cross-brace assembly to the second post of the plurality of posts at a location above the third bolting plate. 6. The method of claim 5, further comprising:
coupling a first end of a first brace of the cross-brace assembly to the first bolting plate; coupling a second end of the first brace to the fourth bolting plate; coupling a first end of a second brace of the cross-brace assembly to the second bolting plate; and coupling a second end of the second brace to the third bolting plate. 7. (canceled) 8. (canceled) 9. The method of claim 1, further comprising:
removing an existing door structure from the autorack; and coupling a seal-safe radial door structure to at least one end of the autorack. 10. The method of claim 1, further comprising:
removing a roof section from the autorack; increasing a height of one or more of the plurality of posts; increasing a height of one or more of a plurality of side screens of the autorack; and coupling the roof section to the autorack. 11. The method of claim 1, further comprising:
removing an existing roof section from an autorack; removing one or more of a plurality of existing side screens from the autorack; removing one or more of a plurality of existing decks from the autorack; increasing a width of a first end portion of a flatcar of the autorack such that the width of the first end portion of the flatcar is greater than a width of a center portion of the flatcar; increasing a width of a second end portion of the flatcar of the autorack such that the width of the second end portion of the flatcar is greater than the width of the center portion of the flatcar; increasing a width between a first post of the plurality of posts and a second post of the plurality of posts, the first post located near a first side of the first end portion of the flatcar and the second post located near a second side of the first end portion, the second side opposite the first side; increasing a width between a third post of the plurality of posts and a fourth post of the plurality of posts, the third post located near a first side of the second end portion of the flatcar and the fourth post located near a second side of the second end portion, the second side opposite the first side; coupling one or more of a plurality of replacement decks to the autorack; coupling one or more of a plurality of replacement side screens to one or more of the plurality of posts; and coupling a replacement roof section to the autorack. 12. The method of claim 1, wherein the autorack is an existing autorack. 13. The method of claim 1, further comprising:
removing one or more of the plurality of posts from the autorack; and increasing a width between a first post of the plurality of posts and a second post of the plurality of posts, the first post located near a first side of the autorack and the second post located near a second side of the autorack, the second side opposite the first side. 14. An autorack comprising:
a plurality of posts; a cross-brace assembly coupled to two or more of the plurality of posts of the autorack, wherein the cross-brace assembly is coupled to the two or more of the plurality of posts at a location above an existing brace bay of the autorack; a plurality of decks, a first deck of the plurality of decks coupled to the autorack at a location above or below the cross-brace assembly. 15. The autorack of claim 14, wherein the cross-brace assembly further comprises at least one brace coupled to a first post of the plurality of posts and a second post of the plurality of posts. 16. The autorack of claim 14, wherein the cross-brace assembly further comprises:
a first bolting plate coupled to a first post of the plurality of posts at a location above the existing brace bay of the autorack; a second bolting plate coupled to the first post of the plurality of posts at a location above the first bolting plate; a third bolting plate coupled to a second post of the plurality of posts at a location above the existing brace bay of the autorack; and a fourth bolting plate coupled to the second post of the plurality of posts at a location above the third bolting plate. 17. The autorack of claim 16, wherein the cross-brace assembly further comprises:
a first brace having a first end and a second end, wherein the first end of the first brace is coupled to the first bolting plate and the second end of the first brace is coupled to the fourth bolting plate; a second brace having a first end and a second end, wherein the first end of the second brace is coupled to the second bolting plate and the second end of the second brace is coupled to the third bolting plate. 18. The autorack of claim 14, further comprising a seal-safe radial door structure coupled to at least one end of the autorack. 19. The autorack of claim 14, further comprising:
a flatcar comprising:
a first end portion;
a second end portion; and
a center portion;
wherein a width of the first end portion of the flatcar is greater than a width of the center portion of the flatcar;
wherein a width of the second end portion of the flatcar is greater than the width of the center portion of a flatcar;
a plurality of posts; a first post of the plurality of posts located near a first side of the first end portion of the flatcar; a second post of the plurality of posts located near a second side of the first end portion, the second side opposite the first side, wherein a width between the first post of the plurality of posts and the second post of the plurality of posts is greater than the width of the center portion of the flatcar; a third post of the plurality of posts located near a first side of the second end portion of the flatcar; a fourth post of the plurality of posts located near a second side of the second end portion, the second side opposite the first side, wherein a width between the third post of the plurality of posts and the fourth post of the plurality of posts is greater than the width of the center portion of the flatcar; one or more of a plurality of replacement side screens coupled to one or more of the plurality of posts; and a replacement roof section coupled to the autorack. 20. The autorack of claim 14, wherein a height of a roof of the autorack is at least twenty feet. 21. The autorack of claim 14, wherein a height of a roof of the autorack is adjustable. 22. The autorack of claim 14, wherein the autorack is an existing autorack. | A method comprises removing a first deck of a plurality of decks and a second deck of the plurality of decks from an autorack. The method further comprises removing one or more of a plurality of posts of the autorack and coupling a cross-brace assembly to one or more of the plurality of posts, wherein the cross-brace assembly is coupled to the one or more of the plurality of posts at a location above an existing brace bay of the autorack. The method also comprises coupling the second deck of the plurality of decks to the autorack at a location above or below the cross-brace assembly.1. A method comprising:
removing a first deck of a plurality of decks from an autorack; removing a second deck of the plurality of decks from the autorack; coupling a cross-brace assembly to two or more of a plurality of posts of the autorack, wherein the cross-brace assembly is coupled to the two or more of the plurality of posts at a location above an existing brace bay of the autorack; coupling the second deck of the plurality of decks to the autorack at a location above or below the cross-brace assembly. 2. (canceled) 3. (canceled) 4. The method of claim 1, wherein coupling the cross-brace assembly to the two or more of the plurality of posts comprises:
coupling at least one brace of the cross-brace assembly to a first post of the plurality of posts; and coupling the at least one brace of the cross-brace assembly to a second post of the plurality of posts. 5. The method of claim 1, wherein coupling the cross-brace assembly to the two or more of the plurality of posts comprises:
coupling a first bolting plate of the cross-brace assembly to a first post of the plurality of posts at a location above the existing brace bay of the autorack; coupling a second bolting plate of the cross-brace assembly to the first post of the plurality of posts at a location above the first bolting plate; coupling a third bolting plate of the cross-brace assembly to a second post of the plurality of posts at a location above the existing brace bay of the autorack; and coupling a fourth bolting plate of the cross-brace assembly to the second post of the plurality of posts at a location above the third bolting plate. 6. The method of claim 5, further comprising:
coupling a first end of a first brace of the cross-brace assembly to the first bolting plate; coupling a second end of the first brace to the fourth bolting plate; coupling a first end of a second brace of the cross-brace assembly to the second bolting plate; and coupling a second end of the second brace to the third bolting plate. 7. (canceled) 8. (canceled) 9. The method of claim 1, further comprising:
removing an existing door structure from the autorack; and coupling a seal-safe radial door structure to at least one end of the autorack. 10. The method of claim 1, further comprising:
removing a roof section from the autorack; increasing a height of one or more of the plurality of posts; increasing a height of one or more of a plurality of side screens of the autorack; and coupling the roof section to the autorack. 11. The method of claim 1, further comprising:
removing an existing roof section from an autorack; removing one or more of a plurality of existing side screens from the autorack; removing one or more of a plurality of existing decks from the autorack; increasing a width of a first end portion of a flatcar of the autorack such that the width of the first end portion of the flatcar is greater than a width of a center portion of the flatcar; increasing a width of a second end portion of the flatcar of the autorack such that the width of the second end portion of the flatcar is greater than the width of the center portion of the flatcar; increasing a width between a first post of the plurality of posts and a second post of the plurality of posts, the first post located near a first side of the first end portion of the flatcar and the second post located near a second side of the first end portion, the second side opposite the first side; increasing a width between a third post of the plurality of posts and a fourth post of the plurality of posts, the third post located near a first side of the second end portion of the flatcar and the fourth post located near a second side of the second end portion, the second side opposite the first side; coupling one or more of a plurality of replacement decks to the autorack; coupling one or more of a plurality of replacement side screens to one or more of the plurality of posts; and coupling a replacement roof section to the autorack. 12. The method of claim 1, wherein the autorack is an existing autorack. 13. The method of claim 1, further comprising:
removing one or more of the plurality of posts from the autorack; and increasing a width between a first post of the plurality of posts and a second post of the plurality of posts, the first post located near a first side of the autorack and the second post located near a second side of the autorack, the second side opposite the first side. 14. An autorack comprising:
a plurality of posts; a cross-brace assembly coupled to two or more of the plurality of posts of the autorack, wherein the cross-brace assembly is coupled to the two or more of the plurality of posts at a location above an existing brace bay of the autorack; a plurality of decks, a first deck of the plurality of decks coupled to the autorack at a location above or below the cross-brace assembly. 15. The autorack of claim 14, wherein the cross-brace assembly further comprises at least one brace coupled to a first post of the plurality of posts and a second post of the plurality of posts. 16. The autorack of claim 14, wherein the cross-brace assembly further comprises:
a first bolting plate coupled to a first post of the plurality of posts at a location above the existing brace bay of the autorack; a second bolting plate coupled to the first post of the plurality of posts at a location above the first bolting plate; a third bolting plate coupled to a second post of the plurality of posts at a location above the existing brace bay of the autorack; and a fourth bolting plate coupled to the second post of the plurality of posts at a location above the third bolting plate. 17. The autorack of claim 16, wherein the cross-brace assembly further comprises:
a first brace having a first end and a second end, wherein the first end of the first brace is coupled to the first bolting plate and the second end of the first brace is coupled to the fourth bolting plate; a second brace having a first end and a second end, wherein the first end of the second brace is coupled to the second bolting plate and the second end of the second brace is coupled to the third bolting plate. 18. The autorack of claim 14, further comprising a seal-safe radial door structure coupled to at least one end of the autorack. 19. The autorack of claim 14, further comprising:
a flatcar comprising:
a first end portion;
a second end portion; and
a center portion;
wherein a width of the first end portion of the flatcar is greater than a width of the center portion of the flatcar;
wherein a width of the second end portion of the flatcar is greater than the width of the center portion of a flatcar;
a plurality of posts; a first post of the plurality of posts located near a first side of the first end portion of the flatcar; a second post of the plurality of posts located near a second side of the first end portion, the second side opposite the first side, wherein a width between the first post of the plurality of posts and the second post of the plurality of posts is greater than the width of the center portion of the flatcar; a third post of the plurality of posts located near a first side of the second end portion of the flatcar; a fourth post of the plurality of posts located near a second side of the second end portion, the second side opposite the first side, wherein a width between the third post of the plurality of posts and the fourth post of the plurality of posts is greater than the width of the center portion of the flatcar; one or more of a plurality of replacement side screens coupled to one or more of the plurality of posts; and a replacement roof section coupled to the autorack. 20. The autorack of claim 14, wherein a height of a roof of the autorack is at least twenty feet. 21. The autorack of claim 14, wherein a height of a roof of the autorack is adjustable. 22. The autorack of claim 14, wherein the autorack is an existing autorack. | 1,700 |
348,626 | 16,806,122 | 3,754 | Examples disclosed herein relate to conduits, devices, systems and methods, which may include a dispensing device including a valve configured to interact with an inlet stream, the inlet stream having a first pressure, the valve having an outlet area with an outlet stream, the outlet stream having a second pressure; and a solenoid configured to interact with the outlet stream. | 1. A dispensing device comprising:
a valve configured to interact with an inlet stream, the inlet stream having a first pressure, the valve having an outlet area with an outlet stream, the outlet stream having a second pressure; a dispensing unit including one or more flavor units and one or more water units where each of the one or more flavor units include a transportation unit, the transportation unit including a barrier element with one or more openings; a blockage device configured to close the one or more openings to prevent a flow from at least one of the one or more flavor units; a movement device configured to move the blockage device to a first position relative to the one or more openings which allows for a passage of one or more fluid elements and one gaseous elements through the one or more openings in the blockage device; and a solenoid configured to interact with the outlet stream. 2. The dispensing device of claim 1, further comprising a carbonated unit. 3. The dispensing device of claim 1, wherein the movement device is a magnet. 4. The dispensing device of claim 1, wherein the movement device is an electro-magnet. 5. The dispensing device of claim 1, wherein at least one of the one or more flavor units is configured to be selectable. 6. The dispensing device of claim 5, wherein at least one of the one or more flavor units is configured to be automatically selectable 7. The dispensing device of claim 1, wherein at least one of the inlet stream and the outlet stream is a carbonated water. 8. The dispensing device of claim 1, wherein the first pressure is greater than the second pressure. 9. The dispensing device of claim 8, wherein a size of the solenoid is reduced based on a reduction in pressure from the first pressure to the second pressure. 10. The dispensing device of claim 1, wherein a size of the solenoid is reduced based on the valve. 11. The dispensing device of claim 1, wherein the inlet stream is a utility line. 12. The dispensing device of claim 1, further comprising an orifice. 13. The dispensing device of claim 12, wherein the orifice is fixed. 14. The dispensing device of claim 12, wherein the orifice is adjustable. 15. The dispensing device of claim 1, wherein the valve is a CFValve. 16. The dispensing device of claim 15, wherein the CF Valve is configured to maintain a relative constant flow of fluid from a variable pressure fluid supply to a fluid outlet, the CF Valve including: a) a valve housing having an inlet port and an outlet port adapted to be connected to the variable pressure fluid supply and the fluid outlet; b) a diaphragm chamber interposed between the inlet port and the outlet port; c) a cup contained within the diaphragm chamber, the cup having a cylindrical side wall extending from a bottom wall facing the outlet port to a circular rim surrounding an open mouth facing an inner side of a barrier wall; d) a resilient disc-shaped diaphragm closing the open mouth of the cup; e) a piston assembly secured to a center of the resilient disc-shaped diaphragm, the piston assembly having a cap on one side of the resilient disc-shaped diaphragm facing the inner side of the barrier wall, and a base suspended from an opposite side of the resilient disc-shaped diaphragm and projecting into an interior of the cup; f) a stem projecting from the cap through a first passageway in the barrier wall to terminate in a valve head, the valve head and an outer side of the barrier wall being configured to define a control orifice connecting the inlet port to the diaphragm chamber via the first passageway; and g) a spring device in the cup coacting with the base of the piston assembly for urging in a resilient manner the resilient disc-shaped diaphragm into a closed position against the inner side of the barrier wall to thereby prevent fluid flow from the inlet port via the first passageway into the diaphragm chamber, the spring device being responsive to fluid pressure above a predetermined level applied to the resilient disc-shaped diaphragm via the inlet port and the first passageway by accommodating movement of the resilient disc-shaped diaphragm away from the inner side of the barrier wall, with the valve head on the stem being moved to adjust a size of the control orifice, thereby maintaining the relative constant flow of fluid from the inlet port through the first passageway and the second passageway to the outlet port for delivery to the fluid outlet. 17. The dispensing device of claim 1, further comprising a solenoid plunger. 18. The dispensing device of claim 17, wherein the solenoid plunger is located between the valve and the solenoid. 19. The dispensing device of claim 1, wherein the inlet stream and the outlet stream are in a serial position relative to each other. 20. The dispensing device of claim 1, wherein the inlet stream and the outlet stream are in a non-linear position relative to each other. | Examples disclosed herein relate to conduits, devices, systems and methods, which may include a dispensing device including a valve configured to interact with an inlet stream, the inlet stream having a first pressure, the valve having an outlet area with an outlet stream, the outlet stream having a second pressure; and a solenoid configured to interact with the outlet stream.1. A dispensing device comprising:
a valve configured to interact with an inlet stream, the inlet stream having a first pressure, the valve having an outlet area with an outlet stream, the outlet stream having a second pressure; a dispensing unit including one or more flavor units and one or more water units where each of the one or more flavor units include a transportation unit, the transportation unit including a barrier element with one or more openings; a blockage device configured to close the one or more openings to prevent a flow from at least one of the one or more flavor units; a movement device configured to move the blockage device to a first position relative to the one or more openings which allows for a passage of one or more fluid elements and one gaseous elements through the one or more openings in the blockage device; and a solenoid configured to interact with the outlet stream. 2. The dispensing device of claim 1, further comprising a carbonated unit. 3. The dispensing device of claim 1, wherein the movement device is a magnet. 4. The dispensing device of claim 1, wherein the movement device is an electro-magnet. 5. The dispensing device of claim 1, wherein at least one of the one or more flavor units is configured to be selectable. 6. The dispensing device of claim 5, wherein at least one of the one or more flavor units is configured to be automatically selectable 7. The dispensing device of claim 1, wherein at least one of the inlet stream and the outlet stream is a carbonated water. 8. The dispensing device of claim 1, wherein the first pressure is greater than the second pressure. 9. The dispensing device of claim 8, wherein a size of the solenoid is reduced based on a reduction in pressure from the first pressure to the second pressure. 10. The dispensing device of claim 1, wherein a size of the solenoid is reduced based on the valve. 11. The dispensing device of claim 1, wherein the inlet stream is a utility line. 12. The dispensing device of claim 1, further comprising an orifice. 13. The dispensing device of claim 12, wherein the orifice is fixed. 14. The dispensing device of claim 12, wherein the orifice is adjustable. 15. The dispensing device of claim 1, wherein the valve is a CFValve. 16. The dispensing device of claim 15, wherein the CF Valve is configured to maintain a relative constant flow of fluid from a variable pressure fluid supply to a fluid outlet, the CF Valve including: a) a valve housing having an inlet port and an outlet port adapted to be connected to the variable pressure fluid supply and the fluid outlet; b) a diaphragm chamber interposed between the inlet port and the outlet port; c) a cup contained within the diaphragm chamber, the cup having a cylindrical side wall extending from a bottom wall facing the outlet port to a circular rim surrounding an open mouth facing an inner side of a barrier wall; d) a resilient disc-shaped diaphragm closing the open mouth of the cup; e) a piston assembly secured to a center of the resilient disc-shaped diaphragm, the piston assembly having a cap on one side of the resilient disc-shaped diaphragm facing the inner side of the barrier wall, and a base suspended from an opposite side of the resilient disc-shaped diaphragm and projecting into an interior of the cup; f) a stem projecting from the cap through a first passageway in the barrier wall to terminate in a valve head, the valve head and an outer side of the barrier wall being configured to define a control orifice connecting the inlet port to the diaphragm chamber via the first passageway; and g) a spring device in the cup coacting with the base of the piston assembly for urging in a resilient manner the resilient disc-shaped diaphragm into a closed position against the inner side of the barrier wall to thereby prevent fluid flow from the inlet port via the first passageway into the diaphragm chamber, the spring device being responsive to fluid pressure above a predetermined level applied to the resilient disc-shaped diaphragm via the inlet port and the first passageway by accommodating movement of the resilient disc-shaped diaphragm away from the inner side of the barrier wall, with the valve head on the stem being moved to adjust a size of the control orifice, thereby maintaining the relative constant flow of fluid from the inlet port through the first passageway and the second passageway to the outlet port for delivery to the fluid outlet. 17. The dispensing device of claim 1, further comprising a solenoid plunger. 18. The dispensing device of claim 17, wherein the solenoid plunger is located between the valve and the solenoid. 19. The dispensing device of claim 1, wherein the inlet stream and the outlet stream are in a serial position relative to each other. 20. The dispensing device of claim 1, wherein the inlet stream and the outlet stream are in a non-linear position relative to each other. | 3,700 |
348,627 | 16,806,116 | 3,754 | Mobile robots and methods involving mobile robots are provided. In one method, a mobile robot performs a hospitality service for a guest of a hospitality business. The mobile robot is operated at the hospitality business. | 1. An apparatus for operating in a facility, the apparatus comprising:
an autonomous mobile robot comprising a communication system, a user interface, an item support, a security system, a drive system, a manipulator system having at least one robot arm for retrieving and placing items on the item support, and a controller integrally formed with the autonomous mobile robot, wherein the autonomous mobile robot is configured to receive information related to transporting an item from a first location to a second location to yield a transportation of the item, wherein:
the item support is integrally formed with the autonomous mobile robot and is configured to support the item during the transportation of the item;
the security system is configured to secure the item in the item support to prevent unauthorized access to the item during the transportation of the item from the first location to the second location, and the security system is further configured to provide access to the item at the second location to an authorized person and to ensure the item remains with the autonomous mobile robot at all times such that the item is at least discoverable at any time without resorting to any additional tracking mechanisms and the item is autonomously moved at any time to any place within the facility;
the drive system is configured to move the autonomous mobile robot in order to transport the item from the first location to the second location; and
the controller is configured to control operation of the mobile robot to transport the item from the first location to the second location without any outside human intervention or human input after initial programming and user input information is provided. 2. The apparatus of claim 1, wherein the facility comprises one of a resort, a hotel, a motel, an inn, a resort, an airport, a bus station, a railroad station, a restaurant, a bar, a spa, a theme park, an arena, a stadium, a government building, and a warehouse. 3. The apparatus of claim 1, wherein one or more of the user interface and the communication system are configured to receive user information related to an individual, and wherein the mobile robot is configured to check in the individual with or check out the individual from the facility based on the user information. 4. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a keycard. 5. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a mechanical key. 6. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as an electronic key. 7. The apparatus of claim 1, wherein the mobile robot is further configured to bill an individual for a service. 8. The apparatus of claim 1, wherein the security system includes an electronically and/or fluidly actuated lock. 9. The apparatus of claim 1, wherein the controller is configured to signal the security system to provide access to the item to the authorized person at the second location. | Mobile robots and methods involving mobile robots are provided. In one method, a mobile robot performs a hospitality service for a guest of a hospitality business. The mobile robot is operated at the hospitality business.1. An apparatus for operating in a facility, the apparatus comprising:
an autonomous mobile robot comprising a communication system, a user interface, an item support, a security system, a drive system, a manipulator system having at least one robot arm for retrieving and placing items on the item support, and a controller integrally formed with the autonomous mobile robot, wherein the autonomous mobile robot is configured to receive information related to transporting an item from a first location to a second location to yield a transportation of the item, wherein:
the item support is integrally formed with the autonomous mobile robot and is configured to support the item during the transportation of the item;
the security system is configured to secure the item in the item support to prevent unauthorized access to the item during the transportation of the item from the first location to the second location, and the security system is further configured to provide access to the item at the second location to an authorized person and to ensure the item remains with the autonomous mobile robot at all times such that the item is at least discoverable at any time without resorting to any additional tracking mechanisms and the item is autonomously moved at any time to any place within the facility;
the drive system is configured to move the autonomous mobile robot in order to transport the item from the first location to the second location; and
the controller is configured to control operation of the mobile robot to transport the item from the first location to the second location without any outside human intervention or human input after initial programming and user input information is provided. 2. The apparatus of claim 1, wherein the facility comprises one of a resort, a hotel, a motel, an inn, a resort, an airport, a bus station, a railroad station, a restaurant, a bar, a spa, a theme park, an arena, a stadium, a government building, and a warehouse. 3. The apparatus of claim 1, wherein one or more of the user interface and the communication system are configured to receive user information related to an individual, and wherein the mobile robot is configured to check in the individual with or check out the individual from the facility based on the user information. 4. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a keycard. 5. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a mechanical key. 6. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as an electronic key. 7. The apparatus of claim 1, wherein the mobile robot is further configured to bill an individual for a service. 8. The apparatus of claim 1, wherein the security system includes an electronically and/or fluidly actuated lock. 9. The apparatus of claim 1, wherein the controller is configured to signal the security system to provide access to the item to the authorized person at the second location. | 3,700 |
348,628 | 16,806,120 | 3,754 | Mobile robots and methods involving mobile robots are provided. In one method, a mobile robot performs a hospitality service for a guest of a hospitality business. The mobile robot is operated at the hospitality business. | 1. An apparatus for operating in a facility, the apparatus comprising:
an autonomous mobile robot comprising a communication system, a user interface, an item support, a security system, a drive system, a manipulator system having at least one robot arm for retrieving and placing items on the item support, and a controller integrally formed with the autonomous mobile robot, wherein the autonomous mobile robot is configured to receive information related to transporting an item from a first location to a second location to yield a transportation of the item, wherein:
the item support is integrally formed with the autonomous mobile robot and is configured to support the item during the transportation of the item;
the security system is configured to secure the item in the item support to prevent unauthorized access to the item during the transportation of the item from the first location to the second location, and the security system is further configured to provide access to the item at the second location to an authorized person and to ensure the item remains with the autonomous mobile robot at all times such that the item is at least discoverable at any time without resorting to any additional tracking mechanisms and the item is autonomously moved at any time to any place within the facility;
the drive system is configured to move the autonomous mobile robot in order to transport the item from the first location to the second location; and
the controller is configured to control operation of the mobile robot to transport the item from the first location to the second location without any outside human intervention or human input after initial programming and user input information is provided. 2. The apparatus of claim 1, wherein the facility comprises one of a resort, a hotel, a motel, an inn, a resort, an airport, a bus station, a railroad station, a restaurant, a bar, a spa, a theme park, an arena, a stadium, a government building, and a warehouse. 3. The apparatus of claim 1, wherein one or more of the user interface and the communication system are configured to receive user information related to an individual, and wherein the mobile robot is configured to check in the individual with or check out the individual from the facility based on the user information. 4. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a keycard. 5. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a mechanical key. 6. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as an electronic key. 7. The apparatus of claim 1, wherein the mobile robot is further configured to bill an individual for a service. 8. The apparatus of claim 1, wherein the security system includes an electronically and/or fluidly actuated lock. 9. The apparatus of claim 1, wherein the controller is configured to signal the security system to provide access to the item to the authorized person at the second location. | Mobile robots and methods involving mobile robots are provided. In one method, a mobile robot performs a hospitality service for a guest of a hospitality business. The mobile robot is operated at the hospitality business.1. An apparatus for operating in a facility, the apparatus comprising:
an autonomous mobile robot comprising a communication system, a user interface, an item support, a security system, a drive system, a manipulator system having at least one robot arm for retrieving and placing items on the item support, and a controller integrally formed with the autonomous mobile robot, wherein the autonomous mobile robot is configured to receive information related to transporting an item from a first location to a second location to yield a transportation of the item, wherein:
the item support is integrally formed with the autonomous mobile robot and is configured to support the item during the transportation of the item;
the security system is configured to secure the item in the item support to prevent unauthorized access to the item during the transportation of the item from the first location to the second location, and the security system is further configured to provide access to the item at the second location to an authorized person and to ensure the item remains with the autonomous mobile robot at all times such that the item is at least discoverable at any time without resorting to any additional tracking mechanisms and the item is autonomously moved at any time to any place within the facility;
the drive system is configured to move the autonomous mobile robot in order to transport the item from the first location to the second location; and
the controller is configured to control operation of the mobile robot to transport the item from the first location to the second location without any outside human intervention or human input after initial programming and user input information is provided. 2. The apparatus of claim 1, wherein the facility comprises one of a resort, a hotel, a motel, an inn, a resort, an airport, a bus station, a railroad station, a restaurant, a bar, a spa, a theme park, an arena, a stadium, a government building, and a warehouse. 3. The apparatus of claim 1, wherein one or more of the user interface and the communication system are configured to receive user information related to an individual, and wherein the mobile robot is configured to check in the individual with or check out the individual from the facility based on the user information. 4. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a keycard. 5. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as a mechanical key. 6. The apparatus of claim 1, wherein the mobile robot is configured to issue an individual a key to a lock at the facility, and the key is configured as an electronic key. 7. The apparatus of claim 1, wherein the mobile robot is further configured to bill an individual for a service. 8. The apparatus of claim 1, wherein the security system includes an electronically and/or fluidly actuated lock. 9. The apparatus of claim 1, wherein the controller is configured to signal the security system to provide access to the item to the authorized person at the second location. | 3,700 |
348,629 | 16,806,096 | 3,754 | User validation accuracy is improved without inconveniencing a user. When an authentication request packet is received from a terminal and the authentication is successful based on a user ID and a password, an HTTP header, user-agent information, and access source IP address are extracted from the packet, and user authentication is performed by verifying the IP address and the user-agent information against usage history information where at most two sets of the IP address and the user-agent information extracted from the authentication request packet which is received from the same user previously are registered. When the set of the IP address and the UA information corresponding to the new extracted IP address and the new extracted UA information is registered in the usage history information, the authentication is successful, and the usage history information is overwritten with the new IP address and the new UA information. | 1. A user validation apparatus comprising:
a memory, and a processor programmed to:
extract user-agent information and an access source internet protocol (IP) address in an HTTP header of a packet received from a terminal device operated by an individual user by applying HTTP as a protocol of an application layer;
store the extracted user-agent information and the extracted access source IP address in the memory as usage history information that corresponds to user identification information of the individual user;
determine that the user is conditionally valid, when:
the received user login information is identical to login information stored in the memory, and
(a) the extracted user-agent information corresponds to user-agent information stored in the memory, but the extracted IP address does not correspond to IP address stored in the memory, or (b) the extracted user-agent information does not correspond to user-agent information stored in the memory, but the extracted IP address corresponds to IP address stored in the memory; and
transmit a further authentication information based on contact information corresponding to the received user login information and stored in the memory, when the user is determined to be conditionally valid. 2. A user validation apparatus comprising:
a memory, and a processor programmed to:
extract user-agent information from HTTP header of a packet received from the terminal device;
store the extracted user-gent information or the extracted access source IP address onto the memory as usage history information that corresponds to user identification information of the individual user;
determine that the user is conditionally valid, when: (i) the received user login information is identical to login information stored in the memory, and (ii) the extracted user-agent information does not correspond to user-agent information stored in the memory; and
transmit a further authentication information based on contact information corresponding to the received user login information and stored in the memory, when the user is determined to be conditionally valid. 3. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
request re-authentication to the given terminal device from which the user login information is transmitted, when the user operating the given terminal device is determined to be the conditionally valid user. 4. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
store a plurality of sets of the access source IP addresses and the user-agent information. 5. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
additionally store a new access source IP address or new user-agent information. 6. A user validation method executed by a computer comprising:
receiving user login information from a terminal device operated by a user; extracting user-agent information from HTTP header of a packet received from the terminal device; determining that the user is conditionally valid, when: (i) the received user login information is identical to login information stored in a first database, and (ii) the extracted user-agent information does not correspond to user-agent information stored in a second database; and transmitting a further authentication information based on contact information corresponding to the received user login information and stored in a third database, when the user is determined to be conditionally valid. 7. The user validation method according to claim 6, wherein the contact information is an electronic mail address. 8. The user validation method according to claim 6, wherein the further authentication information is a confirmation link. 9. The user validation method according to claim 6, further comprising:
updating the second database, when the further authentication is performed successfully. | User validation accuracy is improved without inconveniencing a user. When an authentication request packet is received from a terminal and the authentication is successful based on a user ID and a password, an HTTP header, user-agent information, and access source IP address are extracted from the packet, and user authentication is performed by verifying the IP address and the user-agent information against usage history information where at most two sets of the IP address and the user-agent information extracted from the authentication request packet which is received from the same user previously are registered. When the set of the IP address and the UA information corresponding to the new extracted IP address and the new extracted UA information is registered in the usage history information, the authentication is successful, and the usage history information is overwritten with the new IP address and the new UA information.1. A user validation apparatus comprising:
a memory, and a processor programmed to:
extract user-agent information and an access source internet protocol (IP) address in an HTTP header of a packet received from a terminal device operated by an individual user by applying HTTP as a protocol of an application layer;
store the extracted user-agent information and the extracted access source IP address in the memory as usage history information that corresponds to user identification information of the individual user;
determine that the user is conditionally valid, when:
the received user login information is identical to login information stored in the memory, and
(a) the extracted user-agent information corresponds to user-agent information stored in the memory, but the extracted IP address does not correspond to IP address stored in the memory, or (b) the extracted user-agent information does not correspond to user-agent information stored in the memory, but the extracted IP address corresponds to IP address stored in the memory; and
transmit a further authentication information based on contact information corresponding to the received user login information and stored in the memory, when the user is determined to be conditionally valid. 2. A user validation apparatus comprising:
a memory, and a processor programmed to:
extract user-agent information from HTTP header of a packet received from the terminal device;
store the extracted user-gent information or the extracted access source IP address onto the memory as usage history information that corresponds to user identification information of the individual user;
determine that the user is conditionally valid, when: (i) the received user login information is identical to login information stored in the memory, and (ii) the extracted user-agent information does not correspond to user-agent information stored in the memory; and
transmit a further authentication information based on contact information corresponding to the received user login information and stored in the memory, when the user is determined to be conditionally valid. 3. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
request re-authentication to the given terminal device from which the user login information is transmitted, when the user operating the given terminal device is determined to be the conditionally valid user. 4. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
store a plurality of sets of the access source IP addresses and the user-agent information. 5. The user validation apparatus according to claim 2, wherein the processor is further programmed to:
additionally store a new access source IP address or new user-agent information. 6. A user validation method executed by a computer comprising:
receiving user login information from a terminal device operated by a user; extracting user-agent information from HTTP header of a packet received from the terminal device; determining that the user is conditionally valid, when: (i) the received user login information is identical to login information stored in a first database, and (ii) the extracted user-agent information does not correspond to user-agent information stored in a second database; and transmitting a further authentication information based on contact information corresponding to the received user login information and stored in a third database, when the user is determined to be conditionally valid. 7. The user validation method according to claim 6, wherein the contact information is an electronic mail address. 8. The user validation method according to claim 6, wherein the further authentication information is a confirmation link. 9. The user validation method according to claim 6, further comprising:
updating the second database, when the further authentication is performed successfully. | 3,700 |
348,630 | 16,806,069 | 3,754 | A surgical stapling device includes an adapter assembly and a reload assembly. The adapter assembly includes an elongate body and a channel member coupled to the elongate body. The reload assembly includes an anvil and a cartridge assembly that includes a cartridge body and a channel extension. A proximal portion of the cartridge body is received within the channel member to secure the reload assembly to the adapter assembly. The channel extension is received about a distal portion of the cartridge body and is engaged with the channel member to support the cartridge body. | 1. A surgical stapling device comprising:
an adapter assembly including an elongate body defining a longitudinal axis and having a proximal portion and a distal portion, and a channel member supported on the distal portion of the elongate body, the channel member including a base wall and side walls that define a cavity, the channel member being movable in relation to the elongate body about an axis transverse to the longitudinal axis between a first position aligned with the longitudinal axis and a second position defining an acute angle with respect to the longitudinal axis; and a reload assembly including an anvil and a cartridge assembly pivotably coupled to the anvil, the cartridge assembly including a cartridge body and a plurality of staples, the cartridge body having a proximal portion and a distal portion and defining a central knife slot and staple pockets positioned on each side of the central knife slot, each of the plurality of staples received within one of the staple pockets, wherein the cartridge body is releasably received within the cavity defined by the channel member to mount the reload assembly to the adapter assembly. 2. The surgical stapling device of claim 1, wherein the anvil includes an anvil body having a proximal portion and a distal portion, the proximal portion of the anvil body including spaced flange portions that define a recess, the proximal portion of the cartridge body received within the recess in the proximal portion of the anvil body. 3. The surgical stapling device of claim 2, wherein the proximal portion of the anvil body includes spaced fingers that are positioned within the recess and the proximal portion of the cartridge body defines spaced slots, the spaced fingers received within the spaced slots to pivotably couple the anvil to the cartridge assembly. 4. The surgical stapling device of claim 3, wherein the spaced fingers and the spaced slots are curved. 5. The surgical stapling device of claim 2, wherein the side walls of the channel member of the adapter assembly include an elongated tab and the spaced flange portions of the of the anvil body define slots, the slots in the spaced flange portions of the anvil body receiving the elongated tabs of the channel member to secure the reload assembly to the adapter assembly. 6. The surgical stapling device of claim 5, wherein the adapter assembly includes a biasing member that is positioned to urge the channel member towards its first position. 7. The surgical stapling device of claim 6, wherein the elongated tab and the slots are positioned and configured such that the channel member must be pivoted towards its second position against the bias of the biasing member to position the elongated tab within the slots in the spaced flange portions of the anvil body. 8. The surgical stapling device of claim 1, wherein the cartridge assembly includes a channel extension supported on the distal portion of the cartridge body, the channel extension positioned in abutting relation with the channel member of the adapter assembly when the reload assembly is mounted to the channel member. 9. The surgical stapling device of claim 8, wherein the channel extension includes a base wall and side walls that define a cavity, the cavity defined by the channel extension aligned with the cavity defined by the channel member when the reload assembly is mounted on the channel member of the adapter assembly, the cavity of the channel extension receiving the distal portion of the cartridge body. 10. The surgical stapling device of claim 9, wherein the base wall of the channel extension defines a cutout in a proximal end of the base wall and the base wall of the channel member includes a distal portion that is received within the cutout when the reload assembly is mounted on the channel member of the adapter assembly. 11. The surgical stapling device of claim 1, wherein the adapter assembly includes a mounting assembly for non-removably coupling the channel member to the elongate body of the adapter assembly. 12. An adapter assembly comprising:
an elongate body defining a longitudinal axis and having a proximal portion and a distal portion, a mounting assembly, and a channel member supported on the distal portion of the elongate body by the mounting assembly, the channel member including a base wall and side walls that define a cavity configured to receive a cartridge body of a cartridge assembly of a surgical stapling device, the channel member being movable in relation to the elongate body about an axis transverse to the longitudinal axis between a first position aligned with the longitudinal axis and a second position defining an acute angle with respect to the longitudinal axis. 13. The adapter assembly of claim 12, wherein the mounting assembly non-removably couples the channel member to the elongate body. 14. The adapter assembly of claim 13, wherein the adapter assembly includes a biasing member that is positioned to urge the channel member towards its first position. 15. A reload assembly comprising:
an anvil and a cartridge assembly pivotably coupled to the anvil, the cartridge assembly including a cartridge body, a channel extension and a plurality of staples, the cartridge body having a proximal portion and a distal portion and defining a central knife slot and staple pockets positioned on each side of the central knife slot, each of the plurality of staples received within one of the staple pockets, the channel extension including a base wall and side walls defining a cavity, the cavity receiving the distal portion of the cartridge body, wherein the channel extension is spaced from the proximal portion of the cartridge body. 16. The reload assembly of claim 15, wherein the anvil includes an anvil body having a proximal portion and a distal portion, the proximal portion of the anvil body including spaced flange portions that define a recess, the proximal portion of the cartridge body received within the recess in the proximal portion of the anvil body. 17. The reload assembly of claim 16, wherein the proximal portion of the anvil body includes spaced fingers that are positioned within the recess and the proximal portion of the cartridge body defines spaced slots, the spaced fingers received within the spaced slots to pivotably couple the anvil to the cartridge assembly. 18. The reload assembly of claim 17, wherein the spaced fingers and the spaced slots are curved. 19. The reload assembly of claim 18, wherein the base wall of the channel extension defines a cutout in a proximal end of the base wall. 20. The reload assembly of claim 19, wherein the side walls of the channel extension each include a proximally extending finger. | A surgical stapling device includes an adapter assembly and a reload assembly. The adapter assembly includes an elongate body and a channel member coupled to the elongate body. The reload assembly includes an anvil and a cartridge assembly that includes a cartridge body and a channel extension. A proximal portion of the cartridge body is received within the channel member to secure the reload assembly to the adapter assembly. The channel extension is received about a distal portion of the cartridge body and is engaged with the channel member to support the cartridge body.1. A surgical stapling device comprising:
an adapter assembly including an elongate body defining a longitudinal axis and having a proximal portion and a distal portion, and a channel member supported on the distal portion of the elongate body, the channel member including a base wall and side walls that define a cavity, the channel member being movable in relation to the elongate body about an axis transverse to the longitudinal axis between a first position aligned with the longitudinal axis and a second position defining an acute angle with respect to the longitudinal axis; and a reload assembly including an anvil and a cartridge assembly pivotably coupled to the anvil, the cartridge assembly including a cartridge body and a plurality of staples, the cartridge body having a proximal portion and a distal portion and defining a central knife slot and staple pockets positioned on each side of the central knife slot, each of the plurality of staples received within one of the staple pockets, wherein the cartridge body is releasably received within the cavity defined by the channel member to mount the reload assembly to the adapter assembly. 2. The surgical stapling device of claim 1, wherein the anvil includes an anvil body having a proximal portion and a distal portion, the proximal portion of the anvil body including spaced flange portions that define a recess, the proximal portion of the cartridge body received within the recess in the proximal portion of the anvil body. 3. The surgical stapling device of claim 2, wherein the proximal portion of the anvil body includes spaced fingers that are positioned within the recess and the proximal portion of the cartridge body defines spaced slots, the spaced fingers received within the spaced slots to pivotably couple the anvil to the cartridge assembly. 4. The surgical stapling device of claim 3, wherein the spaced fingers and the spaced slots are curved. 5. The surgical stapling device of claim 2, wherein the side walls of the channel member of the adapter assembly include an elongated tab and the spaced flange portions of the of the anvil body define slots, the slots in the spaced flange portions of the anvil body receiving the elongated tabs of the channel member to secure the reload assembly to the adapter assembly. 6. The surgical stapling device of claim 5, wherein the adapter assembly includes a biasing member that is positioned to urge the channel member towards its first position. 7. The surgical stapling device of claim 6, wherein the elongated tab and the slots are positioned and configured such that the channel member must be pivoted towards its second position against the bias of the biasing member to position the elongated tab within the slots in the spaced flange portions of the anvil body. 8. The surgical stapling device of claim 1, wherein the cartridge assembly includes a channel extension supported on the distal portion of the cartridge body, the channel extension positioned in abutting relation with the channel member of the adapter assembly when the reload assembly is mounted to the channel member. 9. The surgical stapling device of claim 8, wherein the channel extension includes a base wall and side walls that define a cavity, the cavity defined by the channel extension aligned with the cavity defined by the channel member when the reload assembly is mounted on the channel member of the adapter assembly, the cavity of the channel extension receiving the distal portion of the cartridge body. 10. The surgical stapling device of claim 9, wherein the base wall of the channel extension defines a cutout in a proximal end of the base wall and the base wall of the channel member includes a distal portion that is received within the cutout when the reload assembly is mounted on the channel member of the adapter assembly. 11. The surgical stapling device of claim 1, wherein the adapter assembly includes a mounting assembly for non-removably coupling the channel member to the elongate body of the adapter assembly. 12. An adapter assembly comprising:
an elongate body defining a longitudinal axis and having a proximal portion and a distal portion, a mounting assembly, and a channel member supported on the distal portion of the elongate body by the mounting assembly, the channel member including a base wall and side walls that define a cavity configured to receive a cartridge body of a cartridge assembly of a surgical stapling device, the channel member being movable in relation to the elongate body about an axis transverse to the longitudinal axis between a first position aligned with the longitudinal axis and a second position defining an acute angle with respect to the longitudinal axis. 13. The adapter assembly of claim 12, wherein the mounting assembly non-removably couples the channel member to the elongate body. 14. The adapter assembly of claim 13, wherein the adapter assembly includes a biasing member that is positioned to urge the channel member towards its first position. 15. A reload assembly comprising:
an anvil and a cartridge assembly pivotably coupled to the anvil, the cartridge assembly including a cartridge body, a channel extension and a plurality of staples, the cartridge body having a proximal portion and a distal portion and defining a central knife slot and staple pockets positioned on each side of the central knife slot, each of the plurality of staples received within one of the staple pockets, the channel extension including a base wall and side walls defining a cavity, the cavity receiving the distal portion of the cartridge body, wherein the channel extension is spaced from the proximal portion of the cartridge body. 16. The reload assembly of claim 15, wherein the anvil includes an anvil body having a proximal portion and a distal portion, the proximal portion of the anvil body including spaced flange portions that define a recess, the proximal portion of the cartridge body received within the recess in the proximal portion of the anvil body. 17. The reload assembly of claim 16, wherein the proximal portion of the anvil body includes spaced fingers that are positioned within the recess and the proximal portion of the cartridge body defines spaced slots, the spaced fingers received within the spaced slots to pivotably couple the anvil to the cartridge assembly. 18. The reload assembly of claim 17, wherein the spaced fingers and the spaced slots are curved. 19. The reload assembly of claim 18, wherein the base wall of the channel extension defines a cutout in a proximal end of the base wall. 20. The reload assembly of claim 19, wherein the side walls of the channel extension each include a proximally extending finger. | 3,700 |
348,631 | 16,806,135 | 3,754 | Methods and systems for training a non-blind deblurring module are disclosed. Unblurred test images and blurred test images are received, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term. A regularized deconvolution sub-module and a convolutional neural network are jointly trained by adjusting a regularization parameter of a regularized deconvolution function and weights of a convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images. | 1. A method of training a non-blind deblurring module,
wherein the non-blind deblurring module includes a regularized deconvolution sub-module and a convolutional neural network sub-module, the regularized deconvolution sub-module is configured to perform a regularized deconvolution function on a blurred input image to produce a deconvolved image potentially having image artifacts, and the convolutional neural network sub-module is configured to receive the deconvolved image as an input to a convolutional neural network and to remove image artifacts, thereby providing a deblurred output image, the method comprising: receiving, via at least one processor, unblurred test images and blurred test images, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term; jointly training, via the at least one processor, the regularized deconvolution sub-module and the convolutional neural network by adjusting a regularization parameter of the regularized deconvolution function and weights of the convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images, thereby providing a trained regularization parameter, trained weights and a trained non-blind deblurring module; receiving, via the at least one processor, a blurred input image from an imaging device; deblurring, via the at least one processor, the blurred input image using the trained non-blind deblurring module; and outputting, via the at least one processor, a deblurred output image. 2. The method of claim 1, wherein the deconvolution function is a Wiener deconvolution function. 3. The method of claim 1, wherein the deconvolution function is a Tikhonov-regularized deconvolution function. 4. The method of claim 1, comprising using the trained non-blind deblurring module to deblur the blurred input image, thereby producing the deblurred output image, wherein the regularized deconvolution sub-module performs the regularized deconvolution function on the blurred input image to produce a deconvolved image potentially having image artifacts, the regularized deconvolution function including the trained regularization parameter, and the convolutional neural network sub-module processes the deconvolved image through the convolutional neural network to remove image artifacts, the convolution neural network including the trained weights. 5. The method of claim 4, wherein the convolutional neural network outputs residuals and the trained non-blind deblurring module adds the residuals to the deconvolved image, thereby producing the deblurred output image. 6. The method of claim 1, wherein adjusting, via the at least one processor, the regularization parameter and the weights uses a back propagation algorithm. 7. The method of claim 6, wherein the back propagation algorithm adjusts the regularization parameter based on gradients that have been fed back from the CNN and a derivative of the deconvolved image potentially having image artifacts with respect to the regularization parameter. 8. The method of claim 1, wherein the at least one processor receives the unblurred test images and artificially generates the blurred test images using a blur kernel function and a noise function on the unblurred test images. 9. The method of claim 1, wherein the blurred input image is received from the imaging device mounted to a vehicle. 10. The method of claim 9, wherein the vehicle includes a vehicle controller and the method includes controlling at least one vehicle function based on the deblurred output image. 11. A system for training a non-blind deblurring module, comprising:
a non-blind deblurring module including a regularized deconvolution sub-module and a convolutional neural network sub-module, wherein the regularized deconvolution sub-module is configured to perform a regularized deconvolution function on a blurred input image to produce a deconvolved image potentially having image artifacts, and wherein the convolutional neural network sub-module is configured to receive the deconvolved image as an input to a convolutional neural network and to remove image artifacts, thereby providing a deblurred output image; an imaging device; and at least one processor configured to execute program instructions, wherein the program instructions are configured to cause the at least one processor to: received unblurred test images and blurred test images, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term; jointly train the regularized deconvolution sub-module and the convolutional neural network by adjusting a regularization parameter of the regularized deconvolution function and weights of the convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images, thereby providing a trained regularization parameter, trained weights and a trained non-blind deblurring module; receive a blurred input image from the imaging device; deblur the blurred input image using the trained non-blind deblurring module; and output a deblurred output image. 12. The system of claim 11, wherein the deconvolution function is a Wiener deconvolution function. 13. The system of claim 11, wherein the deconvolution function is a Tikhonov-regularized deconvolution function. 14. The system of claim 11, wherein the trained non-blind deblurring module is configured to deblur the blurred input image, thereby producing the deblurred output image, wherein the regularized deconvolution sub-module is configured to perform the regularized deconvolution function on the blurred input image to produce a deconvolved image potentially having image artifacts using the trained regularization parameter, and the convolutional neural network sub-module is configured to process the deconvolved image through the convolutional neural network to remove image artifacts using the trained weights. 15. The system of claim 14, wherein the convolutional neural network is configured to output residuals and the trained non-blind deblurring module is configured to add the residuals to the deconvolved image, thereby producing the deblurred output image. 16. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to adjust the regularization parameter and the weights using a back propagation algorithm. 17. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to adjust the regularization parameter based on gradients that have been fed back from the CNN and a derivative of the deconvolved image potentially having image artifacts with respect to the regularization parameter. 18. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to receive the unblurred test images and artificially generate the blurred test images using a blur kernel function and a noise function on the unblurred test images. 19. The system of claim 11 comprising a vehicle, the vehicle comprising the imaging device and the non-blind deblurring module, the non-blind deblurring module configured to receive the blurred input image from the imaging device. 20. The system of claim 19, wherein the vehicle includes a vehicle controller configured to control at least one vehicle function based on the deblurred output image. | Methods and systems for training a non-blind deblurring module are disclosed. Unblurred test images and blurred test images are received, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term. A regularized deconvolution sub-module and a convolutional neural network are jointly trained by adjusting a regularization parameter of a regularized deconvolution function and weights of a convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images.1. A method of training a non-blind deblurring module,
wherein the non-blind deblurring module includes a regularized deconvolution sub-module and a convolutional neural network sub-module, the regularized deconvolution sub-module is configured to perform a regularized deconvolution function on a blurred input image to produce a deconvolved image potentially having image artifacts, and the convolutional neural network sub-module is configured to receive the deconvolved image as an input to a convolutional neural network and to remove image artifacts, thereby providing a deblurred output image, the method comprising: receiving, via at least one processor, unblurred test images and blurred test images, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term; jointly training, via the at least one processor, the regularized deconvolution sub-module and the convolutional neural network by adjusting a regularization parameter of the regularized deconvolution function and weights of the convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images, thereby providing a trained regularization parameter, trained weights and a trained non-blind deblurring module; receiving, via the at least one processor, a blurred input image from an imaging device; deblurring, via the at least one processor, the blurred input image using the trained non-blind deblurring module; and outputting, via the at least one processor, a deblurred output image. 2. The method of claim 1, wherein the deconvolution function is a Wiener deconvolution function. 3. The method of claim 1, wherein the deconvolution function is a Tikhonov-regularized deconvolution function. 4. The method of claim 1, comprising using the trained non-blind deblurring module to deblur the blurred input image, thereby producing the deblurred output image, wherein the regularized deconvolution sub-module performs the regularized deconvolution function on the blurred input image to produce a deconvolved image potentially having image artifacts, the regularized deconvolution function including the trained regularization parameter, and the convolutional neural network sub-module processes the deconvolved image through the convolutional neural network to remove image artifacts, the convolution neural network including the trained weights. 5. The method of claim 4, wherein the convolutional neural network outputs residuals and the trained non-blind deblurring module adds the residuals to the deconvolved image, thereby producing the deblurred output image. 6. The method of claim 1, wherein adjusting, via the at least one processor, the regularization parameter and the weights uses a back propagation algorithm. 7. The method of claim 6, wherein the back propagation algorithm adjusts the regularization parameter based on gradients that have been fed back from the CNN and a derivative of the deconvolved image potentially having image artifacts with respect to the regularization parameter. 8. The method of claim 1, wherein the at least one processor receives the unblurred test images and artificially generates the blurred test images using a blur kernel function and a noise function on the unblurred test images. 9. The method of claim 1, wherein the blurred input image is received from the imaging device mounted to a vehicle. 10. The method of claim 9, wherein the vehicle includes a vehicle controller and the method includes controlling at least one vehicle function based on the deblurred output image. 11. A system for training a non-blind deblurring module, comprising:
a non-blind deblurring module including a regularized deconvolution sub-module and a convolutional neural network sub-module, wherein the regularized deconvolution sub-module is configured to perform a regularized deconvolution function on a blurred input image to produce a deconvolved image potentially having image artifacts, and wherein the convolutional neural network sub-module is configured to receive the deconvolved image as an input to a convolutional neural network and to remove image artifacts, thereby providing a deblurred output image; an imaging device; and at least one processor configured to execute program instructions, wherein the program instructions are configured to cause the at least one processor to: received unblurred test images and blurred test images, wherein each of the blurred test images is related to a corresponding one of the unblurred test images by a blur kernel term and a noise term; jointly train the regularized deconvolution sub-module and the convolutional neural network by adjusting a regularization parameter of the regularized deconvolution function and weights of the convolution neural network in order to minimize a cost function representative of a difference between each deblurred output image and a corresponding one of the unblurred test images, thereby providing a trained regularization parameter, trained weights and a trained non-blind deblurring module; receive a blurred input image from the imaging device; deblur the blurred input image using the trained non-blind deblurring module; and output a deblurred output image. 12. The system of claim 11, wherein the deconvolution function is a Wiener deconvolution function. 13. The system of claim 11, wherein the deconvolution function is a Tikhonov-regularized deconvolution function. 14. The system of claim 11, wherein the trained non-blind deblurring module is configured to deblur the blurred input image, thereby producing the deblurred output image, wherein the regularized deconvolution sub-module is configured to perform the regularized deconvolution function on the blurred input image to produce a deconvolved image potentially having image artifacts using the trained regularization parameter, and the convolutional neural network sub-module is configured to process the deconvolved image through the convolutional neural network to remove image artifacts using the trained weights. 15. The system of claim 14, wherein the convolutional neural network is configured to output residuals and the trained non-blind deblurring module is configured to add the residuals to the deconvolved image, thereby producing the deblurred output image. 16. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to adjust the regularization parameter and the weights using a back propagation algorithm. 17. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to adjust the regularization parameter based on gradients that have been fed back from the CNN and a derivative of the deconvolved image potentially having image artifacts with respect to the regularization parameter. 18. The system of claim 11, wherein the program instructions are configured to cause the at least one processor to receive the unblurred test images and artificially generate the blurred test images using a blur kernel function and a noise function on the unblurred test images. 19. The system of claim 11 comprising a vehicle, the vehicle comprising the imaging device and the non-blind deblurring module, the non-blind deblurring module configured to receive the blurred input image from the imaging device. 20. The system of claim 19, wherein the vehicle includes a vehicle controller configured to control at least one vehicle function based on the deblurred output image. | 3,700 |
348,632 | 16,806,132 | 3,754 | The disclosure provides a cross-linkable polymer composition, a core layer for an information carrying card comprising such cross-linked composition, resulting information carrying card, and methods of making the same. A crosslinkable polymer composition comprises a curable base polymer resin in a liquid or paste form, and a particulate thermoplastic filler. The base polymer resin is selected from the group consisting of urethane acrylate, silicone acrylate, epoxy acrylate, urethane, acrylate, silicone and epoxy. The particulate thermoplastic filler may be polyolefin, polyvinyl chloride (PVC), a copolymer of vinyl chloride and at least another monomer, or a polyester such as polyethylene terephthalate (PET), a compound or blend thereof. | 1. A method for forming a core layer of an information carrying card, comprising:
providing at least one thermoplastic layer defining at least one cavity therein, each cavity having a continuous surface defined by and inside the at least one thermoplastic layer; disposing an inlay layer comprising at least one electronic component partially or fully into the at least one cavity; dispensing a crosslinkable polymer composition into the at least one cavity and contacting the at least one electronic component, the crosslinkable polymer composition comprising a base polymer resin selected from the group consisting of urethane acrylate, ester acrylate, silicone acrylate, epoxy acrylate, methacrylate, silicone, urethane and epoxy; and placing a breathable release film over the inlay layer after dispensing the crosslinkable polymer composition into the at least one cavity to form a sandwich structure. 2. The method of claim 1 further comprising:
providing another release film; and
placing the at least one thermoplastic layer above the release film before disposing the inlay layer into the at least one cavity. 3. The method of claim 1 further comprising:
pressing the sandwich structure under a pressure less than 2 MPa. 4. The method of claim 1 further comprising:
heating the sandwich structure at a raised temperature under the pressure to cure the crosslinkable polymer composition. 5. The method of claim 4 wherein the raised temperature is less than 150° C. 6. The method of claim 2 further comprising:
peeling off the release films to provide the core layer. 7. The method of claim 1, wherein the crosslinkable polymer composition comprises a thermoplastic filler. 8. The method of claim 1, wherein the breathable release film is a silicone coated paper. 9. The method of claim 1 further comprising:
forming a plurality of holes by cutting a plurality of portions of a supporting film without damages to any of the at least one wire and the at least one integrated circuit on the inlay layer, before disposing the inlay layer of PCB into the at least one cavity on the first thermoplastic layer. 10. The method of claim 1 further comprising:
fixing the inlay layer onto the at least one thermoplastic layer by applying an instant adhesive in the plurality of holes of the inlay layer, before dispensing the crosslinkable polymer composition. 11. The method of claim 10 wherein the instant adhesive comprises cyanoacrylate. 12. The method of claim 1 wherein forming the at least one thermoplastic layer comprises:
die-cutting one or more thermoplastic films; and
laminating the one or more thermoplastic films under a heating condition. 13. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size larger than the size of the inlay layer. 14. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size substantially the same as the size of the inlay layer. 15. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size substantially the same as the size of a portion of the inlay layer. 16. The method of claim 1 wherein the at least one thermoplastic layer comprises a thermoplastic material selected from the group consisting of polyvinyl chloride, copolymer of vinyl chloride, polyolefin, polycarbonate, polyester, polyamide, and acrylonitrile butadiene styrene copolymer (ABS). 17. The method of claim 1 wherein the base polymer resin in the crosslinkable polymer composition is urethane acrylate or epoxy. 18. The method of claim 1 further comprising curing the crosslinkable polymer under a UV light. 19. A method for fabricating an information carrying card, comprising forming a core layer of the information carrying card according to claim 1. 20. A method of claim 19 further comprising laminating a printable thermoplastic film on each side of the core layer of the information carrying card; and laminating a transparent thermoplastic film on the printable thermoplastic film each side of the core layer of the information carrying card. | The disclosure provides a cross-linkable polymer composition, a core layer for an information carrying card comprising such cross-linked composition, resulting information carrying card, and methods of making the same. A crosslinkable polymer composition comprises a curable base polymer resin in a liquid or paste form, and a particulate thermoplastic filler. The base polymer resin is selected from the group consisting of urethane acrylate, silicone acrylate, epoxy acrylate, urethane, acrylate, silicone and epoxy. The particulate thermoplastic filler may be polyolefin, polyvinyl chloride (PVC), a copolymer of vinyl chloride and at least another monomer, or a polyester such as polyethylene terephthalate (PET), a compound or blend thereof.1. A method for forming a core layer of an information carrying card, comprising:
providing at least one thermoplastic layer defining at least one cavity therein, each cavity having a continuous surface defined by and inside the at least one thermoplastic layer; disposing an inlay layer comprising at least one electronic component partially or fully into the at least one cavity; dispensing a crosslinkable polymer composition into the at least one cavity and contacting the at least one electronic component, the crosslinkable polymer composition comprising a base polymer resin selected from the group consisting of urethane acrylate, ester acrylate, silicone acrylate, epoxy acrylate, methacrylate, silicone, urethane and epoxy; and placing a breathable release film over the inlay layer after dispensing the crosslinkable polymer composition into the at least one cavity to form a sandwich structure. 2. The method of claim 1 further comprising:
providing another release film; and
placing the at least one thermoplastic layer above the release film before disposing the inlay layer into the at least one cavity. 3. The method of claim 1 further comprising:
pressing the sandwich structure under a pressure less than 2 MPa. 4. The method of claim 1 further comprising:
heating the sandwich structure at a raised temperature under the pressure to cure the crosslinkable polymer composition. 5. The method of claim 4 wherein the raised temperature is less than 150° C. 6. The method of claim 2 further comprising:
peeling off the release films to provide the core layer. 7. The method of claim 1, wherein the crosslinkable polymer composition comprises a thermoplastic filler. 8. The method of claim 1, wherein the breathable release film is a silicone coated paper. 9. The method of claim 1 further comprising:
forming a plurality of holes by cutting a plurality of portions of a supporting film without damages to any of the at least one wire and the at least one integrated circuit on the inlay layer, before disposing the inlay layer of PCB into the at least one cavity on the first thermoplastic layer. 10. The method of claim 1 further comprising:
fixing the inlay layer onto the at least one thermoplastic layer by applying an instant adhesive in the plurality of holes of the inlay layer, before dispensing the crosslinkable polymer composition. 11. The method of claim 10 wherein the instant adhesive comprises cyanoacrylate. 12. The method of claim 1 wherein forming the at least one thermoplastic layer comprises:
die-cutting one or more thermoplastic films; and
laminating the one or more thermoplastic films under a heating condition. 13. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size larger than the size of the inlay layer. 14. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size substantially the same as the size of the inlay layer. 15. The method of claim 1 wherein the at least one cavity on the at least one thermoplastic layer has a size substantially the same as the size of a portion of the inlay layer. 16. The method of claim 1 wherein the at least one thermoplastic layer comprises a thermoplastic material selected from the group consisting of polyvinyl chloride, copolymer of vinyl chloride, polyolefin, polycarbonate, polyester, polyamide, and acrylonitrile butadiene styrene copolymer (ABS). 17. The method of claim 1 wherein the base polymer resin in the crosslinkable polymer composition is urethane acrylate or epoxy. 18. The method of claim 1 further comprising curing the crosslinkable polymer under a UV light. 19. A method for fabricating an information carrying card, comprising forming a core layer of the information carrying card according to claim 1. 20. A method of claim 19 further comprising laminating a printable thermoplastic film on each side of the core layer of the information carrying card; and laminating a transparent thermoplastic film on the printable thermoplastic film each side of the core layer of the information carrying card. | 3,700 |
348,633 | 16,806,163 | 3,754 | An applicator for applying adhesive to a moving web has a housing with an interior chamber, an inlet and a discharge port. The inlet and discharge port are in fluid communication with the interior chamber. A rotor is disposed within the interior chamber of the housing. The rotor has a body and a nonlinear channel extending about at least a portion of the body. The nonlinear channel is selectively positionable for fluid communication with the inlet and the discharge port of the housing such that adhesive flowing into the housing through the inlet flows through and is directed by the nonlinear channel to the discharge port in the housing. The rotor is rotatable relative to the housing to change the position of the nonlinear channel relative to the discharge port and thereby change the location from which adhesive flows from the discharge port. | 1-20. (canceled) 21. A method of applying adhesive to a moving web, the method comprising:
directing the adhesive through at least a portion of a housing to a rotor disposed within the housing; directing the adhesive to a longitudinally extending passage within the rotor; directing the adhesive from the longitudinally extending passage to a transverse passage within the rotor; directing the adhesive from the transverse passage to a nonlinear channel formed on the rotor wherein the transverse passage fluidly connects the longitudinal passage to the nonlinear channel; directing the adhesive from the nonlinear channel to a discharge port; discharging the adhesive from the housing through the discharge port and onto the moving web at an intersection of the nonlinear channel and the discharge port; and rotating the rotor within the housing to change the location of the intersection and to change the location from which the adhesive is discharged from the housing through the discharge port. 22. The method as set forth in claim 21 further comprising rotating the rotor between an ON position wherein the nonlinear channel intersects the discharge port and adhesive is discharged from the discharge port of the housing and an OFF position wherein the nonlinear channel does not intersect the discharge port and adhesive is prevented from being discharged from the discharge port. 23. The method as set forth in claim 22 further comprising directing the adhesive through the rotor and back to the adhesive source in the OFF position. 24. The method as set forth in claim 22 further comprising rotating the rotor within the housing in a first direction and then rotating the rotor within the housing in a second direction opposite the first direction to change the location of the intersection and to change the location from which the adhesive is discharged from the housing through the discharge port. 25. The method as set forth in claim 24 further comprising continuously directing adhesive through at least a portion of the housing;
intermittently discharging the adhesive from the housing through the discharge port and onto the moving web in a curved adhesive pattern; and
intermittently blocking the adhesive from the discharge port and discharging the adhesive from the housing via a return passage. 26. The method as set forth in claim 25 further comprising,
rotating the rotor to a first position and discharging the adhesive from a first portion of the slot;
rotating the rotor to a second position and discharging the adhesive from a second portion of the slot different than the first portion;
rotating the rotor to a third position and discharging from a third portion of the slot different than the first portion and the second portion. 27. The method as set forth in claim 26 wherein rotating the rotor to the first position, the second position, and the third position collectively is less than one full rotation of the rotor. 28. The method as set forth in claim 27 wherein the rotor comprises two or more nonlinear channels and the method further comprises,
discharging adhesive from a first nonlinear channel through a first location of the slot;
rotating the rotor; and
discharging adhesive from a second nonlinear channel through the first location of the slot, wherein the second nonlinear channel is separate and distinct from the first nonlinear channel. | An applicator for applying adhesive to a moving web has a housing with an interior chamber, an inlet and a discharge port. The inlet and discharge port are in fluid communication with the interior chamber. A rotor is disposed within the interior chamber of the housing. The rotor has a body and a nonlinear channel extending about at least a portion of the body. The nonlinear channel is selectively positionable for fluid communication with the inlet and the discharge port of the housing such that adhesive flowing into the housing through the inlet flows through and is directed by the nonlinear channel to the discharge port in the housing. The rotor is rotatable relative to the housing to change the position of the nonlinear channel relative to the discharge port and thereby change the location from which adhesive flows from the discharge port.1-20. (canceled) 21. A method of applying adhesive to a moving web, the method comprising:
directing the adhesive through at least a portion of a housing to a rotor disposed within the housing; directing the adhesive to a longitudinally extending passage within the rotor; directing the adhesive from the longitudinally extending passage to a transverse passage within the rotor; directing the adhesive from the transverse passage to a nonlinear channel formed on the rotor wherein the transverse passage fluidly connects the longitudinal passage to the nonlinear channel; directing the adhesive from the nonlinear channel to a discharge port; discharging the adhesive from the housing through the discharge port and onto the moving web at an intersection of the nonlinear channel and the discharge port; and rotating the rotor within the housing to change the location of the intersection and to change the location from which the adhesive is discharged from the housing through the discharge port. 22. The method as set forth in claim 21 further comprising rotating the rotor between an ON position wherein the nonlinear channel intersects the discharge port and adhesive is discharged from the discharge port of the housing and an OFF position wherein the nonlinear channel does not intersect the discharge port and adhesive is prevented from being discharged from the discharge port. 23. The method as set forth in claim 22 further comprising directing the adhesive through the rotor and back to the adhesive source in the OFF position. 24. The method as set forth in claim 22 further comprising rotating the rotor within the housing in a first direction and then rotating the rotor within the housing in a second direction opposite the first direction to change the location of the intersection and to change the location from which the adhesive is discharged from the housing through the discharge port. 25. The method as set forth in claim 24 further comprising continuously directing adhesive through at least a portion of the housing;
intermittently discharging the adhesive from the housing through the discharge port and onto the moving web in a curved adhesive pattern; and
intermittently blocking the adhesive from the discharge port and discharging the adhesive from the housing via a return passage. 26. The method as set forth in claim 25 further comprising,
rotating the rotor to a first position and discharging the adhesive from a first portion of the slot;
rotating the rotor to a second position and discharging the adhesive from a second portion of the slot different than the first portion;
rotating the rotor to a third position and discharging from a third portion of the slot different than the first portion and the second portion. 27. The method as set forth in claim 26 wherein rotating the rotor to the first position, the second position, and the third position collectively is less than one full rotation of the rotor. 28. The method as set forth in claim 27 wherein the rotor comprises two or more nonlinear channels and the method further comprises,
discharging adhesive from a first nonlinear channel through a first location of the slot;
rotating the rotor; and
discharging adhesive from a second nonlinear channel through the first location of the slot, wherein the second nonlinear channel is separate and distinct from the first nonlinear channel. | 3,700 |
348,634 | 16,806,137 | 2,616 | A point cloud information generation apparatus according to an embodiment includes a 360-degree image acquirer configured to acquire a 360-degree image of a three-dimensional (3D) space, a point cloud information generator configured to generate first point cloud information for the 3D space from the 360-degree image, and a viewpoint orientation image generator configured to generate a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image, wherein the point cloud information generator further configured to generate second point cloud information for the 3D space from the plurality of viewpoint orientation images. | 1. A point cloud information generation apparatus comprising:
a 360-degree image acquirer configured to acquire a 360-degree image of a three-dimensional (3D) space; a point cloud information generator configured to generate first point cloud information for the 3D space from the 360-degree image; and a viewpoint orientation image generator configured to generate a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image, wherein the point cloud information generator further configured to generate second point cloud information for the 3D space from the plurality of viewpoint orientation images. 2. The point cloud information generation apparatus of claim 1, wherein each of the viewpoint orientation images is an image obtained by projecting a region corresponding to a specific viewpoint in the 360-degree image onto a two-dimensional (2D) plane. 3. The point cloud information generation apparatus of claim 1, wherein the viewpoint orientation image generator further configured to generate a plurality of viewpoint orientation images including a viewpoint orientation image corresponding to the reference viewpoint and viewpoint orientation images corresponding to one or more viewpoints shifted with respect to the reference viewpoint. 4. The point cloud information generation apparatus of claim 1, wherein the viewpoint orientation image generator further configured to generate the plurality of viewpoint orientation images based on at least one of a predetermined image resolution and a field of view (FoV). 5. The point cloud information generation apparatus of claim 1, wherein the point cloud information generator further configured to calculate a correlation between the plurality of viewpoint orientation images based on information for each of the plurality of viewpoint orientation images and generate the second point cloud information based on the correlation. 6. The point cloud information generation apparatus of claim 5, wherein the information for each of the plurality of viewpoint orientation images comprises at least one of location information of each of the plurality of viewpoint orientation images, orientation information of each of the plurality of viewpoint orientation images, and a camera parameter corresponding to each of the plurality of viewpoint orientation images. 7. The point cloud information generation apparatus of claim 5, wherein the correlation comprises at least one of distances between locations corresponding to the plurality of viewpoint orientation images and angles between viewpoint orientations of the plurality of viewpoint orientation images. 8. The point cloud information generation apparatus of claim 1, further comprising a mapper configured to map location information of the 360-degree image to a map including the 3D space. 9. The point cloud information generation apparatus of claim 8, wherein the viewpoint orientation image generator further configured to generate the plurality of viewpoint orientation images based on a coordinate system of the map. 10. The point cloud information generation apparatus of claim 8, wherein the point cloud information generator further configured to generate the second point cloud information based on a coordinate system of the map. 11. A point cloud information generation method comprising:
acquiring a 360-degree image of a three-dimensional (3D) space; generating first point cloud information for the 3D space from the 360-degree image; generating a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image; and generating second point cloud information for the 3D space from the plurality of viewpoint orientation images. 12. The point cloud information generation method of claim 11, wherein each of the viewpoint orientation images is an image obtained by projecting a region corresponding to a specific viewpoint in the 360-degree image onto a two-dimensional (2D) plane. 13. The point cloud information generation method of claim 11, wherein the generating of a plurality of viewpoint orientation images comprises generating a plurality of viewpoint orientation images including a viewpoint orientation image corresponding to the reference viewpoint and viewpoint orientation images corresponding to one or more viewpoints shifted with respect to the reference viewpoint. 14. The point cloud information generation method of claim 11, wherein the generating of a plurality of viewpoint orientation images comprises generating the plurality of viewpoint orientation images based on at least one of a predetermined image resolution and field of view (FoV). 15. The point cloud information generation method of claim 11, wherein the generating of second point cloud information comprises:
calculating a correlation between the plurality of viewpoint orientation images based on information for each of the plurality of viewpoint orientation images; and generating the second point cloud information based on the correlation. 16. The point cloud information generation method of claim 15, wherein the information for each of the plurality of viewpoint orientation images comprises at least one of location information of each of the plurality of viewpoint orientation images, orientation information of each of the plurality of viewpoint orientation images, and a camera parameter corresponding to each of the plurality of viewpoint orientation images. 17. The point cloud information generation method of claim 15, wherein the correlation comprises at least one of distances between locations corresponding to the plurality of viewpoint orientation images and angles between viewpoint orientations of the plurality of viewpoint orientation images. 18. The point cloud information generation method of claim 11, further comprising mapping location information of the 360-degree image to a map including the 3D space after the generating of first point cloud information. 19. The point cloud information generation method of claim 18, wherein the generating of a plurality of viewpoint orientation images comprises generating the plurality of viewpoint orientation images based on a coordinate system of the map. 20. The point cloud information generation method of claim 18, wherein the generating of second point cloud information comprises generating the second point cloud information based on a coordinate system of the map. | A point cloud information generation apparatus according to an embodiment includes a 360-degree image acquirer configured to acquire a 360-degree image of a three-dimensional (3D) space, a point cloud information generator configured to generate first point cloud information for the 3D space from the 360-degree image, and a viewpoint orientation image generator configured to generate a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image, wherein the point cloud information generator further configured to generate second point cloud information for the 3D space from the plurality of viewpoint orientation images.1. A point cloud information generation apparatus comprising:
a 360-degree image acquirer configured to acquire a 360-degree image of a three-dimensional (3D) space; a point cloud information generator configured to generate first point cloud information for the 3D space from the 360-degree image; and a viewpoint orientation image generator configured to generate a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image, wherein the point cloud information generator further configured to generate second point cloud information for the 3D space from the plurality of viewpoint orientation images. 2. The point cloud information generation apparatus of claim 1, wherein each of the viewpoint orientation images is an image obtained by projecting a region corresponding to a specific viewpoint in the 360-degree image onto a two-dimensional (2D) plane. 3. The point cloud information generation apparatus of claim 1, wherein the viewpoint orientation image generator further configured to generate a plurality of viewpoint orientation images including a viewpoint orientation image corresponding to the reference viewpoint and viewpoint orientation images corresponding to one or more viewpoints shifted with respect to the reference viewpoint. 4. The point cloud information generation apparatus of claim 1, wherein the viewpoint orientation image generator further configured to generate the plurality of viewpoint orientation images based on at least one of a predetermined image resolution and a field of view (FoV). 5. The point cloud information generation apparatus of claim 1, wherein the point cloud information generator further configured to calculate a correlation between the plurality of viewpoint orientation images based on information for each of the plurality of viewpoint orientation images and generate the second point cloud information based on the correlation. 6. The point cloud information generation apparatus of claim 5, wherein the information for each of the plurality of viewpoint orientation images comprises at least one of location information of each of the plurality of viewpoint orientation images, orientation information of each of the plurality of viewpoint orientation images, and a camera parameter corresponding to each of the plurality of viewpoint orientation images. 7. The point cloud information generation apparatus of claim 5, wherein the correlation comprises at least one of distances between locations corresponding to the plurality of viewpoint orientation images and angles between viewpoint orientations of the plurality of viewpoint orientation images. 8. The point cloud information generation apparatus of claim 1, further comprising a mapper configured to map location information of the 360-degree image to a map including the 3D space. 9. The point cloud information generation apparatus of claim 8, wherein the viewpoint orientation image generator further configured to generate the plurality of viewpoint orientation images based on a coordinate system of the map. 10. The point cloud information generation apparatus of claim 8, wherein the point cloud information generator further configured to generate the second point cloud information based on a coordinate system of the map. 11. A point cloud information generation method comprising:
acquiring a 360-degree image of a three-dimensional (3D) space; generating first point cloud information for the 3D space from the 360-degree image; generating a plurality of viewpoint orientation images from the 360-degree image based on a reference viewpoint in the 360-degree image; and generating second point cloud information for the 3D space from the plurality of viewpoint orientation images. 12. The point cloud information generation method of claim 11, wherein each of the viewpoint orientation images is an image obtained by projecting a region corresponding to a specific viewpoint in the 360-degree image onto a two-dimensional (2D) plane. 13. The point cloud information generation method of claim 11, wherein the generating of a plurality of viewpoint orientation images comprises generating a plurality of viewpoint orientation images including a viewpoint orientation image corresponding to the reference viewpoint and viewpoint orientation images corresponding to one or more viewpoints shifted with respect to the reference viewpoint. 14. The point cloud information generation method of claim 11, wherein the generating of a plurality of viewpoint orientation images comprises generating the plurality of viewpoint orientation images based on at least one of a predetermined image resolution and field of view (FoV). 15. The point cloud information generation method of claim 11, wherein the generating of second point cloud information comprises:
calculating a correlation between the plurality of viewpoint orientation images based on information for each of the plurality of viewpoint orientation images; and generating the second point cloud information based on the correlation. 16. The point cloud information generation method of claim 15, wherein the information for each of the plurality of viewpoint orientation images comprises at least one of location information of each of the plurality of viewpoint orientation images, orientation information of each of the plurality of viewpoint orientation images, and a camera parameter corresponding to each of the plurality of viewpoint orientation images. 17. The point cloud information generation method of claim 15, wherein the correlation comprises at least one of distances between locations corresponding to the plurality of viewpoint orientation images and angles between viewpoint orientations of the plurality of viewpoint orientation images. 18. The point cloud information generation method of claim 11, further comprising mapping location information of the 360-degree image to a map including the 3D space after the generating of first point cloud information. 19. The point cloud information generation method of claim 18, wherein the generating of a plurality of viewpoint orientation images comprises generating the plurality of viewpoint orientation images based on a coordinate system of the map. 20. The point cloud information generation method of claim 18, wherein the generating of second point cloud information comprises generating the second point cloud information based on a coordinate system of the map. | 2,600 |
348,635 | 16,806,126 | 2,616 | This disclosure provides methods, devices and systems for identifying wake-up signals. Some implementations more specifically relate to PHY preamble designs for wake-up signals such as Wake-Up Radio (WUR) packets conforming to IEEE 802.11ba. In some implementations, the preamble designs can include a combination of modulation schemes, data rate indications and length indications enabling devices capable of receiving and decoding wake-up signals to identify the signals as wake-up signals (for example, WUR packets), while ensuring that devices not capable of receiving and decoding wake-up signals identify the wake-up signals as legacy packets, or otherwise not WUR packets. | 1. A method for wireless communication by a wireless communication device, comprising:
generating a physical layer preamble of a packet, the physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols; modulating each of the one or more symbols in the first portion according to a binary phase shift keying (BPSK) modulation scheme; modulating the first two symbols in the second portion immediately following the last symbol in the first portion according to a BPSK modulation scheme; generating a physical layer payload of the packet including a plurality of symbols; modulating the plurality of symbols in the payload according to a multicarrier on-off keying (MC-OOK) modulation scheme; and outputting the modulated packet for transmission to at least one wireless communication device. 2. The method of claim 1, wherein the second symbol in the second portion is a repeat of the first symbol in the second portion. 3. The method of claim 1, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 4. The method of claim 3, wherein the second set of code bits are the logical complement of the first set of code bits. 5. The method of claim 1, wherein the first portion includes a data rate field and a length field, the data rate field indicating a data rate of 6 Megabits per second (Mbps) and the length field indicating a modulus 3 of 0. 6. The method of claim 1, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 7. A method for wireless communication by a wireless communication device, comprising:
receiving a packet from a second wireless communication device via a first radio, the packet including:
a physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols, each of the one or more symbols in the first portion being modulated according to a binary phase shift keying (BPSK) modulation scheme, the first two symbols in the second portion immediately following the last symbol in the first portion being modulated according to a BPSK modulation scheme, and
a physical layer payload including a plurality of symbols, the plurality of symbols in the payload being modulated according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
determining a packet type of the packet based at least in part on the modulation in the first portion and the modulation in the second portion. 8. The method of claim 7, wherein the determination of the packet type is further based on the modulation of the physical layer payload. 9. The method of claim 7, wherein the second symbol in the second portion is identical to the first symbol in the second portion. 10. The method of claim 7, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 11. The method of claim 10, wherein the second set of code bits are the logical complement of the first set of code bits. 12. The method of claim 7, wherein the first portion includes a data rate field and a length field, and wherein the determination of the packet type is further based on the data rate field indicating a data rate of 6 Megabits per second (Mbps) or the length field indicating a modulus 3 of 0. 13. The method of claim 7, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 14. A wireless communication device, comprising:
at least one modem; at least one processor; and at least one memory communicatively coupled with the at least one processor and storing processor-readable code that, when executed by the at least one processor, causes the wireless communication device to:
generate a physical layer preamble of a packet, the physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols;
modulate each of the one or more symbols in the first portion according to a binary phase shift keying (BPSK) modulation scheme;
modulate the first two symbols in the second portion immediately following the last symbol in the first portion according to a BPSK modulation scheme;
generate a physical layer payload of the packet including a plurality of symbols;
modulate the plurality of symbols in the payload according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
output the modulated packet for transmission to at least one wireless communication device. 15. The wireless communication device of claim 14, wherein the second symbol in the second portion is a repeat of the first symbol in the second portion. 16. The wireless communication device of claim 14, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 17. The wireless communication device of claim 16, wherein the second set of code bits are the logical complement of the first set of code bits. 18. The wireless communication device of claim 14, wherein the first portion includes a data rate field and a length field, the data rate field indicating a data rate of 6 Megabits per second (Mbps) and the length field indicating a modulus 3 of 0. 19. The wireless communication device of claim 14, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 20. A wireless communication device, comprising:
a first low power radio and a second primary radio; at least one modem; at least one processor; and at least one memory communicatively coupled with the at least one processor and storing processor-readable code that, when executed by the at least one processor, causes the wireless communication device to:
receive a packet from a second wireless communication device via the first radio, the packet including:
a physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols, each of the one or more symbols in the first portion being modulated according to a binary phase shift keying (BPSK) modulation scheme, the first two symbols in the second portion immediately following the last symbol in the first portion being modulated according to a BPSK modulation scheme, and
a physical layer payload including a plurality of symbols, the plurality of symbols in the payload being modulated according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
determine a packet type of the packet based at least in part on the modulation in the first portion and the modulation in the second portion. 21. The wireless communication device of claim 20, wherein the determination of the packet type is further based on the modulation of the physical layer payload. 22. The wireless communication device of claim 20, wherein the second symbol in the second portion is identical to the first symbol in the second portion. 23. The wireless communication device of claim 20, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 24. The wireless communication device of claim 23, wherein the second set of code bits are the logical complement of the first set of code bits. 25. The wireless communication device of claim 20, wherein the first portion includes a data rate field and a length field, and wherein the determination of the packet type is further based on the data rate field indicating a data rate of 6 Megabits per second (Mbps) or the length field indicating a modulus 3 of 0. 26. The wireless communication device of claim 20, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. | This disclosure provides methods, devices and systems for identifying wake-up signals. Some implementations more specifically relate to PHY preamble designs for wake-up signals such as Wake-Up Radio (WUR) packets conforming to IEEE 802.11ba. In some implementations, the preamble designs can include a combination of modulation schemes, data rate indications and length indications enabling devices capable of receiving and decoding wake-up signals to identify the signals as wake-up signals (for example, WUR packets), while ensuring that devices not capable of receiving and decoding wake-up signals identify the wake-up signals as legacy packets, or otherwise not WUR packets.1. A method for wireless communication by a wireless communication device, comprising:
generating a physical layer preamble of a packet, the physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols; modulating each of the one or more symbols in the first portion according to a binary phase shift keying (BPSK) modulation scheme; modulating the first two symbols in the second portion immediately following the last symbol in the first portion according to a BPSK modulation scheme; generating a physical layer payload of the packet including a plurality of symbols; modulating the plurality of symbols in the payload according to a multicarrier on-off keying (MC-OOK) modulation scheme; and outputting the modulated packet for transmission to at least one wireless communication device. 2. The method of claim 1, wherein the second symbol in the second portion is a repeat of the first symbol in the second portion. 3. The method of claim 1, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 4. The method of claim 3, wherein the second set of code bits are the logical complement of the first set of code bits. 5. The method of claim 1, wherein the first portion includes a data rate field and a length field, the data rate field indicating a data rate of 6 Megabits per second (Mbps) and the length field indicating a modulus 3 of 0. 6. The method of claim 1, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 7. A method for wireless communication by a wireless communication device, comprising:
receiving a packet from a second wireless communication device via a first radio, the packet including:
a physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols, each of the one or more symbols in the first portion being modulated according to a binary phase shift keying (BPSK) modulation scheme, the first two symbols in the second portion immediately following the last symbol in the first portion being modulated according to a BPSK modulation scheme, and
a physical layer payload including a plurality of symbols, the plurality of symbols in the payload being modulated according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
determining a packet type of the packet based at least in part on the modulation in the first portion and the modulation in the second portion. 8. The method of claim 7, wherein the determination of the packet type is further based on the modulation of the physical layer payload. 9. The method of claim 7, wherein the second symbol in the second portion is identical to the first symbol in the second portion. 10. The method of claim 7, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 11. The method of claim 10, wherein the second set of code bits are the logical complement of the first set of code bits. 12. The method of claim 7, wherein the first portion includes a data rate field and a length field, and wherein the determination of the packet type is further based on the data rate field indicating a data rate of 6 Megabits per second (Mbps) or the length field indicating a modulus 3 of 0. 13. The method of claim 7, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 14. A wireless communication device, comprising:
at least one modem; at least one processor; and at least one memory communicatively coupled with the at least one processor and storing processor-readable code that, when executed by the at least one processor, causes the wireless communication device to:
generate a physical layer preamble of a packet, the physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols;
modulate each of the one or more symbols in the first portion according to a binary phase shift keying (BPSK) modulation scheme;
modulate the first two symbols in the second portion immediately following the last symbol in the first portion according to a BPSK modulation scheme;
generate a physical layer payload of the packet including a plurality of symbols;
modulate the plurality of symbols in the payload according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
output the modulated packet for transmission to at least one wireless communication device. 15. The wireless communication device of claim 14, wherein the second symbol in the second portion is a repeat of the first symbol in the second portion. 16. The wireless communication device of claim 14, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 17. The wireless communication device of claim 16, wherein the second set of code bits are the logical complement of the first set of code bits. 18. The wireless communication device of claim 14, wherein the first portion includes a data rate field and a length field, the data rate field indicating a data rate of 6 Megabits per second (Mbps) and the length field indicating a modulus 3 of 0. 19. The wireless communication device of claim 14, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. 20. A wireless communication device, comprising:
a first low power radio and a second primary radio; at least one modem; at least one processor; and at least one memory communicatively coupled with the at least one processor and storing processor-readable code that, when executed by the at least one processor, causes the wireless communication device to:
receive a packet from a second wireless communication device via the first radio, the packet including:
a physical layer preamble including a first portion and a second portion, the first portion including one or more symbols, the second portion including two or more symbols, each of the one or more symbols in the first portion being modulated according to a binary phase shift keying (BPSK) modulation scheme, the first two symbols in the second portion immediately following the last symbol in the first portion being modulated according to a BPSK modulation scheme, and
a physical layer payload including a plurality of symbols, the plurality of symbols in the payload being modulated according to a multicarrier on-off keying (MC-OOK) modulation scheme; and
determine a packet type of the packet based at least in part on the modulation in the first portion and the modulation in the second portion. 21. The wireless communication device of claim 20, wherein the determination of the packet type is further based on the modulation of the physical layer payload. 22. The wireless communication device of claim 20, wherein the second symbol in the second portion is identical to the first symbol in the second portion. 23. The wireless communication device of claim 20, wherein the last symbol in the first portion includes a first set of code bits, and wherein the first symbol in the second portion includes a second set of code bits, the second set of code bits being based on the first set of code bits. 24. The wireless communication device of claim 23, wherein the second set of code bits are the logical complement of the first set of code bits. 25. The wireless communication device of claim 20, wherein the first portion includes a data rate field and a length field, and wherein the determination of the packet type is further based on the data rate field indicating a data rate of 6 Megabits per second (Mbps) or the length field indicating a modulus 3 of 0. 26. The wireless communication device of claim 20, wherein the first portion is a legacy portion including a legacy short training field (L-STF), followed by a legacy long training field (L-LTF) and followed by a legacy signaling field (L-SIG) having a single symbol, the last symbol in the first portion being the single symbol of the L-SIG. | 2,600 |
348,636 | 16,806,161 | 1,651 | A composition useful for removing energetic compounds from contaminated environments. The composition includes a supported reactant including an adsorbent with high affinity for energetic compounds. Further, the composition includes a first bioremediation material comprising at least one organism capable of degrading an energetic compound and a polymeric substance fueling the first bioremediation material during the degrading of the energetic compound. Additionally, the composition includes a second bioremediation material breaking the polymeric substance into smaller molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner. | 1. A composition for removing energetic compounds from contaminated environments, comprising:
a supported reactant including an adsorbent with high affinity for energetic compounds; a first bioremediation material comprising at least one organism capable of degrading an energetic compound; a polymeric substance fueling the first bioremediation material during the degrading of the energetic compound; and a second bioremediation material breaking the polymeric substance into smaller molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner, wherein the adsorbent includes copper-plated iron, and wherein the degradation time period is at least 20 days in duration. 2. The composition of claim 1, wherein the adsorbent is impregnated with zero valent iron. 3. The composition of claim 1, wherein the adsorbent includes at least one of zinc, tin, platinum, palladium, copper, manganese, iridium, bismuth, cobalt, titanium, and nickel. 4. The composition of claim 1, wherein the adsorbent further includes at least one of a ferro-titanium alloy, a magnesium alloy, a bismuth alloy, a Devarda's alloy, and a mercury amalgam. 5. The composition of claim 1, wherein the adsorbent further includes iron activated with platinum or palladium. 6. The composition of claim 1, wherein the adsorbent comprises at least one of activated carbon, vermiculite, alumina, a zeolite, and a char. 7. The composition of claim 1, wherein the energetic compound is an explosive that is a nitrocompound. 8. The composition of claim 1, wherein the energetic compound is a propellant. 9. The composition of claim 1, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes. 10. The composition of claim 1, wherein the polymeric substance comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein. 11. The composition of claim 1, wherein the polymeric substance comprises at least one of starch and chitin. 12. The composition of claim 11, wherein the starch is a food grade starch. 13. A composition for removing energetic compounds from contaminated environments, comprising:
an adsorbent including copper-plated iron; a first bioremediation material capable of degrading an energetic compound, wherein the energetic compound is an explosive or a propellant; a polymer capable of fueling the first bioremediation material during the degrading of the energetic compound; and a second bioremediation material capable of breaking the polymer into a plurality of molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner. 14. The composition of claim 13, wherein the polymer comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein, wherein the polymer comprises at least one of starch and chitin, and wherein the adsorbent further comprises activated carbon, vermiculite, alumina, a zeolite, or a char. 15. The composition of claim 14, wherein the adsorbent comprises activated carbon impregnated with at least one metal and wherein the metal is chosen from the group consisting of: zero valent iron, zinc, tin, platinum, palladium, bismuth, copper, manganese, iridium, cobalt, titanium, nickel, a magnesium-aluminum alloy, a ferro-titanium alloy, bismuth alloy, Devarda's alloy, a mercury amalgam, iron activated with platinum or palladium, molybdenum, silver, magnesium, rhodium, a cobalt alloy, vanadium, chromium, antimony, tungsten, zirconium, rhenium, indium, rhodium, and thallium. 16. The composition of claim 13, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes, and wherein the degradation time period is at least 20 days in length. 17. A composition for removing energetic compounds from contaminated environments, comprising:
a first bioremediation material for degrading an energetic compound comprising an explosive or a propellant; a polymer for fueling the first bioremediation material during the degrading of the energetic compound, wherein the polymer comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein; a second bioremediation material for breaking the polymer into a plurality of molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner; and a supported reactant comprising an adsorbent including activated carbon and copper-plated iron, wherein the degradation time period is at least 20 days in length. 18. The composition of claim 17, wherein the polymer comprises at least one of starch and chitin. 19. The composition of claim 17, wherein the activated carbon is impregnated with zero valent iron. 20. The composition of claim 18, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes. | A composition useful for removing energetic compounds from contaminated environments. The composition includes a supported reactant including an adsorbent with high affinity for energetic compounds. Further, the composition includes a first bioremediation material comprising at least one organism capable of degrading an energetic compound and a polymeric substance fueling the first bioremediation material during the degrading of the energetic compound. Additionally, the composition includes a second bioremediation material breaking the polymeric substance into smaller molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner.1. A composition for removing energetic compounds from contaminated environments, comprising:
a supported reactant including an adsorbent with high affinity for energetic compounds; a first bioremediation material comprising at least one organism capable of degrading an energetic compound; a polymeric substance fueling the first bioremediation material during the degrading of the energetic compound; and a second bioremediation material breaking the polymeric substance into smaller molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner, wherein the adsorbent includes copper-plated iron, and wherein the degradation time period is at least 20 days in duration. 2. The composition of claim 1, wherein the adsorbent is impregnated with zero valent iron. 3. The composition of claim 1, wherein the adsorbent includes at least one of zinc, tin, platinum, palladium, copper, manganese, iridium, bismuth, cobalt, titanium, and nickel. 4. The composition of claim 1, wherein the adsorbent further includes at least one of a ferro-titanium alloy, a magnesium alloy, a bismuth alloy, a Devarda's alloy, and a mercury amalgam. 5. The composition of claim 1, wherein the adsorbent further includes iron activated with platinum or palladium. 6. The composition of claim 1, wherein the adsorbent comprises at least one of activated carbon, vermiculite, alumina, a zeolite, and a char. 7. The composition of claim 1, wherein the energetic compound is an explosive that is a nitrocompound. 8. The composition of claim 1, wherein the energetic compound is a propellant. 9. The composition of claim 1, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes. 10. The composition of claim 1, wherein the polymeric substance comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein. 11. The composition of claim 1, wherein the polymeric substance comprises at least one of starch and chitin. 12. The composition of claim 11, wherein the starch is a food grade starch. 13. A composition for removing energetic compounds from contaminated environments, comprising:
an adsorbent including copper-plated iron; a first bioremediation material capable of degrading an energetic compound, wherein the energetic compound is an explosive or a propellant; a polymer capable of fueling the first bioremediation material during the degrading of the energetic compound; and a second bioremediation material capable of breaking the polymer into a plurality of molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner. 14. The composition of claim 13, wherein the polymer comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein, wherein the polymer comprises at least one of starch and chitin, and wherein the adsorbent further comprises activated carbon, vermiculite, alumina, a zeolite, or a char. 15. The composition of claim 14, wherein the adsorbent comprises activated carbon impregnated with at least one metal and wherein the metal is chosen from the group consisting of: zero valent iron, zinc, tin, platinum, palladium, bismuth, copper, manganese, iridium, cobalt, titanium, nickel, a magnesium-aluminum alloy, a ferro-titanium alloy, bismuth alloy, Devarda's alloy, a mercury amalgam, iron activated with platinum or palladium, molybdenum, silver, magnesium, rhodium, a cobalt alloy, vanadium, chromium, antimony, tungsten, zirconium, rhenium, indium, rhodium, and thallium. 16. The composition of claim 13, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes, and wherein the degradation time period is at least 20 days in length. 17. A composition for removing energetic compounds from contaminated environments, comprising:
a first bioremediation material for degrading an energetic compound comprising an explosive or a propellant; a polymer for fueling the first bioremediation material during the degrading of the energetic compound, wherein the polymer comprises a polyamide, a polysaccharide, a complex carbohydrate, a polymeric fatty acid, a polymer of an amino acid, or a protein; a second bioremediation material for breaking the polymer into a plurality of molecules over a degradation time period to provide the fueling of the first bioremediation material in a time-release manner; and a supported reactant comprising an adsorbent including activated carbon and copper-plated iron, wherein the degradation time period is at least 20 days in length. 18. The composition of claim 17, wherein the polymer comprises at least one of starch and chitin. 19. The composition of claim 17, wherein the activated carbon is impregnated with zero valent iron. 20. The composition of claim 18, wherein the first bioremediation material includes bacteria, fungi, an aerobic microorganism, an anaerobic microorganism, an algae, a protozoa, or an actinomycetes. | 1,600 |
348,637 | 16,806,138 | 1,651 | A method of assembling an orthopaedic surgical instrument may include selecting a surgical reamer for use in resecting a portion of a patient's bone. The method may also include aligning an outer sleeve of a stem trial component with a distal end of a shaft of the surgical reamer. The method may also include advancing the outer sleeve into engagement with the distal end of the reamer shaft. The method may also include advancing a central rod of the stem trial component along a passageway defined in the outer sleeve into engagement with the distal end of the reamer shaft. The method may also include threading the central rod into the distal end of the reamer shaft to couple the stem trial component to the surgical reamer for use in resecting the portion of the patient's bone. | 1. A method of assembling an orthopaedic surgical instrument, the method comprising:
selecting a surgical reamer for use in resecting a portion of a patient's bone, aligning an outer sleeve of a stem trial component with a distal end of a shaft of the surgical reamer, advancing the outer sleeve into engagement with the distal end of the reamer shaft, advancing a central rod of the stem trial component along a passageway defined in the outer sleeve into engagement with the distal end of the reamer shaft, and threading the central rod into the distal end of the reamer shaft to couple the stem trial component to the surgical reamer for use in resecting the portion of the patient's bone. 2. The method of claim 1, wherein advancing the outer sleeve into engagement with the distal end of the reamer shaft comprises positioning a distal tab extending from the distal end of the reamer shaft into a slot defined in the outer sleeve to constrain relative rotational movement between the outer sleeve and the surgical reamer. 3. The method of claim 2, wherein threading the central rod into the distal end of the reamer shaft includes threading the central rod into the distal end of the reamer shaft while the distal tab of the surgical reamer is received in the slot defined in the outer sleeve of the stem trial component. 4. The method of claim 1, wherein threading the central rod into the distal end of the reamer shaft includes clamping the outer sleeve between an annular shoulder wall of the central rod and the distal end of the shaft of the surgical reamer to prevent relative rotational movement between the stem trial component and the surgical reamer. | A method of assembling an orthopaedic surgical instrument may include selecting a surgical reamer for use in resecting a portion of a patient's bone. The method may also include aligning an outer sleeve of a stem trial component with a distal end of a shaft of the surgical reamer. The method may also include advancing the outer sleeve into engagement with the distal end of the reamer shaft. The method may also include advancing a central rod of the stem trial component along a passageway defined in the outer sleeve into engagement with the distal end of the reamer shaft. The method may also include threading the central rod into the distal end of the reamer shaft to couple the stem trial component to the surgical reamer for use in resecting the portion of the patient's bone.1. A method of assembling an orthopaedic surgical instrument, the method comprising:
selecting a surgical reamer for use in resecting a portion of a patient's bone, aligning an outer sleeve of a stem trial component with a distal end of a shaft of the surgical reamer, advancing the outer sleeve into engagement with the distal end of the reamer shaft, advancing a central rod of the stem trial component along a passageway defined in the outer sleeve into engagement with the distal end of the reamer shaft, and threading the central rod into the distal end of the reamer shaft to couple the stem trial component to the surgical reamer for use in resecting the portion of the patient's bone. 2. The method of claim 1, wherein advancing the outer sleeve into engagement with the distal end of the reamer shaft comprises positioning a distal tab extending from the distal end of the reamer shaft into a slot defined in the outer sleeve to constrain relative rotational movement between the outer sleeve and the surgical reamer. 3. The method of claim 2, wherein threading the central rod into the distal end of the reamer shaft includes threading the central rod into the distal end of the reamer shaft while the distal tab of the surgical reamer is received in the slot defined in the outer sleeve of the stem trial component. 4. The method of claim 1, wherein threading the central rod into the distal end of the reamer shaft includes clamping the outer sleeve between an annular shoulder wall of the central rod and the distal end of the shaft of the surgical reamer to prevent relative rotational movement between the stem trial component and the surgical reamer. | 1,600 |
348,638 | 16,806,154 | 1,651 | A quick-change system for changing attachments on a construction machine using an adapter and a quick coupler connectable to the adapter in which the adapter has at least a first coupling piece and the quick coupler has a second coupling piece connectable to the first coupling piece. A replaceable intermediate piece is arranged on the first coupling piece provided with first electrical contact elements and/or the second coupling piece provided with second electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece. | 1. A quick-change system for changing attachments on a construction machine using an adapter and a quick coupler connectable to the adapter, the adapter having at least a first coupling piece and the quick coupler having a second coupling piece connectable to the first coupling piece, wherein a replaceable intermediate piece is arranged on the first coupling piece provided with the first electrical contact elements and/or the second coupling piece provided with the second electrical contact elements to produce an electrical connection between the first coupling piece and the coupling piece. 2. The quick-change system according to claim 1, wherein the intermediate piece is releasably fastened via an interference-free releasable connection in a body of the first coupling piece and/or a body of the second coupling piece. 3. An adapter for a quick-change system for changing attachments on a construction machine, which contains a support having two coupling elements arranged at a stipulated spacing from each other for connection of the adapter with a quick coupler and at least a first coupling piece arranged on the support for connection with a second coupling piece arranged on the quick coupler, wherein a replaceable intermediate piece is arranged on the first coupling piece provided with first electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece. 4. The adapter according to claim 3, wherein the intermediate piece is releasably fastened using an interference-free releasable connection in a body of the first coupling piece. 5. The adapter according to claim 3, wherein the intermediate piece contains on one side first electrical contacts for connection with the first electrical contact elements of the first coupling piece and on the other side second electrical contacts for connection with the second electrical contact elements of the second coupling piece. 6. The adapter according to claim 5, wherein the first electrical contacts of the intermediate piece are designed as pins and the corresponding first electrical contact elements of the first coupling piece are designed as sleeves. 7. The adapter according to claim 5, wherein the second electrical contacts of the intermediate piece are designed as elastic contact pins. 8. The adapter according to claim 5, wherein the intermediate piece contains additional contacts to form an additional contact plane in addition to the first and second electrical contacts. 9. The adapter according to claim 5, wherein at least one of the first, second or additional electrical contacts of the intermediate piece is designed as a grounding contact. 10. The adapter according to claim 9, wherein the grounding contact is designed so that during coupling of the first and second coupling piece, the grounding contact produces an electrical connection before the other contacts. 11. The adapter according to claim 3, wherein a sealing element is arranged in a first annular groove on the outside of the intermediate piece for sealing of the intermediate piece relative to the first coupling piece. 12. The adapter according to claim 3, wherein a seal is arranged in a second annular groove on the outside of an intermediate piece for sealing of the body of the first coupling piece relative to the second coupling piece. 13. The adapter according to claim 3, wherein a positioning element is provided on the intermediate piece for shape-mated engagement with the mating element. 14. A quick coupler for a quick-change system for changing attachments on a construction machine, containing a support with receptacles for connection with coupling elements of a quick-change adapter with at least a second coupling piece arranged on the support for connection with a first coupling piece arranged on the quick coupler, wherein a replaceable intermediate piece is arranged on the second coupling piece provided with second electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece. | A quick-change system for changing attachments on a construction machine using an adapter and a quick coupler connectable to the adapter in which the adapter has at least a first coupling piece and the quick coupler has a second coupling piece connectable to the first coupling piece. A replaceable intermediate piece is arranged on the first coupling piece provided with first electrical contact elements and/or the second coupling piece provided with second electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece.1. A quick-change system for changing attachments on a construction machine using an adapter and a quick coupler connectable to the adapter, the adapter having at least a first coupling piece and the quick coupler having a second coupling piece connectable to the first coupling piece, wherein a replaceable intermediate piece is arranged on the first coupling piece provided with the first electrical contact elements and/or the second coupling piece provided with the second electrical contact elements to produce an electrical connection between the first coupling piece and the coupling piece. 2. The quick-change system according to claim 1, wherein the intermediate piece is releasably fastened via an interference-free releasable connection in a body of the first coupling piece and/or a body of the second coupling piece. 3. An adapter for a quick-change system for changing attachments on a construction machine, which contains a support having two coupling elements arranged at a stipulated spacing from each other for connection of the adapter with a quick coupler and at least a first coupling piece arranged on the support for connection with a second coupling piece arranged on the quick coupler, wherein a replaceable intermediate piece is arranged on the first coupling piece provided with first electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece. 4. The adapter according to claim 3, wherein the intermediate piece is releasably fastened using an interference-free releasable connection in a body of the first coupling piece. 5. The adapter according to claim 3, wherein the intermediate piece contains on one side first electrical contacts for connection with the first electrical contact elements of the first coupling piece and on the other side second electrical contacts for connection with the second electrical contact elements of the second coupling piece. 6. The adapter according to claim 5, wherein the first electrical contacts of the intermediate piece are designed as pins and the corresponding first electrical contact elements of the first coupling piece are designed as sleeves. 7. The adapter according to claim 5, wherein the second electrical contacts of the intermediate piece are designed as elastic contact pins. 8. The adapter according to claim 5, wherein the intermediate piece contains additional contacts to form an additional contact plane in addition to the first and second electrical contacts. 9. The adapter according to claim 5, wherein at least one of the first, second or additional electrical contacts of the intermediate piece is designed as a grounding contact. 10. The adapter according to claim 9, wherein the grounding contact is designed so that during coupling of the first and second coupling piece, the grounding contact produces an electrical connection before the other contacts. 11. The adapter according to claim 3, wherein a sealing element is arranged in a first annular groove on the outside of the intermediate piece for sealing of the intermediate piece relative to the first coupling piece. 12. The adapter according to claim 3, wherein a seal is arranged in a second annular groove on the outside of an intermediate piece for sealing of the body of the first coupling piece relative to the second coupling piece. 13. The adapter according to claim 3, wherein a positioning element is provided on the intermediate piece for shape-mated engagement with the mating element. 14. A quick coupler for a quick-change system for changing attachments on a construction machine, containing a support with receptacles for connection with coupling elements of a quick-change adapter with at least a second coupling piece arranged on the support for connection with a first coupling piece arranged on the quick coupler, wherein a replaceable intermediate piece is arranged on the second coupling piece provided with second electrical contact elements to produce an electrical connection between the first coupling piece and the second coupling piece. | 1,600 |
348,639 | 16,806,027 | 1,651 | The present invention demonstrated that the modification of the Fc region of an antigen-binding molecule into an Fc region that does not form in a neutral pH range a heterotetramer complex containing two molecules of FcRn and an active Fcγ receptor improved the pharmacokinetics of the antigen-binding molecule and reduced the immune response to the antigen-binding molecule. The present invention also revealed methods for producing antigen-binding molecules having the properties described above, and successfully demonstrated that pharmaceutical compositions containing as an active ingredient such an antigen-binding molecule or an antigen-binding molecule produced by a production method of the present invention have excellent features over conventional antigen-binding molecules in that when administered, they exhibit improved pharmacokinetics and reduced in vivo immune response. | 1. A method of either (a) or (b) below, wherein the method comprises modifying the Fc region of an antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region that has FcRn-binding activity in a neutral pH range into an Fc region that does not form a hetero complex comprising two molecules of FcRn and one molecule of activating Fcγ receptor in a neutral pH range:
(a) a method for improving pharmacokinetics of an antigen-binding molecule; and
(b) a method for reducing immunogenicity of an antigen-binding molecule. 2. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modifying the Fc region into an Fc region whose binding activity to an activating Fcγ receptor is lower than the binding activity of an Fc region of native human IgG to the activating Fcγ receptor. 3. The method of claim 1 or 2, wherein the activating Fcγ receptor is human FcγRIa, human FcγRIIa(R), human FcγRIIa(H), human FcγRIIIa(V), or human FcγRIIIa(F). 4. The method of any one of claims 1 to 3, which comprises substituting an amino acid of said Fc region at any one or more amino acids of positions 235, 237, 238, 239, 270, 298, 325, and 329 as indicated by EU numbering. 5. The method of claim 4, which comprises substituting an amino acid of said Fc region as indicated by EU numbering at any one or more of:
the amino acid of position 234 with any one of Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Lys, Met, Phe, Pro, Ser, Thr, and Trp; the amino acid of position 235 with any one of Ala, Asn, Asp, Gln, Glu, Gly, His, Ile, Lys, Met, Pro, Ser, Thr, Val, and Arg; the amino acid of position 236 with any one of Arg, Asn, Gln, His, Leu, Lys, Met, Phe, Pro, and Tyr; the amino acid of position 237 with any one of Ala, Asn, Asp, Gln, Glu, His, Ile, Leu, Lys, Met, Pro, Ser, Thr, Val, Tyr, and Arg; the amino acid of position 238 with any one of Ala, Asn, Gln, Glu, Gly, His, Ile, Lys, Thr, Trp, and Arg; the amino acid of position 239 with any one of Gln, His, Lys, Phe, Pro, Trp, Tyr, and Arg; the amino acid of position 265 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 266 with any one of Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Lys, Phe, Pro, Ser, Thr, Trp, and Tyr; the amino acid of position 267 with any one of Arg, His, Lys, Phe, Pro, Trp, and Tyr; the amino acid of position 269 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 270 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 271 with any one of Arg, His, Phe, Ser, Thr, Trp, and Tyr; the amino acid of position 295 with any one of Arg, Asn, Asp, Gly, His, Phe, Ser, Trp, and Tyr; the amino acid of position 296 with any one of Arg, Gly, Lys, and Pro; the amino acid of position 297 with Ala; the amino acid of position 298 with any one of Arg, Gly, Lys, Pro, Trp, and Tyr; the amino acid of position 300 with any one of Arg, Lys, and Pro; the amino acid of position 324 with Lys or Pro; the amino acid of position 325 with any one of Ala, Arg, Gly, His, Ile, Lys, Phe, Pro, Thr, Trp, Tyr, and Val; the amino acid of position 327 with any one of Arg, Gln, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 328 with any one of Arg, Asn, Gly, His, Lys, and Pro; the amino acid of position 329 with any one of Asn, Asp, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Ser, Thr, Trp, Tyr, Val, and Arg; the amino acid of position 330 with Pro or Ser; the amino acid of position 331 with any one of Arg, Gly, and Lys; or the amino acid of position 332 with any one of Arg, Lys, and Pro. 6. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modifying the Fc region into an Fc region that has a higher binding activity to an inhibitory Fcγ receptor than to an activating Fcγ receptor. 7. The method of claim 6, wherein the inhibitory Fcγ receptor is human FcγRIIb. 8. The method of claim 6 or 7, wherein the activating Fcγ receptor is human FcγRIa, human FcγRIIa(R), human FcγRIIa(H), human FcγRIIIa(V), or human FcγRIIIa(F). 9. The method of any one of claims 6 to 8, which comprises substituting the amino acid of position 238 or 328 indicated by EU numbering. 10. The method of claim 9, which comprises substituting Asp for the amino acid of position 238 or Glu for the amino acid of position 328 indicated by EU numbering. 11. The method of claim 9 or 10, which comprises substituting any one or more amino acids of:
the amino acid of position 233 with Asp;
the amino acid of position 234 with Trp or Tyr;
the amino acid of position 237 with any one of Ala, Asp, Glu, Leu, Met, Phe, Trp, and Tyr;
the amino acid of position 239 with Asp;
the amino acid of position 267 with any one of Ala, Gln, and Val;
the amino acid of position 268 with any one of Asn, Asp, and Glu;
the amino acid of position 271 with Gly;
the amino acid of position 326 with any one of Ala, Asn, Asp, Gln, Glu, Leu, Met, Ser, and Thr;
the amino acid of position 330 with any one of Arg, Lys, and Met;
the amino acid of position 323 with any one of Ile, Leu, and Met; and
the amino acid of position 296 with Asp; wherein the amino acids are indicated by EU numbering. 12. The method of any one of claims 1 to 11, wherein the Fc region comprises one or more amino acids that are different from amino acids of the native Fc region at any of amino acid positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 298, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 of said Fc region as indicated by EU numbering. 13. The method of claim 12, wherein the amino acids of said Fc region indicated by EU numbering are a combination of one or more of:
Met at amino acid position 237; Ile at amino acid position 248; any one of Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, and Tyr at amino acid position 250; any one of Phe, Trp, and Tyr at amino acid position 252; Thr at amino acid position 254; Glu at amino acid position 255; any one of Asn, Asp, Glu, and Gln at amino acid position 256; any one of Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, and Val at amino acid position 257; His at amino acid position 258; Ala at amino acid position 265; Ala or Glu at amino acid position 286; His at amino acid position 289; Ala at amino acid position 297; Gly at amino acid position 298; Ala at amino acid position 303; Ala at amino acid position 305; any one of Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, and Tyr at amino acid position 307; any one of Ala, Phe, Ile, Leu, Met, Pro, Gln, and Thr at amino acid position 308; any one of Ala, Asp, Glu, Pro, and Arg at amino acid position 309; any one of Ala, His, and Ile at amino acid position 311; Ala or His at amino acid position 312; Lys or Arg at amino acid position 314; any one of Ala, Asp, and His at amino acid position 315; Ala at amino acid position 317; Val at amino acid position 332; Leu at amino acid position 334; His at amino acid position 360; Ala at amino acid position 376; Ala at amino acid position 380; Ala at amino acid position 382; Ala at amino acid position 384; Asp or His at amino acid position 385; Pro at amino acid position 386; Glu at amino acid position 387; Ala or Ser at amino acid position 389; Ala at amino acid position 424; any one of Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, and Tyr at amino acid position 428; Lys at amino acid position 433; any one of Ala, Phe, His, Ser, Trp, and Tyr at amino acid position 434; and any one of His, Ile, Leu, Phe, Thr, and Val at amino acid position 436. 14. The method of any one of claims 1 to 13, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium ion concentration. 15. The method of claim 14, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium ion concentration is lower than the antigen-binding activity at a high calcium ion concentration. 16. The method of any one of claims 1 to 13, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 17. The method of claim 16, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 18. The method of any one of claims 1 to 17, wherein the antigen-binding domain is an antibody variable region. 19. The method of any one of claims 1 to 18, wherein the antigen-binding molecule is an antibody. 20. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modification into an Fc region in which one of the two polypeptides constituting the Fc region has FcRn-binding activity in a neutral pH range and the other does not have FcRn-binding activity in a neutral pH range. 21. The method of claim 20, which comprises substituting an amino acid at any one or more of positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 298, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 as indicated by EU numbering in the amino acid sequence of one of the two polypeptides constituting said Fc region. 22. The method of claim 21, which comprises substituting an amino acid of said Fc region at any one or more of:
the amino acid of position 237 with Met; the amino acid of position 248 with Ile; the amino acid of position 250 with Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, or Tyr; the amino acid of position 252 with Phe, Trp, or Tyr; the amino acid of position 254 with Thr; the amino acid of position 255 with Glu; the amino acid of position 256 with Asn, Asp, Glu, or Gln; the amino acid of position 257 with Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, or Val; the amino acid of position 258 with His; the amino acid of position 265 with Ala; the amino acid of position 286 with Ala or Glu; the amino acid of position 289 with His; the amino acid of position 297 with Ala; the amino acid of position 298 with Gly; the amino acid of position 303 with Ala; the amino acid of position 305 with Ala; the amino acid of position 307 with Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, or Tyr; the amino acid of position 308 with Ala, Phe, Ile, Leu, Met, Pro, Gln, or Thr; the amino acid of position 309 with Ala, Asp, Glu, Pro, or Arg; the amino acid of position 311 with Ala, His, or Ile; the amino acid of position 312 with Ala or His; the amino acid of position 314 with Lys or Arg; the amino acid of position 315 with Ala, Asp, or His; the amino acid of position 317 with Ala; the amino acid of position 332 with Val; the amino acid of position 334 with Leu; the amino acid of position 360 with His; the amino acid of position 376 with Ala; the amino acid of position 380 with Ala; the amino acid of position 382 with Ala; the amino acid of position 384 with Ala; the amino acid of position 385 with Asp or His; the amino acid of position 386 with Pro; the amino acid of position 387 with Glu; the amino acid of position 389 with Ala or Ser; the amino acid of position 424 with Ala; the amino acid of position 428 with Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, or Tyr; the amino acid of position 433 with Lys; the amino acid of position 434 with Ala, Phe, His, Ser, Trp, or Tyr; and the amino acid of position 436 with His, Ile, Leu, Phe, Thr, or Val; wherein the amino acids are indicated by EU numbering. 23. The method of any one of claims 20 to 22, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium concentration. 24. The method of claim 23, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium concentration is lower than the antigen-binding activity at a high calcium concentration. 25. The method of any one of claims 20 to 22, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 26. The method of claim 25, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 27. The method of any one of claims 20 to 26, wherein the antigen-binding domain is an antibody variable region. 28. The method of any one of claims 20 to 27, wherein the antigen-binding molecule is an antibody. 29. An antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region that has FcRn-binding activity in a neutral pH range, wherein the Fc region comprises one or more amino acids selected from:
Ala at amino acid position 234; Ala, Lys, or Arg at amino acid position 235; Arg at amino acid position 236; Arg at amino acid position 238; Lys at amino acid position 239; Phe at amino acid position 270; Ala at amino acid position 297; Gly at amino acid position 298; Gly at amino acid position 325; Arg at amino acid position 328; and Lys or Arg at amino acid position 329; wherein the amino acids are indicated by EU numbering. 30. The antigen-binding molecule of claim 29, which comprises one or more amino acids selected from:
Lys or Arg at amino acid position 237; Lys at amino acid position 238; Arg at amino acid position 239; and Lys or Arg at amino acid position 329; wherein the amino acids are indicated by EU numbering. 31. An antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region in which one of the two polypeptides constituting the Fc region has FcRn-binding activity in a neutral pH range and the other does not have FcRn-binding activity in a neutral pH range. 32. The antigen-binding molecule of any one of claims 29 to 31, wherein the Fc region comprises one or more amino acids that are different from amino acids of a native Fc region at any of amino acid positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 indicated by EU numbering in the amino acid sequence of one of the two polypeptides constituting the Fc region. 33. The antigen-binding molecule of claim 32, which comprises a combination of one or more amino acids of said Fc region of:
Met at amino acid position 237; Ile at amino acid position 248; Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, or Tyr at amino acid position 250; Phe, Trp, or Tyr at amino acid position 252; Thr at amino acid position 254; Glu at amino acid position 255; Asn, Asp, Glu, or Gln at amino acid position 256; Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, or Val at amino acid position 257; His at amino acid position 258; Ala at amino acid position 265; Ala or Glu at amino acid position 286; His at amino acid position 289; Ala at amino acid position 297; Ala at amino acid position 303; Ala at amino acid position 305; Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, or Tyr at amino acid position 307; Ala, Phe, Ile, Leu, Met, Pro, Gln, or Thr at amino acid position 308; Ala, Asp, Glu, Pro, or Arg at amino acid position 309; Ala, His, or Ile at amino acid position 311; Ala or His at amino acid position 312; Lys or Arg at amino acid position 314; Ala, Asp, or His at amino acid position 315; Ala at amino acid position 317; Val at amino acid position 332; Leu at amino acid position 334; His at amino acid position 360; Ala at amino acid position 376; Ala at amino acid position 380; Ala at amino acid position 382; Ala at amino acid position 384; Asp or His at amino acid position 385; Pro at amino acid position 386; Glu at amino acid position 387; Ala or Ser at amino acid position 389; Ala at amino acid position 424; Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, or Tyr at amino acid position 428; Lys at amino acid position 433; Ala, Phe, His, Ser, Trp, or Tyr at amino acid position 434; and His, Ile, Leu, Phe, Thr, or Val at amino acid position 436; wherein the amino acids are indicated by EU numbering. 34. The antigen-binding molecule of any one of claims 29 to 33, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium ion concentration. 35. The antigen-binding molecule of claim 34, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium concentration is lower than the antigen-binding activity at a high calcium concentration. 36. The antigen-binding molecule of any one of claims 29 to 33, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 37. The antigen-binding molecule of claim 36, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 38. The antigen-binding molecule of any one of claims 29 to 37, wherein the antigen-binding domain is an antibody variable region. 39. The antigen-binding molecule of any one of claims 29 to 38, wherein the antigen-binding molecule is an antibody. 40. A polynucleotide encoding the antigen-binding molecule of any one of claims 29 to 39. 41. A vector which is operably linked to the polynucleotide of claim 40. 42. A cell introduced with the vector of claim 41. 43. A method for producing the antigen-binding molecule of any one of claims 29 to 39, which comprises the step of collecting the antigen-binding molecule from a culture of the cell of claim 42. 44. A pharmaceutical composition which comprises as an active ingredient the antigen-binding molecule of any one of claims 29 to 39 or an antigen-binding molecule obtained by the production method of claim 43. | The present invention demonstrated that the modification of the Fc region of an antigen-binding molecule into an Fc region that does not form in a neutral pH range a heterotetramer complex containing two molecules of FcRn and an active Fcγ receptor improved the pharmacokinetics of the antigen-binding molecule and reduced the immune response to the antigen-binding molecule. The present invention also revealed methods for producing antigen-binding molecules having the properties described above, and successfully demonstrated that pharmaceutical compositions containing as an active ingredient such an antigen-binding molecule or an antigen-binding molecule produced by a production method of the present invention have excellent features over conventional antigen-binding molecules in that when administered, they exhibit improved pharmacokinetics and reduced in vivo immune response.1. A method of either (a) or (b) below, wherein the method comprises modifying the Fc region of an antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region that has FcRn-binding activity in a neutral pH range into an Fc region that does not form a hetero complex comprising two molecules of FcRn and one molecule of activating Fcγ receptor in a neutral pH range:
(a) a method for improving pharmacokinetics of an antigen-binding molecule; and
(b) a method for reducing immunogenicity of an antigen-binding molecule. 2. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modifying the Fc region into an Fc region whose binding activity to an activating Fcγ receptor is lower than the binding activity of an Fc region of native human IgG to the activating Fcγ receptor. 3. The method of claim 1 or 2, wherein the activating Fcγ receptor is human FcγRIa, human FcγRIIa(R), human FcγRIIa(H), human FcγRIIIa(V), or human FcγRIIIa(F). 4. The method of any one of claims 1 to 3, which comprises substituting an amino acid of said Fc region at any one or more amino acids of positions 235, 237, 238, 239, 270, 298, 325, and 329 as indicated by EU numbering. 5. The method of claim 4, which comprises substituting an amino acid of said Fc region as indicated by EU numbering at any one or more of:
the amino acid of position 234 with any one of Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Lys, Met, Phe, Pro, Ser, Thr, and Trp; the amino acid of position 235 with any one of Ala, Asn, Asp, Gln, Glu, Gly, His, Ile, Lys, Met, Pro, Ser, Thr, Val, and Arg; the amino acid of position 236 with any one of Arg, Asn, Gln, His, Leu, Lys, Met, Phe, Pro, and Tyr; the amino acid of position 237 with any one of Ala, Asn, Asp, Gln, Glu, His, Ile, Leu, Lys, Met, Pro, Ser, Thr, Val, Tyr, and Arg; the amino acid of position 238 with any one of Ala, Asn, Gln, Glu, Gly, His, Ile, Lys, Thr, Trp, and Arg; the amino acid of position 239 with any one of Gln, His, Lys, Phe, Pro, Trp, Tyr, and Arg; the amino acid of position 265 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 266 with any one of Ala, Arg, Asn, Asp, Gln, Glu, Gly, His, Lys, Phe, Pro, Ser, Thr, Trp, and Tyr; the amino acid of position 267 with any one of Arg, His, Lys, Phe, Pro, Trp, and Tyr; the amino acid of position 269 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 270 with any one of Ala, Arg, Asn, Gln, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 271 with any one of Arg, His, Phe, Ser, Thr, Trp, and Tyr; the amino acid of position 295 with any one of Arg, Asn, Asp, Gly, His, Phe, Ser, Trp, and Tyr; the amino acid of position 296 with any one of Arg, Gly, Lys, and Pro; the amino acid of position 297 with Ala; the amino acid of position 298 with any one of Arg, Gly, Lys, Pro, Trp, and Tyr; the amino acid of position 300 with any one of Arg, Lys, and Pro; the amino acid of position 324 with Lys or Pro; the amino acid of position 325 with any one of Ala, Arg, Gly, His, Ile, Lys, Phe, Pro, Thr, Trp, Tyr, and Val; the amino acid of position 327 with any one of Arg, Gln, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val; the amino acid of position 328 with any one of Arg, Asn, Gly, His, Lys, and Pro; the amino acid of position 329 with any one of Asn, Asp, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Ser, Thr, Trp, Tyr, Val, and Arg; the amino acid of position 330 with Pro or Ser; the amino acid of position 331 with any one of Arg, Gly, and Lys; or the amino acid of position 332 with any one of Arg, Lys, and Pro. 6. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modifying the Fc region into an Fc region that has a higher binding activity to an inhibitory Fcγ receptor than to an activating Fcγ receptor. 7. The method of claim 6, wherein the inhibitory Fcγ receptor is human FcγRIIb. 8. The method of claim 6 or 7, wherein the activating Fcγ receptor is human FcγRIa, human FcγRIIa(R), human FcγRIIa(H), human FcγRIIIa(V), or human FcγRIIIa(F). 9. The method of any one of claims 6 to 8, which comprises substituting the amino acid of position 238 or 328 indicated by EU numbering. 10. The method of claim 9, which comprises substituting Asp for the amino acid of position 238 or Glu for the amino acid of position 328 indicated by EU numbering. 11. The method of claim 9 or 10, which comprises substituting any one or more amino acids of:
the amino acid of position 233 with Asp;
the amino acid of position 234 with Trp or Tyr;
the amino acid of position 237 with any one of Ala, Asp, Glu, Leu, Met, Phe, Trp, and Tyr;
the amino acid of position 239 with Asp;
the amino acid of position 267 with any one of Ala, Gln, and Val;
the amino acid of position 268 with any one of Asn, Asp, and Glu;
the amino acid of position 271 with Gly;
the amino acid of position 326 with any one of Ala, Asn, Asp, Gln, Glu, Leu, Met, Ser, and Thr;
the amino acid of position 330 with any one of Arg, Lys, and Met;
the amino acid of position 323 with any one of Ile, Leu, and Met; and
the amino acid of position 296 with Asp; wherein the amino acids are indicated by EU numbering. 12. The method of any one of claims 1 to 11, wherein the Fc region comprises one or more amino acids that are different from amino acids of the native Fc region at any of amino acid positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 298, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 of said Fc region as indicated by EU numbering. 13. The method of claim 12, wherein the amino acids of said Fc region indicated by EU numbering are a combination of one or more of:
Met at amino acid position 237; Ile at amino acid position 248; any one of Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, and Tyr at amino acid position 250; any one of Phe, Trp, and Tyr at amino acid position 252; Thr at amino acid position 254; Glu at amino acid position 255; any one of Asn, Asp, Glu, and Gln at amino acid position 256; any one of Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, and Val at amino acid position 257; His at amino acid position 258; Ala at amino acid position 265; Ala or Glu at amino acid position 286; His at amino acid position 289; Ala at amino acid position 297; Gly at amino acid position 298; Ala at amino acid position 303; Ala at amino acid position 305; any one of Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, and Tyr at amino acid position 307; any one of Ala, Phe, Ile, Leu, Met, Pro, Gln, and Thr at amino acid position 308; any one of Ala, Asp, Glu, Pro, and Arg at amino acid position 309; any one of Ala, His, and Ile at amino acid position 311; Ala or His at amino acid position 312; Lys or Arg at amino acid position 314; any one of Ala, Asp, and His at amino acid position 315; Ala at amino acid position 317; Val at amino acid position 332; Leu at amino acid position 334; His at amino acid position 360; Ala at amino acid position 376; Ala at amino acid position 380; Ala at amino acid position 382; Ala at amino acid position 384; Asp or His at amino acid position 385; Pro at amino acid position 386; Glu at amino acid position 387; Ala or Ser at amino acid position 389; Ala at amino acid position 424; any one of Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, and Tyr at amino acid position 428; Lys at amino acid position 433; any one of Ala, Phe, His, Ser, Trp, and Tyr at amino acid position 434; and any one of His, Ile, Leu, Phe, Thr, and Val at amino acid position 436. 14. The method of any one of claims 1 to 13, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium ion concentration. 15. The method of claim 14, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium ion concentration is lower than the antigen-binding activity at a high calcium ion concentration. 16. The method of any one of claims 1 to 13, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 17. The method of claim 16, wherein said antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 18. The method of any one of claims 1 to 17, wherein the antigen-binding domain is an antibody variable region. 19. The method of any one of claims 1 to 18, wherein the antigen-binding molecule is an antibody. 20. The method of claim 1, wherein the modification into an Fc region that does not form said hetero complex comprises modification into an Fc region in which one of the two polypeptides constituting the Fc region has FcRn-binding activity in a neutral pH range and the other does not have FcRn-binding activity in a neutral pH range. 21. The method of claim 20, which comprises substituting an amino acid at any one or more of positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 298, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 as indicated by EU numbering in the amino acid sequence of one of the two polypeptides constituting said Fc region. 22. The method of claim 21, which comprises substituting an amino acid of said Fc region at any one or more of:
the amino acid of position 237 with Met; the amino acid of position 248 with Ile; the amino acid of position 250 with Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, or Tyr; the amino acid of position 252 with Phe, Trp, or Tyr; the amino acid of position 254 with Thr; the amino acid of position 255 with Glu; the amino acid of position 256 with Asn, Asp, Glu, or Gln; the amino acid of position 257 with Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, or Val; the amino acid of position 258 with His; the amino acid of position 265 with Ala; the amino acid of position 286 with Ala or Glu; the amino acid of position 289 with His; the amino acid of position 297 with Ala; the amino acid of position 298 with Gly; the amino acid of position 303 with Ala; the amino acid of position 305 with Ala; the amino acid of position 307 with Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, or Tyr; the amino acid of position 308 with Ala, Phe, Ile, Leu, Met, Pro, Gln, or Thr; the amino acid of position 309 with Ala, Asp, Glu, Pro, or Arg; the amino acid of position 311 with Ala, His, or Ile; the amino acid of position 312 with Ala or His; the amino acid of position 314 with Lys or Arg; the amino acid of position 315 with Ala, Asp, or His; the amino acid of position 317 with Ala; the amino acid of position 332 with Val; the amino acid of position 334 with Leu; the amino acid of position 360 with His; the amino acid of position 376 with Ala; the amino acid of position 380 with Ala; the amino acid of position 382 with Ala; the amino acid of position 384 with Ala; the amino acid of position 385 with Asp or His; the amino acid of position 386 with Pro; the amino acid of position 387 with Glu; the amino acid of position 389 with Ala or Ser; the amino acid of position 424 with Ala; the amino acid of position 428 with Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, or Tyr; the amino acid of position 433 with Lys; the amino acid of position 434 with Ala, Phe, His, Ser, Trp, or Tyr; and the amino acid of position 436 with His, Ile, Leu, Phe, Thr, or Val; wherein the amino acids are indicated by EU numbering. 23. The method of any one of claims 20 to 22, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium concentration. 24. The method of claim 23, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium concentration is lower than the antigen-binding activity at a high calcium concentration. 25. The method of any one of claims 20 to 22, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 26. The method of claim 25, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 27. The method of any one of claims 20 to 26, wherein the antigen-binding domain is an antibody variable region. 28. The method of any one of claims 20 to 27, wherein the antigen-binding molecule is an antibody. 29. An antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region that has FcRn-binding activity in a neutral pH range, wherein the Fc region comprises one or more amino acids selected from:
Ala at amino acid position 234; Ala, Lys, or Arg at amino acid position 235; Arg at amino acid position 236; Arg at amino acid position 238; Lys at amino acid position 239; Phe at amino acid position 270; Ala at amino acid position 297; Gly at amino acid position 298; Gly at amino acid position 325; Arg at amino acid position 328; and Lys or Arg at amino acid position 329; wherein the amino acids are indicated by EU numbering. 30. The antigen-binding molecule of claim 29, which comprises one or more amino acids selected from:
Lys or Arg at amino acid position 237; Lys at amino acid position 238; Arg at amino acid position 239; and Lys or Arg at amino acid position 329; wherein the amino acids are indicated by EU numbering. 31. An antigen-binding molecule comprising an antigen-binding domain whose antigen-binding activity varies depending on ion concentration and an Fc region in which one of the two polypeptides constituting the Fc region has FcRn-binding activity in a neutral pH range and the other does not have FcRn-binding activity in a neutral pH range. 32. The antigen-binding molecule of any one of claims 29 to 31, wherein the Fc region comprises one or more amino acids that are different from amino acids of a native Fc region at any of amino acid positions 237, 248, 250, 252, 254, 255, 256, 257, 258, 265, 286, 289, 297, 303, 305, 307, 308, 309, 311, 312, 314, 315, 317, 332, 334, 360, 376, 380, 382, 384, 385, 386, 387, 389, 424, 428, 433, 434, and 436 indicated by EU numbering in the amino acid sequence of one of the two polypeptides constituting the Fc region. 33. The antigen-binding molecule of claim 32, which comprises a combination of one or more amino acids of said Fc region of:
Met at amino acid position 237; Ile at amino acid position 248; Ala, Phe, Ile, Met, Gln, Ser, Val, Trp, or Tyr at amino acid position 250; Phe, Trp, or Tyr at amino acid position 252; Thr at amino acid position 254; Glu at amino acid position 255; Asn, Asp, Glu, or Gln at amino acid position 256; Ala, Gly, Ile, Leu, Met, Asn, Ser, Thr, or Val at amino acid position 257; His at amino acid position 258; Ala at amino acid position 265; Ala or Glu at amino acid position 286; His at amino acid position 289; Ala at amino acid position 297; Ala at amino acid position 303; Ala at amino acid position 305; Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Met, Asn, Pro, Gln, Arg, Ser, Val, Trp, or Tyr at amino acid position 307; Ala, Phe, Ile, Leu, Met, Pro, Gln, or Thr at amino acid position 308; Ala, Asp, Glu, Pro, or Arg at amino acid position 309; Ala, His, or Ile at amino acid position 311; Ala or His at amino acid position 312; Lys or Arg at amino acid position 314; Ala, Asp, or His at amino acid position 315; Ala at amino acid position 317; Val at amino acid position 332; Leu at amino acid position 334; His at amino acid position 360; Ala at amino acid position 376; Ala at amino acid position 380; Ala at amino acid position 382; Ala at amino acid position 384; Asp or His at amino acid position 385; Pro at amino acid position 386; Glu at amino acid position 387; Ala or Ser at amino acid position 389; Ala at amino acid position 424; Ala, Asp, Phe, Gly, His, Ile, Lys, Leu, Asn, Pro, Gln, Ser, Thr, Val, Trp, or Tyr at amino acid position 428; Lys at amino acid position 433; Ala, Phe, His, Ser, Trp, or Tyr at amino acid position 434; and His, Ile, Leu, Phe, Thr, or Val at amino acid position 436; wherein the amino acids are indicated by EU numbering. 34. The antigen-binding molecule of any one of claims 29 to 33, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on calcium ion concentration. 35. The antigen-binding molecule of claim 34, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity at a low calcium concentration is lower than the antigen-binding activity at a high calcium concentration. 36. The antigen-binding molecule of any one of claims 29 to 33, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies depending on pH. 37. The antigen-binding molecule of claim 36, wherein the antigen-binding domain is an antigen-binding domain whose antigen-binding activity varies in a way that the antigen-binding activity in an acidic pH range is lower than the antigen-binding activity in a neutral pH range. 38. The antigen-binding molecule of any one of claims 29 to 37, wherein the antigen-binding domain is an antibody variable region. 39. The antigen-binding molecule of any one of claims 29 to 38, wherein the antigen-binding molecule is an antibody. 40. A polynucleotide encoding the antigen-binding molecule of any one of claims 29 to 39. 41. A vector which is operably linked to the polynucleotide of claim 40. 42. A cell introduced with the vector of claim 41. 43. A method for producing the antigen-binding molecule of any one of claims 29 to 39, which comprises the step of collecting the antigen-binding molecule from a culture of the cell of claim 42. 44. A pharmaceutical composition which comprises as an active ingredient the antigen-binding molecule of any one of claims 29 to 39 or an antigen-binding molecule obtained by the production method of claim 43. | 1,600 |
348,640 | 16,806,103 | 1,651 | Embodiments of the present disclosure provide devices and systems that support wireless communication between wireless communication devices residing within, and external to, a Faraday cage. In some embodiments, devices and systems are provided for transmitting wireless signals through a waveguide port of a Faraday cage for wireless signals having frequencies below the cutoff frequency of the waveguide port, where a portion of the waveguide port is compromised by the presence of a conductor, thereby permitting the propagation of electromagnetic waves. In some embodiments, aspects of the present disclosure are employed to adapt a magnetic resonance imaging system for communications between a scanner room and a control room. | 1. A wireless communication system for communicating through a waveguide port of a Faraday cage, the wireless communications system comprising:
an internal wireless device located within the Faraday cage; an external wireless device located external to the Faraday cage, said internal wireless device and said external wireless device being configured for wireless communication within a frequency band that lies, at least in part, above a cutoff frequency of said waveguide port; and a wireless bridge device comprising an antenna and a transceiver, said transceiver being operably connected to said antenna, said antenna residing within an internal region of said waveguide port; said wireless bridge device being configured to (i) receive, with said antenna, first wireless signals from one of said internal wireless device and said external wireless device, said first wireless signals residing within said frequency band and propagating within said waveguide port as one or both of TE and TM modes, and (ii) transmit, from said antenna, second wireless signals to the other of said internal wireless device and said external wireless device, said second wireless signals residing within said frequency band and propagating within said waveguide port as one or both as TE and TM waves; said wireless bridge device thereby being configured to facilitate wireless communication between said internal wireless device and said external wireless device, through said waveguide port, via wireless signal reception by said antenna and wireless signal re-transmission by said antenna. 2. The wireless communication system according to claim 1 wherein any external electrical conductors that are associated with a portion of said wireless bridge device and reside within said waveguide port are in electrical communication with said waveguide port, thus preserving the operation of said waveguide port as a high-pass filter. 3. The wireless communication system according to claim 1 wherein said transceiver is located outside of said waveguide port. 4. The wireless communication system according to claim 1 wherein the cutoff frequency of said waveguide port is above 2.4 GHz. 5. The wireless communication system according to claim 1 wherein the cutoff frequency of said waveguide port is 3.46 GHz. 6. The wireless communication system according to claim 1 wherein said wireless bridge device comprises one or more additional antennae operably connected to said transceiver. 7. The wireless communication system according to claim 1 wherein said internal wireless device is a first internal wireless device, said wireless communication system further comprising an additional internal wireless device, wherein said wireless bridge device is configured to facilitate wireless communication between said first internal wireless device and said additional internal wireless device. 8. The wireless communication system according to claim 1 wherein said external wireless device is a first external wireless device, said wireless communication system further comprising an additional external wireless device, wherein said wireless bridge device is configured to facilitate wireless communication between said first external wireless device and said additional external wireless device. 9. A method of performing wireless communication through a waveguide port of a Faraday cage, the method comprising:
providing a wireless bridge device comprising an antenna and a transceiver, the transceiver being operably connected to the antenna; positioning the antenna such that the antenna resides within an internal region of the waveguide port; and employing the wireless bridge device to:
receive, with the antenna, first wireless signals from one of an internal wireless device located within the Faraday cage and an external wireless device located external to the Faraday cage, the first wireless signals propagating within the waveguide port as one or both of TE and TM modes and residing within a frequency band that resides, at least in part, above a cutoff frequency of the waveguide port; and
transmit, from the antenna, second wireless signals to the other of the internal wireless device and the external wireless device, such that the second wireless signals reside within the frequency band and propagate within the waveguide port as one or both as TE and TM waves;
thereby facilitating wireless communication between the internal wireless device and the external wireless device, through the waveguide port, via wireless signal reception by the antenna and wireless signal re-transmission by the antenna. | Embodiments of the present disclosure provide devices and systems that support wireless communication between wireless communication devices residing within, and external to, a Faraday cage. In some embodiments, devices and systems are provided for transmitting wireless signals through a waveguide port of a Faraday cage for wireless signals having frequencies below the cutoff frequency of the waveguide port, where a portion of the waveguide port is compromised by the presence of a conductor, thereby permitting the propagation of electromagnetic waves. In some embodiments, aspects of the present disclosure are employed to adapt a magnetic resonance imaging system for communications between a scanner room and a control room.1. A wireless communication system for communicating through a waveguide port of a Faraday cage, the wireless communications system comprising:
an internal wireless device located within the Faraday cage; an external wireless device located external to the Faraday cage, said internal wireless device and said external wireless device being configured for wireless communication within a frequency band that lies, at least in part, above a cutoff frequency of said waveguide port; and a wireless bridge device comprising an antenna and a transceiver, said transceiver being operably connected to said antenna, said antenna residing within an internal region of said waveguide port; said wireless bridge device being configured to (i) receive, with said antenna, first wireless signals from one of said internal wireless device and said external wireless device, said first wireless signals residing within said frequency band and propagating within said waveguide port as one or both of TE and TM modes, and (ii) transmit, from said antenna, second wireless signals to the other of said internal wireless device and said external wireless device, said second wireless signals residing within said frequency band and propagating within said waveguide port as one or both as TE and TM waves; said wireless bridge device thereby being configured to facilitate wireless communication between said internal wireless device and said external wireless device, through said waveguide port, via wireless signal reception by said antenna and wireless signal re-transmission by said antenna. 2. The wireless communication system according to claim 1 wherein any external electrical conductors that are associated with a portion of said wireless bridge device and reside within said waveguide port are in electrical communication with said waveguide port, thus preserving the operation of said waveguide port as a high-pass filter. 3. The wireless communication system according to claim 1 wherein said transceiver is located outside of said waveguide port. 4. The wireless communication system according to claim 1 wherein the cutoff frequency of said waveguide port is above 2.4 GHz. 5. The wireless communication system according to claim 1 wherein the cutoff frequency of said waveguide port is 3.46 GHz. 6. The wireless communication system according to claim 1 wherein said wireless bridge device comprises one or more additional antennae operably connected to said transceiver. 7. The wireless communication system according to claim 1 wherein said internal wireless device is a first internal wireless device, said wireless communication system further comprising an additional internal wireless device, wherein said wireless bridge device is configured to facilitate wireless communication between said first internal wireless device and said additional internal wireless device. 8. The wireless communication system according to claim 1 wherein said external wireless device is a first external wireless device, said wireless communication system further comprising an additional external wireless device, wherein said wireless bridge device is configured to facilitate wireless communication between said first external wireless device and said additional external wireless device. 9. A method of performing wireless communication through a waveguide port of a Faraday cage, the method comprising:
providing a wireless bridge device comprising an antenna and a transceiver, the transceiver being operably connected to the antenna; positioning the antenna such that the antenna resides within an internal region of the waveguide port; and employing the wireless bridge device to:
receive, with the antenna, first wireless signals from one of an internal wireless device located within the Faraday cage and an external wireless device located external to the Faraday cage, the first wireless signals propagating within the waveguide port as one or both of TE and TM modes and residing within a frequency band that resides, at least in part, above a cutoff frequency of the waveguide port; and
transmit, from the antenna, second wireless signals to the other of the internal wireless device and the external wireless device, such that the second wireless signals reside within the frequency band and propagate within the waveguide port as one or both as TE and TM waves;
thereby facilitating wireless communication between the internal wireless device and the external wireless device, through the waveguide port, via wireless signal reception by the antenna and wireless signal re-transmission by the antenna. | 1,600 |
348,641 | 16,806,142 | 1,651 | Systems and methods are provided for distributing content. One embodiment includes a content management server. The content management server includes a memory that stores a library of assets comprising digital media, and that further stores scores that indicate popularity of the assets in the library. The content management server also includes an interface that receives a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server, and a controller that identifies a Uniform Resource Locator (URL) within the HTTP request, selects a group of assets for the URL from the library, identifies an asset that has a highest score within the group, and provides the asset in response to the HTTP request. The controller alters scores for assets in the library over time as assets in the library are provided, and selects different groups of assets for the URL over time. | 1. A system comprising:
a content management server comprising:
a memory that stores a library of assets comprising digital media, and that further stores scores that indicate popularity of the assets in the library;
an interface that receives a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; and
a controller that selects a group of assets from the library based on the HTTP request, identifies an asset that has a highest score within the group, and provides the identified asset in response to the HTTP request,
wherein the controller adjusts the scores based upon an arrangement of the assets at a website. 2. The system of claim 1 wherein:
the controller determines an arrangement of the assets at the website based on an order in which HTTP requests are received. 3. The system of claim 1 wherein:
the controller determines an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 4. The system of claim 1 wherein:
the controller identifies restricted assets in the group that the device does not have permission to access, based on the HTTP request, and prevents the restricted assets from being provided to the device. 5. The system of claim 1 wherein:
the controller removes assets from the library and adds assets to the library over time. 6. The system of claim 1 wherein:
the controller determines, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device, infers that a user of the device has clicked on the identified asset as presented within a web page, and increases a score for the identified asset. 7. The system of claim 1 wherein:
the scores are based on metrics of consumption of the assets in the library during a period of time. 8. A method comprising:
storing a library of assets comprising digital media at a content management server; storing scores that indicate popularity of the assets in the library at the content management server; receiving a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; selecting a group of assets from the library based on the HTTP request; identifying an asset that has a highest score within the group; providing the identified asset in response to the HTTP request; and adjusting the scores based upon an arrangement of the assets at a website. 9. The method of claim 8 further comprising:
determining an arrangement of the assets at the website based on an order in which HTTP requests are received. 10. The method of claim 8 further comprising:
determining an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 11. The method of claim 8 further comprising:
identifying restricted assets in the group that the device does not have permission to access, based on the HTTP request; and
preventing the restricted assets from being provided to the device. 12. The method of claim 8 further comprising:
removing assets from the library and adding assets to the library over time. 13. The method of claim 8 further comprising:
determining, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device;
inferring that a user of the device has clicked on the identified asset as presented within a web page; and
increasing a score for the identified asset. 14. The method of claim 8 wherein:
the scores are based on metrics of consumption of the assets in the library during a period of time. 15. A non-transitory computer readable medium embodying programmed instructions which, when executed by a processor, are operable for performing a method comprising:
storing a library of assets comprising digital media at a content management server; storing scores that indicate popularity of the assets in the library at the content management server; receiving a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; selecting a group of assets from the library based on the HTTP request; identifying an asset that has a highest score within the group; providing the identified asset in response to the HTTP request; and adjusting the scores based upon an arrangement of the assets at a website. 16. The medium of claim 15 wherein the method further comprises:
determining an arrangement of the assets at the website based on an order in which HTTP requests are received. 17. The medium of claim 15 wherein the method further comprises:
determining an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 18. The medium of claim 15 wherein the method further comprises:
identifying restricted assets in the group that the device does not have permission to access, based on the HTTP request; and
preventing the restricted assets from being provided to the device. 19. The medium of claim 15 wherein the method further comprises:
removing assets from the library and adding assets to the library over time. 20. The medium of claim 15 wherein the method further comprises:
determining, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device;
inferring that a user of the device has clicked on the identified asset as presented within a web page; and
increasing a score for the identified asset. | Systems and methods are provided for distributing content. One embodiment includes a content management server. The content management server includes a memory that stores a library of assets comprising digital media, and that further stores scores that indicate popularity of the assets in the library. The content management server also includes an interface that receives a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server, and a controller that identifies a Uniform Resource Locator (URL) within the HTTP request, selects a group of assets for the URL from the library, identifies an asset that has a highest score within the group, and provides the asset in response to the HTTP request. The controller alters scores for assets in the library over time as assets in the library are provided, and selects different groups of assets for the URL over time.1. A system comprising:
a content management server comprising:
a memory that stores a library of assets comprising digital media, and that further stores scores that indicate popularity of the assets in the library;
an interface that receives a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; and
a controller that selects a group of assets from the library based on the HTTP request, identifies an asset that has a highest score within the group, and provides the identified asset in response to the HTTP request,
wherein the controller adjusts the scores based upon an arrangement of the assets at a website. 2. The system of claim 1 wherein:
the controller determines an arrangement of the assets at the website based on an order in which HTTP requests are received. 3. The system of claim 1 wherein:
the controller determines an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 4. The system of claim 1 wherein:
the controller identifies restricted assets in the group that the device does not have permission to access, based on the HTTP request, and prevents the restricted assets from being provided to the device. 5. The system of claim 1 wherein:
the controller removes assets from the library and adds assets to the library over time. 6. The system of claim 1 wherein:
the controller determines, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device, infers that a user of the device has clicked on the identified asset as presented within a web page, and increases a score for the identified asset. 7. The system of claim 1 wherein:
the scores are based on metrics of consumption of the assets in the library during a period of time. 8. A method comprising:
storing a library of assets comprising digital media at a content management server; storing scores that indicate popularity of the assets in the library at the content management server; receiving a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; selecting a group of assets from the library based on the HTTP request; identifying an asset that has a highest score within the group; providing the identified asset in response to the HTTP request; and adjusting the scores based upon an arrangement of the assets at a website. 9. The method of claim 8 further comprising:
determining an arrangement of the assets at the website based on an order in which HTTP requests are received. 10. The method of claim 8 further comprising:
determining an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 11. The method of claim 8 further comprising:
identifying restricted assets in the group that the device does not have permission to access, based on the HTTP request; and
preventing the restricted assets from being provided to the device. 12. The method of claim 8 further comprising:
removing assets from the library and adding assets to the library over time. 13. The method of claim 8 further comprising:
determining, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device;
inferring that a user of the device has clicked on the identified asset as presented within a web page; and
increasing a score for the identified asset. 14. The method of claim 8 wherein:
the scores are based on metrics of consumption of the assets in the library during a period of time. 15. A non-transitory computer readable medium embodying programmed instructions which, when executed by a processor, are operable for performing a method comprising:
storing a library of assets comprising digital media at a content management server; storing scores that indicate popularity of the assets in the library at the content management server; receiving a Hyper Text Transfer Protocol (HTTP) request that is sourced by a device remote from the content management server; selecting a group of assets from the library based on the HTTP request; identifying an asset that has a highest score within the group; providing the identified asset in response to the HTTP request; and adjusting the scores based upon an arrangement of the assets at a website. 16. The medium of claim 15 wherein the method further comprises:
determining an arrangement of the assets at the website based on an order in which HTTP requests are received. 17. The medium of claim 15 wherein the method further comprises:
determining an arrangement of the assets at the website based on Uniform Resource Locators (URLs) in HTTP requests. 18. The medium of claim 15 wherein the method further comprises:
identifying restricted assets in the group that the device does not have permission to access, based on the HTTP request; and
preventing the restricted assets from being provided to the device. 19. The medium of claim 15 wherein the method further comprises:
removing assets from the library and adding assets to the library over time. 20. The medium of claim 15 wherein the method further comprises:
determining, based on an additional HTTP request, that a larger version of the identified asset is being accessed by the device;
inferring that a user of the device has clicked on the identified asset as presented within a web page; and
increasing a score for the identified asset. | 1,600 |
348,642 | 16,806,150 | 3,661 | An eye-safe light detection and ranging system includes a virtual protective housing. A short range pulse is emitted at every measurement point in a field of view before conditionally emitting a long range pulse. Short range pulses result in accessible emissions that are eye-safe at short distances and long range pulses result in accessible emissions that are eye-safe at longer distances. | 1. An apparatus comprising:
a laser light source to produce infrared (IR) laser light pulses at multiple energy levels at times corresponding to depth measurement points in a field of view; a scanning mirror assembly to scan the IR laser light pulses in the field of view; a first IR light detector to detect reflections of the IR laser light pulses from within the field of view; time-of-flight (TOF) circuitry responsive to the first IR light detector to measure distances to objects at the depth measurement points in the field of view; and a virtual protective housing circuit that, for a plurality of depth measurement points, causes the laser light source to emit a first IR laser light pulse at a first pulse energy to detect an object within a short range, determines there is no object within the short range, and emits at least one second IR laser light pulse having a total second energy level to detect an object within a long range, wherein the first energy level is lower than the total second energy level. 2. The apparatus of claim 1 further comprising:
a second IR light detector; and
second TOF circuitry responsive to the second IR light detector. 3. The apparatus of claim 2 further comprising:
a first optical path between the scanning mirror assembly and the field of view; and
a second optical path between the field of view and the first IR light detector, wherein the second IR light detector is positioned to receive light from the field of view through the first optical path. 4. The apparatus of claim 1 wherein the apparatus is mounted on a moving platform. 5. The apparatus of claim 4 wherein the first pulse energy is increased when the moving platform has a velocity above a threshold. 6. The apparatus of claim 4 wherein the first pulse energy increases with increased platform velocity. 7. The apparatus of claim 1 further comprising at least one visible laser light source to emit visible laser light, wherein the virtual protective housing circuit includes circuitry to reduce a power level of the visible laser light in response to the TOF circuitry. 8. An apparatus comprising:
a first laser light source to emit IR laser light pulses at times corresponding to measurement points in a two-dimensional field of view; a scanning mirror assembly to reflect the IR laser light pulses at the measurement points in the field of view, a first time-of-flight (TOF) measurement circuit to produce depth data representing distances to objects at the measurement points in the field of view in response to received reflections of IR laser light pulses; pulse generation circuitry to first produce a short range IR laser light pulse and then produce at least one long range IR laser light pulse for each measurement point, wherein the short range IR laser light pulse is lower energy than the at least one long range IR laser light pulse; and a 3D point cloud storage device to store 3D depth map information. 9. The apparatus of claim 1 wherein a pulse energy of the short range IR laser light pulse is below an eye-safe threshold at a first distance, and a total energy of the at least one long range IR laser light pulse is below an eye-safe threshold at a second distance. 10. The apparatus of claim 9 wherein the apparatus is mounted on a moving platform. 11. The apparatus of claim 10 wherein the first distance is increased when the moving platform has a velocity above a threshold. 12. The apparatus of claim 10 wherein the first distance is increased based on the velocity of the moving platform. 13. The apparatus of claim 8 further comprising a second TOF measurement circuit, wherein the first and second TOF measurement circuits measure TOF of reflections received on different optical paths. 14. The apparatus of claim 8 wherein the pulse generation circuitry is configured to generate the at least one long range pulse when no object is detected by the short range pulse, and to not generate the at least one long range pulse when an object is detected by the short range pulse. 15. The apparatus of claim 8 further comprising:
at least one visible laser light source to emit visible laser light; and
circuitry to reduce a power level of the visible laser light in response to the first TOF measurement circuit. 16. A method comprising:
scanning IR laser light pulses across multiple measurement points in a field of view; generating a short range IR laser light pulse at a time corresponding to a first measurement point in the field of view; if a reflection of the short range IR laser light pulse is detected within a first time period, measuring a time-of-flight of the reflection, and storing the time-of-flight as depth data in a 3D point cloud storage device; if a reflection of the short range IR laser light pulse is not detected within the first time period, generating at least one long range IR laser light pulse at a time still corresponding to the first measurement point within the field of view, and storing time-of-flight of any received reflection of the at least one long range IR laser light pulse as depth data in the 3D point cloud storage device. 17. The method of claim 16 wherein short range IR laser light pulse is lower energy than a total energy of the at least one long range IR laser light pulse. 18. The method of claim 17 wherein the short range IR laser light pulse is eye-safe at a first distance. 19. The method of claim 18 wherein the long range IR laser light pulse is eye-safe at a second distance, wherein the second distance is larger than the first distance. 20. The method of claim 16 further comprising increasing a power of the short range IR laser light pulse when the laser light pulses are emitted from a moving platform. 21. The method of claim 16 wherein the long range IR laser light pulse comprises a plurality of long range IR laser light pulses. 22. The method of claim 16 further comprising:
scanning visible laser light pulses to form an image in the field of view; and
reducing power of the visible laser light pulses when a reflection of the short range IR laser light pulse is detected within the first time period. 23. The method of claim 16 further comprising generating at lease one long range pulse at a time corresponding to a subsequent measurement point within the field of view without first generating a short range pulse at the subsequent measurement point if a reflection of the short range IR laser light pulse is not detected within the first time period. | An eye-safe light detection and ranging system includes a virtual protective housing. A short range pulse is emitted at every measurement point in a field of view before conditionally emitting a long range pulse. Short range pulses result in accessible emissions that are eye-safe at short distances and long range pulses result in accessible emissions that are eye-safe at longer distances.1. An apparatus comprising:
a laser light source to produce infrared (IR) laser light pulses at multiple energy levels at times corresponding to depth measurement points in a field of view; a scanning mirror assembly to scan the IR laser light pulses in the field of view; a first IR light detector to detect reflections of the IR laser light pulses from within the field of view; time-of-flight (TOF) circuitry responsive to the first IR light detector to measure distances to objects at the depth measurement points in the field of view; and a virtual protective housing circuit that, for a plurality of depth measurement points, causes the laser light source to emit a first IR laser light pulse at a first pulse energy to detect an object within a short range, determines there is no object within the short range, and emits at least one second IR laser light pulse having a total second energy level to detect an object within a long range, wherein the first energy level is lower than the total second energy level. 2. The apparatus of claim 1 further comprising:
a second IR light detector; and
second TOF circuitry responsive to the second IR light detector. 3. The apparatus of claim 2 further comprising:
a first optical path between the scanning mirror assembly and the field of view; and
a second optical path between the field of view and the first IR light detector, wherein the second IR light detector is positioned to receive light from the field of view through the first optical path. 4. The apparatus of claim 1 wherein the apparatus is mounted on a moving platform. 5. The apparatus of claim 4 wherein the first pulse energy is increased when the moving platform has a velocity above a threshold. 6. The apparatus of claim 4 wherein the first pulse energy increases with increased platform velocity. 7. The apparatus of claim 1 further comprising at least one visible laser light source to emit visible laser light, wherein the virtual protective housing circuit includes circuitry to reduce a power level of the visible laser light in response to the TOF circuitry. 8. An apparatus comprising:
a first laser light source to emit IR laser light pulses at times corresponding to measurement points in a two-dimensional field of view; a scanning mirror assembly to reflect the IR laser light pulses at the measurement points in the field of view, a first time-of-flight (TOF) measurement circuit to produce depth data representing distances to objects at the measurement points in the field of view in response to received reflections of IR laser light pulses; pulse generation circuitry to first produce a short range IR laser light pulse and then produce at least one long range IR laser light pulse for each measurement point, wherein the short range IR laser light pulse is lower energy than the at least one long range IR laser light pulse; and a 3D point cloud storage device to store 3D depth map information. 9. The apparatus of claim 1 wherein a pulse energy of the short range IR laser light pulse is below an eye-safe threshold at a first distance, and a total energy of the at least one long range IR laser light pulse is below an eye-safe threshold at a second distance. 10. The apparatus of claim 9 wherein the apparatus is mounted on a moving platform. 11. The apparatus of claim 10 wherein the first distance is increased when the moving platform has a velocity above a threshold. 12. The apparatus of claim 10 wherein the first distance is increased based on the velocity of the moving platform. 13. The apparatus of claim 8 further comprising a second TOF measurement circuit, wherein the first and second TOF measurement circuits measure TOF of reflections received on different optical paths. 14. The apparatus of claim 8 wherein the pulse generation circuitry is configured to generate the at least one long range pulse when no object is detected by the short range pulse, and to not generate the at least one long range pulse when an object is detected by the short range pulse. 15. The apparatus of claim 8 further comprising:
at least one visible laser light source to emit visible laser light; and
circuitry to reduce a power level of the visible laser light in response to the first TOF measurement circuit. 16. A method comprising:
scanning IR laser light pulses across multiple measurement points in a field of view; generating a short range IR laser light pulse at a time corresponding to a first measurement point in the field of view; if a reflection of the short range IR laser light pulse is detected within a first time period, measuring a time-of-flight of the reflection, and storing the time-of-flight as depth data in a 3D point cloud storage device; if a reflection of the short range IR laser light pulse is not detected within the first time period, generating at least one long range IR laser light pulse at a time still corresponding to the first measurement point within the field of view, and storing time-of-flight of any received reflection of the at least one long range IR laser light pulse as depth data in the 3D point cloud storage device. 17. The method of claim 16 wherein short range IR laser light pulse is lower energy than a total energy of the at least one long range IR laser light pulse. 18. The method of claim 17 wherein the short range IR laser light pulse is eye-safe at a first distance. 19. The method of claim 18 wherein the long range IR laser light pulse is eye-safe at a second distance, wherein the second distance is larger than the first distance. 20. The method of claim 16 further comprising increasing a power of the short range IR laser light pulse when the laser light pulses are emitted from a moving platform. 21. The method of claim 16 wherein the long range IR laser light pulse comprises a plurality of long range IR laser light pulses. 22. The method of claim 16 further comprising:
scanning visible laser light pulses to form an image in the field of view; and
reducing power of the visible laser light pulses when a reflection of the short range IR laser light pulse is detected within the first time period. 23. The method of claim 16 further comprising generating at lease one long range pulse at a time corresponding to a subsequent measurement point within the field of view without first generating a short range pulse at the subsequent measurement point if a reflection of the short range IR laser light pulse is not detected within the first time period. | 3,600 |
348,643 | 16,806,124 | 3,661 | A magnetic substance detection sensor includes a support substrate, a magnet having a thickness, and disposed on one of an upper main surface and a lower main surface of the support substrate so that a magnetization direction becomes parallel to the upper main surface, and a semiconductor chip disposed on one of the upper main surface and the lower main surface, and having a magnetic field detection element to detect a magnetic field component in a specific direction. The magnetic field detection element is disposed outside a first space adjacent to the magnet in the magnetization direction and having the thickness, a second space adjacent to the magnet in a direction orthogonal to the magnetization direction, and a third space extending from the first space along the direction orthogonal to the specific direction. | 1. A magnetic substance detection sensor, comprising:
a support substrate having an upper main surface and a lower main surface; a magnet having a thickness, and disposed on one of the upper main surface and the lower main surface of the support substrate so that a magnetization direction becomes parallel to the upper main surface; and a semiconductor chip disposed on one of the upper main surface and the lower main surface of the support substrate, and having a magnetic field detection element configured to detect a magnetic field component in a specific direction, wherein the magnetic field detection element is disposed outside a first space, a second space and a third space: the first space is adjacent to the magnet in the magnetization direction and has the thickness, the second space is adjacent to the magnet in a direction orthogonal to the magnetization direction, and the third space extends from the first space along the direction orthogonal to the specific direction. 2. The magnetic substance detection sensor according to claim 1, wherein the semiconductor chip is disposed on the upper main surface of the support substrate, and
wherein a distance between the upper main surface of the support substrate and the magnetic field detection element is larger than the thickness of the magnet in the direction orthogonal to the magnetization direction. 3. The magnetic substance detection sensor according to claim 1, wherein the magnet is disposed in a recess provided on one of the upper main surface and the lower main surface of the support substrate. 4. The magnetic substance detection sensor according to claim 1, wherein the semiconductor chip is disposed relative to one of the upper main surface and the lower main surface of the support substrate with an intervention of an intermediate member therebetween. 5. The magnetic substance detection sensor according to claim 1, wherein the magnetic field detection element overlaps with the first space in a plan view from the specific direction. 6. The magnetic substance detection sensor according to claim wherein the magnetic field detection element is covered with a resin film. | A magnetic substance detection sensor includes a support substrate, a magnet having a thickness, and disposed on one of an upper main surface and a lower main surface of the support substrate so that a magnetization direction becomes parallel to the upper main surface, and a semiconductor chip disposed on one of the upper main surface and the lower main surface, and having a magnetic field detection element to detect a magnetic field component in a specific direction. The magnetic field detection element is disposed outside a first space adjacent to the magnet in the magnetization direction and having the thickness, a second space adjacent to the magnet in a direction orthogonal to the magnetization direction, and a third space extending from the first space along the direction orthogonal to the specific direction.1. A magnetic substance detection sensor, comprising:
a support substrate having an upper main surface and a lower main surface; a magnet having a thickness, and disposed on one of the upper main surface and the lower main surface of the support substrate so that a magnetization direction becomes parallel to the upper main surface; and a semiconductor chip disposed on one of the upper main surface and the lower main surface of the support substrate, and having a magnetic field detection element configured to detect a magnetic field component in a specific direction, wherein the magnetic field detection element is disposed outside a first space, a second space and a third space: the first space is adjacent to the magnet in the magnetization direction and has the thickness, the second space is adjacent to the magnet in a direction orthogonal to the magnetization direction, and the third space extends from the first space along the direction orthogonal to the specific direction. 2. The magnetic substance detection sensor according to claim 1, wherein the semiconductor chip is disposed on the upper main surface of the support substrate, and
wherein a distance between the upper main surface of the support substrate and the magnetic field detection element is larger than the thickness of the magnet in the direction orthogonal to the magnetization direction. 3. The magnetic substance detection sensor according to claim 1, wherein the magnet is disposed in a recess provided on one of the upper main surface and the lower main surface of the support substrate. 4. The magnetic substance detection sensor according to claim 1, wherein the semiconductor chip is disposed relative to one of the upper main surface and the lower main surface of the support substrate with an intervention of an intermediate member therebetween. 5. The magnetic substance detection sensor according to claim 1, wherein the magnetic field detection element overlaps with the first space in a plan view from the specific direction. 6. The magnetic substance detection sensor according to claim wherein the magnetic field detection element is covered with a resin film. | 3,600 |
348,644 | 16,806,118 | 3,661 | Exemplary embodiments provide systems and methods for portable medical ultrasound imaging. Certain embodiments provide a multi-chip module for an ultrasound engine of a portable medical ultrasound imaging system, in which a transmit/receive chip, an amplifier chip and a beamformer chip are assembled in a vertically stacked configuration. Exemplary embodiments also provide an ultrasound engine circuit board including one or more multi-chip modules, and a portable medical ultrasound imaging system including an ultrasound engine circuit board with one or more multi-chip modules. Exemplary embodiments also provide methods for fabricating and assembling multi-chip modules as taught herein. A single circuit board of an ultrasound engine with one or more multi-chip modules may include 16 to 128 channels in some embodiments. Due to the vertical stacking arrangement of the multi-chip modules, a 128-channel ultrasound engine circuit board can be assembled within exemplary planar dimensions of about 10 cm×about 10 cm. | 1. A method of operating handheld medical ultrasound imaging device, the medical ultrasound imaging device including a tablet housing, the housing having a front panel, a computer in the housing, the computer including at least one processor that controls an imaging operation and at least one memory, a battery, a touch screen display for displaying an ultrasound image, the touch screen display positioned on the front panel, and an ultrasound processing circuit disposed in the housing, the touch screen display and the ultrasound processing circuit being communicably coupled to the computer, the method comprising the steps of:
operating a transducer that communicates with the at least one processor and the ultrasound processing circuit such that beamformed image data is processed and displayed on an ultrasound image display window area of the touch screen display, the touch screen display having a plurality of touch actuated icons outside the image display window area that operate imaging parameters wherein the touch actuated icons operate access to a patient data display window and one or more imaging parameter presets; receiving, at the computer, a first moving gesture input from the touch screen display; and in response to the first moving gesture input from the touch screen display, altering a display operation. 2-4. (canceled) 5. The method of claim 1 further comprising in response to a second input from the touch screen display, displaying a first cursor inside a region of a virtual window displaying a magnified image. 6. The method of claim 5 further comprising receiving, at the computer, a third input from the touch screen display, the third input being received inside the region of the virtual window. 7. The method of claim 6 wherein the third input corresponds to a drag gesture on the touch screen display. 8. The method of claim 6 further comprising in response to the third input from the touch screen display, moving the first cursor to a first location inside the region of the virtual window. 9. The method of claim 8 further comprising receiving, at the computer, a fourth input from the touch screen display, the fourth input being received at the first location inside the region of the virtual window. 10. The method of claim 9 wherein the fourth input corresponds to a press gesture against the touch screen display. 11. The method of claim 9 further comprising receiving, at the computer, a fifth input from the touch screen display, the fifth input being received substantially simultaneously with the fourth input. 12. The method of claim 11 wherein the fifth input corresponds to a tap gesture against the touch screen display. 13. The method of claim 11 further comprising in response to the fifth input from the touch screen display, fixing the first cursor at the first location inside the region of the virtual window. 14. The method of claim 13 further comprising performing, by the computer, at least one measurement on the ultrasound image based at least in part on the first cursor at the first location. 15-25. (canceled) 26. A method of operating portable medical ultrasound imaging equipment, the portable medical ultrasound imaging equipment including a housing in a tablet form factor, the housing having a front panel, a computer disposed in the housing, the computer including at least one processor and at least one memory, a battery, a touch screen display for displaying an ultrasound image, the touch screen display being disposed on the front panel, and an ultrasound beamformer circuit disposed in the housing, the touch screen display and the ultrasound engine being communicably coupled to the computer, the method comprising the steps of:
receiving, at the computer, a first input from the touch screen display having a graphical user interface including icons and an ultrasound image display area adjacent to said icons; in response to the first input from the touch screen display, with a moving gesture on the ultrasound image display area of the touch screen, tracing a predetermined feature of the ultrasound image; receiving, at the computer, a second input from the touch screen display; and in response to the second input from the touch screen display, completing the tracing of the predetermined feature of the ultrasound image. 27. The method of claim 26 wherein the moving gesture comprises a press and drag gesture against the touch screen display. 28. The method of claim 26 wherein the second input corresponds to a tap gesture against the touch screen display. 29. The method of claim 26 further comprising receiving, at the computer, a third input from the touch screen display. 30. The method of claim 29 wherein the third input corresponds to a double tap gesture against the touch screen display. 31. The method of claim 29 further comprising in response to the third input from the touch screen display, displaying a first cursor inside a region of the touch screen display. 32. The method of claim 31 further comprising receiving, at the computer, a fourth input from the touch screen display. 33. The method of claim 32 wherein the fourth input corresponds to a drag gesture on the touch screen display. 34. The method of claim 32 further comprising in response to the fourth input from the touch screen display, moving the first cursor to a first location inside the region of the touch screen display. 35-39. (canceled) 40. The method of claim 31 wherein the tracing of the predetermined feature of the ultrasound image includes tracing the predetermined feature of the ultrasound image, starting from the first cursor at a first location inside the region of the touch screen display. 41. The method of claim 26 further comprising performing, by the computer, at least one measurement on the ultrasound image based at least in part on the tracing of the predetermined feature of the ultrasound image. 42-84. (canceled) | Exemplary embodiments provide systems and methods for portable medical ultrasound imaging. Certain embodiments provide a multi-chip module for an ultrasound engine of a portable medical ultrasound imaging system, in which a transmit/receive chip, an amplifier chip and a beamformer chip are assembled in a vertically stacked configuration. Exemplary embodiments also provide an ultrasound engine circuit board including one or more multi-chip modules, and a portable medical ultrasound imaging system including an ultrasound engine circuit board with one or more multi-chip modules. Exemplary embodiments also provide methods for fabricating and assembling multi-chip modules as taught herein. A single circuit board of an ultrasound engine with one or more multi-chip modules may include 16 to 128 channels in some embodiments. Due to the vertical stacking arrangement of the multi-chip modules, a 128-channel ultrasound engine circuit board can be assembled within exemplary planar dimensions of about 10 cm×about 10 cm.1. A method of operating handheld medical ultrasound imaging device, the medical ultrasound imaging device including a tablet housing, the housing having a front panel, a computer in the housing, the computer including at least one processor that controls an imaging operation and at least one memory, a battery, a touch screen display for displaying an ultrasound image, the touch screen display positioned on the front panel, and an ultrasound processing circuit disposed in the housing, the touch screen display and the ultrasound processing circuit being communicably coupled to the computer, the method comprising the steps of:
operating a transducer that communicates with the at least one processor and the ultrasound processing circuit such that beamformed image data is processed and displayed on an ultrasound image display window area of the touch screen display, the touch screen display having a plurality of touch actuated icons outside the image display window area that operate imaging parameters wherein the touch actuated icons operate access to a patient data display window and one or more imaging parameter presets; receiving, at the computer, a first moving gesture input from the touch screen display; and in response to the first moving gesture input from the touch screen display, altering a display operation. 2-4. (canceled) 5. The method of claim 1 further comprising in response to a second input from the touch screen display, displaying a first cursor inside a region of a virtual window displaying a magnified image. 6. The method of claim 5 further comprising receiving, at the computer, a third input from the touch screen display, the third input being received inside the region of the virtual window. 7. The method of claim 6 wherein the third input corresponds to a drag gesture on the touch screen display. 8. The method of claim 6 further comprising in response to the third input from the touch screen display, moving the first cursor to a first location inside the region of the virtual window. 9. The method of claim 8 further comprising receiving, at the computer, a fourth input from the touch screen display, the fourth input being received at the first location inside the region of the virtual window. 10. The method of claim 9 wherein the fourth input corresponds to a press gesture against the touch screen display. 11. The method of claim 9 further comprising receiving, at the computer, a fifth input from the touch screen display, the fifth input being received substantially simultaneously with the fourth input. 12. The method of claim 11 wherein the fifth input corresponds to a tap gesture against the touch screen display. 13. The method of claim 11 further comprising in response to the fifth input from the touch screen display, fixing the first cursor at the first location inside the region of the virtual window. 14. The method of claim 13 further comprising performing, by the computer, at least one measurement on the ultrasound image based at least in part on the first cursor at the first location. 15-25. (canceled) 26. A method of operating portable medical ultrasound imaging equipment, the portable medical ultrasound imaging equipment including a housing in a tablet form factor, the housing having a front panel, a computer disposed in the housing, the computer including at least one processor and at least one memory, a battery, a touch screen display for displaying an ultrasound image, the touch screen display being disposed on the front panel, and an ultrasound beamformer circuit disposed in the housing, the touch screen display and the ultrasound engine being communicably coupled to the computer, the method comprising the steps of:
receiving, at the computer, a first input from the touch screen display having a graphical user interface including icons and an ultrasound image display area adjacent to said icons; in response to the first input from the touch screen display, with a moving gesture on the ultrasound image display area of the touch screen, tracing a predetermined feature of the ultrasound image; receiving, at the computer, a second input from the touch screen display; and in response to the second input from the touch screen display, completing the tracing of the predetermined feature of the ultrasound image. 27. The method of claim 26 wherein the moving gesture comprises a press and drag gesture against the touch screen display. 28. The method of claim 26 wherein the second input corresponds to a tap gesture against the touch screen display. 29. The method of claim 26 further comprising receiving, at the computer, a third input from the touch screen display. 30. The method of claim 29 wherein the third input corresponds to a double tap gesture against the touch screen display. 31. The method of claim 29 further comprising in response to the third input from the touch screen display, displaying a first cursor inside a region of the touch screen display. 32. The method of claim 31 further comprising receiving, at the computer, a fourth input from the touch screen display. 33. The method of claim 32 wherein the fourth input corresponds to a drag gesture on the touch screen display. 34. The method of claim 32 further comprising in response to the fourth input from the touch screen display, moving the first cursor to a first location inside the region of the touch screen display. 35-39. (canceled) 40. The method of claim 31 wherein the tracing of the predetermined feature of the ultrasound image includes tracing the predetermined feature of the ultrasound image, starting from the first cursor at a first location inside the region of the touch screen display. 41. The method of claim 26 further comprising performing, by the computer, at least one measurement on the ultrasound image based at least in part on the tracing of the predetermined feature of the ultrasound image. 42-84. (canceled) | 3,600 |
348,645 | 16,806,149 | 3,661 | This disclosure relates to providing synchronization signal block index signaling in a cellular communication system. A cellular base station may provide synchronization signals according to a periodic pattern, including transmitting one or more synchronization signal bursts each including one or more synchronization signal blocks. A wireless device may detect a synchronization signal block. The wireless device may determine a synchronization signal block index of the detected synchronization signal block. The wireless device may provide an indication of the synchronization signal block index of the detected synchronization signal block to the cellular base station. | 1. A wireless device, comprising:
an antenna; a radio operably coupled to the antenna; and a processor operably coupled to the radio, wherein the processor is configured to cause the wireless device to:
detect a synchronization signal (SS) block from a cellular base station;
determine a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determine a relative position of the detected SS block based on the scrambling code;
determine a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmit an indication of the SS block index of the detected SS block to the cellular base station. 2. The wireless device of claim 1,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 3. The wireless device of claim 2, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 4. The wireless device of claim 1, wherein the processor is further configured to cause the wireless device to:
determine radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 5. The wireless device of claim 1, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 6. The wireless device of claim 1, wherein the processor is further configured to cause the wireless device to:
perform coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. 7. The wireless device of claim 1, wherein the SS block index for each SS block is indicated using a two part signaling arrangement, wherein one part comprises a relative location of the SS block within a SS burst, wherein another part comprises a SS burst index value explicitly indicated in the physical broadcast channel, and wherein determining the SS block index is based on the SS burst index value. 8. An apparatus, comprising:
a processor, configured to cause a wireless device to:
detect a synchronization signal (SS) block from a cellular base station;
determine a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determine a relative position of the detected SS block based on the scrambling code;
determine a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmit an indication of the SS block index of the detected SS block to the cellular base station. 9. The apparatus of claim 8,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 10. The apparatus of claim 9, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 11. The apparatus of claim 8, wherein the processor is further configured to cause the wireless device to:
determine radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 12. The apparatus of claim 8, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 13. The apparatus of claim 8, wherein the processor is further configured to cause the wireless device to:
perform coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. 14. The apparatus of claim 8, wherein the SS block index for each SS block is indicated using a two part signaling arrangement, wherein one part comprises a relative location of the SS block within a SS burst, wherein another part comprises a SS burst index value explicitly indicated in the physical broadcast channel, and wherein determining the SS block index is based on the SS burst index value. 15. A method, comprising:
by a wireless device:
detecting a synchronization signal (SS) block from a cellular base station;
determining a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determining a relative position of the detected SS block based on the scrambling code;
determining a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmitting an indication of the SS block index of the detected SS block to the cellular base station. 16. The method of claim 15,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 17. The method of claim 16, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 18. The method of claim 15, further comprising:
determining radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 19. The method of claim 15, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 20. The method of claim 15, further comprising:
performing coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. | This disclosure relates to providing synchronization signal block index signaling in a cellular communication system. A cellular base station may provide synchronization signals according to a periodic pattern, including transmitting one or more synchronization signal bursts each including one or more synchronization signal blocks. A wireless device may detect a synchronization signal block. The wireless device may determine a synchronization signal block index of the detected synchronization signal block. The wireless device may provide an indication of the synchronization signal block index of the detected synchronization signal block to the cellular base station.1. A wireless device, comprising:
an antenna; a radio operably coupled to the antenna; and a processor operably coupled to the radio, wherein the processor is configured to cause the wireless device to:
detect a synchronization signal (SS) block from a cellular base station;
determine a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determine a relative position of the detected SS block based on the scrambling code;
determine a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmit an indication of the SS block index of the detected SS block to the cellular base station. 2. The wireless device of claim 1,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 3. The wireless device of claim 2, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 4. The wireless device of claim 1, wherein the processor is further configured to cause the wireless device to:
determine radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 5. The wireless device of claim 1, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 6. The wireless device of claim 1, wherein the processor is further configured to cause the wireless device to:
perform coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. 7. The wireless device of claim 1, wherein the SS block index for each SS block is indicated using a two part signaling arrangement, wherein one part comprises a relative location of the SS block within a SS burst, wherein another part comprises a SS burst index value explicitly indicated in the physical broadcast channel, and wherein determining the SS block index is based on the SS burst index value. 8. An apparatus, comprising:
a processor, configured to cause a wireless device to:
detect a synchronization signal (SS) block from a cellular base station;
determine a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determine a relative position of the detected SS block based on the scrambling code;
determine a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmit an indication of the SS block index of the detected SS block to the cellular base station. 9. The apparatus of claim 8,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 10. The apparatus of claim 9, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 11. The apparatus of claim 8, wherein the processor is further configured to cause the wireless device to:
determine radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 12. The apparatus of claim 8, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 13. The apparatus of claim 8, wherein the processor is further configured to cause the wireless device to:
perform coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. 14. The apparatus of claim 8, wherein the SS block index for each SS block is indicated using a two part signaling arrangement, wherein one part comprises a relative location of the SS block within a SS burst, wherein another part comprises a SS burst index value explicitly indicated in the physical broadcast channel, and wherein determining the SS block index is based on the SS burst index value. 15. A method, comprising:
by a wireless device:
detecting a synchronization signal (SS) block from a cellular base station;
determining a scrambling code for the physical broadcast channel portion of the detected SS block by testing a plurality of relative position hypotheses for the detected SS block, wherein each test uses a different scrambling code, and wherein relative positions of SS blocks are implicitly signaled using scrambling codes for the physical broadcast channel portion of the detected SS block;
determining a relative position of the detected SS block based on the scrambling code;
determining a SS block index of the detected SS block based on the relative position of the detected SS block; and
transmitting an indication of the SS block index of the detected SS block to the cellular base station. 16. The method of claim 15,
wherein the SS are transmitted by the cellular base station according to a periodic pattern, wherein, in each period of the periodic pattern, a plurality of SS bursts each comprising a plurality of SS blocks are transmitted, wherein each SS block comprises a primary synchronization signal portion, a secondary synchronization signal portion, and a physical broadcast channel portion. 17. The method of claim 16, wherein each SS block in a SS burst has identical content but is implicitly differentiated by scrambling codes in at least the physical broadcast channel portion. 18. The method of claim 15, further comprising:
determining radio frame level timing of a cell provided by the cellular base station based at least in part on the SS block index of the detected SS block. 19. The method of claim 15, wherein one or more SS bursts each comprising one or more SS blocks are transmitted in each period of a periodic pattern. 20. The method of claim 15, further comprising:
performing coherent combining of a physical broadcast channel portion of the detected SS block and a physical broadcast channel portion of at least one additional SS block in a same SS burst as the detected SS block. | 3,600 |
348,646 | 16,806,113 | 3,661 | According to one embodiment, a virtualization support device includes: a first processor controlling an operation of accelerators; a memory holding first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and a management unit coupled to the first processor and the memory. The first processor performs arbitration of an order in which the accelerators execute the first and second requests, controls setting of the management unit by using the one of first and second information based on the arbitration, and causes the accelerators to execute one of the first and second requests based on the arbitration. | 1. A virtualization support device comprising:
a first processor configured to control an operation of a plurality of hardware accelerators; a memory configured to hold first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and an input/output memory management unit coupled to the first processor and the memory, wherein the first processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 2. The virtualization support device of claim 1, wherein the first processor is configured to communicate with the second processor via the memory. 3. The virtualization support device of claim 1, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 4. The virtualization support device of claim 1, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 5. The virtualization support device of claim 1, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 6. The virtualization support device of claim 1, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 7. The virtualization support device of claim 1, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 8. A control method of the virtualization support device, the method comprising:
performing, by a first processor, arbitration of an order in which a plurality of hardware accelerators execute one or more first requests from a first application and one or more second requests from a second application, the one or more first requests and the one or more second requests having been executed by a second processor; referring, by the first processor, to first information related to the first application and second information related to the second application, the first information and the second information being stored in a memory; controlling, by the first processor, setting of an input/output memory management unit between the plurality of hardware accelerators and the memory by using one of the first and second information based on the arbitration; and causing, by the first processor, one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 9. The control method of the virtualization support device of claim 8, wherein the first processor is configured to communicate with the second processor via the memory. 10. The control method of the virtualization support device of claim 8, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred, or a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 11. The control method of the virtualization support device of claim 8, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first request. 12. The control method of the virtualization support device of claim 8, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 13. The control method of the virtualization support device of claim 8, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 14. The control method of the virtualization support device of claim 8, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 15. A calculation system comprising:
a first processor including a first virtual machine for executing a first application and a second virtual machine for executing a second application; a plurality of hardware accelerators configured to each execute a calculation processing based on one or more first requests from the first application and one or more second requests from the second application; a virtualization support device including a second processor, a memory, and an input/output memory management unit, the second processor configured to control operations of the plurality of hardware accelerators, the memory configured to hold first information related to the first application, a second information related to the second application, the one or more first requests, and the one or more second requests, the input/output memory management unit configured to manage communication between the second processor and the memory, wherein the second processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 16. The calculation system of claim 15, wherein the second processor is configured to communicate with the first processor via the memory. 17. The calculation system of claim 15, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the second processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the second processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 18. The calculation system of claim 15, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 19. The calculation system of claim 15, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 20. The calculation system of claim 15, wherein:
the first processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the first processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. | According to one embodiment, a virtualization support device includes: a first processor controlling an operation of accelerators; a memory holding first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and a management unit coupled to the first processor and the memory. The first processor performs arbitration of an order in which the accelerators execute the first and second requests, controls setting of the management unit by using the one of first and second information based on the arbitration, and causes the accelerators to execute one of the first and second requests based on the arbitration.1. A virtualization support device comprising:
a first processor configured to control an operation of a plurality of hardware accelerators; a memory configured to hold first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and an input/output memory management unit coupled to the first processor and the memory, wherein the first processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 2. The virtualization support device of claim 1, wherein the first processor is configured to communicate with the second processor via the memory. 3. The virtualization support device of claim 1, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 4. The virtualization support device of claim 1, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 5. The virtualization support device of claim 1, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 6. The virtualization support device of claim 1, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 7. The virtualization support device of claim 1, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 8. A control method of the virtualization support device, the method comprising:
performing, by a first processor, arbitration of an order in which a plurality of hardware accelerators execute one or more first requests from a first application and one or more second requests from a second application, the one or more first requests and the one or more second requests having been executed by a second processor; referring, by the first processor, to first information related to the first application and second information related to the second application, the first information and the second information being stored in a memory; controlling, by the first processor, setting of an input/output memory management unit between the plurality of hardware accelerators and the memory by using one of the first and second information based on the arbitration; and causing, by the first processor, one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 9. The control method of the virtualization support device of claim 8, wherein the first processor is configured to communicate with the second processor via the memory. 10. The control method of the virtualization support device of claim 8, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred, or a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 11. The control method of the virtualization support device of claim 8, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first request. 12. The control method of the virtualization support device of claim 8, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 13. The control method of the virtualization support device of claim 8, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 14. The control method of the virtualization support device of claim 8, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 15. A calculation system comprising:
a first processor including a first virtual machine for executing a first application and a second virtual machine for executing a second application; a plurality of hardware accelerators configured to each execute a calculation processing based on one or more first requests from the first application and one or more second requests from the second application; a virtualization support device including a second processor, a memory, and an input/output memory management unit, the second processor configured to control operations of the plurality of hardware accelerators, the memory configured to hold first information related to the first application, a second information related to the second application, the one or more first requests, and the one or more second requests, the input/output memory management unit configured to manage communication between the second processor and the memory, wherein the second processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 16. The calculation system of claim 15, wherein the second processor is configured to communicate with the first processor via the memory. 17. The calculation system of claim 15, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the second processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the second processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 18. The calculation system of claim 15, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 19. The calculation system of claim 15, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 20. The calculation system of claim 15, wherein:
the first processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the first processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. | 3,600 |
348,647 | 16,806,123 | 3,661 | According to one embodiment, a virtualization support device includes: a first processor controlling an operation of accelerators; a memory holding first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and a management unit coupled to the first processor and the memory. The first processor performs arbitration of an order in which the accelerators execute the first and second requests, controls setting of the management unit by using the one of first and second information based on the arbitration, and causes the accelerators to execute one of the first and second requests based on the arbitration. | 1. A virtualization support device comprising:
a first processor configured to control an operation of a plurality of hardware accelerators; a memory configured to hold first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and an input/output memory management unit coupled to the first processor and the memory, wherein the first processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 2. The virtualization support device of claim 1, wherein the first processor is configured to communicate with the second processor via the memory. 3. The virtualization support device of claim 1, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 4. The virtualization support device of claim 1, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 5. The virtualization support device of claim 1, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 6. The virtualization support device of claim 1, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 7. The virtualization support device of claim 1, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 8. A control method of the virtualization support device, the method comprising:
performing, by a first processor, arbitration of an order in which a plurality of hardware accelerators execute one or more first requests from a first application and one or more second requests from a second application, the one or more first requests and the one or more second requests having been executed by a second processor; referring, by the first processor, to first information related to the first application and second information related to the second application, the first information and the second information being stored in a memory; controlling, by the first processor, setting of an input/output memory management unit between the plurality of hardware accelerators and the memory by using one of the first and second information based on the arbitration; and causing, by the first processor, one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 9. The control method of the virtualization support device of claim 8, wherein the first processor is configured to communicate with the second processor via the memory. 10. The control method of the virtualization support device of claim 8, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred, or a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 11. The control method of the virtualization support device of claim 8, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first request. 12. The control method of the virtualization support device of claim 8, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 13. The control method of the virtualization support device of claim 8, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 14. The control method of the virtualization support device of claim 8, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 15. A calculation system comprising:
a first processor including a first virtual machine for executing a first application and a second virtual machine for executing a second application; a plurality of hardware accelerators configured to each execute a calculation processing based on one or more first requests from the first application and one or more second requests from the second application; a virtualization support device including a second processor, a memory, and an input/output memory management unit, the second processor configured to control operations of the plurality of hardware accelerators, the memory configured to hold first information related to the first application, a second information related to the second application, the one or more first requests, and the one or more second requests, the input/output memory management unit configured to manage communication between the second processor and the memory, wherein the second processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 16. The calculation system of claim 15, wherein the second processor is configured to communicate with the first processor via the memory. 17. The calculation system of claim 15, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the second processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the second processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 18. The calculation system of claim 15, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 19. The calculation system of claim 15, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 20. The calculation system of claim 15, wherein:
the first processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the first processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. | According to one embodiment, a virtualization support device includes: a first processor controlling an operation of accelerators; a memory holding first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and a management unit coupled to the first processor and the memory. The first processor performs arbitration of an order in which the accelerators execute the first and second requests, controls setting of the management unit by using the one of first and second information based on the arbitration, and causes the accelerators to execute one of the first and second requests based on the arbitration.1. A virtualization support device comprising:
a first processor configured to control an operation of a plurality of hardware accelerators; a memory configured to hold first information regarding a first application executed by a second processor, second information regarding a second application executed by the second processor, one or more first requests from the first application, and one or more second requests from the second application; and an input/output memory management unit coupled to the first processor and the memory, wherein the first processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 2. The virtualization support device of claim 1, wherein the first processor is configured to communicate with the second processor via the memory. 3. The virtualization support device of claim 1, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 4. The virtualization support device of claim 1, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 5. The virtualization support device of claim 1, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 6. The virtualization support device of claim 1, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 7. The virtualization support device of claim 1, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 8. A control method of the virtualization support device, the method comprising:
performing, by a first processor, arbitration of an order in which a plurality of hardware accelerators execute one or more first requests from a first application and one or more second requests from a second application, the one or more first requests and the one or more second requests having been executed by a second processor; referring, by the first processor, to first information related to the first application and second information related to the second application, the first information and the second information being stored in a memory; controlling, by the first processor, setting of an input/output memory management unit between the plurality of hardware accelerators and the memory by using one of the first and second information based on the arbitration; and causing, by the first processor, one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 9. The control method of the virtualization support device of claim 8, wherein the first processor is configured to communicate with the second processor via the memory. 10. The control method of the virtualization support device of claim 8, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the first processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred, or a notification of violation of protection from the input/output memory management unit; and the first processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 11. The control method of the virtualization support device of claim 8, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the first processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first request. 12. The control method of the virtualization support device of claim 8, wherein:
the second processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the second processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. 13. The control method of the virtualization support device of claim 8, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 14. The control method of the virtualization support device of claim 8, wherein the second processor includes a first virtual machine for executing the first application and a second virtual machine for executing the second application. 15. A calculation system comprising:
a first processor including a first virtual machine for executing a first application and a second virtual machine for executing a second application; a plurality of hardware accelerators configured to each execute a calculation processing based on one or more first requests from the first application and one or more second requests from the second application; a virtualization support device including a second processor, a memory, and an input/output memory management unit, the second processor configured to control operations of the plurality of hardware accelerators, the memory configured to hold first information related to the first application, a second information related to the second application, the one or more first requests, and the one or more second requests, the input/output memory management unit configured to manage communication between the second processor and the memory, wherein the second processor is configured to: perform arbitration of an order in which the plurality of hardware accelerators execute the first and second requests from the first and second applications; control setting of the input/output memory management unit by using one of the first and second information based on the arbitration; and cause one or more of the plurality of hardware accelerators to execute one of the first and second requests based on the arbitration. 16. The calculation system of claim 15, wherein the second processor is configured to communicate with the first processor via the memory. 17. The calculation system of claim 15, wherein:
the memory is configured to hold third information and fourth information, the third information indicating error handling of the first application with respect to at least one of an error of the plurality of hardware accelerators and violation of protection detected by the input/output memory management unit, the fourth information indicating error handling of the second application with respect to at least one of the error and the violation of protection; the second processor is configured to receive at least one of a notification of an error from a hardware accelerator in which the error has occurred and a notification of violation of protection from the input/output memory management unit; and the second processor is configured to perform the error handling by using one of the third and fourth information based on the arbitration. 18. The calculation system of claim 15, wherein:
the first application has a first priority, and the second application has a second priority lower than the first priority; the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the first requests based on the arbitration that is performed using the first and second priorities; and the second processor is configured to cause one or more of the plurality of hardware accelerators to execute the second requests after completion of the first requests. 19. The calculation system of claim 15, wherein:
the first information includes at least one of a first page table, first parameter information, and first queue information, the first page table showing a relationship between a first physical address and a first virtual address of a first memory space used for the first application, the first parameter information relating to data to be subjected to processing of the first application, and the first queue information relating to a queue that holds the one or more first requests; and the second information includes at least one of a second page table, second parameter information, and second queue information, the second page table showing a relationship between a second physical address and a second virtual address of a second memory space used for the second application, the second parameter information relating to data to be subjected to processing of the second application, and the second queue information relating to a queue that holds the one or more second requests. 20. The calculation system of claim 15, wherein:
the first processor is configured to perform calculation processing on image data by using the first application and one or more of the plurality of hardware accelerators; and the first processor is configured to perform processing related to displaying of a result of the calculation processing by using the second application and one or more of the plurality of hardware accelerators. | 3,600 |
348,648 | 16,806,148 | 3,661 | In some embodiments, a method may include reducing the microbial load in contaminated water of water recycle loops. These water recycling loops may include pulp and paper mills, cooling towers and water loops, evaporation ponds, feedstock processing systems and/or non-potable water systems. The methods may include providing a peracetate oxidant solution. The peracetate solution may include peracetate anions and a peracid. In some embodiments, the peracetate solution may include a pH from about pH 10 to about pH 12. In some embodiments, the peracetate solution has a molar ratio of peracetate anions to peracid ranging from about 60:1 to about 6000:1. In some embodiments, the peracetate solution has a molar ratio of peracetate to hydrogen peroxide of greater than about 16:1. The peracetate solution may provide bleaching, sanitizing and/or disinfection of contaminated water and surfaces. The peracetate oxidant solution may provide enhanced separation of microbes from contaminated water. | 1. A method of reducing a microbial load in contaminated water, comprising:
contacting contaminated water containing a population of microbes with a peracetate oxidant solution; and mixing said contaminated water with the peracetate oxidant solution. 2. The method of claim 1, further comprising separating the water peracetate oxidant solution mixture into at least microbes and a water phase. 3. The method of claim 1, further comprising heating the contaminated water to within a temperature range from between about 38° C. to about 95° C. 4. The method of claim 2, wherein the contaminated water comprises impurities, and wherein separating the microbes and water phase comprises separating the microbe and water phase into at least microbes, impurities, and water. 5. The method of claim 1, wherein the peracetate oxidant solution comprises peracetate anions and a peracid, wherein the peracetate oxidant solution has a pH from about 7 to about pH 12, and wherein the peracetate oxidant solution has a molar ratio of peracetate anions to peracid ranging from about 60:1 to about 6000:1. 6. The method of claim 5, wherein a peracetate anion to hydrogen peroxide molar ratio is greater than about 16:1. 7. The method of claim 1, wherein the amount of peracetate oxidant solution used is dependent on a severity of contamination, a degree of microbial control desired and a residual oxidant solution necessary for effective microbial control. 8. The method of claim 1, wherein contacting the contaminated water with the peracetate oxidant solution comprises killing at least a majority of the microbial population in the water. 9. The method of claim 1, wherein contacting the contaminated water with the peracetate oxidant solution comprises reducing biofilms and microbial corrosion. 10. The method of claim 1, wherein reducing the microbial load is effective at a pH range from between about pH 7 to about pH 12. 11. The method of claim 1, wherein the population of microbes are selected from the group consisting of bacteria, fungi, molds, yeast and/or algae. 12. The method of claim 1, further comprising sequentially dosing the contaminated water with peracetate oxidant solution until a degree of microbial control desired is reached. 13. The method of claim 12, wherein sequential dosing the contaminated water comprises synergistically effecting microbial control. 14. The method of claim 1, wherein reducing the microbial load comprises preventing bacteria in the contaminated water from becoming anaerobic. 15. The method of claim 14, wherein reducing anaerobic bacteria comprises preventing the formation of sulfides, ammonia, and/or volatile organic acids and reducing a release of volatile materials and/or odor control. 16. The method of claim 1, further comprising adding an alternative oxidant to said water after said contacting with peracetate oxidant solution. 17. The method of claim 16, wherein the alternative oxidant is selected from the group comprising chlorine, chlorine bleach, bromine, iodine and/or fluorine. 18. The method of claim 1, further comprising adding additional peracetate oxidant solution to reduce a bacteria population. 19. The method of claim 1, further comprising measuring an oxidation-reduction potential to monitor and control a peracetate oxidant solution dose level. 20. The method of claim 1, further comprising measuring an oxidation-reduction potential to control the contacting of the peracetate oxidant solution at a level that provides effective microbial control. 21. The method of claim 1, wherein the microbial load is verified by a reduction of microbial activity monitored by ATP, cell culture tests, and/or flow cytometry. 22. The method of claim 1, further comprising measuring corrosion activity rates. 23. The method of claim 22, wherein the corrosion activity rates are lower than alternative oxidants. 24. The method of claim 1, wherein the peracetate oxidant solution is used for reducing bacteria, fungi, molds, yeast and/or algae. 25. The method of claim 1, wherein the contaminated water is selected from the group consisting of non-potable water, pulp and paper processing water, pulp bleaching water, evaporation pond water, feedstock processing water, recirculating and/or non-recirculating cooling water systems. 26. The method of claim 1, wherein contacting contaminated water comprises contacting contaminated water in a pipe, in-line mixing apparatus, mixed tank, blending unit, circulated sump, recirculating water system and/or inlet or outlet of a pump. 27. A method of reducing the microbial load in contaminated water, comprising:
contacting contaminated water containing a population of microbes with an oxidant; contacting the contaminated water containing the population of microbes with a peracetate oxidant solution; and mixing said contaminated water with a peracetate oxidant solution. 28. The method of claim 27, further comprising separating the water peracetate oxidant solution mixture into at least microbes, alternative oxidant and a water phase. 29. A method of bleaching, sanitizing and/or disinfecting a surface comprising contacting a surface with a peracetate oxidant solution. 30. A method of reducing the microbial load in a slurry comprising:
contacting a slurry containing a population of microbes with a peracetate oxidant solution; and mixing said slurry with the peracetate oxidant solution. 31. The method of claim 30, further comprising separating the slurry peracetate oxidant solution mixture into at least microbes, and a water phase. 32. The method of claim 30, further comprising heating the slurry to within a temperature range from about 38° C. to about 95° C. | In some embodiments, a method may include reducing the microbial load in contaminated water of water recycle loops. These water recycling loops may include pulp and paper mills, cooling towers and water loops, evaporation ponds, feedstock processing systems and/or non-potable water systems. The methods may include providing a peracetate oxidant solution. The peracetate solution may include peracetate anions and a peracid. In some embodiments, the peracetate solution may include a pH from about pH 10 to about pH 12. In some embodiments, the peracetate solution has a molar ratio of peracetate anions to peracid ranging from about 60:1 to about 6000:1. In some embodiments, the peracetate solution has a molar ratio of peracetate to hydrogen peroxide of greater than about 16:1. The peracetate solution may provide bleaching, sanitizing and/or disinfection of contaminated water and surfaces. The peracetate oxidant solution may provide enhanced separation of microbes from contaminated water.1. A method of reducing a microbial load in contaminated water, comprising:
contacting contaminated water containing a population of microbes with a peracetate oxidant solution; and mixing said contaminated water with the peracetate oxidant solution. 2. The method of claim 1, further comprising separating the water peracetate oxidant solution mixture into at least microbes and a water phase. 3. The method of claim 1, further comprising heating the contaminated water to within a temperature range from between about 38° C. to about 95° C. 4. The method of claim 2, wherein the contaminated water comprises impurities, and wherein separating the microbes and water phase comprises separating the microbe and water phase into at least microbes, impurities, and water. 5. The method of claim 1, wherein the peracetate oxidant solution comprises peracetate anions and a peracid, wherein the peracetate oxidant solution has a pH from about 7 to about pH 12, and wherein the peracetate oxidant solution has a molar ratio of peracetate anions to peracid ranging from about 60:1 to about 6000:1. 6. The method of claim 5, wherein a peracetate anion to hydrogen peroxide molar ratio is greater than about 16:1. 7. The method of claim 1, wherein the amount of peracetate oxidant solution used is dependent on a severity of contamination, a degree of microbial control desired and a residual oxidant solution necessary for effective microbial control. 8. The method of claim 1, wherein contacting the contaminated water with the peracetate oxidant solution comprises killing at least a majority of the microbial population in the water. 9. The method of claim 1, wherein contacting the contaminated water with the peracetate oxidant solution comprises reducing biofilms and microbial corrosion. 10. The method of claim 1, wherein reducing the microbial load is effective at a pH range from between about pH 7 to about pH 12. 11. The method of claim 1, wherein the population of microbes are selected from the group consisting of bacteria, fungi, molds, yeast and/or algae. 12. The method of claim 1, further comprising sequentially dosing the contaminated water with peracetate oxidant solution until a degree of microbial control desired is reached. 13. The method of claim 12, wherein sequential dosing the contaminated water comprises synergistically effecting microbial control. 14. The method of claim 1, wherein reducing the microbial load comprises preventing bacteria in the contaminated water from becoming anaerobic. 15. The method of claim 14, wherein reducing anaerobic bacteria comprises preventing the formation of sulfides, ammonia, and/or volatile organic acids and reducing a release of volatile materials and/or odor control. 16. The method of claim 1, further comprising adding an alternative oxidant to said water after said contacting with peracetate oxidant solution. 17. The method of claim 16, wherein the alternative oxidant is selected from the group comprising chlorine, chlorine bleach, bromine, iodine and/or fluorine. 18. The method of claim 1, further comprising adding additional peracetate oxidant solution to reduce a bacteria population. 19. The method of claim 1, further comprising measuring an oxidation-reduction potential to monitor and control a peracetate oxidant solution dose level. 20. The method of claim 1, further comprising measuring an oxidation-reduction potential to control the contacting of the peracetate oxidant solution at a level that provides effective microbial control. 21. The method of claim 1, wherein the microbial load is verified by a reduction of microbial activity monitored by ATP, cell culture tests, and/or flow cytometry. 22. The method of claim 1, further comprising measuring corrosion activity rates. 23. The method of claim 22, wherein the corrosion activity rates are lower than alternative oxidants. 24. The method of claim 1, wherein the peracetate oxidant solution is used for reducing bacteria, fungi, molds, yeast and/or algae. 25. The method of claim 1, wherein the contaminated water is selected from the group consisting of non-potable water, pulp and paper processing water, pulp bleaching water, evaporation pond water, feedstock processing water, recirculating and/or non-recirculating cooling water systems. 26. The method of claim 1, wherein contacting contaminated water comprises contacting contaminated water in a pipe, in-line mixing apparatus, mixed tank, blending unit, circulated sump, recirculating water system and/or inlet or outlet of a pump. 27. A method of reducing the microbial load in contaminated water, comprising:
contacting contaminated water containing a population of microbes with an oxidant; contacting the contaminated water containing the population of microbes with a peracetate oxidant solution; and mixing said contaminated water with a peracetate oxidant solution. 28. The method of claim 27, further comprising separating the water peracetate oxidant solution mixture into at least microbes, alternative oxidant and a water phase. 29. A method of bleaching, sanitizing and/or disinfecting a surface comprising contacting a surface with a peracetate oxidant solution. 30. A method of reducing the microbial load in a slurry comprising:
contacting a slurry containing a population of microbes with a peracetate oxidant solution; and mixing said slurry with the peracetate oxidant solution. 31. The method of claim 30, further comprising separating the slurry peracetate oxidant solution mixture into at least microbes, and a water phase. 32. The method of claim 30, further comprising heating the slurry to within a temperature range from about 38° C. to about 95° C. | 3,600 |
348,649 | 16,806,179 | 3,661 | An information processing apparatus which is capable of reducing the risk of storage device failure. The information processing apparatus is equipped with a storage device that can be accessed a limited number of times. A control unit performs control to write data into the storage device. The control unit determines whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. | 1. An information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control unit configured to perform control to write data into the storage device, wherein the control unit determines whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. 2. The information processing apparatus according to claim 1, wherein in a case where the information processing apparatus is performing a predetermined operation relating to a process that requires writing into the storage device as a prerequisite, the control unit allows writing into the storage device, and in a case where the information processing apparatus is not performing the predetermined operation, the control unit prohibits writing into the storage device. 3. The information processing apparatus according to claim 2, further comprising another storage device that is different from the storage device,
wherein in a case where the information processing apparatus is not performing the predetermined operation, the control unit performs control to write actual data, writing of which into the storage device has been ordered, into the other storage device. 4. The information processing apparatus according to claim 3, wherein in a case where the information processing apparatus is performing the predetermined operation, and the actual data is stored in the other storage device, the control unit performs control to sequentially write all of the actual data stored in the other storage device into the storage device. 5. The information processing apparatus according to claim 1, further comprising:
a holding unit; and a setting unit configured to set a holding time period for which data is held in the holding unit, wherein after holding data in the holding unit for the holding time period, the control unit performs control to write the data into the storage device, wherein in a case where the information processing apparatus is performing a predetermined operation relating to a process that requires writing into the storage device as a prerequisite, a first time period is set as the holding time period, and in a case where the information processing apparatus is not performing the predetermined operation, a second time period longer than the first time period is set as the holding time period. 6. The information processing apparatus according to claim 2, wherein the predetermined operation includes an operation relating to execution of a job. 7. The information processing apparatus according to claim 2, wherein the predetermined operation includes an operation relating to transition of a power supply state of the information processing apparatus. 8. The information processing apparatus according to claim 1, wherein the information processing apparatus is an image forming apparatus that carries out an image forming process. 9. A control method for an information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control step of performing control to write data into the storage device, the control step comprises determining whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. 10. A non-transitory computer-readable storage medium storing a program for causing a computer to execute a control method for an information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control step of performing control to write data into the storage device, the control step comprises determining whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. | An information processing apparatus which is capable of reducing the risk of storage device failure. The information processing apparatus is equipped with a storage device that can be accessed a limited number of times. A control unit performs control to write data into the storage device. The control unit determines whether or not to allow writing into the storage device based on an operating state of the information processing apparatus.1. An information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control unit configured to perform control to write data into the storage device, wherein the control unit determines whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. 2. The information processing apparatus according to claim 1, wherein in a case where the information processing apparatus is performing a predetermined operation relating to a process that requires writing into the storage device as a prerequisite, the control unit allows writing into the storage device, and in a case where the information processing apparatus is not performing the predetermined operation, the control unit prohibits writing into the storage device. 3. The information processing apparatus according to claim 2, further comprising another storage device that is different from the storage device,
wherein in a case where the information processing apparatus is not performing the predetermined operation, the control unit performs control to write actual data, writing of which into the storage device has been ordered, into the other storage device. 4. The information processing apparatus according to claim 3, wherein in a case where the information processing apparatus is performing the predetermined operation, and the actual data is stored in the other storage device, the control unit performs control to sequentially write all of the actual data stored in the other storage device into the storage device. 5. The information processing apparatus according to claim 1, further comprising:
a holding unit; and a setting unit configured to set a holding time period for which data is held in the holding unit, wherein after holding data in the holding unit for the holding time period, the control unit performs control to write the data into the storage device, wherein in a case where the information processing apparatus is performing a predetermined operation relating to a process that requires writing into the storage device as a prerequisite, a first time period is set as the holding time period, and in a case where the information processing apparatus is not performing the predetermined operation, a second time period longer than the first time period is set as the holding time period. 6. The information processing apparatus according to claim 2, wherein the predetermined operation includes an operation relating to execution of a job. 7. The information processing apparatus according to claim 2, wherein the predetermined operation includes an operation relating to transition of a power supply state of the information processing apparatus. 8. The information processing apparatus according to claim 1, wherein the information processing apparatus is an image forming apparatus that carries out an image forming process. 9. A control method for an information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control step of performing control to write data into the storage device, the control step comprises determining whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. 10. A non-transitory computer-readable storage medium storing a program for causing a computer to execute a control method for an information processing apparatus equipped with a storage device that can be accessed a limited number of times, comprising:
a control step of performing control to write data into the storage device, the control step comprises determining whether or not to allow writing into the storage device based on an operating state of the information processing apparatus. | 3,600 |
348,650 | 16,806,168 | 3,661 | A gas turbine engine according to an example of the present disclosure include a compressor section, a combustor, and a turbine section. The combustor has a radially outer surface that defines a diffuser chamber radially outwardly of the combustor. The turbine section has a high pressure turbine first stage blade that has an outer tip, and a blade outer air seal positioned radially outwardly of the outer tip. A tap for tapping air has been compressed by the compressor and is passed through a heat exchanger. The air downstream of the heat exchanger passes through at least one pipe and into a manifold radially outward of the blade outer air seal, and then passes across the blade outer air seal to cool the blade outer air seal. | 1. A gas turbine engine comprising:
a compressor section, a combustor, and a turbine section, said combustor having a radially outer surface defining a diffuser chamber radially outwardly of said combustor; said turbine section including a high pressure turbine first stage blade having an outer tip, and a blade outer air seal positioned radially outwardly of said outer tip; a tap for tapping air having been compressed by said compressor and being passed through a heat exchanger; and said air downstream of said heat exchanger passing through a plurality of pipes and into a manifold radially outward of said blade outer air seal, and then passing across said blade outer air seal to cool said blade outer air seal. 2. The gas turbine engine as set forth in claim 1, wherein said air downstream of said heat exchanger passes into a mixing chamber and is mixed with higher temperature air from a diffuser chamber outwardly of said combustor, and mixed and passes to cool a first stage blade row in a high pressure turbine. 3. The gas turbine engine as set forth in claim 2, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 4. The gas turbine engine as set forth in claim 3, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 5. The gas turbine engine as set forth in claim 3, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 6. The gas turbine engine as set forth in claim 5, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 7. The gas turbine engine as set forth in claim 5, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 8. The gas turbine engine as set forth in claim 7, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 9. The gas turbine engine as set forth in claim 7, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 10. The gas turbine engine as set forth in claim 7, wherein said cooling air is tapped from a location downstream of a downstream most location in a high pressure compressor. 11. The gas turbine engine as set forth in claim 7, wherein said air is tapped from a location upstream of a downstream most location in said compressor section. 12. The gas turbine engine as set forth in claim 2, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 13. The gas turbine engine as set forth in claim 11, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 14. The gas turbine engine as set forth in claim 13, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 15. The gas turbine engine as set forth in claim 14, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 16. The gas turbine engine as set forth in claim 15, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 17. The gas turbine engine as set forth in claim 16, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 18. The gas turbine engine as set forth in claim 2, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 19. The gas turbine engine as set forth in claim 1, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 20. The gas turbine engine as set forth in claim 19, wherein a valve controls the air passing across said blade outer air seal, and allows control of at least one of an amount, a pressure or a temperature of the air being delivered to the blade outer air seal. | A gas turbine engine according to an example of the present disclosure include a compressor section, a combustor, and a turbine section. The combustor has a radially outer surface that defines a diffuser chamber radially outwardly of the combustor. The turbine section has a high pressure turbine first stage blade that has an outer tip, and a blade outer air seal positioned radially outwardly of the outer tip. A tap for tapping air has been compressed by the compressor and is passed through a heat exchanger. The air downstream of the heat exchanger passes through at least one pipe and into a manifold radially outward of the blade outer air seal, and then passes across the blade outer air seal to cool the blade outer air seal.1. A gas turbine engine comprising:
a compressor section, a combustor, and a turbine section, said combustor having a radially outer surface defining a diffuser chamber radially outwardly of said combustor; said turbine section including a high pressure turbine first stage blade having an outer tip, and a blade outer air seal positioned radially outwardly of said outer tip; a tap for tapping air having been compressed by said compressor and being passed through a heat exchanger; and said air downstream of said heat exchanger passing through a plurality of pipes and into a manifold radially outward of said blade outer air seal, and then passing across said blade outer air seal to cool said blade outer air seal. 2. The gas turbine engine as set forth in claim 1, wherein said air downstream of said heat exchanger passes into a mixing chamber and is mixed with higher temperature air from a diffuser chamber outwardly of said combustor, and mixed and passes to cool a first stage blade row in a high pressure turbine. 3. The gas turbine engine as set forth in claim 2, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 4. The gas turbine engine as set forth in claim 3, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 5. The gas turbine engine as set forth in claim 3, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 6. The gas turbine engine as set forth in claim 5, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 7. The gas turbine engine as set forth in claim 5, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 8. The gas turbine engine as set forth in claim 7, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 9. The gas turbine engine as set forth in claim 7, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 10. The gas turbine engine as set forth in claim 7, wherein said cooling air is tapped from a location downstream of a downstream most location in a high pressure compressor. 11. The gas turbine engine as set forth in claim 7, wherein said air is tapped from a location upstream of a downstream most location in said compressor section. 12. The gas turbine engine as set forth in claim 2, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 13. The gas turbine engine as set forth in claim 11, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 14. The gas turbine engine as set forth in claim 13, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 15. The gas turbine engine as set forth in claim 14, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 16. The gas turbine engine as set forth in claim 15, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 17. The gas turbine engine as set forth in claim 16, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 18. The gas turbine engine as set forth in claim 2, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 19. The gas turbine engine as set forth in claim 1, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 20. The gas turbine engine as set forth in claim 19, wherein a valve controls the air passing across said blade outer air seal, and allows control of at least one of an amount, a pressure or a temperature of the air being delivered to the blade outer air seal. | 3,600 |
348,651 | 16,806,170 | 3,661 | A gas turbine engine according to an example of the present disclosure include a compressor section, a combustor, and a turbine section. The combustor has a radially outer surface that defines a diffuser chamber radially outwardly of the combustor. The turbine section has a high pressure turbine first stage blade that has an outer tip, and a blade outer air seal positioned radially outwardly of the outer tip. A tap for tapping air has been compressed by the compressor and is passed through a heat exchanger. The air downstream of the heat exchanger passes through at least one pipe and into a manifold radially outward of the blade outer air seal, and then passes across the blade outer air seal to cool the blade outer air seal. | 1. A gas turbine engine comprising:
a compressor section, a combustor, and a turbine section, said combustor having a radially outer surface defining a diffuser chamber radially outwardly of said combustor; said turbine section including a high pressure turbine first stage blade having an outer tip, and a blade outer air seal positioned radially outwardly of said outer tip; a tap for tapping air having been compressed by said compressor and being passed through a heat exchanger; and said air downstream of said heat exchanger passing through a plurality of pipes and into a manifold radially outward of said blade outer air seal, and then passing across said blade outer air seal to cool said blade outer air seal. 2. The gas turbine engine as set forth in claim 1, wherein said air downstream of said heat exchanger passes into a mixing chamber and is mixed with higher temperature air from a diffuser chamber outwardly of said combustor, and mixed and passes to cool a first stage blade row in a high pressure turbine. 3. The gas turbine engine as set forth in claim 2, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 4. The gas turbine engine as set forth in claim 3, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 5. The gas turbine engine as set forth in claim 3, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 6. The gas turbine engine as set forth in claim 5, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 7. The gas turbine engine as set forth in claim 5, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 8. The gas turbine engine as set forth in claim 7, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 9. The gas turbine engine as set forth in claim 7, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 10. The gas turbine engine as set forth in claim 7, wherein said cooling air is tapped from a location downstream of a downstream most location in a high pressure compressor. 11. The gas turbine engine as set forth in claim 7, wherein said air is tapped from a location upstream of a downstream most location in said compressor section. 12. The gas turbine engine as set forth in claim 2, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 13. The gas turbine engine as set forth in claim 11, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 14. The gas turbine engine as set forth in claim 13, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 15. The gas turbine engine as set forth in claim 14, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 16. The gas turbine engine as set forth in claim 15, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 17. The gas turbine engine as set forth in claim 16, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 18. The gas turbine engine as set forth in claim 2, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 19. The gas turbine engine as set forth in claim 1, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 20. The gas turbine engine as set forth in claim 19, wherein a valve controls the air passing across said blade outer air seal, and allows control of at least one of an amount, a pressure or a temperature of the air being delivered to the blade outer air seal. | A gas turbine engine according to an example of the present disclosure include a compressor section, a combustor, and a turbine section. The combustor has a radially outer surface that defines a diffuser chamber radially outwardly of the combustor. The turbine section has a high pressure turbine first stage blade that has an outer tip, and a blade outer air seal positioned radially outwardly of the outer tip. A tap for tapping air has been compressed by the compressor and is passed through a heat exchanger. The air downstream of the heat exchanger passes through at least one pipe and into a manifold radially outward of the blade outer air seal, and then passes across the blade outer air seal to cool the blade outer air seal.1. A gas turbine engine comprising:
a compressor section, a combustor, and a turbine section, said combustor having a radially outer surface defining a diffuser chamber radially outwardly of said combustor; said turbine section including a high pressure turbine first stage blade having an outer tip, and a blade outer air seal positioned radially outwardly of said outer tip; a tap for tapping air having been compressed by said compressor and being passed through a heat exchanger; and said air downstream of said heat exchanger passing through a plurality of pipes and into a manifold radially outward of said blade outer air seal, and then passing across said blade outer air seal to cool said blade outer air seal. 2. The gas turbine engine as set forth in claim 1, wherein said air downstream of said heat exchanger passes into a mixing chamber and is mixed with higher temperature air from a diffuser chamber outwardly of said combustor, and mixed and passes to cool a first stage blade row in a high pressure turbine. 3. The gas turbine engine as set forth in claim 2, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 4. The gas turbine engine as set forth in claim 3, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 5. The gas turbine engine as set forth in claim 3, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 6. The gas turbine engine as set forth in claim 5, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 7. The gas turbine engine as set forth in claim 5, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 8. The gas turbine engine as set forth in claim 7, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 9. The gas turbine engine as set forth in claim 7, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 10. The gas turbine engine as set forth in claim 7, wherein said cooling air is tapped from a location downstream of a downstream most location in a high pressure compressor. 11. The gas turbine engine as set forth in claim 7, wherein said air is tapped from a location upstream of a downstream most location in said compressor section. 12. The gas turbine engine as set forth in claim 2, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 13. The gas turbine engine as set forth in claim 11, wherein said compressor diffuser chamber has an outer boundary defined by an outer core housing and said pipes are radially outward of said outer core housing. 14. The gas turbine engine as set forth in claim 13, wherein said pipes communicate with the supply of cooled high pressure air at a location upstream of said mixing chamber such that air delivered to said manifold does not include hot air from said diffuser chamber. 15. The gas turbine engine as set forth in claim 14, wherein said manifold is also outwardly of said outer core housing and communicates with passages passing through said outer core housing to said blade outer air seal. 16. The gas turbine engine as set forth in claim 15, wherein said passages passing through said housing extend to a radially outer surface of said blade outer air seal and flow in both upstream and downstream locations around said blade outer air seal. 17. The gas turbine engine as set forth in claim 16, wherein said air flowing upstream of said blade outer air seal being routed through holes in a seal portion of said blade outer air seal to cool adjacent a leading edge of said blade outer air seal and the air passing downstream of said blade outer air seal passing through holes in said seal portion of said blade outer air seal to cool adjacent a trailing edge of said blade outer air seal. 18. The gas turbine engine as set forth in claim 2, wherein said mixing chamber is radially outward of a compressor diffuser defined downstream of a downstream most location in a high pressure compressor section and said air from said mixing chamber passing through vanes in said compressor diffuser. 19. The gas turbine engine as set forth in claim 1, wherein said blade outer air seal includes at least two components having different thermal coefficients of expansion to provide clearance control between an outer periphery of said blades and an inner periphery of said seal portion. 20. The gas turbine engine as set forth in claim 19, wherein a valve controls the air passing across said blade outer air seal, and allows control of at least one of an amount, a pressure or a temperature of the air being delivered to the blade outer air seal. | 3,600 |
348,652 | 16,806,164 | 3,661 | An introducer apparatus includes an outer sleeve and an inner cannula received within the lumen of the outer sleeve. The outer sleeve has a profile such that at least a portion of the distal end of the outer sleeve tapers in the distal direction at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus. The distal open end of the outer sleeve has a wall thickness not exceeding about 0.003 inch. The inner cannula includes a tapered distal end portion. The tapered distal portion of the inner cannula extends distal to the distal open end of the outer sleeve, such that a generally smooth diametrical transition is provided between the outer sleeve tapered portion and the open distal end of the inner cannula. | 1-20. (canceled) 21. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness not exceeding about 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter from about 4-6 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 22. The introducer apparatus of claim 21, wherein the outer sleeve has a diameter from about 4-5 French. 23. The introducer apparatus of claim 21, wherein the outer sleeve tapered portion comprises between the about distal 8 and 20 mm of the outer sleeve. 24. The introducer apparatus of claim 22, wherein the outer sleeve tapered portion comprises between the distal about 8 and 20 mm of the outer sleeve. 25. The introducer apparatus of claim 24, wherein the outer sleeve tapered portion comprises the distal about 15 mm of the outer sleeve. 26. The introducer apparatus of claim 21, wherein the outer sleeve tapered portion is tapered at an angle between about 1° and 1.5°. 27. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness not exceeding about 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter of between about 2-10 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 28. The introducer apparatus of claim 27, wherein the outer sleeve has an outer diameter of about 4-6 French. 29. The introducer apparatus of claim 27, wherein the outer sleeve tapered portion comprises between the distal about 8-20 mm of the outer sleeve. 30. The introducer apparatus of claim 27, wherein the outer sleeve tapered portion is tapered at an angle of between about 0.5° and 2°. 31. The introducer apparatus of claim 30, wherein the outer sleeve tapered portion comprises between the distal about 8-20 mm of the outer sleeve. 33. The introducer apparatus of claim 27, wherein the distal open end of the outer sleeve has a wall thickness of between about 0.0005 and 0.0015 inches. 34. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness between about 0.0005 and 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter between about 2-10 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 35. The introducer apparatus of claim 34, wherein the outer sleeve tapered portion is tapered at an angle of between about 0.5° and 2°. 36. The introducer apparatus of claim 34, wherein the outer sleeve has an outer diameter between about 4-6 French. 37. The introducer apparatus of claim 34, wherein the distal open end of the outer sleeve has a wall thickness of between about 0.0005 and 0.0015 inch. 38. The introducer apparatus of claim 34, wherein the outer sleeve tapered portion comprises between the distal about 8 and 20 mm of the outer sleeve. 39. The introducer apparatus of claim 38, wherein the outer sleeve tapered portion comprises the distal about 15 mm of the outer sleeve. | An introducer apparatus includes an outer sleeve and an inner cannula received within the lumen of the outer sleeve. The outer sleeve has a profile such that at least a portion of the distal end of the outer sleeve tapers in the distal direction at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus. The distal open end of the outer sleeve has a wall thickness not exceeding about 0.003 inch. The inner cannula includes a tapered distal end portion. The tapered distal portion of the inner cannula extends distal to the distal open end of the outer sleeve, such that a generally smooth diametrical transition is provided between the outer sleeve tapered portion and the open distal end of the inner cannula.1-20. (canceled) 21. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness not exceeding about 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter from about 4-6 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 22. The introducer apparatus of claim 21, wherein the outer sleeve has a diameter from about 4-5 French. 23. The introducer apparatus of claim 21, wherein the outer sleeve tapered portion comprises between the about distal 8 and 20 mm of the outer sleeve. 24. The introducer apparatus of claim 22, wherein the outer sleeve tapered portion comprises between the distal about 8 and 20 mm of the outer sleeve. 25. The introducer apparatus of claim 24, wherein the outer sleeve tapered portion comprises the distal about 15 mm of the outer sleeve. 26. The introducer apparatus of claim 21, wherein the outer sleeve tapered portion is tapered at an angle between about 1° and 1.5°. 27. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness not exceeding about 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter of between about 2-10 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 28. The introducer apparatus of claim 27, wherein the outer sleeve has an outer diameter of about 4-6 French. 29. The introducer apparatus of claim 27, wherein the outer sleeve tapered portion comprises between the distal about 8-20 mm of the outer sleeve. 30. The introducer apparatus of claim 27, wherein the outer sleeve tapered portion is tapered at an angle of between about 0.5° and 2°. 31. The introducer apparatus of claim 30, wherein the outer sleeve tapered portion comprises between the distal about 8-20 mm of the outer sleeve. 33. The introducer apparatus of claim 27, wherein the distal open end of the outer sleeve has a wall thickness of between about 0.0005 and 0.0015 inches. 34. An introducer apparatus, comprising:
an outer sleeve having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the outer sleeve having a profile such that at least a portion of the outer sleeve tapers toward the outer sleeve distal end at an angle not exceeding about 2° relative to a longitudinal axis of the apparatus, the distal open end of the outer sleeve having a wall thickness between about 0.0005 and 0.003 inch; and an inner cannula having proximal and distal open ends, and having a lumen extending longitudinally therethrough, the inner cannula sized to be received within the lumen of the outer sleeve, the inner cannula having a portion that tapers toward the inner cannula distal end, the tapered distal portion of the inner cannula extending distal to the distal open end of the outer sleeve and having a profile such that a generally smooth and gradual diametrical transition is provided from the outer sleeve tapered portion and through the inner cannula open end; wherein the outer sleeve tapered portion comprises between the distal about 5 and 50 mm of the outer sleeve; wherein the outer sleeve has an outer diameter between about 2-10 French; and wherein the greatest radial extent of the inner cannula is not greater than the inner diameter of the outer sleeve. 35. The introducer apparatus of claim 34, wherein the outer sleeve tapered portion is tapered at an angle of between about 0.5° and 2°. 36. The introducer apparatus of claim 34, wherein the outer sleeve has an outer diameter between about 4-6 French. 37. The introducer apparatus of claim 34, wherein the distal open end of the outer sleeve has a wall thickness of between about 0.0005 and 0.0015 inch. 38. The introducer apparatus of claim 34, wherein the outer sleeve tapered portion comprises between the distal about 8 and 20 mm of the outer sleeve. 39. The introducer apparatus of claim 38, wherein the outer sleeve tapered portion comprises the distal about 15 mm of the outer sleeve. | 3,600 |
348,653 | 16,806,139 | 3,661 | In one or more embodiments, one or more system, methods, and/or processes may determine, based at least on the user responses from users that listen to audio files, first portions of the audio files that include at least one audio glitch and second portions of the audio files that do not include the at least one audio glitch; may determine values of a filter, of a convolution neural network (CNN), based at least on the first portions and the second portions of the audio files; may provide audio produced by an information handling system (IHS) to the CNN; may determine, based at least on data from convolving the audio produced by the IHS with the filter and output data from the CNN, if the IHS has produced an audio glitch; and may provide information indicating whether or not the IHS has produced the audio glitch. | 1. A system, comprising:
at least one processor; and a memory medium, coupled to the at least one processor, that stores instructions executable by the at least one processor, which when executed by the at least one processor, cause the system to:
provide, to a plurality of users, a plurality of audio files, wherein at least a first audio file of the plurality of audio files includes at least one audio glitch and at least a second of audio file of the plurality of audio files does not include any audio glitch;
receive a plurality of user responses from the plurality of users that listen to the plurality of audio files;
determine, based at least on the plurality of user responses, a first plurality of portions of the plurality of audio files that include at least one audio glitch;
determine, based at least on the plurality of user responses, a second plurality of portions of the plurality of audio files that do not include the at least one audio glitch;
initialize values of a filter of a convolution neural network for detecting at least one pattern associated with the at least one audio glitch;
determine values of the filter based at least on the first plurality of portions of the plurality of audio files that include the at least one audio glitch and the second plurality of portions of the plurality of audio files;
receive audio produced by an information handling system;
provide the audio produced by the information handling system to the convolution neural network;
convolve the audio produced by the information handling system with the filter;
determine, based at least on data from convolving the audio produced by the information handling system with the filter and output data from the convolution neural network, if the information handling system has produced one or more audio glitches;
if the information handling system has produced one or more audio glitches, provide information indicating that the information handling system has produced the one or more audio glitches; and
if the information handling system has not produced one or more audio glitches, provide information indicating that the information handling system has not produced the one or more audio glitches. 2. The system of claim 1,
wherein the instructions further cause the system to perform a pooling operation on the data from convolving the audio produced by the information handling system with the filter; and wherein, to determine, based at least on the data from convolving the audio produced by the information handling system with the filter and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches, the instructions further cause the system to determine, based at least on output data form the pooling operation and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches. 3. The system of claim 2, wherein the pooling operation includes a max pooling operation, a min pooling operation, or an average pooling operation. 4. The system of claim 1,
wherein the instructions further cause the system to determine one or more of weights and biases of the convolution neural network; and wherein the output data from the convolution neural network is based at least on the one or more of weights and biases of the convolution neural network. 5. The system of claim 4, wherein, to determine the one or more of weights and biases of the convolution neural network, the instructions further cause the system to determine the one or more of weights and biases of the convolution neural network via a gradient descent process or a backwards propagation process. 6. The system of claim 1, wherein the filter is configured to determine the at least one pattern that includes a change in magnitude of sound that is above a threshold in a period of time, which indicates at least one of the one or more audio glitches. 7. The system of claim 1,
wherein the at least one audio glitch includes a first audio glitch; and wherein, to determine if the information handling system has produced the one or more audio glitches, the instructions further cause the system to determine, via the convolution neural network, that the audio produced by the information handling system includes a second audio glitch, different from the first audio glitch. 8. A method, comprising:
providing, to a plurality of users, a plurality of audio files, wherein at least a first audio file of the plurality of audio files includes at least one audio glitch and at least a second of audio file of the plurality of audio files does not include any audio glitch; receiving a plurality of user responses from the plurality of users that listen to the plurality of audio files; determining, based at least on the plurality of user responses, a first plurality of portions of the plurality of audio files that include at least one audio glitch; determining, based at least on the plurality of user responses, a second plurality of portions of the plurality of audio files that do not include the at least one audio glitch; initializing values of a filter of a convolution neural network for detecting at least one pattern associated with the at least one audio glitch; determining values of the filter based at least on the first plurality of portions of the plurality of audio files that include the at least one audio glitch and the second plurality of portions of the plurality of audio files; receiving audio produced by an information handling system; providing the audio produced by the information handling system to the convolution neural network; convolving the audio produced by the information handling system with the filter; determining, based at least on data from convolving the audio produced by the information handling system with the filter and output data from the convolution neural network, if the information handling system has produced one or more audio glitches; if the information handling system has produced one or more audio glitches, providing information indicating that the information handling system has produced the one or more audio glitches; and if the information handling system has not produced one or more audio glitches, providing information indicating that the information handling system has not produced the one or more audio glitches. 9. The method of claim 8, further comprising:
performing a pooling operation on the data from convolving the audio produced by the information handling system with the filter; wherein the determining, based at least on the data from convolving the audio produced by the information handling system with the filter and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches includes determining, based at least on output data form the pooling operation and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches. 10. The method of claim 9, wherein the pooling operation includes a max pooling operation, a min pooling operation, or an average pooling operation. 11. The method of claim 8, further comprising:
determining one or more of weights and biases of the convolution neural network; wherein the output data from the convolution neural network is based at least on the one or more of weights and biases of the convolution neural network. 12. The method of claim 11, wherein the determining the one or more of weights and biases of the convolution neural network includes determining the one or more of weights and biases of the convolution neural network via a gradient descent process or a backwards propagation process. 13. The method of claim 8, wherein the filter is configured to determine the at least one pattern that includes a change in magnitude of sound that is above a threshold in a period of time, which indicates at least one of the one or more audio glitches. 14. The method of claim 8,
wherein the at least one audio glitch includes a first audio glitch; and wherein the determining if the information handling system has produced the one or more audio glitches includes determining, via the convolution neural network, that the audio produced by the information handling system includes a second audio glitch, different from the first audio glitch. 15. An information handling system, comprising:
at least one processor; and a memory medium, coupled to the at least one processor, that stores instructions executable by the at least one processor, which when executed by the at least one processor, cause the information handling system to:
produce audio output;
provide the audio output to a convolution neural network, stored by the memory medium, trained to determine if the information handling system has produced one or more audio glitches;
convolve the audio output with a first filter of the convolution neural network to produce first convolved audio output data;
provide data based at least on the first convolved audio output data to a fully connected neural network of the convolution neural network;
determine, based at least on output from the fully connected neural network, if the information handling system produces the one or more audio glitches;
if the information handling system has produced one or more audio glitches, provide information indicating that the information handling system has produced the one or more audio glitches; and
if the information handling system has not produced one or more audio glitches, provide information indicating that the information handling system has not produced the one or more audio glitches. 16. The information handling system of claim 15,
wherein the instructions further cause the information handling system to perform a max pooling operation on the first convolved audio output data; and wherein, to provide the data based at least on the first convolved audio output data to the fully connected neural network of the convolution neural network, the instructions further cause the information handling system to provide data from the max pooling operation to the fully connected neural network of the convolution neural network. 17. The information handling system of claim 15, wherein the filter is configured to determine that a change in magnitude of sounds is above a threshold in a period of time. 18. The information handling system of claim 15, wherein, to determine, based at least on output from the fully connected neural network, if the information handling system has produced one or more audio glitches, the instructions further cause the information handling system to determine if an output value of the fully connected neural network is at or above a threshold value. 19. The information handling system of claim 15,
wherein the instructions further cause the information handling system to:
perform a first pooling operation on the first convolved audio output data; and
convolve output from the first pooling operation with a second filter to produce second convolved output data; and
wherein the data based at least on the first convolved audio output data is further based on the second convolved output data. 20. The information handling system of claim 19,
wherein the instructions further cause the information handling system to:
perform a second pooling operation on the second convolved output data; and
wherein the data based at least on the first convolved audio output data is further based on output from the second pooling operation. | In one or more embodiments, one or more system, methods, and/or processes may determine, based at least on the user responses from users that listen to audio files, first portions of the audio files that include at least one audio glitch and second portions of the audio files that do not include the at least one audio glitch; may determine values of a filter, of a convolution neural network (CNN), based at least on the first portions and the second portions of the audio files; may provide audio produced by an information handling system (IHS) to the CNN; may determine, based at least on data from convolving the audio produced by the IHS with the filter and output data from the CNN, if the IHS has produced an audio glitch; and may provide information indicating whether or not the IHS has produced the audio glitch.1. A system, comprising:
at least one processor; and a memory medium, coupled to the at least one processor, that stores instructions executable by the at least one processor, which when executed by the at least one processor, cause the system to:
provide, to a plurality of users, a plurality of audio files, wherein at least a first audio file of the plurality of audio files includes at least one audio glitch and at least a second of audio file of the plurality of audio files does not include any audio glitch;
receive a plurality of user responses from the plurality of users that listen to the plurality of audio files;
determine, based at least on the plurality of user responses, a first plurality of portions of the plurality of audio files that include at least one audio glitch;
determine, based at least on the plurality of user responses, a second plurality of portions of the plurality of audio files that do not include the at least one audio glitch;
initialize values of a filter of a convolution neural network for detecting at least one pattern associated with the at least one audio glitch;
determine values of the filter based at least on the first plurality of portions of the plurality of audio files that include the at least one audio glitch and the second plurality of portions of the plurality of audio files;
receive audio produced by an information handling system;
provide the audio produced by the information handling system to the convolution neural network;
convolve the audio produced by the information handling system with the filter;
determine, based at least on data from convolving the audio produced by the information handling system with the filter and output data from the convolution neural network, if the information handling system has produced one or more audio glitches;
if the information handling system has produced one or more audio glitches, provide information indicating that the information handling system has produced the one or more audio glitches; and
if the information handling system has not produced one or more audio glitches, provide information indicating that the information handling system has not produced the one or more audio glitches. 2. The system of claim 1,
wherein the instructions further cause the system to perform a pooling operation on the data from convolving the audio produced by the information handling system with the filter; and wherein, to determine, based at least on the data from convolving the audio produced by the information handling system with the filter and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches, the instructions further cause the system to determine, based at least on output data form the pooling operation and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches. 3. The system of claim 2, wherein the pooling operation includes a max pooling operation, a min pooling operation, or an average pooling operation. 4. The system of claim 1,
wherein the instructions further cause the system to determine one or more of weights and biases of the convolution neural network; and wherein the output data from the convolution neural network is based at least on the one or more of weights and biases of the convolution neural network. 5. The system of claim 4, wherein, to determine the one or more of weights and biases of the convolution neural network, the instructions further cause the system to determine the one or more of weights and biases of the convolution neural network via a gradient descent process or a backwards propagation process. 6. The system of claim 1, wherein the filter is configured to determine the at least one pattern that includes a change in magnitude of sound that is above a threshold in a period of time, which indicates at least one of the one or more audio glitches. 7. The system of claim 1,
wherein the at least one audio glitch includes a first audio glitch; and wherein, to determine if the information handling system has produced the one or more audio glitches, the instructions further cause the system to determine, via the convolution neural network, that the audio produced by the information handling system includes a second audio glitch, different from the first audio glitch. 8. A method, comprising:
providing, to a plurality of users, a plurality of audio files, wherein at least a first audio file of the plurality of audio files includes at least one audio glitch and at least a second of audio file of the plurality of audio files does not include any audio glitch; receiving a plurality of user responses from the plurality of users that listen to the plurality of audio files; determining, based at least on the plurality of user responses, a first plurality of portions of the plurality of audio files that include at least one audio glitch; determining, based at least on the plurality of user responses, a second plurality of portions of the plurality of audio files that do not include the at least one audio glitch; initializing values of a filter of a convolution neural network for detecting at least one pattern associated with the at least one audio glitch; determining values of the filter based at least on the first plurality of portions of the plurality of audio files that include the at least one audio glitch and the second plurality of portions of the plurality of audio files; receiving audio produced by an information handling system; providing the audio produced by the information handling system to the convolution neural network; convolving the audio produced by the information handling system with the filter; determining, based at least on data from convolving the audio produced by the information handling system with the filter and output data from the convolution neural network, if the information handling system has produced one or more audio glitches; if the information handling system has produced one or more audio glitches, providing information indicating that the information handling system has produced the one or more audio glitches; and if the information handling system has not produced one or more audio glitches, providing information indicating that the information handling system has not produced the one or more audio glitches. 9. The method of claim 8, further comprising:
performing a pooling operation on the data from convolving the audio produced by the information handling system with the filter; wherein the determining, based at least on the data from convolving the audio produced by the information handling system with the filter and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches includes determining, based at least on output data form the pooling operation and the output data from the convolution neural network, if the information handling system has produced the one or more audio glitches. 10. The method of claim 9, wherein the pooling operation includes a max pooling operation, a min pooling operation, or an average pooling operation. 11. The method of claim 8, further comprising:
determining one or more of weights and biases of the convolution neural network; wherein the output data from the convolution neural network is based at least on the one or more of weights and biases of the convolution neural network. 12. The method of claim 11, wherein the determining the one or more of weights and biases of the convolution neural network includes determining the one or more of weights and biases of the convolution neural network via a gradient descent process or a backwards propagation process. 13. The method of claim 8, wherein the filter is configured to determine the at least one pattern that includes a change in magnitude of sound that is above a threshold in a period of time, which indicates at least one of the one or more audio glitches. 14. The method of claim 8,
wherein the at least one audio glitch includes a first audio glitch; and wherein the determining if the information handling system has produced the one or more audio glitches includes determining, via the convolution neural network, that the audio produced by the information handling system includes a second audio glitch, different from the first audio glitch. 15. An information handling system, comprising:
at least one processor; and a memory medium, coupled to the at least one processor, that stores instructions executable by the at least one processor, which when executed by the at least one processor, cause the information handling system to:
produce audio output;
provide the audio output to a convolution neural network, stored by the memory medium, trained to determine if the information handling system has produced one or more audio glitches;
convolve the audio output with a first filter of the convolution neural network to produce first convolved audio output data;
provide data based at least on the first convolved audio output data to a fully connected neural network of the convolution neural network;
determine, based at least on output from the fully connected neural network, if the information handling system produces the one or more audio glitches;
if the information handling system has produced one or more audio glitches, provide information indicating that the information handling system has produced the one or more audio glitches; and
if the information handling system has not produced one or more audio glitches, provide information indicating that the information handling system has not produced the one or more audio glitches. 16. The information handling system of claim 15,
wherein the instructions further cause the information handling system to perform a max pooling operation on the first convolved audio output data; and wherein, to provide the data based at least on the first convolved audio output data to the fully connected neural network of the convolution neural network, the instructions further cause the information handling system to provide data from the max pooling operation to the fully connected neural network of the convolution neural network. 17. The information handling system of claim 15, wherein the filter is configured to determine that a change in magnitude of sounds is above a threshold in a period of time. 18. The information handling system of claim 15, wherein, to determine, based at least on output from the fully connected neural network, if the information handling system has produced one or more audio glitches, the instructions further cause the information handling system to determine if an output value of the fully connected neural network is at or above a threshold value. 19. The information handling system of claim 15,
wherein the instructions further cause the information handling system to:
perform a first pooling operation on the first convolved audio output data; and
convolve output from the first pooling operation with a second filter to produce second convolved output data; and
wherein the data based at least on the first convolved audio output data is further based on the second convolved output data. 20. The information handling system of claim 19,
wherein the instructions further cause the information handling system to:
perform a second pooling operation on the second convolved output data; and
wherein the data based at least on the first convolved audio output data is further based on output from the second pooling operation. | 3,600 |
348,654 | 16,806,143 | 3,661 | A method, device, system, and computer-readable medium for displaying an augmented reality (AR) image, including controlling a camera to capture an image of a view through a microscope; generating information corresponding to the image; generating the AR image including an information ring configured to display the information; and controlling an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope. | 1. A method of displaying an augmented reality (AR) image, the method comprising:
controlling a camera to capture an image of a view through a microscope; generating information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope; generating the AR image including an information ring configured to display the information; and controlling an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope, wherein the information ring includes a histogram indicating the quantitative information, wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 2. The method of claim 1, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 3. The method of claim 1, wherein the AR image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 4. The method of claim 1, wherein the information is represented within the AR image as at least one of a text, a circular bar, and an icon. 5. The method of claim 4, wherein the text includes a system message corresponding to a system associated with the microscope, and a result message indicating a result of an analysis of the image. 6. The method of claim 5, further comprising scrolling the text in a text display area of the information ring. 7. The method of claim 1, wherein the information ring includes a progress bar indicating a progress of at least one of an analysis of the subject included in the image, and a computation corresponding to the microscope. 8. (canceled) 9. The method of claim 1, wherein the quantitative information includes a confidence level of an analysis of the subject. 10. The method of claim 4, wherein the icon indicates a status of a system associated with the microscope. 11. The method of claim 4, wherein the histogram represents at least one statistic corresponding to the image. 12. The method of claim 1, further comprising:
detecting a change in the image; generating updated information corresponding to the changed image; updating the information ring to include the updated information; controlling the AR display to display the AR image including the updated information ring. 13. A device for displaying an augmented reality (AR) image, the device comprising:
a camera configured to capture an image of a view through a microscope; an AR display configured to display an AR image as being at least partially overlaid over the view through the microscope while the view is visible to a user of the microscope; at least one memory configured to store program code; and at least one processor configured to read the program code and operate as instructed by the program code, the program code including:
first generating code configured to cause the at least one processor to generate information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope;
second generating code configured to cause the at least one processor to generate the AR image including an information ring configured to display the information; and
displaying code configured to cause the at least one processor to control the AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope,
wherein the information ring includes a histogram indicating the quantitative information, and wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 14. The device of claim 13, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 15. The device of claim 13, wherein the AR image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 16. The device of claim 13, wherein the information is represented within the AR image as at least one of a text, a circular bar, and an icon. 17. The device of claim 13, wherein the program code further includes:
detecting code configured to cause the at least one processor to detect a change in the image; third generating code configured to cause the at least one processor to generate updated information corresponding to the changed image; updating code configured to cause the at least one processor to update the information ring to include the updated information; second displaying code configured to cause the at least one processor to control the AR display to display the AR image including the updated information ring. 18. A non-transitory computer-readable medium storing one or more instructions that, when executed by one or more processors of a device for displaying an augmented reality (AR) image, cause the one or more processors to:
control a camera to capture an image of a view through a microscope; generate information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope; generate the AR image including an information ring configured to display the information; and control an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope, wherein the information ring includes a histogram indicating the quantitative information, and wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 19. The non-transitory computer-readable medium of claim 18, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 20. The non-transitory computer-readable medium of claim 18, wherein the AR is image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 21. (canceled) 22. The method of claim 1, wherein the histogram includes a first bar extending around a first partial circumference of the view through the microscope, and extending a first distance from the first partial circumference toward the center of the view through the microscope,
wherein the histogram includes a second bar extending around a second partial circumference of the view through the microscope, and extending a second distance from the second partial circumference toward the center of the view through the microscope, wherein a size of the first partial circumference is equal to a size of the second partial circumference, and wherein the first distance is different from the second distance. 23. The method of claim 1, wherein the histogram shows a plurality of percentages representing an amount of a plurality of tissues visible in the view. | A method, device, system, and computer-readable medium for displaying an augmented reality (AR) image, including controlling a camera to capture an image of a view through a microscope; generating information corresponding to the image; generating the AR image including an information ring configured to display the information; and controlling an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope.1. A method of displaying an augmented reality (AR) image, the method comprising:
controlling a camera to capture an image of a view through a microscope; generating information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope; generating the AR image including an information ring configured to display the information; and controlling an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope, wherein the information ring includes a histogram indicating the quantitative information, wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 2. The method of claim 1, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 3. The method of claim 1, wherein the AR image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 4. The method of claim 1, wherein the information is represented within the AR image as at least one of a text, a circular bar, and an icon. 5. The method of claim 4, wherein the text includes a system message corresponding to a system associated with the microscope, and a result message indicating a result of an analysis of the image. 6. The method of claim 5, further comprising scrolling the text in a text display area of the information ring. 7. The method of claim 1, wherein the information ring includes a progress bar indicating a progress of at least one of an analysis of the subject included in the image, and a computation corresponding to the microscope. 8. (canceled) 9. The method of claim 1, wherein the quantitative information includes a confidence level of an analysis of the subject. 10. The method of claim 4, wherein the icon indicates a status of a system associated with the microscope. 11. The method of claim 4, wherein the histogram represents at least one statistic corresponding to the image. 12. The method of claim 1, further comprising:
detecting a change in the image; generating updated information corresponding to the changed image; updating the information ring to include the updated information; controlling the AR display to display the AR image including the updated information ring. 13. A device for displaying an augmented reality (AR) image, the device comprising:
a camera configured to capture an image of a view through a microscope; an AR display configured to display an AR image as being at least partially overlaid over the view through the microscope while the view is visible to a user of the microscope; at least one memory configured to store program code; and at least one processor configured to read the program code and operate as instructed by the program code, the program code including:
first generating code configured to cause the at least one processor to generate information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope;
second generating code configured to cause the at least one processor to generate the AR image including an information ring configured to display the information; and
displaying code configured to cause the at least one processor to control the AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope,
wherein the information ring includes a histogram indicating the quantitative information, and wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 14. The device of claim 13, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 15. The device of claim 13, wherein the AR image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 16. The device of claim 13, wherein the information is represented within the AR image as at least one of a text, a circular bar, and an icon. 17. The device of claim 13, wherein the program code further includes:
detecting code configured to cause the at least one processor to detect a change in the image; third generating code configured to cause the at least one processor to generate updated information corresponding to the changed image; updating code configured to cause the at least one processor to update the information ring to include the updated information; second displaying code configured to cause the at least one processor to control the AR display to display the AR image including the updated information ring. 18. A non-transitory computer-readable medium storing one or more instructions that, when executed by one or more processors of a device for displaying an augmented reality (AR) image, cause the one or more processors to:
control a camera to capture an image of a view through a microscope; generate information corresponding to the image, including quantitative information corresponding to a subject included in the view through the microscope; generate the AR image including an information ring configured to display the information; and control an AR display to display the AR image such that the information ring is at least partially overlaid over a periphery of the view through the microscope while the view is visible to a user of the microscope, wherein the information ring includes a histogram indicating the quantitative information, and wherein the histogram includes a plurality of bars extending around a partial circumference of the view through the microscope, and extending a plurality of distances from the partial circumference toward a center of the view through the microscope. 19. The non-transitory computer-readable medium of claim 18, wherein the information includes at least one from among information about the subject included in the view through the microscope, information about a diagnosis of the subject, information about an analysis of the subject, information about a status of the analysis, information about a computation corresponding to the microscope, and information about a status of the computation. 20. The non-transitory computer-readable medium of claim 18, wherein the AR is image is displayed such that the information ring is only displayed within a predetermined distance of a circumference of the view through the microscope. 21. (canceled) 22. The method of claim 1, wherein the histogram includes a first bar extending around a first partial circumference of the view through the microscope, and extending a first distance from the first partial circumference toward the center of the view through the microscope,
wherein the histogram includes a second bar extending around a second partial circumference of the view through the microscope, and extending a second distance from the second partial circumference toward the center of the view through the microscope, wherein a size of the first partial circumference is equal to a size of the second partial circumference, and wherein the first distance is different from the second distance. 23. The method of claim 1, wherein the histogram shows a plurality of percentages representing an amount of a plurality of tissues visible in the view. | 3,600 |
348,655 | 16,806,131 | 3,661 | A memory system includes a nonvolatile memory, a buffer, and a controller. The buffer can temporarily store a plurality of data bits to be written to the nonvolatile memory. The controller can write the plurality of data bits, read from the buffer, to the nonvolatile memory; write a plurality of intermediate parity bits to the buffer, but not to the nonvolatile memory, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and write, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits. | 1. A memory system comprising:
a nonvolatile memory; a buffer configured to temporarily store a plurality of data bits to be written to the nonvolatile memory; and a controller configured to:
write the plurality of data bits, read from the buffer, to the nonvolatile memory;
write a plurality of intermediate parity bits to the buffer, but not to the nonvolatile memory, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and
write, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 2. The memory system according to claim 1, wherein the controller is configured to discard the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is determined to be successful. 3. The memory system according to claim 2, wherein the controller is configured to generate the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits, and generate the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 4. The memory system according to claim 3, wherein the plurality of data bits include a plurality of first data bits and a plurality of second data bits,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bits, and wherein the controller is configured to: read the accumulated parity bit from the nonvolatile memory; read the plurality of first data bits from the nonvolatile memory; perform the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; read the second data from the nonvolatile memory; generate the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correct the second data bit using the second intermediate parity bit. 5. The memory system according to claim 3, wherein the predetermined operation is an exclusive OR or an encoding operation for an error correction process. 6. The memory system according to claim 1, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. 7. The memory system according to claim 1, wherein the plurality of data bits are stored in respective areas in the nonvolatile memory that are arranged to be physically dispersed from each other. 8. A method of operating a memory system, the method comprising:
writing a plurality of data bits temporarily stored in a buffer, to a nonvolatile memory; writing a plurality of intermediate parity bits to the buffer but not to the nonvolatile memory, each of the plurality of intermediate parity bits associated with an error correction process on each of the plurality of data bits; and writing, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 9. The method according to claim 8, further comprising:
discarding the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is successful. 10. The method according to claim 8, further comprising:
generating the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits; and generating the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 11. The method according to claim 10, wherein the plurality of data bits include a plurality of first data bits and a second data bit,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bit, the method further comprises: reading the accumulated parity bit from the nonvolatile memory; reading the plurality of first data bits from the nonvolatile memory; performing the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; reading the second data bit from the nonvolatile memory; generating the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correcting the second data bit using the second intermediate parity bit. 12. The method according to claim 10, wherein the predetermined operation is exclusive OR or an encoding operation for an error correction process. 13. The method according to claim 8, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. 14. The method according to claim 8, wherein the plurality of data bits are stored in respective areas in the nonvolatile memory that are arranged to be physically dispersed from each other. 15. A memory system connectable to a host comprising:
a nonvolatile memory; and a controller configured to:
write the plurality of data bits received from the host and not yet been written to the nonvolatile memory, to the nonvolatile memory;
generate a plurality of intermediate parity bits, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and
write, to the nonvolatile memory, not the plurality of intermediate parity bits but an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 16. The memory system according to claim 15, wherein the controller is configured to discard the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is determined to be successful. 17. The memory system according to claim 16, wherein the controller is configured to generate the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits, and generate the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 18. The memory system according to claim 17, wherein the plurality of data bits include a plurality of first data bits and a plurality of second data bits,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bits, and wherein the controller is configured to: read the accumulated parity bit from the nonvolatile memory; read the plurality of first data bits from the nonvolatile memory; perform the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; read the second data from the nonvolatile memory; generate the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correct the second data bit using the second intermediate parity bit. 19. The memory system according to claim 17, wherein the predetermined operation is an exclusive OR or an encoding operation for an error correction process. 20. The memory system according to claim 15, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. | A memory system includes a nonvolatile memory, a buffer, and a controller. The buffer can temporarily store a plurality of data bits to be written to the nonvolatile memory. The controller can write the plurality of data bits, read from the buffer, to the nonvolatile memory; write a plurality of intermediate parity bits to the buffer, but not to the nonvolatile memory, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and write, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits.1. A memory system comprising:
a nonvolatile memory; a buffer configured to temporarily store a plurality of data bits to be written to the nonvolatile memory; and a controller configured to:
write the plurality of data bits, read from the buffer, to the nonvolatile memory;
write a plurality of intermediate parity bits to the buffer, but not to the nonvolatile memory, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and
write, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 2. The memory system according to claim 1, wherein the controller is configured to discard the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is determined to be successful. 3. The memory system according to claim 2, wherein the controller is configured to generate the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits, and generate the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 4. The memory system according to claim 3, wherein the plurality of data bits include a plurality of first data bits and a plurality of second data bits,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bits, and wherein the controller is configured to: read the accumulated parity bit from the nonvolatile memory; read the plurality of first data bits from the nonvolatile memory; perform the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; read the second data from the nonvolatile memory; generate the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correct the second data bit using the second intermediate parity bit. 5. The memory system according to claim 3, wherein the predetermined operation is an exclusive OR or an encoding operation for an error correction process. 6. The memory system according to claim 1, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. 7. The memory system according to claim 1, wherein the plurality of data bits are stored in respective areas in the nonvolatile memory that are arranged to be physically dispersed from each other. 8. A method of operating a memory system, the method comprising:
writing a plurality of data bits temporarily stored in a buffer, to a nonvolatile memory; writing a plurality of intermediate parity bits to the buffer but not to the nonvolatile memory, each of the plurality of intermediate parity bits associated with an error correction process on each of the plurality of data bits; and writing, to the nonvolatile memory, an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 9. The method according to claim 8, further comprising:
discarding the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is successful. 10. The method according to claim 8, further comprising:
generating the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits; and generating the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 11. The method according to claim 10, wherein the plurality of data bits include a plurality of first data bits and a second data bit,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bit, the method further comprises: reading the accumulated parity bit from the nonvolatile memory; reading the plurality of first data bits from the nonvolatile memory; performing the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; reading the second data bit from the nonvolatile memory; generating the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correcting the second data bit using the second intermediate parity bit. 12. The method according to claim 10, wherein the predetermined operation is exclusive OR or an encoding operation for an error correction process. 13. The method according to claim 8, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. 14. The method according to claim 8, wherein the plurality of data bits are stored in respective areas in the nonvolatile memory that are arranged to be physically dispersed from each other. 15. A memory system connectable to a host comprising:
a nonvolatile memory; and a controller configured to:
write the plurality of data bits received from the host and not yet been written to the nonvolatile memory, to the nonvolatile memory;
generate a plurality of intermediate parity bits, wherein each of the plurality of intermediate parity bits is associated with an error correction process on each of the plurality of data bits; and
write, to the nonvolatile memory, not the plurality of intermediate parity bits but an accumulated parity bit that is an integration of the plurality of intermediate parity bits. 16. The memory system according to claim 15, wherein the controller is configured to discard the plurality of intermediate parity bits when writing the plurality of data bits corresponding to the accumulated parity bit to the nonvolatile memory is determined to be successful. 17. The memory system according to claim 16, wherein the controller is configured to generate the plurality of intermediate parity bits by performing an encoding operation for the error correction process on each of the plurality of data bits, and generate the accumulated parity bit by performing a predetermined operation on the plurality of generated intermediate parity bits. 18. The memory system according to claim 17, wherein the plurality of data bits include a plurality of first data bits and a plurality of second data bits,
the plurality of intermediate parity bits include a plurality of first intermediate parity bits that correspond to the plurality of first data bits, and a second intermediate parity bit that corresponds to the second data bits, and wherein the controller is configured to: read the accumulated parity bit from the nonvolatile memory; read the plurality of first data bits from the nonvolatile memory; perform the encoding operation for the error correction process on the plurality of first data bits to generate the plurality of first intermediate parity bits; read the second data from the nonvolatile memory; generate the second intermediate parity bit on the basis of the plurality of first intermediate parity bits and the accumulated parity bit; and correct the second data bit using the second intermediate parity bit. 19. The memory system according to claim 17, wherein the predetermined operation is an exclusive OR or an encoding operation for an error correction process. 20. The memory system according to claim 15, wherein a bit length of the accumulated parity bit is shorter than a sum of respective bit lengths of the plurality of intermediate parity bits. | 3,600 |
348,656 | 16,806,177 | 3,653 | A flexural document pick-up device includes: a feeding path comprised of a upper wall and a lower wall; a input tray arranged upstream to the feeding path; a paper feeding unit arranged partially in the feeding path; a separation roller disposed on the opposite side of the paper feeding unit; a blocking arm disposed upstream to the paper feeding unit; a securing groove arranged on the upper wall; and a guiding unit with the following portions disposed sequentially from downstream to upstream of the feeding direction: a securing section which is secured to the securing groove, a flexure section which is extended from the securing section to the feeding path, a guiding section which is connected to the flexure section and essentially parallel to the feeding path, a lifting section which is connected to the guiding section and a vertex which is arranged on the end of the lifting section. | 1. A flexural document pick-up device includes:
a feeding path comprised of an upper wall and a lower wall; an input tray arranged at the upstream of the feeding path; a paper feeding unit arranged partially in the feeding path; a separation roller disposed on the opposite side of the paper feeding unit to be contacted with the paper feeding unit; a blocking arm disposed between the input tray and the paper feeding unit and configured to be switchable move between a blocking position for blocking the paper and a feeding position for passing the paper through the feeding path; a securing groove arranged on the upper wall; and a guiding unit with the following portions disposed sequentially from downstream to upstream of the feeding direction: a securing section which is secured to the securing groove, a flexure section which is extended from the securing section to the feeding path, a guiding section which is connected to the flexure section and essentially parallel to the feeding path, a lifting section which is connected to the guiding section and a vertex which is arranged on the end of the lifting section; wherein the guiding section is movably arranged is a seam space formed with the paper feeding unit and the separation roller, the radius of a virtual circle formed by the separation roller and the lifting section is greater than the wheel diameter of the separation roller, and the vertical distance between the lower wall and the guiding section is greater than the vertical distance between the lower wall and the separation roller. 2. The flexural document pick-up device as claimed in claim 1, wherein the junction point of the guiding section and the lifting section is arranged upstream to contact point of the separation roller and the paper. 3. The flexural document pick-up device as claimed in claim 1, wherein the lifting section is arranged downstream to the blocking arm in the paper feed direction. 4. The flexural document pick-up device as claimed in claim 1, wherein the angle between the guiding section and the feeding path is smaller than the angle between the lifting section and the feeding path when viewed from an axial direction of the separation roller. 5. The flexural document pick-up device as claimed in claim 1, wherein the blocking arm is arranged upstream to the vertex. 6. The flexural document pick-up device as claimed in claim 1, wherein the vertical distance between the paper to be fed and the vertex is greater than the vertical distance between the paper to be fed and the bottom of the blocking arm. | A flexural document pick-up device includes: a feeding path comprised of a upper wall and a lower wall; a input tray arranged upstream to the feeding path; a paper feeding unit arranged partially in the feeding path; a separation roller disposed on the opposite side of the paper feeding unit; a blocking arm disposed upstream to the paper feeding unit; a securing groove arranged on the upper wall; and a guiding unit with the following portions disposed sequentially from downstream to upstream of the feeding direction: a securing section which is secured to the securing groove, a flexure section which is extended from the securing section to the feeding path, a guiding section which is connected to the flexure section and essentially parallel to the feeding path, a lifting section which is connected to the guiding section and a vertex which is arranged on the end of the lifting section.1. A flexural document pick-up device includes:
a feeding path comprised of an upper wall and a lower wall; an input tray arranged at the upstream of the feeding path; a paper feeding unit arranged partially in the feeding path; a separation roller disposed on the opposite side of the paper feeding unit to be contacted with the paper feeding unit; a blocking arm disposed between the input tray and the paper feeding unit and configured to be switchable move between a blocking position for blocking the paper and a feeding position for passing the paper through the feeding path; a securing groove arranged on the upper wall; and a guiding unit with the following portions disposed sequentially from downstream to upstream of the feeding direction: a securing section which is secured to the securing groove, a flexure section which is extended from the securing section to the feeding path, a guiding section which is connected to the flexure section and essentially parallel to the feeding path, a lifting section which is connected to the guiding section and a vertex which is arranged on the end of the lifting section; wherein the guiding section is movably arranged is a seam space formed with the paper feeding unit and the separation roller, the radius of a virtual circle formed by the separation roller and the lifting section is greater than the wheel diameter of the separation roller, and the vertical distance between the lower wall and the guiding section is greater than the vertical distance between the lower wall and the separation roller. 2. The flexural document pick-up device as claimed in claim 1, wherein the junction point of the guiding section and the lifting section is arranged upstream to contact point of the separation roller and the paper. 3. The flexural document pick-up device as claimed in claim 1, wherein the lifting section is arranged downstream to the blocking arm in the paper feed direction. 4. The flexural document pick-up device as claimed in claim 1, wherein the angle between the guiding section and the feeding path is smaller than the angle between the lifting section and the feeding path when viewed from an axial direction of the separation roller. 5. The flexural document pick-up device as claimed in claim 1, wherein the blocking arm is arranged upstream to the vertex. 6. The flexural document pick-up device as claimed in claim 1, wherein the vertical distance between the paper to be fed and the vertex is greater than the vertical distance between the paper to be fed and the bottom of the blocking arm. | 3,600 |
348,657 | 16,806,156 | 3,653 | An information processing system includes a first apparatus, a second apparatus providing a service for fee, and a server. The first apparatus transmits, to the server, identification information and settlement destination information in an associated form, the identification information identifying use of the service, the settlement destination information stored on the first apparatus and identifying a settlement destination of a usage fee for the use of the service. The second apparatus transmits to the server the identification information and fee information in an associated form, the fee information indicating the usage fee for the use identified by the identification information. The server settles the usage fee indicated by the fee information at the settlement destination identified the settlement destination information associated with the identification information. | 1. An information processing system comprising a first apparatus, a second apparatus providing a service for fee, and a server,
wherein the first apparatus transmits, to the server, identification information and settlement destination information in an associated form, the identification information identifying use of the service, the settlement destination information stored on the first apparatus and identifying a settlement destination of a usage fee for the use of the service, wherein the second apparatus transmits to the server the identification information and fee information in an associated form, the fee information indicating the usage fee for the use identified by the identification information, and wherein the server settles the usage fee indicated by the fee information at the settlement destination identified by the settlement destination information associated with the identification information. 2. The information processing system according to claim 1, wherein the second apparatus displays code information indicating the identification information, and
wherein the first apparatus acquires the identification information read the displayed code information and transmits the acquired identification information to the server. 3. The information processing system according to claim 1, wherein the second apparatus wirelessly outputs the identification information, and
wherein the first apparatus acquires the received identification information and transmits the acquired identification information to the server. 4. The information processing system according to claim 2, wherein the first apparatus authenticates a user and acquires the identification information via a function that is available if the user has been authenticated. 5. The information processing system according to claim 3, wherein the first apparatus authenticates a user and acquires the identification information via a function that is available if the user has been authenticated. 6. The information processing system according to claim 1, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 7. The information processing system according to claim 2, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 8. The information processing system according to claim 3, wherein the server transmits to the second apparatus the identification information received from, the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 9. The information processing system according to claim 4, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 10. The information processing system according to claim 5, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 11. The information processing system according to claim 6, wherein the first apparatus transmits, to the server, unique information on the first apparatus or a user together with the identification information and the settlement destination information, and
wherein the server transmits the identification information to the second apparatus if the received unique information satisfies a usage condition. 12. The information processing system according to claim 11, wherein the unique information is associated with a service that is available, and
wherein the usage condition is satisfied if the unique information and the identification information identifying the use of the service associated with the unique information have been received. 13. The information processing system according to claim wherein a usage amount of the service is accumulated in association with the unique information, and
wherein the usage condition is satisfied if the usage amount associated with the unique information is less than a specific reference value. 14. The information processing system according to claim 1, wherein the second apparatus transmits to the server, as the fee information, information indicating the usage fee cost throughout a period of time that continues from when the second apparatus starts providing the service until an end condition is satisfied. 15. The information processing system according to claim 14, wherein the end condition is satisfied if a distance between the first apparatus and the second apparatus exceeds a threshold value. 16. The information processing system according to claim 15, wherein the end condition is satisfied if an operation is not input on the second apparatus throughout a constant period of time. 17. The information processing system according to claim 1, wherein the second apparatus repeatedly transmits to the server, as the fee information, content information indicating contents of the service and deletes the content information each time the content information has been transmitted. 18. The information processing system according to claim 1, wherein the first apparatus authenticates a user and transmits the identification information and the settlement destination information to the server via a function that is available if the user has been authenticated. 19. An information processing apparatus comprising:
a providing unit that provides a service for fee; an acquisition unit that acquires identification information identifying use of the service; a generating unit that generates fee information indicating a usage fee for the use identified by the acquired identification information; and a transmitting unit that transmits to a server the acquired identification information and the generated fee information in an associated form, wherein the server acquires, from an external apparatus, identification information and settlement destination information in an associated form, the identification information identifying the use of the service by a user, the settlement destination information identifying a settlement destination for a usage fee for the use of the service, and settles the usage fee indicated by the fee information at the settlement destination identified by the settlement destination information associated with the identification information. 20. A server comprising:
a first acquisition unit that acquires, from an external apparatus, identification information identify ag use of a service for fee by a user who uses a providing apparatus that provides the user with the service and settlement destination information identifying a settlement destination of a usage fee for the use; a second acquisition unit that acquires from the providing apparatus the identification information and fee information indicating the usage fee for the use identified by the identification information; and a processing unit that settles the usage fee indicated by the acquired fee information at the settlement destination identified by the settlement destination information associated with the identification information. | An information processing system includes a first apparatus, a second apparatus providing a service for fee, and a server. The first apparatus transmits, to the server, identification information and settlement destination information in an associated form, the identification information identifying use of the service, the settlement destination information stored on the first apparatus and identifying a settlement destination of a usage fee for the use of the service. The second apparatus transmits to the server the identification information and fee information in an associated form, the fee information indicating the usage fee for the use identified by the identification information. The server settles the usage fee indicated by the fee information at the settlement destination identified the settlement destination information associated with the identification information.1. An information processing system comprising a first apparatus, a second apparatus providing a service for fee, and a server,
wherein the first apparatus transmits, to the server, identification information and settlement destination information in an associated form, the identification information identifying use of the service, the settlement destination information stored on the first apparatus and identifying a settlement destination of a usage fee for the use of the service, wherein the second apparatus transmits to the server the identification information and fee information in an associated form, the fee information indicating the usage fee for the use identified by the identification information, and wherein the server settles the usage fee indicated by the fee information at the settlement destination identified by the settlement destination information associated with the identification information. 2. The information processing system according to claim 1, wherein the second apparatus displays code information indicating the identification information, and
wherein the first apparatus acquires the identification information read the displayed code information and transmits the acquired identification information to the server. 3. The information processing system according to claim 1, wherein the second apparatus wirelessly outputs the identification information, and
wherein the first apparatus acquires the received identification information and transmits the acquired identification information to the server. 4. The information processing system according to claim 2, wherein the first apparatus authenticates a user and acquires the identification information via a function that is available if the user has been authenticated. 5. The information processing system according to claim 3, wherein the first apparatus authenticates a user and acquires the identification information via a function that is available if the user has been authenticated. 6. The information processing system according to claim 1, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 7. The information processing system according to claim 2, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 8. The information processing system according to claim 3, wherein the server transmits to the second apparatus the identification information received from, the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 9. The information processing system according to claim 4, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 10. The information processing system according to claim 5, wherein the server transmits to the second apparatus the identification information received from the first apparatus, and
wherein the second apparatus starts providing the service if the identification information has been received from the server. 11. The information processing system according to claim 6, wherein the first apparatus transmits, to the server, unique information on the first apparatus or a user together with the identification information and the settlement destination information, and
wherein the server transmits the identification information to the second apparatus if the received unique information satisfies a usage condition. 12. The information processing system according to claim 11, wherein the unique information is associated with a service that is available, and
wherein the usage condition is satisfied if the unique information and the identification information identifying the use of the service associated with the unique information have been received. 13. The information processing system according to claim wherein a usage amount of the service is accumulated in association with the unique information, and
wherein the usage condition is satisfied if the usage amount associated with the unique information is less than a specific reference value. 14. The information processing system according to claim 1, wherein the second apparatus transmits to the server, as the fee information, information indicating the usage fee cost throughout a period of time that continues from when the second apparatus starts providing the service until an end condition is satisfied. 15. The information processing system according to claim 14, wherein the end condition is satisfied if a distance between the first apparatus and the second apparatus exceeds a threshold value. 16. The information processing system according to claim 15, wherein the end condition is satisfied if an operation is not input on the second apparatus throughout a constant period of time. 17. The information processing system according to claim 1, wherein the second apparatus repeatedly transmits to the server, as the fee information, content information indicating contents of the service and deletes the content information each time the content information has been transmitted. 18. The information processing system according to claim 1, wherein the first apparatus authenticates a user and transmits the identification information and the settlement destination information to the server via a function that is available if the user has been authenticated. 19. An information processing apparatus comprising:
a providing unit that provides a service for fee; an acquisition unit that acquires identification information identifying use of the service; a generating unit that generates fee information indicating a usage fee for the use identified by the acquired identification information; and a transmitting unit that transmits to a server the acquired identification information and the generated fee information in an associated form, wherein the server acquires, from an external apparatus, identification information and settlement destination information in an associated form, the identification information identifying the use of the service by a user, the settlement destination information identifying a settlement destination for a usage fee for the use of the service, and settles the usage fee indicated by the fee information at the settlement destination identified by the settlement destination information associated with the identification information. 20. A server comprising:
a first acquisition unit that acquires, from an external apparatus, identification information identify ag use of a service for fee by a user who uses a providing apparatus that provides the user with the service and settlement destination information identifying a settlement destination of a usage fee for the use; a second acquisition unit that acquires from the providing apparatus the identification information and fee information indicating the usage fee for the use identified by the identification information; and a processing unit that settles the usage fee indicated by the acquired fee information at the settlement destination identified by the settlement destination information associated with the identification information. | 3,600 |
348,658 | 16,806,169 | 3,653 | A payload retrieval apparatus including an extending member having an upper end and a lower end, a channel having a first end and a second end, the channel coupled to the extending member, a first tether engager that extends in a first direction from the first end of the channel section, and a payload holder positioned near the second end of the channel and is adapted to secure a payload. | 1. A payload retrieval apparatus comprising:
an extending member having an upper end and a lower end; a channel having a first end and a second end, the channel coupled to the extending member; a first extension that extends in a first direction from the first end of the channel; and a payload engaging member positioned near the second end of the channel and is adapted to secure a payload. 2. The payload retrieval apparatus of claim 1, wherein an angled extender is secured to the extending member and secured to the channel. 3. The payload retrieval apparatus of claim 1, wherein a first shield extends from the first end of the channel. 4. The payload retrieval apparatus of claim 1, wherein a first shield extends from the first extension. 5. The payload retrieval apparatus of claim 1, further including a second extension that extends in a second direction from the first end of the channel section. 6. The payload retrieval apparatus of claim 5, wherein a first shield extends from the first tether engager and a second shield extends from the second tether engager. 7. The payload retrieval apparatus of claim 1, wherein an upper portion of the channel includes a tether slot that extends from the first end of the channel to the second end of the channel. 8. The payload retrieval apparatus of claim 7, wherein the channel has an interior having cams or slots adapted to cooperate with external cams or slots on a payload retriever attached to an end of a tether suspended from a UAV, to orient the payload retriever within the channel. 9. The payload retrieval apparatus of claim 7, wherein one or more a metal is are positioned on an interior of the channel adapted to magnetically engage one or more magnets positioned on an exterior of a payload retriever, to orient the payload retriever within the channel. 10. The payload retrieval apparatus of claim 7, wherein the payload retrieval apparatus is configured to accept a payload retriever attached to an end of a tether suspended from a UAV, wherein the payload retriever has a weighted side to orient the payload retriever within the channel. 11. The payload retrieval apparatus of claim 1, wherein the payload engaging member comprises a pair of pins adapted to extend through openings in a handle of a payload. 12. The payload retrieval apparatus of claim 1, wherein the payload engaging member comprises one or magnets, or a metal, adapted to magnetically engage one or more magnets, or a metal, positioned on the payload. 13. The payload retrieval apparatus of claim 1, wherein a handle of the payload includes one or more magnets adapted to engage a metal on the payload engaging member. 14. A system for payload retrieval comprising:
a payload retrieval apparatus comprising: a channel having a first end and a second end, the channel coupled to the extending member; a first extension that extends in a first direction from the first end of the channel; 15. The system of claim 14, wherein the payload retrieval apparatus first extension and the channel may be folded up to facilitate transport and storage of the payload retrieval apparatus. 16. The system of claim 14, wherein the payload retriever has a weighted side to orient the payload retriever within the channel. 17. The system of claim 14, wherein the second end of the channel is spring-loaded to further assist orienting the payload retriever within the channel. 18. The system of claim 14, wherein the payload comprises a handle with an aperture, the payload secured to the payload engaging member;
wherein the payload retriever is attached to the tether that is suspended from a UAV; and wherein the tether slot has a width that is narrower than a width of the payload retriever. 19. A method of a retrieving a payload with a UAV, comprising:
positioning a payload having a handle with an aperture on a payload engaging member coupled to a channel on a payload retrieval apparatus; causing a UAV having a payload retriever attached to a tether suspended from the UAV to position the tether to come into contact with a first extension extending from an end of the channel; causing the UAV to advance the tether into a tether slot positioned on a top of the channel, wherein the tether slot has a width that is narrower than a width of the payload retriever; causing the UAV to advance the payload retriever into the channel; causing the UAV to advance the payload retriever until the payload retriever engages the handle of the payload; and causing the UAV to pick up the payload by the payload retriever thereby disengaging the payload from the payload engaging member. 20. The method of claim 19, wherein the payload retriever comprises a capsule having a slot adapted to engage the handle of the payload; and
wherein the channel has an interior having cams or slots in engagement with external cams or slots on the capsule, to orient the capsule within the channel. | A payload retrieval apparatus including an extending member having an upper end and a lower end, a channel having a first end and a second end, the channel coupled to the extending member, a first tether engager that extends in a first direction from the first end of the channel section, and a payload holder positioned near the second end of the channel and is adapted to secure a payload.1. A payload retrieval apparatus comprising:
an extending member having an upper end and a lower end; a channel having a first end and a second end, the channel coupled to the extending member; a first extension that extends in a first direction from the first end of the channel; and a payload engaging member positioned near the second end of the channel and is adapted to secure a payload. 2. The payload retrieval apparatus of claim 1, wherein an angled extender is secured to the extending member and secured to the channel. 3. The payload retrieval apparatus of claim 1, wherein a first shield extends from the first end of the channel. 4. The payload retrieval apparatus of claim 1, wherein a first shield extends from the first extension. 5. The payload retrieval apparatus of claim 1, further including a second extension that extends in a second direction from the first end of the channel section. 6. The payload retrieval apparatus of claim 5, wherein a first shield extends from the first tether engager and a second shield extends from the second tether engager. 7. The payload retrieval apparatus of claim 1, wherein an upper portion of the channel includes a tether slot that extends from the first end of the channel to the second end of the channel. 8. The payload retrieval apparatus of claim 7, wherein the channel has an interior having cams or slots adapted to cooperate with external cams or slots on a payload retriever attached to an end of a tether suspended from a UAV, to orient the payload retriever within the channel. 9. The payload retrieval apparatus of claim 7, wherein one or more a metal is are positioned on an interior of the channel adapted to magnetically engage one or more magnets positioned on an exterior of a payload retriever, to orient the payload retriever within the channel. 10. The payload retrieval apparatus of claim 7, wherein the payload retrieval apparatus is configured to accept a payload retriever attached to an end of a tether suspended from a UAV, wherein the payload retriever has a weighted side to orient the payload retriever within the channel. 11. The payload retrieval apparatus of claim 1, wherein the payload engaging member comprises a pair of pins adapted to extend through openings in a handle of a payload. 12. The payload retrieval apparatus of claim 1, wherein the payload engaging member comprises one or magnets, or a metal, adapted to magnetically engage one or more magnets, or a metal, positioned on the payload. 13. The payload retrieval apparatus of claim 1, wherein a handle of the payload includes one or more magnets adapted to engage a metal on the payload engaging member. 14. A system for payload retrieval comprising:
a payload retrieval apparatus comprising: a channel having a first end and a second end, the channel coupled to the extending member; a first extension that extends in a first direction from the first end of the channel; 15. The system of claim 14, wherein the payload retrieval apparatus first extension and the channel may be folded up to facilitate transport and storage of the payload retrieval apparatus. 16. The system of claim 14, wherein the payload retriever has a weighted side to orient the payload retriever within the channel. 17. The system of claim 14, wherein the second end of the channel is spring-loaded to further assist orienting the payload retriever within the channel. 18. The system of claim 14, wherein the payload comprises a handle with an aperture, the payload secured to the payload engaging member;
wherein the payload retriever is attached to the tether that is suspended from a UAV; and wherein the tether slot has a width that is narrower than a width of the payload retriever. 19. A method of a retrieving a payload with a UAV, comprising:
positioning a payload having a handle with an aperture on a payload engaging member coupled to a channel on a payload retrieval apparatus; causing a UAV having a payload retriever attached to a tether suspended from the UAV to position the tether to come into contact with a first extension extending from an end of the channel; causing the UAV to advance the tether into a tether slot positioned on a top of the channel, wherein the tether slot has a width that is narrower than a width of the payload retriever; causing the UAV to advance the payload retriever into the channel; causing the UAV to advance the payload retriever until the payload retriever engages the handle of the payload; and causing the UAV to pick up the payload by the payload retriever thereby disengaging the payload from the payload engaging member. 20. The method of claim 19, wherein the payload retriever comprises a capsule having a slot adapted to engage the handle of the payload; and
wherein the channel has an interior having cams or slots in engagement with external cams or slots on the capsule, to orient the capsule within the channel. | 3,600 |
348,659 | 16,806,115 | 3,653 | Provided herein are dUTPase inhibitors, compositions comprising such compounds and methods of using such compounds and compositions. | 1. A compound of Formula (I): 2. The compound of claim 1, wherein A is 3. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 alkylene, wherein at least two geminal hydrogens together with the carbon to which they are attached are optionally replaced with cyclopropano or cyclobutano. 4. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 alkenylene. 5. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 heteroalkylene. 6. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 heteroalkenylene. 7. The compound of claim 1, wherein L1 is selected from the group consisting of: 8. The compound of claim 1, wherein L1 is -L11-L12-L13-, wherein L11 is attached to A. 9. The compound of claim 8, wherein -L11-L12-L13- is 10. The compound of claim 1, wherein L2 is —S(O)2NH—, wherein the sulfur is attached to L1. 11. The compound of claim 1, wherein L2 is —NHS(O)2—, wherein the nitrogen is attached to L1. 12. The compound of claim 1, wherein L3 is a bond. 13. The compound of claim 1, wherein L3 is selected from the group consisting of 14. The compound of claim 1, wherein B is 15. A composition comprising a compound of claim 1, and at least one pharmaceutically acceptable excipient or carrier. 16. A method of treating a disease in a patient whose treatment is impeded by the expression or over expression of dUTPase, comprising:
a. administering to the patient in need of such treatment a therapeutically effective amount of the compound of claim 1; or b. screening a cell or tissue sample from the patient; determining the expression level of dUTPase in the sample; and administering to a patient whose sample shows over expression of dUTPase, a therapeutically effective amount of the compound of claim 1; 17. The method of claim 16, wherein the disease is cancer. 18. The method of claim 17, wherein the cancer is selected from the group consisting of colon cancer, colorectal cancer, gastric cancer, esophageal cancer, head and neck cancer, breast cancer, lung cancer, stomach cancer, liver cancer, gall bladder cancer, pancreatic cancer and leukemia. 19. A method of inhibiting the growth of a cancer cell comprising contacting the cell with a therapeutically effective amount of the compound of claim 1; and a therapeutically effective amount of a dUTPase directed therapeutic, thereby inhibiting the growth of the cancer cell. 20. The method of claim 19, wherein the cancer cell is selected from a colon cancer cell, a colorectal cancer cell, a gastric cancer cell, a head and neck cancer cell, a breast cancer cell, a lung cancer cell or a blood cell. | Provided herein are dUTPase inhibitors, compositions comprising such compounds and methods of using such compounds and compositions.1. A compound of Formula (I): 2. The compound of claim 1, wherein A is 3. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 alkylene, wherein at least two geminal hydrogens together with the carbon to which they are attached are optionally replaced with cyclopropano or cyclobutano. 4. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 alkenylene. 5. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 heteroalkylene. 6. The compound of claim 1, wherein L1 is an optionally substituted C3-C10 heteroalkenylene. 7. The compound of claim 1, wherein L1 is selected from the group consisting of: 8. The compound of claim 1, wherein L1 is -L11-L12-L13-, wherein L11 is attached to A. 9. The compound of claim 8, wherein -L11-L12-L13- is 10. The compound of claim 1, wherein L2 is —S(O)2NH—, wherein the sulfur is attached to L1. 11. The compound of claim 1, wherein L2 is —NHS(O)2—, wherein the nitrogen is attached to L1. 12. The compound of claim 1, wherein L3 is a bond. 13. The compound of claim 1, wherein L3 is selected from the group consisting of 14. The compound of claim 1, wherein B is 15. A composition comprising a compound of claim 1, and at least one pharmaceutically acceptable excipient or carrier. 16. A method of treating a disease in a patient whose treatment is impeded by the expression or over expression of dUTPase, comprising:
a. administering to the patient in need of such treatment a therapeutically effective amount of the compound of claim 1; or b. screening a cell or tissue sample from the patient; determining the expression level of dUTPase in the sample; and administering to a patient whose sample shows over expression of dUTPase, a therapeutically effective amount of the compound of claim 1; 17. The method of claim 16, wherein the disease is cancer. 18. The method of claim 17, wherein the cancer is selected from the group consisting of colon cancer, colorectal cancer, gastric cancer, esophageal cancer, head and neck cancer, breast cancer, lung cancer, stomach cancer, liver cancer, gall bladder cancer, pancreatic cancer and leukemia. 19. A method of inhibiting the growth of a cancer cell comprising contacting the cell with a therapeutically effective amount of the compound of claim 1; and a therapeutically effective amount of a dUTPase directed therapeutic, thereby inhibiting the growth of the cancer cell. 20. The method of claim 19, wherein the cancer cell is selected from a colon cancer cell, a colorectal cancer cell, a gastric cancer cell, a head and neck cancer cell, a breast cancer cell, a lung cancer cell or a blood cell. | 3,600 |
348,660 | 16,806,175 | 3,653 | A heating apparatus for a fluid flow system having a fluid conduit includes at least one heater element and a support member within the conduit. The at least one heater element includes a resistance wire, a sheath, and an electrically insulating material. The sheath has a closed profile shape that extends along a tortuous path through the container body and surrounds the resistance wire along the tortuous path. The insulating material is disposed about the wire between the wire and the sheath. The support member restricts movement of the at least one heater element relative to the fluid conduit. The support member defines a corrugated geometry that follows the tortuous path while contacting the sheath along a majority of a length of the sheath. The support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit. | 1. A heating apparatus for an exhaust gas system having a container body, the heating apparatus comprising:
at least one heater element within the container body, the at least one heater element including a resistance wire, a sheath, and an insulating material, the sheath having a closed profile shape that extends along a spiral path through the container body and surrounds the resistance wire along the spiral path, the insulating material disposed about the resistance wire between the resistance wire and the sheath; and a support member disposed inside the container body and configured for restricting movement of the at least one heater element in the container body, the support member including a strip that defines a tortuous geometry that follows the spiral path while contacting the sheath along a majority of a length of the sheath, wherein the insulating material electrically insulates the resistance wire from the sheath, wherein the support member increases heat transfer from the at least one heater element to an exhaust gas flowing through the container body. 2. The heating apparatus according to claim 1, wherein the at least one heater element is sandwiched between portions of the strip that are located at different locations along the spiral shape of the strip. 3. The heating apparatus according to claim 1, wherein the strip is a corrugated strip defining a plurality of ridges and grooves. 4. The heating apparatus according to claim 3, wherein the corrugated strip further defines a plurality of indentations disposed at the ridges and grooves and the sheath is received in the indentations. 5. The heating apparatus according to claim 1, wherein the support member further includes an outer peripheral wall surrounding the strip. 6. The heating apparatus according to claim 5, wherein the outer peripheral wall defines at least one annular groove. 7. The heating apparatus according to claim 5, wherein the outer peripheral wall defines an outer boundary of an exhaust gas flow channel through the container body. 8. The heating apparatus according to claim 5, wherein the container body defines an outer boundary of an exhaust gas flow channel and the outer peripheral wall is a separate component from the container body and is disposed inside the container body. 9. The heating apparatus according to claim 5, wherein the outer peripheral wall is fixed to the strip. 10. The heating apparatus according to claim 1, wherein the strip is fixed to the at least one heater element at a plurality of contact points, the plurality of contact points being spaced at a spacing along a length of the strip, the spacing is less than ten times an outside diameter of the at least one heater element. 11. The heating apparatus according to claim 10, wherein a natural frequency of vibration for sections of the at least one heater element between adjacent two of the contacts points is greater than 400 Hz. 12. The heating apparatus according to claim 10, wherein the number of contact points is selected such that a temperature variation across the heating apparatus is less than 200° C. 13. The heating apparatus according to claim 1, wherein the at least one heating element has a power density greater than 84 watts/in2 for the sheath. 14. A heating apparatus for a fluid flow system having a fluid conduit, the heating apparatus comprising:
at least one heater element within the fluid conduit, the at least one heater element including a resistance wire, a sheath, and an insulating material, the sheath having a closed profile shape that extends along a tortuous path through the container body and surrounds the resistance wire along the tortuous path, the insulating material disposed about the resistance wire between the resistance wire and the sheath; and a support member disposed within the fluid conduit and configured for restricting movement of the at least one heater element relative to the fluid conduit, the support member defining a corrugated geometry that follows the tortuous path while contacting the sheath along a majority of a length of the sheath, wherein the insulating material electrically insulates the resistance wire from the sheath, wherein the support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit. 15. The heating apparatus according to claim 14, wherein the support member includes a strip that defines the corrugated geometry. 16. The heating apparatus according to claim 14, wherein the corrugated shape includes a plurality of ridges and grooves and the strip defines a plurality of indentions disposed at the ridges and grooves, the sheath being received in the indentions. 17. The heating apparatus according to claim 14, wherein the support member includes a peripheral wall that defines an outer boundary of a gas flow channel of the fluid conduit. 18. A heating apparatus for a fluid flow system having a fluid conduit, the heating apparatus comprising:
at least one heater element extending along a tortuous path within the fluid conduit, the at least one heater element including a resistance wire and an insulating material disposed about the resistance wire; and a continuous support member disposed within the fluid conduit and configured for restricting movement of the at least one heater element relative to the fluid conduit, the support member defining a tortuous geometry and following the tortuous path such that one side of a region of the heater element contacts a first location on the support member and an opposite side of the region of the heater element is flanked by a second location on the support member, the second location being further along the tortuous path than the first location, wherein the insulating material electrically insulates the resistance wire from the support member, wherein the support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit. 19. The heating apparatus according to claim 18, wherein the tortuous path is a spiral path. 20. The heating apparatus according to claim 19, wherein the support member includes a strip that defines the tortuous geometry and follows the spiral path. | A heating apparatus for a fluid flow system having a fluid conduit includes at least one heater element and a support member within the conduit. The at least one heater element includes a resistance wire, a sheath, and an electrically insulating material. The sheath has a closed profile shape that extends along a tortuous path through the container body and surrounds the resistance wire along the tortuous path. The insulating material is disposed about the wire between the wire and the sheath. The support member restricts movement of the at least one heater element relative to the fluid conduit. The support member defines a corrugated geometry that follows the tortuous path while contacting the sheath along a majority of a length of the sheath. The support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit.1. A heating apparatus for an exhaust gas system having a container body, the heating apparatus comprising:
at least one heater element within the container body, the at least one heater element including a resistance wire, a sheath, and an insulating material, the sheath having a closed profile shape that extends along a spiral path through the container body and surrounds the resistance wire along the spiral path, the insulating material disposed about the resistance wire between the resistance wire and the sheath; and a support member disposed inside the container body and configured for restricting movement of the at least one heater element in the container body, the support member including a strip that defines a tortuous geometry that follows the spiral path while contacting the sheath along a majority of a length of the sheath, wherein the insulating material electrically insulates the resistance wire from the sheath, wherein the support member increases heat transfer from the at least one heater element to an exhaust gas flowing through the container body. 2. The heating apparatus according to claim 1, wherein the at least one heater element is sandwiched between portions of the strip that are located at different locations along the spiral shape of the strip. 3. The heating apparatus according to claim 1, wherein the strip is a corrugated strip defining a plurality of ridges and grooves. 4. The heating apparatus according to claim 3, wherein the corrugated strip further defines a plurality of indentations disposed at the ridges and grooves and the sheath is received in the indentations. 5. The heating apparatus according to claim 1, wherein the support member further includes an outer peripheral wall surrounding the strip. 6. The heating apparatus according to claim 5, wherein the outer peripheral wall defines at least one annular groove. 7. The heating apparatus according to claim 5, wherein the outer peripheral wall defines an outer boundary of an exhaust gas flow channel through the container body. 8. The heating apparatus according to claim 5, wherein the container body defines an outer boundary of an exhaust gas flow channel and the outer peripheral wall is a separate component from the container body and is disposed inside the container body. 9. The heating apparatus according to claim 5, wherein the outer peripheral wall is fixed to the strip. 10. The heating apparatus according to claim 1, wherein the strip is fixed to the at least one heater element at a plurality of contact points, the plurality of contact points being spaced at a spacing along a length of the strip, the spacing is less than ten times an outside diameter of the at least one heater element. 11. The heating apparatus according to claim 10, wherein a natural frequency of vibration for sections of the at least one heater element between adjacent two of the contacts points is greater than 400 Hz. 12. The heating apparatus according to claim 10, wherein the number of contact points is selected such that a temperature variation across the heating apparatus is less than 200° C. 13. The heating apparatus according to claim 1, wherein the at least one heating element has a power density greater than 84 watts/in2 for the sheath. 14. A heating apparatus for a fluid flow system having a fluid conduit, the heating apparatus comprising:
at least one heater element within the fluid conduit, the at least one heater element including a resistance wire, a sheath, and an insulating material, the sheath having a closed profile shape that extends along a tortuous path through the container body and surrounds the resistance wire along the tortuous path, the insulating material disposed about the resistance wire between the resistance wire and the sheath; and a support member disposed within the fluid conduit and configured for restricting movement of the at least one heater element relative to the fluid conduit, the support member defining a corrugated geometry that follows the tortuous path while contacting the sheath along a majority of a length of the sheath, wherein the insulating material electrically insulates the resistance wire from the sheath, wherein the support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit. 15. The heating apparatus according to claim 14, wherein the support member includes a strip that defines the corrugated geometry. 16. The heating apparatus according to claim 14, wherein the corrugated shape includes a plurality of ridges and grooves and the strip defines a plurality of indentions disposed at the ridges and grooves, the sheath being received in the indentions. 17. The heating apparatus according to claim 14, wherein the support member includes a peripheral wall that defines an outer boundary of a gas flow channel of the fluid conduit. 18. A heating apparatus for a fluid flow system having a fluid conduit, the heating apparatus comprising:
at least one heater element extending along a tortuous path within the fluid conduit, the at least one heater element including a resistance wire and an insulating material disposed about the resistance wire; and a continuous support member disposed within the fluid conduit and configured for restricting movement of the at least one heater element relative to the fluid conduit, the support member defining a tortuous geometry and following the tortuous path such that one side of a region of the heater element contacts a first location on the support member and an opposite side of the region of the heater element is flanked by a second location on the support member, the second location being further along the tortuous path than the first location, wherein the insulating material electrically insulates the resistance wire from the support member, wherein the support member increases heat transfer from the at least one heater element to a fluid flowing through the fluid conduit. 19. The heating apparatus according to claim 18, wherein the tortuous path is a spiral path. 20. The heating apparatus according to claim 19, wherein the support member includes a strip that defines the tortuous geometry and follows the spiral path. | 3,600 |
348,661 | 16,806,104 | 3,653 | An electronic component-embedded substrate includes an electronic component module having a first surface and a second surface opposite to the first surface, and including a first support member having a first through-portion, a first electronic component disposed in the first through-portion, a first resin layer covering at least a portion of the first electronic component, a second support member disposed on one side of the first support member and having a second through-portion, a second electronic component disposed in the second through-portion and connected to the first electronic component, and a second resin layer covering at least a portion of the second electronic component, an insulating material covering at least a portion of each of a side surface of the electronic component module and the first surface, and a first wiring layer disposed on the insulating material and connected to the first electronic component. | 1. An electronic component-embedded substrate comprising:
an electronic component module having a first surface and a second surface opposite to the first surface, and including a first support member having a first through-portion, a first electronic component disposed in the first through-portion, a first resin layer covering at least a portion of the first electronic component, a second support member disposed on one side of the first support member and having a second through-portion, a second electronic component disposed in the second through-portion and connected to the first electronic component, and a second resin layer covering at least a portion of the second electronic component; an insulating material covering at least a portion of each of a side surface and the first surface of the electronic component module; and a first wiring layer disposed on the insulating material and connected to the first electronic component, wherein the first electronic component and the second electronic component are electrically connected to each other by at least two connection conductors arranged therebetween in a thickness direction, and wherein at least one of the first resin layer or the second resin layer is disposed between the at least two connection conductors in a direction perpendicular to the thickness direction. 2. The electronic component-embedded substrate of claim 1, wherein the first electronic component and the second electronic component are capacitors respectively having electrodes,
wherein the electrodes are connected to each other in parallel. 3. The electronic component-embedded substrate of claim 2, wherein each of the electrodes comprises a first electrode and a second electrode,
the first electrode of the first electronic component is connected to the first electrode of the second electronic component, and the second electrode of the first electronic component is connected to the second electrode of the second electronic component. 4. (canceled) 5. The electronic component-embedded substrate of claim 1, wherein at least one of the at least two connection conductors comprises at least one of a solder or a conductive paste. 6. The electronic component-embedded substrate of claim 1, wherein at least a portion of the at least two connection conductors is embedded in the first resin layer. 7. The electronic component-embedded substrate of claim 1, wherein the first electronic component and the second electronic component are disposed in a thickness direction of each of the first electronic component and the second electronic component. 8. The electronic component-embedded substrate of claim 7, wherein on a plane, the second electronic component is disposed to overlap the first electronic component. 9. The electronic component-embedded substrate of claim 1, wherein the first electronic component is provided as a plurality of first electronic components, and the plurality of first electronic components are disposed spaced apart from each other in the first through-portion, and
the second electronic component is provided as a plurality of second electronic components, and the plurality of second electronic components are disposed spaced apart from each other in the second through-portion. 10. The electronic component-embedded substrate of claim 1, further comprising a core member having a cavity,
wherein the electronic component module is disposed in the cavity. 11. The electronic component-embedded substrate of claim 10, further comprising:
a first build-up structure including the first wiring layer; and a second build-up structure disposed on the second surface of the electronic component module and including a second wiring layer connected to the second electronic component. 12. The electronic component-embedded substrate of claim 11, wherein the first build-up structure further comprises a first via penetrating through the insulating material and connecting the first wiring layer and the first electronic component, and
the second build-up structure further comprises a second via penetrating through the second resin layer and connecting the second wiring layer and the second electronic component. 13. The electronic component-embedded substrate of claim 12, wherein the first and second vias are tapered in directions opposite to each other. 14. The electronic component-embedded substrate of claim 11, further comprising a through-via penetrating through the core member and the insulating material and connecting the first wiring layer and the second wiring layer to each other. 15. The electronic component-embedded substrate of claim 1, further comprising a third electronic component disposed at a level between the first electronic component and the second electronic component. 16. The electronic component-embedded substrate of claim 15, wherein the first electronic component and the third electronic component are connected to each other by a first connection conductor, among the at least two connection conductors, comprising a solder or a conductive paste, and
the second electronic component and the third electronic component are connected to each other by a second connection conductor, among the at least two connection conductors, comprising a solder or a conductive paste. 17. The electronic component-embedded substrate of claim 16, wherein the first electronic component is connected to a first wiring layer disposed on the first surface by a first via, and
the second electronic component is connected to a second wiring layer disposed on the second surface by a second via. 18. The electronic component-embedded substrate of claim 1, wherein at least a portion of each of the first support member and the first electronic component is exposed to the first surface of the electronic component module. 19. An electronic component-embedded substrate comprising:
a core member having a cavity; an electronic component module disposed in the cavity, the electronic component module including a first electronic component, a second electronic component disposed on one side of the first electronic component and connected to the first electronic component in parallel, and at least two connection conductors arranged between the first electronic component and the second electronic component in a thickness direction; a first insulating material covering at least a portion of the electronic component module; and a second insulating material disposed between the at least two connection conductors in a direction perpendicular to the thickness direction, wherein at least one of the at least two connection conductors includes a solder or a conductive paste. 20. The electronic component-embedded substrate of claim 19, wherein the first electronic component and the second electronic component are connected to first and second wiring layers disposed on opposing sides of the electronic component module by first and second vias, respectively, and
the first and second vias are tapered in directions opposite to each other. | An electronic component-embedded substrate includes an electronic component module having a first surface and a second surface opposite to the first surface, and including a first support member having a first through-portion, a first electronic component disposed in the first through-portion, a first resin layer covering at least a portion of the first electronic component, a second support member disposed on one side of the first support member and having a second through-portion, a second electronic component disposed in the second through-portion and connected to the first electronic component, and a second resin layer covering at least a portion of the second electronic component, an insulating material covering at least a portion of each of a side surface of the electronic component module and the first surface, and a first wiring layer disposed on the insulating material and connected to the first electronic component.1. An electronic component-embedded substrate comprising:
an electronic component module having a first surface and a second surface opposite to the first surface, and including a first support member having a first through-portion, a first electronic component disposed in the first through-portion, a first resin layer covering at least a portion of the first electronic component, a second support member disposed on one side of the first support member and having a second through-portion, a second electronic component disposed in the second through-portion and connected to the first electronic component, and a second resin layer covering at least a portion of the second electronic component; an insulating material covering at least a portion of each of a side surface and the first surface of the electronic component module; and a first wiring layer disposed on the insulating material and connected to the first electronic component, wherein the first electronic component and the second electronic component are electrically connected to each other by at least two connection conductors arranged therebetween in a thickness direction, and wherein at least one of the first resin layer or the second resin layer is disposed between the at least two connection conductors in a direction perpendicular to the thickness direction. 2. The electronic component-embedded substrate of claim 1, wherein the first electronic component and the second electronic component are capacitors respectively having electrodes,
wherein the electrodes are connected to each other in parallel. 3. The electronic component-embedded substrate of claim 2, wherein each of the electrodes comprises a first electrode and a second electrode,
the first electrode of the first electronic component is connected to the first electrode of the second electronic component, and the second electrode of the first electronic component is connected to the second electrode of the second electronic component. 4. (canceled) 5. The electronic component-embedded substrate of claim 1, wherein at least one of the at least two connection conductors comprises at least one of a solder or a conductive paste. 6. The electronic component-embedded substrate of claim 1, wherein at least a portion of the at least two connection conductors is embedded in the first resin layer. 7. The electronic component-embedded substrate of claim 1, wherein the first electronic component and the second electronic component are disposed in a thickness direction of each of the first electronic component and the second electronic component. 8. The electronic component-embedded substrate of claim 7, wherein on a plane, the second electronic component is disposed to overlap the first electronic component. 9. The electronic component-embedded substrate of claim 1, wherein the first electronic component is provided as a plurality of first electronic components, and the plurality of first electronic components are disposed spaced apart from each other in the first through-portion, and
the second electronic component is provided as a plurality of second electronic components, and the plurality of second electronic components are disposed spaced apart from each other in the second through-portion. 10. The electronic component-embedded substrate of claim 1, further comprising a core member having a cavity,
wherein the electronic component module is disposed in the cavity. 11. The electronic component-embedded substrate of claim 10, further comprising:
a first build-up structure including the first wiring layer; and a second build-up structure disposed on the second surface of the electronic component module and including a second wiring layer connected to the second electronic component. 12. The electronic component-embedded substrate of claim 11, wherein the first build-up structure further comprises a first via penetrating through the insulating material and connecting the first wiring layer and the first electronic component, and
the second build-up structure further comprises a second via penetrating through the second resin layer and connecting the second wiring layer and the second electronic component. 13. The electronic component-embedded substrate of claim 12, wherein the first and second vias are tapered in directions opposite to each other. 14. The electronic component-embedded substrate of claim 11, further comprising a through-via penetrating through the core member and the insulating material and connecting the first wiring layer and the second wiring layer to each other. 15. The electronic component-embedded substrate of claim 1, further comprising a third electronic component disposed at a level between the first electronic component and the second electronic component. 16. The electronic component-embedded substrate of claim 15, wherein the first electronic component and the third electronic component are connected to each other by a first connection conductor, among the at least two connection conductors, comprising a solder or a conductive paste, and
the second electronic component and the third electronic component are connected to each other by a second connection conductor, among the at least two connection conductors, comprising a solder or a conductive paste. 17. The electronic component-embedded substrate of claim 16, wherein the first electronic component is connected to a first wiring layer disposed on the first surface by a first via, and
the second electronic component is connected to a second wiring layer disposed on the second surface by a second via. 18. The electronic component-embedded substrate of claim 1, wherein at least a portion of each of the first support member and the first electronic component is exposed to the first surface of the electronic component module. 19. An electronic component-embedded substrate comprising:
a core member having a cavity; an electronic component module disposed in the cavity, the electronic component module including a first electronic component, a second electronic component disposed on one side of the first electronic component and connected to the first electronic component in parallel, and at least two connection conductors arranged between the first electronic component and the second electronic component in a thickness direction; a first insulating material covering at least a portion of the electronic component module; and a second insulating material disposed between the at least two connection conductors in a direction perpendicular to the thickness direction, wherein at least one of the at least two connection conductors includes a solder or a conductive paste. 20. The electronic component-embedded substrate of claim 19, wherein the first electronic component and the second electronic component are connected to first and second wiring layers disposed on opposing sides of the electronic component module by first and second vias, respectively, and
the first and second vias are tapered in directions opposite to each other. | 3,600 |
348,662 | 16,806,174 | 3,771 | The present invention relates to an intraluminal vessel prosthesis system for implantation in the region of the aortic arch of a patient, comprising a hollow cylindrical main vessel prosthesis, wherein the hollow cylindrical main vessel prosthesis is configured and dimensioned for implantation in the region of the artic arch and the descending aorta (Aorta descendens) of the patient and wherein the main vessel prosthesis, at least over part of the length L2 of the anchoring vessel prosthesis, and wherein the diameter D2 of the anchoring vessel prosthesis is at least 45% smaller than the diameter D1 of the main vessel prosthesis and wherein the length L2 of the anchoring vessel prosthesis is shorter than the length L2 of the main vessel prosthesis. | 1. An intraluminal vascular prosthesis system for implantation in the region of the aortic arch of a patient, comprising:
a hollow-cylindrical main vessel prosthesis, which has a lumen routed through the main vessel prosthesis, a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L1 and a diameter D1, wherein the hollow-cylindrical main vessel prosthesis is configured and dimensioned for implantation in the region of the aortic arch and the descending aorta of the patient, and wherein the main vessel prosthesis has at least one hollow-cylindrical anchoring vessel prosthesis, which has a lumen routed through the anchoring vessel prosthesis, a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L2 and a diameter D2, wherein the anchoring vessel prosthesis is securely attached within the lumen of the main vessel prosthesis, at least over part of the length L2 of the anchoring vessel prosthesis, and wherein the diameter D2 of the anchoring vessel prosthesis is at least 45% smaller than the diameter D1 of the main vessel prosthesis, and wherein the length L2 of the anchoring vessel prosthesis is shorter than the length L1 of the main vessel prosthesis. 2. The intraluminal vascular prosthesis system as claimed in claim 1, characterized in that the vascular prosthesis system moreover comprises
at least one hollow-cylindrical side vessel prosthesis, with a lumen routed through the side vessel prosthesis, wherein the side vessel prosthesis has a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L3 and a diameter D3, and wherein the hollow-cylindrical side vessel prosthesis for implantation is designed and dimensioned to bridge the outlet of the subclavian artery and/or the carotid artery of the patient, in such a way that the side vessel prosthesis can be positioned with its first lumen end in the subclavian artery and/or the carotid artery, and, in order to securely anchor the side vessel prosthesis, its second lumen end can be inserted at least partially into and fixed in the lumen of the anchoring vessel prosthesis via the first lumen end of the anchoring vessel prosthesis. 3. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the main vessel prosthesis and/or the anchoring vessel prosthesis and/or the side vessel prosthesis have/has a stent frame and a prosthesis material secured on the latter. 4. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis is chosen from a laser-cut stent frame, individual stent springs or a braided stent frame. 5. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis has non-interconnected stent rings, which are arranged in succession and extend circumferentially in a meandering formation, and a prosthesis material fixedly connected to the stent rings. 6. The intraluminal vascular prosthesis system as claimed in claim 5, wherein the meandering circumferential course of at least one stent ring of the stent frame has a non-uniform amplitude. 7. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis is self-expandable. 8. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D1 of the main vessel prosthesis is from 24 mm to 42 mm, in particular 24 mm, 26 mm, 28 mm, 30 mm, 32 mm, 34 mm, 36 mm, 38 mm, 40 mm or 42 mm. 9. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D2 of the anchoring vessel prosthesis is from 6 mm to 14 mm, in particular 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm or 14 mm. 10. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D3 of the side vessel prosthesis is from 6 mm to 16 mm, in particular 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, 15 mm or 16 mm. 11. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the anchoring vessel prosthesis, in the lumen of the main vessel prosthesis, is mounted on an inner wall, preferably by sewing, adhesive bonding or welding. 12. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the second lumen end of the side vessel prosthesis is insertable, via the first lumen end of the main vessel prosthesis, into the first lumen end of the anchoring vessel prosthesis and at least partially into the lumen thereof. 13. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the main vessel prosthesis has a jacket surface, and a fenestration, which is provided in the jacket surface and via which the second lumen end of the side vessel prosthesis is insertable into the lumen of the main vessel prosthesis and at least partially into the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 14. A method for the implantation of an intraluminal vascular prosthesis system as claimed in claim 2 into the aortic arch of a patient, wherein the method comprises the following steps:
inserting and releasing the main vessel prosthesis in the region of the aortic arch and of the descending aorta,
inserting and releasing the side vessel prosthesis with its first lumen end in the subclavian artery and/or in the carotid artery and with its second lumen end at least partially in the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 15. The method as claimed in claim 14, wherein the side vessel prosthesis is inserted into the lumen of the anchoring vessel prosthesis via the first lumen end of the main vessel prosthesis. 16. The method as claimed in claim 14, wherein the main vessel prosthesis has a jacket surface and a fenestration provided in the jacket surface, and in that the side vessel prosthesis is inserted via the fenestration in the main vessel prosthesis into the lumen of the main vessel prosthesis and at least partially into the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 17. A method for treating a vascular disease in the aortic arch of a subject in need thereof, the method comprising the following steps:
providing the intraluminal vascular prosthesis system as claimed in claim 2, inserting and releasing the main vessel prosthesis of the intraluminal vascular prosthesis system in the region of the aortic arch and of the descending aorta, inserting and releasing the side vessel prosthesis with its first lumen end in the subclavian artery and/or in the carotid artery and with its second lumen end at least partially in the lumen of the anchoring vessel prosthesis via the first lumen end of the latter, thereby treating the vascular disease. | The present invention relates to an intraluminal vessel prosthesis system for implantation in the region of the aortic arch of a patient, comprising a hollow cylindrical main vessel prosthesis, wherein the hollow cylindrical main vessel prosthesis is configured and dimensioned for implantation in the region of the artic arch and the descending aorta (Aorta descendens) of the patient and wherein the main vessel prosthesis, at least over part of the length L2 of the anchoring vessel prosthesis, and wherein the diameter D2 of the anchoring vessel prosthesis is at least 45% smaller than the diameter D1 of the main vessel prosthesis and wherein the length L2 of the anchoring vessel prosthesis is shorter than the length L2 of the main vessel prosthesis.1. An intraluminal vascular prosthesis system for implantation in the region of the aortic arch of a patient, comprising:
a hollow-cylindrical main vessel prosthesis, which has a lumen routed through the main vessel prosthesis, a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L1 and a diameter D1, wherein the hollow-cylindrical main vessel prosthesis is configured and dimensioned for implantation in the region of the aortic arch and the descending aorta of the patient, and wherein the main vessel prosthesis has at least one hollow-cylindrical anchoring vessel prosthesis, which has a lumen routed through the anchoring vessel prosthesis, a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L2 and a diameter D2, wherein the anchoring vessel prosthesis is securely attached within the lumen of the main vessel prosthesis, at least over part of the length L2 of the anchoring vessel prosthesis, and wherein the diameter D2 of the anchoring vessel prosthesis is at least 45% smaller than the diameter D1 of the main vessel prosthesis, and wherein the length L2 of the anchoring vessel prosthesis is shorter than the length L1 of the main vessel prosthesis. 2. The intraluminal vascular prosthesis system as claimed in claim 1, characterized in that the vascular prosthesis system moreover comprises
at least one hollow-cylindrical side vessel prosthesis, with a lumen routed through the side vessel prosthesis, wherein the side vessel prosthesis has a first lumen end, a second lumen end, a hollow-cylindrical stent frame, optionally with a prosthesis material secured thereon, a length L3 and a diameter D3, and wherein the hollow-cylindrical side vessel prosthesis for implantation is designed and dimensioned to bridge the outlet of the subclavian artery and/or the carotid artery of the patient, in such a way that the side vessel prosthesis can be positioned with its first lumen end in the subclavian artery and/or the carotid artery, and, in order to securely anchor the side vessel prosthesis, its second lumen end can be inserted at least partially into and fixed in the lumen of the anchoring vessel prosthesis via the first lumen end of the anchoring vessel prosthesis. 3. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the main vessel prosthesis and/or the anchoring vessel prosthesis and/or the side vessel prosthesis have/has a stent frame and a prosthesis material secured on the latter. 4. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis is chosen from a laser-cut stent frame, individual stent springs or a braided stent frame. 5. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis has non-interconnected stent rings, which are arranged in succession and extend circumferentially in a meandering formation, and a prosthesis material fixedly connected to the stent rings. 6. The intraluminal vascular prosthesis system as claimed in claim 5, wherein the meandering circumferential course of at least one stent ring of the stent frame has a non-uniform amplitude. 7. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the stent frame of the main vessel prosthesis and/or the stent frame of the anchoring vessel prosthesis and/or the stent frame of the side vessel prosthesis is self-expandable. 8. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D1 of the main vessel prosthesis is from 24 mm to 42 mm, in particular 24 mm, 26 mm, 28 mm, 30 mm, 32 mm, 34 mm, 36 mm, 38 mm, 40 mm or 42 mm. 9. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D2 of the anchoring vessel prosthesis is from 6 mm to 14 mm, in particular 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm or 14 mm. 10. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the diameter D3 of the side vessel prosthesis is from 6 mm to 16 mm, in particular 6 mm, 7 mm, 8 mm, 9 mm, 10 mm, 11 mm, 12 mm, 13 mm, 14 mm, 15 mm or 16 mm. 11. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the anchoring vessel prosthesis, in the lumen of the main vessel prosthesis, is mounted on an inner wall, preferably by sewing, adhesive bonding or welding. 12. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the second lumen end of the side vessel prosthesis is insertable, via the first lumen end of the main vessel prosthesis, into the first lumen end of the anchoring vessel prosthesis and at least partially into the lumen thereof. 13. The intraluminal vascular prosthesis system as claimed in claim 2, wherein the main vessel prosthesis has a jacket surface, and a fenestration, which is provided in the jacket surface and via which the second lumen end of the side vessel prosthesis is insertable into the lumen of the main vessel prosthesis and at least partially into the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 14. A method for the implantation of an intraluminal vascular prosthesis system as claimed in claim 2 into the aortic arch of a patient, wherein the method comprises the following steps:
inserting and releasing the main vessel prosthesis in the region of the aortic arch and of the descending aorta,
inserting and releasing the side vessel prosthesis with its first lumen end in the subclavian artery and/or in the carotid artery and with its second lumen end at least partially in the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 15. The method as claimed in claim 14, wherein the side vessel prosthesis is inserted into the lumen of the anchoring vessel prosthesis via the first lumen end of the main vessel prosthesis. 16. The method as claimed in claim 14, wherein the main vessel prosthesis has a jacket surface and a fenestration provided in the jacket surface, and in that the side vessel prosthesis is inserted via the fenestration in the main vessel prosthesis into the lumen of the main vessel prosthesis and at least partially into the lumen of the anchoring vessel prosthesis via the first lumen end of the latter. 17. A method for treating a vascular disease in the aortic arch of a subject in need thereof, the method comprising the following steps:
providing the intraluminal vascular prosthesis system as claimed in claim 2, inserting and releasing the main vessel prosthesis of the intraluminal vascular prosthesis system in the region of the aortic arch and of the descending aorta, inserting and releasing the side vessel prosthesis with its first lumen end in the subclavian artery and/or in the carotid artery and with its second lumen end at least partially in the lumen of the anchoring vessel prosthesis via the first lumen end of the latter, thereby treating the vascular disease. | 3,700 |
348,663 | 16,806,184 | 3,771 | The present invention provides a coin handling device that enables a simple and easy change of a way of handling a coin of which a type is difficult to determine according to the user needs. The coin handling device includes a detector that detects a feature of a coin, a determiner that determines a type of the coin based on the feature of the coin detected by the detector, a reception unit that receives from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted by the determiner, and a handling unit that handles the indeterminate coin based on the handling settings received by the reception unit. | 1. A coin handling device comprising:
a detector that detects a feature of a coin; a determiner that determines a type of the coin based on the feature of the coin detected by the detector; a reception unit that receives from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted by the determiner; and a handling unit that handles the indeterminate coin based on the handling settings received by the reception unit. 2. The coin handling device according to claim 1,
wherein the detector includes a magnetic sensor that detects a magnetic feature of the coin. 3. The coin handling device according to claim 1,
wherein the detector includes an image sensor that detects an optical feature of the coin. 4. The coin handling device according to claim 1,
wherein the multiple options of the type have the same denomination. 5. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates the indeterminate coin as a coin to be subjected to rejection handling, and wherein the handling unit performs the rejection handling on the indeterminate coin. 6. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates the indeterminate coin as a coin of a type having a highest degree of similarity among the multiple options of the type, and wherein the handling unit handles the indeterminate coin as a coin of the type having the highest degree of similarity among the multiple options of the type. 7. The coin handling device according to claim 6,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination as that of a coin of the non-rare type. 8. The coin handling device according to claim 6,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 9. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates a degree of priority of the type of the indeterminate coin, and wherein the handling unit handles the indeterminate coin as a coin of a type having a highest degree of priority among the multiple options of the type. 10. The coin handling device according to claim 9,
wherein the multiple options of the type are a rare type and a non-rare type having the same denomination as the rare type, wherein the setting item designates the non-rare type to have a higher degree of priority than the rare type, and wherein the handling unit handles the indeterminate coin as a coin of the non-rare type. 11. The coin handling device according to claim 10,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination as that of a coin of the non-rare type. 12. The coin handling device according to claim 10,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 13. The coin handling device according to claim 9,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the setting item designates the rare type to have a higher degree of priority than the non-rare type, and wherein the handling unit handles the indeterminate coin as a coin of the rare type. 14. The coin handling device according to claim 13,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination of a coin of the non-rare type. 15. The coin handling device according to claim 13,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 16. A coin handling method comprising:
detecting a feature of a coin; determining a type of the coin based on the feature of the coin detected in the detecting; receiving from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted in the determining; and handling the indeterminate coin based on the handling settings received in the receiving. | The present invention provides a coin handling device that enables a simple and easy change of a way of handling a coin of which a type is difficult to determine according to the user needs. The coin handling device includes a detector that detects a feature of a coin, a determiner that determines a type of the coin based on the feature of the coin detected by the detector, a reception unit that receives from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted by the determiner, and a handling unit that handles the indeterminate coin based on the handling settings received by the reception unit.1. A coin handling device comprising:
a detector that detects a feature of a coin; a determiner that determines a type of the coin based on the feature of the coin detected by the detector; a reception unit that receives from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted by the determiner; and a handling unit that handles the indeterminate coin based on the handling settings received by the reception unit. 2. The coin handling device according to claim 1,
wherein the detector includes a magnetic sensor that detects a magnetic feature of the coin. 3. The coin handling device according to claim 1,
wherein the detector includes an image sensor that detects an optical feature of the coin. 4. The coin handling device according to claim 1,
wherein the multiple options of the type have the same denomination. 5. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates the indeterminate coin as a coin to be subjected to rejection handling, and wherein the handling unit performs the rejection handling on the indeterminate coin. 6. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates the indeterminate coin as a coin of a type having a highest degree of similarity among the multiple options of the type, and wherein the handling unit handles the indeterminate coin as a coin of the type having the highest degree of similarity among the multiple options of the type. 7. The coin handling device according to claim 6,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination as that of a coin of the non-rare type. 8. The coin handling device according to claim 6,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 9. The coin handling device according to claim 1,
wherein the handling settings include a setting item that designates a degree of priority of the type of the indeterminate coin, and wherein the handling unit handles the indeterminate coin as a coin of a type having a highest degree of priority among the multiple options of the type. 10. The coin handling device according to claim 9,
wherein the multiple options of the type are a rare type and a non-rare type having the same denomination as the rare type, wherein the setting item designates the non-rare type to have a higher degree of priority than the rare type, and wherein the handling unit handles the indeterminate coin as a coin of the non-rare type. 11. The coin handling device according to claim 10,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination as that of a coin of the non-rare type. 12. The coin handling device according to claim 10,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 13. The coin handling device according to claim 9,
wherein the multiple options of the type are a rare type and a non-rare type that is equal in denomination to the rare type, wherein the setting item designates the rare type to have a higher degree of priority than the non-rare type, and wherein the handling unit handles the indeterminate coin as a coin of the rare type. 14. The coin handling device according to claim 13,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the same transport destination of a coin of the non-rare type. 15. The coin handling device according to claim 13,
wherein the handling settings include a setting item that designates a transport destination of the indeterminate coin to a transport destination different from that of a coin of the non-rare type, and wherein the handling unit performs handling of transporting the indeterminate coin to the transport destination different from that of a coin of the non-rare type. 16. A coin handling method comprising:
detecting a feature of a coin; determining a type of the coin based on the feature of the coin detected in the detecting; receiving from an operating person handling settings that designate a way of handling the coin that is an indeterminate coin of which the type is not determined and for which multiple options of the type are extracted in the determining; and handling the indeterminate coin based on the handling settings received in the receiving. | 3,700 |
348,664 | 16,806,152 | 3,771 | Diamond bodies and methods of manufacture are disclosed. Diamond bodies are formed from at least a bimodal, alternatively a tri-modal or higher modal, feedstock having at least one fraction of modified diamond particles with a fine particle size (0.5-3.0 μm) and at least one fraction of diamond particles with coarse particle size (15.0 to 30 μm). During high pressure-high temperature processing, fine particle sized, modified diamond particles in the first fraction preferentially fracture to smaller sizes while preserving the morphology of coarse particle sized diamond particles in the second fraction. Diamond bodies incorporating the two fractions have a microstructure including second fraction diamond particles dispersed in a continuous matrix of first fraction modified diamond particles and exhibit improved wear characteristics, particularly for wear associated with drilling of geological formations. | 1.-4. (canceled) 5. A feedstock for manufacturing a polycrystalline diamond body, the feedstock comprising:
a plurality of diamond particles including at least one fraction of modified diamond particles having a first median particle distribution D50 and at least one fraction of monocrystalline diamond particles having a second median particle distribution D50; wherein the first median particle distribution D50 is less than the second median particle distribution D50, and wherein at least about 40% of the first fraction of modified diamond grains have a sphericity of less than about 0.7 and at least about 75% of the second fraction of monocrystalline diamond grains have a sphericity of greater than about 0.8. 6. The feedstock of claim 5, wherein the second median particle distribution D50 is at least about 7 times the first median particle distribution D50, 7. The feedstock of claim 5, wherein the first fraction of modified diamond grains comprises from about 20 vol. % to 40 vol % of the diamond particles in the feedstock, and wherein the second fraction of monocrystalline diamond grains comprises from about 80 vol. % to 60 vol % of the diamond particles in the feedstock 8. The feedstock of claim 5, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm. 9. The feedstock of claim 8, wherein the first median particle distribution D50 is from about 0.5 μm to about 3 μm. 10. The feedstock of claim 5, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm. 11. The feedstock of claim 10 wherein the second median particle distribution D50 is from about 15.0 μm to about 30.0 μm. 12. The feedstock of claim 10 wherein the second median particle distribution D50 is from about 15.0 μm to about 20.0 μm. 13. The feedstock of claim 5, wherein the at least one fraction of modified diamond particles is distributed within a volume of the at least one fraction of monocrystalline diamond particles to form a homogenous mixture. 14. A feedstock for manufacturing a polycrystalline diamond body, the feedstock comprising:
a plurality of diamond particles including a first fraction of modified diamond particles having a first median particle distribution D50, a second fraction of monocrystalline diamond particles having a second median particle distribution D50, and a third fraction of diamond particles having a third median particle distribution D50, wherein the first median particle distribution D50 (i) is less than the second median particle distribution D50 and (ii) is less than the third median particle distribution D50, wherein the second median particle distribution D50 (i) is greater than the first median particle distribution D50 and (ii) is greater than the third median particle distribution D50, and wherein at least about 40% of the first fraction of modified diamond grains have a sphericity of less than about 0.7 and at least about 75% of the second fraction of monocrystalline diamond grains have a sphericity of greater than about 0.8. 15. The feedstock of claim 14, wherein the diamond particles in the third fraction of diamond particles are modified diamond particles. 16. The feedstock of claim 14, wherein the diamond particles in the third fraction of diamond particles are monocrystalline diamond particles. 17. The feedstock of claim 14, wherein the first fraction of modified diamond particles comprises >0 vol. % to less than about 10 vol. % of the feedstock,
wherein the third fraction of diamond particles comprises about 20 vol. % to less than about 40 vol. % of the feedstock, and wherein the second fraction of monocrystalline diamond particles comprises a balance (in vol. %) of the feedstock. 18. The feedstock of claim 17, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm. 19. The feedstock of claim 17, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm. 20. The feedstock of claim 17, wherein the third median particle distribution D50 is from about 3.0 μm to about 10.0 μm. 21. The feedstock of claim 14, wherein the first fraction of modified diamond particles comprises 2 vol. % to less than about 8 vol. % of the feedstock,
wherein the third fraction of diamond particles comprises about 20 vol. % to less than about 40 vol. % of the feedstock, and wherein the second fraction of monocrystalline diamond particles comprises greater than 60 vol. % of the feedstock. 22. The feedstock of claim 21, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm, and wherein the third median particle distribution D50 is from about 3.0 μm to about 10.0 μm. 23. The feedstock of claim 14, wherein the first fraction of modified diamond particles and the third fraction of diamond particles are distributed within a volume of the second fraction of monocrystalline diamond particles to form a homogenous mixture. | Diamond bodies and methods of manufacture are disclosed. Diamond bodies are formed from at least a bimodal, alternatively a tri-modal or higher modal, feedstock having at least one fraction of modified diamond particles with a fine particle size (0.5-3.0 μm) and at least one fraction of diamond particles with coarse particle size (15.0 to 30 μm). During high pressure-high temperature processing, fine particle sized, modified diamond particles in the first fraction preferentially fracture to smaller sizes while preserving the morphology of coarse particle sized diamond particles in the second fraction. Diamond bodies incorporating the two fractions have a microstructure including second fraction diamond particles dispersed in a continuous matrix of first fraction modified diamond particles and exhibit improved wear characteristics, particularly for wear associated with drilling of geological formations.1.-4. (canceled) 5. A feedstock for manufacturing a polycrystalline diamond body, the feedstock comprising:
a plurality of diamond particles including at least one fraction of modified diamond particles having a first median particle distribution D50 and at least one fraction of monocrystalline diamond particles having a second median particle distribution D50; wherein the first median particle distribution D50 is less than the second median particle distribution D50, and wherein at least about 40% of the first fraction of modified diamond grains have a sphericity of less than about 0.7 and at least about 75% of the second fraction of monocrystalline diamond grains have a sphericity of greater than about 0.8. 6. The feedstock of claim 5, wherein the second median particle distribution D50 is at least about 7 times the first median particle distribution D50, 7. The feedstock of claim 5, wherein the first fraction of modified diamond grains comprises from about 20 vol. % to 40 vol % of the diamond particles in the feedstock, and wherein the second fraction of monocrystalline diamond grains comprises from about 80 vol. % to 60 vol % of the diamond particles in the feedstock 8. The feedstock of claim 5, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm. 9. The feedstock of claim 8, wherein the first median particle distribution D50 is from about 0.5 μm to about 3 μm. 10. The feedstock of claim 5, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm. 11. The feedstock of claim 10 wherein the second median particle distribution D50 is from about 15.0 μm to about 30.0 μm. 12. The feedstock of claim 10 wherein the second median particle distribution D50 is from about 15.0 μm to about 20.0 μm. 13. The feedstock of claim 5, wherein the at least one fraction of modified diamond particles is distributed within a volume of the at least one fraction of monocrystalline diamond particles to form a homogenous mixture. 14. A feedstock for manufacturing a polycrystalline diamond body, the feedstock comprising:
a plurality of diamond particles including a first fraction of modified diamond particles having a first median particle distribution D50, a second fraction of monocrystalline diamond particles having a second median particle distribution D50, and a third fraction of diamond particles having a third median particle distribution D50, wherein the first median particle distribution D50 (i) is less than the second median particle distribution D50 and (ii) is less than the third median particle distribution D50, wherein the second median particle distribution D50 (i) is greater than the first median particle distribution D50 and (ii) is greater than the third median particle distribution D50, and wherein at least about 40% of the first fraction of modified diamond grains have a sphericity of less than about 0.7 and at least about 75% of the second fraction of monocrystalline diamond grains have a sphericity of greater than about 0.8. 15. The feedstock of claim 14, wherein the diamond particles in the third fraction of diamond particles are modified diamond particles. 16. The feedstock of claim 14, wherein the diamond particles in the third fraction of diamond particles are monocrystalline diamond particles. 17. The feedstock of claim 14, wherein the first fraction of modified diamond particles comprises >0 vol. % to less than about 10 vol. % of the feedstock,
wherein the third fraction of diamond particles comprises about 20 vol. % to less than about 40 vol. % of the feedstock, and wherein the second fraction of monocrystalline diamond particles comprises a balance (in vol. %) of the feedstock. 18. The feedstock of claim 17, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm. 19. The feedstock of claim 17, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm. 20. The feedstock of claim 17, wherein the third median particle distribution D50 is from about 3.0 μm to about 10.0 μm. 21. The feedstock of claim 14, wherein the first fraction of modified diamond particles comprises 2 vol. % to less than about 8 vol. % of the feedstock,
wherein the third fraction of diamond particles comprises about 20 vol. % to less than about 40 vol. % of the feedstock, and wherein the second fraction of monocrystalline diamond particles comprises greater than 60 vol. % of the feedstock. 22. The feedstock of claim 21, wherein the first median particle distribution D50 is from about 0.1 μm to about 3 μm, wherein the second median particle distribution D50 is from about 10.0 μm to about 40.0 μm, and wherein the third median particle distribution D50 is from about 3.0 μm to about 10.0 μm. 23. The feedstock of claim 14, wherein the first fraction of modified diamond particles and the third fraction of diamond particles are distributed within a volume of the second fraction of monocrystalline diamond particles to form a homogenous mixture. | 3,700 |
348,665 | 16,806,158 | 3,711 | A play structure having one or more monolith structures for the connection of other surfaces (e.g., deckings, water-based elements, interactive elements, etc.). Each of the monolith structures may be adjustably connected with a ground surface such that a variety of possible angles may be obtained by the monolith with respect to the ground surface. After the desired orientation of the monolith is obtained to the ground surface via the adjustable connection, the monolith may be secured in such position. Water or other fluid may be provided to the monolith structures via piping that interfaces with the monolith structures by a fluid connection that is in communication with piping disposed within the monolith structures. A fluid dumping or delivery system (e.g., based upon a tipping element that provides water to a fluid flowing surface and/or other water dispersion element) may be provided as part of the play structure. | 1. A fluid delivery system comprising:
a fluid delivery element configured to contain a volume of fluid and release such fluid; a fluid flowing element positioned adjacent to the fluid delivery element and configured to receive at least a portion of the volume of fluid from the fluid delivery element; and a fluid dispersion element positioned adjacent to the fluid flowing element and configured to engage with at least a portion of the volume of fluid from the fluid flowing element. 2. The fluid delivery system of claim 1 wherein the fluid delivery element releases fluid via pivoting of the fluid delivery clement. 3. The fluid delivery system of claim 2 wherein the fluid delivery element pivots automatically when the volume of fluid exceeds a predetermined volume. 4. The fluid delivery system of claim 2 wherein the fluid delivery element pivots in response to a signal. 5. The fluid delivery system of claim 4 wherein the signal is based upon a measured weight of the volume of fluid in the fluid delivery element. 6. The fluid delivery system of claim 4 wherein the signal is based upon an elapsed amount of time. 7. The fluid delivery system of claim 1 wherein the fluid flowing element is a sloped surface having a first end adjacent to the fluid delivery element and a second end adjacent to the fluid dispersion clement. 8. The fluid delivery system of claim 7 wherein the fluid flowing element is at least partially translucent. 9. The fluid delivery system of claim 1 wherein the fluid flowing element is a plurality of rotatable buckets configured to rotate in response to the at least a portion of the volume of fluid from the fluid delivery element. 10. The fluid delivery system of Claim 1 wherein the fluid dispersion element is shaped in the form of a corkscrew. 11. The fluid delivery system of claim 1 wherein the fluid dispersion element is configured to rotate in response to the at least a portion of the volume of fluid from the fluid delivery element. 12. The fluid delivery system of claim 11 wherein the fluid dispersion element is configured to rotate about an axis that is perpendicular to the at least a portion of the volume of fluid from the fluid delivery element. 13. The fluid delivery system of claim 1 further comprising a notification element configured to provide a notification that the fluid delivery element is going to deliver the at least a portion of the volume of fluid from the fluid delivery element to the fluid flowing element. 14. The fluid dumping system of claim 13 wherein the notification element emits a sound. 15. The fluid dumping system of claim 13 wherein the notification element receives at least a portion of the volume of fluid from the fluid delivery element that does not release to the fluid flowing element. 16. A play structure comprising:
a monolith including:
a frame,
a connector for fastening the monolith to a ground surface,
a first surface connected with the frame,
a second surface connected with the frame opposing the first surface, wherein a cavity is formed between the first surface and the second surface, and
a fluid conduit disposed within the cavity formed between the first surface and the second surface;
a decking connected with the monolith; and a fluid-based element connected with the monolith; wherein the monolith is configured to rotate with respect to the ground surface via the connector. 17. The play structure of claim 16 wherein the monolith is configured to spin with respect to the ground surface via the connector. 18. The play structure of claim 16 further comprising an interactive element connected with the frame of the monolith, the interactive element configured to be interacted with by a user for a flow of fluid from the fluid conduit to the fluid-based component. 19. A play structure disposed upon a surface comprising:
a base segment; a leveling element connected with the base segment for adjusting a distance of the base segment from the surface a frame connected with the base segment; a decking connected with the frame; a fluid delivery element configured to contain a volume of fluid and release such fluid via pivoting of the fluid delivery element; and a rotatable fluid dispersion element configured to receive at least a portion of the volume of fluid from the fluid delivery element. 20. The play structure of claim 19 wherein the fluid dispersion element is in the shape of a spiral. | A play structure having one or more monolith structures for the connection of other surfaces (e.g., deckings, water-based elements, interactive elements, etc.). Each of the monolith structures may be adjustably connected with a ground surface such that a variety of possible angles may be obtained by the monolith with respect to the ground surface. After the desired orientation of the monolith is obtained to the ground surface via the adjustable connection, the monolith may be secured in such position. Water or other fluid may be provided to the monolith structures via piping that interfaces with the monolith structures by a fluid connection that is in communication with piping disposed within the monolith structures. A fluid dumping or delivery system (e.g., based upon a tipping element that provides water to a fluid flowing surface and/or other water dispersion element) may be provided as part of the play structure.1. A fluid delivery system comprising:
a fluid delivery element configured to contain a volume of fluid and release such fluid; a fluid flowing element positioned adjacent to the fluid delivery element and configured to receive at least a portion of the volume of fluid from the fluid delivery element; and a fluid dispersion element positioned adjacent to the fluid flowing element and configured to engage with at least a portion of the volume of fluid from the fluid flowing element. 2. The fluid delivery system of claim 1 wherein the fluid delivery element releases fluid via pivoting of the fluid delivery clement. 3. The fluid delivery system of claim 2 wherein the fluid delivery element pivots automatically when the volume of fluid exceeds a predetermined volume. 4. The fluid delivery system of claim 2 wherein the fluid delivery element pivots in response to a signal. 5. The fluid delivery system of claim 4 wherein the signal is based upon a measured weight of the volume of fluid in the fluid delivery element. 6. The fluid delivery system of claim 4 wherein the signal is based upon an elapsed amount of time. 7. The fluid delivery system of claim 1 wherein the fluid flowing element is a sloped surface having a first end adjacent to the fluid delivery element and a second end adjacent to the fluid dispersion clement. 8. The fluid delivery system of claim 7 wherein the fluid flowing element is at least partially translucent. 9. The fluid delivery system of claim 1 wherein the fluid flowing element is a plurality of rotatable buckets configured to rotate in response to the at least a portion of the volume of fluid from the fluid delivery element. 10. The fluid delivery system of Claim 1 wherein the fluid dispersion element is shaped in the form of a corkscrew. 11. The fluid delivery system of claim 1 wherein the fluid dispersion element is configured to rotate in response to the at least a portion of the volume of fluid from the fluid delivery element. 12. The fluid delivery system of claim 11 wherein the fluid dispersion element is configured to rotate about an axis that is perpendicular to the at least a portion of the volume of fluid from the fluid delivery element. 13. The fluid delivery system of claim 1 further comprising a notification element configured to provide a notification that the fluid delivery element is going to deliver the at least a portion of the volume of fluid from the fluid delivery element to the fluid flowing element. 14. The fluid dumping system of claim 13 wherein the notification element emits a sound. 15. The fluid dumping system of claim 13 wherein the notification element receives at least a portion of the volume of fluid from the fluid delivery element that does not release to the fluid flowing element. 16. A play structure comprising:
a monolith including:
a frame,
a connector for fastening the monolith to a ground surface,
a first surface connected with the frame,
a second surface connected with the frame opposing the first surface, wherein a cavity is formed between the first surface and the second surface, and
a fluid conduit disposed within the cavity formed between the first surface and the second surface;
a decking connected with the monolith; and a fluid-based element connected with the monolith; wherein the monolith is configured to rotate with respect to the ground surface via the connector. 17. The play structure of claim 16 wherein the monolith is configured to spin with respect to the ground surface via the connector. 18. The play structure of claim 16 further comprising an interactive element connected with the frame of the monolith, the interactive element configured to be interacted with by a user for a flow of fluid from the fluid conduit to the fluid-based component. 19. A play structure disposed upon a surface comprising:
a base segment; a leveling element connected with the base segment for adjusting a distance of the base segment from the surface a frame connected with the base segment; a decking connected with the frame; a fluid delivery element configured to contain a volume of fluid and release such fluid via pivoting of the fluid delivery element; and a rotatable fluid dispersion element configured to receive at least a portion of the volume of fluid from the fluid delivery element. 20. The play structure of claim 19 wherein the fluid dispersion element is in the shape of a spiral. | 3,700 |
348,666 | 16,806,141 | 3,711 | A liquid ejecting head including: a liquid ejecting portion configured to eject a liquid; a supply flow path configured to supply the liquid to the liquid ejecting portion; and a discharging flow path configured to discharge the liquid from the liquid ejecting portion, in which a supply portion along a horizontal plane in the supply flow path and a discharging portion along the horizontal plane in the discharging flow path have different positions with respect to a direction perpendicular to the horizontal plane. | 1. A liquid ejecting head comprising:
a first liquid ejecting portion configured to eject a liquid; a first supply flow path configured to supply the liquid to the first liquid ejecting portion; and a first discharging flow path configured to discharge the liquid from the first liquid ejecting portion, wherein a first supply portion along a horizontal plane in the first supply flow path and a first discharging portion along the horizontal plane in the first discharging flow path have different positions with respect to a direction perpendicular to the horizontal plane. 2. The liquid ejecting head according to claim 1, wherein
the first supply portion and the first discharging portion partially overlap when viewed in the direction perpendicular to the horizontal plane. 3. The liquid ejecting head according to claim 2, wherein
the first discharging portion is located between the first liquid ejecting portion and the first supply portion. 4. The liquid ejecting head according to claim 1, further comprising:
a flow path structure in which the first supply flow path and the first discharging flow path are formed, wherein the first flow path structure includes a stack of substrates, the first supply portion is formed between a first set of substrates among the substrates, and the first discharging portion is formed between a second set of substrates different from the first set among the substrates. 5. The liquid ejecting head according to claim 1, further comprising:
a second liquid ejecting portion configured to eject a liquid, a second supply flow path configured to supply a liquid to the second liquid ejecting portion, a second discharging flow path configured to discharge the liquid from the second liquid ejecting portion, and a second supply portion along the horizontal plane in the second supply flow path and a second discharging portion along the horizontal plane in the second discharging flow path have different positions with respect to the direction perpendicular to the horizontal plane. 6. The liquid ejecting head according to claim 5, wherein
the first supply portion and the second supply portion are located in a first direction perpendicular to the horizontal plane with respect to a predetermined position, and the first discharging portion and the second discharging portion are located in a second direction opposite to the first direction with respect to the predetermined position. 7. The liquid ejecting head according to claim 6, wherein
a consumption amount of the liquid supplied to the second liquid ejecting portion is larger than that of the liquid supplied to the first liquid ejecting portion, and the second discharging portion is located between the first discharging portion and the first supply portion or between the first discharging portion and the second supply portion. 8. The liquid ejecting head according to claim 6, wherein
the liquid supplied to the second liquid ejecting portion is cyan ink or magenta ink, the liquid supplied to the first liquid ejecting portion is color ink other than the cyan ink and the magenta ink, and the second discharging portion is located between the first discharging portion and the first supply portion or between the first discharging portion and the second supply portion. 9. A liquid ejecting apparatus comprising:
the liquid ejecting head according to claim 1; and an ejecting controller controlling ejecting of the liquid by the liquid ejecting head. 10. The liquid ejecting apparatus according to claim 9, further comprising:
a heating mechanism configured to heat the liquid supplied to the first supply flow path. 11. The liquid ejecting head according to claim 5, wherein
the first supply portion, the first discharging portion, the second supply portion, and the second discharging portion partially overlap when viewed in the direction perpendicular to the horizontal plane. | A liquid ejecting head including: a liquid ejecting portion configured to eject a liquid; a supply flow path configured to supply the liquid to the liquid ejecting portion; and a discharging flow path configured to discharge the liquid from the liquid ejecting portion, in which a supply portion along a horizontal plane in the supply flow path and a discharging portion along the horizontal plane in the discharging flow path have different positions with respect to a direction perpendicular to the horizontal plane.1. A liquid ejecting head comprising:
a first liquid ejecting portion configured to eject a liquid; a first supply flow path configured to supply the liquid to the first liquid ejecting portion; and a first discharging flow path configured to discharge the liquid from the first liquid ejecting portion, wherein a first supply portion along a horizontal plane in the first supply flow path and a first discharging portion along the horizontal plane in the first discharging flow path have different positions with respect to a direction perpendicular to the horizontal plane. 2. The liquid ejecting head according to claim 1, wherein
the first supply portion and the first discharging portion partially overlap when viewed in the direction perpendicular to the horizontal plane. 3. The liquid ejecting head according to claim 2, wherein
the first discharging portion is located between the first liquid ejecting portion and the first supply portion. 4. The liquid ejecting head according to claim 1, further comprising:
a flow path structure in which the first supply flow path and the first discharging flow path are formed, wherein the first flow path structure includes a stack of substrates, the first supply portion is formed between a first set of substrates among the substrates, and the first discharging portion is formed between a second set of substrates different from the first set among the substrates. 5. The liquid ejecting head according to claim 1, further comprising:
a second liquid ejecting portion configured to eject a liquid, a second supply flow path configured to supply a liquid to the second liquid ejecting portion, a second discharging flow path configured to discharge the liquid from the second liquid ejecting portion, and a second supply portion along the horizontal plane in the second supply flow path and a second discharging portion along the horizontal plane in the second discharging flow path have different positions with respect to the direction perpendicular to the horizontal plane. 6. The liquid ejecting head according to claim 5, wherein
the first supply portion and the second supply portion are located in a first direction perpendicular to the horizontal plane with respect to a predetermined position, and the first discharging portion and the second discharging portion are located in a second direction opposite to the first direction with respect to the predetermined position. 7. The liquid ejecting head according to claim 6, wherein
a consumption amount of the liquid supplied to the second liquid ejecting portion is larger than that of the liquid supplied to the first liquid ejecting portion, and the second discharging portion is located between the first discharging portion and the first supply portion or between the first discharging portion and the second supply portion. 8. The liquid ejecting head according to claim 6, wherein
the liquid supplied to the second liquid ejecting portion is cyan ink or magenta ink, the liquid supplied to the first liquid ejecting portion is color ink other than the cyan ink and the magenta ink, and the second discharging portion is located between the first discharging portion and the first supply portion or between the first discharging portion and the second supply portion. 9. A liquid ejecting apparatus comprising:
the liquid ejecting head according to claim 1; and an ejecting controller controlling ejecting of the liquid by the liquid ejecting head. 10. The liquid ejecting apparatus according to claim 9, further comprising:
a heating mechanism configured to heat the liquid supplied to the first supply flow path. 11. The liquid ejecting head according to claim 5, wherein
the first supply portion, the first discharging portion, the second supply portion, and the second discharging portion partially overlap when viewed in the direction perpendicular to the horizontal plane. | 3,700 |
348,667 | 16,806,133 | 3,711 | A backpack dust collector includes a housing. The housing includes: a suction port; a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag; a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor; an exhaust port through which air from the motor chamber is discharged; first and second battery openings; and first and second battery receiving portions respectively corresponding to the first and second battery openings. At least part of the first battery opening is formed on a left side surface of the housing, and at least part of the second battery opening is formed on a right side surface of the housing. | 1. A backpack dust collector comprising
a housing that includes:
a suction port;
a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag;
a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor;
an exhaust port through which air from the motor chamber is discharged;
first and second battery openings; and
first and second battery receiving portions respectively corresponding to the first and second battery openings, wherein
at least part of the first battery opening is formed on a left side surface of the housing, and at least part of the second battery opening is formed on a right side surface of the housing. 2. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail extends in a right-and-left direction. 3. The backpack dust collector according to claim 2, wherein the first battery opening is formed on the left side surface of the housing, and the second battery opening is formed on the right side surface of the housing. 4. The backpack dust collector according to claim 3, wherein the guide rail is inclined downward as farther from the corresponding battery opening. 5. The backpack dust collector according to claim 4, further comprising bottom plates that define bottom surfaces of the battery receiving portions,
each of the bottom surfaces faces part of a lower surface of the battery mounted on the corresponding battery mounting portion, and the bottom surfaces are inclined downward as farther from the corresponding battery opening. 6. The backpack dust collector according to claim 4, wherein the battery mounting portion is arranged on an upper surface of the corresponding battery receiving portion. 7. The backpack dust collector according to claim 6, wherein the first battery opening and the second battery opening are formed at a lower portion of the housing. 8. The backpack dust collector according to claim 7, wherein
the housing includes a front housing and a rear housing, the front housing and the rear housing include respective bottom plates that define bottom surfaces of the first and second battery receiving portions, each of the bottom surfaces faces part of the lower surface of the battery mounted on the corresponding battery mounting portion, and an opening is disposed between the bottom plate of the front housing and the bottom plate of the rear housing. 9. The backpack dust collector according to claim 3, wherein a dimension of the battery opening in a front-and-rear direction is larger than a dimension of the corresponding battery receiving portion in a front-and-rear direction where the corresponding guide rails are arranged. 10. The backpack dust collector according to claim 9, wherein
the housing includes a front housing and a rear housing, the front housing and the rear housing include respective inner side plates that define inner side surfaces connected to the first and second battery openings, each of the inner side surfaces of the front housing is inclined rearward as farther from the corresponding battery opening, each of the inner side surfaces of the rear housing is inclined forward as farther from the corresponding battery opening. 11. The backpack dust collector according to claim 10, wherein, in the battery receiving portion, the battery is guided by the inner side surfaces of the battery receiving portion that is located further in from the corresponding inner side plate and by the guide rail. 12. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined forward as farther from the corresponding battery opening. 13. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined rearward as farther from the corresponding battery opening. 14. The backpack dust collector according to claim 13, wherein part of the first battery opening and part of the second battery opening are formed on a front surface of the housing. 15. The backpack dust collector according to claim 14, wherein an inclination angle of the guide rail with respect to a lateral axis is equal to or smaller than 45 degrees. 16. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined upward as farther from the corresponding battery opening. 17. The backpack dust collector according to claim 1, further comprising a moving mechanism disposed in the battery receiving portion and configured to generate force for moving a battery toward the battery opening. 18. The backpack dust collector according to claim 17, wherein the moving mechanism is disposed at a position where the moving mechanism is able to be in contact with the battery. 19. The backpack dust collector according to claim 18, wherein the moving mechanism includes an elastic member. 20. The backpack dust collector according to claim 1, wherein the battery receiving portion is configured to receive a battery for a power tool. | A backpack dust collector includes a housing. The housing includes: a suction port; a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag; a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor; an exhaust port through which air from the motor chamber is discharged; first and second battery openings; and first and second battery receiving portions respectively corresponding to the first and second battery openings. At least part of the first battery opening is formed on a left side surface of the housing, and at least part of the second battery opening is formed on a right side surface of the housing.1. A backpack dust collector comprising
a housing that includes:
a suction port;
a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag;
a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor;
an exhaust port through which air from the motor chamber is discharged;
first and second battery openings; and
first and second battery receiving portions respectively corresponding to the first and second battery openings, wherein
at least part of the first battery opening is formed on a left side surface of the housing, and at least part of the second battery opening is formed on a right side surface of the housing. 2. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail extends in a right-and-left direction. 3. The backpack dust collector according to claim 2, wherein the first battery opening is formed on the left side surface of the housing, and the second battery opening is formed on the right side surface of the housing. 4. The backpack dust collector according to claim 3, wherein the guide rail is inclined downward as farther from the corresponding battery opening. 5. The backpack dust collector according to claim 4, further comprising bottom plates that define bottom surfaces of the battery receiving portions,
each of the bottom surfaces faces part of a lower surface of the battery mounted on the corresponding battery mounting portion, and the bottom surfaces are inclined downward as farther from the corresponding battery opening. 6. The backpack dust collector according to claim 4, wherein the battery mounting portion is arranged on an upper surface of the corresponding battery receiving portion. 7. The backpack dust collector according to claim 6, wherein the first battery opening and the second battery opening are formed at a lower portion of the housing. 8. The backpack dust collector according to claim 7, wherein
the housing includes a front housing and a rear housing, the front housing and the rear housing include respective bottom plates that define bottom surfaces of the first and second battery receiving portions, each of the bottom surfaces faces part of the lower surface of the battery mounted on the corresponding battery mounting portion, and an opening is disposed between the bottom plate of the front housing and the bottom plate of the rear housing. 9. The backpack dust collector according to claim 3, wherein a dimension of the battery opening in a front-and-rear direction is larger than a dimension of the corresponding battery receiving portion in a front-and-rear direction where the corresponding guide rails are arranged. 10. The backpack dust collector according to claim 9, wherein
the housing includes a front housing and a rear housing, the front housing and the rear housing include respective inner side plates that define inner side surfaces connected to the first and second battery openings, each of the inner side surfaces of the front housing is inclined rearward as farther from the corresponding battery opening, each of the inner side surfaces of the rear housing is inclined forward as farther from the corresponding battery opening. 11. The backpack dust collector according to claim 10, wherein, in the battery receiving portion, the battery is guided by the inner side surfaces of the battery receiving portion that is located further in from the corresponding inner side plate and by the guide rail. 12. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined forward as farther from the corresponding battery opening. 13. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined rearward as farther from the corresponding battery opening. 14. The backpack dust collector according to claim 13, wherein part of the first battery opening and part of the second battery opening are formed on a front surface of the housing. 15. The backpack dust collector according to claim 14, wherein an inclination angle of the guide rail with respect to a lateral axis is equal to or smaller than 45 degrees. 16. The backpack dust collector according to claim 1, further comprising battery mounting portions respectively arranged in the battery receiving portions, wherein
each of the battery mounting portions includes a guide rail configured to guide a battery, and the guide rail is inclined upward as farther from the corresponding battery opening. 17. The backpack dust collector according to claim 1, further comprising a moving mechanism disposed in the battery receiving portion and configured to generate force for moving a battery toward the battery opening. 18. The backpack dust collector according to claim 17, wherein the moving mechanism is disposed at a position where the moving mechanism is able to be in contact with the battery. 19. The backpack dust collector according to claim 18, wherein the moving mechanism includes an elastic member. 20. The backpack dust collector according to claim 1, wherein the battery receiving portion is configured to receive a battery for a power tool. | 3,700 |
348,668 | 16,806,166 | 3,711 | Acoustic resonators, such as bulk acoustic wave (BAW) resonators and, in particular, acoustic resonators including stacked crystal filters (SCFs) are disclosed. SCF structures are disclosed with increased spurious free ranges by providing various arrangements of acoustically soft materials in one or more locations that correspond with high stress regions of one or more modes. For SCFs operating in first order modes, relative amounts of acoustically soft materials within shared electrodes may be increased. One or more additional layers of acoustically soft materials may also be added to SCF structures near shared electrodes. Accordingly, SCFs may be provided with increased frequency spreads between first order modes and second order modes. | 1. A stacked crystal filter (SCF) comprising:
a first piezoelectric layer; a second piezoelectric layer; a shared electrode between the first piezoelectric layer and the second piezoelectric layer; a first electrode on the first piezoelectric layer opposite the shared electrode; and a second electrode on the second piezoelectric layer opposite the shared electrode; wherein the shared electrode comprises a thickness as measured between the first piezoelectric layer and the second piezoelectric layer that is at least two and a half times greater than at least one of a thickness of the first electrode or a thickness of the second electrode. 2. The SCF of claim 1, wherein the thickness of the shared electrode is at least three times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 3. The SCF of claim 1, wherein the thickness of the shared electrode is at least four times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 4. The SCF of claim 1, wherein the thickness of the shared electrode is in a range including two and a half times greater and four times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 5. The SCF of claim 1, wherein the thickness of the shared electrode is at least two and a half times greater than the thickness of the first electrode and at least two and a half times greater than the thickness of the second electrode. 6. The SCF of claim 1, wherein a frequency of a second order mode is at least 2.5 times higher than a frequency of a first order mode. 7. The SCF of claim 6, wherein the frequency of the second order mode is in a range including 2.5 higher and 4 times higher than the frequency of the first order mode. 8. The SCF of claim 1, wherein the shared electrode comprises a plurality of sublayers. 9. The SCF of claim 8, wherein:
the plurality of sublayers comprises a first sublayer, a second sublayer, and a third sublayer; the second sublayer is arranged between the first sublayer and the third sublayer; and the second sublayer comprises a thickness that is at least two and a half times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 10. The SCF of claim 1, wherein the shared electrode comprises an acoustically soft material having a stiffness parameter that is lower than a stiffness parameter of the first piezoelectric layer and the second piezoelectric layer. 11. The SCF of claim 10, wherein the acoustically soft material comprises a thickness that is at least two and a half times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 12. The SCF of claim 10, wherein the stiffness parameter is less than or equal to 150 gigapascals (GPa). 13. The SCF of claim 10, wherein the stiffness parameter is in a range including 50 gigapascals (GPa) and 150 GPa. 14. The SCF of claim 10, wherein the acoustically soft material comprises a dielectric layer. 15. The SCF of claim 10, wherein the acoustically soft material comprises a metal layer. 16. A stacked crystal filter (SCF) comprising:
a first piezoelectric layer; a second piezoelectric layer; a shared electrode between the first piezoelectric layer and the second piezoelectric layer; a first electrode on the first piezoelectric layer opposite the shared electrode; a second electrode on the second piezoelectric layer opposite the shared electrode; and a first layer between the shared electrode and the second piezoelectric layer, the first layer comprising a material with a stiffness parameter that is lower than a stiffness parameter of the second piezoelectric layer. 17. The SCF of claim 16, wherein the first layer comprises a stiffness parameter of less than or equal to 150 gigapascals (GPa). 18. The SCF of claim 16, wherein the first layer comprises a stiffness parameter in a range including 50 gigapascals (GPa) and 150 GPa. 19. The SCF of claim 16, wherein the first layer comprises a dielectric layer. 20. The SCF of claim 19, wherein the dielectric layer comprises silicon dioxide. 21. The SCF of claim 16, wherein the first layer comprises a metal layer. 22. The SCF of claim 21, wherein the metal layer comprises an aluminum copper alloy. 23. The SCF of claim 16, further comprising a second layer between the shared electrode and the first piezoelectric layer, the second layer comprising a material with a stiffness parameter that is lower than a stiffness parameter of the first piezoelectric layer. 24. The SCF of claim 23, wherein the first layer and the second layer comprise a same material. 25. The SCF of claim 23, wherein the first layer and the second layer comprise different materials. 26. The SCF of claim 16, wherein a frequency of a second order mode is at least 2.5 times higher than a frequency of a first order mode. 27. The SCF of claim 26, wherein the frequency of the second order mode is in a range including 2.5 higher and 4 times higher than the frequency of the first order mode. | Acoustic resonators, such as bulk acoustic wave (BAW) resonators and, in particular, acoustic resonators including stacked crystal filters (SCFs) are disclosed. SCF structures are disclosed with increased spurious free ranges by providing various arrangements of acoustically soft materials in one or more locations that correspond with high stress regions of one or more modes. For SCFs operating in first order modes, relative amounts of acoustically soft materials within shared electrodes may be increased. One or more additional layers of acoustically soft materials may also be added to SCF structures near shared electrodes. Accordingly, SCFs may be provided with increased frequency spreads between first order modes and second order modes.1. A stacked crystal filter (SCF) comprising:
a first piezoelectric layer; a second piezoelectric layer; a shared electrode between the first piezoelectric layer and the second piezoelectric layer; a first electrode on the first piezoelectric layer opposite the shared electrode; and a second electrode on the second piezoelectric layer opposite the shared electrode; wherein the shared electrode comprises a thickness as measured between the first piezoelectric layer and the second piezoelectric layer that is at least two and a half times greater than at least one of a thickness of the first electrode or a thickness of the second electrode. 2. The SCF of claim 1, wherein the thickness of the shared electrode is at least three times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 3. The SCF of claim 1, wherein the thickness of the shared electrode is at least four times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 4. The SCF of claim 1, wherein the thickness of the shared electrode is in a range including two and a half times greater and four times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 5. The SCF of claim 1, wherein the thickness of the shared electrode is at least two and a half times greater than the thickness of the first electrode and at least two and a half times greater than the thickness of the second electrode. 6. The SCF of claim 1, wherein a frequency of a second order mode is at least 2.5 times higher than a frequency of a first order mode. 7. The SCF of claim 6, wherein the frequency of the second order mode is in a range including 2.5 higher and 4 times higher than the frequency of the first order mode. 8. The SCF of claim 1, wherein the shared electrode comprises a plurality of sublayers. 9. The SCF of claim 8, wherein:
the plurality of sublayers comprises a first sublayer, a second sublayer, and a third sublayer; the second sublayer is arranged between the first sublayer and the third sublayer; and the second sublayer comprises a thickness that is at least two and a half times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 10. The SCF of claim 1, wherein the shared electrode comprises an acoustically soft material having a stiffness parameter that is lower than a stiffness parameter of the first piezoelectric layer and the second piezoelectric layer. 11. The SCF of claim 10, wherein the acoustically soft material comprises a thickness that is at least two and a half times greater than at least one of the thickness of the first electrode or the thickness of the second electrode. 12. The SCF of claim 10, wherein the stiffness parameter is less than or equal to 150 gigapascals (GPa). 13. The SCF of claim 10, wherein the stiffness parameter is in a range including 50 gigapascals (GPa) and 150 GPa. 14. The SCF of claim 10, wherein the acoustically soft material comprises a dielectric layer. 15. The SCF of claim 10, wherein the acoustically soft material comprises a metal layer. 16. A stacked crystal filter (SCF) comprising:
a first piezoelectric layer; a second piezoelectric layer; a shared electrode between the first piezoelectric layer and the second piezoelectric layer; a first electrode on the first piezoelectric layer opposite the shared electrode; a second electrode on the second piezoelectric layer opposite the shared electrode; and a first layer between the shared electrode and the second piezoelectric layer, the first layer comprising a material with a stiffness parameter that is lower than a stiffness parameter of the second piezoelectric layer. 17. The SCF of claim 16, wherein the first layer comprises a stiffness parameter of less than or equal to 150 gigapascals (GPa). 18. The SCF of claim 16, wherein the first layer comprises a stiffness parameter in a range including 50 gigapascals (GPa) and 150 GPa. 19. The SCF of claim 16, wherein the first layer comprises a dielectric layer. 20. The SCF of claim 19, wherein the dielectric layer comprises silicon dioxide. 21. The SCF of claim 16, wherein the first layer comprises a metal layer. 22. The SCF of claim 21, wherein the metal layer comprises an aluminum copper alloy. 23. The SCF of claim 16, further comprising a second layer between the shared electrode and the first piezoelectric layer, the second layer comprising a material with a stiffness parameter that is lower than a stiffness parameter of the first piezoelectric layer. 24. The SCF of claim 23, wherein the first layer and the second layer comprise a same material. 25. The SCF of claim 23, wherein the first layer and the second layer comprise different materials. 26. The SCF of claim 16, wherein a frequency of a second order mode is at least 2.5 times higher than a frequency of a first order mode. 27. The SCF of claim 26, wherein the frequency of the second order mode is in a range including 2.5 higher and 4 times higher than the frequency of the first order mode. | 3,700 |
348,669 | 16,806,146 | 3,711 | According to one embodiment, a semiconductor device includes a substrate, a plurality of insulating films and a plurality of electrode films provided alternately on the substrate. The semiconductor device further includes a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film that are sequentially provided along at least one side surface of each of the electrode films. The first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and the second charge storage film includes a semiconductor film. | 1. A semiconductor device comprising:
a substrate; a plurality of insulating films and a plurality of electrode films provided alternately on the substrate; and a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film that are sequentially provided along at least one side surface of each of the electrode films, wherein the first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and wherein the second charge storage film includes a semiconductor film. 2. The semiconductor device according to claim 1, wherein the first charge storage film includes molybdenum, and a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 3. The semiconductor device according to claim 1, wherein an in-plane concentration of molybdenum in the first charge storage film is at least 2.0×1014 atoms/cm2 and not more than 4.0×1015 atoms/cm2. 4. The semiconductor device according to claim 1, wherein the first charge storage film includes (a) molybdenum and (b) at least one of oxygen, nitrogen, carbon, sulfur, chlorine, silicon, vanadium, or tungsten. 5. The semiconductor device according to claim 1, wherein the first charge storage film contains titanium and nitrogen, and a thickness of the first charge storage film is from about 0.05 nm to about 0.30 nm. 6. The semiconductor device according to claim 1, wherein an in-plane concentration of titanium in the first charge storage film is at least 2.0×1014 atoms/cm2 and not more than 1.2×1015 atoms/cm2. 7. The semiconductor device according to claim 1, wherein the first insulating film is an oxide film including at least one of hafnium, zirconium or aluminum. 8. The semiconductor device according to claim 1, wherein the third insulating film includes silicon and is either an oxide film, or a nitride film or an oxynitride film. 9. The semiconductor device according to claim 1, wherein the first charge storage film and the second charge storage film are provided between the plurality of insulating films. 10. The semiconductor device according to claim 1, wherein the first charge storage film and the second charge storage film are electrically insulated from each other. 11. The semiconductor device according to claim 1, wherein the first semiconductor film is provided along a side surface of the second charge storage film and side surfaces of the plurality of insulating films via the second insulating film. 12. A semiconductor device comprising:
a substrate; a plurality of insulating films and a plurality of electrode films that are provided alternately on the substrate; and a first insulating film, a first charge storage film, a second insulating film, and a first semiconductor film which are sequentially provided along at least one side surface of each of the electrode films, wherein the first charge storage film includes molybdenum. 13. A method for manufacturing a semiconductor device, comprising:
forming, on a substrate, a plurality of fourth insulating films and a plurality of fifth insulating films alternately on top of one another; sequentially forming a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film along at least one side surface of each of the fifth insulating films; and replacing the fifth insulating films with a plurality of electrode films, wherein the first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and wherein the second charge storage film is a semiconductor film. 14. The semiconductor device according to claim 12, wherein a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 15. The method according to claim 13, wherein the first charge storage film includes molybdenum, and a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 16. The method according to claim 13, wherein the first charge storage film contains titanium and nitrogen, and a thickness of the first charge storage film is from about 0.05 nm to about 0.30 nm. | According to one embodiment, a semiconductor device includes a substrate, a plurality of insulating films and a plurality of electrode films provided alternately on the substrate. The semiconductor device further includes a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film that are sequentially provided along at least one side surface of each of the electrode films. The first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and the second charge storage film includes a semiconductor film.1. A semiconductor device comprising:
a substrate; a plurality of insulating films and a plurality of electrode films provided alternately on the substrate; and a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film that are sequentially provided along at least one side surface of each of the electrode films, wherein the first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and wherein the second charge storage film includes a semiconductor film. 2. The semiconductor device according to claim 1, wherein the first charge storage film includes molybdenum, and a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 3. The semiconductor device according to claim 1, wherein an in-plane concentration of molybdenum in the first charge storage film is at least 2.0×1014 atoms/cm2 and not more than 4.0×1015 atoms/cm2. 4. The semiconductor device according to claim 1, wherein the first charge storage film includes (a) molybdenum and (b) at least one of oxygen, nitrogen, carbon, sulfur, chlorine, silicon, vanadium, or tungsten. 5. The semiconductor device according to claim 1, wherein the first charge storage film contains titanium and nitrogen, and a thickness of the first charge storage film is from about 0.05 nm to about 0.30 nm. 6. The semiconductor device according to claim 1, wherein an in-plane concentration of titanium in the first charge storage film is at least 2.0×1014 atoms/cm2 and not more than 1.2×1015 atoms/cm2. 7. The semiconductor device according to claim 1, wherein the first insulating film is an oxide film including at least one of hafnium, zirconium or aluminum. 8. The semiconductor device according to claim 1, wherein the third insulating film includes silicon and is either an oxide film, or a nitride film or an oxynitride film. 9. The semiconductor device according to claim 1, wherein the first charge storage film and the second charge storage film are provided between the plurality of insulating films. 10. The semiconductor device according to claim 1, wherein the first charge storage film and the second charge storage film are electrically insulated from each other. 11. The semiconductor device according to claim 1, wherein the first semiconductor film is provided along a side surface of the second charge storage film and side surfaces of the plurality of insulating films via the second insulating film. 12. A semiconductor device comprising:
a substrate; a plurality of insulating films and a plurality of electrode films that are provided alternately on the substrate; and a first insulating film, a first charge storage film, a second insulating film, and a first semiconductor film which are sequentially provided along at least one side surface of each of the electrode films, wherein the first charge storage film includes molybdenum. 13. A method for manufacturing a semiconductor device, comprising:
forming, on a substrate, a plurality of fourth insulating films and a plurality of fifth insulating films alternately on top of one another; sequentially forming a first insulating film, a first charge storage film, a third insulating film, a second charge storage film, a second insulating film, and a first semiconductor film along at least one side surface of each of the fifth insulating films; and replacing the fifth insulating films with a plurality of electrode films, wherein the first charge storage film includes either (i) molybdenum, or (ii) titanium and nitrogen, and wherein the second charge storage film is a semiconductor film. 14. The semiconductor device according to claim 12, wherein a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 15. The method according to claim 13, wherein the first charge storage film includes molybdenum, and a thickness of the first charge storage film is from about 0.05 nm to about 1.0 nm. 16. The method according to claim 13, wherein the first charge storage film contains titanium and nitrogen, and a thickness of the first charge storage film is from about 0.05 nm to about 0.30 nm. | 3,700 |
348,670 | 16,806,165 | 3,711 | Methods and apparatuses for scheduling and indicating scheduling information in a wireless local area network (WLAN). A station (STA) includes a transceiver configured to receive a header for a protocol data unit and a controller configured to identify common information for a plurality of STAs that are scheduled in the WLAN from a common field in the header and to identify user-specific information for the STA from a user-specific field in the header that follows the common field. An access point (AP) includes a controller configured to include common information for a plurality STAs that are scheduled in the WLAN in a common field in a header of a protocol data unit, and to include user-specific information for the STAs in a user-specific field in the header that follows the common field. The AP also includes a transceiver configured to transmit the protocol data unit including the header. | 1. An apparatus of a station (STA) for identifying scheduling information in a wireless local area network (WLAN), the apparatus comprising:
a transceiver configured to receive a header for a protocol data unit in a channel including a plurality of resource units (RUs) of data; and a controller configured:
to identify common information for a plurality of STAs that are scheduled in the WLAN from a common field in the header, wherein the common field includes an RU signaling that jointly indicates an arrangement of the RUs in frequency domain and a number of multi-user multiple-input multiple-output (MU-MIMO) users in an MU-MIMO resource;
to identify user-specific information for the STA from a user-specific field in the header that follows the common field; and
to calculate a location of a RU of data for the STA, the calculated location computed based on the arrangement of the RUs in the channel minus an offset determined by the number of MU-MIMO users in allocations indicated in the common field,
wherein the transceiver is configured to receive the data for the STA based on the calculated location of the RU of data. | Methods and apparatuses for scheduling and indicating scheduling information in a wireless local area network (WLAN). A station (STA) includes a transceiver configured to receive a header for a protocol data unit and a controller configured to identify common information for a plurality of STAs that are scheduled in the WLAN from a common field in the header and to identify user-specific information for the STA from a user-specific field in the header that follows the common field. An access point (AP) includes a controller configured to include common information for a plurality STAs that are scheduled in the WLAN in a common field in a header of a protocol data unit, and to include user-specific information for the STAs in a user-specific field in the header that follows the common field. The AP also includes a transceiver configured to transmit the protocol data unit including the header.1. An apparatus of a station (STA) for identifying scheduling information in a wireless local area network (WLAN), the apparatus comprising:
a transceiver configured to receive a header for a protocol data unit in a channel including a plurality of resource units (RUs) of data; and a controller configured:
to identify common information for a plurality of STAs that are scheduled in the WLAN from a common field in the header, wherein the common field includes an RU signaling that jointly indicates an arrangement of the RUs in frequency domain and a number of multi-user multiple-input multiple-output (MU-MIMO) users in an MU-MIMO resource;
to identify user-specific information for the STA from a user-specific field in the header that follows the common field; and
to calculate a location of a RU of data for the STA, the calculated location computed based on the arrangement of the RUs in the channel minus an offset determined by the number of MU-MIMO users in allocations indicated in the common field,
wherein the transceiver is configured to receive the data for the STA based on the calculated location of the RU of data. | 3,700 |
348,671 | 16,806,153 | 3,711 | A backpack dust collector includes a housing, a slit portion, and a noise-absorbing member. The housing includes a suction port, a dust collecting chamber, a motor chamber, and an exhaust port. The dust collecting chamber is connected to the suction port and configured to accommodate a dust collecting bag. The motor chamber is connected to the dust collecting chamber and accommodates a fan and a motor. Through the exhaust port, air from the motor chamber is discharged. The slit portion is disposed in a flow path between the motor chamber and the exhaust port and includes at least one slit-shaped vent through which air from the motor chamber passes. The noise-absorbing member is disposed in at least part of a flow path between the vent and the exhaust port. | 1. A backpack dust collector comprising:
a housing that includes
a suction port,
a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag,
a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor, and
an exhaust port through which air from the motor chamber is discharged;
a slit portion disposed in a flow path between the motor chamber and the exhaust port and including at least one slit-shaped vent through which air from the motor chamber passes; and a noise-absorbing member disposed in at least part of a flow path between the vent and the exhaust port. 2. The backpack dust collector according to claim 1, wherein the noise-absorbing member faces the vent. 3. The backpack dust collector according to claim 1, wherein
the vent is provided in plural numbers, and the noise-absorbing member faces each of the vents. 4. The backpack dust collector according to claim 3, wherein
a longitudinal direction of each of the vents corresponds to a right-and-left direction of the backpack dust collector, and a widthwise direction of each of the vents corresponds to an up-and-down direction of the backpack dust collector, and the vents are aligned in the up-and-down direction. 5. The backpack dust collector according to claim 1, wherein a distance between the vent and the noise-absorbing member is shorter than a distance between the vent and the exhaust port. 6. The backpack dust collector according to claim 5, wherein the distance between the vent and the exhaust port is at least two times longer than the distance between the vent and the noise-absorbing member. 7. The backpack dust collector according to claim 1, wherein the vent is formed in at least part of the housing. 8. The backpack dust collector according to claim 1, wherein
the housing includes a base housing and a plate connected to the base housing, and the flow path between the vent and the exhaust port is defined between the base housing and the plate. 9. The backpack dust collector according to claim 8, wherein
the base housing includes a recessed portion that is recessed rearward, the plate is disposed so as to cover an opening of the recessed portion, the flow path is defined between an inner surface of the recessed portion and a rear surface of the plate, and the noise-absorbing member is fixed to the inner surface of the recessed portion and the rear surface of the plate. 10. The backpack dust collector according to claim 9, wherein in a state in which the housing is carried on an operator's back, the plate faces the operator's back. 11. The backpack dust collector according to claim 9, wherein
the vent is disposed in the base housing, and the noise-absorbing member faces the vent. 12. The backpack dust collector according to claim 9, wherein
the flow path extends in an up-and-down direction of the backpack dust collector (1), and the exhaust port is defined by a lower end portion of the inner surface of the recessed portion and a lower end portion of the rear surface of the plate. 13. The backpack dust collector according to claim 8, wherein the slit portion is provided to the base housing. 14. The backpack dust collector according to claim 13, wherein, in a state in which the housing is carried on an operator's back, the plate faces the operator's back, the vent faces laterally, and the exhaust port faces downward. 15. The backpack dust collector according to claim 8, wherein the slit portion is provided to a slit member that is attachable to and detachable from the base housing. 16. The backpack dust collector according to claim 1, wherein the noise-absorbing member includes a porous member. 17. The backpack dust collector according to claim 16, wherein the noise-absorbing member includes an open-cell porous member. 18. The backpack dust collector according to claim 1, wherein the noise-absorbing member is disposed in a flow path between the motor chamber and the vent. | A backpack dust collector includes a housing, a slit portion, and a noise-absorbing member. The housing includes a suction port, a dust collecting chamber, a motor chamber, and an exhaust port. The dust collecting chamber is connected to the suction port and configured to accommodate a dust collecting bag. The motor chamber is connected to the dust collecting chamber and accommodates a fan and a motor. Through the exhaust port, air from the motor chamber is discharged. The slit portion is disposed in a flow path between the motor chamber and the exhaust port and includes at least one slit-shaped vent through which air from the motor chamber passes. The noise-absorbing member is disposed in at least part of a flow path between the vent and the exhaust port.1. A backpack dust collector comprising:
a housing that includes
a suction port,
a dust collecting chamber connected to the suction port and configured to accommodate a dust collecting bag,
a motor chamber connected to the dust collecting chamber and accommodating a fan and a motor, and
an exhaust port through which air from the motor chamber is discharged;
a slit portion disposed in a flow path between the motor chamber and the exhaust port and including at least one slit-shaped vent through which air from the motor chamber passes; and a noise-absorbing member disposed in at least part of a flow path between the vent and the exhaust port. 2. The backpack dust collector according to claim 1, wherein the noise-absorbing member faces the vent. 3. The backpack dust collector according to claim 1, wherein
the vent is provided in plural numbers, and the noise-absorbing member faces each of the vents. 4. The backpack dust collector according to claim 3, wherein
a longitudinal direction of each of the vents corresponds to a right-and-left direction of the backpack dust collector, and a widthwise direction of each of the vents corresponds to an up-and-down direction of the backpack dust collector, and the vents are aligned in the up-and-down direction. 5. The backpack dust collector according to claim 1, wherein a distance between the vent and the noise-absorbing member is shorter than a distance between the vent and the exhaust port. 6. The backpack dust collector according to claim 5, wherein the distance between the vent and the exhaust port is at least two times longer than the distance between the vent and the noise-absorbing member. 7. The backpack dust collector according to claim 1, wherein the vent is formed in at least part of the housing. 8. The backpack dust collector according to claim 1, wherein
the housing includes a base housing and a plate connected to the base housing, and the flow path between the vent and the exhaust port is defined between the base housing and the plate. 9. The backpack dust collector according to claim 8, wherein
the base housing includes a recessed portion that is recessed rearward, the plate is disposed so as to cover an opening of the recessed portion, the flow path is defined between an inner surface of the recessed portion and a rear surface of the plate, and the noise-absorbing member is fixed to the inner surface of the recessed portion and the rear surface of the plate. 10. The backpack dust collector according to claim 9, wherein in a state in which the housing is carried on an operator's back, the plate faces the operator's back. 11. The backpack dust collector according to claim 9, wherein
the vent is disposed in the base housing, and the noise-absorbing member faces the vent. 12. The backpack dust collector according to claim 9, wherein
the flow path extends in an up-and-down direction of the backpack dust collector (1), and the exhaust port is defined by a lower end portion of the inner surface of the recessed portion and a lower end portion of the rear surface of the plate. 13. The backpack dust collector according to claim 8, wherein the slit portion is provided to the base housing. 14. The backpack dust collector according to claim 13, wherein, in a state in which the housing is carried on an operator's back, the plate faces the operator's back, the vent faces laterally, and the exhaust port faces downward. 15. The backpack dust collector according to claim 8, wherein the slit portion is provided to a slit member that is attachable to and detachable from the base housing. 16. The backpack dust collector according to claim 1, wherein the noise-absorbing member includes a porous member. 17. The backpack dust collector according to claim 16, wherein the noise-absorbing member includes an open-cell porous member. 18. The backpack dust collector according to claim 1, wherein the noise-absorbing member is disposed in a flow path between the motor chamber and the vent. | 3,700 |
348,672 | 16,806,162 | 2,674 | Systems, methods and apparatuses of virtual object control of a physical device and/or physical device control of a virtual object are disclosed. In one aspect, embodiments of the present disclosure include a method, which may be implemented on a system, to present a depiction of a virtual object in the augmented reality environment. In the method, one or more functions of the virtual object accessible in the augmented reality environment are used for control of a physical device. | 1. A method of an augmented reality environment, the method, comprising:
presenting a depiction of a virtual object in the augmented reality environment, the depiction of the virtual object being observable in the augmented reality environment; wherein, one or more functions of the virtual object accessible in the augmented reality environment are used for control of a physical device. 2. The method of claim 1, further comprising:
identifying the physical device in a physical location that is controlled by the virtual object; ascertaining functions of the physical device; rendering the one or more functions of the virtual object accessible for use in control of the physical device, based on the functions of the physical device. 3. The method of claim 1, wherein:
the virtual object is used to adjust a setting of the physical device to a value amongst a set of values. 4. The method of claim 1, wherein:
the virtual object is depicted in the augmented reality environment in response to action performed on the physical device. 5. The method of claim 1, wherein:
an instance of the virtual object is launched in the augmented reality environment in response to action detected by the physical device; further wherein, the physical device is also used to access the one or more functions of the virtual object. 6. (canceled) 7. The method of claim 6, further comprising,
responsive to detecting action performed on the physical device, identifying a function of the one or more functions of the virtual object corresponding to the action performed on the physical device; updating the depiction of the virtual object in the augmented reality environment, based on the function of the one or more functions of the virtual object that has been identified; wherein, the function of the one or more functions is accessible by a human user via the depiction of the virtual object, for the human user to interact with the physical device. 8. (canceled) 9. The method of claim 1, wherein
the virtual object is accessed to control the physical device through one or more of, mechanical actuation, electrical actuation, magnetic actuation, acoustic actuation, biometric and biochemical actuation. 10.-12. (canceled) 13. A method of an augmented reality environment in a real world environment, the method, comprising:
causing to be perceptible or imperceptible, to a human user, a virtual object in the augmented reality environment; wherein, the virtual object is associated with a physical device in a physical location; wherein, the augmented reality environment includes:
the real world environment or a representation of the real world environment associated with the physical location in which the physical device is physically located;
the virtual object. 14. The method of claim 13, wherein:
the physical device associated with the virtual object, is used to control the virtual object. 15. (canceled) 16. The method of claim 13, wherein:
the virtual object is usable to control the physical device; further wherein: the virtual object is able to control multiple physical devices in the physical location; further wherein, a function of the virtual object in the augmented reality environment is governed by a function or an attribute of the physical device; further wherein, a rendering of the virtual object in the augmented reality environment is determined based on the function or the attribute of the physical device which the virtual object controls. 17.-18. (canceled) 19. The method of claim 13, wherein:
the virtual object includes a biometric sensor to authenticate the human user to access the physical device. 20. The method of claim 13, wherein:
the virtual object is usable to control multiple functions or attributes of the physical device; the virtual object is depicted as an instrument panel having multiple virtual control objects in the augmented reality environment; wherein, the multiple virtual control objects are operable to access or control the multiple functions or attributes of the physical device. 21. (canceled) 22. The method of claim 13, wherein:
the virtual object is adjustable to control another physical device different from the physical device in the physical location; further wherein, a representation of the virtual object is updated in the augmented reality environment, to depict a change in its control from the physical device to the other physical device. 23.-24. (canceled) 25. The method of claim 13, wherein:
the virtual object is depicted as an instrument panel having multiple virtual control objects in the augmented reality environment; wherein, the multiple virtual control objects are operable to access or control the multiple physical devices in the physical location. 26. The method of claim 13,
wherein, the virtual object is made perceptible or imperceptible to the human user in the augmented reality environment depending on a rule set; wherein, the rule set includes a proximity parameter; wherein, the proximity parameter includes an indication of a physical distance between the human user and the physical device; wherein, the augmented reality environment is rendered at least in part in a hologam, wherein the hologram is accessible in 3D and in 360 degrees; wherein, perceptibility of the virtual object and perceptibility of the representation of the real environment is configurable or adjustable by the human user. 27. (canceled) 28. A system to facilitate control of a physical object by a virtual object in an augmented reality environment, the system, comprising:
a processor; memory having stored having stored thereon instructions, which when executed by a processor, cause the processor to: present a depiction of a virtual object in the augmented reality environment, the depiction of the virtual object being observable in the augmented reality environment; wherein, one or more functions of the virtual object accessible in the augmented reality environment are used for control of the physical object; identify the physical object in a physical location that is controlled by the virtual object. 29. The system of claim 28, wherein, the processor is further operable to:
determine functions of the physical object; render the one or more functions of the virtual object accessible for use in control of the physical object, based on the functions of the physical object. 30. The system of claim 28,
wherein, the physical object is also used to access the one or more functions of the virtual object; wherein, the processor is further operable to:
detect a gesture performed in relation to the physical object;
identify a function of the one or more functions of the virtual object corresponding to the gesture performed;
update the depiction of the virtual object in the augmented reality environment, based on the function of the one or more functions of the virtual object that has been identified. 31. The system of claim 28, further comprising,
a sensor coupled to the processor; wherein, the sensor detects actuation of the physical device to access the one or more functions of the virtual object. 32. The system of claim 28, wherein, the sensor includes one or more of, a heat sensor, a proximity sensor, a motion sensor, a pressure sensor, a light sensor, a temperature, and an acoustic sensor. | Systems, methods and apparatuses of virtual object control of a physical device and/or physical device control of a virtual object are disclosed. In one aspect, embodiments of the present disclosure include a method, which may be implemented on a system, to present a depiction of a virtual object in the augmented reality environment. In the method, one or more functions of the virtual object accessible in the augmented reality environment are used for control of a physical device.1. A method of an augmented reality environment, the method, comprising:
presenting a depiction of a virtual object in the augmented reality environment, the depiction of the virtual object being observable in the augmented reality environment; wherein, one or more functions of the virtual object accessible in the augmented reality environment are used for control of a physical device. 2. The method of claim 1, further comprising:
identifying the physical device in a physical location that is controlled by the virtual object; ascertaining functions of the physical device; rendering the one or more functions of the virtual object accessible for use in control of the physical device, based on the functions of the physical device. 3. The method of claim 1, wherein:
the virtual object is used to adjust a setting of the physical device to a value amongst a set of values. 4. The method of claim 1, wherein:
the virtual object is depicted in the augmented reality environment in response to action performed on the physical device. 5. The method of claim 1, wherein:
an instance of the virtual object is launched in the augmented reality environment in response to action detected by the physical device; further wherein, the physical device is also used to access the one or more functions of the virtual object. 6. (canceled) 7. The method of claim 6, further comprising,
responsive to detecting action performed on the physical device, identifying a function of the one or more functions of the virtual object corresponding to the action performed on the physical device; updating the depiction of the virtual object in the augmented reality environment, based on the function of the one or more functions of the virtual object that has been identified; wherein, the function of the one or more functions is accessible by a human user via the depiction of the virtual object, for the human user to interact with the physical device. 8. (canceled) 9. The method of claim 1, wherein
the virtual object is accessed to control the physical device through one or more of, mechanical actuation, electrical actuation, magnetic actuation, acoustic actuation, biometric and biochemical actuation. 10.-12. (canceled) 13. A method of an augmented reality environment in a real world environment, the method, comprising:
causing to be perceptible or imperceptible, to a human user, a virtual object in the augmented reality environment; wherein, the virtual object is associated with a physical device in a physical location; wherein, the augmented reality environment includes:
the real world environment or a representation of the real world environment associated with the physical location in which the physical device is physically located;
the virtual object. 14. The method of claim 13, wherein:
the physical device associated with the virtual object, is used to control the virtual object. 15. (canceled) 16. The method of claim 13, wherein:
the virtual object is usable to control the physical device; further wherein: the virtual object is able to control multiple physical devices in the physical location; further wherein, a function of the virtual object in the augmented reality environment is governed by a function or an attribute of the physical device; further wherein, a rendering of the virtual object in the augmented reality environment is determined based on the function or the attribute of the physical device which the virtual object controls. 17.-18. (canceled) 19. The method of claim 13, wherein:
the virtual object includes a biometric sensor to authenticate the human user to access the physical device. 20. The method of claim 13, wherein:
the virtual object is usable to control multiple functions or attributes of the physical device; the virtual object is depicted as an instrument panel having multiple virtual control objects in the augmented reality environment; wherein, the multiple virtual control objects are operable to access or control the multiple functions or attributes of the physical device. 21. (canceled) 22. The method of claim 13, wherein:
the virtual object is adjustable to control another physical device different from the physical device in the physical location; further wherein, a representation of the virtual object is updated in the augmented reality environment, to depict a change in its control from the physical device to the other physical device. 23.-24. (canceled) 25. The method of claim 13, wherein:
the virtual object is depicted as an instrument panel having multiple virtual control objects in the augmented reality environment; wherein, the multiple virtual control objects are operable to access or control the multiple physical devices in the physical location. 26. The method of claim 13,
wherein, the virtual object is made perceptible or imperceptible to the human user in the augmented reality environment depending on a rule set; wherein, the rule set includes a proximity parameter; wherein, the proximity parameter includes an indication of a physical distance between the human user and the physical device; wherein, the augmented reality environment is rendered at least in part in a hologam, wherein the hologram is accessible in 3D and in 360 degrees; wherein, perceptibility of the virtual object and perceptibility of the representation of the real environment is configurable or adjustable by the human user. 27. (canceled) 28. A system to facilitate control of a physical object by a virtual object in an augmented reality environment, the system, comprising:
a processor; memory having stored having stored thereon instructions, which when executed by a processor, cause the processor to: present a depiction of a virtual object in the augmented reality environment, the depiction of the virtual object being observable in the augmented reality environment; wherein, one or more functions of the virtual object accessible in the augmented reality environment are used for control of the physical object; identify the physical object in a physical location that is controlled by the virtual object. 29. The system of claim 28, wherein, the processor is further operable to:
determine functions of the physical object; render the one or more functions of the virtual object accessible for use in control of the physical object, based on the functions of the physical object. 30. The system of claim 28,
wherein, the physical object is also used to access the one or more functions of the virtual object; wherein, the processor is further operable to:
detect a gesture performed in relation to the physical object;
identify a function of the one or more functions of the virtual object corresponding to the gesture performed;
update the depiction of the virtual object in the augmented reality environment, based on the function of the one or more functions of the virtual object that has been identified. 31. The system of claim 28, further comprising,
a sensor coupled to the processor; wherein, the sensor detects actuation of the physical device to access the one or more functions of the virtual object. 32. The system of claim 28, wherein, the sensor includes one or more of, a heat sensor, a proximity sensor, a motion sensor, a pressure sensor, a light sensor, a temperature, and an acoustic sensor. | 2,600 |
348,673 | 16,806,188 | 2,674 | An acoustic panel with a cellular core includes cells that are provided with one or more obstacles, each of the obstacles extending transversely in relation to the main axis of the associated cell so as to increase the length of the path (F) that sound waves travel through the cell. Methods enabling the production of such a panel implements steps of cutting, folding and bonding that are suitable for creating cells provided with such obstacles. | 1. An acoustic panel with resonators for a nacelle of an aircraft propulsion unit, the acoustic panel comprising a plurality of adjoining acoustic cells which form a cellular core, each acoustic cell being delimited by a peripheral wall, and each acoustic cell extending along a longitudinal main axis corresponding to an axis of propagation of sound waves, from a front end up to a rear end of the acoustic cell,
wherein at least one acoustic cell among the plurality of acoustic cells includes at least one partial obstacle extending transversely with respect to the longitudinal main axis of the at least one acoustic cell, from the peripheral wall of the at least one acoustic cell, the at least one partial obstacle having a free end edge which delimits a passage with a portion of an opposite wall to increase a length of a path traveled by the sound waves through the at least one acoustic cell. 2. The acoustic panel according to claim 1, wherein the at least one acoustic cell includes a first obstacle and a second obstacle, the first obstacle and the second obstacle being shifted along the longitudinal main axis, wherein a passage defined by a free end edge of the first obstacle and a passage defined by a free end edge of the second obstacle is radially shifted so as to form a baffle to increase the length of the path traveled by the sound waves through the at least one acoustic cell. 3. The acoustic panel according to claim 2, wherein a portion of the free end edge of the first obstacle and a portion of the free end edge of the second obstacle are superimposed along the longitudinal main axis of the acoustic cell to inhibit the sound waves from drawing a direct path from the front end up to the rear end of the at least one acoustic cell. 4. The acoustic panel according to claim 2, wherein the at least one acoustic cell includes at least one acoustically permeable septum which extends across the at least one acoustic cell. 5. The acoustic panel according to claim 4, wherein the at least one acoustically permeable septum extends from the free end edge of one of the partial obstacles, up to the peripheral wall of the at least one acoustic cell. 6. The acoustic panel according to claim 4, wherein the at least one acoustically permeable septum extends from the free end edge of the first obstacle up to the free end edge of the second obstacle. 7. The acoustic panel according to claim 1, wherein the at least one partial obstacle comprises a central portion which extends transversely with respect to the longitudinal main axis of the at least one acoustic cell and two lateral portions, each lateral portion extending in an oblique direction with respect to the longitudinal main axis of the at least one acoustic cell, each oblique direction being between 30° and 60° with respect to the longitudinal main axis. 8. The acoustic panel according to claim 1, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to at least two adjacent faces of the at least one acoustic cell. 9. The acoustic panel according to claim 1, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to at least two non-adjacent faces of the at least one acoustic cell. 10. A nacelle for an aircraft propulsion unit comprising at least one acoustic panel according to claim 1. 11. A method for manufacturing an acoustic panel according to claim 1, the method comprising:
fastening at least one ribbon to a first plate and a second plate to the first plate by respective nodal portions; and forming non-nodal portions of the first plate and the second plate, the non-nodal portions being shaped such that each non-nodal portion of the first plate forms, with a respective non-nodal portion of the second plate, a peripheral wall of each acoustic cell delimiting a corresponding acoustic cell of the cellular core, such that a portion of the at least one ribbon forms at least one partial obstacle in the at least one acoustic cell. 12. The method according to claim 11, wherein, during the fastening step, the at least one ribbon extends throughout the nodal portions of the first plate and the second plate. 13. The method according to claim 11, wherein a strip is fastened to one end of the at least one ribbon during the fastening step, and during the forming step, the non-nodal portion of the at least one ribbon forming the at least one partial obstacle is shaped by pulling the strip. 14. The method according to claim 11, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to three adjacent faces of the at least one acoustic cell, the three adjacent faces being portions of the first plate or the second plate. 15. A method for manufacturing an acoustic panel according to claim 1, the acoustic panel further comprising a first plate and a second plate fastened together by nodal portions, wherein non-nodal portions of the first plate and the second plate form walls delimiting cells of the cellular core, the method comprising fastening at least one first obstacle to a respective non-nodal portion of the first and second plates. 16. The method according to claim 15, wherein a first fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the first plate, the first fastening leg extending in a direction of a first end of the at least one acoustic cell, and wherein a second fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the second plate, the second fastening leg extending in a direction of a second end of the at least one acoustic cell. 17. The method according to claim 15, wherein a first fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the first plate, the first fastening leg extending in a direction of one end of the at least one acoustic cell, and wherein a second fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the second plate, the second fastening leg extending in a direction of the same end of the at least one acoustic cell. | An acoustic panel with a cellular core includes cells that are provided with one or more obstacles, each of the obstacles extending transversely in relation to the main axis of the associated cell so as to increase the length of the path (F) that sound waves travel through the cell. Methods enabling the production of such a panel implements steps of cutting, folding and bonding that are suitable for creating cells provided with such obstacles.1. An acoustic panel with resonators for a nacelle of an aircraft propulsion unit, the acoustic panel comprising a plurality of adjoining acoustic cells which form a cellular core, each acoustic cell being delimited by a peripheral wall, and each acoustic cell extending along a longitudinal main axis corresponding to an axis of propagation of sound waves, from a front end up to a rear end of the acoustic cell,
wherein at least one acoustic cell among the plurality of acoustic cells includes at least one partial obstacle extending transversely with respect to the longitudinal main axis of the at least one acoustic cell, from the peripheral wall of the at least one acoustic cell, the at least one partial obstacle having a free end edge which delimits a passage with a portion of an opposite wall to increase a length of a path traveled by the sound waves through the at least one acoustic cell. 2. The acoustic panel according to claim 1, wherein the at least one acoustic cell includes a first obstacle and a second obstacle, the first obstacle and the second obstacle being shifted along the longitudinal main axis, wherein a passage defined by a free end edge of the first obstacle and a passage defined by a free end edge of the second obstacle is radially shifted so as to form a baffle to increase the length of the path traveled by the sound waves through the at least one acoustic cell. 3. The acoustic panel according to claim 2, wherein a portion of the free end edge of the first obstacle and a portion of the free end edge of the second obstacle are superimposed along the longitudinal main axis of the acoustic cell to inhibit the sound waves from drawing a direct path from the front end up to the rear end of the at least one acoustic cell. 4. The acoustic panel according to claim 2, wherein the at least one acoustic cell includes at least one acoustically permeable septum which extends across the at least one acoustic cell. 5. The acoustic panel according to claim 4, wherein the at least one acoustically permeable septum extends from the free end edge of one of the partial obstacles, up to the peripheral wall of the at least one acoustic cell. 6. The acoustic panel according to claim 4, wherein the at least one acoustically permeable septum extends from the free end edge of the first obstacle up to the free end edge of the second obstacle. 7. The acoustic panel according to claim 1, wherein the at least one partial obstacle comprises a central portion which extends transversely with respect to the longitudinal main axis of the at least one acoustic cell and two lateral portions, each lateral portion extending in an oblique direction with respect to the longitudinal main axis of the at least one acoustic cell, each oblique direction being between 30° and 60° with respect to the longitudinal main axis. 8. The acoustic panel according to claim 1, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to at least two adjacent faces of the at least one acoustic cell. 9. The acoustic panel according to claim 1, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to at least two non-adjacent faces of the at least one acoustic cell. 10. A nacelle for an aircraft propulsion unit comprising at least one acoustic panel according to claim 1. 11. A method for manufacturing an acoustic panel according to claim 1, the method comprising:
fastening at least one ribbon to a first plate and a second plate to the first plate by respective nodal portions; and forming non-nodal portions of the first plate and the second plate, the non-nodal portions being shaped such that each non-nodal portion of the first plate forms, with a respective non-nodal portion of the second plate, a peripheral wall of each acoustic cell delimiting a corresponding acoustic cell of the cellular core, such that a portion of the at least one ribbon forms at least one partial obstacle in the at least one acoustic cell. 12. The method according to claim 11, wherein, during the fastening step, the at least one ribbon extends throughout the nodal portions of the first plate and the second plate. 13. The method according to claim 11, wherein a strip is fastened to one end of the at least one ribbon during the fastening step, and during the forming step, the non-nodal portion of the at least one ribbon forming the at least one partial obstacle is shaped by pulling the strip. 14. The method according to claim 11, wherein the peripheral wall of the at least one acoustic cell comprises six faces forming a hexagonal cell, the at least one partial obstacle being fastened to three adjacent faces of the at least one acoustic cell, the three adjacent faces being portions of the first plate or the second plate. 15. A method for manufacturing an acoustic panel according to claim 1, the acoustic panel further comprising a first plate and a second plate fastened together by nodal portions, wherein non-nodal portions of the first plate and the second plate form walls delimiting cells of the cellular core, the method comprising fastening at least one first obstacle to a respective non-nodal portion of the first and second plates. 16. The method according to claim 15, wherein a first fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the first plate, the first fastening leg extending in a direction of a first end of the at least one acoustic cell, and wherein a second fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the second plate, the second fastening leg extending in a direction of a second end of the at least one acoustic cell. 17. The method according to claim 15, wherein a first fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the first plate, the first fastening leg extending in a direction of one end of the at least one acoustic cell, and wherein a second fastening leg of the at least one first obstacle is fastened to a non-nodal portion of the second plate, the second fastening leg extending in a direction of the same end of the at least one acoustic cell. | 2,600 |
348,674 | 16,806,178 | 2,674 | A decoder unit is configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, and includes a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where p<n; and control logic configured to allocate blocks of encoded texture data to the decoders in accordance with the texel request. | 1. A decoder unit embodied in hardware and configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the decoder unit comprising:
a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of one or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and control logic configured to allocate different blocks of encoded texture data to the decoders in accordance with the texel request, wherein the control logic is configured to, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, allocate an instance of at least one block of encoded texture data to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. 2. The decoder unit as claimed in claim 1, wherein each of the second set of one or more decoders is configured to decode a single texel from a received block of encoded texture data. 3. The decoder unit as claimed in claim 1, wherein each of the one or more second set of decoders is configured to decode two texels from a received block of encoded texture data. 4. The decoder unit as claimed in claim 1, wherein each of the first set of decoders is configured to decode four texels from a single received block of encoded texture data. 5. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate an instance of one block of encoded texture data that encodes two texels of the 2×2 sub-block to each of two decoders of the second set in response to the texel request indicating the 2×2 sub-block overlaps the edges of two adjacent texel blocks. 6. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate two different blocks of encoded texture data encoding two different texels of the 2×2 sub-block to two decoders of the first set in response to the texel request indicating the 2×2 block overlaps the corners of four adjacent texel blocks. 7. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate a block of encoded data different to the blocks allocated to the decoders of the second set to a decoder of the first set that encodes at least one other texel of the 2×2 sub-block. 8. The decoder unit as claimed in claim 1, wherein each encoded block of texture data is encoded according to an Adaptable Scalable Texture Compression (ASTC) format. 9. The decoder unit as claimed in claim 8, wherein each of the first set of decoders comprises:
a parameter decode unit configured to decode configuration data for the received block of texture data; a colour decode unit configured to decode colour endpoint data for n texels of the received block in dependence on the configuration data; a weight decode unit configured to decode interpolation weight data for each of the n texels of the received block in dependence on the configuration data; and at least one interpolator unit configured to calculate a colour value for each of the n texels of the received block using the interpolation weight data for that texel and a pair of colour endpoints from the colour endpoint data; wherein at least one of the parameter decode unit, colour decode unit and weight decode unit are configured to decode intermediate data from the received block that is common to the decoding of the texels of that block and to use that decoded intermediate data in the decoding of at least two of the n texels from the received block of texture data. 10. The decoder unit as claimed in claim 9, wherein the at least one of the parameter decode unit, colour decode unit and weight decode unit are configured to use the same data as part of the decoding of each of the n texels. 11. The decoder unit as claimed in claim 10, wherein the colour decode unit is configured to: decode intermediate colour data from the received block of texture data as part of decoding the colour endpoint data that is common to the decoding of the texels of that block; and use that intermediate colour data to decode the colour endpoint data for each of the n texels. 12. The decoder unit as claimed in claim 9, wherein a first portion of the configuration data is common to the decoding of the n texels, and the weight decode unit is configured to use that first portion of configuration data for decoding the interpolation weight data for each of the n texels, the first portion of configuration data comprises at least one of: a weight grid size specifying the dimensions of a weight grid; and weight ranges specifying the range of values occupied by weights of the grid. 13. The decoder unit as claimed in claim 9, wherein a second portion of the configuration data is common to the decoding of the texels of the received block, and the colour decode unit is configured to use that second portion of configuration data for decoding the colour endpoint data for each of the n texels. 14. The decoder unit as claimed in claim 12, wherein the second portion of configuration data comprises colour endpoint mode data that specifies how to convert a set of colour endpoint values into a pair of colour endpoints. 15. The decoder unit as claimed in claim 9, wherein the parameter decode unit is configured to: decode intermediate configuration data from the received block of texture data as part of decoding the configuration data; and use that same intermediate configuration data to decode a partition index for each of the n texels. 16. The decoder unit as claimed in claim 9, wherein the weight decode unit is configured to: decode intermediate weight data from the received block of texture data as part of decoding the interpolation weight data that is common to the texels of that block; and use that data to decode the interpolation weight data for each of the n texels, wherein the intermediate data comprises the size of the data within the block used to represent the interpolation weight data. 17. The decoder unit as claimed in claim 9, wherein the texels represented by the block are partitioned into np partitions, and the decoder comprises np interpolators each configured to calculate a colour value for a subset of texels in a respective partition using the interpolation weight data for that texel and a respective pair of colour endpoints from the colour endpoint data. 18. The decoder unit as claimed in claim 1, wherein the blocks of texture data are encoded according to one of the following texture compression formats: S3TC; PVR-TC; PVR-TC2; ASTC; ETC1; ETC2; EAC; 3Dc; and BC1-BC5. 19. A method of decoding a plurality of texels in accordance with a texel request using a decoder unit embodied in hardware, the texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the method comprising:
allocating blocks of encoded texture data to decoders of a first and second set of one or more decoders in accordance with the texel request, wherein each of the first set of decoders is configured to decode n texels from a single received block of encoded texture data, and each of the second set of decoders is configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and wherein, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, an instance of at least one block of encoded texture data is allocated to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. 20. An integrated circuit definition dataset that, when processed in an integrated circuit manufacturing system, configures the integrated circuit manufacturing system to manufacture a decoder unit embodied in hardware and configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the decoder unit comprising:
a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of one or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and control logic configured to allocate different blocks of encoded texture data to the decoders in accordance with the texel request, wherein the control logic is configured to, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, allocate an instance of at least one block of encoded texture data to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. | A decoder unit is configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, and includes a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where p<n; and control logic configured to allocate blocks of encoded texture data to the decoders in accordance with the texel request.1. A decoder unit embodied in hardware and configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the decoder unit comprising:
a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of one or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and control logic configured to allocate different blocks of encoded texture data to the decoders in accordance with the texel request, wherein the control logic is configured to, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, allocate an instance of at least one block of encoded texture data to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. 2. The decoder unit as claimed in claim 1, wherein each of the second set of one or more decoders is configured to decode a single texel from a received block of encoded texture data. 3. The decoder unit as claimed in claim 1, wherein each of the one or more second set of decoders is configured to decode two texels from a received block of encoded texture data. 4. The decoder unit as claimed in claim 1, wherein each of the first set of decoders is configured to decode four texels from a single received block of encoded texture data. 5. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate an instance of one block of encoded texture data that encodes two texels of the 2×2 sub-block to each of two decoders of the second set in response to the texel request indicating the 2×2 sub-block overlaps the edges of two adjacent texel blocks. 6. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate two different blocks of encoded texture data encoding two different texels of the 2×2 sub-block to two decoders of the first set in response to the texel request indicating the 2×2 block overlaps the corners of four adjacent texel blocks. 7. The decoder unit as claimed in claim 1, wherein the control logic is configured to allocate a block of encoded data different to the blocks allocated to the decoders of the second set to a decoder of the first set that encodes at least one other texel of the 2×2 sub-block. 8. The decoder unit as claimed in claim 1, wherein each encoded block of texture data is encoded according to an Adaptable Scalable Texture Compression (ASTC) format. 9. The decoder unit as claimed in claim 8, wherein each of the first set of decoders comprises:
a parameter decode unit configured to decode configuration data for the received block of texture data; a colour decode unit configured to decode colour endpoint data for n texels of the received block in dependence on the configuration data; a weight decode unit configured to decode interpolation weight data for each of the n texels of the received block in dependence on the configuration data; and at least one interpolator unit configured to calculate a colour value for each of the n texels of the received block using the interpolation weight data for that texel and a pair of colour endpoints from the colour endpoint data; wherein at least one of the parameter decode unit, colour decode unit and weight decode unit are configured to decode intermediate data from the received block that is common to the decoding of the texels of that block and to use that decoded intermediate data in the decoding of at least two of the n texels from the received block of texture data. 10. The decoder unit as claimed in claim 9, wherein the at least one of the parameter decode unit, colour decode unit and weight decode unit are configured to use the same data as part of the decoding of each of the n texels. 11. The decoder unit as claimed in claim 10, wherein the colour decode unit is configured to: decode intermediate colour data from the received block of texture data as part of decoding the colour endpoint data that is common to the decoding of the texels of that block; and use that intermediate colour data to decode the colour endpoint data for each of the n texels. 12. The decoder unit as claimed in claim 9, wherein a first portion of the configuration data is common to the decoding of the n texels, and the weight decode unit is configured to use that first portion of configuration data for decoding the interpolation weight data for each of the n texels, the first portion of configuration data comprises at least one of: a weight grid size specifying the dimensions of a weight grid; and weight ranges specifying the range of values occupied by weights of the grid. 13. The decoder unit as claimed in claim 9, wherein a second portion of the configuration data is common to the decoding of the texels of the received block, and the colour decode unit is configured to use that second portion of configuration data for decoding the colour endpoint data for each of the n texels. 14. The decoder unit as claimed in claim 12, wherein the second portion of configuration data comprises colour endpoint mode data that specifies how to convert a set of colour endpoint values into a pair of colour endpoints. 15. The decoder unit as claimed in claim 9, wherein the parameter decode unit is configured to: decode intermediate configuration data from the received block of texture data as part of decoding the configuration data; and use that same intermediate configuration data to decode a partition index for each of the n texels. 16. The decoder unit as claimed in claim 9, wherein the weight decode unit is configured to: decode intermediate weight data from the received block of texture data as part of decoding the interpolation weight data that is common to the texels of that block; and use that data to decode the interpolation weight data for each of the n texels, wherein the intermediate data comprises the size of the data within the block used to represent the interpolation weight data. 17. The decoder unit as claimed in claim 9, wherein the texels represented by the block are partitioned into np partitions, and the decoder comprises np interpolators each configured to calculate a colour value for a subset of texels in a respective partition using the interpolation weight data for that texel and a respective pair of colour endpoints from the colour endpoint data. 18. The decoder unit as claimed in claim 1, wherein the blocks of texture data are encoded according to one of the following texture compression formats: S3TC; PVR-TC; PVR-TC2; ASTC; ETC1; ETC2; EAC; 3Dc; and BC1-BC5. 19. A method of decoding a plurality of texels in accordance with a texel request using a decoder unit embodied in hardware, the texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the method comprising:
allocating blocks of encoded texture data to decoders of a first and second set of one or more decoders in accordance with the texel request, wherein each of the first set of decoders is configured to decode n texels from a single received block of encoded texture data, and each of the second set of decoders is configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and wherein, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, an instance of at least one block of encoded texture data is allocated to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. 20. An integrated circuit definition dataset that, when processed in an integrated circuit manufacturing system, configures the integrated circuit manufacturing system to manufacture a decoder unit embodied in hardware and configured to decode a plurality of texels in accordance with a texel request, the plurality of texels being encoded across one or more blocks of encoded texture data each encoding a block of texels, the decoder unit comprising:
a first set of one or more decoders, each of the first set of decoders being configured to decode n texels from a single received block of encoded texture data; a second set of one or more decoders, each of the second set of decoders being configured to decode p texels from a single received block of encoded texture data, where 1≤p<n; and control logic configured to allocate different blocks of encoded texture data to the decoders in accordance with the texel request, wherein the control logic is configured to, in response to a texel request indicating a 2×2 sub-block of texels encoded across more than one block of encoded texture data is to be decoded, allocate an instance of at least one block of encoded texture data to each of two decoders of the second set, each of said more than one blocks of encoded texture data encoding at least one texel of the 2×2 sub-block. | 2,600 |
348,675 | 16,806,187 | 3,668 | A fail-safe interface for a by-wire vehicle control system merges driver commands and external commands developed by a by-wire control unit to form a failure-tolerant actuator command that never diminishes a driver command. External commands are passed through a fault detection circuit that filters out aberrant cyclical and constant command signals from the by-wire control unit, and the actuator command is determined according to the higher or maximum of the driver-generated and external commands. The interface is powered by vehicle power supply, and is electro-optically isolated from the external control unit so that if the external control unit loses power, the actuator command faithfully follows the driver command. | 1. A by-wire control system for a vehicle, comprising:
a sensor assembly manipulated by a driver of the vehicle that produces a first electrical signal indicative of a driver command for a vehicle control parameter; an external control unit for producing a second electrical signal indicative of an external command for said control parameter; an actuator that regulates said control parameter in accordance with a third electrical signal indicative of a final command for said control parameter; and an interface circuit that merges said first and second electrical signals to form said third electrical signal, including a filter circuit that blocks said second electrical signal during specified fault modes of said external control unit while otherwise passing said second electrical signal a filter circuit output, and a merging circuit for setting said third electrical signal equal to said first electrical signal when said driver command equals or exceeds said external command, and otherwise setting said third electrical signal equal to said filter circuit output. 2. The by-wire control system of claim 1, further comprising:
an electrical isolation circuit through which said second electrical signal is supplied to said interface circuit so that an electrical failure of said external control unit does not cause a failure of said interface circuit. 3. The by-wire control system of claim 1, where:
said second electrical signal is a pulse width modulated signal having a duty cycle based on said external command; and said filter circuit includes a high-pass or band-pass filter responsive to said second electrical signal, a demodulator for demodulating an output of said filter. 4. The by-wire control system of claim 3, where:
said first electrical signal is a pulse width modulated signal having a duty cycle based on said driver command; and said filter circuit includes an AND-gate for logically combining said second electrical signal with an output of said demodulator to form said filter circuit output. 5. The by-wire control system of claim 4, where said output of said demodulator disables said AND-gate to block said
second electrical signal during said specified fault modes of said external control unit, and otherwise enables said AND-gate to pass said second electrical signal to said filter circuit output. 6. The by-wire control system of claim 3, where:
said first electrical signal is a pulse width modulated signal having a duty cycle based on said driver command; and said merging circuit includes a logic gate that combines said filter circuit output with said first electrical signal. 7. The by-wire control system of claim 3, where:
said first electrical circuit is an analog voltage having a magnitude based on said driver command; and said demodulator includes a low-pass filter for converting an output of said filter into an analog voltage. 8. The by-wire control system of claim 7, where:
said merging circuit includes a summer for combining an output of said low-pass filter with said first electrical signal to form said third electrical signal. 9. The by-wire control system of claim 1, where:
said sensor assembly is an accelerator pedal sensor assembly, and said driver command is an accelerator pedal position. 10. The by-wire control system of claim 1, where:
said sensor assembly is an brake pedal sensor assembly, and said driver command is an brake pedal position. 11. The by-wire control system of claim 1, further comprising:
a first power supply for supplying power to said sensor assembly, said actuator and said interface circuit; a second power supply for supplying power to said external control unit; and an electrical isolation circuit through which said second electrical signal is supplied to said interface circuit so that an electrical failure of said second power supply does not cause a failure of said interface circuit. | A fail-safe interface for a by-wire vehicle control system merges driver commands and external commands developed by a by-wire control unit to form a failure-tolerant actuator command that never diminishes a driver command. External commands are passed through a fault detection circuit that filters out aberrant cyclical and constant command signals from the by-wire control unit, and the actuator command is determined according to the higher or maximum of the driver-generated and external commands. The interface is powered by vehicle power supply, and is electro-optically isolated from the external control unit so that if the external control unit loses power, the actuator command faithfully follows the driver command.1. A by-wire control system for a vehicle, comprising:
a sensor assembly manipulated by a driver of the vehicle that produces a first electrical signal indicative of a driver command for a vehicle control parameter; an external control unit for producing a second electrical signal indicative of an external command for said control parameter; an actuator that regulates said control parameter in accordance with a third electrical signal indicative of a final command for said control parameter; and an interface circuit that merges said first and second electrical signals to form said third electrical signal, including a filter circuit that blocks said second electrical signal during specified fault modes of said external control unit while otherwise passing said second electrical signal a filter circuit output, and a merging circuit for setting said third electrical signal equal to said first electrical signal when said driver command equals or exceeds said external command, and otherwise setting said third electrical signal equal to said filter circuit output. 2. The by-wire control system of claim 1, further comprising:
an electrical isolation circuit through which said second electrical signal is supplied to said interface circuit so that an electrical failure of said external control unit does not cause a failure of said interface circuit. 3. The by-wire control system of claim 1, where:
said second electrical signal is a pulse width modulated signal having a duty cycle based on said external command; and said filter circuit includes a high-pass or band-pass filter responsive to said second electrical signal, a demodulator for demodulating an output of said filter. 4. The by-wire control system of claim 3, where:
said first electrical signal is a pulse width modulated signal having a duty cycle based on said driver command; and said filter circuit includes an AND-gate for logically combining said second electrical signal with an output of said demodulator to form said filter circuit output. 5. The by-wire control system of claim 4, where said output of said demodulator disables said AND-gate to block said
second electrical signal during said specified fault modes of said external control unit, and otherwise enables said AND-gate to pass said second electrical signal to said filter circuit output. 6. The by-wire control system of claim 3, where:
said first electrical signal is a pulse width modulated signal having a duty cycle based on said driver command; and said merging circuit includes a logic gate that combines said filter circuit output with said first electrical signal. 7. The by-wire control system of claim 3, where:
said first electrical circuit is an analog voltage having a magnitude based on said driver command; and said demodulator includes a low-pass filter for converting an output of said filter into an analog voltage. 8. The by-wire control system of claim 7, where:
said merging circuit includes a summer for combining an output of said low-pass filter with said first electrical signal to form said third electrical signal. 9. The by-wire control system of claim 1, where:
said sensor assembly is an accelerator pedal sensor assembly, and said driver command is an accelerator pedal position. 10. The by-wire control system of claim 1, where:
said sensor assembly is an brake pedal sensor assembly, and said driver command is an brake pedal position. 11. The by-wire control system of claim 1, further comprising:
a first power supply for supplying power to said sensor assembly, said actuator and said interface circuit; a second power supply for supplying power to said external control unit; and an electrical isolation circuit through which said second electrical signal is supplied to said interface circuit so that an electrical failure of said second power supply does not cause a failure of said interface circuit. | 3,600 |
348,676 | 16,806,145 | 3,668 | This disclosure relates to dosage forms containing an enantiomerically enriched or pure bupropion such as enantiomeric excess of (S)-bupropion, enantiomerically enriched (S)-bupropion, or enantiomerically pure (S)-bupropion and methods of using these dosage forms. These dosage forms may be administered to human beings in a reduced amount as compared to the amount of racemic bupropion that would be administered in the same situation. | 1. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 150 mg to about 200 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24 of bupropion, wherein the daily dose of the (S)-bupropion is about 60 mg to about 120 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 2. The method of claim 1, wherein the (S)-bupropion is administered once daily. 3. The method of claim 1, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 4. The method of claim 1, wherein the (S)-bupropion is administered for at least 8 consecutive days. 5. The method of claim 1, wherein the (S)-bupropion is administered for at least 14 consecutive days. 6. The method of claim 1, wherein the (S)-bupropion is administered for at least 21 consecutive days. 7. The method of claim 1, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 8. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 200 mg to about 250 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24of bupropion, wherein the daily dose of the (S)-bupropion is about 80 mg to about 150 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 9. The method of claim 8, wherein the (S)-bupropion is administered once daily. 10. The method of claim 8, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 11. The method of claim 8, wherein the (S)-bupropion is administered for at least 8 consecutive days. 12. The method of claim 8, wherein the (S)-bupropion is administered for at least 14 consecutive days. 13. The method of claim 8, wherein the (S)-bupropion is administered for at least 21 consecutive days. 14. The method of claim 8, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 15. The method of claim 8, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is at least about 400 ng·hr/mL. 16. The method of claim 8, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is about 500 ng·hr/mL to about 900 ng·hr/mL. 17. The method of claim 8, wherein the method achieves a Cmax of (S)-bupropion in the human being that is about 60 ng/mL to about 140 ng/mL. 18. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 250 mg to about 300 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24of bupropion, wherein the daily dose of the (S)-bupropion is about 100 mg to about 180 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 19. The method of claim 18, wherein the (S)-bupropion is administered once daily. 20. The method of claim 18, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 21. The method of claim 18, wherein the (S)-bupropion is administered for at least 8 consecutive days. 22. The method of claim 18, wherein the (S)-bupropion is administered for at least 14 consecutive days. 23. The method of claim 18, wherein the (S)-bupropion is administered for at least 21 consecutive days. 24. The method of claim 18, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 25. The method of claim 18, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is at least about 400 ng·hr/mL. 26. The method of claim 18, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is about 500 ng·hr/mL to about 900 ng·hr/mL. 27. The method of claim 18, wherein the method achieves a Cmax of (S)-bupropion in the human being that is about 60 ng/mL to about 140 ng/mL. | This disclosure relates to dosage forms containing an enantiomerically enriched or pure bupropion such as enantiomeric excess of (S)-bupropion, enantiomerically enriched (S)-bupropion, or enantiomerically pure (S)-bupropion and methods of using these dosage forms. These dosage forms may be administered to human beings in a reduced amount as compared to the amount of racemic bupropion that would be administered in the same situation.1. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 150 mg to about 200 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24 of bupropion, wherein the daily dose of the (S)-bupropion is about 60 mg to about 120 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 2. The method of claim 1, wherein the (S)-bupropion is administered once daily. 3. The method of claim 1, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 4. The method of claim 1, wherein the (S)-bupropion is administered for at least 8 consecutive days. 5. The method of claim 1, wherein the (S)-bupropion is administered for at least 14 consecutive days. 6. The method of claim 1, wherein the (S)-bupropion is administered for at least 21 consecutive days. 7. The method of claim 1, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 8. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 200 mg to about 250 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24of bupropion, wherein the daily dose of the (S)-bupropion is about 80 mg to about 150 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 9. The method of claim 8, wherein the (S)-bupropion is administered once daily. 10. The method of claim 8, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 11. The method of claim 8, wherein the (S)-bupropion is administered for at least 8 consecutive days. 12. The method of claim 8, wherein the (S)-bupropion is administered for at least 14 consecutive days. 13. The method of claim 8, wherein the (S)-bupropion is administered for at least 21 consecutive days. 14. The method of claim 8, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 15. The method of claim 8, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is at least about 400 ng·hr/mL. 16. The method of claim 8, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is about 500 ng·hr/mL to about 900 ng·hr/mL. 17. The method of claim 8, wherein the method achieves a Cmax of (S)-bupropion in the human being that is about 60 ng/mL to about 140 ng/mL. 18. A method of treating a condition, comprising:
selecting a human being having the condition, wherein the condition is treated by achieving a first AUC0-24 of bupropion, wherein the first AUC0-24 of bupropion is the same as a reference AUC0-24 of bupropion that results from administering a daily dose of racemic bupropion, wherein the daily dose of racemic bupropion is about 250 mg to about 300 mg; and orally administering a daily dose of an (S)-bupropion to the human being to achieve the first AUC0-24of bupropion, wherein the daily dose of the (S)-bupropion is about 100 mg to about 180 mg; wherein the (S)-bupropion is at least 95% enantiomerically pure, and no other bupropion is administered with the daily dose of the (S)-bupropion; and wherein the daily dose of the (S)-bupropion is about 40% to about 60% of the daily dose of racemic bupropion. 19. The method of claim 18, wherein the (S)-bupropion is administered once daily. 20. The method of claim 18, wherein the (S)-bupropion is administered in two doses per day, wherein the sum of the two doses per day is the daily dose. 21. The method of claim 18, wherein the (S)-bupropion is administered for at least 8 consecutive days. 22. The method of claim 18, wherein the (S)-bupropion is administered for at least 14 consecutive days. 23. The method of claim 18, wherein the (S)-bupropion is administered for at least 21 consecutive days. 24. The method of claim 18, wherein the (S)-bupropion is administered in a dosage form that provides sustained release of the (S)-bupropion. 25. The method of claim 18, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is at least about 400 ng·hr/mL. 26. The method of claim 18, wherein the method achieves an AUC0-12 of (S)-bupropion in the human being that is about 500 ng·hr/mL to about 900 ng·hr/mL. 27. The method of claim 18, wherein the method achieves a Cmax of (S)-bupropion in the human being that is about 60 ng/mL to about 140 ng/mL. | 3,600 |
348,677 | 16,806,159 | 3,668 | A filter assembly includes a body of filter media, a seal, and a compression ring. The body of filter media having a first end surface, a second end surface spaced apart from and opposing the first end surface, and an outer surface extending between the first end surface and the second end surface. The seal surrounds the first end surface. The compression ring is disposed about the second end surface. The compression ring includes a first channel configured to allow fluid communication between the second end surface and the outer surface. | 1. A filter assembly, comprising:
a body of filter media having a first media end surface, a second media end surface spaced apart from and opposing the first media end surface, and an outer media surface extending between the first media end surface and the second media end surface; a seal surrounding the first media end surface; and a compression ring disposed about the second media end surface and including (i) and outer ring surface spaced radially outwardly from the outer media surface and having a height extending from a first end to a second end along an axial direction and (ii) a first ring end surface spaced axially from the second media end surface and having a width extending radially inwardly from the first end of the outer ring surface, the compression ring including a first channel having a first channel portion extending through an entire length of the outer ring surface and a second channel portion extending from the first channel portion through an entire width of the first ring end surface, the first channel providing a fluid passage from the second media end surface to the outer media surface. 2. (canceled) 3. The filter assembly according to claim 1, wherein the first ring end surface extends radially and the outer ring surface extends axially. 4. The filter assembly according to claim 1, wherein the compression ring further includes a second channel, a third channel, and a fourth channel. 5. The filter assembly according to claim 4, wherein each of the second channel, the third channel, and the fourth channel are disposed in the first ring end surface and the outer ring surface of the compression ring. 6. The filter assembly according to claim 5, wherein the first channel, the second channel, the third channel, and the fourth channel are evenly spaced about the second end media surface of the body of filter media. 7. The filter assembly according to claim 1, wherein the body of filter media is substantially cylindrical. 8. The filter assembly according to claim 1, further comprising screen element having a first screen end surface and a second screen end surface spaced apart from and opposing the first screen end surface, the second screen end surface of the screen element disposed adjacent to the first media end surface of the body of filter media. 9. The filter assembly according to claim 8, wherein the screen element includes a substantially disc-shaped base portion and an outer flange portion. 10. The filter assembly according to claim 8, wherein the body of filter media further defines a ledge disposed proximate the first media end surface of the body of filter media, and wherein the seal is disposed upon the ledge and surrounds a portion of the screen element. 11. A filter assembly, comprising:
a body of filter media having an inlet end, an outlet end spaced apart from and opposing the inlet end, and a sidewall extending between the inlet end and the outlet end; a seal member extending around the body of filter media and including a first radially-extending surface, the outlet end disposed between the first radially-extending surface and the inlet end; and a compression ring extending around the body of filter media and including (i) an axially-extending surface spaced radially outwardly from the sidewall of the body of filter media and having a height extending from a first end to a second end along an axial direction and (ii) a second radially-extending surface spaced axially from the inlet end of the body of filter media and having a width extending radially inwardly from the first end of the axially-extending surface, the compression ring including a first channel having a first channel portion extending through an entire length of the axially-extending surface and a second channel portion extending from the first channel portion through an entire width of the axially-extending surface, the first channel providing a fluid passage from the inlet end to the sidewall. 12. (canceled) 13. The filter assembly according to claim 11, wherein the second radially-extending surface of the compression ring further defines a second channel, a third channel, and a fourth channel. 14. The filter assembly according to claim 13, wherein each of the second channel, the third channel, and the fourth channel is disposed in the second radially-extending surface and the axially-extending surface of the compression ring. 15. The filter assembly according to claim 13, wherein the first channel, the second channel, the third channel, and the fourth channel are evenly spaced about the body of filter media. 16. The filter assembly according to claim 11, wherein the body of filter media is substantially cylindrical. 17. The filter assembly according to claim 11, further comprising a screen element having a first screen end surface and a second screen end surface spaced apart from and opposing the first screen end surface, the second screen end surface is disposed adjacent to the outlet end of the body of filter media. 18. The filter assembly according to claim 17, wherein the screen element includes a substantially disc-shaped base portion and an outer flange. 19. The filter assembly according to claim 18, wherein the body of filter media further defines a ledge disposed proximate the outlet end. 20. The filter assembly according to claim 19, wherein the seal member is disposed upon the ledge and surrounds at least a portion of the screen element. | A filter assembly includes a body of filter media, a seal, and a compression ring. The body of filter media having a first end surface, a second end surface spaced apart from and opposing the first end surface, and an outer surface extending between the first end surface and the second end surface. The seal surrounds the first end surface. The compression ring is disposed about the second end surface. The compression ring includes a first channel configured to allow fluid communication between the second end surface and the outer surface.1. A filter assembly, comprising:
a body of filter media having a first media end surface, a second media end surface spaced apart from and opposing the first media end surface, and an outer media surface extending between the first media end surface and the second media end surface; a seal surrounding the first media end surface; and a compression ring disposed about the second media end surface and including (i) and outer ring surface spaced radially outwardly from the outer media surface and having a height extending from a first end to a second end along an axial direction and (ii) a first ring end surface spaced axially from the second media end surface and having a width extending radially inwardly from the first end of the outer ring surface, the compression ring including a first channel having a first channel portion extending through an entire length of the outer ring surface and a second channel portion extending from the first channel portion through an entire width of the first ring end surface, the first channel providing a fluid passage from the second media end surface to the outer media surface. 2. (canceled) 3. The filter assembly according to claim 1, wherein the first ring end surface extends radially and the outer ring surface extends axially. 4. The filter assembly according to claim 1, wherein the compression ring further includes a second channel, a third channel, and a fourth channel. 5. The filter assembly according to claim 4, wherein each of the second channel, the third channel, and the fourth channel are disposed in the first ring end surface and the outer ring surface of the compression ring. 6. The filter assembly according to claim 5, wherein the first channel, the second channel, the third channel, and the fourth channel are evenly spaced about the second end media surface of the body of filter media. 7. The filter assembly according to claim 1, wherein the body of filter media is substantially cylindrical. 8. The filter assembly according to claim 1, further comprising screen element having a first screen end surface and a second screen end surface spaced apart from and opposing the first screen end surface, the second screen end surface of the screen element disposed adjacent to the first media end surface of the body of filter media. 9. The filter assembly according to claim 8, wherein the screen element includes a substantially disc-shaped base portion and an outer flange portion. 10. The filter assembly according to claim 8, wherein the body of filter media further defines a ledge disposed proximate the first media end surface of the body of filter media, and wherein the seal is disposed upon the ledge and surrounds a portion of the screen element. 11. A filter assembly, comprising:
a body of filter media having an inlet end, an outlet end spaced apart from and opposing the inlet end, and a sidewall extending between the inlet end and the outlet end; a seal member extending around the body of filter media and including a first radially-extending surface, the outlet end disposed between the first radially-extending surface and the inlet end; and a compression ring extending around the body of filter media and including (i) an axially-extending surface spaced radially outwardly from the sidewall of the body of filter media and having a height extending from a first end to a second end along an axial direction and (ii) a second radially-extending surface spaced axially from the inlet end of the body of filter media and having a width extending radially inwardly from the first end of the axially-extending surface, the compression ring including a first channel having a first channel portion extending through an entire length of the axially-extending surface and a second channel portion extending from the first channel portion through an entire width of the axially-extending surface, the first channel providing a fluid passage from the inlet end to the sidewall. 12. (canceled) 13. The filter assembly according to claim 11, wherein the second radially-extending surface of the compression ring further defines a second channel, a third channel, and a fourth channel. 14. The filter assembly according to claim 13, wherein each of the second channel, the third channel, and the fourth channel is disposed in the second radially-extending surface and the axially-extending surface of the compression ring. 15. The filter assembly according to claim 13, wherein the first channel, the second channel, the third channel, and the fourth channel are evenly spaced about the body of filter media. 16. The filter assembly according to claim 11, wherein the body of filter media is substantially cylindrical. 17. The filter assembly according to claim 11, further comprising a screen element having a first screen end surface and a second screen end surface spaced apart from and opposing the first screen end surface, the second screen end surface is disposed adjacent to the outlet end of the body of filter media. 18. The filter assembly according to claim 17, wherein the screen element includes a substantially disc-shaped base portion and an outer flange. 19. The filter assembly according to claim 18, wherein the body of filter media further defines a ledge disposed proximate the outlet end. 20. The filter assembly according to claim 19, wherein the seal member is disposed upon the ledge and surrounds at least a portion of the screen element. | 3,600 |
348,678 | 16,806,181 | 3,733 | A kit and a method of providing a kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, wherein the kit includes a wrinkle-resistant polymeric fabric dress, a pouch formed of a flexible, waterproof, tear-resistant material, including means for selectable opening and closure of a longitudinal opening thereof, wherein the dress is capable of selectable folding and compression to less than the volume of the pouch and which is press-or slip-fittable thereinto, and the kit includes a reclosable sealable plastic zip-top bag for receiving soiled garments, separate from that of the pouch. | 1. A kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, the kit comprising:
a pouch formed of a flexible, waterproof, tear-resistant material having a volume in the range of 400 to 1000 cubic centimeters, the pouch including means for selectable opening and closure of a longitudinal opening thereof; a compressible dress, constructed of fabric configured to resist wrinkles cause by compression for an extended period of time, wherein said fabric is in a weight range of up to 450 grams, having a thickness in the range of 0.35 mm to 0.55 mm, thereby allowing said compressible dress to be optimally folded for a reduced volume; said wrinkle-resistant fabric capable of selectable folding and compression to less than said volume of said pouch and, thereupon, press- or slip-fittable thereinto; said fabric of said compressible dress is capable of expansion of at least 200% in size upon removal from said pouch, wherein said expansion does not result in a sheer or see-through material, and said fabric is capable of returning to its original physical condition after expansion; and a reclosable sealable plastic zip-top bag for receiving soiled garments, separate from that of said pouch 2. The kit as recited in claim 1, wherein the pouch further comprises an interior lining of moisture and heat-resistant flexible fabric adhered to an interior of said pouch, said fabric having non-reactive properties with both the material of said pouch and of said reusable compressible dress. 3. The kit as recited in claim 1, in which a density of material of said pouch defines a range of about 0.25 to about 0.50 grams per square centimeter. 4. The kit as recited in claim 1, wherein a waist measurement of said dress define a range of twenty eight inches to thirty six inches, a chest measurement of said dress define a range of thirty two inches to forty inches, a hip measurement of said dress define a range of thirty four inches to forty two inches, and a length measurement of said dress define a range of thirty four inches to thirty eight inches. 5. The kit as recited in claim 4, wherein the dress is configured to be short-sleeved to minimize excess fabric. 6. A method for providing a kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, the method comprising:
providing a pouch wherein said pouch is selected from a material having a flexible, waterproof, tear-resistant material having a volume in the range of 400 to 1000 cubic centimeters, the pouch including means for selectable opening and closure of a longitudinal opening thereof; providing a compressible dress, wherein said providing of said compressible dress further includes constructing said dress of fabric configured to resist wrinkles cause by compression for an extended period of time, wherein said fabric is in a weight range of up to 450 grams, having a thickness in the range of 0.35 mm to 0.55 mm, thereby allowing said compressible dress to be optimally folded for a reduced volume, wherein said wrinkle-resistant fabric is capable of selectable folding and compression to less than said volume of said pouch and, thereupon, press- or slip-fittable thereinto, and said fabric of said compressible dress is capable of expansion of at least 200% in size upon removal from said pouch, wherein said expansion does not result in a sheer or see-through material, and said fabric is capable of returning to its original physical condition after expansion; folding and including a reclosable sealable plastic zip-top bag inside said pouch for receiving soiled garments, separate from that of said pouch; folding said compressible dress into segments that mirror width and length dimensions of said pouch to avoid gaps and air pockets between the compressible dress and pouch when said dress is slipped into said pouch; and inserting said compressed dress into said longitudinal opening. 7. The method of claim 6, further comprising:
including interior lining of moisture and heat-resistant flexible fabric adhered to an interior of said pouch, said fabric having non-reactive properties with both the material of said pouch and of said reusable compressible dress. 8. The method as recited in claim 6, further comprising:
configuring a density of material of said pouch to define a range of about 0.25 to about 0.50 grams per square centimeter. 9. The method as recited in claim 6, further comprising:
configuring a waist measurement of said dress define a range of twenty eight inches to thirty six inches; configuring a chest measurement of said dress define a range of thirty two inches to forty inches; configuring a hip measurement of said dress define a range of thirty four inches to forty two inches; and configuring a length measurement of said dress define a range of thirty four inches to thirty eight inches. 10. The kit as recited in claim 9, further comprising:
configuring the dress to be short-sleeved to minimize excess fabric. | A kit and a method of providing a kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, wherein the kit includes a wrinkle-resistant polymeric fabric dress, a pouch formed of a flexible, waterproof, tear-resistant material, including means for selectable opening and closure of a longitudinal opening thereof, wherein the dress is capable of selectable folding and compression to less than the volume of the pouch and which is press-or slip-fittable thereinto, and the kit includes a reclosable sealable plastic zip-top bag for receiving soiled garments, separate from that of the pouch.1. A kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, the kit comprising:
a pouch formed of a flexible, waterproof, tear-resistant material having a volume in the range of 400 to 1000 cubic centimeters, the pouch including means for selectable opening and closure of a longitudinal opening thereof; a compressible dress, constructed of fabric configured to resist wrinkles cause by compression for an extended period of time, wherein said fabric is in a weight range of up to 450 grams, having a thickness in the range of 0.35 mm to 0.55 mm, thereby allowing said compressible dress to be optimally folded for a reduced volume; said wrinkle-resistant fabric capable of selectable folding and compression to less than said volume of said pouch and, thereupon, press- or slip-fittable thereinto; said fabric of said compressible dress is capable of expansion of at least 200% in size upon removal from said pouch, wherein said expansion does not result in a sheer or see-through material, and said fabric is capable of returning to its original physical condition after expansion; and a reclosable sealable plastic zip-top bag for receiving soiled garments, separate from that of said pouch 2. The kit as recited in claim 1, wherein the pouch further comprises an interior lining of moisture and heat-resistant flexible fabric adhered to an interior of said pouch, said fabric having non-reactive properties with both the material of said pouch and of said reusable compressible dress. 3. The kit as recited in claim 1, in which a density of material of said pouch defines a range of about 0.25 to about 0.50 grams per square centimeter. 4. The kit as recited in claim 1, wherein a waist measurement of said dress define a range of twenty eight inches to thirty six inches, a chest measurement of said dress define a range of thirty two inches to forty inches, a hip measurement of said dress define a range of thirty four inches to forty two inches, and a length measurement of said dress define a range of thirty four inches to thirty eight inches. 5. The kit as recited in claim 4, wherein the dress is configured to be short-sleeved to minimize excess fabric. 6. A method for providing a kit for compact storage and maximum portability of a reusable compressible dress intended for emergency use, the method comprising:
providing a pouch wherein said pouch is selected from a material having a flexible, waterproof, tear-resistant material having a volume in the range of 400 to 1000 cubic centimeters, the pouch including means for selectable opening and closure of a longitudinal opening thereof; providing a compressible dress, wherein said providing of said compressible dress further includes constructing said dress of fabric configured to resist wrinkles cause by compression for an extended period of time, wherein said fabric is in a weight range of up to 450 grams, having a thickness in the range of 0.35 mm to 0.55 mm, thereby allowing said compressible dress to be optimally folded for a reduced volume, wherein said wrinkle-resistant fabric is capable of selectable folding and compression to less than said volume of said pouch and, thereupon, press- or slip-fittable thereinto, and said fabric of said compressible dress is capable of expansion of at least 200% in size upon removal from said pouch, wherein said expansion does not result in a sheer or see-through material, and said fabric is capable of returning to its original physical condition after expansion; folding and including a reclosable sealable plastic zip-top bag inside said pouch for receiving soiled garments, separate from that of said pouch; folding said compressible dress into segments that mirror width and length dimensions of said pouch to avoid gaps and air pockets between the compressible dress and pouch when said dress is slipped into said pouch; and inserting said compressed dress into said longitudinal opening. 7. The method of claim 6, further comprising:
including interior lining of moisture and heat-resistant flexible fabric adhered to an interior of said pouch, said fabric having non-reactive properties with both the material of said pouch and of said reusable compressible dress. 8. The method as recited in claim 6, further comprising:
configuring a density of material of said pouch to define a range of about 0.25 to about 0.50 grams per square centimeter. 9. The method as recited in claim 6, further comprising:
configuring a waist measurement of said dress define a range of twenty eight inches to thirty six inches; configuring a chest measurement of said dress define a range of thirty two inches to forty inches; configuring a hip measurement of said dress define a range of thirty four inches to forty two inches; and configuring a length measurement of said dress define a range of thirty four inches to thirty eight inches. 10. The kit as recited in claim 9, further comprising:
configuring the dress to be short-sleeved to minimize excess fabric. | 3,700 |
348,679 | 16,806,201 | 3,733 | A replaceable control module includes a base and an operation module. The base includes an upper cover, at least one buckling portion, at least one first elastic element, a driving rotation handle, at least one second elastic element and a cam assembly. A top surface of the upper cover has an assembling groove and a perforation. The at least one buckling portion is disposed to the upper cover. The at least one first elastic element is connected between the upper cover and the at least one buckling portion. The driving rotation handle is disposed in the upper cover. The at least one second elastic element is connected between the upper cover and the driving rotation handle. The cam assembly is disposed between the at least one buckling portion and the driving rotation handle. The operation module is assembled in the assembling groove. | 1. A replaceable control module adapted for being applied in a game controller, comprising:
a base, including
an upper cover, a top surface of the upper cover having an assembling groove and a perforation, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove,
at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove,
at least one first elastic element connected between the upper cover and the at least one buckling portion,
a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, the operation pole being disposed to and exposed to the perforation,
at least one second elastic element connected between the upper cover and the driving rotation handle, and
a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and
an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, when the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively. 2. The replaceable control module as claimed in claim 1, wherein the cam assembly includes a driving cylinder disposed to the at least one buckling portion, and at least one cam groove disposed in the driving rotation handle, the driving cylinder of the at least one buckling portion is movably disposed in the at least one cam groove. 3. The replaceable control module as claimed in claim 2, wherein each buckling portion has a bottom board, the driving cylinder is disposed to one side of a bottom surface of the bottom board, the driving rotation handle has a circular pad, the at least one cam groove is disposed to the circular pad, each cam groove includes a line groove and an arc-shaped sliding groove communicated with each other, the driving cylinder of the at least one buckling portion moves in the arc-shaped sliding groove of the at least one cam groove. 4. The replaceable control module as claimed in claim 1, wherein the at least one first elastic element is at least one tension spring, each buckling portion has a fastening groove, the upper cover has a location block, one end of each tension spring hooks the fastening groove, the other end of each tension spring hooks the location block. 5. The replaceable control module as claimed in claim 4, wherein each buckling portion has a bottom board, two sides of a bottom surface of a bottom board extend downward to form two extending portions, the two extending portions are located to two sides of the tension spring. 6. The replaceable control module as claimed in claim 5, wherein each buckling portion has a lateral board connected with the bottom board, the bottom board extends downward to form a protruding block, a portion between the lateral board and the protruding block is recessed inward to form the fastening groove. 7. The replaceable control module as claimed in claim 1, wherein the at least one second elastic element is at least one torsion spring, the upper cover has a fixing hole, the driving rotation handle has a crack, one end of the at least one torsion spring is disposed in the fixing hole, the other end of the at least one torsion spring is disposed in the crack. 8. The replaceable control module as claimed in claim 7, wherein the upper cover has at least one first location piece and a third location piece, a middle portion of the at least one torsion spring is disposed between the third location piece and the at least one first location piece. 9. The replaceable control module as claimed in claim 1, wherein the assembling groove has a bottom wall, and a peripheral wall connected with a periphery of the bottom wall, an inside of the upper cover has a location pillar, the driving rotation handle has a limiting groove, the location pillar is movably disposed in the limiting groove. 10. The replaceable control module as claimed in claim 9, wherein a bottom surface of the bottom wall of the assembling groove of the upper cover has a restricting groove, the driving rotation handle has a convex clasp, the convex clasp is restricted in or breaks away from the restricting groove to make the driving rotation handle stop rotating or rotate. 11. The replaceable control module as claimed in claim 1, wherein the perforation is arched outward to show an arc shape, a middle of the operation pole is arched outward to show the arc shape, the operation pole is substantially matched with the perforation. 12. A replaceable control module mounted to the game controller, comprising:
an upper cover, a top surface of the upper cover being recessed downward to form an assembling groove, a front of the upper cover opening a perforation penetrating through a top wall of the accommodating groove and communicated with the accommodating groove, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove, an inside of the upper cover having a location pillar; at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove; at least one first elastic element connected between the upper cover and the at least one buckling portion; a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, a bottom of the operation pole extending sideward to form a sliding portion, the sliding portion opening the limiting groove, the location pillar being movably disposed in the limiting groove, a top surface of the operation pole protruding upward to form an operation portion, the operation pole being disposed to and exposed to the perforation, the operation portion penetrating through the perforation and being exposed out of the upper cover; at least one second elastic element connected between the upper cover and the driving rotation handle; a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation portion of the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, the location pillar abuts against one side wall of the limiting groove, when the operation portion of the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively, the location pillar abuts against the other side wall of the limiting groove. 13. The replaceable control module as claimed in claim 12, wherein the perforation is arched outward to show an arc shape, a middle of the operation pole is arched outward to show the arc shape, the operation pole is substantially matched with the perforation. 14. The replaceable control module as claimed in claim 12, wherein the sliding portion is shown as a sector shape. 15. The replaceable control module as claimed in claim 12, wherein a middle of the limiting groove is slightly curved outward. 16. The replaceable control module as claimed in claim 12, wherein the cam assembly includes a driving cylinder disposed to the at least one buckling portion, and at least one cam groove disposed in the driving rotation handle, the driving cylinder of the at least one buckling portion is movably disposed in the at least one cam groove. 17. The replaceable control module as claimed in claim 16, wherein each buckling portion has a bottom board, the driving cylinder is disposed to one side of a bottom surface of the bottom board, the driving rotation handle has a circular pad, the at least one cam groove is disposed to the circular pad, each cam groove includes a line groove and an arc-shaped sliding groove communicated with each other, the driving cylinder of the at least one buckling portion moves in the arc-shaped sliding groove of the at least one cam groove. 18. A game controller, comprising:
a shell; and a replaceable control module mounted to the shell, the replaceable control module including: a base, including
an upper cover, a top surface of the upper cover having an assembling groove and a perforation, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove,
at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove,
at least one first elastic element connected between the upper cover and the at least one buckling portion,
a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, a top surface of the operation pole protruding upward to form an operation portion, the operation pole being disposed to and exposed to the perforation, the operation portion penetrating through the perforation and being exposed out of the upper cover,
at least one second elastic element connected between the upper cover and the driving rotation handle, and
a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and
an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, when the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively. | A replaceable control module includes a base and an operation module. The base includes an upper cover, at least one buckling portion, at least one first elastic element, a driving rotation handle, at least one second elastic element and a cam assembly. A top surface of the upper cover has an assembling groove and a perforation. The at least one buckling portion is disposed to the upper cover. The at least one first elastic element is connected between the upper cover and the at least one buckling portion. The driving rotation handle is disposed in the upper cover. The at least one second elastic element is connected between the upper cover and the driving rotation handle. The cam assembly is disposed between the at least one buckling portion and the driving rotation handle. The operation module is assembled in the assembling groove.1. A replaceable control module adapted for being applied in a game controller, comprising:
a base, including
an upper cover, a top surface of the upper cover having an assembling groove and a perforation, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove,
at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove,
at least one first elastic element connected between the upper cover and the at least one buckling portion,
a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, the operation pole being disposed to and exposed to the perforation,
at least one second elastic element connected between the upper cover and the driving rotation handle, and
a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and
an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, when the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively. 2. The replaceable control module as claimed in claim 1, wherein the cam assembly includes a driving cylinder disposed to the at least one buckling portion, and at least one cam groove disposed in the driving rotation handle, the driving cylinder of the at least one buckling portion is movably disposed in the at least one cam groove. 3. The replaceable control module as claimed in claim 2, wherein each buckling portion has a bottom board, the driving cylinder is disposed to one side of a bottom surface of the bottom board, the driving rotation handle has a circular pad, the at least one cam groove is disposed to the circular pad, each cam groove includes a line groove and an arc-shaped sliding groove communicated with each other, the driving cylinder of the at least one buckling portion moves in the arc-shaped sliding groove of the at least one cam groove. 4. The replaceable control module as claimed in claim 1, wherein the at least one first elastic element is at least one tension spring, each buckling portion has a fastening groove, the upper cover has a location block, one end of each tension spring hooks the fastening groove, the other end of each tension spring hooks the location block. 5. The replaceable control module as claimed in claim 4, wherein each buckling portion has a bottom board, two sides of a bottom surface of a bottom board extend downward to form two extending portions, the two extending portions are located to two sides of the tension spring. 6. The replaceable control module as claimed in claim 5, wherein each buckling portion has a lateral board connected with the bottom board, the bottom board extends downward to form a protruding block, a portion between the lateral board and the protruding block is recessed inward to form the fastening groove. 7. The replaceable control module as claimed in claim 1, wherein the at least one second elastic element is at least one torsion spring, the upper cover has a fixing hole, the driving rotation handle has a crack, one end of the at least one torsion spring is disposed in the fixing hole, the other end of the at least one torsion spring is disposed in the crack. 8. The replaceable control module as claimed in claim 7, wherein the upper cover has at least one first location piece and a third location piece, a middle portion of the at least one torsion spring is disposed between the third location piece and the at least one first location piece. 9. The replaceable control module as claimed in claim 1, wherein the assembling groove has a bottom wall, and a peripheral wall connected with a periphery of the bottom wall, an inside of the upper cover has a location pillar, the driving rotation handle has a limiting groove, the location pillar is movably disposed in the limiting groove. 10. The replaceable control module as claimed in claim 9, wherein a bottom surface of the bottom wall of the assembling groove of the upper cover has a restricting groove, the driving rotation handle has a convex clasp, the convex clasp is restricted in or breaks away from the restricting groove to make the driving rotation handle stop rotating or rotate. 11. The replaceable control module as claimed in claim 1, wherein the perforation is arched outward to show an arc shape, a middle of the operation pole is arched outward to show the arc shape, the operation pole is substantially matched with the perforation. 12. A replaceable control module mounted to the game controller, comprising:
an upper cover, a top surface of the upper cover being recessed downward to form an assembling groove, a front of the upper cover opening a perforation penetrating through a top wall of the accommodating groove and communicated with the accommodating groove, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove, an inside of the upper cover having a location pillar; at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove; at least one first elastic element connected between the upper cover and the at least one buckling portion; a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, a bottom of the operation pole extending sideward to form a sliding portion, the sliding portion opening the limiting groove, the location pillar being movably disposed in the limiting groove, a top surface of the operation pole protruding upward to form an operation portion, the operation pole being disposed to and exposed to the perforation, the operation portion penetrating through the perforation and being exposed out of the upper cover; at least one second elastic element connected between the upper cover and the driving rotation handle; a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation portion of the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, the location pillar abuts against one side wall of the limiting groove, when the operation portion of the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively, the location pillar abuts against the other side wall of the limiting groove. 13. The replaceable control module as claimed in claim 12, wherein the perforation is arched outward to show an arc shape, a middle of the operation pole is arched outward to show the arc shape, the operation pole is substantially matched with the perforation. 14. The replaceable control module as claimed in claim 12, wherein the sliding portion is shown as a sector shape. 15. The replaceable control module as claimed in claim 12, wherein a middle of the limiting groove is slightly curved outward. 16. The replaceable control module as claimed in claim 12, wherein the cam assembly includes a driving cylinder disposed to the at least one buckling portion, and at least one cam groove disposed in the driving rotation handle, the driving cylinder of the at least one buckling portion is movably disposed in the at least one cam groove. 17. The replaceable control module as claimed in claim 16, wherein each buckling portion has a bottom board, the driving cylinder is disposed to one side of a bottom surface of the bottom board, the driving rotation handle has a circular pad, the at least one cam groove is disposed to the circular pad, each cam groove includes a line groove and an arc-shaped sliding groove communicated with each other, the driving cylinder of the at least one buckling portion moves in the arc-shaped sliding groove of the at least one cam groove. 18. A game controller, comprising:
a shell; and a replaceable control module mounted to the shell, the replaceable control module including: a base, including
an upper cover, a top surface of the upper cover having an assembling groove and a perforation, the assembling groove having a peripheral wall, the peripheral wall having at least one buckling groove,
at least one buckling portion disposed to the upper cover, each buckling portion having a locking hook, the locking hook penetrating through the at least one buckling groove and projecting into the assembling groove,
at least one first elastic element connected between the upper cover and the at least one buckling portion,
a driving rotation handle disposed in the upper cover, the driving rotation handle having an operation pole, the operation pole being disposed to and exposed to the perforation, a top surface of the operation pole protruding upward to form an operation portion, the operation pole being disposed to and exposed to the perforation, the operation portion penetrating through the perforation and being exposed out of the upper cover,
at least one second elastic element connected between the upper cover and the driving rotation handle, and
a cam assembly disposed between the at least one buckling portion and the driving rotation handle; and
an operation module assembled in the assembling groove, one side surface of the operation module having at least one snapping groove, the locking hook of the at least one buckling portion being locked in the at least one snapping groove, wherein when the operation pole rotates, the driving rotation handle drives the at least one buckling portion to move outward by virtue of the cam assembly so as to make the locking hook of the at least one buckling portion break away from the at least one snapping groove, when the operation pole is returned to an initial position, the at least one first elastic element and the at least one second elastic element drive the driving rotation handle and the at least one buckling portion to return to the initial position and an original position, respectively. | 3,700 |
348,680 | 16,806,182 | 3,733 | A method for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device. The method includes: carrying out a filling control in order to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable, adapting the filling control with the aid of an adaptation variable that indicates a correction value for the lambda setpoint value, and storing an adaptation value as a function of an operating range of the engine system, the adaptation value in question being updated with the value of the adaptation variable for the instantaneous operating range. | 1-9. (canceled) 10. A method for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device in an exhaust gas discharge system, the method comprising the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. 11. The method as recited in claim 10, wherein for operating the internal combustion engine, the filling control is adapted as a function of the stored adaptation value for the operating range of the internal combustion engine. 12. The method as recited in claim 10, wherein the adaptation of the filling control is carried out continuously. 13. The method as recited in claim 10, wherein the operating range is indicated as a function of at least one of the following variables: load, engine speed, engine temperature. 14. A method for diagnosing components of an exhaust gas discharge system, comprising the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range; and associating an error in the exhaust gas discharge system as a function of adaptation values that are stored for operating ranges of the internal combustion engine. 15. The method as recited in claim 14, wherein a self-adjustment is carried out for an exhaust gas sensor situated upstream from the exhaust aftertreatment device to obtain an exhaust gas sensor offset value, via which the lambda value provided to the lambda regulation is corrected, the adaptation values that are stored for the operating ranges being corrected as a function of the exhaust gas sensor offset value to obtain particular fuel trim values that are used as remaining adaptation values for the filling control, wherein (i) a systematic error in the exhaust gas discharge system being recognized when an average value of the fuel trim values is greater than a predefined threshold value, and/or (ii) a model inaccuracy of a filling model, based on the filling control, being recognized when a deviation of the adaptation values from an average value of the adaptation values exceeds a predefined threshold value. 16. A control unit configured to operate an engine system, the engine system including an internal combustion engine and an exhaust aftertreatment device, the control unit configured to:
carry out a filling control in order to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapt the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and store an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. 17. A non-transitory machine-readable memory medium on which is stored a computer program for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device in an exhaust gas discharge system, the computer program, when executed by a computer, causing the computer to perform the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. | A method for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device. The method includes: carrying out a filling control in order to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable, adapting the filling control with the aid of an adaptation variable that indicates a correction value for the lambda setpoint value, and storing an adaptation value as a function of an operating range of the engine system, the adaptation value in question being updated with the value of the adaptation variable for the instantaneous operating range.1-9. (canceled) 10. A method for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device in an exhaust gas discharge system, the method comprising the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. 11. The method as recited in claim 10, wherein for operating the internal combustion engine, the filling control is adapted as a function of the stored adaptation value for the operating range of the internal combustion engine. 12. The method as recited in claim 10, wherein the adaptation of the filling control is carried out continuously. 13. The method as recited in claim 10, wherein the operating range is indicated as a function of at least one of the following variables: load, engine speed, engine temperature. 14. A method for diagnosing components of an exhaust gas discharge system, comprising the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range; and associating an error in the exhaust gas discharge system as a function of adaptation values that are stored for operating ranges of the internal combustion engine. 15. The method as recited in claim 14, wherein a self-adjustment is carried out for an exhaust gas sensor situated upstream from the exhaust aftertreatment device to obtain an exhaust gas sensor offset value, via which the lambda value provided to the lambda regulation is corrected, the adaptation values that are stored for the operating ranges being corrected as a function of the exhaust gas sensor offset value to obtain particular fuel trim values that are used as remaining adaptation values for the filling control, wherein (i) a systematic error in the exhaust gas discharge system being recognized when an average value of the fuel trim values is greater than a predefined threshold value, and/or (ii) a model inaccuracy of a filling model, based on the filling control, being recognized when a deviation of the adaptation values from an average value of the adaptation values exceeds a predefined threshold value. 16. A control unit configured to operate an engine system, the engine system including an internal combustion engine and an exhaust aftertreatment device, the control unit configured to:
carry out a filling control in order to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapt the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and store an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. 17. A non-transitory machine-readable memory medium on which is stored a computer program for operating an engine system that includes an internal combustion engine and an exhaust aftertreatment device in an exhaust gas discharge system, the computer program, when executed by a computer, causing the computer to perform the following steps:
carrying out a filling control to regulate a filling level of the exhaust aftertreatment device as a function of a predefined filling level setpoint value, a lambda setpoint value for a lambda regulation being predefined as a manipulated variable; adapting the filling control using an adaptation variable that indicates a correction value for the lambda setpoint value; and storing an adaptation value as a function of an operating range of the engine system, the adaptation value being updated with a value of the adaptation variable for an instantaneous operating range. | 3,700 |
348,681 | 16,806,210 | 2,884 | The invention relates to an arrangement in connection with a mammography apparatus, in the invention, a screen or a user interface with a screen is attached to the mammography apparatus, which attachment is realized such that the screen or the user interface with a screen is aligned or can be aligned at least partly towards a lower tray structure of the mammography apparatus. Such screen or a user interface with a screen can be arranged in a functional connection with an information system and patient images recorded earlier in the information system can be displayed on the screen or the user interface with a screen. | 1. A mammography imaging arrangement, which includes a mammography apparatus, which includes
a substantially vertically standing frame or a frame part attachable to a wall or a ceiling, an arm structure connecting to said frame or frame part and pivotable in relation to a horizontal rotation axis, wherein at a substantially first end of the opposite ends of the arm structure is placed an X-ray source and substantially at a second end an image data receiving means and wherein in connection with said second end of the arm structure is additionally arranged a lower tray structure, positioned substantially on top of the image data receiving means and a control system and in connection with it a user interface arrangement, at least one user interface with a screen, wherein said at least one user interface with a screen is connected to structures of the mammography apparatus and located within an arm's length or closer of a patient positioned at the lower tray structure for imaging, the connection being realized such that said user interface with a screen is aligned or can be aligned at least partly at said lower tray structure, and in that a means is arranged to the mammography apparatus to bring said user interface with a screen into a functional connection with an external information system such that patient images recorded earlier in said information system can be displayed on said user interface with a screen connected to the structures of the mammography apparatus. 2. The arrangement according to claim 1, wherein the arrangement includes a means for showing images on said user interface with a screen in an orientation corresponding to an orientation in which a breast is positioned on top of said lower tray structure. 3. The arrangement according to claim 1, including at least two user interfaces with a screen, wherein said user interfaces with a screen are arranged to the mammography apparatus at least one on both of its sides, as viewed from said lower tray structure. 4. The arrangement according to claim 1, wherein said at least one user interface with a screen belongs to a user interface arrangement which is
attached as articulated to the frame part or implemented with a technology by which a direction in which information on the screen is visible is adjustable 5. The arrangement according to claim 4, wherein said at least one user interface with a screen is attached to the frame part as articulated, the articulation being realized as motorized, and said control system comprises at least one operation mode according to which a view generated by the screen of the user interface automatically turns into a position determined for it by said operation mode, as dependent on the operation to which the operation mode relates to or on what the control system shows on the screen. 6. The arrangement according to claim 4, wherein said at least one user interface with a screen is attached to the frame part as articulated. 7. The arrangement according to claim 4, wherein one or several views have been defined in the control system to be automatically presented on the user interface with a screen when it is turned into its said second position. 8. The arrangement according to claim 1, wherein said user interface with a screen is a touch screen. 9. The arrangement according to claim 1, wherein a camera or a video camera aligned at said lower tray structure is arranged in connection with the arm structure of the mammography apparatus. 10. The arrangement according to claim 1, wherein the arrangement includes a means to include identifiers in the images to be recoded and image retrieval means to automatically present on the screen an image with a particular identifier. 11. The arrangement according to claim 10, wherein the arrangement includes a means to be continuously aware of or to recognize on demand the acute orientation of the arm structure supporting the x-ray source and the detector housing and a means to correlate information of the acute orientation with a prior image with an orientation identifier corresponding to the acute orientation of the arm structure. 12. (canceled) 13. (canceled) 14. (canceled) 15. (canceled) 16. A mammography Imaging arrangement which includes a mammography apparatus and which comprises
a frame or a frame part attachable to a wall or a ceiling, an arm structure connected to said frame or frame part and pivotable in relation to a horizontal rotation axis, the arm structure including an X-ray source and an image data receiving means, and a control system including at least one user interface with a screen, wherein said control system is connected to an external information system remote from the mammography imaging arrangement such that a patient image recorded remote from the mammography imaging arrangement can be displayed on said screen of the user interface and/or used in positioning a breast and/or the arm structure during imaging and wherein said user interface with a screen is located within an arm's length or closer of a patient positioned at the image data receiving means for imaging. 17. The apparatus of claim 16, wherein said patient image includes a patient identifier is selected from patient identification, examination time, imaging modality and imaging procedure description. 18. The apparatus of claim 17, wherein said patient identifier functions as a positioning guide for the arm structure during imaging. 19. The apparatus of claim 16, wherein said patient image recorded remote from the mammography imaging arrangement is zoomed, cropped and/or rotated on said screen. 20. The apparatus of claim 1, wherein said screen of the user interface is configured to display said patient image recorded earlier and studied at a separate work station. 21. The apparatus of claim 20, wherein the image recorded earlier has been modified to include a measurement marking. 22. The apparatus of claim 16, wherein the patient image recorded remote from the mammography imaging arrangement is displayed on said screen of the user interface with a measurement marking inserted at a remote work station. | The invention relates to an arrangement in connection with a mammography apparatus, in the invention, a screen or a user interface with a screen is attached to the mammography apparatus, which attachment is realized such that the screen or the user interface with a screen is aligned or can be aligned at least partly towards a lower tray structure of the mammography apparatus. Such screen or a user interface with a screen can be arranged in a functional connection with an information system and patient images recorded earlier in the information system can be displayed on the screen or the user interface with a screen.1. A mammography imaging arrangement, which includes a mammography apparatus, which includes
a substantially vertically standing frame or a frame part attachable to a wall or a ceiling, an arm structure connecting to said frame or frame part and pivotable in relation to a horizontal rotation axis, wherein at a substantially first end of the opposite ends of the arm structure is placed an X-ray source and substantially at a second end an image data receiving means and wherein in connection with said second end of the arm structure is additionally arranged a lower tray structure, positioned substantially on top of the image data receiving means and a control system and in connection with it a user interface arrangement, at least one user interface with a screen, wherein said at least one user interface with a screen is connected to structures of the mammography apparatus and located within an arm's length or closer of a patient positioned at the lower tray structure for imaging, the connection being realized such that said user interface with a screen is aligned or can be aligned at least partly at said lower tray structure, and in that a means is arranged to the mammography apparatus to bring said user interface with a screen into a functional connection with an external information system such that patient images recorded earlier in said information system can be displayed on said user interface with a screen connected to the structures of the mammography apparatus. 2. The arrangement according to claim 1, wherein the arrangement includes a means for showing images on said user interface with a screen in an orientation corresponding to an orientation in which a breast is positioned on top of said lower tray structure. 3. The arrangement according to claim 1, including at least two user interfaces with a screen, wherein said user interfaces with a screen are arranged to the mammography apparatus at least one on both of its sides, as viewed from said lower tray structure. 4. The arrangement according to claim 1, wherein said at least one user interface with a screen belongs to a user interface arrangement which is
attached as articulated to the frame part or implemented with a technology by which a direction in which information on the screen is visible is adjustable 5. The arrangement according to claim 4, wherein said at least one user interface with a screen is attached to the frame part as articulated, the articulation being realized as motorized, and said control system comprises at least one operation mode according to which a view generated by the screen of the user interface automatically turns into a position determined for it by said operation mode, as dependent on the operation to which the operation mode relates to or on what the control system shows on the screen. 6. The arrangement according to claim 4, wherein said at least one user interface with a screen is attached to the frame part as articulated. 7. The arrangement according to claim 4, wherein one or several views have been defined in the control system to be automatically presented on the user interface with a screen when it is turned into its said second position. 8. The arrangement according to claim 1, wherein said user interface with a screen is a touch screen. 9. The arrangement according to claim 1, wherein a camera or a video camera aligned at said lower tray structure is arranged in connection with the arm structure of the mammography apparatus. 10. The arrangement according to claim 1, wherein the arrangement includes a means to include identifiers in the images to be recoded and image retrieval means to automatically present on the screen an image with a particular identifier. 11. The arrangement according to claim 10, wherein the arrangement includes a means to be continuously aware of or to recognize on demand the acute orientation of the arm structure supporting the x-ray source and the detector housing and a means to correlate information of the acute orientation with a prior image with an orientation identifier corresponding to the acute orientation of the arm structure. 12. (canceled) 13. (canceled) 14. (canceled) 15. (canceled) 16. A mammography Imaging arrangement which includes a mammography apparatus and which comprises
a frame or a frame part attachable to a wall or a ceiling, an arm structure connected to said frame or frame part and pivotable in relation to a horizontal rotation axis, the arm structure including an X-ray source and an image data receiving means, and a control system including at least one user interface with a screen, wherein said control system is connected to an external information system remote from the mammography imaging arrangement such that a patient image recorded remote from the mammography imaging arrangement can be displayed on said screen of the user interface and/or used in positioning a breast and/or the arm structure during imaging and wherein said user interface with a screen is located within an arm's length or closer of a patient positioned at the image data receiving means for imaging. 17. The apparatus of claim 16, wherein said patient image includes a patient identifier is selected from patient identification, examination time, imaging modality and imaging procedure description. 18. The apparatus of claim 17, wherein said patient identifier functions as a positioning guide for the arm structure during imaging. 19. The apparatus of claim 16, wherein said patient image recorded remote from the mammography imaging arrangement is zoomed, cropped and/or rotated on said screen. 20. The apparatus of claim 1, wherein said screen of the user interface is configured to display said patient image recorded earlier and studied at a separate work station. 21. The apparatus of claim 20, wherein the image recorded earlier has been modified to include a measurement marking. 22. The apparatus of claim 16, wherein the patient image recorded remote from the mammography imaging arrangement is displayed on said screen of the user interface with a measurement marking inserted at a remote work station. | 2,800 |
348,682 | 16,806,157 | 2,884 | According to an embodiment, there is provided an electrode including an active material-containing layer. A logarithmic differential pore volume distribution curve of the active material-containing layer by a mercury intrusion method includes first and second peaks. The first peak is a local maximum value in a range where a pore size is from 0.1 μm or more to 0.5 μm or less. The second peak is a local maximum value in a range where the pore size is from 0.5 μm or more to 1.0 μm or less. An intensity A1 of the first peak and an intensity A2 of the second peak satisfy 0.1≤A2/A1≤0.3. A density of the active material-containing layer is from 2.9 g/cm3 or more to 3.3 g/cm3 or less. | 1. An electrode comprising:
an active material-containing layer containing active material particles, and the active material particles containing particles of a lithium-containing nickel-cobalt-manganese composite oxide represented by the following Formula (1):
Li1-xNi1-a-bCOaMnbO2 (1),
in the Formula (1), x is in a range of −0.2≤x≤0.5, a is in a range of 0<a≤0.4, and b is in a range of 0<b≤0.4, a logarithmic differential pore volume distribution curve of the active material-containing layer by a mercury intrusion method includes a first peak and a second peak, the first peak is a local maximum value in a range where a pore size is from 0.1 μm or more to 0.5 μm or less, the second peak is a local maximum value in a range where the pore size is from 0.5 μm or more to 1.0 μm or less and in a range where the pore size is larger than the pore size of the first peak, an intensity A1 of the first peak and an intensity A2 of the second peak satisfy a relational expression of 0.1≤A2/A1≤0.3, and a density of the active material-containing layer is from 2.9 g/cm3 or more to 3.3 g/cm3 or less. 2. The electrode according to claim 1, wherein,
in a cumulative pore volume distribution curve of the active material-containing layer by a mercury intrusion method, a cumulative pore volume V1 in a range where the pore size is from 0.1 μm or more to 0.5 μm or less, and a total pore volume V having an upper limit of 0.2 mL/g satisfy a relational expression of 0.2≤V1/V≤0.8. 3. The electrode according to claim 2, wherein
a pore specific surface area obtained from the cumulative pore volume distribution curve of the active material-containing layer by the mercury intrusion method is from 2.7 cm2/g or more to 3.5 cm2/g or less. 4. A nonaqueous electrolyte battery comprising:
the electrode according to claim 1 as a positive electrode; a negative electrode including a negative electrode active material; a separator interposed therebetween; and a nonaqueous electrolyte. 5. A battery pack comprising the nonaqueous electrolyte battery according to claim 4. | According to an embodiment, there is provided an electrode including an active material-containing layer. A logarithmic differential pore volume distribution curve of the active material-containing layer by a mercury intrusion method includes first and second peaks. The first peak is a local maximum value in a range where a pore size is from 0.1 μm or more to 0.5 μm or less. The second peak is a local maximum value in a range where the pore size is from 0.5 μm or more to 1.0 μm or less. An intensity A1 of the first peak and an intensity A2 of the second peak satisfy 0.1≤A2/A1≤0.3. A density of the active material-containing layer is from 2.9 g/cm3 or more to 3.3 g/cm3 or less.1. An electrode comprising:
an active material-containing layer containing active material particles, and the active material particles containing particles of a lithium-containing nickel-cobalt-manganese composite oxide represented by the following Formula (1):
Li1-xNi1-a-bCOaMnbO2 (1),
in the Formula (1), x is in a range of −0.2≤x≤0.5, a is in a range of 0<a≤0.4, and b is in a range of 0<b≤0.4, a logarithmic differential pore volume distribution curve of the active material-containing layer by a mercury intrusion method includes a first peak and a second peak, the first peak is a local maximum value in a range where a pore size is from 0.1 μm or more to 0.5 μm or less, the second peak is a local maximum value in a range where the pore size is from 0.5 μm or more to 1.0 μm or less and in a range where the pore size is larger than the pore size of the first peak, an intensity A1 of the first peak and an intensity A2 of the second peak satisfy a relational expression of 0.1≤A2/A1≤0.3, and a density of the active material-containing layer is from 2.9 g/cm3 or more to 3.3 g/cm3 or less. 2. The electrode according to claim 1, wherein,
in a cumulative pore volume distribution curve of the active material-containing layer by a mercury intrusion method, a cumulative pore volume V1 in a range where the pore size is from 0.1 μm or more to 0.5 μm or less, and a total pore volume V having an upper limit of 0.2 mL/g satisfy a relational expression of 0.2≤V1/V≤0.8. 3. The electrode according to claim 2, wherein
a pore specific surface area obtained from the cumulative pore volume distribution curve of the active material-containing layer by the mercury intrusion method is from 2.7 cm2/g or more to 3.5 cm2/g or less. 4. A nonaqueous electrolyte battery comprising:
the electrode according to claim 1 as a positive electrode; a negative electrode including a negative electrode active material; a separator interposed therebetween; and a nonaqueous electrolyte. 5. A battery pack comprising the nonaqueous electrolyte battery according to claim 4. | 2,800 |
348,683 | 16,806,167 | 2,884 | An information processing system includes a client apparatus and a service providing system. The client apparatus includes first circuitry to transmit, to the service providing system, a package acquisition request for obtaining a package including at least one application program. The service providing system includes second circuitry. The second circuitry receives the package acquisition request, and obtains the package. The second circuitry receives, from the client apparatus, an email address and a tenant setup request, and generates a usage registration screen. The second circuitry transmits an email addressed to the email address, the email including a network, and receives an access to the usage registration screen from an information processing apparatus. The second circuitry sets up a tenant in response to acquisition of package identification information, and registers the at least one application program included in the package identified by the package identification information with the tenant. | 1. An information processing system comprising:
a client apparatus; and a service providing system communicable with the client apparatus via a network, wherein the client apparatus includes first circuitry to transmit, to the service providing system, a package acquisition request for obtaining package including at least one application program; and the service providing system includes second circuitry to:
receive, from the client apparatus, the package acquisition request;
obtain the package including the at least one application program;
receive, from the client apparatus, an email address and a tenant setup request;
generate a usage registration screen in accordance with the tenant setup request;
transmit an email addressed to the received email address, the email including a network address for accessing the usage registration screen;
receive an access to the usage registration screen from an information processing apparatus;
set up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and
register the at least one application program included in the package identified by the package identification information with the tenant. 2. The information processing system of claim 1, wherein
the second circuitry further determines whether the received email address is registered, based on a determination that the received email address is not registered, the second circuitry transmits the email addressed to the received email address, the email including the network address, and based on a determination that the received email address is registered, the second circuitry transmits a denial-of-registration email indicating that registration is denied to the received email address. 3. The information processing system of claim 1, wherein
the second circuitry further: sets an expiration date to the usage registration screen; checks the expiration date in response to the access to the usage registration screen by the information processing apparatus; transmits the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmits an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 4. The information processing system of claim 1, wherein
the second circuitry further: checks whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; sets up the tenant based on a check result indicating that the at least one application program is available; and transmits a package unavailability notification screen indicating that the package is not available, based on a check result indicating that the at least one application program is unavailable. 5. The information processing system of claim 1, wherein
the second circuitry: registers a user based on information obtained from the information processing apparatus via the usage registration screen; transmits, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registers the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 6. The information processing system of claim 1, wherein
the first circuitry transmits a package registration request including the package identification information after the tenant is set up, and the second circuitry performs the registering the at least one application program included in the package identified by the package identification information with the tenant. 7. The information processing system of claim 1, wherein
the first circuitry transmits the email address and a package usage request to the service providing system, in response to accepting a request made by a user for using the package after the tenant is set up, and the second circuitry: generates a package registration screen in response to the package usage request; transmits a package registration email including a network address for accessing the package registration screen to the email address; receives an access to the package registration screen from the information processing apparatus through the network; and performs the registering at least one application program included in the package identified by the package identification information with the tenant, in response to acquisition of the package identification information from the information processing apparatus via the package registration screen. 8. A service providing system comprising circuitry to:
receive, from a client apparatus, a package acquisition request for obtaining a package including at least one application program; obtain the package including the at least one application program; receive, from the client apparatus, an email address and a tenant setup request; generate a usage registration screen in accordance with the tenant setup request; transmit a usage registration email addressed to the received email address, the email including a network address for accessing the usage registration screen to the email address; receive an access to the usage registration screen from an information processing apparatus; set up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and register the at least one application program included in the package identified by the package identification information with the tenant. 9. The service providing system of claim 8, wherein
the circuitry further determines whether the received email address is registered, based on a determination that the received email address is not registered, the circuitry transmits the email addressed to the received email address, the email including the network address, and based on a determination that the received email address is registered, the circuitry transmits a denial-of-registration email indicating that registration is denied to the received email address. 10. The service providing system of claim 8, wherein
the circuitry further: sets an expiration date to the usage registration screen; checks the expiration date in response to the access to the usage registration screen by the information processing apparatus; and transmits the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmits an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 11. The service providing system of claim 8, wherein
the circuitry further: checks whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; sets up the tenant based on the check result indicating that the at least one application program is available; and transmits a package unavailability notification screen indicating that the package is not available, based on the check result indicating that the at least one application program is unavailable. 12. The service providing system of claim 8, wherein
the circuitry: registers a user based on information obtained from the information processing apparatus via the usage registration screen; transmits, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registers the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 13. The service providing system of claim 8, wherein
the circuitry further: receives, from the client apparatus, a package registration request including the package identification information after the tenant is set up; and performs the registering the at least one application program included with the package identified by the package identification information into the tenant. 14. The service providing system of claim 8, wherein
the circuitry further: receives the email address and a package usage request from the client apparatus, in response to accepting a package usage request made by a user after the tenant has been set up; generates a package registration screen in response to the package usage request; transmits a package registration email including a network address for accessing the package registration screen to the email address; receives an access to the package registration screen from the information processing apparatus through the network; and performs the registering at least one application program included in the package identified by the package identification information with the tenant, in response to acquisition of the package identification information from the information processing apparatus via the package registration screen. 15. An information processing method performed by a service providing system that is communicable with a client apparatus via a network, the method comprising:
receiving, from a client apparatus, a package acquisition request for obtaining a package including at least one application program; obtaining the package including the at least one application program; receiving, from the client apparatus, an email address and a tenant setup request; generating a usage registration screen in accordance with the tenant setup request; transmitting a usage registration email addressed to the received email address, the email including a network address for accessing the usage registration screen to the email address; receiving an access to the usage registration screen from an information processing apparatus; setting up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and register the at least one application program included in the package identified by the package identification information with the tenant. 16. The information processing method of claim 15, further comprising:
determining whether the received email address is registered; transmitting the email addressed to the received email address, the email including the network address, based on a determination that the received email address is not registered; and transmitting a denial-of-registration email indicating that registration is denied to the received email address, based on a determination that the received email address is registered. 17. The information processing method of claim 15, further comprising:
setting an expiration date to the usage registration screen; checking the expiration date in response to the access to the usage registration screen by the information processing apparatus; and transmitting the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmitting an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 18. The information processing method of claim 15, further comprising:
checking whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; setting up the tenant based on the check result indicating that the at least one application program is available; and transmitting a package unavailability notification screen indicating that the package is not available, based on the check result indicating that the at least one application program is unavailable. 19. The information processing method of claim 15, further comprising:
registering a user based on information obtained from the information processing apparatus via the usage registration screen; transmitting, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registering the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 20. The information processing method of claim 15, further comprising:
receiving, from the client apparatus, a package registration request including the package identification information after the tenant is set up; and performing registering the at least one application program included in the package identified by the package identification information with the tenant. | An information processing system includes a client apparatus and a service providing system. The client apparatus includes first circuitry to transmit, to the service providing system, a package acquisition request for obtaining a package including at least one application program. The service providing system includes second circuitry. The second circuitry receives the package acquisition request, and obtains the package. The second circuitry receives, from the client apparatus, an email address and a tenant setup request, and generates a usage registration screen. The second circuitry transmits an email addressed to the email address, the email including a network, and receives an access to the usage registration screen from an information processing apparatus. The second circuitry sets up a tenant in response to acquisition of package identification information, and registers the at least one application program included in the package identified by the package identification information with the tenant.1. An information processing system comprising:
a client apparatus; and a service providing system communicable with the client apparatus via a network, wherein the client apparatus includes first circuitry to transmit, to the service providing system, a package acquisition request for obtaining package including at least one application program; and the service providing system includes second circuitry to:
receive, from the client apparatus, the package acquisition request;
obtain the package including the at least one application program;
receive, from the client apparatus, an email address and a tenant setup request;
generate a usage registration screen in accordance with the tenant setup request;
transmit an email addressed to the received email address, the email including a network address for accessing the usage registration screen;
receive an access to the usage registration screen from an information processing apparatus;
set up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and
register the at least one application program included in the package identified by the package identification information with the tenant. 2. The information processing system of claim 1, wherein
the second circuitry further determines whether the received email address is registered, based on a determination that the received email address is not registered, the second circuitry transmits the email addressed to the received email address, the email including the network address, and based on a determination that the received email address is registered, the second circuitry transmits a denial-of-registration email indicating that registration is denied to the received email address. 3. The information processing system of claim 1, wherein
the second circuitry further: sets an expiration date to the usage registration screen; checks the expiration date in response to the access to the usage registration screen by the information processing apparatus; transmits the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmits an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 4. The information processing system of claim 1, wherein
the second circuitry further: checks whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; sets up the tenant based on a check result indicating that the at least one application program is available; and transmits a package unavailability notification screen indicating that the package is not available, based on a check result indicating that the at least one application program is unavailable. 5. The information processing system of claim 1, wherein
the second circuitry: registers a user based on information obtained from the information processing apparatus via the usage registration screen; transmits, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registers the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 6. The information processing system of claim 1, wherein
the first circuitry transmits a package registration request including the package identification information after the tenant is set up, and the second circuitry performs the registering the at least one application program included in the package identified by the package identification information with the tenant. 7. The information processing system of claim 1, wherein
the first circuitry transmits the email address and a package usage request to the service providing system, in response to accepting a request made by a user for using the package after the tenant is set up, and the second circuitry: generates a package registration screen in response to the package usage request; transmits a package registration email including a network address for accessing the package registration screen to the email address; receives an access to the package registration screen from the information processing apparatus through the network; and performs the registering at least one application program included in the package identified by the package identification information with the tenant, in response to acquisition of the package identification information from the information processing apparatus via the package registration screen. 8. A service providing system comprising circuitry to:
receive, from a client apparatus, a package acquisition request for obtaining a package including at least one application program; obtain the package including the at least one application program; receive, from the client apparatus, an email address and a tenant setup request; generate a usage registration screen in accordance with the tenant setup request; transmit a usage registration email addressed to the received email address, the email including a network address for accessing the usage registration screen to the email address; receive an access to the usage registration screen from an information processing apparatus; set up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and register the at least one application program included in the package identified by the package identification information with the tenant. 9. The service providing system of claim 8, wherein
the circuitry further determines whether the received email address is registered, based on a determination that the received email address is not registered, the circuitry transmits the email addressed to the received email address, the email including the network address, and based on a determination that the received email address is registered, the circuitry transmits a denial-of-registration email indicating that registration is denied to the received email address. 10. The service providing system of claim 8, wherein
the circuitry further: sets an expiration date to the usage registration screen; checks the expiration date in response to the access to the usage registration screen by the information processing apparatus; and transmits the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmits an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 11. The service providing system of claim 8, wherein
the circuitry further: checks whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; sets up the tenant based on the check result indicating that the at least one application program is available; and transmits a package unavailability notification screen indicating that the package is not available, based on the check result indicating that the at least one application program is unavailable. 12. The service providing system of claim 8, wherein
the circuitry: registers a user based on information obtained from the information processing apparatus via the usage registration screen; transmits, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registers the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 13. The service providing system of claim 8, wherein
the circuitry further: receives, from the client apparatus, a package registration request including the package identification information after the tenant is set up; and performs the registering the at least one application program included with the package identified by the package identification information into the tenant. 14. The service providing system of claim 8, wherein
the circuitry further: receives the email address and a package usage request from the client apparatus, in response to accepting a package usage request made by a user after the tenant has been set up; generates a package registration screen in response to the package usage request; transmits a package registration email including a network address for accessing the package registration screen to the email address; receives an access to the package registration screen from the information processing apparatus through the network; and performs the registering at least one application program included in the package identified by the package identification information with the tenant, in response to acquisition of the package identification information from the information processing apparatus via the package registration screen. 15. An information processing method performed by a service providing system that is communicable with a client apparatus via a network, the method comprising:
receiving, from a client apparatus, a package acquisition request for obtaining a package including at least one application program; obtaining the package including the at least one application program; receiving, from the client apparatus, an email address and a tenant setup request; generating a usage registration screen in accordance with the tenant setup request; transmitting a usage registration email addressed to the received email address, the email including a network address for accessing the usage registration screen to the email address; receiving an access to the usage registration screen from an information processing apparatus; setting up a tenant in response to acquisition of package identification information for identifying the package from the information processing apparatus via the usage registration screen; and register the at least one application program included in the package identified by the package identification information with the tenant. 16. The information processing method of claim 15, further comprising:
determining whether the received email address is registered; transmitting the email addressed to the received email address, the email including the network address, based on a determination that the received email address is not registered; and transmitting a denial-of-registration email indicating that registration is denied to the received email address, based on a determination that the received email address is registered. 17. The information processing method of claim 15, further comprising:
setting an expiration date to the usage registration screen; checking the expiration date in response to the access to the usage registration screen by the information processing apparatus; and transmitting the usage registration screen to the information processing apparatus based on a check result indicating that the expiration date is not expired; and transmitting an expiration notification screen indicating that the expiration date is expired to the information processing apparatus based on a check result indicating that the expiration date is expired. 18. The information processing method of claim 15, further comprising:
checking whether the at least one application program included in the package identified by the package identification information is available, in response to acquisition of the package identification information from the information processing apparatus; setting up the tenant based on the check result indicating that the at least one application program is available; and transmitting a package unavailability notification screen indicating that the package is not available, based on the check result indicating that the at least one application program is unavailable. 19. The information processing method of claim 15, further comprising:
registering a user based on information obtained from the information processing apparatus via the usage registration screen; transmitting, to the information processing apparatus, an additional user registration screen for registering an additional user after the at least one application program is registered with the tenant; and registering the additional user based on information obtained from the information processing apparatus via the additional user registration screen. 20. The information processing method of claim 15, further comprising:
receiving, from the client apparatus, a package registration request including the package identification information after the tenant is set up; and performing registering the at least one application program included in the package identified by the package identification information with the tenant. | 2,800 |
348,684 | 16,806,191 | 2,884 | The present invention provides methods, reactor systems and catalysts for converting biomass and biomass-derived feedstocks to C8+ hydrocarbons using heterogenous catalysts. The product stream may be separated and further processed for use in chemical applications, or as a neat fuel or a blending component in jet fuel and diesel fuel, or as heavy oils for lubricant and/or fuel oil applications. | 1. A method of making C8+ compounds comprising:
catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant average oxygen to carbon ratio of 0.2 or less, and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls,
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream,
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water and a plurality of C8+ compounds selected from the group consisting of C8+ alkanes, C8+ alkenes, C8+ cycloalkanes, C8+ cycloalkenes, C8+ alcohols, C8+ ketones, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 2. The method of claim 1, wherein the acidic support is selected from the group consisting of an aluminosilicate, a tungstated aluminosilicate, a silica-alumina phosphate, an aluminum phosphate, an amorphous silica alumina, an acidic alumina, a phosphate alumina, a tungstated alumina, a zirconia, a tungstated zirconia, a tungstated silica, a tungstated titania, a tungstated phosphate, niobia, an acid modified resin, a zeolite, a heteropolyacid, a tungstated heteropolyacid, and combinations thereof. 3. The method of claim 1, wherein the acid condensation catalyst comprises the heterogeneous acid catalyst that further comprises a support selected from the group consisting of carbon, silica, alumina, zirconia, titania, vanadia, kieselguhr, hydroxyapatite, chromia, niobia, mixtures thereof, and combinations thereof. 4. The method of claim 1, wherein the acid condensation catalyst further comprises a modifier selected from the group consisting of Cu, Ag, Au, Ru, Pd, Ni, Co, Ga, In, Cr, Mo, W, Sn, Nb, Ti, Zr, Ge, P, Al, alloys thereof, and combinations thereof. 5. The method of claim 1, wherein the acid condensation catalyst comprises ZSM-5 or tungstated zirconia. 6. The method of claim 5, wherein the acid condensation catalyst further comprises Pd or Cu. 7. The method of claim 1, wherein the second reactant stream has an average oxygen to molecule ratio of 1 to 4, and the first reactant stream has an average oxygen to molecule ratio of 1.5 or less. 8. The method of claim 1, wherein the second reactant stream has a boiling point of less than 210° C. 9. The method of claim 1, wherein the product stream further comprises one or more C7− compounds having 2 to 7 carbon atoms and 0 to 1 oxygen atoms, and wherein a portion of the product stream is recycled to form at least in part the second reactant. 10. The method of claim 9, further comprising the step of removing water from the product stream prior to recycling the portion of the product stream to form in part the second reactant. 11. The method of claim 1 further comprising the step of catalytically reacting at least a portion of the product stream in the presence of a finishing catalyst. 12. (canceled) 13. The method of claim 1, wherein the deoxygenation catalyst further comprises a support. 14. The method of claim 13, wherein the support comprises a member selected from group consisting of a carbon, silica, alumina, zirconia, titania, vanadia, heteropolyacid, kieselguhr, hydroxyapatite, chromia, zeolite, and mixtures thereof. 15. The method of claim 14, wherein the support is selected from the group consisting of tungstated zirconia, tungsten modified zirconia, tungsten modified alpha-alumina, or tungsten modified theta alumina. 16. The method of claim 1, wherein the water soluble oxygenated hydrocarbon is selected from the group consisting of a starch, a carbohydrate, a polysaccharide, a disaccharide, a monosaccharide, a sugar, a sugar alcohol, an aldopentose, an aldohexose, a ketotetrose, a ketopentose, a ketohexose, a hemicellulose, a cellulosic derivative, a lignocellulosic derivative, and a polyol. 17. (canceled) 18. (canceled) 19. (canceled) 20. A method of making C8+ compounds comprising:
(i) catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising water and molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant stream average oxygen to carbon ratio of 0.2 or less, and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls; and
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream; and
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
wherein the water concentration of the combined reactant stream is less than the water concentration of the first reactant stream; and,
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water and a plurality of C8+ compounds selected from the group consisting of a C8+ alkane, a C8+ alkene, a C8+ cycloalkane, a C8+ cycloalkene, a C8+ alcohol, a C8+ ketone, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 21. (canceled) 22. The method of claim 20, wherein the deoxygenation catalyst additionally comprises a support. 23. The method of claim 22, wherein the support comprises a member selected from group consisting of a carbon, silica, alumina, zirconia, titania, vanadia, heteropolyacid, kieselguhr, hydroxyapatite, chromia, zeolite, and mixtures thereof. 24. The method of claim 23, wherein the support is selected from the group consisting of tungstated zirconia, tungsten modified zirconia, tungsten modified alpha-alumina, or tungsten modified theta alumina. 25. The method of claim 20, wherein the water soluble oxygenated hydrocarbon is selected from the group consisting of a starch, a carbohydrate, a polysaccharide, a disaccharide, a monosaccharide, a sugar, a sugar alcohol, an aldopentose, an aldohexose, a ketotetrose, a ketopentose, a ketohexose, a hemicellulose, a cellulosic derivative, a lignocellulosic derivative, and a polyol. 26. A method of making C8+ compounds comprising:
(i) catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant stream average oxygen to carbon ratio of 0.2 or less and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls,
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream; and
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water, a plurality of C7− compounds selected from the group consisting of a C7− alkane, a C7− alkene, a C7− cycloalkane, a C7− cycloalkene, a C7− alcohol, a C7− ketone, a C7− aryl, and mixtures thereof, and a plurality of C8+ compounds selected from the group consisting of a C8+ alkane, a C8+ alkene, a C8+ cycloalkane, a C8+ cycloalkene, a C8+ alcohol, a C8+ ketone, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
(iv) separating a portion of the C7− compounds from the product stream to provide a recycle stream, and
(v) recycling the recycle stream to form at least in part the second reactant stream
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 27. The method of claim 26, wherein the acidic support is selected from the group consisting of an aluminosilicate, a tungstated aluminosilicate, a silica-alumina phosphate, an aluminum phosphate, an amorphous silica alumina, an acidic alumina, a phosphate alumina, a tungstated alumina, a zirconia, a tungstated zirconia, a tungstated silica, a tungstated titania, a tungstated phosphate, niobia, an acid modified resin, a zeolite, a heteropolyacid, a tungstated heteropolyacid, and combinations thereof. 28. The method of claim 26, wherein the acid condensation catalyst comprises the heterogeneous acid catalyst that further comprises a support selected from the group consisting of carbon, silica, alumina, zirconia, titania, vanadia, kieselguhr, hydroxyapatite, chromia, niobia, mixtures thereof, and combinations thereof. 29. The method of claim 26, wherein the acid condensation catalyst further comprises a modifier selected from the group consisting of Cu, Ag, Au, Ru, Pd, Ni, Co, Ga, In, Cr, Mo, W, Sn, Nb, Ti, Zr, Ge, P, Al, alloys thereof, and combinations thereof. 30. The method of claim 26, wherein the acid condensation catalyst comprises ZSM-5 or tungstated zirconia. 31. The method of claim 30, wherein the acid condensation catalyst further comprises Pd or Cu. 32. The method of claim 26, wherein the second reactant stream has an average oxygen to molecule ratio of 1 to 4, and the first reactant stream has an average oxygen to molecule ratio of 1.5 or less. 33. The method of claim 26, wherein the recycle stream has a boiling point of less than 210° C. 34. The method of claim 1, wherein the resulting C8+ compounds are further processed by:
(iv) separating at least a portion of the C8+ compounds from the product stream, and
(v) catalytically reacting the separated C8+ compounds in the presence of a finishing catalyst to produce a fuel product. 35. The method of claim 34, further comprising a step of separating the fuel product to provide a C8-14 fraction comprising a plurality of hydrocarbons having 8 to 14 carbon atoms, a C12-24 fraction comprising a plurality of hydrocarbons having 12 to 24 carbon atoms, and a C25+ fraction comprising a plurality of hydrocarbons having 25 or more carbon atoms. 36. The method of claim 35, wherein the C8-14 fraction is blended to provide a jet fuel, or the C12-24 fraction is blended to provide a diesel fuel, or the C25+ fraction is blended to provide a heavy oil. 37.-39. (canceled) 40. The method of claim 1, wherein the aqueous feedstock solution comprises a sugar alcohol. 41. The method of claim 40, wherein the sugar alcohol is sorbitol. 42. The method of claim 20, wherein the aqueous feedstock solution comprises a sugar alcohol. 43. The method of claim 42, wherein the sugar alcohol is sorbitol. 44. The method of claim 26, wherein the aqueous feedstock solution comprises a sugar alcohol. 45. The method of claim 44, wherein the sugar alcohol is sorbitol. | The present invention provides methods, reactor systems and catalysts for converting biomass and biomass-derived feedstocks to C8+ hydrocarbons using heterogenous catalysts. The product stream may be separated and further processed for use in chemical applications, or as a neat fuel or a blending component in jet fuel and diesel fuel, or as heavy oils for lubricant and/or fuel oil applications.1. A method of making C8+ compounds comprising:
catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant average oxygen to carbon ratio of 0.2 or less, and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls,
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream,
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water and a plurality of C8+ compounds selected from the group consisting of C8+ alkanes, C8+ alkenes, C8+ cycloalkanes, C8+ cycloalkenes, C8+ alcohols, C8+ ketones, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 2. The method of claim 1, wherein the acidic support is selected from the group consisting of an aluminosilicate, a tungstated aluminosilicate, a silica-alumina phosphate, an aluminum phosphate, an amorphous silica alumina, an acidic alumina, a phosphate alumina, a tungstated alumina, a zirconia, a tungstated zirconia, a tungstated silica, a tungstated titania, a tungstated phosphate, niobia, an acid modified resin, a zeolite, a heteropolyacid, a tungstated heteropolyacid, and combinations thereof. 3. The method of claim 1, wherein the acid condensation catalyst comprises the heterogeneous acid catalyst that further comprises a support selected from the group consisting of carbon, silica, alumina, zirconia, titania, vanadia, kieselguhr, hydroxyapatite, chromia, niobia, mixtures thereof, and combinations thereof. 4. The method of claim 1, wherein the acid condensation catalyst further comprises a modifier selected from the group consisting of Cu, Ag, Au, Ru, Pd, Ni, Co, Ga, In, Cr, Mo, W, Sn, Nb, Ti, Zr, Ge, P, Al, alloys thereof, and combinations thereof. 5. The method of claim 1, wherein the acid condensation catalyst comprises ZSM-5 or tungstated zirconia. 6. The method of claim 5, wherein the acid condensation catalyst further comprises Pd or Cu. 7. The method of claim 1, wherein the second reactant stream has an average oxygen to molecule ratio of 1 to 4, and the first reactant stream has an average oxygen to molecule ratio of 1.5 or less. 8. The method of claim 1, wherein the second reactant stream has a boiling point of less than 210° C. 9. The method of claim 1, wherein the product stream further comprises one or more C7− compounds having 2 to 7 carbon atoms and 0 to 1 oxygen atoms, and wherein a portion of the product stream is recycled to form at least in part the second reactant. 10. The method of claim 9, further comprising the step of removing water from the product stream prior to recycling the portion of the product stream to form in part the second reactant. 11. The method of claim 1 further comprising the step of catalytically reacting at least a portion of the product stream in the presence of a finishing catalyst. 12. (canceled) 13. The method of claim 1, wherein the deoxygenation catalyst further comprises a support. 14. The method of claim 13, wherein the support comprises a member selected from group consisting of a carbon, silica, alumina, zirconia, titania, vanadia, heteropolyacid, kieselguhr, hydroxyapatite, chromia, zeolite, and mixtures thereof. 15. The method of claim 14, wherein the support is selected from the group consisting of tungstated zirconia, tungsten modified zirconia, tungsten modified alpha-alumina, or tungsten modified theta alumina. 16. The method of claim 1, wherein the water soluble oxygenated hydrocarbon is selected from the group consisting of a starch, a carbohydrate, a polysaccharide, a disaccharide, a monosaccharide, a sugar, a sugar alcohol, an aldopentose, an aldohexose, a ketotetrose, a ketopentose, a ketohexose, a hemicellulose, a cellulosic derivative, a lignocellulosic derivative, and a polyol. 17. (canceled) 18. (canceled) 19. (canceled) 20. A method of making C8+ compounds comprising:
(i) catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising water and molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant stream average oxygen to carbon ratio of 0.2 or less, and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls; and
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream; and
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
wherein the water concentration of the combined reactant stream is less than the water concentration of the first reactant stream; and,
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water and a plurality of C8+ compounds selected from the group consisting of a C8+ alkane, a C8+ alkene, a C8+ cycloalkane, a C8+ cycloalkene, a C8+ alcohol, a C8+ ketone, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 21. (canceled) 22. The method of claim 20, wherein the deoxygenation catalyst additionally comprises a support. 23. The method of claim 22, wherein the support comprises a member selected from group consisting of a carbon, silica, alumina, zirconia, titania, vanadia, heteropolyacid, kieselguhr, hydroxyapatite, chromia, zeolite, and mixtures thereof. 24. The method of claim 23, wherein the support is selected from the group consisting of tungstated zirconia, tungsten modified zirconia, tungsten modified alpha-alumina, or tungsten modified theta alumina. 25. The method of claim 20, wherein the water soluble oxygenated hydrocarbon is selected from the group consisting of a starch, a carbohydrate, a polysaccharide, a disaccharide, a monosaccharide, a sugar, a sugar alcohol, an aldopentose, an aldohexose, a ketotetrose, a ketopentose, a ketohexose, a hemicellulose, a cellulosic derivative, a lignocellulosic derivative, and a polyol. 26. A method of making C8+ compounds comprising:
(i) catalytically reacting an aqueous feedstock solution that comprises a water soluble oxygenated hydrocarbon comprising a C2+O1+ hydrocarbon with hydrogen in the presence of a deoxygenation catalyst comprising Pd, Mo, and Sn to produce a first reactant stream comprising molecules having a general formula CxHyOz and a first reactant stream average oxygen to carbon ratio of between 0.2 and 1.0 and wherein x=2-12 carbon atoms and z=1-12 oxygen atoms;
(ii) adding to the first reactant stream a distinct second reactant stream to create a combined reactant stream that comprises carbon atoms from the first and second reactant streams, the second reactant stream comprising molecules having a general formula CpHrOs and a second reactant stream average oxygen to carbon ratio of 0.2 or less and wherein p=2-7 carbon atoms and s=0-1 oxygen atoms and the second reactant stream comprises a plurality of C7− compounds selected from the group consisting of alkanes, alkenes, cycloalkanes, cycloalkenes, and aryls,
wherein, of the total number of carbon atoms in the combined reactant stream, greater than 10% are from the first reactant stream, and greater than 10% are from the second reactant stream; and
wherein the average oxygen to carbon ratio of the first reactant stream is higher than the average oxygen to carbon ratio of the second reactant stream; and
(iii) catalytically reacting the combined reactant stream with hydrogen in the presence of an acid condensation catalyst to produce a product stream comprising water, a plurality of C7− compounds selected from the group consisting of a C7− alkane, a C7− alkene, a C7− cycloalkane, a C7− cycloalkene, a C7− alcohol, a C7− ketone, a C7− aryl, and mixtures thereof, and a plurality of C8+ compounds selected from the group consisting of a C8+ alkane, a C8+ alkene, a C8+ cycloalkane, a C8+ cycloalkene, a C8+ alcohol, a C8+ ketone, an aryl, a fused aryl, an oxygenated aryl, an oxygenated fused aryl, and a mixture thereof, wherein the acid condensation catalyst comprises an acidic support or a heterogeneous acid catalyst comprising a metal selected from the group consisting of Pd, Pt, Cu, Co, Ru, Cr, Ni, Ag, an alloy thereof, and a combination thereof,
(iv) separating a portion of the C7− compounds from the product stream to provide a recycle stream, and
(v) recycling the recycle stream to form at least in part the second reactant stream
wherein, after the catalytic reaction of step (iii), percent yield of the C8+ compounds in the product stream is greater than percent yield of C8+ compounds in a product stream produced when either the first or the second reactant stream alone is catalytically reacted with hydrogen in the presence of the acid condensation catalyst. 27. The method of claim 26, wherein the acidic support is selected from the group consisting of an aluminosilicate, a tungstated aluminosilicate, a silica-alumina phosphate, an aluminum phosphate, an amorphous silica alumina, an acidic alumina, a phosphate alumina, a tungstated alumina, a zirconia, a tungstated zirconia, a tungstated silica, a tungstated titania, a tungstated phosphate, niobia, an acid modified resin, a zeolite, a heteropolyacid, a tungstated heteropolyacid, and combinations thereof. 28. The method of claim 26, wherein the acid condensation catalyst comprises the heterogeneous acid catalyst that further comprises a support selected from the group consisting of carbon, silica, alumina, zirconia, titania, vanadia, kieselguhr, hydroxyapatite, chromia, niobia, mixtures thereof, and combinations thereof. 29. The method of claim 26, wherein the acid condensation catalyst further comprises a modifier selected from the group consisting of Cu, Ag, Au, Ru, Pd, Ni, Co, Ga, In, Cr, Mo, W, Sn, Nb, Ti, Zr, Ge, P, Al, alloys thereof, and combinations thereof. 30. The method of claim 26, wherein the acid condensation catalyst comprises ZSM-5 or tungstated zirconia. 31. The method of claim 30, wherein the acid condensation catalyst further comprises Pd or Cu. 32. The method of claim 26, wherein the second reactant stream has an average oxygen to molecule ratio of 1 to 4, and the first reactant stream has an average oxygen to molecule ratio of 1.5 or less. 33. The method of claim 26, wherein the recycle stream has a boiling point of less than 210° C. 34. The method of claim 1, wherein the resulting C8+ compounds are further processed by:
(iv) separating at least a portion of the C8+ compounds from the product stream, and
(v) catalytically reacting the separated C8+ compounds in the presence of a finishing catalyst to produce a fuel product. 35. The method of claim 34, further comprising a step of separating the fuel product to provide a C8-14 fraction comprising a plurality of hydrocarbons having 8 to 14 carbon atoms, a C12-24 fraction comprising a plurality of hydrocarbons having 12 to 24 carbon atoms, and a C25+ fraction comprising a plurality of hydrocarbons having 25 or more carbon atoms. 36. The method of claim 35, wherein the C8-14 fraction is blended to provide a jet fuel, or the C12-24 fraction is blended to provide a diesel fuel, or the C25+ fraction is blended to provide a heavy oil. 37.-39. (canceled) 40. The method of claim 1, wherein the aqueous feedstock solution comprises a sugar alcohol. 41. The method of claim 40, wherein the sugar alcohol is sorbitol. 42. The method of claim 20, wherein the aqueous feedstock solution comprises a sugar alcohol. 43. The method of claim 42, wherein the sugar alcohol is sorbitol. 44. The method of claim 26, wherein the aqueous feedstock solution comprises a sugar alcohol. 45. The method of claim 44, wherein the sugar alcohol is sorbitol. | 2,800 |
348,685 | 16,806,200 | 2,884 | Synchronization of plural outputs of data transported by a wireless network is facilitated by bandlimiting a sample clock signal controlling a rate at which data is processed by the network's devices and/or bandlimiting wall time data controlling the real time for presenting a datum. | 1. A method of recovering a sample clock in a network, the method comprising the steps of:
(a) generating a raw sample clock signal oscillating at a frequency determined by a datum included in a data packet; and (b) bandlimiting the raw sample clock signal about the mean frequency of the raw sample clock signal by estimating the raw sample clock signal. 2. A method of recovering a sample clock in a network, the method comprising the steps of:
(a) bandlimiting a raw wall time signal about a mean frequency of said raw wall time signal by estimating the raw wall time signal; and (b) generating a sample clock signal oscillating at a frequency determined by a datum included in a data packet and the bandlimited raw wall time signal. | Synchronization of plural outputs of data transported by a wireless network is facilitated by bandlimiting a sample clock signal controlling a rate at which data is processed by the network's devices and/or bandlimiting wall time data controlling the real time for presenting a datum.1. A method of recovering a sample clock in a network, the method comprising the steps of:
(a) generating a raw sample clock signal oscillating at a frequency determined by a datum included in a data packet; and (b) bandlimiting the raw sample clock signal about the mean frequency of the raw sample clock signal by estimating the raw sample clock signal. 2. A method of recovering a sample clock in a network, the method comprising the steps of:
(a) bandlimiting a raw wall time signal about a mean frequency of said raw wall time signal by estimating the raw wall time signal; and (b) generating a sample clock signal oscillating at a frequency determined by a datum included in a data packet and the bandlimited raw wall time signal. | 2,800 |
348,686 | 16,806,176 | 2,884 | An image forming apparatus includes an image forming unit, first and second detectors, and a corrector. The image forming unit includes first and second image forming units disposed downstream of the first unit in a transport direction of a recording medium and causes the first and second units to form predetermined correction images onto the recording medium. The first detector is disposed downstream of the first unit and upstream of the second unit in the transport direction, and detects the correction image formed by the first unit. The second detector is disposed downstream of the second unit in the transport direction and detects the correction image formed by the second unit. The corrector corrects an image position of the second unit in a width direction of the recording medium by using the correction images formed by the first and second units and detected by the first and second detectors. | 1. An image forming apparatus comprising:
an image forming unit that includes a first image forming unit and a second image forming unit disposed downstream of the first image forming unit in a transport direction of a recording medium, the image forming unit causing the first image forming unit and the second image forming unit to form predetermined correction images onto the recording medium; a first detector that is disposed downstream of the first image forming unit in the transport direction and upstream of the second image forming unit in the transport direction and that detects the correction image formed by the first image forming unit; a second detector that is disposed downstream of the second image forming unit in the transport direction and that at least detects the correction image formed by the second image forming unit; and a corrector that corrects an image position of the second image forming unit in a width direction of the recording medium by using the correction image formed by the first image forming unit and detected by the first detector and the correction image formed by the second image forming unit and detected by the second detector. 2. The image forming apparatus according to claim 1,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the width direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the width direction. 3. The image forming apparatus according to claim 1,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the width direction before the third image forming unit performs an image forming process. 4. The image forming apparatus according to claim 2,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the width direction before the third image forming unit performs an image forming process. 5. The image forming apparatus according to claim 3,
wherein the image forming unit performs an image forming process such that the correction image formed by the first image forming unit is interposed, in the transport direction, between the correction image formed by the second image forming unit and a correction image formed by the third image forming unit. 6. The image forming apparatus according to claim 4,
wherein the image forming unit performs an image forming process such that the correction image formed by the first image forming unit is interposed, in the transport direction, between the correction image formed by the second image forming unit and a correction image formed by the third image forming unit. 7. The image forming apparatus according to claim 1,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 8. The image forming apparatus according to claim 2,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 9. The image forming apparatus according to claim 3,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 10. The image forming apparatus according to claim 4,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 11. The image forming apparatus according to claim 5,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 12. The image forming apparatus according to claim 6,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 13. The image forming apparatus according to claim 7,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the transport direction before the third image forming unit performs an image forming process. 14. The image forming apparatus according to claim 8,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the transport direction before the third image forming unit performs an image forming process. 15. The image forming apparatus according to claim 9,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 16. The image forming apparatus according to claim 10,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 17. The image forming apparatus according to claim 11,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 18. The image forming apparatus according to claim 12,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 19. An image forming apparatus comprising:
image forming means for causing first image forming means and second image forming means to form predetermined correction images onto a recording medium, the image forming means including the first image forming means and the second image forming means disposed downstream of the first image forming means in a transport direction of the recording medium; first detecting means for detecting the correction image formed by the first image forming means, the first detecting means being disposed downstream of the first image forming means in the transport direction and upstream of the second image forming means in the transport direction; second detecting means for at least detecting the correction image formed by the second image forming means, the second detecting means being disposed downstream of the second image forming means in the transport direction; and correcting means for correcting an image position of the second image forming means in a width direction of the recording medium by using the correction image formed by the first image forming means and detected by the first detecting means and the correction image formed by the second image forming means and detected by the second detecting means. | An image forming apparatus includes an image forming unit, first and second detectors, and a corrector. The image forming unit includes first and second image forming units disposed downstream of the first unit in a transport direction of a recording medium and causes the first and second units to form predetermined correction images onto the recording medium. The first detector is disposed downstream of the first unit and upstream of the second unit in the transport direction, and detects the correction image formed by the first unit. The second detector is disposed downstream of the second unit in the transport direction and detects the correction image formed by the second unit. The corrector corrects an image position of the second unit in a width direction of the recording medium by using the correction images formed by the first and second units and detected by the first and second detectors.1. An image forming apparatus comprising:
an image forming unit that includes a first image forming unit and a second image forming unit disposed downstream of the first image forming unit in a transport direction of a recording medium, the image forming unit causing the first image forming unit and the second image forming unit to form predetermined correction images onto the recording medium; a first detector that is disposed downstream of the first image forming unit in the transport direction and upstream of the second image forming unit in the transport direction and that detects the correction image formed by the first image forming unit; a second detector that is disposed downstream of the second image forming unit in the transport direction and that at least detects the correction image formed by the second image forming unit; and a corrector that corrects an image position of the second image forming unit in a width direction of the recording medium by using the correction image formed by the first image forming unit and detected by the first detector and the correction image formed by the second image forming unit and detected by the second detector. 2. The image forming apparatus according to claim 1,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the width direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the width direction. 3. The image forming apparatus according to claim 1,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the width direction before the third image forming unit performs an image forming process. 4. The image forming apparatus according to claim 2,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the width direction before the third image forming unit performs an image forming process. 5. The image forming apparatus according to claim 3,
wherein the image forming unit performs an image forming process such that the correction image formed by the first image forming unit is interposed, in the transport direction, between the correction image formed by the second image forming unit and a correction image formed by the third image forming unit. 6. The image forming apparatus according to claim 4,
wherein the image forming unit performs an image forming process such that the correction image formed by the first image forming unit is interposed, in the transport direction, between the correction image formed by the second image forming unit and a correction image formed by the third image forming unit. 7. The image forming apparatus according to claim 1,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 8. The image forming apparatus according to claim 2,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 9. The image forming apparatus according to claim 3,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 10. The image forming apparatus according to claim 4,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 11. The image forming apparatus according to claim 5,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 12. The image forming apparatus according to claim 6,
wherein the corrector uses the correction image formed by the first image forming unit and detected by the first detector to correct the image position of the second image forming unit in the transport direction before the second image forming unit performs an image forming process, and uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the second image forming unit in the transport direction. 13. The image forming apparatus according to claim 7,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the transport direction before the third image forming unit performs an image forming process. 14. The image forming apparatus according to claim 8,
wherein the image forming unit further includes a third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct an image position of the third image forming unit in the transport direction before the third image forming unit performs an image forming process. 15. The image forming apparatus according to claim 9,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 16. The image forming apparatus according to claim 10,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 17. The image forming apparatus according to claim 11,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 18. The image forming apparatus according to claim 12,
wherein the image forming unit includes the third image forming unit disposed downstream of the second detector in the transport direction, and wherein the corrector uses the correction image formed by the second image forming unit and detected by the second detector to correct the image position of the third image forming unit in the transport direction before the third image forming unit performs the image forming process. 19. An image forming apparatus comprising:
image forming means for causing first image forming means and second image forming means to form predetermined correction images onto a recording medium, the image forming means including the first image forming means and the second image forming means disposed downstream of the first image forming means in a transport direction of the recording medium; first detecting means for detecting the correction image formed by the first image forming means, the first detecting means being disposed downstream of the first image forming means in the transport direction and upstream of the second image forming means in the transport direction; second detecting means for at least detecting the correction image formed by the second image forming means, the second detecting means being disposed downstream of the second image forming means in the transport direction; and correcting means for correcting an image position of the second image forming means in a width direction of the recording medium by using the correction image formed by the first image forming means and detected by the first detecting means and the correction image formed by the second image forming means and detected by the second detecting means. | 2,800 |
348,687 | 16,806,205 | 2,884 | An exemplary adjustable length link includes a first rod end having a body with a threaded socket, a second rod end having a threaded shaft and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft. | 1. An adjustable length link comprising:
a first rod end having a body with a threaded socket; a second rod end having a threaded shaft; and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft. 2. The adjustable length link of claim 1, wherein the external threads and the internal threads have different thread pitches. 3. The adjustable length link of claim 1, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another. 4. The adjustable length link of claim 1, further comprising a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 5. The adjustable length link of claim 1, wherein the first rod end comprises a first connector and the second rod end comprises a second connector. 6. The adjustable length link of claim 5, wherein the first connector and the second connectors are bearings. 7. The adjustable length link of claim 1, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another; and
a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 8. The adjustable length link of claim 7, wherein the external threads and the internal threads have different thread pitches. 9. The adjustable length link of claim 7, wherein the first rod end comprises a first connector and the second rod end comprises a second connector, wherein the first connector and the second connector are bearings. 10. The adjustable length link of claim 10, wherein the external threads and the internal threads have different thread pitches. 11. An aircraft rotor system comprising:
an adjustable link coupled to a rotor blade, the adjustable link comprising: a first rod end having a body with a threaded socket; a second rod end having a threaded shaft; and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft. 12. The aircraft rotor system of claim 11, wherein one of the first rod end and the second rod end is coupled to the rotor blade and the other one of the first rod end and the second rod end is coupled to a hub mounted with a mast. 13. The aircraft rotor system of claim 11, wherein the external threads and the internal threads have different thread pitches. 14. The aircraft rotor system of claim 11, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another. 15. The aircraft rotor system of claim 11, further comprising a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 16. The aircraft rotor system of claim 11, wherein the first rod end comprises a first connector and the second rod end comprises a second connector. 17. The aircraft rotor system of claim 16, wherein the first connector and the second connectors are bearings. 18. The aircraft rotor system of claim 11, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another; and
a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 19. The aircraft rotor system of claim 18, wherein the external threads and the internal threads have different thread pitches. 20. The aircraft rotor system of claim 19, wherein the first rod end comprises a first connector and the second rod end comprises a second connector, wherein the first connector and the second connector are bearings. | An exemplary adjustable length link includes a first rod end having a body with a threaded socket, a second rod end having a threaded shaft and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft.1. An adjustable length link comprising:
a first rod end having a body with a threaded socket; a second rod end having a threaded shaft; and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft. 2. The adjustable length link of claim 1, wherein the external threads and the internal threads have different thread pitches. 3. The adjustable length link of claim 1, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another. 4. The adjustable length link of claim 1, further comprising a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 5. The adjustable length link of claim 1, wherein the first rod end comprises a first connector and the second rod end comprises a second connector. 6. The adjustable length link of claim 5, wherein the first connector and the second connectors are bearings. 7. The adjustable length link of claim 1, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another; and
a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 8. The adjustable length link of claim 7, wherein the external threads and the internal threads have different thread pitches. 9. The adjustable length link of claim 7, wherein the first rod end comprises a first connector and the second rod end comprises a second connector, wherein the first connector and the second connector are bearings. 10. The adjustable length link of claim 10, wherein the external threads and the internal threads have different thread pitches. 11. An aircraft rotor system comprising:
an adjustable link coupled to a rotor blade, the adjustable link comprising: a first rod end having a body with a threaded socket; a second rod end having a threaded shaft; and a sleeve having external threads cooperative with the threaded socket and a bore with internal threads cooperative with the threaded shaft. 12. The aircraft rotor system of claim 11, wherein one of the first rod end and the second rod end is coupled to the rotor blade and the other one of the first rod end and the second rod end is coupled to a hub mounted with a mast. 13. The aircraft rotor system of claim 11, wherein the external threads and the internal threads have different thread pitches. 14. The aircraft rotor system of claim 11, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another. 15. The aircraft rotor system of claim 11, further comprising a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 16. The aircraft rotor system of claim 11, wherein the first rod end comprises a first connector and the second rod end comprises a second connector. 17. The aircraft rotor system of claim 16, wherein the first connector and the second connectors are bearings. 18. The aircraft rotor system of claim 11, further comprising a sleeve jam nut threadedly connected to the external threads of the sleeve to engage the body and secure the first rod end and the sleeve in a fixed position relative to one another; and
a shaft jam nut threadedly connected to the threaded shaft to engage the sleeve and secure the sleeve and the second rod in a fixed position relative to one another. 19. The aircraft rotor system of claim 18, wherein the external threads and the internal threads have different thread pitches. 20. The aircraft rotor system of claim 19, wherein the first rod end comprises a first connector and the second rod end comprises a second connector, wherein the first connector and the second connector are bearings. | 2,800 |
348,688 | 16,806,180 | 2,884 | A learning management system may be configured to retrieve roster data from a roster database and determine from the roster data whether a pilot has a scheduled downtime during a flight or a layover time before the flight. The system may further retrieve flight data associated with the flight from the learning management system and determine a training concept associated with the flight. The system may also select a training exercise from multiple training exercises, where the training exercise is associated with the training concept. A notification may be sent to an electronic device associated with the pilot, where the notification includes an offer to perform the training exercise. | 1. A method comprising:
retrieving roster data from a roster database; determining from the roster data whether an employee has a period of downtime; selecting a training exercise applicable to the employee; and sending a notification to an electronic device associated with the employee, wherein the notification includes an offer to perform the training exercise. 2. The method of claim 1, wherein the period of downtime includes scheduled available time during a flight, a scheduled downtime during the flight, or a layover before the flight. 3. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving flight data from a flight database, wherein the flight data corresponds to a flight associated with the employee; determining a training concept associated with the flight; and selecting the training exercise from multiple training exercises, wherein the training exercise is associated with the training concept. 4. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving regulatory or audit data from a regulatory or audit database, wherein the regulatory or audit data indicates the training exercise. 5. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving sample data associated with multiple employees; and determining a common training exercise associated with the multiple employees, wherein the training exercise is the common training exercise. 6. The method of claim 5, wherein said determining the common training exercise associated with multiple employees includes performing an artificial intelligence analysis of a training history associated with the multiple employees. 7. The method of claim 1, wherein the selected training exercise includes a mid-fidelity simulation. 8. The method of claim 1, wherein the employee is a pilot, an aircraft engineer, a ground operation crew member, or a cabin crew member. 9. The method of claim 1, further comprising:
providing feedback regarding the training exercise to a learning management system. 10. A learning management system comprising:
a network module configured to retrieve roster data from a roster database, wherein the roster data indicates whether an employee has a period of downtime; memory storing multiple training exercises; and a processor configured to determine whether an employee has a period of downtime based on the roster data, select a training exercise from the multiple training exercises, and send a notification to an electronic device associate with the employee, wherein the notification includes an offer to perform the training exercise. 11. The system of claim 10, wherein the period of downtime includes scheduled available time during a flight, a scheduled downtime during the flight, or a layover before the flight. 12. The system of claim 10, wherein the processor is further configured to:
retrieve flight data for a flight associated with the employee; and determine a training concept associated with the flight, wherein the training exercise is associated with the training concept. 13. The system of claim 10, wherein the processor is further configured to:
retrieve regulatory or audit data, wherein the regulatory or audit data indicates relevant training exercises. 14. The system of claim 10, wherein the processor is further configured to:
retrieve sample data associated with multiple employees; and determine a common training exercise associated with the multiple employees, wherein the training exercise is the common training exercise. 15. The system of claim 14, further comprising an artificial intelligence learning model configured to perform an artificial intelligence analysis of a training history associated with the multiple employees and to determine the common training exercise associated with the multiple employees based on results of the artificial intelligence analysis. 16. The system of claim 10, wherein the selected training exercise includes a mid-fidelity simulation. 17. The system of claim 10, wherein the employee is a pilot, an aircraft engineer, a ground operations crew member, or a cabin crew member. 18. The system of claim 10, wherein the processor is further configured to receive feedback regarding the training exercise. 19. A system comprising a processor and memory, wherein the memory stores instruction that, when executed by the processor, cause the processor to:
retrieve roster data from a roster database; determine from the roster data whether a pilot has a scheduled downtime during a flight or a layover before the flight; retrieve flight data associated with the flight from a flight database; determine a training concept associated with the flight; select a training exercise from multiple training exercises, wherein the training exercise is associated with the training concept; and send a notification to an electronic device associated with the pilot, wherein the notification includes an offer to perform the training exercise. 20. The system of claim 19, wherein the instructions further cause the processor to receive feedback regarding the training exercise from the electronic device. | A learning management system may be configured to retrieve roster data from a roster database and determine from the roster data whether a pilot has a scheduled downtime during a flight or a layover time before the flight. The system may further retrieve flight data associated with the flight from the learning management system and determine a training concept associated with the flight. The system may also select a training exercise from multiple training exercises, where the training exercise is associated with the training concept. A notification may be sent to an electronic device associated with the pilot, where the notification includes an offer to perform the training exercise.1. A method comprising:
retrieving roster data from a roster database; determining from the roster data whether an employee has a period of downtime; selecting a training exercise applicable to the employee; and sending a notification to an electronic device associated with the employee, wherein the notification includes an offer to perform the training exercise. 2. The method of claim 1, wherein the period of downtime includes scheduled available time during a flight, a scheduled downtime during the flight, or a layover before the flight. 3. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving flight data from a flight database, wherein the flight data corresponds to a flight associated with the employee; determining a training concept associated with the flight; and selecting the training exercise from multiple training exercises, wherein the training exercise is associated with the training concept. 4. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving regulatory or audit data from a regulatory or audit database, wherein the regulatory or audit data indicates the training exercise. 5. The method of claim 1, wherein said selecting the training exercise applicable to the employee comprises:
retrieving sample data associated with multiple employees; and determining a common training exercise associated with the multiple employees, wherein the training exercise is the common training exercise. 6. The method of claim 5, wherein said determining the common training exercise associated with multiple employees includes performing an artificial intelligence analysis of a training history associated with the multiple employees. 7. The method of claim 1, wherein the selected training exercise includes a mid-fidelity simulation. 8. The method of claim 1, wherein the employee is a pilot, an aircraft engineer, a ground operation crew member, or a cabin crew member. 9. The method of claim 1, further comprising:
providing feedback regarding the training exercise to a learning management system. 10. A learning management system comprising:
a network module configured to retrieve roster data from a roster database, wherein the roster data indicates whether an employee has a period of downtime; memory storing multiple training exercises; and a processor configured to determine whether an employee has a period of downtime based on the roster data, select a training exercise from the multiple training exercises, and send a notification to an electronic device associate with the employee, wherein the notification includes an offer to perform the training exercise. 11. The system of claim 10, wherein the period of downtime includes scheduled available time during a flight, a scheduled downtime during the flight, or a layover before the flight. 12. The system of claim 10, wherein the processor is further configured to:
retrieve flight data for a flight associated with the employee; and determine a training concept associated with the flight, wherein the training exercise is associated with the training concept. 13. The system of claim 10, wherein the processor is further configured to:
retrieve regulatory or audit data, wherein the regulatory or audit data indicates relevant training exercises. 14. The system of claim 10, wherein the processor is further configured to:
retrieve sample data associated with multiple employees; and determine a common training exercise associated with the multiple employees, wherein the training exercise is the common training exercise. 15. The system of claim 14, further comprising an artificial intelligence learning model configured to perform an artificial intelligence analysis of a training history associated with the multiple employees and to determine the common training exercise associated with the multiple employees based on results of the artificial intelligence analysis. 16. The system of claim 10, wherein the selected training exercise includes a mid-fidelity simulation. 17. The system of claim 10, wherein the employee is a pilot, an aircraft engineer, a ground operations crew member, or a cabin crew member. 18. The system of claim 10, wherein the processor is further configured to receive feedback regarding the training exercise. 19. A system comprising a processor and memory, wherein the memory stores instruction that, when executed by the processor, cause the processor to:
retrieve roster data from a roster database; determine from the roster data whether a pilot has a scheduled downtime during a flight or a layover before the flight; retrieve flight data associated with the flight from a flight database; determine a training concept associated with the flight; select a training exercise from multiple training exercises, wherein the training exercise is associated with the training concept; and send a notification to an electronic device associated with the pilot, wherein the notification includes an offer to perform the training exercise. 20. The system of claim 19, wherein the instructions further cause the processor to receive feedback regarding the training exercise from the electronic device. | 2,800 |
348,689 | 16,806,193 | 2,894 | The invention comprises a novel composite multi-stack seed layer (CMSL) having lattice constant matched crystalline structure with the Co layer in above perpendicular magnetic pinning layer (pMPL) so that an excellent epitaxial growth of magnetic super lattice pinning layer [Co/(Pt, Pd or Ni)]n along its FCC (111) orientation can be achieved, resulting in a significant enhancement of perpendicular magnetic anisotropy (PMA) for perpendicular spin-transfer-torque magnetic-random-access memory (pSTT-MRAM) using perpendicular magnetoresistive elements as basic memory cells which potentially replace the conventional semiconductor memory used in electronic chips, especially mobile chips for power saving and non-volatility. | 1. A perpendicular magnetic pinning element (pMPE) comprising
a composite multi-stack seed layer (CMSL) provided on the surface of a substrate and having at least a modulating-layer (ML), a (Pt, Pd or Ir) layer and a buffer-layer (BL) sandwiched by the ML and the (Pt, Pd or Ir) layer; a perpendicular magnetic pinning layer (pMPL) provided on the surface of the CMSL and having a face-center-cubic (FCC) crystalline structure and having a perpendicular magnetic anisotropy (PMA) and having an invariable magnetization direction; an antiferromagnetic coupling spacer (AFCS) provided on the surface of the pMPL; a perpendicular magnetic reference layer (pMRL) provided on the surface of the AFCS and having a perpendicular magnetic anisotropy and having an invariable magnetization direction; wherein, said ML comprising a metal layer or a metal nitride layer and having a face-center-cubic (FCC) crystalline lattice constant between 0.34 nm and 0.37 nm, preferred to be selected from Cu, CuN, CuCo, CuNi or NiN; said BL comprising a metal layer having at least one element selected from the group consisting of Ta, Hf, Nb, Zr, Mo, W and having a thickness between 0.3-1.5 nm; said CMSL forming a face-center-cubic (FCC) crystalline structure with a (111) texture; said pMPE forming a strong perpendicular antiferromagnetic coupling (pAFC) between the pMPL and the pMRL through the AFCS. 2. The element of claim 1, wherein said pMPL comprises a multilayer stack structure [Co/(Pt, Pd or Ni)]n/Co, wherein n is an integer between 2 and 6 inclusive, and thicknesses of each said Co sub-layer and (Pt, Pd or Ni) sub-layer are between 0.25 nm-0.7 nm and between 0.2 nm-0.8 nm, respectively. 3. The element of claim 1, wherein said CMSL comprises a four-layer stack structure base-layer/ML/BL/(Pt, Pd or Ir), wherein the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of said ML is between 3-30 nm, the thickness of said BL is between 0.3-1.5 nm, and the thickness of said (Pt, Pd or Ir) layer is between 1-3 nm. 4. The element of claim 1, wherein said CMSL comprises a repeated multi-layer stack structure base-layer/[ML/BL/(Pt, Pd or Ir)]z or base-layer/[ML/BL]z/(Pt, Pd or Ir), wherein said z is an integer between 2 and 5 inclusive, and the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of each said ML is between 1.5-30 nm, the thickness of each said BL is between 0.3-1.5 nm, and thickness of each said (Pt, Pd or Ir) layer is between 1-3 nm. 5. The element of claim 1, wherein said CMSL comprises a repeated multi-layer stack structure base-layer/{[ML/BL]x/(Pt, Pd or Ir)}y, wherein said x, y are integers between 2 and 5 inclusive, and the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of each said ML is between 1.5-30 nm, the thickness of each said BL is between 0.3-1.5 nm, and thickness of each said (Pt, Pd or Ir) layer is between 1-3 nm. 6. The element of claim 1, wherein said CMSL and said pMPL both have their closed-packed FCC (111) crystalline orientation normal to the film surface. 7. The element of claim 1, wherein said pMRL comprises a multilayer stack structure [Co/(Pt, Pd or Ni)]m/(Co or Ta/Co)/(W or Mo)/CoFeB or Fe/[Co/(Pt, Pd or Ni)]m/(Co or Ta/Co)/(W or Mo)/CoFeB, wherein m is an integer between 2 and 4 inclusive; and said Co layer has a thickness between 0.25-0.7 nm, said (Pt, Pd or Ni) layer has a thickness between 0.2-0.8 nm, said CoFeB layer has a thickness between 0.7-1.5 nm, said (W or Mo) layer has a thickness between 0.1-0.5 nm, said Ta layer has a thickness between 0.05-0.2 nm. 8. The element of claim 1, wherein said pMRL comprises a bi-layer stack structure Fe/CoFeB, Fe/FeB, FeB/CoFeB, or Fe/CoFe, wherein said Fe layer has a thickness between 0.1-0.5 nm, said CoFeB, FeB and CoFe layer have thicknesses between 0.7 nm-1.3 nm. 9. The element of claim 1, wherein said pMRL is made of a single layer of CoFeB and having a thickness between 0.7 nm-1.3 nm. 10. The element of claim 1, wherein said AFCS is made of a single layer of (Ru, Rh or Ir) or a bi-layer structure of (Ru, Rh or Ir)/(Cr, Mo, W or V) or tri-layer structure of (Ru, Rh or Ir)/(W, Mo or V)/Cr. 11. The element of claim 1, wherein said pMPE has its magnetization direction perpendicular to a film surface, and said pMPE further forms a perpendicular magnetic tunnel junction (pMTJ) further comprising a tunnel barrier (TB) and a storage layer (SL), wherein said TB is sandwiched between said SL and said pMRL. 12. The element of claim 11, wherein said TB is an MgO layer having a thickness between 0.8 nm to 1.5 nm, and said SL is a single layer CoFeB or tri-layer CoFeB/(W or Mo)/CoFeB having a total CoFeB thickness between 1 nm-2.0 nm, wherein said W or Mo layer has a thickness between 0.1 nm-0.5 nm. 13. The element of claim 11, wherein said pMTJ comprises a film stack of CMSL/pMPL/AFCS/pMRL/TB/SL/capping layer counting from bottom to top, forming a bottom-pinned pSTT-MRAM film element. 14. The element of claim 11, wherein said pMTJ comprises a film stack of CMSL/pMPL1/AFCS1/pMRL1/TB1/SL/TB2/pMRL2/AFCS2/pMPL2/cap layer, forming a dual-pinned pSTT-MRAM film element. 15. The element of claim 13, wherein said bottom-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/[Co/(Pt, Pd or Ni)]m/Co/(Ta, W or Mo)/CoFeB/ MgO/CoFeB/(W or Mo)/CoFeB/MgO/W/Ru/Ta, with said repetition numbers n and m ranging from 2 to 6 and 1 to 4, respectively. 16. The element of claim 13, wherein said bottom-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]nCo/(Ru, Rh or Ir)/Cr/Fe/CoFeB/ MgO/CoFeB/W or Mo/CoFeB/MgO/W/Ru/Ta or substrate/CMSL/ [Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/(W, Mo or V)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/W/Ru/Ta. 17. The element of claim 14, wherein said dual-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/CoFeB/Fe/Cr/(Ru, Rh or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru or substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/(W, Mo or V)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/CoFeB/Fe/Cr/(W, Mo or V)(Ru, Rh or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru, wherein film thickness of the middle composite storage layer (CSL) takes values of CoFeB(1-2 nm)/(W or Mo)(0.15-0.5 nm)/CoFeB(1-2 nm) while the other layers in the stack will have a similar film thickness of that in said bottom-pinned pSTT-MRAM 18. The element of claim 14, wherein said dual-pinned pSTT-MRAM film element comprises a film stack of substrate/or substrate/CMSL//[Co/(Pt, Pd or Ni)]n/Co/(Ru or Ir)/Co/[(Pt, Pd or Ni]/CO]m/(W, Mo or Ta)/CoFeB/MgO/CoFeB/(W or Mo)/CoFeB/MgO/CoFeB/(W, Mo or Ta)/Co/[Co/(Pt, Pd or Ni)]m/Co/(Ru or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru, wherein the film thickness of the middle composite storage layer (CSL) takes values of CoFeB(1-2 nm)/(W or Mo)(0.15-0.5 nm)/CoFeB(1-2 nm) while the other layers in the stack will have a similar film thickness of that in said bottom-pinned pSTT-MRAM. 19. A method of forming a bottom-pinned pSTT-MRAM film stack comprising
forming a composite multi-stack seed layer (CMSL) having at least one sandwich structure modulating-layer/buffer-layer/(Pt, Pd or Ir), wherein, said modulating-layer comprising a metal layer or a metal nitride layer and preferred to be selected from Cu, CuN, CuCo, CuNi or NiN, said buffer-layer comprising a metal layer having at least one element selected from the group consisting of Ta, Hf, Nb, Zr, Mo, W forming a perpendicular magnetic pinning layer (pMPL) on the surface of said CMSL and having a face-center-cubic (FCC) crystalline structure and having an invariable perpendicular magnetization direction; forming an antiferromagnetic coupling spacer (AFC) provided on the surface of the pMPL and having a single layer structure of (Ru, Rh or Ir), bi-layer structure of (Ru, Rh or Ir)/Cr or tri-layer structure of (Ru, Rh or Ir)/(W, Mo or V)/Cr; forming a perpendicular magnetic reference layer (pMRL) provided on the surface of the AFC and having a body-center-cubic (BCC) crystalline structure and having an invariable magnetization direction; forming a tunnel barrier (TB) layer on the surface of said pMRL; forming a magnetic storage layer (SL) on the surface of said TB; forming a capping layer on the surface of said SL; annealing said film stack substrate/CMSL/pMPL/AFMs/PMRL/TB/SL/capping layer at temperature between 350-450 C for 30-150 minutes. 20. The method of claim 19 makes a pSTT-MRAM device having said bottom-pinned pSTT-MRAM film stack electrically connected between a top electrode and a bottom electrode and having write/read operations as a storage device. | The invention comprises a novel composite multi-stack seed layer (CMSL) having lattice constant matched crystalline structure with the Co layer in above perpendicular magnetic pinning layer (pMPL) so that an excellent epitaxial growth of magnetic super lattice pinning layer [Co/(Pt, Pd or Ni)]n along its FCC (111) orientation can be achieved, resulting in a significant enhancement of perpendicular magnetic anisotropy (PMA) for perpendicular spin-transfer-torque magnetic-random-access memory (pSTT-MRAM) using perpendicular magnetoresistive elements as basic memory cells which potentially replace the conventional semiconductor memory used in electronic chips, especially mobile chips for power saving and non-volatility.1. A perpendicular magnetic pinning element (pMPE) comprising
a composite multi-stack seed layer (CMSL) provided on the surface of a substrate and having at least a modulating-layer (ML), a (Pt, Pd or Ir) layer and a buffer-layer (BL) sandwiched by the ML and the (Pt, Pd or Ir) layer; a perpendicular magnetic pinning layer (pMPL) provided on the surface of the CMSL and having a face-center-cubic (FCC) crystalline structure and having a perpendicular magnetic anisotropy (PMA) and having an invariable magnetization direction; an antiferromagnetic coupling spacer (AFCS) provided on the surface of the pMPL; a perpendicular magnetic reference layer (pMRL) provided on the surface of the AFCS and having a perpendicular magnetic anisotropy and having an invariable magnetization direction; wherein, said ML comprising a metal layer or a metal nitride layer and having a face-center-cubic (FCC) crystalline lattice constant between 0.34 nm and 0.37 nm, preferred to be selected from Cu, CuN, CuCo, CuNi or NiN; said BL comprising a metal layer having at least one element selected from the group consisting of Ta, Hf, Nb, Zr, Mo, W and having a thickness between 0.3-1.5 nm; said CMSL forming a face-center-cubic (FCC) crystalline structure with a (111) texture; said pMPE forming a strong perpendicular antiferromagnetic coupling (pAFC) between the pMPL and the pMRL through the AFCS. 2. The element of claim 1, wherein said pMPL comprises a multilayer stack structure [Co/(Pt, Pd or Ni)]n/Co, wherein n is an integer between 2 and 6 inclusive, and thicknesses of each said Co sub-layer and (Pt, Pd or Ni) sub-layer are between 0.25 nm-0.7 nm and between 0.2 nm-0.8 nm, respectively. 3. The element of claim 1, wherein said CMSL comprises a four-layer stack structure base-layer/ML/BL/(Pt, Pd or Ir), wherein the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of said ML is between 3-30 nm, the thickness of said BL is between 0.3-1.5 nm, and the thickness of said (Pt, Pd or Ir) layer is between 1-3 nm. 4. The element of claim 1, wherein said CMSL comprises a repeated multi-layer stack structure base-layer/[ML/BL/(Pt, Pd or Ir)]z or base-layer/[ML/BL]z/(Pt, Pd or Ir), wherein said z is an integer between 2 and 5 inclusive, and the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of each said ML is between 1.5-30 nm, the thickness of each said BL is between 0.3-1.5 nm, and thickness of each said (Pt, Pd or Ir) layer is between 1-3 nm. 5. The element of claim 1, wherein said CMSL comprises a repeated multi-layer stack structure base-layer/{[ML/BL]x/(Pt, Pd or Ir)}y, wherein said x, y are integers between 2 and 5 inclusive, and the base-layer is made of a metal layer, metal oxide layer or metal nitride layer comprising at least one element selected from the group consisting of Ta, Hf, Nb, Mo, W, Zr, Ti, V, Cr, Ru, Rh, Zn and having a thickness between 1-20 nm, the thickness of each said ML is between 1.5-30 nm, the thickness of each said BL is between 0.3-1.5 nm, and thickness of each said (Pt, Pd or Ir) layer is between 1-3 nm. 6. The element of claim 1, wherein said CMSL and said pMPL both have their closed-packed FCC (111) crystalline orientation normal to the film surface. 7. The element of claim 1, wherein said pMRL comprises a multilayer stack structure [Co/(Pt, Pd or Ni)]m/(Co or Ta/Co)/(W or Mo)/CoFeB or Fe/[Co/(Pt, Pd or Ni)]m/(Co or Ta/Co)/(W or Mo)/CoFeB, wherein m is an integer between 2 and 4 inclusive; and said Co layer has a thickness between 0.25-0.7 nm, said (Pt, Pd or Ni) layer has a thickness between 0.2-0.8 nm, said CoFeB layer has a thickness between 0.7-1.5 nm, said (W or Mo) layer has a thickness between 0.1-0.5 nm, said Ta layer has a thickness between 0.05-0.2 nm. 8. The element of claim 1, wherein said pMRL comprises a bi-layer stack structure Fe/CoFeB, Fe/FeB, FeB/CoFeB, or Fe/CoFe, wherein said Fe layer has a thickness between 0.1-0.5 nm, said CoFeB, FeB and CoFe layer have thicknesses between 0.7 nm-1.3 nm. 9. The element of claim 1, wherein said pMRL is made of a single layer of CoFeB and having a thickness between 0.7 nm-1.3 nm. 10. The element of claim 1, wherein said AFCS is made of a single layer of (Ru, Rh or Ir) or a bi-layer structure of (Ru, Rh or Ir)/(Cr, Mo, W or V) or tri-layer structure of (Ru, Rh or Ir)/(W, Mo or V)/Cr. 11. The element of claim 1, wherein said pMPE has its magnetization direction perpendicular to a film surface, and said pMPE further forms a perpendicular magnetic tunnel junction (pMTJ) further comprising a tunnel barrier (TB) and a storage layer (SL), wherein said TB is sandwiched between said SL and said pMRL. 12. The element of claim 11, wherein said TB is an MgO layer having a thickness between 0.8 nm to 1.5 nm, and said SL is a single layer CoFeB or tri-layer CoFeB/(W or Mo)/CoFeB having a total CoFeB thickness between 1 nm-2.0 nm, wherein said W or Mo layer has a thickness between 0.1 nm-0.5 nm. 13. The element of claim 11, wherein said pMTJ comprises a film stack of CMSL/pMPL/AFCS/pMRL/TB/SL/capping layer counting from bottom to top, forming a bottom-pinned pSTT-MRAM film element. 14. The element of claim 11, wherein said pMTJ comprises a film stack of CMSL/pMPL1/AFCS1/pMRL1/TB1/SL/TB2/pMRL2/AFCS2/pMPL2/cap layer, forming a dual-pinned pSTT-MRAM film element. 15. The element of claim 13, wherein said bottom-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/[Co/(Pt, Pd or Ni)]m/Co/(Ta, W or Mo)/CoFeB/ MgO/CoFeB/(W or Mo)/CoFeB/MgO/W/Ru/Ta, with said repetition numbers n and m ranging from 2 to 6 and 1 to 4, respectively. 16. The element of claim 13, wherein said bottom-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]nCo/(Ru, Rh or Ir)/Cr/Fe/CoFeB/ MgO/CoFeB/W or Mo/CoFeB/MgO/W/Ru/Ta or substrate/CMSL/ [Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/(W, Mo or V)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/W/Ru/Ta. 17. The element of claim 14, wherein said dual-pinned pSTT-MRAM film element comprises a film stack of substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/CoFeB/Fe/Cr/(Ru, Rh or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru or substrate/CMSL/[Co/(Pt, Pd or Ni)]n/Co/(Ru, Rh or Ir)/(W, Mo or V)/Cr/Fe/CoFeB/MgO/CoFeB/W or Mo/CoFeB/MgO/CoFeB/Fe/Cr/(W, Mo or V)(Ru, Rh or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru, wherein film thickness of the middle composite storage layer (CSL) takes values of CoFeB(1-2 nm)/(W or Mo)(0.15-0.5 nm)/CoFeB(1-2 nm) while the other layers in the stack will have a similar film thickness of that in said bottom-pinned pSTT-MRAM 18. The element of claim 14, wherein said dual-pinned pSTT-MRAM film element comprises a film stack of substrate/or substrate/CMSL//[Co/(Pt, Pd or Ni)]n/Co/(Ru or Ir)/Co/[(Pt, Pd or Ni]/CO]m/(W, Mo or Ta)/CoFeB/MgO/CoFeB/(W or Mo)/CoFeB/MgO/CoFeB/(W, Mo or Ta)/Co/[Co/(Pt, Pd or Ni)]m/Co/(Ru or Ir)/Co/[(Pt, Pd or Ni)/Co]n/W/Ru, wherein the film thickness of the middle composite storage layer (CSL) takes values of CoFeB(1-2 nm)/(W or Mo)(0.15-0.5 nm)/CoFeB(1-2 nm) while the other layers in the stack will have a similar film thickness of that in said bottom-pinned pSTT-MRAM. 19. A method of forming a bottom-pinned pSTT-MRAM film stack comprising
forming a composite multi-stack seed layer (CMSL) having at least one sandwich structure modulating-layer/buffer-layer/(Pt, Pd or Ir), wherein, said modulating-layer comprising a metal layer or a metal nitride layer and preferred to be selected from Cu, CuN, CuCo, CuNi or NiN, said buffer-layer comprising a metal layer having at least one element selected from the group consisting of Ta, Hf, Nb, Zr, Mo, W forming a perpendicular magnetic pinning layer (pMPL) on the surface of said CMSL and having a face-center-cubic (FCC) crystalline structure and having an invariable perpendicular magnetization direction; forming an antiferromagnetic coupling spacer (AFC) provided on the surface of the pMPL and having a single layer structure of (Ru, Rh or Ir), bi-layer structure of (Ru, Rh or Ir)/Cr or tri-layer structure of (Ru, Rh or Ir)/(W, Mo or V)/Cr; forming a perpendicular magnetic reference layer (pMRL) provided on the surface of the AFC and having a body-center-cubic (BCC) crystalline structure and having an invariable magnetization direction; forming a tunnel barrier (TB) layer on the surface of said pMRL; forming a magnetic storage layer (SL) on the surface of said TB; forming a capping layer on the surface of said SL; annealing said film stack substrate/CMSL/pMPL/AFMs/PMRL/TB/SL/capping layer at temperature between 350-450 C for 30-150 minutes. 20. The method of claim 19 makes a pSTT-MRAM device having said bottom-pinned pSTT-MRAM film stack electrically connected between a top electrode and a bottom electrode and having write/read operations as a storage device. | 2,800 |
348,690 | 16,806,160 | 2,894 | A circuit board includes a board, first connection pads disposed on the board and arranged in a first direction, second connection pads disposed on the board and arranged in the first direction, a driving chip disposed on the board and between the first connection pads and the second connection pads, and a first adhesive layer disposed on the board and overlapping with an entirety of the first connection pads in a plan view. The second connection pads are spaced apart from the first connection pads in a second direction perpendicular to the first direction. | 1. A circuit board comprising:
a board; first connection pads disposed on the board and arranged in a first direction; second connection pads disposed on the board and arranged in the first direction, the second connection pads being spaced apart from the first connection pads in a second direction perpendicular to the first direction; a driving chip disposed on the board and between the first connection pads and the second connection pads; and a first adhesive layer disposed on the board and overlapping with an entirety of the first connection pads in a plan view. 2. The circuit board of claim 1, wherein the first adhesive layer overlaps with an area between the first connection pads in the plan view. 3. The circuit board of claim 2, wherein the first adhesive layer overlapping with the area between the first connection pads is disposed directly on the board, and
wherein a thickness of the first adhesive layer overlapping with the area between the first connection pads is greater than a thickness of each of the first connection pads. 4. The circuit board of claim 2, wherein the first adhesive layer is spaced apart from the board and is disposed on the first connection pads. 5. The circuit board of claim 4, wherein each of the first connection pads comprises:
a first conductive layer disposed between the board and the first adhesive layer; and a second conductive layer disposed between the board and the first adhesive layer, the second conductive layer having a different material from a material of the first conductive layer and surrounding a side surface of the first conductive layer. 6. The circuit board of claim 4, wherein the first adhesive layer has a tape shape, and
wherein the first adhesive layer overlaps with the first connection pads in neither the first direction nor the second direction. 7. The circuit board of claim 1, wherein the first connection pads consist of a metal of a single material. 8. The circuit board of claim 7, further comprising:
first signal lines disposed between the driving chip and the first connection pads to electrically connect the first connection pads to the driving chip; and second signal lines disposed between the driving chip and the second connection pads to electrically connect the second connection pads to the driving chip. 9. The circuit board of claim 8, wherein each of the first signal lines comprises:
a first line layer which consists of a same material as a material of the first connection pads and is disposed on the board; and a second line layer disposed on the first line layer and which consists of a different material from a material of the first line layer, wherein the first line layer and the first connection pad constitute a single unitary body. 10. The circuit board of claim 9, wherein a thickness of the second line layer is less than a thickness of the first line layer. 11. The circuit board of claim 9, wherein the first line layer includes copper, and the second line layer include tin. 12. The circuit board of claim 8, wherein the second connection pads consist of a metal of a single material, and the circuit board further comprising:
a second adhesive layer overlapping with an entirety of the second connection pads in the plan view and disposed on the second connection pads. 13. The circuit board of claim 12, wherein each of the second signal lines comprises:
a third line layer which consists of a same material as a material of the second connection pads and is disposed on the board; and a fourth line layer disposed on the third line layer and which consists of a different material from a material of the third line layer, wherein the third line layer and the second connection pad constitute a single unitary body. 14. A method for manufacturing a circuit board, the method comprising:
forming first conductive pads spaced apart from each other and arranged in one direction and first conductive lines connected to the first conductive pads, respectively, on a board; forming an adhesive layer overlapping with an entirety of the first conductive pads, on the first conductive pads; and forming second conductive lines having a different material from a material of the first conductive lines, on the first conductive lines, wherein the first conductive pads and the first conductive lines are formed of a same material, and the second conductive lines do not overlap with the first conductive pads in a plan view. 15. The method of claim 14, wherein the adhesive layer is formed by applying an adhesive material onto the board. 16. The method of claim 15, wherein the adhesive layer overlaps with an entirety of the first conductive pads and an area between the first conductive pads in the plan view, and
wherein a thickness of the adhesive layer overlapping with the area between the first conductive pads is greater than a thickness of each of the first conductive pads. 17. The method of claim 14, wherein the adhesive layer is provided in a tape shape of a single unitary body and is disposed on the first conductive pads, and
wherein the adhesive layer is spaced apart from the board. 18. The method of claim 17, wherein a length from the board to a top surface of the adhesive layer is greater than a length from the board to a top surface of each of the first conductive pads. 19. The method of claim 17, wherein an auxiliary conductive layer having a same material as a material of the second conductive lines is formed on a side surface of each of the first conductive pads. 20. The method of claim 14, wherein the first conductive pads are formed of a single material. | A circuit board includes a board, first connection pads disposed on the board and arranged in a first direction, second connection pads disposed on the board and arranged in the first direction, a driving chip disposed on the board and between the first connection pads and the second connection pads, and a first adhesive layer disposed on the board and overlapping with an entirety of the first connection pads in a plan view. The second connection pads are spaced apart from the first connection pads in a second direction perpendicular to the first direction.1. A circuit board comprising:
a board; first connection pads disposed on the board and arranged in a first direction; second connection pads disposed on the board and arranged in the first direction, the second connection pads being spaced apart from the first connection pads in a second direction perpendicular to the first direction; a driving chip disposed on the board and between the first connection pads and the second connection pads; and a first adhesive layer disposed on the board and overlapping with an entirety of the first connection pads in a plan view. 2. The circuit board of claim 1, wherein the first adhesive layer overlaps with an area between the first connection pads in the plan view. 3. The circuit board of claim 2, wherein the first adhesive layer overlapping with the area between the first connection pads is disposed directly on the board, and
wherein a thickness of the first adhesive layer overlapping with the area between the first connection pads is greater than a thickness of each of the first connection pads. 4. The circuit board of claim 2, wherein the first adhesive layer is spaced apart from the board and is disposed on the first connection pads. 5. The circuit board of claim 4, wherein each of the first connection pads comprises:
a first conductive layer disposed between the board and the first adhesive layer; and a second conductive layer disposed between the board and the first adhesive layer, the second conductive layer having a different material from a material of the first conductive layer and surrounding a side surface of the first conductive layer. 6. The circuit board of claim 4, wherein the first adhesive layer has a tape shape, and
wherein the first adhesive layer overlaps with the first connection pads in neither the first direction nor the second direction. 7. The circuit board of claim 1, wherein the first connection pads consist of a metal of a single material. 8. The circuit board of claim 7, further comprising:
first signal lines disposed between the driving chip and the first connection pads to electrically connect the first connection pads to the driving chip; and second signal lines disposed between the driving chip and the second connection pads to electrically connect the second connection pads to the driving chip. 9. The circuit board of claim 8, wherein each of the first signal lines comprises:
a first line layer which consists of a same material as a material of the first connection pads and is disposed on the board; and a second line layer disposed on the first line layer and which consists of a different material from a material of the first line layer, wherein the first line layer and the first connection pad constitute a single unitary body. 10. The circuit board of claim 9, wherein a thickness of the second line layer is less than a thickness of the first line layer. 11. The circuit board of claim 9, wherein the first line layer includes copper, and the second line layer include tin. 12. The circuit board of claim 8, wherein the second connection pads consist of a metal of a single material, and the circuit board further comprising:
a second adhesive layer overlapping with an entirety of the second connection pads in the plan view and disposed on the second connection pads. 13. The circuit board of claim 12, wherein each of the second signal lines comprises:
a third line layer which consists of a same material as a material of the second connection pads and is disposed on the board; and a fourth line layer disposed on the third line layer and which consists of a different material from a material of the third line layer, wherein the third line layer and the second connection pad constitute a single unitary body. 14. A method for manufacturing a circuit board, the method comprising:
forming first conductive pads spaced apart from each other and arranged in one direction and first conductive lines connected to the first conductive pads, respectively, on a board; forming an adhesive layer overlapping with an entirety of the first conductive pads, on the first conductive pads; and forming second conductive lines having a different material from a material of the first conductive lines, on the first conductive lines, wherein the first conductive pads and the first conductive lines are formed of a same material, and the second conductive lines do not overlap with the first conductive pads in a plan view. 15. The method of claim 14, wherein the adhesive layer is formed by applying an adhesive material onto the board. 16. The method of claim 15, wherein the adhesive layer overlaps with an entirety of the first conductive pads and an area between the first conductive pads in the plan view, and
wherein a thickness of the adhesive layer overlapping with the area between the first conductive pads is greater than a thickness of each of the first conductive pads. 17. The method of claim 14, wherein the adhesive layer is provided in a tape shape of a single unitary body and is disposed on the first conductive pads, and
wherein the adhesive layer is spaced apart from the board. 18. The method of claim 17, wherein a length from the board to a top surface of the adhesive layer is greater than a length from the board to a top surface of each of the first conductive pads. 19. The method of claim 17, wherein an auxiliary conductive layer having a same material as a material of the second conductive lines is formed on a side surface of each of the first conductive pads. 20. The method of claim 14, wherein the first conductive pads are formed of a single material. | 2,800 |
348,691 | 16,806,185 | 2,875 | It is an object of the present invention to provide a light-emitting device where periphery deterioration can be prevented from occurring even when an organic insulating film is used as an insulating film for the light-emitting device. In addition, it is an object of the present invention to provide a light-emitting device where reliability for a long period of time can be improved. A structure of an inorganic film, an organic film, and an inorganic film is not continuously provided from under a sealing material under a cathode for a light-emitting element. In addition, penetration of water is suppressed by defining the shape of the inorganic film that is formed over the organic film even when a structure of an inorganic film, an organic film, and an inorganic film is continuously provided under a cathode for a light-emitting element. | 1. (canceled) 2. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, and wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode. 3. The light-emitting device according to claim 2,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 4. The light-emitting device according to claim 2,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 5. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, and wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the plurality of openings. 6. The light-emitting device according to claim 5,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 7. The light-emitting device according to claim 5,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 8. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, and wherein the conductive layer is spaced from the anode. 9. The light-emitting device according to claim 8,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 10. The light-emitting device according to claim 8,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 11. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the plurality of openings, and wherein the conductive layer is spaced from the anode. 12. The light-emitting device according to claim 11,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 13. The light-emitting device according to claim 11,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. | It is an object of the present invention to provide a light-emitting device where periphery deterioration can be prevented from occurring even when an organic insulating film is used as an insulating film for the light-emitting device. In addition, it is an object of the present invention to provide a light-emitting device where reliability for a long period of time can be improved. A structure of an inorganic film, an organic film, and an inorganic film is not continuously provided from under a sealing material under a cathode for a light-emitting element. In addition, penetration of water is suppressed by defining the shape of the inorganic film that is formed over the organic film even when a structure of an inorganic film, an organic film, and an inorganic film is continuously provided under a cathode for a light-emitting element.1. (canceled) 2. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, and wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode. 3. The light-emitting device according to claim 2,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 4. The light-emitting device according to claim 2,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 5. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, and wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the plurality of openings. 6. The light-emitting device according to claim 5,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 7. The light-emitting device according to claim 5,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 8. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, and wherein the conductive layer is spaced from the anode. 9. The light-emitting device according to claim 8,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 10. The light-emitting device according to claim 8,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. 11. A light-emitting device comprising:
a first organic insulating layer over a first substrate; a conductive layer over the first organic insulating layer; an anode over the first organic insulating layer; a second organic insulating layer over the conductive layer and the anode; a layer containing a light-emitting material over the second organic insulating layer; a cathode over the layer containing a light-emitting material; a second substrate over the cathode; and a layer configured to keep a gap between the first substrate and the second substrate, wherein the cathode overlaps a first region of the conductive layer with the second organic insulating layer therebetween, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the conductive layer with the second organic insulating layer therebetween, wherein the conductive layer comprises a plurality of openings in a second region which is not overlapped by the cathode, wherein the layer configured to keep a gap between the first substrate and the second substrate overlaps the plurality of openings, and wherein the conductive layer is spaced from the anode. 12. The light-emitting device according to claim 11,
wherein the cathode overlaps with a gap between the conductive layer and the anode. 13. The light-emitting device according to claim 11,
wherein the cathode comprises a region which does not overlap the layer containing a light-emitting material. | 2,800 |
348,692 | 16,806,198 | 3,783 | A compact modular multifunctional inhalation device including a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a tray within the cartridge for holding a solid inhalant, a heating element mounted within the cartridge above and through the tray for heating the inhalant; and a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. The heating element is a coil mounted within a chamber in thermal proximity to the solid inhalant. A quartz rod is mounted within the coil. A plunger is mounted within the cartridge to translate therein and compact the solid inhalant. In an alternative embodiment, dual channels and outlet ports are mounted in communication with an inlet port. In another embodiment, the cartridge is a split chamber cartridge with a split plunger mounted therein. Yet another embodiment features a measurement glass cover gauge mounted on the cartridge. | 1. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a tray within the cartridge for retaining a solid inhalant and a heating element mounted within the cartridge above and through the tray for heating the inhalant; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. 2. The device of claim 1 wherein said heating element is a coil of metal or ceramic having 2-13 loops and a diameter of 1.3 mm-3.5 mm. 3. The device of claim 2 wherein said coil is mounted within a chamber in thermal proximity to said solid inhalant. 4. The device of claim 3 further including a quartz rod mounted within said coil. 5. The device of claim 1 further including a plunger adapted to translate within said cartridge. 6. The device of claim 5 further including an air inlet port mounted on said cartridge, a vapor outlet port mounted within said plunger and a channel therebetween mounted within said plunger. 7. The device of claim 6 further including dual channels and outlet ports mounted within said in communication with said inlet port. 8. The device of claim 1 wherein said cartridge is a split chamber cartridge. 9. The device of claim 8 further including a split plunger mounted within said split chamber cartridge. 10. The device of claim 1 further including a gauge mounted on said cartridge. 11. The device of claim 10 wherein said cartridge is at least partially transparent. 12. The device of claim 11 wherein said gauge is a measurement glass cover gauge. 13. The device of claim 1 further including a draw strength switch. 14. The device of claim 13 further including an arrangement for changing the temperature of said coil in response to said draw strength switch. 15. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a heating element mounted within the cartridge for heating a solid inhalant and
a plunger adapted to translate the inhalant within the cartridge; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. 16. The device of claim 15 further including an air inlet port mounted on said cartridge, a vapor outlet port mounted within said plunger and a channel therebetween mounted within said plunger. 17. The device of claim 16 further including dual channels and outlet ports mounted within said in communication with said inlet port. 18. The device of claim 1 wherein said cartridge is a split chamber cartridge. 19. The device of claim 18 further including a split plunger mounted within said split chamber cartridge. 20. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a heating element mounted within the cartridge for heating a solid inhalant and
a gauge mounted on said cartridge; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. | A compact modular multifunctional inhalation device including a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a tray within the cartridge for holding a solid inhalant, a heating element mounted within the cartridge above and through the tray for heating the inhalant; and a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. The heating element is a coil mounted within a chamber in thermal proximity to the solid inhalant. A quartz rod is mounted within the coil. A plunger is mounted within the cartridge to translate therein and compact the solid inhalant. In an alternative embodiment, dual channels and outlet ports are mounted in communication with an inlet port. In another embodiment, the cartridge is a split chamber cartridge with a split plunger mounted therein. Yet another embodiment features a measurement glass cover gauge mounted on the cartridge.1. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a tray within the cartridge for retaining a solid inhalant and a heating element mounted within the cartridge above and through the tray for heating the inhalant; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. 2. The device of claim 1 wherein said heating element is a coil of metal or ceramic having 2-13 loops and a diameter of 1.3 mm-3.5 mm. 3. The device of claim 2 wherein said coil is mounted within a chamber in thermal proximity to said solid inhalant. 4. The device of claim 3 further including a quartz rod mounted within said coil. 5. The device of claim 1 further including a plunger adapted to translate within said cartridge. 6. The device of claim 5 further including an air inlet port mounted on said cartridge, a vapor outlet port mounted within said plunger and a channel therebetween mounted within said plunger. 7. The device of claim 6 further including dual channels and outlet ports mounted within said in communication with said inlet port. 8. The device of claim 1 wherein said cartridge is a split chamber cartridge. 9. The device of claim 8 further including a split plunger mounted within said split chamber cartridge. 10. The device of claim 1 further including a gauge mounted on said cartridge. 11. The device of claim 10 wherein said cartridge is at least partially transparent. 12. The device of claim 11 wherein said gauge is a measurement glass cover gauge. 13. The device of claim 1 further including a draw strength switch. 14. The device of claim 13 further including an arrangement for changing the temperature of said coil in response to said draw strength switch. 15. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a heating element mounted within the cartridge for heating a solid inhalant and
a plunger adapted to translate the inhalant within the cartridge; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. 16. The device of claim 15 further including an air inlet port mounted on said cartridge, a vapor outlet port mounted within said plunger and a channel therebetween mounted within said plunger. 17. The device of claim 16 further including dual channels and outlet ports mounted within said in communication with said inlet port. 18. The device of claim 1 wherein said cartridge is a split chamber cartridge. 19. The device of claim 18 further including a split plunger mounted within said split chamber cartridge. 20. A compact modular multifunctional inhalation device comprising:
a housing having an inlet port and an outlet port; a removable cartridge module adapted to seat within the housing, the cartridge including: a heating element mounted within the cartridge for heating a solid inhalant and
a gauge mounted on said cartridge; and
a removable modular electronic circuit adapted to seat within the housing to provide electrical current to the heating element. | 3,700 |
348,693 | 16,806,171 | 3,783 | A network port connector ejection system includes a computing device connector that is connected to a network port connector. A retention device in the network port connector ejection system is configured to engage the network port connector to secure the network port connector to the computing device connector. A retention device release subsystem in the network port connector ejection system is coupled to the retention device and is configured to be actuated to release the retention device from engagement with the network port connector. A network port connector ejection subsystem in the network port connector ejection system is configured to engage the network port connector, while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, to disconnect the network port connector from the computing device connector. | 1. A network port connector ejection system, comprising:
a computing device connector that is configured to connect to a network port connector; a retention device that is configured to engage the network port connector to secure the network port connector to the computing device connector; a retention device release subsystem that is coupled to the retention device and that is configured, in response to receiving an instruction to disconnect the network port connector from the computing device connector, to be actuated to release the retention device from engagement with the network port connector; and a network port connector ejection subsystem that is configured, in response to the receiving the instruction to disconnect the network port connector from the computing device connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, to engage the network port connector to disconnect the network port connector from the computing device connector. 2. The system of claim 1, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 3. The system of claim 1, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 4. The system of claim 1, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 5. The system of claim 1, further comprising:
a communication system coupled to the retention device release subsystem and the network port connector ejection subsystem, wherein the retention device release subsystem is configured to be actuated and the network port connector ejection subsystem is configured to engage the network port connector in response to instructions received through a network via the communication system. 6. The system of claim 1, wherein the network port connector is an Ethernet cable connector. 7. An Information Handling System (IHS), comprising:
a processing system; and a memory system that is coupled to the processing system and that includes instructions that, when executed by the processing system, cause the processing system to provide a network port connector ejection engine that is configured to:
receive an instruction to eject a network port connector that is connected to a computing device connector;
actuate, in response to receiving the instruction to eject the network port connector, a retention device release subsystem that is coupled to a retention device to release the retention device from engagement with the network port connector; and
actuate, in response to receiving the instruction to eject the network port connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, a network port connector ejection subsystem to engage the network port connection ejection subsystem with the network port connector to disconnect the network port connector from the computing device connector. 8. The IHS of claim 7, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 9. The IHS of claim 7, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 10. The IHS of claim 7, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 11. The IHS of claim 7, further comprising:
a communication system coupled to the network port connector ejection engine, wherein the network port connector ejection engine is configured to actuate the retention device release subsystem and the network port connector ejection subsystem in response to instructions received through a network via the communication system. 12. The IHS of claim 7, wherein the network port connector is an Ethernet cable connector. 13. The IHS of claim 12, wherein the retention device release subsystem is configured to engage the Ethernet cable connector to release the retention device from engagement with the Ethernet cable connector. 14. A method for ejecting a network port connector, comprising:
receiving, by a computing device, an instruction to eject a network port connector that is connected to a computing device connector; actuating, by the computing device in response to receiving the instruction to eject the network port connector, a retention device release subsystem that is coupled to a retention device to release the retention device from engagement with the network port connector; and actuating, by the computing device in response to receiving the instruction to eject the network port connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, a network port connector ejection subsystem to engage the network port connection ejection subsystem with the network port connector to disconnect the network port connector from the computing device connector. 15. The method of claim 14, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 16. The method of claim 14, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 17. The method of claim 14, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 18. The method of claim 14, further comprising:
receiving, by the computing device through a network via a communication system, instructions to actuate the retention device release subsystem and the network port connector ejection subsystem. 19. The method of claim 14, wherein the network port connector is an Ethernet cable connector. 20. The method of claim 19, wherein the retention device release subsystem is configured to engage the Ethernet cable connector to release the retention device from engagement with the Ethernet cable connector. | A network port connector ejection system includes a computing device connector that is connected to a network port connector. A retention device in the network port connector ejection system is configured to engage the network port connector to secure the network port connector to the computing device connector. A retention device release subsystem in the network port connector ejection system is coupled to the retention device and is configured to be actuated to release the retention device from engagement with the network port connector. A network port connector ejection subsystem in the network port connector ejection system is configured to engage the network port connector, while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, to disconnect the network port connector from the computing device connector.1. A network port connector ejection system, comprising:
a computing device connector that is configured to connect to a network port connector; a retention device that is configured to engage the network port connector to secure the network port connector to the computing device connector; a retention device release subsystem that is coupled to the retention device and that is configured, in response to receiving an instruction to disconnect the network port connector from the computing device connector, to be actuated to release the retention device from engagement with the network port connector; and a network port connector ejection subsystem that is configured, in response to the receiving the instruction to disconnect the network port connector from the computing device connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, to engage the network port connector to disconnect the network port connector from the computing device connector. 2. The system of claim 1, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 3. The system of claim 1, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 4. The system of claim 1, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 5. The system of claim 1, further comprising:
a communication system coupled to the retention device release subsystem and the network port connector ejection subsystem, wherein the retention device release subsystem is configured to be actuated and the network port connector ejection subsystem is configured to engage the network port connector in response to instructions received through a network via the communication system. 6. The system of claim 1, wherein the network port connector is an Ethernet cable connector. 7. An Information Handling System (IHS), comprising:
a processing system; and a memory system that is coupled to the processing system and that includes instructions that, when executed by the processing system, cause the processing system to provide a network port connector ejection engine that is configured to:
receive an instruction to eject a network port connector that is connected to a computing device connector;
actuate, in response to receiving the instruction to eject the network port connector, a retention device release subsystem that is coupled to a retention device to release the retention device from engagement with the network port connector; and
actuate, in response to receiving the instruction to eject the network port connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, a network port connector ejection subsystem to engage the network port connection ejection subsystem with the network port connector to disconnect the network port connector from the computing device connector. 8. The IHS of claim 7, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 9. The IHS of claim 7, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 10. The IHS of claim 7, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 11. The IHS of claim 7, further comprising:
a communication system coupled to the network port connector ejection engine, wherein the network port connector ejection engine is configured to actuate the retention device release subsystem and the network port connector ejection subsystem in response to instructions received through a network via the communication system. 12. The IHS of claim 7, wherein the network port connector is an Ethernet cable connector. 13. The IHS of claim 12, wherein the retention device release subsystem is configured to engage the Ethernet cable connector to release the retention device from engagement with the Ethernet cable connector. 14. A method for ejecting a network port connector, comprising:
receiving, by a computing device, an instruction to eject a network port connector that is connected to a computing device connector; actuating, by the computing device in response to receiving the instruction to eject the network port connector, a retention device release subsystem that is coupled to a retention device to release the retention device from engagement with the network port connector; and actuating, by the computing device in response to receiving the instruction to eject the network port connector, following the actuation of the retention device release subsystem, and while the retention device release subsystem is actuated to release the retention device from engagement with the network port connector, a network port connector ejection subsystem to engage the network port connection ejection subsystem with the network port connector to disconnect the network port connector from the computing device connector. 15. The method of claim 14, wherein the network port connector is a Small Form-factor Pluggable (SFP) transceiver device. 16. The method of claim 14, wherein the retention device includes a metal material, and wherein the retention device release subsystem includes an electromagnet device that is configured to attract the metal material in the retention device to cause the retention device to move and release from engagement with the network port connector. 17. The method of claim 14, wherein the network port connector ejection subsystem includes a solenoid device having a network port connector engagement member that is configured, when the network port connector ejection system is actuated, to engage the network port connector to disconnect the network port connector from the computing device connector. 18. The method of claim 14, further comprising:
receiving, by the computing device through a network via a communication system, instructions to actuate the retention device release subsystem and the network port connector ejection subsystem. 19. The method of claim 14, wherein the network port connector is an Ethernet cable connector. 20. The method of claim 19, wherein the retention device release subsystem is configured to engage the Ethernet cable connector to release the retention device from engagement with the Ethernet cable connector. | 3,700 |
348,694 | 16,806,144 | 3,783 | The present disclosure provides wearable electronic devices with thermoelectric devices. The wearable electronic device may comprise a user interface for displaying information to a user. The thermoelectric device may comprise a heat collecting unit, a thermoelectric element, and a heat expelling unit. During use, the thermoelectric element may generate power upon the flow of thermal energy from the heat collecting unit, across the thermoelectric element, and to the heat expelling unit. | 1. A wearable electronic device, comprising:
an electronic display with a user interface for displaying information to a user; and a power management unit operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element, wherein, during use, said thermoelectric element generates power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 2. The wearable electronic device of claim 1, wherein said wearable electronic device is integrated with said power management unit. 3. The wearable electronic device of claim 1, wherein said power management unit provides at least about 10% of a power requirement of said wearable electronic device. 4. The wearable electronic device of claim 1, wherein said power management unit provides at least about 20% of a power requirement of said wearable electronic device. 5. The wearable electronic device of claim 1, wherein said power management unit provides at least about 30% of a power requirement of said wearable electronic device. 6. The wearable electronic device of claim 1, wherein said power management unit provides at least about 40% of a power requirement of said wearable electronic device. 7. The wearable electronic device of claim 1, wherein said power management unit provides at least about 60% of a power requirement of said wearable electronic device. 8. The wearable electronic device of claim 1, wherein said power management unit provides at least about 80% of a power requirement of said wearable electronic device. 9. The wearable electronic device of claim 1, wherein said power management unit further comprises an external power unit for providing external power to charge said energy storage device. 10. The wearable electronic device of claim 1, further comprising a casing containing said electronic display and said power management unit. 11. The wearable electronic device of claim 10, wherein said heat expelling unit is at a side portion of said casing. 12. The wearable electronic device of claim 10, wherein said casing is in thermal communication with said heat collecting unit. 13. The wearable electronic device of claim 10, wherein said casing is in thermal communication with said heat expelling unit. 14. The wearable electronic device of claim 10, wherein said casing is in thermal communication with both of said heat collecting unit and said heat expelling unit. 15. The wearable electronic device of claim 10, wherein said casing is substantially waterproof or water resistant. 16. The wearable electronic device of claim 10, wherein said casing comprises lugs. 17. The wearable electronic device of claim 16, wherein said lugs are in thermal communication with said heat expelling unit. 18. The wearable electronic device of claim 16, wherein said lugs dissipate heat. 19. The wearable electronic device of claim 16, wherein said lugs do not dissipate heat. 20. The wearable electronic device of claim 10, wherein said casing further comprises a bottom subassembly. 21. The wearable electronic device of claim 20, wherein said bottom subassembly comprises a conductive plate. 22. The wearable electronic device of claim 20, wherein said bottom subassembly comprises said thermoelectric element. 23. The wearable electronic device of claim 20, wherein said bottom subassembly comprises a conductive backing. 24. The wearable electronic device of claim 23, wherein during use said conductive backing is in thermal communication with said body of said user. 25. The wearable electronic device of claim 20, wherein said bottom subassembly snaps into said casing. 26. The wearable electronic device of claim 20, wherein said bottom subassembly comprises threads and wherein said bottom subassembly threads into said casing. 27. The wearable electronic device of claim 26, wherein said threads are thermally conductive. 28. The wearable electronic device of claim 1, wherein said heat expelling unit includes one or more heat sinks. 29. The wearable electronic device of claim 28, wherein said one or more heat sinks are heat fins. 30. The wearable electronic device of claim 1, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by at least one heat pipe. 31. The wearable electronic device of claim 1, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by a heat spreader plate. 32. The wearable electronic device of claim 1, further comprising a control unit operatively coupled to said electronic display and said power management unit, wherein said control unit regulates display of said information on said user interface. 33. The wearable electronic device of claim 1, wherein said wearable electronic device is a watch. 34. The wearable electronic device of claim 1, wherein said user interface is a graphical user interface. 35. The wearable electronic device of claim 1, wherein said user interface is an analog user interface. 36. The wearable electronic device of claim 1, wherein said power management unit is included in a clasp that secures said electronic display to said body surface of said user. 37. The wearable electronic device of claim 1, further comprising a flexible circuit operatively coupled and in electrical communication with said electronic display and said power management unit. 38. The wearable electronic device of claim 37, wherein said flexible circuit is a flexible printed circuit. 39. The wearable electronic device of claim 37, wherein said flexible circuit is a flexible-flat cable. 40. The wearable electronic device of claim 1, further comprising one or more power generation units in electrical communication with said energy store device. 41. The wearable electronic device of claim 40, wherein said one or more power generation units are selected from the group consisting of a solar cell, an inductive coupling unit, a radio frequency coupling unit, and a kinetic power generation unit. 42. A method for using a wearable electronic device, comprising:
(a) activating said wearable electronic device comprising:
a. an electronic display with a user interface for displaying information to a user; and
b. a power management unit operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element;
(b) using said thermoelectric element to generate power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 43. The method of claim 42, wherein said wearable electronic device is integrated with said power management unit. 44. The method of claim 42, wherein said power management unit provides at least about 10% of a power requirement of said wearable electronic device. 45. The method of claim 42, wherein said power management unit provides at least about 20% of a power requirement of said wearable electronic device. 46. The method of claim 42, wherein said power management unit provides at least about 30% of a power requirement of said wearable electronic device. 47. The method of claim 42, wherein said power management unit provides at least about 40% of a power requirement of said wearable electronic device. 48. The method of claim 42, wherein said power management unit provides at least about 60% of a power requirement of said wearable electronic device. 49. The method of claim 42, wherein said power management unit provides at least about 80% of a power requirement of said wearable electronic device. 50. The method of claim 42, wherein said power management unit further comprises an external power unit for providing external power to charge said energy storage device. 51. The method of claim 42, wherein said wearable electronic device comprises a casing containing said electronic display and said power management unit. 52. The method of claim 51, wherein said heat expelling unit is at a side portion of said casing. 53. The method of claim 51, wherein said casing is in thermal communication with said heat collecting unit. 54. The method of claim 51, wherein said casing is in thermal communication with said heat expelling unit. 55. The method of claim 51, wherein said casing is in thermal communication with both of said heat collecting unit and said heat expelling unit. 56. The method of claim 51, wherein said casing is substantially waterproof or water resistant. 57. The method of claim 51, wherein said casing comprises lugs. 58. The method of claim 57, wherein said lugs are in thermal communication with said heat expelling unit. 59. The method of claim 57, wherein said lugs dissipate heat. 60. The method of claim 57, wherein said lugs do not dissipate heat. 61. The method of claim 51, wherein said casing further comprises a bottom subassembly. 62. The method of claim 61, wherein said bottom subassembly comprises a conductive plate. 63. The method of claim 61, wherein said bottom subassembly comprises said thermoelectric element. 64. The method of claim 61, wherein said bottom subassembly comprises a conductive backing. 65. The method of claim 62, wherein during use said conductive backing is in thermal communication with said body of said user. 66. The method of claim 61, wherein said bottom subassembly snaps into said casing. 67. The method of claim 61, wherein said bottom subassembly comprises threads and wherein said bottom subassembly threads into said casing. 68. The method of claim 67, wherein said threads are thermally conductive. 69. The method of claim 42, wherein said heat expelling unit includes one or more heat sinks. 70. The method of claim 69, wherein said one or more heat sinks are heat fins. 71. The method of claim 42, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by at least one heat pipe. 72. The method of claim 42, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by a heat spreader plate. 73. The method of claim 42, wherein said wearable electronic device comprises a control unit operatively coupled to said electronic display and said power management unit, wherein said control unit regulates display of said information on said user interface. 74. The method of claim 42, wherein said wearable electronic device is a watch. 75. The method of claim 42, wherein said user interface is a graphical user interface. 76. The method of claim 42, wherein said user interface is an analog user interface. 77. The method of claim 42, wherein said power management unit is included in a clasp that secures said electronic display to said body surface of said user. 78. The method of claim 42, wherein said wearable electronic device comprises a flexible circuit operatively coupled and in electrical communication with said electronic display and said power management unit. 79. The method of claim 78, wherein said flexible circuit is a flexible printed circuit. 80. The method of claim 78, wherein said flexible circuit is a flexible-flat cable. 81. The method of claim 42, wherein the wearable electronic device further comprises one or more power generation units in electrical communication with said energy store device. 82. The method of claim 81, wherein said one or more power generation units are selected from the group consisting of a solar cell, an inductive coupling unit, a radio frequency coupling unit, and a kinetic power generation unit. 83. A method for manufacturing a wearable electronic device, comprising (i) assembling an electronic display with a user interface for displaying information to a user, and (ii) assembling a power management unit to yield said wearable electronic device,
wherein said power management unit is operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element, wherein said wearable device is configured such that during use, said thermoelectric element generates power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 84. The method of claim 83, wherein said wearable electronic device comprises a casing containing said electronic display and said power management unit. 85. The method of claim 84, wherein said casing comprises a top side and a bottom side and wherein said electronic display is disposed adjacent to said top side of said casing. 86. The method of claim 84, wherein said electronic display and said power management unit are loaded into said casing from said top side of said casing. 87. The method of claim 84, wherein said electronic display and said power management unit are loaded into said casing from said bottom side of said casing. | The present disclosure provides wearable electronic devices with thermoelectric devices. The wearable electronic device may comprise a user interface for displaying information to a user. The thermoelectric device may comprise a heat collecting unit, a thermoelectric element, and a heat expelling unit. During use, the thermoelectric element may generate power upon the flow of thermal energy from the heat collecting unit, across the thermoelectric element, and to the heat expelling unit.1. A wearable electronic device, comprising:
an electronic display with a user interface for displaying information to a user; and a power management unit operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element, wherein, during use, said thermoelectric element generates power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 2. The wearable electronic device of claim 1, wherein said wearable electronic device is integrated with said power management unit. 3. The wearable electronic device of claim 1, wherein said power management unit provides at least about 10% of a power requirement of said wearable electronic device. 4. The wearable electronic device of claim 1, wherein said power management unit provides at least about 20% of a power requirement of said wearable electronic device. 5. The wearable electronic device of claim 1, wherein said power management unit provides at least about 30% of a power requirement of said wearable electronic device. 6. The wearable electronic device of claim 1, wherein said power management unit provides at least about 40% of a power requirement of said wearable electronic device. 7. The wearable electronic device of claim 1, wherein said power management unit provides at least about 60% of a power requirement of said wearable electronic device. 8. The wearable electronic device of claim 1, wherein said power management unit provides at least about 80% of a power requirement of said wearable electronic device. 9. The wearable electronic device of claim 1, wherein said power management unit further comprises an external power unit for providing external power to charge said energy storage device. 10. The wearable electronic device of claim 1, further comprising a casing containing said electronic display and said power management unit. 11. The wearable electronic device of claim 10, wherein said heat expelling unit is at a side portion of said casing. 12. The wearable electronic device of claim 10, wherein said casing is in thermal communication with said heat collecting unit. 13. The wearable electronic device of claim 10, wherein said casing is in thermal communication with said heat expelling unit. 14. The wearable electronic device of claim 10, wherein said casing is in thermal communication with both of said heat collecting unit and said heat expelling unit. 15. The wearable electronic device of claim 10, wherein said casing is substantially waterproof or water resistant. 16. The wearable electronic device of claim 10, wherein said casing comprises lugs. 17. The wearable electronic device of claim 16, wherein said lugs are in thermal communication with said heat expelling unit. 18. The wearable electronic device of claim 16, wherein said lugs dissipate heat. 19. The wearable electronic device of claim 16, wherein said lugs do not dissipate heat. 20. The wearable electronic device of claim 10, wherein said casing further comprises a bottom subassembly. 21. The wearable electronic device of claim 20, wherein said bottom subassembly comprises a conductive plate. 22. The wearable electronic device of claim 20, wherein said bottom subassembly comprises said thermoelectric element. 23. The wearable electronic device of claim 20, wherein said bottom subassembly comprises a conductive backing. 24. The wearable electronic device of claim 23, wherein during use said conductive backing is in thermal communication with said body of said user. 25. The wearable electronic device of claim 20, wherein said bottom subassembly snaps into said casing. 26. The wearable electronic device of claim 20, wherein said bottom subassembly comprises threads and wherein said bottom subassembly threads into said casing. 27. The wearable electronic device of claim 26, wherein said threads are thermally conductive. 28. The wearable electronic device of claim 1, wherein said heat expelling unit includes one or more heat sinks. 29. The wearable electronic device of claim 28, wherein said one or more heat sinks are heat fins. 30. The wearable electronic device of claim 1, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by at least one heat pipe. 31. The wearable electronic device of claim 1, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by a heat spreader plate. 32. The wearable electronic device of claim 1, further comprising a control unit operatively coupled to said electronic display and said power management unit, wherein said control unit regulates display of said information on said user interface. 33. The wearable electronic device of claim 1, wherein said wearable electronic device is a watch. 34. The wearable electronic device of claim 1, wherein said user interface is a graphical user interface. 35. The wearable electronic device of claim 1, wherein said user interface is an analog user interface. 36. The wearable electronic device of claim 1, wherein said power management unit is included in a clasp that secures said electronic display to said body surface of said user. 37. The wearable electronic device of claim 1, further comprising a flexible circuit operatively coupled and in electrical communication with said electronic display and said power management unit. 38. The wearable electronic device of claim 37, wherein said flexible circuit is a flexible printed circuit. 39. The wearable electronic device of claim 37, wherein said flexible circuit is a flexible-flat cable. 40. The wearable electronic device of claim 1, further comprising one or more power generation units in electrical communication with said energy store device. 41. The wearable electronic device of claim 40, wherein said one or more power generation units are selected from the group consisting of a solar cell, an inductive coupling unit, a radio frequency coupling unit, and a kinetic power generation unit. 42. A method for using a wearable electronic device, comprising:
(a) activating said wearable electronic device comprising:
a. an electronic display with a user interface for displaying information to a user; and
b. a power management unit operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element;
(b) using said thermoelectric element to generate power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 43. The method of claim 42, wherein said wearable electronic device is integrated with said power management unit. 44. The method of claim 42, wherein said power management unit provides at least about 10% of a power requirement of said wearable electronic device. 45. The method of claim 42, wherein said power management unit provides at least about 20% of a power requirement of said wearable electronic device. 46. The method of claim 42, wherein said power management unit provides at least about 30% of a power requirement of said wearable electronic device. 47. The method of claim 42, wherein said power management unit provides at least about 40% of a power requirement of said wearable electronic device. 48. The method of claim 42, wherein said power management unit provides at least about 60% of a power requirement of said wearable electronic device. 49. The method of claim 42, wherein said power management unit provides at least about 80% of a power requirement of said wearable electronic device. 50. The method of claim 42, wherein said power management unit further comprises an external power unit for providing external power to charge said energy storage device. 51. The method of claim 42, wherein said wearable electronic device comprises a casing containing said electronic display and said power management unit. 52. The method of claim 51, wherein said heat expelling unit is at a side portion of said casing. 53. The method of claim 51, wherein said casing is in thermal communication with said heat collecting unit. 54. The method of claim 51, wherein said casing is in thermal communication with said heat expelling unit. 55. The method of claim 51, wherein said casing is in thermal communication with both of said heat collecting unit and said heat expelling unit. 56. The method of claim 51, wherein said casing is substantially waterproof or water resistant. 57. The method of claim 51, wherein said casing comprises lugs. 58. The method of claim 57, wherein said lugs are in thermal communication with said heat expelling unit. 59. The method of claim 57, wherein said lugs dissipate heat. 60. The method of claim 57, wherein said lugs do not dissipate heat. 61. The method of claim 51, wherein said casing further comprises a bottom subassembly. 62. The method of claim 61, wherein said bottom subassembly comprises a conductive plate. 63. The method of claim 61, wherein said bottom subassembly comprises said thermoelectric element. 64. The method of claim 61, wherein said bottom subassembly comprises a conductive backing. 65. The method of claim 62, wherein during use said conductive backing is in thermal communication with said body of said user. 66. The method of claim 61, wherein said bottom subassembly snaps into said casing. 67. The method of claim 61, wherein said bottom subassembly comprises threads and wherein said bottom subassembly threads into said casing. 68. The method of claim 67, wherein said threads are thermally conductive. 69. The method of claim 42, wherein said heat expelling unit includes one or more heat sinks. 70. The method of claim 69, wherein said one or more heat sinks are heat fins. 71. The method of claim 42, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by at least one heat pipe. 72. The method of claim 42, wherein thermal communication between said thermoelectric element and said heat expelling unit is provided by a heat spreader plate. 73. The method of claim 42, wherein said wearable electronic device comprises a control unit operatively coupled to said electronic display and said power management unit, wherein said control unit regulates display of said information on said user interface. 74. The method of claim 42, wherein said wearable electronic device is a watch. 75. The method of claim 42, wherein said user interface is a graphical user interface. 76. The method of claim 42, wherein said user interface is an analog user interface. 77. The method of claim 42, wherein said power management unit is included in a clasp that secures said electronic display to said body surface of said user. 78. The method of claim 42, wherein said wearable electronic device comprises a flexible circuit operatively coupled and in electrical communication with said electronic display and said power management unit. 79. The method of claim 78, wherein said flexible circuit is a flexible printed circuit. 80. The method of claim 78, wherein said flexible circuit is a flexible-flat cable. 81. The method of claim 42, wherein the wearable electronic device further comprises one or more power generation units in electrical communication with said energy store device. 82. The method of claim 81, wherein said one or more power generation units are selected from the group consisting of a solar cell, an inductive coupling unit, a radio frequency coupling unit, and a kinetic power generation unit. 83. A method for manufacturing a wearable electronic device, comprising (i) assembling an electronic display with a user interface for displaying information to a user, and (ii) assembling a power management unit to yield said wearable electronic device,
wherein said power management unit is operatively coupled with said electronic display, wherein said power management unit comprises an energy storage device and at least one thermoelectric device in electrical communication with said energy storage device, wherein said thermoelectric device comprises (i) a heat collecting unit that rests adjacent to a body surface of said user, which heat collecting unit collects thermal energy from said body surface of said user, (ii) a thermoelectric element in thermal communication with said heat collecting unit, and (iii) a heat expelling unit in thermal communication with said thermoelectric element, which heat expelling unit expels thermal energy from said thermoelectric element, wherein said wearable device is configured such that during use, said thermoelectric element generates power upon flow of thermal energy from said heat collecting unit, across said thermoelectric element and to said heat expelling unit, wherein at least a portion of said power is stored in said energy storage device. 84. The method of claim 83, wherein said wearable electronic device comprises a casing containing said electronic display and said power management unit. 85. The method of claim 84, wherein said casing comprises a top side and a bottom side and wherein said electronic display is disposed adjacent to said top side of said casing. 86. The method of claim 84, wherein said electronic display and said power management unit are loaded into said casing from said top side of said casing. 87. The method of claim 84, wherein said electronic display and said power management unit are loaded into said casing from said bottom side of said casing. | 3,700 |
348,695 | 16,806,197 | 3,783 | Described are methods comprises transducing a mammalian cell with one or more virus vectors. Each vector comprises a nucleic acid sequence encoding a Cpf1 (also known as Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof; and a CRISPR RNA (crRNA) array comprising at least two spacers in operative association with an RNA pol III promoter. Each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a genomic region of interest. The method further comprises culturing the transduced cells, thereby providing a plurality of cultured cell cultures, each cell culture comprising said deletion. Additionally, described are compositions used in methods as well as libraries generated by the methods. Such compositions comprise libraries of transduced cell cultures, viral vectors, nucleic acid sequences, CRISPR RNA spacers, and RNA guides, as described herein. | 1. An in vitro method comprising:
transducing a mammalian cell with one or more virus vectors, each vector comprising (i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and (ii) a CRISPR RNA (crRNA) array comprising at least two spacers, wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter; and culturing said transduced cells, wherein in the cultured cells, the Cpf1 (Cas12a) creates a deletion comprising the chromosome or genome between cleavage sites located downstream of each the PAM, thereby providing a plurality of transduced cell cultures, each cell culture comprising said deletion. 2. The method according to claim 1, wherein the viral vector is a retroviral vector. 3. The method according to claim 1, wherein the viral vector is a lentiviral vector or an adeno-associated virus (AAV). 4. The method according to claim 1, wherein said crRNA array comprises between two to ten said spacers. 5. The method according to claim 1, wherein a direct repeat sequence separates each spacer in the crRNA array. 6. The method according to claim 5, wherein at least one direct repeat is an engineered optimized repeat. 7. The method according to claim 6, wherein the optimized repeat comprises a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 8. The method according to claim 6, wherein the optimized repeat consists of a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 9. The method according to claim 1, further comprising prior to the transducing step
generating a library of CRISPR RNA (crRNA) spacers, wherein each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian, and wherein each crRNA guide hybridizes to a protospacer that is unique as compared to that of any other crRNA in the library. 10. The method according to claim 1, further comprising prior to the transducing step:
generating a library of virus vectors, each vector comprising (i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and a selectable marker in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and (ii) a CRISPR RNA (crRNA) array comprising at least two spacers, wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter. 11. The method according to claim 1, further comprising harvesting genomic DNA from each cell culture to identify or quantify the deletion. 12. The method according to claim 1, wherein the Cpf1 (Cas12a) cleavage sites for any two crRNA spacers are spaced apart in contiguous sequence of the genome or chromosome by about 100 bp to about 1 mb. 13. The method according to claim 1, wherein the deletion occurs in a non-coding sequence of said genome or chromosome. 14. The method according to claim 1, wherein the deletion occurs in a coding sequence of said genome or chromosome. 15. The method according to claim 1, wherein the culturing step occurs for between more than two and less than 30 days. 16. The method according to claim 1, further comprising identifying or quantifying the effects of said deletion on the cell. 17. The method according to claim 1, further comprising identifying or quantifying a phenotypic change of the transfected cell cultures. 18. The method according to claim 1, further comprising identifying or quantifying response of the transfected cell cultures to a treatment. 19. The method according to claim 18, wherein the treatment comprises contact of the cultured cells to a chemical or biological agent or compound, or exposure to a physical treatment. 20. The method according to claim 19, wherein said treatment comprises contact of the cells with a chemical compound and the effect or change is demonstrated a change in response to the compound in the transduced cultured cells compared to the response exhibited by the cell culture without the deletion. 21. A library of mammalian cell cultures, wherein each cell of the cell culture comprises at least one deletion in a contiguous DNA of a chromosome or the genome, and wherein the library is generated by the method of claim 1. 22. The library according to claim 21, wherein the cell is a eukaryotic cell, a prokaryotic cell, a mammalian cell, an embryonic stem cell, or a cancer cell. 23. A library of nucleic acid sequences, comprising at least two CRISPR RNA spacers (crRNAs), wherein each spacer encodes an RNA guide which hybridizes to a unique protospacer sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, wherein the crRNA guides are capable of complexing with Cpf1 (Cas12a) protein and providing targeting specificity and binding ability for nuclease activity of Cpf1, and wherein each of the spacers is adjacent to an optimized Direct Repeat at the 5′ end thereof. 24. The library according to claim 23, wherein the optimized Direct Repeats comprise a nucleic acid sequence of TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 25. The library according to claim 23, wherein the crRNA guide targets every Cpf1 (Cas12a)-specific protospacer in a contiguous region of genome or chromosome of a cell. 26. The library according to claim 23, wherein the crRNA guide targets at least about 100, about 1000, about 10,000, about 100,000, about 1,000,000 or more sequences in a genome or chromosome of the cell. 27. A library of vectors, wherein each vector comprises two or more spacers from the library according to claim 23. 28. A library comprising Cpf1 (Cas12a)-guide vectors, wherein each of the Cpf1 (Cas12a)-guide vectors comprises:
(a) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and an optional selectable marker in operative association with regulatory sequences which controls expression thereof; and (b) two or more spacers from the library according to claim 23, wherein each of the spacers is adjacent to a direct Repeat at the 5′ end thereof. 29. The library according to claim 28, wherein the library comprising at least 75% of the Cpf1 (Cas12a)-guide vectors. | Described are methods comprises transducing a mammalian cell with one or more virus vectors. Each vector comprises a nucleic acid sequence encoding a Cpf1 (also known as Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof; and a CRISPR RNA (crRNA) array comprising at least two spacers in operative association with an RNA pol III promoter. Each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a genomic region of interest. The method further comprises culturing the transduced cells, thereby providing a plurality of cultured cell cultures, each cell culture comprising said deletion. Additionally, described are compositions used in methods as well as libraries generated by the methods. Such compositions comprise libraries of transduced cell cultures, viral vectors, nucleic acid sequences, CRISPR RNA spacers, and RNA guides, as described herein.1. An in vitro method comprising:
transducing a mammalian cell with one or more virus vectors, each vector comprising (i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and an optional selectable marker in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and (ii) a CRISPR RNA (crRNA) array comprising at least two spacers, wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter; and culturing said transduced cells, wherein in the cultured cells, the Cpf1 (Cas12a) creates a deletion comprising the chromosome or genome between cleavage sites located downstream of each the PAM, thereby providing a plurality of transduced cell cultures, each cell culture comprising said deletion. 2. The method according to claim 1, wherein the viral vector is a retroviral vector. 3. The method according to claim 1, wherein the viral vector is a lentiviral vector or an adeno-associated virus (AAV). 4. The method according to claim 1, wherein said crRNA array comprises between two to ten said spacers. 5. The method according to claim 1, wherein a direct repeat sequence separates each spacer in the crRNA array. 6. The method according to claim 5, wherein at least one direct repeat is an engineered optimized repeat. 7. The method according to claim 6, wherein the optimized repeat comprises a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 8. The method according to claim 6, wherein the optimized repeat consists of a nucleic acid sequence, TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 9. The method according to claim 1, further comprising prior to the transducing step
generating a library of CRISPR RNA (crRNA) spacers, wherein each spacer encodes an RNA guide which hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian, and wherein each crRNA guide hybridizes to a protospacer that is unique as compared to that of any other crRNA in the library. 10. The method according to claim 1, further comprising prior to the transducing step:
generating a library of virus vectors, each vector comprising (i) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and a selectable marker in operative association with an RNA pol II promoter which controls expression thereof, in a mammalian cell; and (ii) a CRISPR RNA (crRNA) array comprising at least two spacers, wherein each spacer encodes an RNA guide, wherein each guide hybridizes to a unique sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, said array in operative association with an RNA pol III promoter. 11. The method according to claim 1, further comprising harvesting genomic DNA from each cell culture to identify or quantify the deletion. 12. The method according to claim 1, wherein the Cpf1 (Cas12a) cleavage sites for any two crRNA spacers are spaced apart in contiguous sequence of the genome or chromosome by about 100 bp to about 1 mb. 13. The method according to claim 1, wherein the deletion occurs in a non-coding sequence of said genome or chromosome. 14. The method according to claim 1, wherein the deletion occurs in a coding sequence of said genome or chromosome. 15. The method according to claim 1, wherein the culturing step occurs for between more than two and less than 30 days. 16. The method according to claim 1, further comprising identifying or quantifying the effects of said deletion on the cell. 17. The method according to claim 1, further comprising identifying or quantifying a phenotypic change of the transfected cell cultures. 18. The method according to claim 1, further comprising identifying or quantifying response of the transfected cell cultures to a treatment. 19. The method according to claim 18, wherein the treatment comprises contact of the cultured cells to a chemical or biological agent or compound, or exposure to a physical treatment. 20. The method according to claim 19, wherein said treatment comprises contact of the cells with a chemical compound and the effect or change is demonstrated a change in response to the compound in the transduced cultured cells compared to the response exhibited by the cell culture without the deletion. 21. A library of mammalian cell cultures, wherein each cell of the cell culture comprises at least one deletion in a contiguous DNA of a chromosome or the genome, and wherein the library is generated by the method of claim 1. 22. The library according to claim 21, wherein the cell is a eukaryotic cell, a prokaryotic cell, a mammalian cell, an embryonic stem cell, or a cancer cell. 23. A library of nucleic acid sequences, comprising at least two CRISPR RNA spacers (crRNAs), wherein each spacer encodes an RNA guide which hybridizes to a unique protospacer sequence located 3′ from a T-rich protospacer-adjacent motif (PAM) in a contiguous region of the genome or a chromosome of a mammalian cell, wherein the crRNA guides are capable of complexing with Cpf1 (Cas12a) protein and providing targeting specificity and binding ability for nuclease activity of Cpf1, and wherein each of the spacers is adjacent to an optimized Direct Repeat at the 5′ end thereof. 24. The library according to claim 23, wherein the optimized Direct Repeats comprise a nucleic acid sequence of TAATTTCTACTAAGTGTAGAT, SEQ ID NO: 7. 25. The library according to claim 23, wherein the crRNA guide targets every Cpf1 (Cas12a)-specific protospacer in a contiguous region of genome or chromosome of a cell. 26. The library according to claim 23, wherein the crRNA guide targets at least about 100, about 1000, about 10,000, about 100,000, about 1,000,000 or more sequences in a genome or chromosome of the cell. 27. A library of vectors, wherein each vector comprises two or more spacers from the library according to claim 23. 28. A library comprising Cpf1 (Cas12a)-guide vectors, wherein each of the Cpf1 (Cas12a)-guide vectors comprises:
(a) a nucleic acid sequence encoding a Cpf1 (Cas12a) protein and an optional selectable marker in operative association with regulatory sequences which controls expression thereof; and (b) two or more spacers from the library according to claim 23, wherein each of the spacers is adjacent to a direct Repeat at the 5′ end thereof. 29. The library according to claim 28, wherein the library comprising at least 75% of the Cpf1 (Cas12a)-guide vectors. | 3,700 |
348,696 | 16,806,206 | 3,783 | Methods of forming line-end extensions and devices having line-end extensions are provided. In some embodiments, a method includes forming a patterned photoresist on a first region of a hard mask layer. A line-end extension region is formed in the hard mask layer. The line-end extension region extends laterally outward from an end of the first region of the hard mask layer. The line-end extension region may be formed by changing a physical property of the hard mask layer at the line-end extension region. | 1. A method, comprising:
forming a patterned photoresist on a first region of a hard mask layer; and forming a line-end extension region in the hard mask layer, the line-end extension region extending laterally outward from an end of the first region of the hard mask layer, the forming the line-end extension region including changing a physical property of the hard mask layer at the line-end extension region. 2. The method of claim 1, further comprising:
removing the patterned photoresist; and exposing portions of a target layer by removing portions of the hard mask layer outside of the first region and the line-end extension region. 3. The method of claim 2, wherein the physical property of the hard mask layer includes a selectivity to an etchant gas, wherein the removing the portions of the hard mask layer includes removing the portions of the hard mask layer by etching the portions of the hard mask layer with the etchant gas. 4. The method of claim 2, further comprising:
removing the exposed portions of the target layer. 5. The method of claim 4, further comprising:
removing the first region and the line-end extension region of the hard mask layer. 6. The method of claim 1, wherein the forming the line-end extension region includes:
implanting a first concentration of ions in line-end extension region of the hard mask layer; and implanting a second concentration of ions in the hard mask layer outside of the line-end extension regions, the second concentration of ions being greater than the first concentration of ions. 7. The method of claim 1, wherein the forming a line-end extension region in the hard mask layer includes irradiating the hard mask layer with an ion beam, the ion beam having a non-zero ion beam angle with respect to a direction orthogonal to the hard mask layer. 8. The method of claim 7, wherein the ion beam angle is less than about 85°. 9. The method of claim 7, wherein the ion beam angle is greater than 30°. 10. The method of claim 7, wherein the ion beam angle is within a range from about 50° to about 80°. 11. The method of claim 7, wherein the ion beam includes ions formed of an element selected from the group including: nitrogen (N), tellurium (Te), boron (B), gallium (Ga), phosphorus (P), arsenic (As), argon (Ar), krypton (Kr), and xenon (Xe). 12. The method of claim 1, wherein a length of the line-end extension region is based at least partly on a height of the patterned photoresist. 13. The method of claim 12, wherein the height of the patterned photoresist is within a range from about 20 nm to about 50 nm. 14. A method, comprising:
forming a hard mask layer on a target layer, the target layer disposed between a substrate and the hard mask layer; forming a patterned photoresist on a plurality of first regions of the hard mask layer; forming a plurality of line-end extension regions extending outwardly from ends of the plurality of first regions by irradiating the hard mask layer with a plurality of ion beams each having a non-zero ion beam angle with respect to a direction orthogonal to the hard mask layer, the patterned photoresist blocking at least a portion of the plurality of ion beams from reaching the plurality of line-end extension regions; removing the patterned photoresist; exposing portions of the target layer by removing portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions; and forming a patterned feature in the target layer by removing the exposed portions of the target layer. 15. The method of claim 14, wherein the forming the plurality of line-end extension regions includes changing, by the irradiating the hard mask layer, a selectivity to an etchant gas in the plurality of line-end extension regions of the hard mask layer. 16. The method of claim 15, wherein the removing portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions includes exposing the hard mask layer to the etchant gas, the etchant gas having a lower selectivity to the plurality of line-end extension regions than to the portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions. 17. The method of claim 15, wherein the forming the plurality of line-end extension regions includes forming the plurality of line-end extension regions to have a length substantially equal to h×tan θ, wherein h is a height of the patterned photoresist and θ is the non-zero ion beam angle. 18. An integrated circuit, comprising:
a substrate; and a plurality of patterned features on the substrate, each of the plurality of patterned features formed of a same material, wherein a distance between an end of a first patterned feature of the plurality of features and an end of a second patterned feature of the plurality of patterned features is less than 25 nm. 19. The integrated circuit of claim 18, wherein the distance between the end of the first patterned feature and the end of the second patterned feature is less than 10 nm. 20. The integrated circuit of claim 18 wherein the plurality of patterned features includes at least one of: a semiconductor device feature, a polysilicon or metal gate, an electrically conductive trace, or an electrically conductive via. | Methods of forming line-end extensions and devices having line-end extensions are provided. In some embodiments, a method includes forming a patterned photoresist on a first region of a hard mask layer. A line-end extension region is formed in the hard mask layer. The line-end extension region extends laterally outward from an end of the first region of the hard mask layer. The line-end extension region may be formed by changing a physical property of the hard mask layer at the line-end extension region.1. A method, comprising:
forming a patterned photoresist on a first region of a hard mask layer; and forming a line-end extension region in the hard mask layer, the line-end extension region extending laterally outward from an end of the first region of the hard mask layer, the forming the line-end extension region including changing a physical property of the hard mask layer at the line-end extension region. 2. The method of claim 1, further comprising:
removing the patterned photoresist; and exposing portions of a target layer by removing portions of the hard mask layer outside of the first region and the line-end extension region. 3. The method of claim 2, wherein the physical property of the hard mask layer includes a selectivity to an etchant gas, wherein the removing the portions of the hard mask layer includes removing the portions of the hard mask layer by etching the portions of the hard mask layer with the etchant gas. 4. The method of claim 2, further comprising:
removing the exposed portions of the target layer. 5. The method of claim 4, further comprising:
removing the first region and the line-end extension region of the hard mask layer. 6. The method of claim 1, wherein the forming the line-end extension region includes:
implanting a first concentration of ions in line-end extension region of the hard mask layer; and implanting a second concentration of ions in the hard mask layer outside of the line-end extension regions, the second concentration of ions being greater than the first concentration of ions. 7. The method of claim 1, wherein the forming a line-end extension region in the hard mask layer includes irradiating the hard mask layer with an ion beam, the ion beam having a non-zero ion beam angle with respect to a direction orthogonal to the hard mask layer. 8. The method of claim 7, wherein the ion beam angle is less than about 85°. 9. The method of claim 7, wherein the ion beam angle is greater than 30°. 10. The method of claim 7, wherein the ion beam angle is within a range from about 50° to about 80°. 11. The method of claim 7, wherein the ion beam includes ions formed of an element selected from the group including: nitrogen (N), tellurium (Te), boron (B), gallium (Ga), phosphorus (P), arsenic (As), argon (Ar), krypton (Kr), and xenon (Xe). 12. The method of claim 1, wherein a length of the line-end extension region is based at least partly on a height of the patterned photoresist. 13. The method of claim 12, wherein the height of the patterned photoresist is within a range from about 20 nm to about 50 nm. 14. A method, comprising:
forming a hard mask layer on a target layer, the target layer disposed between a substrate and the hard mask layer; forming a patterned photoresist on a plurality of first regions of the hard mask layer; forming a plurality of line-end extension regions extending outwardly from ends of the plurality of first regions by irradiating the hard mask layer with a plurality of ion beams each having a non-zero ion beam angle with respect to a direction orthogonal to the hard mask layer, the patterned photoresist blocking at least a portion of the plurality of ion beams from reaching the plurality of line-end extension regions; removing the patterned photoresist; exposing portions of the target layer by removing portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions; and forming a patterned feature in the target layer by removing the exposed portions of the target layer. 15. The method of claim 14, wherein the forming the plurality of line-end extension regions includes changing, by the irradiating the hard mask layer, a selectivity to an etchant gas in the plurality of line-end extension regions of the hard mask layer. 16. The method of claim 15, wherein the removing portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions includes exposing the hard mask layer to the etchant gas, the etchant gas having a lower selectivity to the plurality of line-end extension regions than to the portions of the hard mask layer outside of the plurality of first regions and the plurality of line-end extension regions. 17. The method of claim 15, wherein the forming the plurality of line-end extension regions includes forming the plurality of line-end extension regions to have a length substantially equal to h×tan θ, wherein h is a height of the patterned photoresist and θ is the non-zero ion beam angle. 18. An integrated circuit, comprising:
a substrate; and a plurality of patterned features on the substrate, each of the plurality of patterned features formed of a same material, wherein a distance between an end of a first patterned feature of the plurality of features and an end of a second patterned feature of the plurality of patterned features is less than 25 nm. 19. The integrated circuit of claim 18, wherein the distance between the end of the first patterned feature and the end of the second patterned feature is less than 10 nm. 20. The integrated circuit of claim 18 wherein the plurality of patterned features includes at least one of: a semiconductor device feature, a polysilicon or metal gate, an electrically conductive trace, or an electrically conductive via. | 3,700 |
348,697 | 16,806,183 | 3,783 | A method for manufacturing a semiconductor device includes forming one or more memory device layers over a contact structure. In the method, a plurality of hardmask layers are deposited on the one or more memory device layers in a stacked configuration. Alternating hardmask layers of the stacked configuration are different from each other in at least one respect. The method further includes patterning the plurality of hardmask layers and the one or more memory device layers into a pillar over the contact structure. | 1. A semiconductor device, comprising:
one or more memory device layers disposed over a bottom contact structure; a plurality of hardmask layers disposed on the one or more memory device layers in a stacked configuration; and a top contact structure disposed on the plurality of hardmask layers; wherein alternating hardmask layers of the stacked configuration are different from each other in at least one respect; wherein the plurality of hardmask layers and the one or more memory device layers are in a pillar shape; and wherein the plurality of hardmask layers are electrically conductive. 2. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration have opposite stress states from each other. 3. The semiconductor device according to claim 2, wherein the opposite stress states comprise tensile and compressive stress states. 4. The semiconductor device according to claim 2, wherein the alternating hardmask layers of the stacked configuration have different nitrogen percentages from each other. 5. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise a buffer hardmask layer stacked on a large grain hardmask layer. 6. The semiconductor device according to claim 5, wherein the large grain hardmask layer comprises a rough top surface. 7. The semiconductor device according to claim 6, wherein the buffer hardmask layer fills in a plurality of gaps along the rough top surface of the large grain hardmask layer. 8. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise at least two hardmask layers and an upper hardmask layer of the at least two hardmask layers is thinner than a lower hardmask layer of the at least two hardmask layers. 9. The semiconductor device according to claim 1, wherein the plurality of hardmask layers comprise at least one of niobium (Nb), niobium nitride (NbN), tungsten (W), tungsten nitride (WN), tantalum (Ta), tantalum nitride (TaN), titanium (Ti), titanium nitride (TiN), ruthenium (Ru), molybdenum (Mo), chromium (Cr), vanadium (V), palladium (Pd), platinum (Pt), rhodium (Rh), scandium (Sc), aluminum (Al) and silicides thereof. 10. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise a layer of a metal and a layer of a nitride of the metal stacked on the layer of the metal. 11. A semiconductor device, comprising:
one or more memory device layers disposed over a bottom contact structure; a plurality of hardmask layers disposed on the one or more memory device layers in a stacked configuration; and a top contact structure disposed on the plurality of hardmask layers; wherein alternating hardmask layers of the stacked configuration are different from each other in at least one respect. 12. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration have opposite stress states from each other. 13. The semiconductor device according to claim 12, wherein the opposite stress states comprise tensile and compressive stress states. 14. The semiconductor device according to claim 12, wherein the alternating hardmask layers of the stacked configuration have different nitrogen percentages from each other. 15. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise a buffer hardmask layer stacked on a large grain hardmask layer. 16. The semiconductor device according to claim 15, wherein the large grain hardmask layer comprises a rough top surface. 17. The semiconductor device according to claim 16, wherein the buffer hardmask layer fills in a plurality of gaps along the rough top surface of the large grain hardmask layer. 18. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise at least two hardmask layers and an upper hardmask layer of the at least two hardmask layers is thinner than a lower hardmask layer of the at least two hardmask layers. 19. The semiconductor device according to claim 11, wherein the plurality of hardmask layers comprise at least one of niobium (Nb), niobium nitride (NbN), tungsten (W), tungsten nitride (WN), tantalum (Ta), tantalum nitride (TaN), titanium (Ti), titanium nitride (TiN), ruthenium (Ru), molybdenum (Mo), chromium (Cr), vanadium (V), palladium (Pd), platinum (Pt), rhodium (Rh), scandium (Sc), aluminum (Al) and silicides thereof. 20. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise a layer of a metal and a layer of a nitride of the metal stacked on the layer of the metal. | A method for manufacturing a semiconductor device includes forming one or more memory device layers over a contact structure. In the method, a plurality of hardmask layers are deposited on the one or more memory device layers in a stacked configuration. Alternating hardmask layers of the stacked configuration are different from each other in at least one respect. The method further includes patterning the plurality of hardmask layers and the one or more memory device layers into a pillar over the contact structure.1. A semiconductor device, comprising:
one or more memory device layers disposed over a bottom contact structure; a plurality of hardmask layers disposed on the one or more memory device layers in a stacked configuration; and a top contact structure disposed on the plurality of hardmask layers; wherein alternating hardmask layers of the stacked configuration are different from each other in at least one respect; wherein the plurality of hardmask layers and the one or more memory device layers are in a pillar shape; and wherein the plurality of hardmask layers are electrically conductive. 2. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration have opposite stress states from each other. 3. The semiconductor device according to claim 2, wherein the opposite stress states comprise tensile and compressive stress states. 4. The semiconductor device according to claim 2, wherein the alternating hardmask layers of the stacked configuration have different nitrogen percentages from each other. 5. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise a buffer hardmask layer stacked on a large grain hardmask layer. 6. The semiconductor device according to claim 5, wherein the large grain hardmask layer comprises a rough top surface. 7. The semiconductor device according to claim 6, wherein the buffer hardmask layer fills in a plurality of gaps along the rough top surface of the large grain hardmask layer. 8. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise at least two hardmask layers and an upper hardmask layer of the at least two hardmask layers is thinner than a lower hardmask layer of the at least two hardmask layers. 9. The semiconductor device according to claim 1, wherein the plurality of hardmask layers comprise at least one of niobium (Nb), niobium nitride (NbN), tungsten (W), tungsten nitride (WN), tantalum (Ta), tantalum nitride (TaN), titanium (Ti), titanium nitride (TiN), ruthenium (Ru), molybdenum (Mo), chromium (Cr), vanadium (V), palladium (Pd), platinum (Pt), rhodium (Rh), scandium (Sc), aluminum (Al) and silicides thereof. 10. The semiconductor device according to claim 1, wherein the alternating hardmask layers of the stacked configuration comprise a layer of a metal and a layer of a nitride of the metal stacked on the layer of the metal. 11. A semiconductor device, comprising:
one or more memory device layers disposed over a bottom contact structure; a plurality of hardmask layers disposed on the one or more memory device layers in a stacked configuration; and a top contact structure disposed on the plurality of hardmask layers; wherein alternating hardmask layers of the stacked configuration are different from each other in at least one respect. 12. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration have opposite stress states from each other. 13. The semiconductor device according to claim 12, wherein the opposite stress states comprise tensile and compressive stress states. 14. The semiconductor device according to claim 12, wherein the alternating hardmask layers of the stacked configuration have different nitrogen percentages from each other. 15. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise a buffer hardmask layer stacked on a large grain hardmask layer. 16. The semiconductor device according to claim 15, wherein the large grain hardmask layer comprises a rough top surface. 17. The semiconductor device according to claim 16, wherein the buffer hardmask layer fills in a plurality of gaps along the rough top surface of the large grain hardmask layer. 18. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise at least two hardmask layers and an upper hardmask layer of the at least two hardmask layers is thinner than a lower hardmask layer of the at least two hardmask layers. 19. The semiconductor device according to claim 11, wherein the plurality of hardmask layers comprise at least one of niobium (Nb), niobium nitride (NbN), tungsten (W), tungsten nitride (WN), tantalum (Ta), tantalum nitride (TaN), titanium (Ti), titanium nitride (TiN), ruthenium (Ru), molybdenum (Mo), chromium (Cr), vanadium (V), palladium (Pd), platinum (Pt), rhodium (Rh), scandium (Sc), aluminum (Al) and silicides thereof. 20. The semiconductor device according to claim 11, wherein the alternating hardmask layers of the stacked configuration comprise a layer of a metal and a layer of a nitride of the metal stacked on the layer of the metal. | 3,700 |
348,698 | 16,806,221 | 2,844 | Examples of the various techniques introduced here include, but not limited to, a method for generating a visual indication. The method includes receiving a signal indicative of an event associated with a vehicle operation and instructing a lighting device to emit light rays based at least in part on the signal. The method further includes instructing a constant-current module to provide a constant current to the lighting device when emitting the light rays. | 1. A method for generating a visual indication, comprising:
receiving a signal indicative of an event associated with a vehicle operation; instructing a lighting device to emit light rays based at least in part on the signal; and instructing a constant current module to provide a constant current to the lighting device when emitting the light rays. 2. The method of claim 1, further comprising determining the constant current at least partially based on a Pulse-Width Modulation (PMW) scheme. 3. The method of claim 2, further comprising:
performing the PMW scheme based on a duty ratio. 4. The method of claim 2, further comprising:
performing the PMW scheme based on a carrier frequency. 5. The method of claim 1, wherein the signal indicative of the event is received from a transmitter communicably coupled to a communication interface of a vehicle. 6. The method of claim 5, wherein the transmitter includes a regulator configured to receive power with a first voltage and provide power with a second voltage to a processor of the transmitter and a frequency shift keying (FSK) module of the transmitter, and wherein the first voltage is about 12 Volt, and wherein the second voltage is about 3.3 Volt. 7. The method of claim 1, wherein the constant current is determined by a constant-current circuit. 8. The method of claim 7, wherein the constant-current circuit includes a tail constant-current control channel and a brake constant-current control channel. 9. The method of claim 8, wherein the tail constant-current control channel is configured to provide the constant current to lighting device indication component when the lighting device emits blinking light rays. 10. The method of claim 8, wherein the brake constant-current control channel is configured to provide the constant current to the lighting device when the lighting device emits constant light rays. 11. A system for generating a visual indication, comprising:
a transmitter configured to be communicably coupled to a communication interface of a vehicle, the transmitter being configured to receive a signal indicative of an event associated with an operation of the vehicle; a first receiver configured to receive a first signal from the transmitter, wherein the first signal is indicative that the operation of the vehicle is associated with a first side of the vehicle where the first receiver is located, wherein the first receiver is configured to provide a first visual indication based on the first signal, and wherein the first visual indication is provided by a first lighting device powered by a first constant current provided by a first battery in the first receiver; and a second receiver configured to receive a second signal from the transmitter, wherein the second signal is indicative that the operation of the vehicle is associated with a second side of the vehicle where the second receiver is located. 12. The system of claim 11, wherein the second receiver is configured to provide a second visual indication based on the second signal, and wherein the second visual indication is provided by a second lighting device powered by a second constant current provided by a second battery in the second receiver. 13. The system of claim 11, wherein the vehicle includes a tractor and a trailer, and wherein the transmitter is located on the tractor, and where the first and second receiver are on the trailer. 14. The system of claim 11, wherein the first receiver is located at a driver side of the vehicle. 15. The system of claim 11, wherein the second receiver is located at a passenger side of the vehicle. 16. The system of claim 11, wherein the first receiver includes a signal relay device. 17. An apparatus for generating a visual indication, comprising:
a housing; a transparent lip coupled to the housing, the housing and the transparent lip together forming an enclosure; a processor in the enclosure; one or more lighting devices, the light devices being coupled to the processor; a battery coupled to the processor; and a constant current module coupled to the battery and configured to provide a constant current to the one or more lighting devices. 18. The apparatus of claim 17, wherein the one or more lighting devices include one or more LEDs, and wherein each of the one or more LEDs is positioned in a socket. 19. The apparatus of claim 18, wherein the one or more LEDs are arranged in two parallel rows, and wherein a notch is formed between two neighboring LEDs. 20. The apparatus of claim 17, wherein the constant current module includes a circuit having a tail constant-current control channel and a brake constant-current control channel. | Examples of the various techniques introduced here include, but not limited to, a method for generating a visual indication. The method includes receiving a signal indicative of an event associated with a vehicle operation and instructing a lighting device to emit light rays based at least in part on the signal. The method further includes instructing a constant-current module to provide a constant current to the lighting device when emitting the light rays.1. A method for generating a visual indication, comprising:
receiving a signal indicative of an event associated with a vehicle operation; instructing a lighting device to emit light rays based at least in part on the signal; and instructing a constant current module to provide a constant current to the lighting device when emitting the light rays. 2. The method of claim 1, further comprising determining the constant current at least partially based on a Pulse-Width Modulation (PMW) scheme. 3. The method of claim 2, further comprising:
performing the PMW scheme based on a duty ratio. 4. The method of claim 2, further comprising:
performing the PMW scheme based on a carrier frequency. 5. The method of claim 1, wherein the signal indicative of the event is received from a transmitter communicably coupled to a communication interface of a vehicle. 6. The method of claim 5, wherein the transmitter includes a regulator configured to receive power with a first voltage and provide power with a second voltage to a processor of the transmitter and a frequency shift keying (FSK) module of the transmitter, and wherein the first voltage is about 12 Volt, and wherein the second voltage is about 3.3 Volt. 7. The method of claim 1, wherein the constant current is determined by a constant-current circuit. 8. The method of claim 7, wherein the constant-current circuit includes a tail constant-current control channel and a brake constant-current control channel. 9. The method of claim 8, wherein the tail constant-current control channel is configured to provide the constant current to lighting device indication component when the lighting device emits blinking light rays. 10. The method of claim 8, wherein the brake constant-current control channel is configured to provide the constant current to the lighting device when the lighting device emits constant light rays. 11. A system for generating a visual indication, comprising:
a transmitter configured to be communicably coupled to a communication interface of a vehicle, the transmitter being configured to receive a signal indicative of an event associated with an operation of the vehicle; a first receiver configured to receive a first signal from the transmitter, wherein the first signal is indicative that the operation of the vehicle is associated with a first side of the vehicle where the first receiver is located, wherein the first receiver is configured to provide a first visual indication based on the first signal, and wherein the first visual indication is provided by a first lighting device powered by a first constant current provided by a first battery in the first receiver; and a second receiver configured to receive a second signal from the transmitter, wherein the second signal is indicative that the operation of the vehicle is associated with a second side of the vehicle where the second receiver is located. 12. The system of claim 11, wherein the second receiver is configured to provide a second visual indication based on the second signal, and wherein the second visual indication is provided by a second lighting device powered by a second constant current provided by a second battery in the second receiver. 13. The system of claim 11, wherein the vehicle includes a tractor and a trailer, and wherein the transmitter is located on the tractor, and where the first and second receiver are on the trailer. 14. The system of claim 11, wherein the first receiver is located at a driver side of the vehicle. 15. The system of claim 11, wherein the second receiver is located at a passenger side of the vehicle. 16. The system of claim 11, wherein the first receiver includes a signal relay device. 17. An apparatus for generating a visual indication, comprising:
a housing; a transparent lip coupled to the housing, the housing and the transparent lip together forming an enclosure; a processor in the enclosure; one or more lighting devices, the light devices being coupled to the processor; a battery coupled to the processor; and a constant current module coupled to the battery and configured to provide a constant current to the one or more lighting devices. 18. The apparatus of claim 17, wherein the one or more lighting devices include one or more LEDs, and wherein each of the one or more LEDs is positioned in a socket. 19. The apparatus of claim 18, wherein the one or more LEDs are arranged in two parallel rows, and wherein a notch is formed between two neighboring LEDs. 20. The apparatus of claim 17, wherein the constant current module includes a circuit having a tail constant-current control channel and a brake constant-current control channel. | 2,800 |
348,699 | 16,806,172 | 2,844 | The present technology relates to a solid-state imaging device, an imaging apparatus, and an electronic apparatus, which can suppress a color mixture without lowering the sensitivity. | 1. A light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range; and
a second pixel including a second color filter configured to transmit light of a second wavelength range, the second color filter being surrounded by a first light shielding film in a plan view,
wherein the first wavelength range is different from the second wavelength range,
wherein an area of the first color filter is greater than an area of the second color filter in the plan view. 2. The light detecting device according to claim 1, wherein the light of the first wavelength range is white light. 3. The light detecting device according to claim 2, wherein the light of the second wavelength range is at least one of red light, green light and blue light. 4. The light detecting device according to claim 2, wherein the light of the second wavelength range is at least one of yellow light, magenta light and cyan light. 5. The light detecting device according to claim 3, wherein the plurality of pixels further includes a third pixel including a third color filter configured to transmit light of a third wavelength range, the third color filter being surrounded by a second light shielding film in the plan view. 6. The light detecting device according to claim 5, wherein the plurality of pixels further includes a fourth pixel including a fourth color filter configured to transmit light of a fourth wavelength range, the fourth color filter being surrounded by a third light shielding film in the plan view. 7. The light detecting device according to claim 6, wherein the plurality of pixels further includes a fifth pixel including a fifth color filter configured to transmit light of a fifth wavelength range, the fifth color filter being surrounded by a fourth light shielding film in the plan view. 8. The light detecting device according to claim 7, wherein the first pixel is surrounded by the second pixel and the third pixel and the fourth pixel and the fifth pixel in the plan view. 9. The light detecting device according to claim 8, wherein the area of the first color is an area surrounded by the first light shielding film and the second light shielding film and the third light shielding film and the fourth light shielding film in the plan view. 10. The light detecting device according to claim 9, wherein the light of the second wavelength range is red light, and the light of the third and fifth wavelength range is green light, and the light of the fourth wavelength range is blue light. 11. The light detecting device according to claim 10, wherein the area of the first color filter is greater than an area of the third color filter in the plan view, and the area of the first color filter is greater than an area of the fourth color filter in the plan view. 12. The light detecting device according to claim 11, wherein the area of the first color filter is greater than the area of the second color filter, and the area of the second color filter is greater than the area of the third color filter. 13. A light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range;
a second pixel including a second color filter configured to transmit light of a second wavelength range; and
a first light shielding film,
wherein the first wavelength range is different from the second wavelength range,
wherein a first distance of the first light shielding film between an edge of the first light shielding film and a boundary of the first color filter and the second color filter is greater than a second distance of the first light shielding film between the other edge of the first light shielding film and the boundary in a cross sectional view. 14. The light detecting device according to claim 13, wherein the light of the first wavelength range is at least one of red light, green light, blue light and white light. 15. The light detecting device according to claim 13, wherein the light of the second wavelength range is at least one of red light, green light, blue light and white light. 16. The light detecting device according to claim 13, wherein the edge of the light shielding film is attached to a portion of the first color filter, and the other edge of the light shielding film is attached to a portion of the second color filter. 17. The light detecting device according to claim 16, wherein the first color filter is adjacent to the second color filter. 18. The light detecting device according to claim 13, wherein the first light shielding film is disposed above a light receiving section. 19. The light detecting device according to claim 18, wherein the light receiving section outputs a pixel signal according to an amount of light. 20. An electronic apparatus comprising:
an optical system; a signal processing circuit, and a light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range;
a second pixel including a second color filter configured to transmit light of a second wavelength range; and
a first light shielding film,
wherein the first wavelength range is different from the second wavelength range,
wherein a first distance of the first light shielding film between an edge of the first light shielding film and a boundary of the first color filter and the second color filter is greater than a second distance of the first light shielding film between the other edge of the first light shielding film and the boundary in a cross sectional view. | The present technology relates to a solid-state imaging device, an imaging apparatus, and an electronic apparatus, which can suppress a color mixture without lowering the sensitivity.1. A light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range; and
a second pixel including a second color filter configured to transmit light of a second wavelength range, the second color filter being surrounded by a first light shielding film in a plan view,
wherein the first wavelength range is different from the second wavelength range,
wherein an area of the first color filter is greater than an area of the second color filter in the plan view. 2. The light detecting device according to claim 1, wherein the light of the first wavelength range is white light. 3. The light detecting device according to claim 2, wherein the light of the second wavelength range is at least one of red light, green light and blue light. 4. The light detecting device according to claim 2, wherein the light of the second wavelength range is at least one of yellow light, magenta light and cyan light. 5. The light detecting device according to claim 3, wherein the plurality of pixels further includes a third pixel including a third color filter configured to transmit light of a third wavelength range, the third color filter being surrounded by a second light shielding film in the plan view. 6. The light detecting device according to claim 5, wherein the plurality of pixels further includes a fourth pixel including a fourth color filter configured to transmit light of a fourth wavelength range, the fourth color filter being surrounded by a third light shielding film in the plan view. 7. The light detecting device according to claim 6, wherein the plurality of pixels further includes a fifth pixel including a fifth color filter configured to transmit light of a fifth wavelength range, the fifth color filter being surrounded by a fourth light shielding film in the plan view. 8. The light detecting device according to claim 7, wherein the first pixel is surrounded by the second pixel and the third pixel and the fourth pixel and the fifth pixel in the plan view. 9. The light detecting device according to claim 8, wherein the area of the first color is an area surrounded by the first light shielding film and the second light shielding film and the third light shielding film and the fourth light shielding film in the plan view. 10. The light detecting device according to claim 9, wherein the light of the second wavelength range is red light, and the light of the third and fifth wavelength range is green light, and the light of the fourth wavelength range is blue light. 11. The light detecting device according to claim 10, wherein the area of the first color filter is greater than an area of the third color filter in the plan view, and the area of the first color filter is greater than an area of the fourth color filter in the plan view. 12. The light detecting device according to claim 11, wherein the area of the first color filter is greater than the area of the second color filter, and the area of the second color filter is greater than the area of the third color filter. 13. A light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range;
a second pixel including a second color filter configured to transmit light of a second wavelength range; and
a first light shielding film,
wherein the first wavelength range is different from the second wavelength range,
wherein a first distance of the first light shielding film between an edge of the first light shielding film and a boundary of the first color filter and the second color filter is greater than a second distance of the first light shielding film between the other edge of the first light shielding film and the boundary in a cross sectional view. 14. The light detecting device according to claim 13, wherein the light of the first wavelength range is at least one of red light, green light, blue light and white light. 15. The light detecting device according to claim 13, wherein the light of the second wavelength range is at least one of red light, green light, blue light and white light. 16. The light detecting device according to claim 13, wherein the edge of the light shielding film is attached to a portion of the first color filter, and the other edge of the light shielding film is attached to a portion of the second color filter. 17. The light detecting device according to claim 16, wherein the first color filter is adjacent to the second color filter. 18. The light detecting device according to claim 13, wherein the first light shielding film is disposed above a light receiving section. 19. The light detecting device according to claim 18, wherein the light receiving section outputs a pixel signal according to an amount of light. 20. An electronic apparatus comprising:
an optical system; a signal processing circuit, and a light detecting device comprising:
a plurality of pixels including:
a first pixel including a first color filter configured to transmit light of a first wavelength range;
a second pixel including a second color filter configured to transmit light of a second wavelength range; and
a first light shielding film,
wherein the first wavelength range is different from the second wavelength range,
wherein a first distance of the first light shielding film between an edge of the first light shielding film and a boundary of the first color filter and the second color filter is greater than a second distance of the first light shielding film between the other edge of the first light shielding film and the boundary in a cross sectional view. | 2,800 |
Subsets and Splits