meta
dict | text
stringlengths 2
641k
|
|---|---|
{
"pile_set_name": "Wikipedia (en)"
} | Maouéni-Ladjiri
Maouéni-Ladjiri is a village on the island of Grande Comore (Ngazidja) in the Comoros. According to the 1991 census, the village had a population of 791.
References
Category:Populated places in Grande Comore |
{
"pile_set_name": "Github"
} | /*
* Copyright (C) 2008 Christoph Hellwig.
* Portions Copyright (C) 2000-2008 Silicon Graphics, Inc.
*
* This program is free software; you can redistribute it and/or
* modify it under the terms of the GNU General Public License as
* published by the Free Software Foundation.
*
* This program is distributed in the hope that it would be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU General Public License for more details.
*
* You should have received a copy of the GNU General Public License
* along with this program; if not, write the Free Software Foundation,
* Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA
*/
#include "xfs.h"
#include "xfs_format.h"
#include "xfs_log_format.h"
#include "xfs_trans_resv.h"
#include "xfs_mount.h"
#include "xfs_da_format.h"
#include "xfs_inode.h"
#include "xfs_attr.h"
#include "xfs_attr_leaf.h"
#include "xfs_acl.h"
#include <linux/posix_acl_xattr.h>
#include <linux/xattr.h>
static int
xfs_xattr_get(const struct xattr_handler *handler, struct dentry *dentry,
const char *name, void *value, size_t size)
{
int xflags = handler->flags;
struct xfs_inode *ip = XFS_I(d_inode(dentry));
int error, asize = size;
if (strcmp(name, "") == 0)
return -EINVAL;
/* Convert Linux syscall to XFS internal ATTR flags */
if (!size) {
xflags |= ATTR_KERNOVAL;
value = NULL;
}
error = xfs_attr_get(ip, (unsigned char *)name, value, &asize, xflags);
if (error)
return error;
return asize;
}
void
xfs_forget_acl(
struct inode *inode,
const char *name,
int xflags)
{
/*
* Invalidate any cached ACLs if the user has bypassed the ACL
* interface. We don't validate the content whatsoever so it is caller
* responsibility to provide data in valid format and ensure i_mode is
* consistent.
*/
if (xflags & ATTR_ROOT) {
#ifdef CONFIG_XFS_POSIX_ACL
if (!strcmp(name, SGI_ACL_FILE))
forget_cached_acl(inode, ACL_TYPE_ACCESS);
else if (!strcmp(name, SGI_ACL_DEFAULT))
forget_cached_acl(inode, ACL_TYPE_DEFAULT);
#endif
}
}
static int
xfs_xattr_set(const struct xattr_handler *handler, struct dentry *dentry,
const char *name, const void *value, size_t size, int flags)
{
int xflags = handler->flags;
struct xfs_inode *ip = XFS_I(d_inode(dentry));
int error;
if (strcmp(name, "") == 0)
return -EINVAL;
/* Convert Linux syscall to XFS internal ATTR flags */
if (flags & XATTR_CREATE)
xflags |= ATTR_CREATE;
if (flags & XATTR_REPLACE)
xflags |= ATTR_REPLACE;
if (!value)
return xfs_attr_remove(ip, (unsigned char *)name, xflags);
error = xfs_attr_set(ip, (unsigned char *)name,
(void *)value, size, xflags);
if (!error)
xfs_forget_acl(d_inode(dentry), name, xflags);
return error;
}
static const struct xattr_handler xfs_xattr_user_handler = {
.prefix = XATTR_USER_PREFIX,
.flags = 0, /* no flags implies user namespace */
.get = xfs_xattr_get,
.set = xfs_xattr_set,
};
static const struct xattr_handler xfs_xattr_trusted_handler = {
.prefix = XATTR_TRUSTED_PREFIX,
.flags = ATTR_ROOT,
.get = xfs_xattr_get,
.set = xfs_xattr_set,
};
static const struct xattr_handler xfs_xattr_security_handler = {
.prefix = XATTR_SECURITY_PREFIX,
.flags = ATTR_SECURE,
.get = xfs_xattr_get,
.set = xfs_xattr_set,
};
const struct xattr_handler *xfs_xattr_handlers[] = {
&xfs_xattr_user_handler,
&xfs_xattr_trusted_handler,
&xfs_xattr_security_handler,
#ifdef CONFIG_XFS_POSIX_ACL
&posix_acl_access_xattr_handler,
&posix_acl_default_xattr_handler,
#endif
NULL
};
static unsigned int xfs_xattr_prefix_len(int flags)
{
if (flags & XFS_ATTR_SECURE)
return sizeof("security");
else if (flags & XFS_ATTR_ROOT)
return sizeof("trusted");
else
return sizeof("user");
}
static const char *xfs_xattr_prefix(int flags)
{
if (flags & XFS_ATTR_SECURE)
return xfs_xattr_security_handler.prefix;
else if (flags & XFS_ATTR_ROOT)
return xfs_xattr_trusted_handler.prefix;
else
return xfs_xattr_user_handler.prefix;
}
static int
xfs_xattr_put_listent(
struct xfs_attr_list_context *context,
int flags,
unsigned char *name,
int namelen,
int valuelen,
unsigned char *value)
{
unsigned int prefix_len = xfs_xattr_prefix_len(flags);
char *offset;
int arraytop;
ASSERT(context->count >= 0);
/*
* Only show root namespace entries if we are actually allowed to
* see them.
*/
if ((flags & XFS_ATTR_ROOT) && !capable(CAP_SYS_ADMIN))
return 0;
arraytop = context->count + prefix_len + namelen + 1;
if (arraytop > context->firstu) {
context->count = -1; /* insufficient space */
return 1;
}
offset = (char *)context->alist + context->count;
strncpy(offset, xfs_xattr_prefix(flags), prefix_len);
offset += prefix_len;
strncpy(offset, (char *)name, namelen); /* real name */
offset += namelen;
*offset = '\0';
context->count += prefix_len + namelen + 1;
return 0;
}
static int
xfs_xattr_put_listent_sizes(
struct xfs_attr_list_context *context,
int flags,
unsigned char *name,
int namelen,
int valuelen,
unsigned char *value)
{
context->count += xfs_xattr_prefix_len(flags) + namelen + 1;
return 0;
}
static int
list_one_attr(const char *name, const size_t len, void *data,
size_t size, ssize_t *result)
{
char *p = data + *result;
*result += len;
if (!size)
return 0;
if (*result > size)
return -ERANGE;
strcpy(p, name);
return 0;
}
ssize_t
xfs_vn_listxattr(struct dentry *dentry, char *data, size_t size)
{
struct xfs_attr_list_context context;
struct attrlist_cursor_kern cursor = { 0 };
struct inode *inode = d_inode(dentry);
int error;
/*
* First read the regular on-disk attributes.
*/
memset(&context, 0, sizeof(context));
context.dp = XFS_I(inode);
context.cursor = &cursor;
context.resynch = 1;
context.alist = data;
context.bufsize = size;
context.firstu = context.bufsize;
if (size)
context.put_listent = xfs_xattr_put_listent;
else
context.put_listent = xfs_xattr_put_listent_sizes;
xfs_attr_list_int(&context);
if (context.count < 0)
return -ERANGE;
/*
* Then add the two synthetic ACL attributes.
*/
if (posix_acl_access_exists(inode)) {
error = list_one_attr(POSIX_ACL_XATTR_ACCESS,
strlen(POSIX_ACL_XATTR_ACCESS) + 1,
data, size, &context.count);
if (error)
return error;
}
if (posix_acl_default_exists(inode)) {
error = list_one_attr(POSIX_ACL_XATTR_DEFAULT,
strlen(POSIX_ACL_XATTR_DEFAULT) + 1,
data, size, &context.count);
if (error)
return error;
}
return context.count;
}
|
{
"pile_set_name": "StackExchange"
} | Q:
Set RGB value for label text
I am having the color codes as R:38 G:171 B:228 , but when I set the values as .38f in the color with Red : Green : Blue:, I am unable to get the desired color:
[CategoryLbl setTextColor:[UIColor colorWithRed:.38f green:.171f blue:.226f alpha:1.0f]];
Please help.
A:
You're mixing up two scales: UIColour looks like it uses floating point values 0-1 whereas the usual RGB values are 0-255. Instead you want
38 / 255 = 0.1491f
171 / 255 = 0.6706f
226 / 255 = 0.8863f
so
[CategoryLbl setTextColor:[UIColor colorWithRed:0.1491f green:0.6706f blue:0.8863f alpha:1.0f]];
There may be better ways to do this, e.g. using the 0-255 values - I don't know OSX / iPhone development well.
Actually it looks like you can just do:
[CategoryLbl setTextColor:[UIColor colorWithRed:(38/255.f) green:(171/255.f) blue:(226/255.f) alpha:1.0f]];
which is easier to understand (although I gave you enough d.p. the first one should be as accurate).
|
{
"pile_set_name": "OpenWebText2"
} | With one of the largest selections of Los Angeles Rams merchandise, gear, and apparel, our Los Angeles Rams store here at NFLShop.com is the place for Rams fans to find what they need to cheer on the team in style. Check out the brand new logo that the LA Rams will be sporting in 2020 and beyond that gives a nod to their LA roots with our official LA Rams new logo apparel including hats, shirts and more. As the official online shop of the NFL, we offer all the most in-demand, officially licensed Rams apparel for all fans. Shop for Los Angeles Rams fan gear for men, women, and kids, and find just what you need for the Rams fan in your life to show their support for the team. Gear up for the next big Rams game with official Los Angeles Rams jerseys, t-shirts, hats, custom Rams apparel and any other gear you could ever need. Are you heading to the game? Then make sure you are prepared to throw a great tailgate party beforehand with Rams tailgating gear and car accessories. And don't forget to keep nice and warm with Rams sweatshirts and jackets. Also, be sure to show your love for the Rams by decorating your surroundings in Rams colors with Rams bedding sets, kitchenware, pet gear, Rams collectibles and more. Our collections of exclusive Rams gear and apparel come from great brands like New Era, Nike, Mitchell & Ness, and more. Pair this with our exclusive online discounts and fast shipping options, and it will be easy to see why the official online retailer of the NFL is your top source for Los Angeles Rams clothing,gifts, merchandise and more. Show your Rams colors of millennium blue, new century gold, and white proudly by picking up any of our Los Angeles Rams merchandise and apparel. Get your hands on the jerseys and gear from your favorite Rams players like Jared Goff, Aaron Donald, Cooper Kupp, and more.
Los Angeles Rams Nike Apparel, Gear
There is no better way to gear up for a Rams game and show your support than with the Nike Rams apparel that we have to offer. With sizes and styles available for all men, women, and kids, our collections of the latest Nike Rams gear and apparel is perfect for any Rams fan. Browse and shop our huge selection of Nike Rams gear, including Nike Rams t-shirts, numbered tees, polos, shorts, and more. Or, look like the Rams players on the field with Rams Nike jerseys - available in Nike Game, Limited or Elite styles. Impress your fellow Rams fans with your new Los Angeles Rams Nike apparel or give gear as a gift to one of these friends. Shop for your new Rams Nike apparel today and be sure to stop back to NFLShop.com for exclusive updates and new arrivals of the latest in Nike Rams gear. |
{
"pile_set_name": "Pile-CC"
} | Art Berke, a lifelong White Sox fan, has worked at the highest levels of the sports industry with Major League Baseball, ABC Television and Sports Illustrated. He grew up in Northwest Indiana, in the shadow of old Comiskey Park, and proudly proclaims 2005 as the best year of his life. Art offers his glass half-full opinions and observations as he lives and dies with the Sox.
What Paul Konerko Means to the White Sox
Last week’s signing of Paul Konerko was unlike any other transaction in recent memory. It wasn’t your routine, everyday free agent acquisition because of how SoxWorld feels about their All-Star slugger. The outpouring of joy over Konerko’s return has been as much about who he is as a person and what he represents as the impressive numbers he’s produced between the white lines.
Chairman Jerry Reinsdorf said in no uncertain terms that Paulie belongs in Chicago. GM Kenny Williams observed that it would be funny to see him in another uniform. Teammate Gordon Beckham expressed how much Konerko has helped him become a major leaguer and Chicago Sun-Times columnist Rick Morrissey put it beautifully when he wrote that Konerko is the “quintessential leader by example.”
In his 12 seasons on the South Side, Konerko has endeared himself to the Sox organization and fans alike. Here are some reasons why No. 14 is so beloved.
* Let’s begin with the obvious–the numbers. In his tenure with the Sox, Konerko has slugged 358 homers, driven in 1127 runs, compiled a respectable .282 batting average and has batted .300 or better three times. He has hit 40 or more homers twice, 30 or more six times and 20 or more on 11 occasions. Paulie has driven in 100 or more runs five times and 90 or more in eight seasons with a .358 on base percentage and .505 slugging mark, giving him an OPS of .863. In the postseason (2000, 2005, 2008) he has hit seven homers and driven in 17 runs.
* Konerko’s offensive rank in Sox history is quite impressive as well. He’s second in home runs and RBIs to only future Hall of Famer Frank Thomas, is tied for third in doubles with Hall of Famer Nellie Fox (behind Thomas and Hall of Famer Luke Appling) and is fifth in runs scored behind Thomas, Appling, Fox and Eddie Collins, who is also enshrined in Cooperstown.
* He’s a Chicago guy–a modest, hard-working, team player who, as Morrissey wrote, is a leader by example. The captain title its him perfectly and the fact he has chosen NOT to wear the “C” on his uniform speaks volumes about his humble nature.
* Konerko was at the heart of the 2005 World Champions, delivering in the clutch time and time again. We certainly won’t forget his grand slam in Game 2 of the World Series, key homers in the ALCS against the Angels and that he appropriately made the final putout in the division clincher in Detroit and all three playoff series.
* His gesture of presenting Reinsdorf with the ball from the final out of the World Series at the victory parade has become legend and yet another example of Paulie’s character. In contrast, just the year before, Red Sox first baseman Doug Mientkiewicz threatened to keep the ball from the final out and was sued by the team before it was decided that the ball would be displayed at the Baseball Hall of Fame. Why did Konerko do it? Paulie simply said it was because Reinsdorf deserves to have it. And it’s important to note that the Chairman called the moment the most emotional of his life.
* He has been involved in numerous charitable endeavors. Among them has been his participation in the Children’s Home & Aid “Bring Me Home” campaign with former teammate Jim Thome in support of foster families.
* Only nine White Sox players have had their uniform numbers retired. By signing on with the Sox for another three years and continuing his Sox legacy, we could be celebrating Paulie’s No. 14 as the latest to the list of elite Pale Hosers. And the fans will love when he reaches that mountaintop.
He would join Fox (2), Harold Baines (3), Appling (4), Minnie Minoso (9), Luis Aparicio (11), Ted Lyons (16), Billy Pierce (19), Thomas (35) and Carlton Fisk (72) in the exclusive club. For the record, 38 White Sox have worn the number, including Bill Melton, Hall of Famer Larry Doby and Moose Skowron. But it’s doubtful anyone would have a problem with retiring it for Konerko–or building a statue for him on the outfield concourse to go along with his bronze image on the monument outside of the Cell.
For these reasons and more, Paul Konerko IS the White Sox. It’s true that he played briefly for both the Dodgers and Reds early in his career, but he’s a South Sider through and through and we have accepted him as such deep in our souls.
Meta
The following are trademarks or service marks of Major League Baseball entities and may be used only with permission of Major League Baseball Properties, Inc. or the relevant Major League Baseball entity: Major League, Major League Baseball, MLB, the silhouetted batter logo, World Series, National League, American League, Division Series, League Championship Series, All-Star Game, and the names, nicknames, logos, uniform designs, color combinations, and slogans designating the Major League Baseball clubs and entities, and their respective mascots, events and exhibitions. |
{
"pile_set_name": "Github"
} | Legend
======
show_legend
-----------
You can remove legend by setting this to ``False``
.. pygal-code::
chart = pygal.Line(show_legend=False)
chart.add('Serie 1', [1, 2, 3])
chart.add('Serie 2', [4, 2, 0])
chart.add('Serie 3', [1, -1, 1])
chart.add('Serie 4', [3, 1, 5])
legend_at_bottom
----------------
You can put legend at bottom by setting ``legend_at_bottom`` to True:
.. pygal-code::
chart = pygal.Line(legend_at_bottom=True)
chart.add('Serie 1', [1, 2, 3])
chart.add('Serie 2', [4, 2, 0])
chart.add('Serie 3', [1, -1, 1])
chart.add('Serie 4', [3, 1, 5])
legend_at_bottom_columns
------------------------
Force the number of legend columns when set at bottom
.. pygal-code::
chart = pygal.Line(legend_at_bottom=True, legend_at_bottom_columns=4)
chart.add('Serie 1', [1, 2, 3])
chart.add('Serie 2', [4, 2, 0])
chart.add('Serie 3', [1, -1, 1])
chart.add('Serie 4', [3, 1, 5])
legend_box_size
---------------
.. pygal-code::
chart = pygal.Line(legend_box_size=18)
chart.add('Serie 1', [1, 2, 3])
chart.add('Serie 2', [4, 2, 0])
chart.add('Serie 3', [1, -1, 1])
chart.add('Serie 4', [3, 1, 5])
truncate_legend
---------------
By default long legends are automatically truncated at reasonable length to fit in the graph.
You can override that by setting truncation lenght with ``truncate_legend``.
.. pygal-code::
chart = pygal.Line(truncate_legend=17)
chart.x_labels = [
'This is the first point !',
'This is the second point !',
'This is the third point !',
'This is the fourth point !']
chart.add('line', [0, .0002, .0005, .00035])
or disable it by setting this to -1
.. pygal-code::
chart = pygal.Line(truncate_legend=-1)
chart.x_labels = [
'This is the first point !',
'This is the second point !',
'This is the third point !',
'This is the fourth point !']
chart.add('line', [0, .0002, .0005, .00035])
|
{
"pile_set_name": "PubMed Abstracts"
} | Influence of conjugation chemistry and B epitope orientation on the immune response of branched peptide antigens.
Multimeric presentation, a well-proven way of enhancing peptide immunogenicity, has found substantial application in synthetic vaccine design. We have reported that a combination of four copies of a B-cell epitope with one of a T-cell epitope in a single branched construct results in a peptide vaccine conferring total protection against foot-and-mouth disease virus in swine, a natural host (Cubillos et al. (2008) J. Virol. 82, 7223-7230). More recently, a downsized version of this prototype with only two copies of the B epitope has proven as effective as the tetravalent one in mice. Here we evaluate three approaches to bivalent platforms of this latter type, involving different chemistries for the conjugation of two B epitope peptides to a branching T epitope. Comparison of classical thioether, "reverse" thioether (Monsó et al. (2012) Org. Biomol. Chem. 10, 3116-3121) and thiol-ene conjugation chemistries in terms of synthetic efficiency clearly singles out the latter, maleimide-based strategy as most advantageous. We also examine how minor structural differences among the conjugates--including the N- or C-terminal attachment of the B epitope to the branching T epitope--bear on the immunogenicity of these vaccine candidates, with the maleimide-based conjugate again emerging as the most successful. |
{
"pile_set_name": "Github"
} | T=cd cf
V=x,y
R=-7.25+3.625i, 7.25-3.625i, 0.5-0.25i
F=x*y
C=x*y
|
{
"pile_set_name": "OpenWebText2"
} | How am I supposed to check my phone and follow the test rules at the same time?
Brian McElroy
So your exam can really be cancelled if you simply look away from the screen, even before the test begins?
I've been trying to take the online test for over an hour now, and I keep getting a variety of error messages from Pearson Vue...grrr.First I had problems with getting the workplace photos to work--even though I thought I had already taken care of that issue last night, it turns out that you have to do it all over again when the test begins. I tried over and over, and they were finally approved on the 3rd (or maybe 4th?) try. All I know is, Pearson Vue now has a ton of photos of me, my license and my daughter's room. : / I logged onto the test briefly, answered a single question confirming my identity, had some connection issues that got resolved, then, just as the test was about to begin, I was logged off by the proctor without any notice and locked out of the exam.Before that, there was a chat option available, but when I clicked on it, it just said something vague like "Thank you. A proctor will respond when available." I did get a chance to try out the online whiteboard and text editor, which was cool, but all I saw was a spinning circle while the test waited to load. I never even saw a single Quant question before the proctor closed the window and effectively ended the exam.Now I am no longer able to start / restart my exam from my mba.com account page, even though it indicates that the exam is "in progress":I tried over and over for this byzantine process to work, but it never quite did, even though I got very close. Just a bunch of mystery error messages, frozen loading screens, etc. I never even heard a proctor's voice on the other side. Neither did I receive a single chat message or phone call regarding any of my tech issues, even though the program said that the proctors would contact us by phone with any concerns. Disappointing to say the least.Also kind of weird that right before the exam is supposed to begin, they put you on camera and say "you must now obey all exam rules," but at the same time they tell you to check your phone for messages from the proctor.What a joke! Oh well. That's what I get for being an early adopter, I guess. I'l probably try again in a couple of weeks.Overall, this experience was highly discouraging and made my 6-hour long At-Home GRE on 4/5/20 seem fun by comparison. I would not recommend taking the just yet--there are currently too many bugs in the technology.-Brianp.s. I just explained to my wife everything that happened, and how the proctor logged me off just as the test was about to begin. She said, "maybe they saw that it wasand got scared."I picked the right gal, fellas.Update, 12:51 am PST:The saga continues...This gets more ridiculous by the hour. I was on camera waiting for the exam to start about 3 different times for probably 45 minutes total, so of course I looked off camera...to check my phone to see whether my proctors were calling me or sending me any messages about what was happening, as Pearson Vue had alerted me to do (see pics above). They weren't.Ugh. Give me the test center GMAT back.By the way, the email from Pearson Vue above was of the "**PLEASE DO NOT REPLY TO THIS EMAIL**" variety. Get ready for the red tape... |
{
"pile_set_name": "PubMed Abstracts"
} | Maternal Aneurysmal Subarachnoid Hemorrhage During Pregnancy as an Interdisciplinary Task.
Maternal aneurysmal subarachnoid hemorrhage (aSAH) during pregnancy presents a challenge regarding treatment and management. Due to the limited number of cases there are no treatment guidelines available. Thus, treatment is usually done on a case-by-case basis. Here we report on four cases of aSAH during pregnancy, describing the different management strategies and suggesting a possible treatment algorithm. Patients treated between 2003 and 2013 in our center were included in this retrospective study. Clinical data focused on time management concerning gestation week (GW), microsurgical or endovascular treatment, and outcome of the patients and the fetuses. Results were compared to the present literature on this issue. Mean age was 30.8 years, initial Hunt & Hess (H&H) grade ranged from III to V. All patients suffered from aSAH during the 3rd trimester of pregnancy. In the four cases, two emergency Caesarean sections (CS) were performed. Two aneurysms were occluded by microsurgical clipping and one was treated endovascularly. One patient died before definitive treatment of the aneurysm could be achieved, whereas fetal mortality was 0%. The mean follow-up was 83 months. aSAH during pregnancy needs individualized interdisciplinary management. Efforts must focus on the mother so that a delay in the best available treatment for the pregnant patient is avoided. Therefore treatment modality should be primarily determined by the aneurysm itself. However, timing in terms of delivery of the fetus and aneurysm treatment is a crucial point. |
{
"pile_set_name": "StackExchange"
} | Q:
Should you dispatch or call next multiple times inside of a Redux middleware?
I'm curious, I've seen in middlewares, such as redux-promise-middleware where we want a single action to fire off multiple actions (e.g. REQUEST, SUCCESS, FAILURE). However, in the middleware, we're provided the dispatch to be able to dispatch these actions. Is there a reason for calling these additional actions with next(action) over the dispatch(action)?
A:
If you dispatch an action then it will go through all of the middleware chain again. On the other hand next just sends it along to the next middleware in the chain or straight to the reducers if there aren't any more middlewares.
|
{
"pile_set_name": "Github"
} | # From https://lists.x.org/archives/xorg-announce/2016-November/002744.html
sha256 afba3289d7a40217a19d90db98ce181772f9ca6d77e1898727b0afcf02073b5a xf86-input-synaptics-1.9.0.tar.bz2
|
{
"pile_set_name": "Pile-CC"
} | Joined + Jointed
Born in Hong Kong, Samuel Chan’s schoolboy love for woodworking was taken to the next level after training for seven years in the UK. In 1995 he set up his own furniture company, Joined & Jointed, based on contemporary, enduring design. |
{
"pile_set_name": "PubMed Abstracts"
} | White blood cell count abnormalities and infections in one-year follow-up of 124 patients with SLE.
The purpose of our study was to evaluate the frequency of leukocyte count abnormalities in a large cohort of SLE patients and its association with infection. To make this evaluation, we studied consecutive patients with SLE diagnosis and prospectively followed them in the Coimbra Lupus Cohort. Data about white blood cell count abnormalities and infection during one-year follow-up were obtained. The presence of leukopenia, lymphopenia, and neutropenia was registered for one-year period. Infections were classified as severe or mild. We found that of the 124 patients who were included (91.1% female, mean age 41.2, mean disease duration 11.1), mild infections occurred in 43.5%, and severe in 3.2% of the patients. Twelve percent, 41.1%, and 4.8% of the patients had persistent leukopenia, lymphopenia, and neutropenia, respectively. Fourteen percent received a pneumococcal vaccination. Patients with neutropenia had a significantly higher number of infections (P = 0.033). Thus, our study showed that neutropenia was associated with an increased risk of infection during this one-year follow-up. Infections were frequent, but most of them were mild. |
{
"pile_set_name": "OpenWebText2"
} | I got the free bottle of the spicy agave since I love hot sauce and I’m always looking to try new kinds. This has to be one of my favorites. Perfect marriage of sweet and spicy. Definitely going to be a staple in my house from now on. Fortunately they sent me a 20% off coupon with my free bottle, must be they knew I would want more...
Jorden P. |
{
"pile_set_name": "Github"
} | #include <u.h>
#include <libc.h>
#include <draw.h>
extern vlong _drawflength(int);
int _fontpipe(char*);
int
parsefontscale(char *name, char **base)
{
char *p;
int scale;
p = name;
scale = 0;
while('0' <= *p && *p <= '9') {
scale = scale*10 + *p - '0';
p++;
}
if(*p == '*' && scale > 0)
*base = p+1;
else {
*base = name;
scale = 1;
}
return scale;
}
extern char _defontfile[];
Font*
openfont1(Display *d, char *name)
{
Font *fnt;
int fd, i, n, scale;
char *buf, *nambuf, *nambuf0, *fname, *freename;
nambuf = 0;
freename = nil;
scale = parsefontscale(name, &fname);
if(strcmp(fname, "*default*") == 0) {
buf = strdup(_defontfile);
goto build;
}
fd = open(fname, OREAD);
if(fd < 0 && strncmp(fname, "/lib/font/bit/", 14) == 0){
nambuf = smprint("#9/font/%s", fname+14);
if(nambuf == nil)
return 0;
nambuf0 = unsharp(nambuf);
if(nambuf0 != nambuf)
free(nambuf);
nambuf = nambuf0;
if(nambuf == nil)
return 0;
if((fd = open(nambuf, OREAD)) < 0){
free(nambuf);
return 0;
}
if(scale > 1) {
name = smprint("%d*%s", scale, nambuf);
freename = name;
} else {
name = nambuf;
}
}
if(fd >= 0)
n = _drawflength(fd);
if(fd < 0 && strncmp(fname, "/mnt/font/", 10) == 0) {
fd = _fontpipe(fname+10);
n = 1024*1024;
}
if(fd < 0){
free(nambuf);
free(freename);
return 0;
}
buf = malloc(n+1);
if(buf == 0){
close(fd);
free(nambuf);
free(freename);
return 0;
}
i = readn(fd, buf, n);
close(fd);
if(i <= 0){
free(buf);
free(nambuf);
free(freename);
return 0;
}
buf[i] = 0;
build:
fnt = buildfont(d, buf, name);
free(buf);
free(nambuf);
free(freename);
if(scale != 1) {
fnt->scale = scale;
fnt->height *= scale;
fnt->ascent *= scale;
fnt->width *= scale;
}
return fnt;
}
void
swapfont(Font *targ, Font **oldp, Font **newp)
{
Font f, *old, *new;
if(targ != *oldp)
sysfatal("bad swapfont %p %p %p", targ, *oldp, *newp);
old = *oldp;
new = *newp;
f.name = old->name;
f.display = old->display;
f.height = old->height;
f.ascent = old->ascent;
f.width = old->width;
f.nsub = old->nsub;
f.age = old->age;
f.maxdepth = old->maxdepth;
f.ncache = old->ncache;
f.nsubf = old->nsubf;
f.scale = old->scale;
f.cache = old->cache;
f.subf = old->subf;
f.sub = old->sub;
f.cacheimage = old->cacheimage;
old->name = new->name;
old->display = new->display;
old->height = new->height;
old->ascent = new->ascent;
old->width = new->width;
old->nsub = new->nsub;
old->age = new->age;
old->maxdepth = new->maxdepth;
old->ncache = new->ncache;
old->nsubf = new->nsubf;
old->scale = new->scale;
old->cache = new->cache;
old->subf = new->subf;
old->sub = new->sub;
old->cacheimage = new->cacheimage;
new->name = f.name;
new->display = f.display;
new->height = f.height;
new->ascent = f.ascent;
new->width = f.width;
new->nsub = f.nsub;
new->age = f.age;
new->maxdepth = f.maxdepth;
new->ncache = f.ncache;
new->nsubf = f.nsubf;
new->scale = f.scale;
new->cache = f.cache;
new->subf = f.subf;
new->sub = f.sub;
new->cacheimage = f.cacheimage;
*oldp = new;
*newp = old;
}
static char*
hidpiname(Font *f)
{
char *p, *q;
int size;
// If font name has form x,y return y.
p = strchr(f->namespec, ',');
if(p != nil)
return strdup(p+1);
// If font name is /mnt/font/Name/Size/font, scale Size.
if(strncmp(f->name, "/mnt/font/", 10) == 0) {
p = strchr(f->name+10, '/');
if(p == nil || *++p < '0' || *p > '9')
goto scale;
q = p;
size = 0;
while('0' <= *q && *q <= '9')
size = size*10 + *q++ - '0';
return smprint("%.*s%d%s", utfnlen(f->name, p-f->name), f->name, size*2, q);
}
// Otherwise use pixel doubling.
scale:
return smprint("%d*%s", f->scale*2, f->name);
}
void
loadhidpi(Font *f)
{
char *name;
Font *fnew;
if(f->hidpi == f)
return;
if(f->hidpi != nil) {
swapfont(f, &f->lodpi, &f->hidpi);
return;
}
name = hidpiname(f);
fnew = openfont1(f->display, name);
if(fnew == nil)
return;
f->hidpi = fnew;
free(name);
swapfont(f, &f->lodpi, &f->hidpi);
}
Font*
openfont(Display *d, char *name)
{
Font *f;
char *p;
char *namespec;
// If font name has form x,y use x for lodpi, y for hidpi.
name = strdup(name);
namespec = strdup(name);
if((p = strchr(name, ',')) != nil)
*p = '\0';
f = openfont1(d, name);
if(!f)
return nil;
f->lodpi = f;
free(f->namespec);
f->namespec = namespec;
/* add to display list for when dpi changes */
/* d can be nil when invoked from mc. */
if(d != nil) {
f->ondisplaylist = 1;
f->prev = d->lastfont;
f->next = nil;
if(f->prev)
f->prev->next = f;
else
d->firstfont = f;
d->lastfont = f;
/* if this is a hi-dpi display, find hi-dpi version and swap */
if(d->dpi >= DefaultDPI*3/2)
loadhidpi(f);
}
free(name);
return f;
}
int
_fontpipe(char *name)
{
int p[2];
char c;
char buf[1024], *argv[10];
int nbuf, pid;
if(pipe(p) < 0)
return -1;
pid = rfork(RFNOWAIT|RFFDG|RFPROC);
if(pid < 0) {
close(p[0]);
close(p[1]);
return -1;
}
if(pid == 0) {
close(p[0]);
dup(p[1], 1);
dup(p[1], 2);
if(p[1] > 2)
close(p[1]);
argv[0] = "fontsrv";
argv[1] = "-pp";
argv[2] = name;
argv[3] = nil;
execvp("fontsrv", argv);
print("exec fontsrv: %r\n");
_exit(0);
}
close(p[1]);
// success marked with leading \001.
// otherwise an error happened.
for(nbuf=0; nbuf<sizeof buf-1; nbuf++) {
if(read(p[0], &c, 1) < 1 || c == '\n') {
buf[nbuf] = '\0';
werrstr(buf);
close(p[0]);
return -1;
}
if(c == '\001')
break;
}
return p[0];
}
|
{
"pile_set_name": "StackExchange"
} | Q:
Joining two records with the same key
Let's say I have these two objects:
public class Employee : Person
{
public string Something { get; set; }
}
public class Person
{
public int Id { get; set; }
public string FirstName { get; set; }
public string LastName { get; set; }
}
Now I have to deal with a given database schema, that looks like follows:
CREATE TABLE employee (
id INTEGER PRIMARY KEY,
something TEXT
);
CREATE TABLE person (
id INTEGER PRIMARY KEY,
firstname TEXT,
lastname TEXT
);
(Both share the same id, so they can be joined together to a single record in a query.)
Question: Do I have a chance to get this resolved by sqlite-net with SQLite-Net Extensions? And if so: how would that work?
A:
SQLite.Net mapping flattens the object hierarchy into a single table, so if you let SQLite.Net create the tables you will obtain these completely unrelated tables:
CREATE TABLE employee (
id INTEGER PRIMARY KEY,
firstname TEXT,
lastname TEXT,
something TEXT
);
CREATE TABLE person (
id INTEGER PRIMARY KEY,
firstname TEXT,
lastname TEXT
);
Changes to the latter won't affect the previous and vice versa. You will be able to use custom queries for reading and writing, but you won't be able to to use any of the utility methods of SQLite.Net with that schema and those classes.
Depending on your needs, you could add intermediate classes that will be used in database operations and then map them to model classes. Something like this:
[Table("employee")]
public class DBEmployee
{
[PrimaryKey]
public int Id { get; set; }
public string Something { get; set; }
}
[Table("person")]
public class DBPerson
{
[AutoIncrement, PrimaryKey]
public int Id { get; set; }
public string FirstName { get; set; }
public string LastName { get; set; }
}
public class DBService {
static SQLiteConnection _connection;
public void SaveEmployee(Employee employee) {
var dbPerson = new DBPerson {
FirstName = employee.FirstName,
LastName = employee.LastName
};
_connection.Insert(dbPerson);
var dbEmployee = new DBEmployee {
Id = dbPerson.Id,
Something = employee.Something
};
_connection.Insert(dbEmployee);
}
public Employee GetEmployee(int employeeId) {
var dbEmployee = _connection.Get<DBEmployee>(employeeId);
var dbPerson = _connection.Get<DBPerson>(employeeId);
return new Employee {
Id = employeeId,
Something = dbEmployee.Something,
FirstName = dbPerson.FirstName,
LastName = dbPerson.LastName
};
}
}
You could use AutoMapper or equivalent to make mapping code more readable and maintainable.
|
{
"pile_set_name": "PubMed Abstracts"
} | Role of mycoplasma strain F38 in contagious caprine pleuropneumonia.
The role of the F38 group of mycoplasma in contagious caprine pleuropneumonia is assessed with reference to certain criteria whereby a causative relationship between a particular agent and the disease in question is established. The evidence that Mycoplasma mycoides subsp. mycoides (large colony) or M. mycoides subsp. capri may be involved in the disease is similarly considered. |
{
"pile_set_name": "StackExchange"
} | Q:
What is the purpose of ASP.NET MVC Generic Controller
I am newbie in asp.net mvc. I heard the word ASP.NET MVC generic controller, can anyone easily explain what it is? I have worked with the default controller before but now I want to able to visualize the kind of purpose ASP.NET MVC generic controller does. It will be very helpful if some one can explain the situations when a developer has to think about using ASP.NET MVC generic controller. Concepts and code about how to implement it will be greatly appreciated. Thanks
A:
You usually create a generic class to abstract away operations you can perform on a range of types, for example Entity Framework models containing an ID. In that case you can move all duplicate code into a base class.
For an MVC controller, a generic base controller may look like this:
public abstract class GenericController<T>
where T : class
{
public virtual ActionResult Details(int id)
{
var model = _repository.Set<T>().Find(id);
return View(model);
}
}
And an implementation like this:
public class FooController : GenericController<Foo>
{
}
Now when someone requests /Foo/Details/42, the entitiy is pulled from the _repository's Set<Foo>(), without having to write anything for that in the FooController.
This way you can create a basic "CRUD" controller that lets you easily extend your application with Create, Read, Update and Delete operations for new models.
|
{
"pile_set_name": "Pile-CC"
} | Here is another papercraft turkey to get you in the mood for Thanksgiving. This one is a bit lot more realistic than the one we made a while back.
As we head into the shortened Thanksgiving week, we’d like to offer our traditional holiday papercraft project. This delectable roast turkey was found on a Japanese site. We’ve bundled the templates into a single PDF: |
{
"pile_set_name": "Github"
} | /*
* Copyright 2010-2015 Amazon.com, Inc. or its affiliates. All Rights Reserved.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at:
*
* http://aws.amazon.com/apache2.0
*
* This file is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES
* OR CONDITIONS OF ANY KIND, either express or implied. See the
* License for the specific language governing permissions and
* limitations under the License.
*/
package com.amazonaws.util.json;
import static org.junit.Assert.assertEquals;
import static org.junit.Assert.assertFalse;
import static org.junit.Assert.assertNotNull;
import static org.junit.Assert.assertNull;
import static org.junit.Assert.assertTrue;
import static org.junit.Assert.fail;
import org.junit.Test;
import java.io.IOException;
import java.io.StringReader;
import java.io.StringWriter;
import java.nio.ByteBuffer;
import java.util.Date;
import java.util.HashMap;
import java.util.Map;
public class JsonUtilsTest {
private static final String JSON_STRING = "{\"string\":\"string\","
+ "\"long\":123,"
+ "\"double\":123.45,"
+ "\"null\":null,"
+ "\"true\":true,"
+ "\"false\":false,"
+ "\"encoding\":\"Chloë\","
+ "\"array\":[\"string\",123,123.45,null,true,false],"
+ "\"object\":{}"
+ "}";
private static final String JSON_STRING_WITH_ARRAYS = "{\"string\":\"string\","
+ "\"long\":123,"
+ "\"double\":123.45,"
+ "\"null\":null,"
+ "\"true\":true,"
+ "\"false\":false,"
+ "\"encoding\":\"Chloë\","
+ "\"array\":[\"string\",123,123.45,null,true,false],"
+ "\"array2\":[{\"key1\":\"string1\"},{\"key2\":\"string2\"}],"
+ "\"array3\":[{\"key1\":123.45},{\"key2\":false}],"
+ "\"array4\":[\"string\",123,[\"string\",123,123.45,null,true,false],123.45,null,true],"
+ "\"array5\":[{\"key1\":\"string1\"},{\"key2\":[{\"key3\":\"string2\"}]},{\"key3\":\"string3\"}],"
+ "\"array6\":[[],[[]]],"
+ "\"array7\":[],"
+ "\"array8\":[null],"
+ "\"array9\":[\"A\",{\"B\":[[]]},\"C\",[[]],\"D\",null],"
+ "\"object\":{}"
+ "}";
@Test
public void testJsonToMap() {
Map<String, String> map = JsonUtils.jsonToMap(JSON_STRING);
assertEquals("string value", "string", map.get("string"));
assertEquals("long value", "123", map.get("long"));
assertEquals("double value", "123.45", map.get("double"));
assertEquals("null value", null, map.get("null"));
assertEquals("true value", "true", map.get("true"));
assertEquals("false value", "false", map.get("false"));
assertEquals("encoding", "Chloë", map.get("encoding"));
assertNull("array is ignored", map.get("array"));
assertNull("object is ignored", map.get("object"));
}
@Test
public void testJsonToMapWithList() {
Map<String, String> map = JsonUtils.jsonToStringMapWithList(new StringReader(JSON_STRING_WITH_ARRAYS));
Map<String, String> actualMap = new HashMap<>();
actualMap.put("string", "string");
actualMap.put("long", "123");
actualMap.put("double", "123.45");
actualMap.put("null", null);
actualMap.put("true", "true");
actualMap.put("false", "false");
actualMap.put("encoding", "Chloë");
actualMap.put("array", "[\"string\",\"123\",\"123.45\",null,\"true\",\"false\"]");
actualMap.put("array2", "[{\"key1\":\"string1\"},{\"key2\":\"string2\"}]");
actualMap.put("array3", "[{\"key1\":\"123.45\"},{\"key2\":\"false\"}]");
actualMap.put("array4", "[\"string\",\"123\",\"123.45\",null,\"true\"]");
actualMap.put("array5", "[{\"key1\":\"string1\"},{},{\"key3\":\"string3\"}]");
actualMap.put("array6", "[]");
actualMap.put("array7", "[]");
actualMap.put("array8", "[null]");
actualMap.put("array9", "[\"A\",{},\"C\",\"D\",null]");
assertEquals(actualMap, map);
}
@Test
public void testMapToJson() {
Map<String, String> source = new HashMap<String, String>();
source.put("string", "string");
source.put("long", "123");
source.put("double", "123.45");
source.put("null", null);
source.put("true", "true");
source.put("false", "false");
source.put("encoding", "Chloë");
String json = JsonUtils.mapToString(source);
Map<String, String> map = JsonUtils.jsonToMap(json);
assertEquals("string value", "string", map.get("string"));
assertEquals("long value", "123", map.get("long"));
assertEquals("double value", "123.45", map.get("double"));
assertEquals("null value", null, map.get("null"));
assertEquals("true value", "true", map.get("true"));
assertEquals("false value", "false", map.get("false"));
assertEquals("encoding", "Chloë", map.get("encoding"));
}
@Test
public void testEmptyMapToJson() {
Map<String, String> source = new HashMap<String, String>();
assertEquals("empty map", "{}", JsonUtils.mapToString(source));
}
@Test
public void testNullJsonToMap() {
String nullStr = null;
Map<String, String> map = JsonUtils.jsonToMap(nullStr);
assertNotNull("map isn't null", map);
assertTrue("map is empty", map.isEmpty());
}
@Test
public void testEmptyJsonToMap() {
String json = "";
Map<String, String> map = JsonUtils.jsonToMap(json);
assertTrue("empty string", map.isEmpty());
}
@Test
public void testJsonReader() throws IOException {
AwsJsonReader reader = JsonUtils.getJsonReader(new StringReader(JSON_STRING));
reader.beginObject();
assertTrue("has properties", reader.hasNext());
while (reader.hasNext()) {
String name = reader.nextName();
if (name.equals("string")) {
assertTrue("VALUE_STRING", AwsJsonToken.VALUE_STRING == reader.peek());
assertEquals("string value", "string", reader.nextString());
} else if (name.equals("long")) {
assertTrue("VALUE_NUMBER", AwsJsonToken.VALUE_NUMBER == reader.peek());
assertEquals("long value", "123", reader.nextString());
} else if (name.equals("double")) {
assertTrue("VALUE_NUMBER", AwsJsonToken.VALUE_NUMBER == reader.peek());
assertEquals("double value", "123.45", reader.nextString());
} else if (name.equals("null")) {
assertTrue("VALUE_NULL", AwsJsonToken.VALUE_NULL == reader.peek());
assertNull("null value", reader.nextString());
} else if (name.equals("true")) {
assertTrue("VALUE_BOOLEAN", AwsJsonToken.VALUE_BOOLEAN == reader.peek());
assertEquals("true value", "true", reader.nextString());
} else if (name.equals("false")) {
assertTrue("VALUE_BOOLEAN", AwsJsonToken.VALUE_BOOLEAN == reader.peek());
assertEquals("false value", "false", reader.nextString());
} else if (name.equals("encoding")) {
assertTrue("VALUE_STRING", AwsJsonToken.VALUE_STRING == reader.peek());
assertEquals("encoding", "Chloë", reader.nextString());
} else if (name.equals("array")) {
assertTrue("BEGIN_ARRAY", AwsJsonToken.BEGIN_ARRAY == reader.peek());
reader.beginArray();
assertTrue("has next", reader.hasNext());
assertEquals("string value", "string", reader.nextString());
assertEquals("long value", "123", reader.nextString());
assertEquals("double value", "123.45", reader.nextString());
assertNull("null value", reader.nextString());
assertEquals("true value", "true", reader.nextString());
assertEquals("false value", "false", reader.nextString());
reader.endArray();
} else if (name.equals("object")) {
assertTrue("BEGIN_OBJECT", AwsJsonToken.BEGIN_OBJECT == reader.peek());
reader.beginObject();
assertFalse("empty object", reader.hasNext());
reader.endObject();
} else {
fail("should not reach here");
}
}
reader.endObject();
}
@Test
public void testJsonWriter() throws IOException {
StringWriter out = new StringWriter();
AwsJsonWriter writer = JsonUtils.getJsonWriter(out);
writer.beginObject()
.name("string").value("string")
.name("long").value(123)
.name("double").value(123.45)
.name("null").value()
.name("true").value(true)
.name("false").value(false)
.name("encoding").value("Chloë")
.name("array").beginArray()
.value("string").value(123).value(123.45).value().value(true).value(false)
.endArray()
.name("object").beginObject().endObject()
.endObject().close();
String json = out.toString();
assertEquals("same json", JSON_STRING, json);
}
@Test
public void testReadPerformance() throws IOException {
Map<String, String> map = new HashMap<String, String>();
for (int i = 0; i < 5000; i++) {
map.put("key" + i, "value" + i);
}
String json = JsonUtils.mapToString(map);
System.out.println("Serialize a 5000 properties map 1000 times");
long start = System.nanoTime();
for (int i = 0; i < 1000; i++) {
JsonUtils.jsonToMap(json);
}
System.out.println("Read elapsed: "
+ (System.nanoTime() - start) / 1000000 + "ms");
}
@Test
public void testWritePerformance() throws IOException {
Map<String, String> map = new HashMap<String, String>();
for (int i = 0; i < 5000; i++) {
map.put("key" + i, "value" + i);
}
System.out.println("Deserialize a JSON string with a 5000 properties map 1000 times");
long start = System.nanoTime();
for (int i = 0; i < 1000; i++) {
JsonUtils.mapToString(map);
}
System.out.println("Write elapsed: "
+ (System.nanoTime() - start) / 1000000 + "ms");
}
@Test
public void testDate() throws IOException {
Date d = new Date(1423875641895L);
String target = "1423875641.895";
StringWriter out = new StringWriter();
// This is wrapped in an array so that JsonWriter doesn't complain about
// invalid JSON encoding
JsonUtils.getJsonWriter(out)
.beginArray().value(d).endArray()
.close();
assertEquals("[" + target + "]", out.toString());
out.getBuffer().setLength(0); // clear string writer
}
@Test
public void testByteBuffer() throws IOException {
ByteBuffer bb = generateByteBuffer(16);
// Note: the target string is back filled with the output of the above
// byte buffer
String target = "AAECAwQFBgcICQoLDA0ODw==";
StringWriter out = new StringWriter();
JsonUtils.getJsonWriter(out)
.beginArray().value(bb).endArray()
.close();
assertEquals("[\"" + target + "\"]", out.toString());
out.getBuffer().setLength(0);
}
private ByteBuffer generateByteBuffer(int length) {
byte[] bytes = new byte[length];
for (int i = 0; i < length; i++) {
bytes[i] = (byte) (i % Byte.MAX_VALUE);
}
return ByteBuffer.wrap(bytes);
}
}
|
{
"pile_set_name": "Pile-CC"
} | Using Business Rule For Data Import Validation
Recently, I saw one question in a CRM forum where the user was interested in using Business Rules to implement data validation for Data Import. So can we do that? The answer is yes, of course we can do that, the business provides support to run your logic on the server side. If you don’t know about this, check our earlier article first, but from the end-user perspective, it will not be helpful.
Let’s see this in action using a quick business rule on Contact entity. Suppose we have a couple of fields which are required and we want to cancel data import if those sets of fields are missing an import file. Let’s say we want to enforce the user to supply contact’s email and phone number:
So let’s setup quick business rules for contact entity to show the error message if contact’s email or phone number is null. |
{
"pile_set_name": "StackExchange"
} | Q:
circle with dfferent colours representing different criteria
I want to draw circles on maps with different colours, this gives the signal strength of the tower, suppose circle is of 50 m then first 20m should be given a color1 and next 20 m color2 and remaining color3.
Is this possible in Geoserver SLD or openlayers? How?
A:
Look at that! Someone has already asked for drawing circles and it has already been answered.
Regarding colors, you should use OpenLayers.Style(); and have a look on OL doc and eventually on the wiki page.
|
{
"pile_set_name": "Github"
} | GL_EXT_framebuffer_multisample_blit_scaled
http://www.opengl.org/registry/specs/gl/EXT/framebuffer_multisample_blit_scaled.txt
GL_EXT_framebuffer_multisample_blit_scaled
GL_SCALED_RESOLVE_FASTEST_EXT 0x90BA
GL_SCALED_RESOLVE_NICEST_EXT 0x90BB
|
{
"pile_set_name": "Wikipedia (en)"
} | Jeffrey Saad
Jeffrey Saad (born c. 1967) is an American chef, author, restaurant owner, television personality, and real estate broker from Chicago, Illinois. He is currently the host of United Tastes of America on the Cooking Channel and Estate Director with Compass in Beverly Hills.
Career
Saad became interested in the culinary business when he was a teenager working at a diner behind his junior high school. Later in his life, he enrolled in the Hotel Restaurant Management Program at Iowa State University. There he earned the title of chef de cuisine during his sophomore year. He continued studies at the Culinary Institute of America and the California Culinary Academy. He performed his internship in London, with Anton Mosimann.
In 1993 Saad traveled to Mexico looking to expand his knowledge of the Mexican cuisine. This led him to open a Mexican-influenced restaurant called Sweet Heat in San Francisco. After that, he opened two more restaurants and started his own signature line of bottled chutneys. Among his culinary and business ventures, he became a partner of California's Pasta Pomodoro Italian Restaurants. After that, Saad moved to Los Angeles with his wife and they both started running a real estate company.
In 2009 Saad auditioned for the fifth season of the show The Next Food Network Star. He ended up as the first runner-up, losing to Melissa d'Arabian in the finale. However, Food Network gave him the opportunity to host his own web series called Spice Smuggler, where he highlighted spices and foods from other countries. The web series ran for a year, and then Cooking Channel asked him to be the host of the show United Tastes of America.
Saad is a partner and executive chef of "The Grove" restaurants in San Francisco. He also distributes his own collection of spice blends. In 2012, Saad released his first cookbook titled Jeffrey Saad's Global Kitchen: Recipes Without Borders. On December 9, 2013, he opened the restaurant, La Ventura in Studio City, California.
Television appearances
In addition to his own shows, Saad has appeared on these other cooking shows:
Grill It! with Bobby Flay
Unique Sweets
Unique Cocktails
The Rachael Ray Show
Iron Chef America Countdown
ABC World News Now
In 2012 he competed in Food Network's Chopped All-Stars. Saad ended up in second place, behind Marcus Samuelsson, but above chefs like Keegan Gerhard, Aarti Sequeira, and Michael Symon.
Personal life
Saad lives in Los Angeles with his wife, Nadia, and two children. His wife is of Iranian descent. Saad enjoys surfing and mountain biking. He also practices taekwondo. He began practicing it while studying in college, and reached black belt under Master Brandt in San Francisco. He also practiced at the Southern California Tae Kwon Do Center under Scot Lewis where he received his second degree black belt.
References
External links
Category:1960s births
Category:American restaurateurs
Category:American television chefs
Category:Male chefs
Category:Businesspeople from Chicago
Category:Culinary Institute of America alumni
Category:Date of birth missing (living people)
Category:Food Network Star contestants
Category:Living people
Category:Participants in American reality television series
Category:Reality cooking competition contestants |
{
"pile_set_name": "PubMed Abstracts"
} | Desensitization at the interface.
Normal brain function requires the faithful transmission and integration of information on a timescale of milliseconds, and this rapid signaling is mediated by cell membrane receptors that are ligand-gated ion channels. Fast excitatory transmission occurs when synaptically released glutamate opens channels in neighboring neurons, but these channels desensitize rapidly during sustained high-frequency firing. Recent structural data have begun to provide important insights into the molecular mechanisms that underlie channel activation and desensitization. |
{
"pile_set_name": "Wikipedia (en)"
} | Richland, Holmes County, Mississippi
Richland is an unincorporated community in Holmes County, Mississippi, located approximately northwest of Goodman and approximately north of Pickens.
History
The Eureka Masonic College
Historic Eureka Masonic College, birthplace of the Order of the Eastern Star (OES), is located along Highway 17, in the unincorporated community of Richland. The historic schoolhouse has also housed Masons and Company C, 15th Mississippi Infantry, of the Confederate States Army, during the American Civil War.
Presentation of Colors (1863)
The 1st Mississippi Cavalry, of the Confederate States Army, was presented with its regimental colors on September 12, 1863, a gift of the ladies of Richland.
References
See also
National Register of Historic Places listings in Holmes County, Mississippi
External links
Richland (Holmes County)
Richland (Holmes County), Mississippi
Richland
Richland (Holmes County) |
{
"pile_set_name": "Pile-CC"
} | Director of Hollywood blockbuster ‘Kong: Skull Island’ Jordan Vogt-Roberts, who has been named Honorary Tourism Ambassador of Vietnam posted a number of beautiful photos of Son Doong Cave on his Instagram.
The director has spent three days on a solo trip inside Son Doong cave, one of the most special and wonderful places in the world.
Roberts also called on people to conquer the world’s largest cave because there is no place like this on Earth.
The cave is located in the heart of Phong Nha - Ke Bang National Park in the central Quang Binh province. Son Doong was discovered by a local in 1991. It was first explored in 2009 by the British Cave Research Association and has been open to the public since 2013.
The 1,645m-long cave system, which extends through a mountain, was named one of the most captivating caves on earth by National Geographic.
Geologists say the cave formed two to five million years ago. It is roughly 6,5km long, 200m high and 150m wide, exceeding the former world record of Deer Cave in Gunung Muli National Park in Malaysia.
Kong director posed for photos in Song Dong Cave.
“One of the most beautiful and relaxing thing I’ve ever seen was watching small streams of water fall from the cave’s roof hundreds of feet above me. Because it was such a far distance and there’s such a large draft inside the cave, you could lay on the ground and watch the mini-waterfalls dance around in the sky and change directions slowly until they would land on you. It was remarkable”, Roberts wrote on his Instagram.
Each tour requires a team of 25 porters and cooks, a tour guide, two cave experts and two park rangers.
Currently, the 2017 trips, on sale on the website of Oxalis Adventure Tours, the sole operator, offer five-day and four-night tours with a maximum of ten people at the cost of US$ 3,000 per person during the January-August period.
Visitors need to ensure they are in good health before embarking on the adventurous trip. People who suffer from high blood pressure, cardiovascular disease, joint problems or diabetes are not eligible for the trip. |
{
"pile_set_name": "OpenWebText2"
} | A pack of super cute mix matched socks! It's a good thing they're child sized, otherwise I would probably wear them instead of using them for sock critters. |
{
"pile_set_name": "Github"
} | using UnityEngine.SceneManagement;
namespace ET
{
public class SceneChangeComponentUpdateSystem: UpdateSystem<SceneChangeComponent>
{
public override void Update(SceneChangeComponent self)
{
if (!self.loadMapOperation.isDone)
{
return;
}
if (self.tcs == null)
{
return;
}
ETTaskCompletionSource tcs = self.tcs;
self.tcs = null;
tcs.SetResult();
}
}
public class SceneChangeComponentDestroySystem: DestroySystem<SceneChangeComponent>
{
public override void Destroy(SceneChangeComponent self)
{
self.loadMapOperation = null;
self.tcs = null;
}
}
public static class SceneChangeComponentSystem
{
public static async ETTask ChangeSceneAsync(this SceneChangeComponent self, string sceneName)
{
self.tcs = new ETTaskCompletionSource();
// 加载map
self.loadMapOperation = SceneManager.LoadSceneAsync(sceneName);
//this.loadMapOperation.allowSceneActivation = false;
await self.tcs.Task;
}
public static int Process(this SceneChangeComponent self)
{
if (self.loadMapOperation == null)
{
return 0;
}
return (int)(self.loadMapOperation.progress * 100);
}
}
} |
{
"pile_set_name": "PubMed Abstracts"
} | Emergency coronary stenting for acute occlusive dissection of the left main coronary artery.
Catheter-induced left main coronary artery dissection is a rare but serious complication of diagnostic cardiac angiography. We report the case of a patient with mitral regurgitation and accidental dissection of the left main coronary artery successfully managed with intracoronary stent that allowed emergent surgical revascularization and mitral replacement. |
{
"pile_set_name": "Pile-CC"
} | AutoYaST enables you to install the SLES operating system on multiple systems. For information
about how to prepare an automated installation using AutoYaST, refer to the Novell SUSE
documentation collection at:
From the Oracle ILOM web interface, select Host Management > Power Control in the navigation tree. Then, select Reset
from the Select Action list box and click Save.
From the local server, press the Power button (approximately 1 second) on the front panel of
the server to power off the server, then press the Power button again
to power on the server.
From the Oracle ILOM CLI on the server SP, type: reset /System
The BIOS screen appears.
Note - The next events occur very quickly; therefore, focused attention is needed for these
steps. Watch carefully for the messages as they appear on the screen for
a brief time. You might want to enlarge the size of your screen
to eliminate scroll bars. |
{
"pile_set_name": "Pile-CC"
} | Washington: A new study has recently revealed that music cuts across cultures as it can make people from different ethnicity, like from Pygmies to hipsters , feel similarly excited or calm.
A team of researchers from McGill University, Technische Universitat Berlin, and l'Universite de Montreal arrived at the conclusion that certain aspects of our reactions to music are universal, after travelling deep into the rainforest to play music to a very isolated group of people, the Mbenzele Pygmies, who live without access to radio, television or electricity.
They then compared how the Mbenzele responded both to their own and to unfamiliar Western music, with the way that a group of Canadians (in not-so-remote downtown Montreal) responded to the same pieces.
The researchers explained that although the groups felt quite differently about whether specific pieces of music made them feel good or bad, their subjective and physiological responses to how exciting or calming they found the music to be appeared to be universal.
The main difference between Pygmy and Canadian listeners was that the Canadians described themselves as feeling a much wider range of emotions as they listened to the Western music than the Pygmies felt when listening to either their own or Western music. This was probably attributable to the varying roles that music plays in each culture.
Nathalie Fernando of l'Universite de Montreal's Faculty of Music said that negative emotions disturb the harmony of the forest in Pygmy culture and are therefore dangerous.
The study is published in the open-access journal Frontiers in Psychology. |
{
"pile_set_name": "Github"
} | /**
* Outline support.
*
* @copyright 2012, Ajax.org B.V.
* @license GPLv3 <http://www.gnu.org/licenses/gpl.txt>
*/
define(function(require, exports, module) {
var ide = require("core/ide");
var ext = require("core/ext");
var settings = require("core/settings");
var editors = require("ext/editors/editors");
var Range = require("ace/range").Range;
var menus = require("ext/menus/menus");
var commands = require("ext/commands/commands");
var gotofile = require("ext/gotofile/gotofile");
var search = require("ext/gotofile/search");
var outline;
module.exports = {
nodes: [],
fullOutline : [],
filteredOutline : [],
ignoreSelectOnce : false,
isDirty : false,
isKeyDownAfterDirty : false,
lastGoToFileText : "",
lastOutlineText : "@",
hook: function(oExt, worker) {
this.worker = worker;
var _self = this;
outline = oExt;
worker.on("outline", function(event) {
_self.openOutline(event);
});
commands.addCommand({
name: "outline",
hint: "search for a definition and jump to it",
bindKey: {mac: "Command-Shift-E", win: "Ctrl-Shift-E"},
isAvailable : function(editor) {
return editor && editor.path == "ext/code/code";
},
exec: function () {
_self.updateOutline(true);
}
});
var mnuItem = new ppc.item({
command : "outline"
});
this.nodes.push(
menus.addItemByPath("Tools/Quick Outline", mnuItem, 100),
menus.addItemByPath("Goto/Goto Definition...", mnuItem.cloneNode(false), 110)
);
ide.addEventListener("init.ext/gotofile/gotofile", function() {
var selStart, selEnd;
dgGoToFile.parentNode.insertBefore(treeOutline, dgGoToFile);
txtGoToFile.addEventListener("afterchange", function(e) {
_self.onAfterChange(e);
}, true);
txtGoToFile.addEventListener("keydown", function(e) {
_self.onKeyDown(e);
});
txtGoToFile.addEventListener("keyup", function(e) {
_self.onKeyUp(e);
});
treeOutline.addEventListener("onafterselect", function() {
_self.onSelect(treeOutline.selected);
});
treeOutline.addEventListener("onafterchoose", function() {
_self.ignoreSelectOnce = false;
_self.onSelect(treeOutline.selected);
gotofile.toggleDialog(-1);
});
treeOutline.addEventListener("click", function(e) {
_self.ignoreSelectOnce = false;
_self.onSelect(treeOutline.selected);
var COLLAPSE_AREA = 14;
if (e.htmlEvent.x >= treeOutline.$container.getClientRects()[0].left + 14)
gotofile.toggleDialog(-1);
});
txtGoToFile.addEventListener("blur", function() {
selStart = txtGoToFile.$input.selectionStart;
selEnd = txtGoToFile.$input.selectionEnd;
});
treeOutline.addEventListener("focus", function() {
txtGoToFile.focus();
if (selStart && selEnd) {
txtGoToFile.$input.selectionStart = selStart;
txtGoToFile.$input.selectionEnd = selEnd;
}
});
winGoToFile.addEventListener("prop.visible", function(e) {
if (!e.value)
_self.showGoToFile();
});
var editor = editors.currentEditor.amlEditor.$editor;
treeOutline.bufferselect = false;
});
},
outlineJsonToXml: function(array, selected, tag) {
var xmlS = [];
for (var i = 0; i < array.length; i++) {
var elem = array[i];
var pos = elem.displayPos || elem.pos;
xmlS.push('<'); xmlS.push(tag); xmlS.push(' name="'); xmlS.push(elem.name.replace(/"/g, "''"));
xmlS.push('" icon="' + (elem.icon || "method"));
xmlS.push('" sl="'); xmlS.push(pos.sl);
xmlS.push('" el="'); xmlS.push(pos.el);
xmlS.push('" sc="'); xmlS.push(pos.sc);
xmlS.push('" ec="'); xmlS.push(pos.ec);
xmlS.push('" elx="'); xmlS.push(elem.pos.el);
elem.meta && xmlS.push('" meta="') && xmlS.push(elem.meta);
if (elem === selected)
xmlS.push('" selected="true');
xmlS.push('">\n');
xmlS = xmlS.concat(this.outlineJsonToXml(elem.items, selected, 'entry'));
xmlS.push('</'); xmlS.push(tag); xmlS.push('>');
}
return xmlS.join('');
},
updateOutline : function(showNow, ignoreInputText) {
this.showOutline(showNow, ignoreInputText);
/* TODO: set loading message if file has changed
treeOutline.$setClearMessage(treeOutline["loading-message"], "loading");
ppc.setOpacity(winGoToFile.$ext, 1);
*/
this.worker.emit("outline", { data : { ignoreFilter: showNow } });
},
findCursorInOutline: function(json, cursor) {
for (var i = 0; i < json.length; i++) {
var elem = json[i];
if(cursor.row < elem.pos.sl || cursor.row > elem.pos.el)
continue;
var inChildren = this.findCursorInOutline(elem.items, cursor);
return inChildren ? inChildren : elem;
}
return null;
},
openOutline : function(event) {
var data = event.data;
if (data.error) {
// TODO: show error in outline?
console.log("Oh noes! " + data.error);
return;
}
var editor = editors.currentEditor;
if (!editor || editor.path != "ext/code/code" || !editor.amlEditor)
return;
this.fullOutline = event.data.body;
var ace = editor.amlEditor.$editor;
var cursor = ace.getCursorPosition();
this.$originalLine = cursor.row + 1;
this.$originalColumn = cursor.column;
// var selected = this.renderOutline(event.data.showNow);
this.renderOutline(event.data.showNow);
if (txtGoToFile.value.match(/^@/))
this.showOutline();
// UNDONE: Scroll to selected
// if (event.data.showNow)
// this.scrollToSelected(selected);
},
/**
* Show the outline view in the goto dialog,
* instead of the file list.
*/
showOutline: function(makeVisible, ignoreInputText) {
ext.initExtension(outline);
ext.initExtension(gotofile);
if (makeVisible) {
gotofile.toggleDialog(1);
txtGoToFile.focus();
this.showOutline();
if (txtGoToFile.value.length > 0)
txtGoToFile.$input.selectionStart = 1;
this.scrollToTop();
}
gotofile.setEventsEnabled(false);
if (!dgGoToFile.getProperty("visible"))
return;
if (!txtGoToFile.value.match(/^@/) && !ignoreInputText) {
this.lastGoToFileText = txtGoToFile.value;
txtGoToFile.setValue(this.lastOutlineText);
}
this.ignoreSelectOnce = true;
dgGoToFile.hide();
treeOutline.show();
if (makeVisible)
txtGoToFile.$input.selectionStart = 1;
},
showGoToFile: function() {
gotofile.setEventsEnabled(true);
if (dgGoToFile.getProperty("visible"))
return;
if (txtGoToFile.value.match(/^@/)) {
this.lastOutlineText = txtGoToFile.value;
txtGoToFile.setValue(this.lastGoToFileText);
}
gotofile.filter(txtGoToFile.value, false, true);
dgGoToFile.show();
treeOutline.hide();
},
renderOutline: function(ignoreFilter) {
var editor = editors.currentEditor;
if (!editor || editor.path != "ext/code/code" || !editor.amlEditor)
return;
ext.initExtension(gotofile);
var filter = ignoreFilter ? "" : txtGoToFile.value.substr(1);
this.isDirty = ignoreFilter;
this.isKeyDownAfterDirty = false;
var outline = this.filteredOutline = search.treeSearch(this.fullOutline, filter, true);
/* TODO: set "empty" message
if (outline.length === 0)
treeOutline.clear(treeOutline["empty-message"], "empty");
else
treeOutline.$removeClearMessage();
*/
var ace = editor.amlEditor.$editor;
var selected = this.findCursorInOutline(outline, ace.getCursorPosition());
mdlOutline.load(ppc.getXml('<data>' + this.outlineJsonToXml(outline, selected, 'entries') + '</data>'));
return selected;
},
scrollToSelected: function(selected) {
var node = mdlOutline.queryNode("//*[@selected]");
if (node) {
this.ignoreSelectOnce = true;
treeOutline.select(node);
var htmlNode = ppc.xmldb.getHtmlNode(node, treeOutline);
htmlNode.scrollIntoView();
}
else {
this.scrollToTop();
}
},
scrollToTop: function(selectFirstItem) {
if (selectFirstItem && mdlOutline.data.childNodes[0] && mdlOutline.data.childNodes[0].nodeType === 1) {
treeOutline.select(mdlOutline.data.childNodes[0]);
}
// HACK: Need to set to non-falsy values first
treeOutline.$container.scrollTop = 2;
treeOutline.$container.scrollTop = 1;
treeOutline.$container.scrollTop = 0;
},
onSelect: function(el) {
if (gotofile.eventsEnabled || !el)
return;
if (this.ignoreSelectOnce) {
this.ignoreSelectOnce = false;
return;
}
var editor = editors.currentEditor.amlEditor.$editor;
var range = new Range(+el.getAttribute("sl"), +el.getAttribute("sc"),
+el.getAttribute("el"), +el.getAttribute("ec"));
this.scrollToDefinition(editor, +el.getAttribute("sl"), +el.getAttribute("elx") || +el.getAttribute("el"));
editor.selection.setSelectionRange(range);
},
scrollToDefinition: function(editor, line, lineEnd) {
var lineHeight = editor.renderer.$cursorLayer.config.lineHeight;
var lineVisibleStart = editor.renderer.scrollTop / lineHeight
var linesVisible = editor.renderer.$size.height / lineHeight;
lineEnd = Math.min(lineEnd, line + linesVisible);
if (lineVisibleStart <= line && lineEnd <= lineVisibleStart + linesVisible)
return;
var SAFETY = 1.5;
editor.scrollToLine(Math.round((line + lineEnd) / 2 - SAFETY), true);
},
onKeyDown: function(e) {
if (gotofile.eventsEnabled)
return;
if (e.keyCode === 27) { // Escape
if (this.$originalLine) {
var editor = editors.currentEditor;
var ace = editor.amlEditor.$editor;
ace.gotoLine(this.$originalLine, this.$originalColumn, ppc.isTrue(settings.model.queryValue("editors/code/@animatedscroll")));
delete this.$originalLine;
delete this.$originalColumn;
}
gotofile.toggleDialog(-1);
}
else if (e.keyCode === 13) { // Enter
this.ignoreSelectOnce = false;
this.onSelect(treeOutline.selected);
gotofile.toggleDialog(-1);
}
else if (e.keyCode === 40) { // Down
e.preventDefault();
delete e.currentTarget;
treeOutline.dispatchEvent("keydown", e);
return;
}
else if (e.keyCode === 38) { // Up
e.preventDefault();
delete e.currentTarget;
treeOutline.dispatchEvent("keydown", e);
return;
}
else if (this.isDirty) {
this.isKeyDownAfterDirty = true;
}
},
onKeyUp: function(e) {
if (e.keyCode === 50) { // @
this.updateOutline(false, true);
}
else if (this.isDirty && this.isKeyDownAfterDirty) {
this.renderOutline();
this.scrollToTop(true);
this.isDirty = false;
}
},
onAfterChange: function(event) {
if (txtGoToFile.value.match(/^@/)) {
this.updateOutline();
gotofile.setEventsEnabled(false);
}
else {
this.showGoToFile();
}
this.renderOutline();
this.scrollToTop(true);
}
};
});
|
{
"pile_set_name": "OpenWebText2"
} | CUYAHOGA FALLS, Ohio -- Blossom Music Center opened with the Cleveland Orchestra's performance of two works of Beethoven on July 19, 1968.
"The gentle, wooded slopes of the upper Cuyahoga Valley were alive with the sound of music and applause," Plain Dealer reporter Mary Strassmeyer wrote of that opening night.
"The place is a visual, musical, acoustical and artistic triumph," reporter Robert Finn raved in another front-page story. "The inauguration of a new summer festival that may rank one day with the finest anywhere."
Don't Edit
Architect's sketch of Blossom Music Center courtesy Joseph E. Cole, Cleveland Press Collection
Blossom Music Center is named after Dudley S. Blossom Sr. and his family, longtime supporters of the orchestra who were also integral in the building of Severance Hall. It was designed to accommodate 4,600 people in the pavilion and another 15,000 on the lawn.
Don't Edit
That first season in the orchestra's new summer home relied heavily on its own concerts, the New York City ballet and a few jazz shows. But by the next year, Blossom welcomed performers like Liberace, Tony Bennett, Janis Joplin and Bill Cosby in addition to a steady diet of orchestra shows.
The variety of bookings continued to expand throughout that first full decade, with big band, rock and roll, pop, country, R&B, even disco acts gracing the stage inside the venue's trademark clamshell pavilion.
What was your first concert at Blossom? What other shows do you remember seeing there during those early days?
Here are 50 classic Blossom concert ads to help jog your memory.
[Note: the date listed under the photo is the date the ad appeared in the newspaper, not the date of the show.]
Don't Edit
1968-1969
Don't Edit
May 5, 1968
Don't Edit
Don't Edit
April 13, 1969
Don't Edit
August 29, 1969
Don't Edit
1970
Don't Edit
May 10, 1970
Don't Edit
July 31, 1970
Don't Edit
Don't Edit
August 29, 1970
Don't Edit
Sept. 2, 1970
Don't Edit
1971
Don't Edit
July 7, 1971
Don't Edit
July 11, 1971
Don't Edit
Don't Edit
July 27, 1971
Don't Edit
August 20, 1971
Don't Edit
1972
Don't Edit
July 2, 1972
Don't Edit
July 9, 1972
Don't Edit
Don't Edit
July 25, 1972
Don't Edit
August 3, 1972
Don't Edit
August 19, 1972
Don't Edit
August 26, 1972
Don't Edit
August 30, 1972
Don't Edit
Don't Edit
1973
Don't Edit
June 24, 1973
Don't Edit
July 24, 1973
Don't Edit
August 21, 1973
Don't Edit
August 28, 1973
Don't Edit
Don't Edit
1974
Don't Edit
July 5, 1974
Don't Edit
July 28, 1974
Don't Edit
July 30, 1974
Don't Edit
August 11, 1974
Don't Edit
Don't Edit
Sept. 5, 1974
Don't Edit
1975
Don't Edit
June 27, 1975
Don't Edit
August 19, 1975
Don't Edit
August 24, 1975
Don't Edit
Don't Edit
August 31, 1975
Don't Edit
1976
Don't Edit
May 16, 1976
Don't Edit
June 13, 1976
Don't Edit
June 20, 1976
Don't Edit
Don't Edit
June 27, 1976
Don't Edit
1977
Don't Edit
June 5, 1977
Don't Edit
July 10, 1977
Don't Edit
July 18, 1977
Don't Edit
Don't Edit
1978
Don't Edit
May 21, 1978
Don't Edit
June 16, 1978
Don't Edit
June 25, 1978
Don't Edit
August 22, 1978
Don't Edit
Don't Edit
1979
Don't Edit
June 10, 1979
Don't Edit
June 15, 1979
Don't Edit
July 10, 1979
Don't Edit
July 20, 1979
Don't Edit
Don't Edit
August 5, 1979
Don't Edit
August 26, 1979
Don't Edit
Sept. 2, 1979 |
{
"pile_set_name": "USPTO Backgrounds"
} | 1. Field of the Invention
The invention relates to a device for the production of a glass melt from a batch.
2. Description of the Related Art
Such a device for the production of a glass melt is mostly of rectangular ground plan. It has peripheral walls as well as a bottom. It is equipped, furthermore, with an electric heating system. Here there can also be provided several heating circuits. The heating-up occurs over electrodes. There takes place here a direct current flow through the conductive glass melt.
Under the bottom of the melt tank there is located a draw-off channel. The draw-off channel is fully open toward the melt bath. The channel runs essentially horizontally, and therewith in a plane parallel to the melt surface. It has an outlet which is located in the region of one of the side walls of the melt tank.
In operation the glass melt is always covered by a cold batch layer orxe2x80x9cbatch blanketxe2x80x9d. The tank, therefore, is also designated as axe2x80x9ccold top melt tankxe2x80x9d. There, heed is taken that the surface of the glass melt is always covered by batch. At the edges of the melt surface, i.e. on the peripheral walls, however, as a rule a so-called glow strip is left open that serves for the de-gassing of the melt. This can be controlled over an charging machine. The batch layer lying on the glass melt has, namely, an insulating effect. If the batch layer is not closed, there occur heat radiations, which means losses of energy. Mixture, accordingly, is always supplied in a corresponding amount.
For the achieving of a faultless quality it is absolutely indispensable that through the draw-off channel molten and refined (bubble-free) glass emerges and that still unmelted batch is not carried along. Even small quantities of unmelted or only initially molten batch are unacceptable in respect to the glass quality to be achieved.
All strivings are being undertaken in this direction. To this there belongs inter alia the correct arranging of the heating circuits and of the appertaining electrodes, as well as the bringing-in of a sufficiently high electric power. Despite these measures it does occur that unmolten or only insufficiently melted batch as well as incompletely refined glass passes through the draw-off channel with the flow of the glass melt, which is extremely troublesome in the further processing and results in an unsatisfactory quality of the glass.
DE 1 080740 B describes a device for the production of a glass melt from a batch, in which the heated melt tank has a draw-off channel the entry opening of which is arranged in the region of the bottom of the melt tank. The draw-off channel is located under the bottom of the melt tank and has an outlet opening in the zone of a peripheral wall. There the draw-off channel in at least two corners is brought directly onto the wall of the tank.
U.S. Pat. No. 4,410,997 A describes a device for the production of a glass melt from a mixture. Here too, the heated melt tank has a draw-off channel which runs in a central zone of the tank bottom. There, no covering is provided.
DE 29 17 386 A likewise describes a melt tank with a draw-off channel which proceeds from the bottom zone of the tank. A covering of the draw-off channel is not provided here.
Underlying the invention is the problem of constructing a melt tank of the type described in such manner that there is guaranteed a complete melting-up of the batch as well as a complete refining of the glass, and that not even the smallest batch components and bubble-infected glass pass into the draw-off channel and, together with the rest of the glass flow, pass through its outlet opening.
The inventors have perceived the following:
The draw-off channel mentioned, open toward the melt bath, is located outside of the main zone of the electric heating. There the flow velocities arising are comparatively low. Here the glass of the glass melt can dead-melt in certain zones. In the zone of the peripheral wall in which also the outlet is located, a predominantly downward directed flow builds up. Through this flow it is possible that incompletely melted-up mixture or incompletely refined glass will enter directly into the removal flow in the draw-off channel and will cause the disadvantageous consequences mentioned.
For the solution of the problem the inventors propose the four following courses of solution, which can be applied in each case alone or in combination.
The first course of solution consists in the following:
The draw-off channel is covered on a part of its extent. There remains only an opening that is located in the zone of action of the heating circuits. In general this entry opening into the draw-off channel will be arranged in a central zone of the tank bottom. The tank bottom, thereforexe2x80x94except for the entry opening into the draw-off channelxe2x80x94is simultaneously the covering of the draw-off channel. One could also say that the channel is largely covered. The covering extends from the zone of its outlet opening to a central zone of the tank bottom, purposefully, however, at least up to a tenth of the distance between two oppositely lying peripheral walls of the melt tank.
There is thereby prevented the possibility that incompletely melted-up batch components as well as bubble-infected glass will be able to pass out of the zone of the tank over the channel, directly into the channel and therewith into the removal flow. In this manner there can be achieved a perfect glass quality, provided that all the other parameters are in order.
As material for the covering mentionedxe2x80x94i.e. the partition between the glass melt and the channelxe2x80x94there come into consideration fireproof materials (metallic or nonmetallic) with low corrosion, high endurance, low costs and a low glass-fault potential. Here there offer themselves refractory metals such as molybdenum or tungsten as well as their alloys.
The second course of solution consists in the following:
a covering is provided, for example of the material of which also the tank consists. The covering covers off a part of the surface of the melt surface. The melt surface is therewith reduced. This leads to a favorable influencing of the glass flow, since the heat lead-off over the covering is less than over the mixture cover, and since therewith a thermal barrier is built up underneath the covering. Thereby there is prevented the possibility that incompletely melted-up batch of incompletely refined glass can be directly into the removal flow. In this manner incompletely melted-up batch constituents remain longer in the melt tank and are completely melted up and refined. The result is the same as with the first course of solution.
The third course of solution consists in providing an additional heating in the zone of the draw-off channel, and namely in the zone above the draw-off channel where the glass flow leaves the tank. The effect of this additional heating lies in the build-up of a thermal barrier, by which there is prevented the possibility that incompletely melted-up batch or incompletely refined glass can pass directly into the removal flow.
The fourth course of solution consists in installing a heated dome (heated by burners for example) and in not laying in any batch in this zone. There, accordingly, a blank glass surface is established through which energy can enter into the glass bath from the heated dome. As in the second and third courses of solution, therewith a thermal barrier is built up, by which there is prevented the possibility that incompletely melted-up batch or incompletely refined glass can pass directly into the removal flow. By all four solutions, accordingly, there is guaranteed a complete melting-up of the batch and a sufficient refining of the glass melt. There is prevented the possibility that any batch particles that are incompletely melted up, or any bubble-contaminated glass will pass into the draw-off and thus leave the melt tank with the glass flow. |
{
"pile_set_name": "USPTO Backgrounds"
} | Conventionally, in the manufacture of semiconductor devices, micro-processing by lithography using a photoresist composition has been carried out. The micro-processing is a processing method including forming a thin film of a photoresist composition on a semiconductor substrate such as a silicon wafer, irradiating actinic rays such as ultraviolet rays through a mask pattern on which a pattern for a semiconductor device is depicted, developing it to obtain a photoresist pattern, and etching the semiconductor substrate using the photoresist pattern as a protective film. However, in recent progress in high integration of semiconductor devices, there has been a tendency that shorter wavelength actinic rays are being used, i.e., ArF excimer laser beam (wavelength 193 nm) have been taking the place of i-line (wavelength 365 nm) or KrF excimer laser beam (wavelength 248 nm). Along with this change, influences of random reflection and standing wave off a substrate have become serious problems. Accordingly, it has been widely studied to provide an anti-reflective coating between the photoresist and the substrate (Bottom Anti-Reflective Coating, BARC).
As the anti-reflective coating, inorganic anti-reflective coatings made of titanium, titanium dioxide, titanium nitride, chromium oxide, carbon or α-silicon and organic anti-reflective coatings made of a light-absorbing substance and a polymer compound are known. The former requires an installation such as a vacuum deposition apparatus, a CVD (chemical vapor deposition) apparatus or a sputtering apparatus. In contrast, the latter is considered advantageous in that it requires no special installation so that many studies have been made. For example, mention may be made of the acrylic resin type anti-reflective coating having a hydroxyl group being a crosslinking reaction group and a light absorbing group in the same molecule and the novolak resin type anti-reflective coating having a hydroxyl group being a crosslinking reaction group and a light absorbing group in the same molecule (see, for example U.S. Pat. Nos. 5,919,599 and 5,693,691).
The physical properties desired for organic anti-reflective coating materials include high absorbance to light and radioactive rays, no intermixing with the photoresist layer (being insoluble in photoresist solvents), no diffusion of low molecular substances from the anti-reflective coating material into the topcoat resist upon coating or heat-drying, and a higher dry etching rate than the photoresist (see, for example, Tom Lynch et al., “Properties and Performance of Near UV Reflectivity Control Layers”, US, in Advances in Resist Technology and Processing XI, Omkaram Nalamasu ed., Proceedings of SPIE, 1994, Vol. 2195, p. 225-229; G. Taylor et al., “Methacrylate Resist and Antireflective Coatings for 193 nm Lithography”, US, in Microlithography 1999: in Advances in Resist Technology and Processing XVI, Will Conley ed., Proceedings of SPIE, 1999, Vol. 3678, p. 174-185; and Jim D. Meador et al., “Recent Progress in 193 nm Antireflective Coatings, US, in Microlithography 1999: in Advances in Resist Technology and Processing XVI, Will Conley ed., Proceedings of SPIE, 1999, Vol. 3678, p. 800-809).
In recent years, miniaturization of process dimension in lithography process by use of KrF excimer laser beam or ArF excimer laser beam, that is, miniaturization of photoresist pattern to be formed is progressing. With the progress in the miniaturization of photoresist pattern, it is desired to make photoresist thinner in order to avoid collapse of photoresist pattern. When the photoresist is used in a form of thin film, it is desired that an organic anti-reflective coating used together with it can be removed for a short time in order to depress reduction in film thickness of the photoresist layer in a step of removing the organic anti-reflective coating by etching. That is, for reduction in time for etching removing step, it is required that any organic anti-reflective coating can be used in a form of thinner film, or that the organic anti-reflective coating has a larger selection ratio of etching rate with photoresist than the prior one.
By the way, a hitherto technique of anti-reflective coatings has been mainly considered on lithography process with irradiation light having a wavelength of 365 nm, 248 nm or 193 nm. As a result of such consideration, light absorbing components and light absorbing groups effectively absorbing light of each wavelength are developed, and they come to be utilized as one component of an organic anti-reflective coating composition. For example, it is known that chalcone dies prepared by condensation of 4-hydroxyacetophenone with 4-methoxybenzaldehyde are effective for irradiation light having a wavelength of 365 nm (see, for example Japanese Patent Laid-open No. Hei 11-511194), it is known that naphthalene group-containing polymers having a specific structure have high absorbance for irradiation light having a wavelength of 248 nm (see, for example Japanese Patent Laid-open No. Hei 10-186671), and it is known that resin binder compositions containing phenyl unit are excellent for irradiation light having a wavelength of 193 nm (see, for example Japanese Patent Laid-open No. 2000-187331).
In addition, it is known that tris(hydroxyalkyl)isocyanurate substituted with aromatic compound or alicyclic compound is used as a broad UV absorber (see, for example Japanese Patent Laid-open No. Hei 11-279523), and that a curing composition contains cyanuric acid as a polymerizable organic compound (see, for example Japanese Patent Laid-open No. Hei 10-204110). An anti-reflective coating composition containing cyanuric acid derivative is also known (see, for example WO 02/086624). Further, it is disclosed that a polyester synthesized from 1,3,5-tris(2-hydroxyethyl)cyanuric acid is used for an anti-reflective coating (see, for example EP 1298492 A and EP 1298493 A).
In recent years, lithography process with F2 excimer laser (wavelength 157 nm) being a light source having a shorter wavelength comes to be regarded as next-generation technology in place of that with ArF excimer laser (wavelength 193 nm). It is considered that the former process permits micro-processing of process dimension not more than 100 nm, and at present its development and research have been actively carried out from the aspects of apparatus and material, etc. However, most of the research on material relate to photoresist, and it is an actual condition that the research on organic anti-reflective coatings is little known. This is because components effectively absorbing light having a wavelength of 157 nm, that is light absorbing components having a strong absorption band at 157 nm are little known.
It is considered that as irradiation light provides process dimension not more than 100 nm. Therefore, it is also considered that a photoresist is used in a form of thin film having a thickness of 100 to 300 nm that is thinner compared with the prior one. Organic anti-reflective coatings used along with such a photoresist in a form of thin film require the followings: they can be used in a form of a thin film; and they have a high selectivity of dry etching for photoresist. And, it is considered that organic anti-reflective coatings are required to have a large attenuation coefficient k so that they could be used in a shape of thin film having a thickness of 30 to 80 nm. In a simulation with PROLITH ver. 5 (manufactured by Litho Tech Japan; expected and ideal values are used as optical constants (refractive index, attenuation coefficient) of the photoresist), an anti-reflective coating having a base substrate made of silicon with a thickness of 30 to 80 nm can have second minimum thickness (about 70 nm), and in this case the coating has an attenuation coefficient k of 0.3 to 0.6 and a reflectance from substrate of 2% or less, thus has a sufficient anti-reflective effect. In addition, a similar simulation in which silicon oxide is used as base substance and a thickness of silicon oxide varies between 100 nm and 200 nm results in that attenuation coefficient k of 0.4 to 0.6 is required in order to exert a sufficient anti-reflective effect with an anti-reflective coating having a thickness of 70 nm. For example, in case where attenuation coefficient k is 0.2, reflectance from substrate varies between 5% and 10%, and in case where attenuation coefficient k is 0.4, reflectance from substrate varies between 0% and 5%. Consequently, it is considered that in order to exert a sufficient anti-reflective effect, a high attenuation coefficient k, for example 0.3 or more is required. However, any material for organic anti-reflective coatings satisfying such an attenuation coefficient k have been little known.
Under such circumstances, it is demanded to develop organic anti-reflective coatings efficiently absorbing reflection light from a substrate and thereby having an excellent anti-reflective effect. Further, photoresists for lithography process for which irradiation light from F2 excimer laser are used are actively examined at present, and therefore it is considered that many kinds of photoresists will be developed in future. And, it is considered that a method of changing attenuation coefficient so as to suit required characteristics of each photoresist, for example a method of changing attenuation coefficient k comes to be important.
The present invention relates to a composition for forming anti-reflective coating, which has a strong absorption of light at a short wavelength, particularly light at wavelength of 248 nm, 193 nm or 157 nm. In addition, the present invention provides a composition for forming anti-reflective coating, which can be used in a lithography process for manufacturing a semiconductor device carried out by using irradiation light from KrF excimer laser (wavelength 248 nm), ArF excimer laser beam (wavelength 193 nm) or F2 excimer laser (wavelength 157 nm). Further, the present invention provides an anti-reflective coating for lithography which effectively absorbs reflection light from a substrate when irradiation light from KrF excimer laser, ArF excimer laser beam or F2 excimer laser is used for micro-processing, and which causes no intermixing with photoresist layer, can be rapidly removed in the following removal step, and has a high dry etching rate compared with the photoresists. In addition, the present invention provides a method of forming an anti-reflective coating for lithography by using the composition for forming anti-reflective coating, and a method of forming a photoresist pattern. |
{
"pile_set_name": "Pile-CC"
} | Re: David Duke, Zionist Stooge
Question: In your article The Ashkenzazim, you explain that Ashklenazi Jews are descendants of Ashkenazic Khazarians. Have you seen the video by David Duke that dispels this theory. He cited 12 studies, and said there were 100’s of studies that refute it. He stated that he once believed in the Khazar theory too, but it was a theory that was meant to convince people the Jews of today were not a race. He made a convincing argument and had references to back it up. Thought that if anyone would know about Jewish history, David Duke would as he has clearly spent a lifetime studying the Jews, and of course he is a favorite target of the media. Your thoughts, please.
Answer: All lies and fabrications.
1) Jews today are NOT a race, even though they are pretending to be Hebrews. See The Hebrew Disease. How David Duke (and others) can have the intellectual courage to utter such nonsense is beyond comprehension, especially as a cursory look perusing the web can show anyone the diverse “looks” or “ethnicities” amongst those who call themselves “Jews.”
Their racial make up is not homogeneous. There are Ashkenazic, Sephardic, Samaritan, African, European, Chinese, and Indian Jews, who adhere to the Pharisaism religion, which today is known as Judaism.
2) Saying with a straight face that there are HUNDREDS of studies that position Judaism as indicative of a race adds insult to injury. Besides, none of the studies David Duke pointed at mentioned a) the Bible b) Jesus’s prophecies concerning the destruction of the Hebrews, and c) the historical records of Josephus and Tacitus in reference to the annihilation of the Hebrew race in 70 A.D.
No accurate study on the Hebrews can be deemed complete without referring to these aforementioned documents. It doesn’t matter who those people are that did those “hundreds of studies,” and it doesn’t matter that David Duke spent an eternity studying the Jews. The absence of biblical documents alone is enough to raise the red flag of suspicion. Besides, doing a study on Jews is totally different than doing a study on Hebrews.
In other words, many Jews are telling us they’re Ashkenazic Khazarians, while some non-Jews like David Duke are telling us differently. Silly, isn’t it?
4) It would not be farfetched to consider David Duke as controlled opposition supported by Zionist Jews, not unlike Israel with its backing of MidEast terrorists or the FBI when it wagged the Klu Klux Klan via informants.
As a matter of fact, because of his history in confronting Jews in the media, what better person to posit such theory than David Duke? He would appear “beyond reproach” in his lies.
Keep in mind that, in this day and age, Zionist Jews control the flow of information via publishing and media. Thus they have the means and power to distort the bible, manipulate history, fabricate any study or studies, and buy anyone in order to spread their fake Hebrewness, which allows them to hold on to stolen Palestinian land and not appear as impostors, liars, and criminals. They have a lot at stake.
In other words, US politicians are being wagged to strengthen the twin linchpins of Jewish control of America: Israel and the Federal Reserve.
The Fed dominates all American financial institutions through their unconstitutional power to issue money; while Israel’s spy agency, the Mossad, spies on American politicians, blackmailing them with their dirty laundry, at the same time that AIPAC bribes them; thereby securing Jewish dominance over the US Dollar, the world’s current reserve currency.
The second most pernicious special interest group is BIG PHARMA, which has no qualms about poisoning humanity just to pad their bottom line. How are they poisoning humanity? Click here.
Question #2: Should we allow the falsely named ‘Jews’ of this world to run our financial institutions?
Answer #2: Like Jesus we say, “Give to Caesar what is Caesar’s and to God what is God’s.” Money is controlled by the principalities of Hell, so they gave control of these financial institutions to the ones who look like them.
When God thinks true Christians, with no vanity and selfishness in their hearts, are ready to take control of these financial institutions and turn them around, He will kick out the money changers and their demons like He did in the Jerusalem Temple. All in good time.
+++++++++++++
Re: Conspiracy Theory
Question #1: Your VIEWS OF NEWS section is full of conspiracy theories. Why?
Answer #1: Why not? Somebody needs to unmask those who are conspiring. Oh, so you don’t believe there are people conspiring? Well, let’s see.
What does a conspiracy need? Two or more people or groups, plus an agenda.
Are there two or more people or groups conspiring somewhere to take political and economical advantage of many important issues?
One would be a fool not to believe so.
The problem is that you’ve been brainwashed to see “conspiracy” as the work of crazies outside the government. That way those within government, who are being wagged by special interest groups, can go on conspiring to make specific agendas a reality, while pointing their fingers at “fantasist nuts” and their “conspiracy theories.”
Wake up! because even though we can only theorize by analyzing and linking facts and events, conspiracies are quite real.
Question #2: I respect Biblicism Institute’s wish to remain anonymous and not publish the name of the author. Still, aren’t you fanning the flame of conspiracy theorists who see it as a way of hiding the fact that an Arab is the author or that Arabs are financing this site?
Answer #2: First, publishing an author’s name adds no real value to the truth presented. Our position is that Jesus is the ONE that needs to be recognized. Sticking a human’s name in there can only obscure that possibility. We prefer to emulate our Lord who didn’t feel it necessary to sign His name on every created thing in the Universe, like an artist does a painting or a sculpture.
Second, only Zionists think Arabs finance this site because when they don’t have a precise someone they can zoom in on and destroy they feel frustrated and blame their perennial victim, the Arab; that’s their modus operandi. Besides, if Arabs are behind this site, you need to tip your hat to them for having the insight of siding with the truth, as opposed to Zionist Jews who always seek to pulverize anyone who clamors it.
+++++++++++++
Re: Is Lottery Evil?
Question: Do you think the lottery winnings are controlled by God or Satan, or is it just chance? Is it okay for a Christian once in a while to play the lottery in a non-addictive way?
Answer: a) Gambling is never a good proposition because its twin sibling is called addiction, and all addicts are blind to their own addiction.
b) It is NOT a question of whether the Lottery is controlled by God or Satan – and by the way Jesus is in control of everything, even if the dark forces sub-manage or sub-control certain aspects of life, their sub-control ultimately fits God’s purpose. The REAL question is: what is YOUR motivation for playing the lottery?
Is it Greed? Do you want to be a Millionaire?
More often than not, the motivation is always the love of Money or people trying to avoid work, the anti-theses of everything the word of God teaches – for example: “you have to work to eat,” “the love of money is the root of all evil,” etc.
Are you free to play as a Christian? Sure.
But is it beneficial?
“ ‘I have the right to do anything,’ you say–but not everything is beneficial. ‘I have the right to do anything’ – but not everything is constructive.” 1 Corinthians 10:23
“Better is a little with the fear of the LORD than great treasure and turmoil with it.” Proverbs 15:16
However, if you are going through a rough time, and somehow, some way God whispers in your ear to drop a buck on a ticket and you end up winning, then all power to you! Still, the flip side is addiction through which you may end up losing a lot more.
Re: Israel In Prophecy?
Question: Luke 21:24 clearly states that “Jerusalem would be trodden down of the Gentiles until the times of the Gentiles be fulfilled.” Jerusalem fell in 70 A.D. and was in the hands of the Gentiles for 1897 years until Israel, the modern state, took control of it, thereby fulfilling the prophecy in the Scripture. So how come you don’t acknowledge that while ignoring the true biblical context of its occurrence?
Answer: The reason we don’t acknowledge it is because we don’t acknowledge lies from the pit of hell.
1. Jerusalem was NEVER the capital of the ancient kingdom of Israel, but of Judah. And Jews today are not of the tribe of Judah.
2. Jerusalem was trodden down by the Gentiles (i.e., by the Romans) in 70 A.D. However, when the Gentiles or the Romans were done trodden it down (i.e., until their time was fulfilled), they left it be. That verse has nothing to do with modern-day Israel. See Bad Translation #15.
These self-styled Jews are of various origins: Ashkenazic, Sephardic, Samaritan, European, African, Iranian, Indian, etc. Therefore, they are nothing but converts to Pharisaism, now known as Judaism.
The Ashkenazim misappropriated the name Jews in the 18th Century in order to appear Hebrews and steal Palestine with a view to turning the Arab country into their new homeland, following the loss of their country Khazaria.
These Zionist Jews are messing with Christians and toying with the bible so as to hold on to Palestine, which they have nabbed under biblical pretense.
“The LORD was very angry with Israel, and removed them out of his sight… And the LORD rejected all the seed of Israel, and afflicted them, and delivered them into the hand of spoilers, until he had cast them out of his sight.” 2 Kings 17:18,20
Unfortunately, these deceivers have on payroll many preachers, who spew out their demonic bile to brainwash folks like you.
4. It’s time to renew your mind and unwash your brain – unless you’re basking in ignorance’s bliss and prefer to stay blind to the truth by providing your own context to the word of God, or by blindly swallowing context that was provided for you by deceivers and mammonists.
Re: Sex
Question #1: Why is fornication a sin against one’s own body?
Answer #1: Once you become a Christian, it is not just your soul that is given to God but your body as well.
God intended sex for husband and wife to produce children, itself a great spiritual act whereby God is working with mankind to fill the earth. However, fornication is sex outside these God-given parameters.
By fornicating, itself a selfish pleasure, the body is thus defiled, because the commandment of God regarding sex is made of no effect and DEBASED (or defiled), which in turn defiles the body that commits it.
There’s no other circumstance where one uses his whole body to sin thus.
“I appeal to you therefore, brothers, by the mercies of God, to present your bodies as a living sacrifice, holy and acceptable to God, which is your spiritual worship. Do not be conformed to this world, but be transformed by the renewal of your mind…” Romans 12:1-2
Question #2: Does the Greek word porneia really translate as fornication? Because some sources do translate it as prostitution, as in sex for money.
If so, isn’t Matthew 19:9 wrong when it says, “Whosoever shall put away his wife, except it be for fornication, and shall marry another, committeth adultery: and whoso marrieth her which is put away doth commit adultery.”
Shouldn’t it be “except it be for prostitution“?
Answer #2: The Greek word porneia derives from porneno, which has a literal meaning of “indulging lust,” and which is also the root word for the English word porno. So it’s not just sex for money, though it is translated as both “fornication” and “harlotry.”
Fornication (i.e., playing the harlot) is the indulgence of unlawful lust for selfish pleasure, whereas harlotry or prostitution is the indulgence of unlawful lust for money. Their common core is the indulgence of lust. See Of Fornication, Divorce, And Adultery.
Consequently, Matthew 19:9 is perfectly translated as is. See some real Bad Translation.
Question #3: Matthew 5:32 says that, “Whosoever shall put away his wife, saving for the cause of fornication, causes her to commit adultery: and whosoever shall marry her that is divorced commits adultery.”
Shouldn’t we construe that the cause of fornication in that passage is the same as the cause of fornication in this Deuteronomy 22 passage:
23 If a man happens to meet in a town a virgin pledged to be married and he sleeps with her,24 you shall take both of them to the gate of that town and stone them to death—the young woman because she was in a town and did not scream for help, and the man because he violated another man’s wife. You must purge the evil from among you.
In other words, the only time a man can put away his woman is when she’s betrothed and commits sexual immorality or fornication, and not when she’s actually married. Besides, that would help stem the tide in our divorce-obsessed culture.
“Do not add to his words, lest he rebuke you and you be found a liar.” Proverbs 30:6
You’re the one who added “betrothal” by making strange connections with unrelated biblical circumstances.
Second, that Deuteronomy passage is very well defined with a specific situation, as opposed to the passage in Matthew which doesn’t confirm a Deuteronomy-type circumstance.
Third, you are insinuating that the Deuteronomy passage is the only instance of fornication within a “marriage” context that can happen. Wrong.
“It is actually reported that there is sexual immorality among you, and of a kind that even pagans do not tolerate: A man is sleeping with his father’s wife.” 1 Corinthians 5:1
Paul was very explicit in that verse, and just because the Matthew verse you quoted is not as categorical doesn’t automatically make it Deuteronomy-like. If it were, Jesus would have made it very clear.
Arbitrarily connecting bible verses because you want to stem the divorce tide is not the way to go. The only way is to obey God’s commandments and apply His principles. See Sex and The Christian.
And finally fourth, you totally neglected this other passage from Deuteronomy 22: 13-21:
“If a man takes a wife and, after sleeping with her, dislikes her and slanders her and gives her a bad name, saying, “I married this woman, but when I approached her, I did not find proof of her virginity,” then the young woman’s father and mother shall bring to the town elders at the gate proof that she was a virgin…
“If, however, the charge is true and no proof of the young woman’s virginity can be found, she shall be brought to the door of her father’s house and there the men of her town shall stone her to death. She has done an outrageous thing in Israel by being promiscuous while still in her father’s house. You must purge the evil from among you.”
That woman, who committed fornication while betrothed, ended up fully married when she was discovered, and the law demanded that she be executed.
However, Jesus removed the death penalty from that law when He told the accusers of the adulteress: “Let any one of you who is without sin be the first to throw a stone at her.” (John 8:7)
Still, He commanded the adulteress in John 8:11 to “go and sin no more(i.e., go and cut off the unlawful relationship).” And in the case of a married woman who fornicates, instead of death He said “to put her away, for the cause of fornication (Matthew 5:32).”
Consequently, now, instead of the death penalty, they get a chance to repent, sin no more, and cut off their unlawful relationships as the new way of purging evil, because evil still needs to be expurgated before facing God on judgment day.
“If your right hand makes you stumble, cut it off and throw it from you; for it is better for you to lose one of the parts of your body, than for your whole body to go into hell.” Matthew 5:30
Question #4: I always understood that according to the bible if a woman has committed fornication (i.e., have had sex) with another man, that alone constitutes marriage.
Answer #4: Fornication is distinct from the sexual act within a marriage covenant. Its literal meaning is to play the harlot (i.e., having sex here and there with no responsibility and no commitment, just for the selfish pleasure of it). Biblical verses after biblical verses prove that. See Of Fornication, Divorce and Adultery.
Marriage takes place when two people, man and woman, enter into a marriage covenant, with parents on both sides agreeing to their siblings being joined as one. Please read The Biblical Marriage Blueprint.
With your understanding, you make the marriage Covenant as ordained by God of no effect. Biblical marriage is sealed with the first copulation of the married couple, but is NOT just the sex. It is a COVENANT whose main goal is to produce children. Otherwise, according to your definition, rape would also be considered marriage.
+++++++++++++
Re: Moral Laws
Question #1: Weren’t the moral laws that today come close to being part of the conscience of educated men and women everywhere in part spread by Socrates who was sentenced to the hemlock nearly 2,500 years ago?
Answer #1: In actuality, the true moral law that governs today’s societies is Jesus Christ’s new commandment to Love One Another, a decree that is a summary of the 10 Moral Laws or Commandments God gave us thousands of years before Socrates.
“A new commandment I give to you, that you love one another, even as I have loved you, that you also love one another.” John 13:34
Prior to Christ, it was extremely difficult for anyone to love one another. With Jesus’s sacrifice on the Cross, His resurrection, and the Advent of the Holy Spirit, applying such moral law became much easier.
Every religion or philosophy, which espouses loving one another and good will towards man, whether aware of it or not, has benefited from Jesus’s new commandment, which is the foundation of Christian enlightenment.
“And when everything is subject to Christ, then the Son Himself will also be subject to the One who subjected everything to Him, so that God may be all in all. ” 1 Corinthians 15:28
Question #2: Just read The 11 Commandments article. Your 11th commandment has replaced the 10. The 10 were abolished. See Hebrews 8:13 for details.
Answer #2: It wasn’t the commandments that were abolished, but the covenant that God made with the Houses of Israel and Judah.
“‘Behold, days are coming,’ declares the LORD, ‘when I will make a new covenant with the house of Israel and with the house of Judah, not like the covenant which I made with their fathers in the day I took them by the hand to bring them out of the land of Egypt, My covenant which they broke, although I was a husband to them,’ declares the LORD.” Jeremiah 31:31,32
The Hebrews did not follow God’s commandments, and thus broke their covenant with God. So God chose a new people (Christians) who would obey His commandments and made a NEW covenant with them.
“When He said, ‘A new covenant,’ He has made the first obsolete.” Hebrews 8:13
However, the new covenant still contains all of God’s enduring commandments.
Re: Islam, Saudi Arabia, And The Jews
Question #1: Just wondering if the term Jew was translated correctly from the Koran, and if Saudi Arabia was really founded by Jews.
Answer #1: We’re not experts on the Koran, but we believe Muhammad actually wrote Judahites/Jehudites, or in Arabic Yahoodi which is close to the Hebrew Yehuwdiy – wrongfully translated as Jews, same error as in the translated bible.
There’s also a lot of propaganda about Saudi Arabians being Jews, don’t fall for it.
Remember, the brainwashing has been quite extensive, so it might take a bit of time to see clearly.
Question #2: I want to understand why the Koran mentions the Jews or Judahites, yet we are led to believe that they were wiped out in 70 AD, 600ish years earlier. I suspect that the so called self-styled Jews want us to believe that there was no break in transmission from 70 AD onward. Could you please elaborate?
Your site has opened my eyes and I am eternally grateful. Thanks and keep up the good work.
2) Here’s what we plucked out of Wikipedia: “The Quran assumes familiarity with major narratives recounted in the Biblical scriptures. It summarizes some, dwells at length on others and, in some cases, presents alternative accounts and interpretations of events.”
Basically, when Muhammad wrote about the Judahites, centuries after their existence, he was recounting and commenting on biblical occurrences, just like the Apostles did, in writing, decades after Jesus went up to heaven.
Remember, Muslims believe in Jesus, albeit not as fully as we Christians do, but belief it is nonetheless. As a matter of fact, every year the world’s biggest decorated Christmas tree is not found in “Christian” America but in Muslim Dubai.
Consequently, we don’t think the use of the word Judahite in the Quran has anything to do with today’s self-styled Jews.
Question #3: Why don’t you have anything extensive about Islam? Like you do about Judaism?
Answer #3: For the same reason we don’t have anything about Buddhism, Hinduism, etc. We preach the ONLY truth: pure Christianity. That’s enough to get all those of different faiths to ponder on what they should adhere to.
They did 9/11 and disquieted the world with never-ending terrorism and war.
Jesus’s peace and morality had been steadily increasing throughout the world, until that deadly, persistent Talmudic Ashkenazic Khazarian (aka Jewish) virus, which invariably hates the Prince of Peace and His followers, craves immorality, and engenders wars, began its assault on Christian civilization. But it won’t win.
“The Son of God appeared for this purpose, to destroy the works of the devil.” 1 John 3:8
“Of the increase of His government and peace there shall be no end…” Isaiah 9: 7
++++++++++++
Re: Judahites And Jews
Question #1: I like your website very much. I am trying to understand your position that there are no longer any Semitic Jews, but am struggling with what I have been taught: that the majority of Jews who did not return to Judah, but remained in Babylon and lived there for many generations before being removed in the 1930s by the Iraqi government (or whatever Iraq was called at that time). The descendants of these people would be Semitic, yes? I do agree that the vast majority of people who call themselves Jews today are descendants of proselytized peoples into Judaism. How to reconcile this issue please?
Answer #1: Thank you. Now to your inquiry.
a) In Separda of the Babylonian Empire, where the Judahites were captives, very few stayed behind as the vast majority went back home as commanded by God, and with the earthly edict issued by King Cyrus of Babylon himself.
Those few who stayed behind intermarried with Persians and Medes. So they were no longer Hebrews as the Hebraic blood had become extremely diluted, especially if one takes into consideration thousands of years of marrying non-Hebrews. Anyway, would you call a Mulatto a White person? Nope, you wouldn’t. So, nope, they’re NOT Judahites.
Many people from Separda converted to the faith of the Judahites, and, along with the few mixed-bloods, are known today as Sephardic Jews.
Question #2: Could you elaborate on the passage where it says “to the Judahite first and then to the Gentile”? The way a lot of pastors and commentaries explain it sounds wrong. Is it because Jesus came from them and was speaking particularly to those alive at that time?
Answer #2: Correct. Because there are no more Judahites, and Jews today are not Judahite Hebrews. A Gentile is a non-Hebrew, just like Jews. In fact, Ashkenazic and Sephardic Jews are the original, classified biblical Gentiles.
In addition, if not most importantly, Jesus wanted to make sure the Judahites were reached as soon as possible, so He could shut down the Old Covenant, bring about the end of the age of Satan’s dominion upon the earth, and allow free rein to the New Covenant. That admonition from Romans 1:16 was NOT a matter of favoritism, but of urgency.
That way people could see them as the Chosen People, while they endeavored to steal Palestine and create modern-day Israel without the objection of the Christian world, especially since they were Eastern-European Nomads seeking a new country following the loss of their homeland Khazaria.
Then they – who originally spoke Yiddish – resurrected the dead Hebrew tongue after thousands of years in the dustbin of oblivion to make it Israel’s official language. In so doing, they consolidated in the world’s mind the impression that they were Hebrews rightfully returning home, when in fact they were not.
However, in their lust to deceive the world they got blindsided and completely overlooked the fact that, following the destruction of the Kingdom of Israel in 721 B.C., not even the Hebrews spoke Hebrew. They spoke Aramaic, the language of Jesus.
“We all fell to the ground, and I heard a voice saying to me in Aramaic, ‘Saul, Saul, why do you persecute me? It is hard for you to kick against the goads.’” Acts 26:14
That’s why Mel Gibson made the movie The Passion of The Christ in that dialect. In turn, the Jews became furious – still on a vendetta against him – because Mel made them look ridiculous, especially as they wanted to be seen as “kinsmen” of Jesus, which they’re absolutely not. See Are Jews the Israelites of the Bible?
Deception: Yids who faked their Hebrew names.
Further, as Jewish land thieves disembarked in Palestine in the 1940s to seize Palestinian lands and homes that Zionist terrorist groups – such as the Irgun, the Stern gang, and Haganah – had stolen in order to turn the country into Israel, they adopted Hebrew names to complete their “Hebraization” process – not unlike what they did when they scattered throughout Europe and America and assumed European surnames. See Israel: Land of Impostors
2) Are all people in countries where English is spoken of English descent? No. Were all Catholics who celebrated mass in Latin Romans? No. A spoken language is not indicative of a person’s ancestry.
++++++++++++
Re: Revealing Faith
Question:Why don’t you tell us just one thing that religion has revealed about the universe? Just one.
Answer: We don’t know about religions, we know about our God who is the Maker of heaven and earth (Psalm 115:15), or the Universe as you call it. That’s the first revelation.
Second, the birth, death, and resurrection of Jesus the Messiah and the Advent of the Holy Spirit drastically changed the world. From that point in history nothing has been the same.
The Holy Spirit of Christ has been inspiring the world forward through dazzling innovations and technological achievements, not to mention the fact that the backward thinking of pagan cultures has been wiped out by Christian mores.
Where were all these achievements before Christ? Nowhere. The civilization you’re living in is known as Christian Western Civilization, which has impacted the entire globe.
Is that revealing enough for you?
+++++++++++++
Re: Marriage
Question #1:What is the Bible’s definition of marriage?
Answer #1: Biblical Marriage is a covenant between a man and a woman, who join as one for the purpose of making children, with God-assigned authorities, the parents on both sides, agreeing to the union of their offspring.
Question #2: a) Does sex between two virgins living together create a marriage?
b) Doesn’t consensual sex equal marriage, regardless of the situation, and that while sometimes there is a marriage covenant, the covenant ends at the consummation and then it’s just a marriage?
Answer #2: a) Did those two virgins enter into a marriage covenant with each other? Unless it’s marriage, it’s a sin. And did they get their fathers’ blessings?
“Thus says the Lord of hosts: Because you have obeyed the command of Jonadab your father and kept all his precepts and done all that he commanded you,therefore thus says the Lord of hosts: Jonadab the son of Rechab shall never lack a man to stand before me.” Jeremiah 35:18,19
Besides, would you like it if a boy shacked up with your daughter for his personal pleasure as if she were a whore?
b) Consensual sex is still fornication, a sin. Sex in and of itself is NOT marriage. Biblical marriage is as defined above. Besides, let’s check Exodus 22:16,17:
“If a man seduces a virgin who is not pledged to be married and sleeps with her, he must pay the bride-price, and she shall be his wife. If her father absolutely refuses to give her to him, he must still pay the bride-price for virgins.”
In that situation sex occurred, but when the father refused to give her daughter to that particular man, marriage did not materialize; and she did not run away and married him without her father’s approval either.
Question #3: Numbers 36:6, “This is the thing which the LORD doth command concerning the daughters of Zelophehad, saying, Let them marry to whom they think best; only to the family of the tribe of their father shall they marry.”
This verse directly tells fathers to let their daughters marry who they think best. But you can’t add that to the article The Biblical Marriage Blueprint because it destroys most of the arguments you are trying to make.
Answer #3: It must feel good taking verses out of context.
Unless ANYONE is the daughter of Zelophehad, which is impossible since they no longer exist, that verse is being misappropriated.
In addition, Zelophehad was dead and had no son, so there were no close male family members to give his girls in marriage as per biblical customs; therefore, God allowed his daughters to make the decision themselves when suitors would come asking for their hands in marriage.
That’s why we have that “rare situation” clause in the article’s conclusion. Today, the Holy Spirit has been given to us as the Helper who guides in these types of decisions, because each one of those “rare situations” will be different.
Further, having a male family member green light a woman’s potential husband is for her own protection. The biblical authority structure is an umbrella that covers and protects those who seek its shelter.
Christians have a bad habit of taking these kinds of “targeted” verses and applying them to themselves or to other circumstances. WRONG!
In the bible, when God uses commands that are directed to particular individuals or circumstances, especially when they digress from the norm, He also provides the grace and covering for them to be valid ONLY to said individuals and circumstances.
Question #4: In the article Can A Man Have Many Wives?, you write that a woman has to simply accept her lot if her husband does not want a child.
What about Tamar in Genesis, who posed as a prostitute and slept with her father-in-law Judah in order to have a child?
The Bible does not record any disapproval of Tamar and she thereby became part of the ancestry of Jesus Christ himself.
Judah blamed himself, and well he should have. Tamar’s desperate act was Judah’s fault, for failing to give her his third son in marriage.
Answer #4: At that time a certain Old Testament law was in Tamar’s favor. It demanded that the brother of a deceased husband give the deceased brother an heir if the deceased did not have one, which Tamar’s late husband did not.
“If brothers dwell together, and one of them dies, and has no child, the wife of the dead shall not marry outside unto a stranger: her husband’s brother shall go in unto her, and take her to him as wife, and perform the duty of a husband’s brother unto her.” Deuteronomy 25:5
So, to conform to that particular law God Himself required, and only after being rejected by her late husband’s family to fulfill that law, she guilefully, though justly, labored to obtain justice as you so aptly described.
Consequently, she got herself pregnant by her father-in-law and thus provided an heir for her late husband. Her action was NOT to satiate her own yearning, but to fulfill God’s law. In turn, her selflessness earned her a place in Jesus’s genealogy.
Is your argument within the context of that law? Obviously not.
Then don’t compare apples with oranges.
Too many Christians have that bad habit: taking something out of a targeted and directed circumstance, and arbitrarily repackaging it for another circumstance that has nothing to do with the original intent.
Question #5: Can one marry one’s cousin?
Answer #5: There’s nowhere in the bible where God forbids it. Forbidden marital/sexual relationships are very well delineated in Leviticus chapter 18:
7 “‘Do not dishonor your father by having sexual relations with your mother. She is your mother; do not have relations with her.
8 “‘Do not have sexual relations with your father’s wife; that would dishonor your father.
9 “‘Do not have sexual relations with your sister, either your father’s daughter or your mother’s daughter, whether she was born in the same home or elsewhere.
10 “‘Do not have sexual relations with your son’s daughter or your daughter’s daughter; that would dishonor you.
11 “‘Do not have sexual relations with the daughter of your father’s wife, born to your father; she is your sister.
12 “‘Do not have sexual relations with your father’s sister; she is your father’s close relative.
13 “‘Do not have sexual relations with your mother’s sister, because she is your mother’s close relative.
14 “‘Do not dishonor your father’s brother by approaching his wife to have sexual relations; she is your aunt.
15 “‘Do not have sexual relations with your daughter-in-law. She is your son’s wife; do not have relations with her.
16 “‘Do not have sexual relations with your brother’s wife; that would dishonor your brother.
17 “‘Do not have sexual relations with both a woman and her daughter. Do not have sexual relations with either her son’s daughter or her daughter’s daughter; they are her close relatives. That is wickedness.
18 “‘Do not take your wife’s sister as a rival wife and have sexual relations with her while your wife is living.
19 “‘Do not approach a woman to have sexual relations during the uncleanness of her monthly period.
20 “‘Do not have sexual relations with your neighbor’s wife and defile yourself with her.
21 “‘Do not give any of your children to be sacrificed to Molek, for you must not profane the name of your God. I am the Lord.
22 “‘Do not have sexual relations with a man as one does with a woman; that is detestable.
23 “‘Do not have sexual relations with an animal and defile yourself with it. A woman must not present herself to an animal to have sexual relations with it; that is a perversion.
+++++++++++++
Re: Polygamy
Question: I know your article Can A Man Have Many Wives? is all true, but as a woman it makes me feel a little icky. Mostly because of the underlying feeling that men just want to have lots of sex with many women, which isn’t of God but of the world. So I remember, “For your Maker is your husband– the LORD Almighty is his name.” The spiritual ecstasy we will know in heaven will far surpass the sensual gratification we get here. Plus, the idea of many wives probably doesn’t work nowadays in our sex-obsessed culture, but it does make for entertaining reality t.v.
Answer: Ironically, in biblical times when man could have many wives there was no sex-obsessed culture. The western sex-obsessed culture has selfishness at its root: “Me, me, me. Pleasure, pleasure, pleasure.”
Maybe if man could have many wives in the West, it’d help get rid of that obsession, because having several wives with various children is hard work. Consequently, the selfishness of pleasure for pleasure’s sake would be far from his mind, since he’d be too busy providing for so many individuals within his household. So why belittle such a God-appointed possibility just because you don’t like the idea?
In addition, if the thought of a potential husband having sex with his many wives makes a woman feel icky, she likewise has selfishness at the root of her disposition: “I want my man all to myself. Tough luck, if I can’t give him the children he wants.”
It’s a shame that in one breath you praise God, and in another you curse a system He’s put in place by a) saying that a man having sex with his many wives is not from God, when you already affirmed that everything in the article is true, and b) debasing God’s allowance for man to have many wives to the level of reality TV.
Re: Christmas Trees
Question: In your article Is Christmas Pagan? you seem to purposefully overlook bible verses that specifically command us that we not bring a tree into our homes and affix it with silver and gold.
Answer: Here’s the passage you mentioned but was afraid to quote because it has nothing to do with Christmas trees. IN CONTEXT from Jeremiah 10:
³ For the customs of the peoples are delusion; Because it is wood cut from the forest, The work of the hands of a craftsman with a cutting tool. 4 ″They decorate it with silver and with gold; They fasten it with nails and with hammers So that it will not totter. 5 ″Like a scarecrow in a cucumber field are they, And they cannot speak; They must be carried, Because they cannot walk! Do not fear them, For they can do no harm, Nor can they do any good.”
God is talking about GODS that the nations made out of wood, as in STATUES, as in “work of the hands of a CRAFTSMAN with a CUTTING TOOL,” that they fell down to and worshiped.
They decorated them with gold and silver, like Buddhists do with the statue of Buddha or Hindus with the statues of their gods.
No wonder you didn’t quote the verse but alluded to it, because, in your prejudicial spirit, you wanted to misuse the word of God for your own propagandist agenda.
Here’s Jeremiah concluding in chapter 10 verses 8-10:
“But they are altogether stupid and foolish In their discipline of delusion– their idol is wood! Beaten silver is brought from Tarshish, And gold from Uphaz, The work of a craftsman and of the hands of a goldsmith; Violet and purple are their clothing; They are all the work of skilled men. But the LORD is the true God; He is the living God and the everlasting King.”
Re: Race Mixing
Question: Does God forbid race mixing? Miscegenation?
Answer: No, God does not.
He forbade the Hebrews to do so, only because the other nations did not follow Jehovah.
“Do not intermarry with them. Do not give your daughters to their sons or take their daughters for your sons, For they will turn your sons away from following Me to serve other gods; then the anger of the LORD will be kindled against you and He will quickly destroy you.” Deuteronomy 7:3
With the New Covenant, the same concern still holds.
“Do not be unequally yoked with unbelievers.” 2 Corinthians 6:14
Thus, it’s a matter of FAITH, not of race.
“There is neither Judahite nor Gentile, neither slave nor free, nor is there male and female, for you are all one in Christ Jesus.” Galatians 3:28
Still, when it comes to marriage, fathers are the ones God put in charge. They decide what’s best for their children.
“Honor your father and your mother, as the LORD your God has commanded you, that your days may be prolonged and that it may go well with you.” Deuteronomy 5:16
“Thus says the Lord of hosts: Because you have obeyed the command of Jonadab your father and kept all his precepts and done all that he commanded you,therefore thus says the Lord of hosts: Jonadab the son of Rechab shall never lack a man to stand before me.” Jeremiah 35:18,19
“The thief comes only to steal and kill and destroy.” – Jesus in John 10:10
Nothing describes the Zionists better.
+++++++++++++
Re: Chosen Ones
Question #1: Why do many Christians fall on their knees to Israel in respect for the so called “God’s Chosen”?
Correct me if I am wrong. Those who believe in Jesus as the son of God are now “God’s Chosen.” I can’t understand why Christians are not taught this. Besides, Jesus made it quite clear in Matthew 21:43.
“The kingdom of God will be taken away from you and given to a people who will bring forth the fruits thereof.” Matthew 21:43
Answer #1: You’re absolutely right.
Figuratively, many “Christians” do fall on their knees in respect to converted Jews and Israel, even though they are taught that Christians are the new chosen people – chosen to love, to do good, and to spread peace.
“But you are a chosen people, a royal priesthood.” 1 Peter 2:9
At the same time, they are also taught by unscrupulous preachers that God has two covenants simultaneously at play, one for Christians and another one for Jews, never quoting the truth of the bible that says quite the opposite.
“By calling this covenant new, he has made the first oneobsolete and what is obsolete is outdated.” Hebrews 8:13
In addition, those preachers don’t teach their congregations that Jews today are not the Hebrews of the Bible, that the Old Covenant was never for those who converted but for those of Hebraic blood only, that all Hebrews are irrevocably dead, and that the word Jew is not even in the bible.
Question #2: Are you claiming that the Old Covenant was only with the chosen ethnic Hebrews, while the non-ethnics stood by and watched in exclusion?
God’s covenants have never had ethnic dependencies. From the very beginning, faith and obedience have been the sole covenant requisites.
Answer #2: The purpose of the Old Covenant with the ancient Hebrews (mind you) was to bring forth the Messiah, who Himself was a pure Hebrew of the tribe of Judah. Therefore, the Old Covenant was purely ethnic-centered.
“The LORD said to Moses and Aaron, ‘These are the regulations for the Passover meal: No foreigner may eat it.’ ” Exodus 12:43
However, proselytism within the Old Covenant was allowed and was different from the Covenant itself. That’s why Jesus told the converted Samaritans, who also worshiped Jehovah just like the Hebrews:
“You Samaritans worship what you do not know; we worship what we do know, for salvation is from Judah.” John 4:22
What Jesus meant was that Salvation would come about and bear fruit out of the Old Covenant, with Jesus Himself, a pure Judahite Hebrew, being the Salvation.
Now with the New Covenant things are totally different. It’s no longer ethnic-centered.
“For I am not ashamed of the gospel, because it is the power of God that brings salvation to EVERYONE WHO BELIEVES: first to the Judahite, then to the Gentile.” Romans 1:16
The purpose of the New Covenant is to prepare and deliver a new chosen people throughout all the nations of the earth, who will become a spiritual bride for the Messiah.
“But you are a chosen people, a royal priesthood.” 1 Peter 2:9
“And in your seed [Jesus]all the families of the earth shall be blessed…” Genesis 26: 4
“Let us be glad and rejoice, and give honor to him: for the marriage of the Lamb is come, and his wife has made herself ready.” Revelation 19:7-9
In other words, the Old Covenant brought forth the Groom, while the New will bring forth the Bride.
Question #3: Israel is mentioned many times in the New Testament. Since ancient Israel no longer existed, why was the word Israel used?
Answer #3: In the context of the New Testament, Israel does not refer to the Israel of today nor to the ancient Kingdom of Israel, but to the promise that God made to Jacob, whom God renamed Israel, and which promise was fulfilled in the person of Jesus.
“In you and in your seed shall all the families of the earth shall be blessed.” Genesis 28:14
That seed was to be Jesus the Messiah. In addition, said promise was similar to the one God made to Jacob/Israel’s father, Abraham.
“Now the promises were spoken to Abraham and to his seed. He does not say, ‘And to seeds,’ as referring to many, but rather to one, ‘And to your seed,’ that is, Christ.” Galatians 3:16
Further, Judah was Jacob/Israel’s son and the tribe Jesus was born in. So Israel was interchangeable with Judah, since Judah was Israel’s son by whom the promise was fulfilled.
It’s somewhat not unlike Jesus and His Father who are one and the same. Remember when Philip asked to see the Father, and Jesus answered:
“Have I been so long with you, and yet you have not come to know Me, Philip? He who has seen Me has seen the Father; how can you say, ‘Show us the Father?” John 8:9
+++++++++++++
Re: Christians And Islam
Question #1: From a Christian perspective, how should we view the religion of Islam?
Answer #1: First, Christians must understand what Islam stands for. Muslims believe in Jehovah; and accept that Jesus was born of the Holy Spirit and the Virgin Mary, was only a prophet to the ancient Israelites, was not crucified to death, went to heaven without dying, and is expected to return soon.
Second, Christians must pray for and reach out to Muslims IN LOVE in order to correct the misconception they currently have about Jesus, especially about His godship, death, and resurrection. And more importantly, they should dispel any hatred of Muslims Zionist-compromised “preachers” have been teaching.
Question #2: Some churches preach “one ocean, many boats,” an attitude towards the gift of salvation made possible by Jesus that it denies that people even must accept His way of life before their death, that indeed such people think that Jesus will gladly welcome Muslims into heaven. Where do you stand?
Answer #2: True Christians, who follow God’s commandments, will make it into heaven right after death. In addition, many non-Christians, including Muslims, whose moral lives resemble those of true Christians, will also make it; though they’ll have to wait Judgment Day to find out.
However, many so-called Christians, who don’t follow God’s commandments, won’t attain it; because salvation is not a robotically regurgitated prayer that pays lip service to the Lord. It is obedience to His commandments.
“For it is not the hearers of the law who are righteous before God, but the doers of the law who will be justified.”Romans 2:13
Jesus came to be the Savior of the whole world (i.e., He came to spur all men, without exception, into duplicating His way and His life by following His commandments).
“We have put our hope in the living God, who is the Savior of all people, and especially of those who believe.” 1 Timothy 4:10
For a more thorough understanding of what salvation in Christ really is, go there.
Re: Religion
Answer: Religion, as some interpret and use it, may be. However, a personal relationship with God through Christ Jesus is not. It’s the salvation and redemption of man’s soul.
Religion is man-made with earthly rules and agendas. A relationship with Christ is not. They are two different concepts.
Besides, imagine a world without Christian love and compassion. That would be the bane of human existence.
+++++++++++++
Re: Should Israel Exist?
Question #1: There are 56 Nations with Islamic majorities, 49 with Catholic majorities, 20 with Protestant majorities, 12 with Orthodox majorities, and 4 with Hindu majorities. Shouldn’t there be 1 with a Jewish majority? In other words, shouldn’t Israel exist?
Answer #1: No.
a. When you take the entire land of Palestine, which the Jews have stolen to create Israel, the Palestinians (Christians and Muslims) constitute a majority, not Jews. That’s why it’s an Apartheid state.
Besides, very few countries, if any, impose religious conformity within their borders or turn the religion of the majority into a mandatory state religion which everyone must follow.
In the US, it’s forbidden by the constitution to have a state religion. If tomorrow the US decides to become a Christian-only country, the Jews would be the first to cry foul, while they hypocritically do the same with Pharisaism in Apartheid Israel.
b. Being part of a religious group does not entitle one to a country. The following religions (just to name a few) have none:
c. Judaism is Pharisaism, not an Abrahamic religion. Today’s Jews are NOT Hebrews (all HEBREWS are irrevocably DEAD), hence they have no right to the land of Palestine. Those who believe otherwise suffer from the Chosen People Syndrome.
d. No country has a “right to exist.” People have that right, and people can exist anywhere. Cases in point: when the Soviet Union was dissolved, its people continued to exist without the “Soviet” moniker, while the US is inhabited by people who gave up their countries of origin in order to make a fresh start in a new land.
Question #2: Wasn’t Israel created as an act of reparation for what the Jews went through during World War 2?
Answer #2: No.
Israel has been in the planning since the late 18th century, way before World War 2 – a war that was orchestrated by Zionist Jews in order to 1) favor their fellow Jewish bankers who stood to make a “killing” loaning money to Western Governments to wage war, and 2) finally give birth to Israel.
And what’s with this “act of reparation” business? Stealing another people’s country in the Middle East, which had nothing to do with what was going on in Europe at that time, is what you call act of reparation? Is that your sense of justice?
Besides, who’s going to pay acts of reparation to the Palestinians for what they have suffered at the hands of the Jews? Who?
Question #3: Wasn’t Israel as a country sanctioned by the United Nations? And doesn’t that make it legitimate?
Answer #3: No and no.
Most countries of the world were bribed and bullied by Britain and the US to shamelessly recommend the partition of Palestine at the United Nations in 1947, though the resolution of said recommendation was non-binding and never implemented by the Security Council.
Israel segregates and oppresses its majority Arab population, and treats them like animals. It is therefore not a legitimate country by any stretch of the imagination.
Question #4: First, Israel won their lands by right of conquest, the oldest and most salient form of land acquisition; therefore yours is an infantile argument. Second, Palestine was a creation of the Roman Emperor Hadrian. But you don’t know that because you obviously don’t know history.
Answer #4: First, as per your argument, it’s okay for China today, for instance, to invade the US in order to acquire more land and expand its Empire, since the right of conquest is the most salient form of land acquisition. And then when Chinese folks begin to take over the homes of Americans (like Israelis did of Palestinians), no one should utter a word. Yours is the argument of a THIEF!
“You shall not steal.” Exodus 20:15
Second, every nation on earth was started at some point by some entity. But you wouldn’t know since you’re having fun picking and twisting the history that suits you. Still, according to you, because the Roman Empire created Palestine, it’s quite just for it to be erased from the map, while Israel maintains Palestinians segregated in the ugliest form of apartheid.
Again, yours is the argument of a THIEF who wishes to appease his conscience by wrangling with false contentions that make no sense. There’s a better way to appease your conscience, since obviously you’re a Zionist Jew leaving on stolen Palestinian land: follow God’s commandments instead.
“You shall not covet your neighbor’s house. You shall not covet your neighbor’s wife, or his male or female servant, his ox or donkey, or anything that belongs to your neighbor.” Exodus 20:17
Question #5: One of the things Israelis love to say is that there’s no such thing as a Palestinian people. How do you respond?
Answer #5: That there’s no such thing either as:
– a Jewish/Israeli people – because Talmudic Judaism is Pharisaism, a non-Abrahamic religion that follows an evil book called the Babylonian Talmud, full of satanic superstitions, hence not a race;
– or an American people – because America is comprised of different races from all over the world that make up a community of inhabitants seeking a better life in a new land, hence not a race either.
The Israelis love to muddy the water in order to take the focus away from the fact that they’re not Hebrews (all Hebrews are irrevocably dead) and have no right to the land of Palestine, a country they’ve stolen and destroyed.
They hoodwink the uninformed into believing that the Palestinians – whether a race or not (like Americans) – do not exist, when said Palestinians have inhabited Palestine for about 2000 years, roughly 1600 more years than Americans have inhabited America.
Unfortunately, a large number of people, especially brainwashed Christians, swallow the bait hook, line, and sinker, and consequently fail to see the following:
a) modern Israel is not comprised of the 10 Hebrew tribes like in scriptures; b) the country’s current geographical demarcation is not as delineated by God in the book of Joshua; c) the nation would be called Judah instead of Israel, with the Levites sheltered therein, if Jews today were of the tribe of David; and d) the modern impostor state of Israel is made up of Jewish converts who are not Semitic descendants of Abraham.
“To your (Abraham’s) descendants I give this land….” Genesis 15:18
However, Palestinian Arabs are Semites, descendants of Abraham; and therefore rightful inheritors of the land, not converted Jews. To obfuscate that reality, Israel engineered a hate-mongering and demonization campaign against Arabs and Muslims, which metastasized worldwide and seduced many Christians into sanctioning Israel’s foul anti-Christ spirit of “Hate Thy Neighbor.” See Israel Is The Problem.
Question #6: Haven’t the Jews always had a connection to Jerusalem?
Answer #6: No.
The Hebrews did, for a while. Before them, the Canaanites founded that place. And after Jerusalem was destroyed in 70 AD during the Hebraic period, the Arabs then took over.
Re: Bible Discrepancies
Question #1: Scholars who have had the rare privilege of studying the Bible have identified a whopping 14,800 mistakes and discrepancies. Although yes the bible is coherent, its history is an extremely convoluted one. I spent some time researching the subject a couple years ago and I must admit it’s quite the rabbit hole. How do you respond?
Answer #1: a) It is not a “rare” privilege to study the Christian bible. Everybody can and should and must. It’s the ONLY book with the truth.
b) The discrepancies are usually in translating words correctly. See BAD TRANSLATION. And it’s quite doubtful that there are 14,000 mistakes in the bible. Seriously, why didn’t they make it 140,000 or 1 million while they were at it? Scholars are usually full of it, especially those who hate God.
c) The word of God is not a rabbit hole. If it feels like that, it’s because it’s on purpose. It’s God’s way of nudging us to investigate and connect His thoughts on whatever subject is being explored, and which are scattered throughout the bible. The Good Book may appear truncated and cryptic, that’s also because it’s a spiritual book that can only be fully understood with the help of its author, God. See The Word of God.
Question #2: I read several threads here and was astounded that someone speaking with ‘authority’ stated that the bible was historical fact! The bible is allegorical.
In fact, the garden of Eden, the great flood, etc. – all those stories were stolen from other middle eastern cultures. The idea that there are people in the 21st century who take these anecdotes literally is mind-boggling.
Biblical legend doesn’t equal historical fact.
Answer #2: We, on the other hand, are not astounded at all by your foolishness.
“The fool says in his heart, ‘There is no God.'” Psalm 14:1
That’s the only way to classify the ‘authority’ behind such an idiotic theory.
You wrongfully assume God’s word to be false – as if God isn’t capable of choosing a few men to write His story, when mere mortals rely on historians to do the same.
Consequently, using your mind-boggling logic, Christopher Columbus, Johannes Gutenberg, plus every other important figure in human history are nothing but concocted characters, whose allegorical stories are meant to inspire stupid people.
Wow!
Further, the bible didn’t steal anything from other cultures. THEY DID. They acted out God’s prophetic pronouncements. Read When Prophecies Echo.
Illogical argument of a prejudicial mind does not equal truth nor historical fact.
There is a controversy about a possible discrepancy and where the comma should have been placed in His words. The meaning changes accordingly from “this day you will be in Paradise” to “I tell you this day.”
I don’t know if you agree with the new interpretation, but thought you might consider including it in one of your examples of Biblical mistranslations.
Paradise, so I read, was not a Hebrew but a pagan Greek concept. What is your thinking and research on that passage?
Answer #3: There’s no discrepancy at all, and paradise is not a pagan concept.
a) Whether the repentant thief would be in paradise “today” or “some other day” is not really an issue that deserves to be made a federal case out of. The fact of the matter still remains that the repentant thief would be in paradise – that day or the next, especially when…
“With the Lord a day is like a thousand years, and a thousand years are like a day.” 2 Peter 3:8
However, our position is:
“Truly I tell you, today you will be with me in paradise.” Luke 23:43
Because why would Jesus say, “I tell you today, you’ll be…?” Didn’t Jesus know that what He was saying He was saying “that day” which was “today?” Was there some “other day” He was supposed to say it? It doesn’t make any sense.
So we’re quite sure that “today” was the appointed time Jesus meant when He promised the repentant thief paradise.
b) The Christian paradise is NOT a pagan notion.
Where Jesus is, everlasting life is as well: thus paradise is in the bosom of the Lord. In addition, there are many other verses that point to the Christian paradise reality, both in the Old and the New Testaments.
“To him who overcomes I will grant to eat of the tree of life which is in the Paradise of God.” Revelation 2:7
“And many of those who sleep in the dust of the earth shall awake, some to everlasting life, and some to shame and everlasting contempt.” Daniel 12:2
Pagan cultures were the ones that mimicked and enacted biblical prophecies, never the other way around.
Question #4: Why wasn’t the New Testament written in Aramaic or Hebrew? Many believe that the fact that it was written in Greek is a glaring discrepancy when one considers the spoken languages of the time.
Answer #4: The original non-translated bible is in Hebrew (Old Testament) and in Greek (New Testament). In Jesus’s time no one spoke Hebrew but Aramaic, as Jesus demonstrated on the cross: “Eli, Eli, lema sabachthani?” (Matthew 27:46)
Why then wasn’t the New Testament written in Aramaic? Simply because Greek was the language of scholarship during the years of the composition of the New Testament from 50 to 66 AD.
“So the New Testament authors wrote in Greek. They did not, however, use really high-class or classical Greek, but a very common and everyday type of Greek. For many years some scholars ridiculed the Greek of the New Testament because many of its words were strange to those who read the writings of the great Greek classical authors such as Plato and Aristotle. But later many records were uncovered of ordinary people, and amazingly there were the same common terms used in everyday speech! The ridicule dried up accordingly,” explains The International Bible Society.
Question #5: The discrepancies you’ve discovered in the bible, which make up your Bad Translation section, prompt one to question even following the bible, especially since God has apparently not brought man to make a faithful interpretation?
Answer #5: Why follow the bible? Because you should.
And yes, God has brought man to a faithful interpretation of it, even if you erroneously think He has not. As you yourself already attested, whatever inaccurate transliterations that currently exist in the many versions have been discovered and fixed in our Bad Translation section.
That alone should tell you that God is still watching over His word, even if those corrections have not yet been added to all published versions: that’s why you need to make a mental note of them for when you’re studying the word.
Those are coherently and faithfully interpreted and translated throughout the bible, no matter the version.
Question #6: Could there be manipulation at the root of some discrepancies in published bibles?
Answer #6: Yes, though it’s limited to the word Jew.
In all currently published bibles the word Jew is what is printed, instead of Judahite or Judean as it should be. However, in the 1985 New King James version, published by Thomas Nelson, Inc., there’s a glaring discrepancy:
“…the Judeans, who both killed the Lord Jesus and their own prophets, and have persecuted us; and they do not please God and are contrary to all men.” 1 Thessalonians 2:15
That’s the only place in that version where the word Ioudaios is rightly translated as Judean instead of the conspicuous word Jew.
Which prompts the following questions:
Did Jews bribe Thomas Nelson, Inc. to do it? If so, what did they stand to gain? And do the editors at Thomas Nelson, Inc. actually know that the word Jew is NOT in the bible?
All in all, it simply is deliberate manipulation. Because, simply put, the same Greek word Ioudaios is oddly translated two different ways in that version.
And the only place where it’s different is in that very uncomfortable and crucial verse where we are being led, like sheep to the slaughter, to envisage “Jews” (of today, of course) as not contrary to all men and not the killers of our Lord; while the “Judeans,” of the tribe of Judah, were the actual contrary ones who crucified the Lord and persecuted Christians.
Still, in other verses where the word Jew is maintained throughout, the Talmudic Rabbinists (aka Fake Hebrews or Jews) get to be seen as the Hebrews of old – a misappropriated appellation that is full of benefits for them, including the theft of Palestine to create modern-day Israel.
Consequently, yes, the editors at Thomas Nelson, Inc. do know that the Word Jew is NOT in the Bible, and yet they keep using it.
Re: Japhetite Jews
Question:Since you say in your articles that Jews today are the descendants of Japheth, what does the following verse mean: “May God extend the territory of Japheth, may Japheth live in the tents of Shem (Genesis 9:27)?” Does it not refer to the Japhetites – today’s Jews – inhabiting the land of the Arab Semites?
Answer: No, and we just absolutely abhor when people pluck a single verse out of context to either make or infer a false point.
You totally ignored Genesis 9:26: “Praise be to the LORD, the God of Shem!”
Notice that Noah didn’t say the God of Japheth. The implication is that the tents of Shem would be blessed by God Himself, and that God would dwell there. Noah blessed Shem and cursed Canaan, but gave Japhteth secondary blessings which would drip out of the tents of Shem and onto Japheth’s. Hence, “May Japheth live in the tents of Shem.”
The extension here is that of SPIRITUAL blessings, and by implication means “if only Japheth dwelt in the tent of Jehovah (Shem’s tents where He lived), God would prosper him or enlarge his territory.”
“Whoever dwells in the tent of the Most High will rest in the shadow of the Almighty.” Psalm 91:1
The branches of Japheth are many. Today, a few of them (Talmudic Ashkenazim and Sephardim) are dwelling in the tents of Satan, not Jehovah’s, because Talmudic Judaism is Pharisaism, not an Abrahamic religion.
However, with the New Covenant everything has changed. Only those who dwell in the tent of Jesus are saved and placed in an “enlarged” or “blessed” position, which on Judgment Day will translate into Everlasting Life and into Inheriting the Earth (territorial blessing).
“Blessed are the meek, for they will inherit the earth.” Matthew 5:5
Get with the program. The OLD has passed! Behold, the NEW!
+++++++++++++
Re: Talmud And Torah
Question: Isn’t the Talmud in essence the same as the Torah? Simply read Deuteronomy – the master race kleptocracy stuff is spelled out fully.
Answer: The Torah or the Pentateuch is comprised of the first 5 books of the Christian Bible: Genesis, Exodus, Leviticus, Numbers, and Deuteronomy. Whereas the Talmud is a Babylonian book full of superstitions and lies.
Most of Deuteronomy is now obsolete as it is part of the Old Covenant.
“By calling this covenant ‘new,’ he has made the first one obsolete.” Hebrews 8:13
However, the supremacist idea you thought you saw in Deuteronomy is actually God’s election of the 12 Ancient Hebrew Tribes, which was for a singular purpose: it was God’s way of nurturing for Himself an earthly home and family for when He decided to visit in the person of Jesus, the Savior of the world.
From the very beginning, God’s plan was to always include all the nations of the earth within His family once the Messiah had arrived.
“And through your [Abraham’s] offspring [Jesus] all the families of the earth shall be blessed…” Genesis 26: 4
Irrespective of what Jews believe, they’re in denial of the truth.
“No one who denies the Son has the Father; whoever acknowledges the Son has the Father also.” 1 John 2:23
Worse still, Talmudic Jews follow Pharisaism, not an Abrahamic faith, and adhere to the Babylonian Talmud, the real Satanic Verses, a book full of lies and superstitions. In addition, they consider themselves to be gods, and see Jesus as a sorcerer and a demon-possessed liar who is now boiling in excrement in hell, and whose mother Mary was a whore.
“We are divine gods on this planet. We are as different from the inferior races as they are from insects. In fact, compared to our race, other races are beasts and animals, cattle at best. Other races are considered as human excrement,” vomited Menahem Begin, the 6th Prime Minister of Israel.
As for such demented master-race supremacist belief, it’ll go the way of all supremacist beliefs. Down in flames.
+++++++++++++
Re: Patriotism
Question: Is patriotism incompatible with the Christian life?
Answer: First of all, patriotism is a fallacy, since it revolves around countries with imaginary borders that God did not biblically delineate.
Second, if true patriotism exists in this world, it is connected to one’s local area where one makes a living.
“Money is the answer for everything.” Ecclesiastes 10:19
It manifests itself through one’s hard work, which in turn provides one with a healthy financial condition that affords one true freedom: one not reliant upon a falsely revered piece of cloth (flag) nor on some archaic music notes (national anthem) as waved and manipulated by a fascist government that is wagged by a small elite or the 1%.
However, because God has established governing authorities, Christians are commanded to obey the laws of the countries in which they live.
“Let everyone be subject to the governing authorities, for there is no authority except that which God has established. The authorities that exist have been established by God.Consequently, whoever rebels against the authority is rebelling against what God has instituted, and those who do so will bring judgment on themselves.” Romans 13:1,2
Still, Christian obedience to man-made laws of governing authorities is not intended to be absolute, since there will be instances of these laws that violate scriptures. Therefore, if such laws from Governing Authorities are contrary to God’s laws, the following principle applies:
“We must obey God rather than human beings!” Acts 5:9
Third, attachment to anything on earth is a form of vanity, a type of seduction that elevates things on earth above things of the spirit.
“For everything in the world–the lust of the flesh, the lust of the eyes, and the pride of life–comes not from the Father but from the world.” 1 John 2:16
True Christians are ambassadors of Christ on earth, and thus unequivocally under the jurisdiction of Christ’s government and Biblical Laws – hence they are only foreigners on this earth.
“All these people were still living by faith when they died. They did not receive the things promised; they only saw them and welcomed them from a distance, admitting that they were foreigners and strangers on earth.” Hebrews 11:13
Said detachment in no way invalidates our God-assigned mission or business, which is to change the world through love, peace, and biblical morality.
“Engage in business until I come.” Luke 19:13
+++++++++++++
Re: The Edomites
Question: Are the descendants of Edom still around? Because some people sure think so.
Answer: Edom (or Esau) was the brother of Jacob (or Israel). Jacob went and stole his brother Esau’s blessings from their father Isaac, which in turn created a deep hatred in Esau’s (or Edom’s) heart.
“And Esau hated Jacob because of the blessing wherewith his father blessed him: and Esau said in his heart, The days of mourning for my father are at hand; then will I slay my brother Jacob.” Genesis 27: 41
Knowing of Esau’s plan to kill him, Jacob fled. However, the blood feud never ceased and went on for generations.
“Because of what Edom did against the house of Judah by taking vengeance, and has greatly offended by avenging itself on them, therefore thus says the Lord GOD: ‘I will also stretch out My hand against Edom, cut off man and beast from it, and make it desolate from Teman; Dedan shall fall by the sword. I will lay My vengeance on Edom by the hand of My people Israel, that they may do in Edom according to My anger and according to My fury; and they shall know My vengeance,’ says the Lord GOD.” Ezekiel 25:12-14
“Because you have had an ancient hatred, and have shed the blood of the children of Israel by the power of the sword at the time of their calamity, when their iniquity came to an end, therefore, as I live,” says the Lord GOD, “I will prepare you for blood, and blood shall pursue you… Because you have said, ‘These two nations and these two countries shall be mine, and we will possess them,’ although the LORD was there, therefore, as I live,” says the Lord GOD, “I will do according to your anger and according to the envy which you showed in your hatred against them… The whole earth will rejoice when I make you desolate… you shall be desolate, O Mount Seir, as well as all of Edom—all of it! Then they shall know that I am the LORD.” Ezekiel 35: 5-6,10-11, 14-15
The Edomites never repented of their hatred and suffered the consequences. They were totally wiped out.
“Esau I have hated, and I have turned his hill country into a wasteland and left his inheritance to the desert jackals.” Malachi 1:3
By Esau’s inheritance God meant his descendants.
“Children are an inheritance of the LORD.” Psalm 127:3
So, to answer your question, no. There are no more Edomites roaming about. They’re all DEAD. D-E-A-D. Dead like all the Hebrews.
+++++++++++++
Re: Battered Women
Question #1: Not a day goes by in which a drunken, brutish man does not beat his wife to the point of, and even to death. There is NO legal protection to keep this from happening, certainly not restraining orders that seem to be enforced after the fact. Is it Scriptural for a woman to “stand by her man” even in the certain knowledge that the next time he beats her, or their children, they will die? How could this possibly be the existence that God has set forth for a woman?
Answer #1: a) God didn’t set forth that woman’s predicament. SHE chose her man, not God. It’s called consequences.
b) There might not be legal protection to prevent something like that from happening, however God did set out how one goes about getting married to help foil as much as possible such things from occurring. See The Biblical Marriage Blueprint.
c) If these things do transpire, the wife can separate herself from her husband temporarily until the husband gets some help and changes for the better. Family members are key in such an instance. The husband needs to know that his wife is surrounded by people who can protect her and provide for her. See The Family Is God’s Plan.
d) As a last resort, the wife can divorce her husband, even though God hates divorce. The only consequence of such an action is that she would never be able to marry again. That’s all. However, if she decides to marry after divorcing her husband, she would become an adulteress. Hence, she won’t see the kingdom of God. Now, that’s bad. Really bad. See Of Fornication, Divorce, and Adultery.
Question #2: I eloped as a youngster, with no familial consent. My parents were completely against the marriage, my dad called it a sham from the start. God was not part of the picture back then. I divorced this man five years ago. I have one child from this marriage. I have since been trying to be a good Christian. I have not dated, even though I’m urged to, even at church… Therefore I need strong advice right now.
So my question is this: my marriage was never quite bona fide, but in my gut I think the rules still apply; I cannot remarry unless the ex dies. Or I have to reconcile with him. Which won’t happen because he’s had a traumatic brain injury and is now unable to care even for himself. But mostly because I’d rather be alone for the rest of my life than deal with a sociopath and abuser again.
Does my conclusion sound right?
I respect this website and your advice. I know it comes across harsh, but the truth hurts. Thanks for any reply.
Answer #2: Thank you.
Excellent question, and even though we are not in the business of meting out personal advice, there are a couple of points we can elaborate on. However, as a rule, when God’s laws are echoing in your conscience, pay heed to them – which you seem to be doing.
In any case, you went ahead and married that individual without parental consent.
On one hand, there are consequences for disobedience. God’s rule for getting married is to obey your parents by obtaining their blessing, which you failed to secure. The purpose of said blessing is to cause everything to go well with you and to protect you from this very situation you are now experiencing. See The Biblical Marriage Blueprint.
“Honor your father and your mother, as the LORD your God has commanded you, that your days may be prolonged and that it may go well with you.” Deuteronomy 5:16
Your parents’ disagreement with the union cannot be used as an excuse to nullify a marriage that already occurred. Besides, there are no laws in the bible to confirm such a possibility. Ultimately, the marriage covenant is between a man and his wife – meaning, you must now carry your cross for the Lord.
“For this reason a man will leave his father and mother and be united to his wife…” Ephesians 5: 31
On the other hand, you received from that union a gift from God, a child, the ultimate purpose of marriage, which is accomplished. Most everyone seems to forget said purpose, as they have bought into the fallacious fantasy of “falling in love” just for the sake of finding someone.
If truly you cannot reconcile with your husband, then there’s nothing wrong in being alone at this point in your life. You have produced a child who should now be your focus.
“She shall be saved in childbearing – if she continues in faith, love, and holiness with propriety.” 1 Timothy 2:15
So stand on God’s laws, and after you have done all to stand, stand – especially as an example to your child.
Question #3: Since Eve was not subjected to Adam until God pronounced judgment upon her, and if reconciliation restored us to that original communion with our Father (we are all ONE family with equal access to our Father), and the bible says, ‘There is neither Judahite nor Greek, MALE nor FEMALE, slave nor free’ (Galatians 3:28), then why is the woman still subjected to her husband if she is now married to Christ and no distinction exists to God?
Corinth was in Greece and they considered women with so little value they could kill them if they were displeased with them, thus Paul’s reference ‘as the LAW states.’
The old covenant made distinctions, the new does not. Freedom is freedom for ALL God’s children, not for some. Religion has lied in order to maintain their ‘power, dominion and authority’ over people who cannot discern their right hand from their left.
Answer #3: The No-Distinction clause in the New Covenant concerns SALVATION. Jesus came to be the Savior of the whole world: man, woman, Hebrew, Gentile or non-Hebrew, etc. That’s the reconciliation.
“We have put our hope in the living God, who is the Savior of all people, and especially of those who believe.” 1 Timothy 4:10
However, the New Covenant does make a distinction when it comes to spiritual structural authority.
“But I want you to understand that the head of every man is Christ, the head of woman is man, and the head of Christ is God.” 1 Corinthians 11:3
The head of woman is man, not Jesus and not God. Even before the fall, woman was created for man and not the other way around. She was “of man,” or woman, fashioned to be his helper.
“The LORD God said, ‘It is not good for the man to be alone. I will make a helper suitable for him.’” Genesis 2:18
The freedom for all you mentioned is the feminism charade you are trying to morph into God’s law, since you do not wish to follow His authority paradigm. Hence you are the one who’s now equivocating and twisting God’s word, even though you’re right about religion lying concerning many other aspects of faith in order to maintain power and control.
Further, God’s structural authority is not to be construed as making a woman inferior or of no value to a man. It is to protect her from that very weakness which caused the first woman, Eve, to fall in the first place.
“Husbands, dwell with your wives with understanding, giving honor unto the wife as unto the weaker vessel, and as being heirs together of the grace of life, that your prayers be not hindered.” 1 Peter 3:7
+++++++++++++
Re: Divorce
Question #1: I have a question that really isn’t explicitly stated in your article on divorce. If a wife has sex with another man than her husband but then confessed the sin to her husband and repents of her sin and the husband forgives her, is the husband required to divorce her still or can the marriage continue under God’s approval?
Answer #1: When a married woman fornicates, she emotionally cuts herself off from her husband. That’s how she’s able to sin thusly. In addition, her act reeks of contempt and disrespect for the one who’s her God-appointed authority. Consequently, she not only spits on her husband but on God as well.
Her newfound emotional and sexual attachment indubitably engulfs her to the point where her disposition will manifest itself down the line with further infraction. Very rare are these women, if any, whose married lives go back to normal.
Still, if her husband forgives her and does not wish to divorce her, whether it is because of their small children or some other reason, then that’s between the two of them. There’s NO biblical law that says he MUST divorce her – even though the law openly allows for that possibility.
Now, whether their love and their trust in each other, which create family harmony, will remain unscathed, especially on the husband’s side, is quite doubtful: that’s why such an instance is the only time God, who knows His creation quite well, allows divorce.
Question #2: If a man marries a woman who is an ex-wife, repents of the adultery, and is no longer married to her, do you believe he’s able to remarry?
Answer #2:Though there is no biblical example for such an instance, we believe that such a man can remarry because his first marriage to someone’s wife (or ex) was never valid in God’s eyes to begin with. In fact, God calls it adultery, which He wants cut off.
“You have heard that it was said, ‘You shall not commit adultery.’ But I say unto you, that whosoever looks upon someone’s wife to set his heart upon her has already committed adultery with her in his heart. If your right eye makes you stumble, tear it out and throw it from you; for it is better for you to lose one of the parts of your body, than for your whole body to be thrown into hell.If your right hand makes you stumble, cut it off and throw it from you; for it is better for you to lose one of the parts of your body, than for your whole body to go into hell.” Matthew 5:28-30
Re: Spirit Vs. Flesh
Question #1: I tried using the search box, but didn’t come across any titles that would match my question.
If a Jew is actually not a Judahite, what does it mean then that “a Judahite is not one outwardly but one inwardly?” Because that doesn’t even make sense, but neither does the typical one we always hear. I left messianic Judaism after seeing how stupid it is with all this Ashkenazi stuff. I’m really bent on telling others not to let the rabbi use them as a tool for furthering the Zionist agenda.
Answer #1: The reason we don’t have anything on your question is because the bible is pretty clear on the subject if you read the whole thing in context.
“The one who is physically uncircumcised yet keeps the Law will condemn you who, even though you have the written code and circumcision, are a lawbreaker. A person is not a Judahite who is one only outwardly, nor is circumcision merely outward and physical. No, a man is a Judahite because he is one inwardly, and circumcision is a matter of the heart, by the Spirit, not by the written code. Such a man’s praise does not come from men, but from God.” Romans 2:27,28,29
Paul was admonishing the Judahites who didn’t want to follow God’s laws, and who thought that just because they were born in the tribe of Judah, that was enough. Paul told them it wasn’t, and that following all of God’s enduring laws was the rule to show God’s election in one’s life.
A Judahite was supposed to follow God’s commandments since he was elected to do so as per the Old Covenant. Therefore, a Judahite was not one outwardly (through the flesh and the election of the tribe of Judah) but through the application of God’s laws, which is by the spirit (i.e. inwardly).
So when in the spirit a circumcised person (i.e., a Judahite Hebrew) – or even an uncircumcised (i.e., a non-Hebrew or Gentile) – followed said laws, he was applying the spirit of God. Consequently, having been born a Judahite (of the tribe of Judah) was not sufficient, hence “a Judahite was not one outwardly, but inwardly.”
Likewise, with the advent of Christ, the savior of the whole world, everyone who’s now saved, through the New Covenant in Christ’s blood, is thus elected to do the same as the Judahites of old (i.e., applying God’s laws). However, many Christians unfortunately have the same mistaken disposition; they think that being born again is enough, and that they don’t have to follow God’s laws, which is a fallacy as well. See Of Legalism and Christians
Question #2: The true Hebrews/Israelites are white, Christian Europeans and their descendants around the world today, mainly America. Have you forgotten all the everlasting promises and blessings prophesied to the descendants of Jacob? That their seed would endure forever. We are Israel!!!!!
Answer #2: First, all Hebrews are DEAD. Besides, they were a Semitic people, like Arabs are. Do these Europeans and their descendants look like Arabs to you? Jeez. You have a SEVERE case of the Hebrew Disease.
Second, that SEED was JESUS.
“If you belong to Christ, then you are Abraham’s seed, and heirs according to the promise.” Galatians 3:29
Those descendants you mentioned encompass CHRISTIANS everywhere, regardless of race. We are all “spiritual” Israel. Hence, it’s NOT about bloodline, but about FAITH in Christ Jesus. That’s what makes a Christian a “descendant” of Abraham, or of Abraham’s “seed.”
If Christ is in us, then the SEED of Abraham, who is Christ, is in us. Thus we are of Abraham’s seed. It is because of JESUS we are of that “seed.” NOT because of bloodline, since we are not.
In any case, God couldn’t care less about bloodline. The flesh will rot, but the spirit will endure forever.
“There is neither Judahite nor Gentile, neither slave nor free, nor is there male and female, for you are all one in Christ Jesus.” Galatians 3:28
Further, we will get a HEAVENLY BODY on resurrection day, a body that has nothing to do with “Hebraic” bloodline.
So pick another battle.
+++++++++++++
Re: Origin Of Races
Question: Do you have a theory as to how the Races came to be?
Answer: A theory, sure.
In the beginning, there was just one race or nation which God scattered throughout the earth at the Tower of Babel.
“So the Lord scattered them from there over all the earth.” Genesis 11:8
Obviously God had foreseen such an event, and most likely – because there are no bible verses to point to – embedded in man’s genetic make up something He allowed to develop, which changed man’s singular feature into various ones (not unlike the 35 human blood group systems). Said changes most likely occurred early in mankind’s history, following the scattering.
Re: Meaning Of Life
Question #1: What is the meaning of life?
Answer #1: To love and serve God by loving and serving one another.
“ ‘Love the Lord your God with all your heart and with all your soul and with all your mind.‘ This is the first and greatest commandment.And the second is like it: ‘Love your neighbor as yourself.’All the Law and the Prophets hang on these two commandments.” Matthew 22:37-40
When you buy a car, for instance, you buy something that was created to serve the one who buys it. Likewise, God created us to love and serve.
Re: Christ-Tard Nonsense?
Question: Isn’t it about time we give up on the Jew Book and all this Christ-tard nonsense and take control of our own future?
Answer: We bet you thought you were being original.
First, the bible is not a Jew book. It’s God’s. The word JEW is not even in the bible (the original non-translated one).
Second, Christ is NOT nonsense. If you could take control of your future, you could also take control over death which is in your future. As it stands, you can’t control death, therefore you can’t control your future.
Jesus on the other hand rose from the dead, and thereby controlled his future and his death. Isn’t it better to follow His “nonsense” than your nonsense? 🙂
Get on board with the real truth and the real future, because not every individual can make up his own truth. That would be chaos. There can only be ONE TRUTH. Either white is white or it is not. Truth is truth, and Jesus is that truth.
“I am the way and the TRUTH and the life. No one comes to the Father except through me.” John 14:6
Re: Holocaust Denial
Question: If the Holocaust didn’t happen, like you posit in your article Jews And History: Lies Galore, why did Germany pay reparations to Israel? And where are the German documents that prove what your article puts forward?
1. Germany never did anything to Israel. Israel didn’t even exist during World War 2. On the contrary, Israel was created using World War 2 as an excuse, while demonizing Germany to no end. So Israel is the one that in reality should be paying “reparations” to Germany, just to thank them and apologize for maligning their nation throughout the last century.
2. Germany did not really pay “reparations.” What it did was pay taxes or tributes to the Jewish Empire, like the vassal states of old did to the empires of their time. America may be the current world empire to be reckoned with, but it’s on a tightly controlled Jewish leash.
Empires always squeeze their victims. For instance, Haiti just recently finished paying “reparations” to France, because the Haitians had the gall to kick out their French slave masters and declared independence in… wait for it… 1803. And what was the French reasoning for demanding reparations? Well, according to them, Haiti, the then richest colony in the world, was theirs, and the Haitians stole it. Go figure.
Now, we await the day when Jews will pay reparations to the Palestinians for having stolen their land, massacred their people, and kicked millions out of their homes. (We can dream, can’t we?)
3. Even today, Germany is an occupied country with many American military bases. Since it was on the losing side in World War 2, it was taken over by the US for the benefit of the Jews who control the Federal Reserve, a private firm that wags every other institution in America.
When General Patton finally understood that America was being wagged from within, he classified the war against Germany as, “The wrong war, at the wrong place, at the wrong time, and with the wrong enemy.” After uttering such wisdom, the Empire sidelined and relegated him to a desk job.
B. Now, to your “documents” question.
The Nazis were very meticulous and kept strict records of everything that went on. Following their defeat, the US Army took over their government and seized all “pertinent” documents. So waiting for the real truth about the “Holocaust” to come from a shackled Germany is like waiting for hell to freeze over.
Besides, the onus is on the Jews to prove their accusatory lies, not the other way around. In a court of law, the accuser or the District Attorney is the one that makes the case for guilt, not the accused. And for Germany to try to prove its innocence is to try to convince an Empire-controlled kangaroo court of the fact that it was framed by the Empire.
Like Winston Churchill said, “History is written by the victors.”
+++++++++++++
Re: Love And The Law
Question: In the Christian faith, which is more important, love or the law?
Answer: Let’s see.
1. The Christian faith has Jesus’s sacrifice on the cross at its core. And the cross is God’s fulfillment of the law.
“It is fulfilled.” John 19:30
2. Obedience to God’s commandments is Love.
“If you love Me, you will keep My commandments.” John 14:15
However, some will say that God is love (1 John 4:8) and therefore more important than the law. What they overlook is, God IS also the Law or the Word.
“In the beginning was the Word, and the Word was with God, and the Word was God.” John 1:1
So the Word or the Law is Love. And…
“Love is the fulfillment of the law.” Matthew 23:23
Consequently, because love originates from fulfilling the law, it has the LAW at its source.
3. Everything revolves around the law, even mercy and faith.
“You have neglected the more important matters of the law–justice, mercy, and faithfulness.” Matthew 23:23
Re: Song Of Songs
Question: Is the biblical book Song of Songs a dedication to romance prior to marriage (i.e., a way of winning someone’s heart)? If it is, doesn’t that mean your article The Biblical Marriage Blueprint is off the mark?
Answer: No, Song of Songs is not a book about seduction western-style.
Even if it is about romance prior to marriage, it is directed towards a beloved who is betrothed, not towards an individual whom one is trying to seduce prior to betrothal.
Many in the Western world see it thus because they have modern goggles on, painted with the fantastic stroke of romance as a tool to win someone’s heart.
The entire biblical culture towards marriage is as explained in said article. Song of Songs is thus written within that context, which is different from today’s western tradition.
Does the bible have instances of individuals who stepped out of the norm? Of course.
The Word of God doesn’t fail to display the wrongdoings of those who go against the biblical grain. It also does show us the consequences of their actions.
What the author meant was that all clean foods were still clean even after one ate “without the ceremonial washing of one’s hands,” which was the actual context.
“Why don’t your disciples live according to the tradition of the elders instead of eating their food with defiled hands?” Mark 7:5
Some also use the Apostle Peter’s vision to declare the same, that all foods are clean. Acts 10:
9 About noon the following day as they were on their journey and approaching the city, Peter went up on the roof to pray.10 He became hungry and wanted something to eat, and while the meal was being prepared, he fell into a trance.11 He saw heaven opened and something like a large sheet being let down to earth by its four corners.12 It contained all kinds of four-footed animals, as well as reptiles and birds.13 Then a voice told him, “Get up, Peter. Kill and eat.”
15 The voice spoke to him a second time, “Do not call anything impure that God has made clean.”
16 This happened three times, and immediately the sheet was taken back to heaven.
Unfortunately, Peter’s vision, like all symbolic dreams and visions, was not literally about food. After meditating, Peter understood what God was trying to tell him.
“Peter went inside and found a large gathering of people. He said to them: ‘You are well aware that it is against our law for a Judahite to associate with or visit a Gentile. God has shown me that I should not call anyone impure or unclean.'” Acts 10:27,28
What then?
Let’s recap.
In the beginning, God gave all animals as food to us. He then restricted many of them as “ceremonially unclean” in Leviticus. Subsequently, those Old Covenant “ceremonies” became defunct with the advent of Christ’s New Covenant. However, there’s nothing in the New Testament that specifically revokes the Old Testament ordinances on eating unclean food.
Yet, as Christ succinctly put it, it is not what one eats that defiles a man.
“’What comes out of a person is what defiles them.For it is from within, out of a person’s heart, that evil thoughts come—sexual immorality, theft, murder, adultery, greed, malice, deceit, lewdness, envy, slander, arrogance and folly.All these evils come from inside and defile a person.’” Mark 7:20-23
Consequently, as to unclean food it truly becomes a question of necessity or of conscience.
“Holding faith, and a good conscience.” 1 Timothy 1:19
“‘All things are permissible for me, but not everything is beneficial. All things are lawful for me, but I will not be mastered by anything. Food for the stomach and the stomach for food, but God will destroy them both.” 1 Corinthians 6:12,13
+++++++++++++
Re: Black Hebrews
Question: In various of your articles you wrongfully state that all Hebrews are dead. What you fail to grasp is that the word Hebrew means Black. Therefore, blacks today are the real Hebrews. And because they’re still around, you’re wrong. So deal with it.
Answer: The word Hebrew is from the Hebrew word Abarim, meaning Beyond. Its root is derived from Eber, who was the ancestor of Abraham. Eber also means “beyond” or “this side,” NOT Black. So you’re wrong, all Hebrews are dead. Therefore, you’re the one who has to deal with it, because you’ve got a bad case of The Hebrew Disease.
+++++++++++++
Re: The Anti-Christ
Question #1: Can you expand on the role of the anti-Christ? All nations being ruled from Jerusalem because of the Mount of Olives prophecy? Babylon being destroyed by fire in the book of Revelation? The 7 churches? Lambs and lions peacefully around each other during the millennial period? And the timeliness of Daniel?
Answer #1:a) As per the Apostle John, the Anti-Christ is not to be construed as a stand-alone entity, but it is to be understood as a diseased spirit that takes hold of individuals and makes them fight throughout the centuries against everything Christ represents (e.g., the Anti-Christ spirit of “Hate Thy Neighbor” that revs up the engine of the State of Israel).
“Dear children, this is the last hour; and as you have heard that the antichrist is coming, even now many antichrists have come. This is how we know it is the last hour.” 1 John 2:18
Still, that particular “anti-Christ” depicted in the Book of Revelation was to be the Emperor of Rome, who thought himself god. The Apostle John actually called him the beast.
“The beast was captured, and with it the false prophet who had performed the signs on its behalf. With these signs he had deluded those who had received the mark of the beast and worshiped its image.” Revelation 19:20
He also gave the beast the number 666.
“Let the person who has insight calculate the number of the beast, for it is the number of a man. That number is 666.” Revelation 13:18
The significance of the number 6 rests in the fact that man was created on the 6th day. Therefore 6 is the number of man. And triple 6 or 666 is man puffing himself up from 6 to the third degree, 1 degree more than God’s duality of Father and Son: such was the Emperor of Rome’s hubris in positioning his might above God’s and above his created status.
That’s why the Caesar was nicknamed the Anti-Christ by Christians everywhere, because he was the agent of Satan the Dragon, placed himself above Jehovah and His anointed Jesus, and persecuted Christians throughout his empire.
“…every high thing that exalts itself against the knowledge of God…” 2 Corinthians 10:5
The animal sacrifices, performed daily by the Judahites in Jerusalem, were abolished by Rome, which then had the image or statue of its Emperor Caligula (Gaius) set up to be worshiped in the very temple which was later desolated by its army in 70 A.D., along with Jerusalem. Emperor Vespasian’s ruthless son, Titus, led the war that year, and for his achievement was awarded a triumph: the Arch of Titus.
“From the time that the daily sacrifice is abolished and the abomination that causes desolation is set up...” Daniel 12:11
“On that day his feet will stand on the Mount of Olives, east of Jerusalem, and the Mount of Olives will be split in two from east to west, forming a great valley, with half of the mountain moving north and half moving south.” Zechariah 14:4
That prophetic and symbolic imagery of Jesus’s FEET, standing on the Mount of Olives in earthly Jerusalem and splitting it in two from east to west, meant that Jesus’s glory would WALK AWAY from Jerusalem, situated in the eastern part of the world, and would spread throughout the western part of it (thereby creating Christian Western Civilization), with the mountain itself moving north and south in two halves to cover the whole globe.
“For the earth will be filled with the knowledge of the glory of the LORD as the waters cover the sea.” Habbakuk 2:14
Consequently, Jesus abandoned once and for all the Babylonian abomination that earthly and wicked Jerusalem had become, and in 70 A.D. orchestrated its destruction which brought about a great valley of death.
“And upon her forehead was a name written, MYSTERY, BABYLON THE GREAT, THE MOTHER OF HARLOTS AND ABOMINATIONS OF THE EARTH.” Revelation 17:5
“Even though I walk through the valley of the shadow of death…” Psalm 23:4
c) Babylon in Revelation was thus symbolic of earthly Jerusalem, which was destroyed by fire in 70 A.D.
d) The 7 churches/assemblies in Revelation were assemblies that existed in various regions (7) of the world, which God wanted perfect before shutting down the Old Covenant in 70 A.D. so He could rebuild the world on a new, solid foundation, that of the New Covenant.
e) We are currently within the thousand-year reign of Christ: obviously Christians (lambs) are living side by side with non-Christians (lions), as opposed to when the Hebrews used to live within their own Kingdoms (Israel and Judah), separate and away from non-believers.
f) Daniel’s prophecies in the Old Testament were confirmations of John’s prophecies in Revelation and also pertained to 70 A.D., as evidenced in section a) of the Anti-Christ. But you can read more here.
“Every matter must be established by the testimony of two or three witnesses.” 2 Corinthians 13:1
Question #2: 666, which is the number of a man, can also be construed as the man Mayer Amschel Rothschild, who first used the six pointed star as his corporate logo. Then later the Rothschilds also had it placed on the flag of Israel, the Palestinian land they swindled during WWI/II.
Answer #2: 666 does NOT point to Mayer A. Rothschild. It’s indicative of the Emperor of Rome, as explained above.
In addition, the star of “David,” which is not David’s at all, has been used by countless individuals in occult practices for millennia, way before the Rothschilds commandeered it for their own use.
The Rothschilds and the modern impostor state of Israel are NOT that important for God to have thought of incorporating them in the bible.
Re: Rapture
Question #1: I have a close friend who is “knowledgeable” about the bible and I set forth to him about the tribulation described by Tacitus, Josephus, Eusebius, but he said that scripture should line up with scripture and not to use non biblical sources. He is pre-tribulation dispensationalist (i.e., he believes in rapture theology). Your thoughts.
Answer #1: When he says scriptures should line up with scriptures, he’s correct.
However, he and his fellow dispensationalists don’t follow their own advice. They keep pointing at world news, modern Israel – which is not comprised of biblical Hebrews – and the many other fallacies of rapture doctrine that either step out of the bible or totally misinterpret God’s word.
Our article on rapture uses scriptures to confirm scriptures. The exception is, we point to the fact that the prophecies of Jesus, the Prophets, and the Apostles all line up with what occurred in 70 AD, as compared to the dispensational view that they will take place in the future in an unprecedented, unbiblical momentary interruption of the course of history, along with Christian bodies being supernaturally snatched all over the place, contrary to scriptures.
Still, in either case one has to slightly step outside the bible to point out the fulfilled prophecies in world history. There’s no other way around it.
Question #2: Isaiah 65:20 says, “There shall be no more thence an infant of days, nor an old man that hath not filled his days: for the child shall die an hundred years old; but the sinner being an hundred years old shall be accursed.”
There are those that use Isaiah 65:20 as proof of a millennium (following the rapture) where children will live a hundred years. What does Isaiah 65:20 reveal to you?
Answer #2: First, the millennium of rapture theology is pure fallacy. We are currently living in Christ’s millennium. See Where Is Satan Now? for an explanation of the millennial time of Christ.
Second, the word “hundred” in this instance is used in a similar fashion as the word “thousand” in the thousand-year reign of Christ. Therefore, that prophetic passage in Isaiah means that God’s people (or Christians, connected to the new Jerusalem above) during the “very, very long” reign of the Messiah, which is currently taking place, otherwise known as Christ’s millennium, would be bountifully blessed with “long” life.
“With long life I will satisfy him and show him my salvation.” Psalm 91:16
“Honor your father and your mother, as the LORD your God has commanded you, that your days may be prolonged and that it may go well with you.” Deuteronomy 5:16
Keep in mind that prophecies many times use “colorful imagery” to convey a simple message or idea; just the way Jesus used parables, and said things like “moving mountain” when He was not literally talking about “moving a mountain” but about resolving a difficulty of sort.
“All these things spoke Jesus unto the multitude in parables; and without a parable spoke He not unto them.” Matthew 13:34
+++++++++++++
Re: The Kingdom Of God
Question #1: If the Kingdom of God was on Earth right now, wouldn’t the King take care of so many atrocious people himself? Don’t the Scriptures say that He would rule them with an iron rod? Jesus himself told Pilate that if His Kingdom was of this world more than twelve legions of angels would be fighting for Him. So now that His Kingdom is finally established, nothing happens and sin and injustice run rampant?
Answer #1: Jesus left us Christians in charge. WE are the salt of the earth. WE are supposed to take care of these problems by doing what God commanded, and by inspiring and helping people everywhere to look up to God for solutions.
“Truly, truly, I say to you, he who believes in Me, the works that I do, he will do also; and greater works than these he will do; because I go to the Father. Whatever you ask in My name, that will I do, so that the Father may be glorified in the Son. If you ask Me anything in My name, I will do it.” John 14:12-14
As to “Jesus ruling with an iron rod,” that verse is referring to how Jesus keeps His people in line, away from sins. Read When Bad Things Happen to see how He does it.
In reference to the Kingdom of God and Pilate question, here’s Jesus:
“When asked by the Pharisees when the kingdom of God would come, Jesus replied, ‘The kingdom of God will not come with observable signs. Nor will people say, ‘Here it is,’ or ‘There it is,’ because the kingdom of God is within you.’ ” Luke 17:20,21
You are thinking like the Judahites of Old who wanted a military-style Kingdom. DON’T. God’s Kingdom is of the Spirit, which first and foremost changes the sinful nature of man and in turn allows positive change to take place.
Last, you say that sin is running rampant.
It is because:
1) many Christians have been poisoned with the heretical Rapture Doctrine, and consequently have given up on being the salt of the earth;
“You are the salt of the earth. But if the salt loses its saltiness, how can it be made salty again? It is no longer good for anything, except to be thrown out and trampled underfoot.” Matthew 5:13
2) the church has been hijacked by unscrupulous men peddling false dogmas that are contrary to the Lord’s commands;
“There will be men who abandon the true faith and allow themselves to be spiritually seduced by teachings of the devil, teachings given by men who are lying hypocrites, whose consciences are as dead as seared flesh.” 1 Timothy 4:1,2
3) many refuse to go through the narrow door that leads to life;
“But small is the gate and narrow the road that leads to life, and only a few find it.” Matthew 7:14
4) the weed is growing with the wheat.
“Jesus said, ‘if you pull the weeds now, you might uproot the wheat with them. Let both grow together until the harvest. At that time I will tell the harvesters: First collect the weeds and tie them in bundles to be burned; then gather the wheat and bring it into my barn.’” Matthew 13: 29,20
Question #2: When did the Kingdom of God on earth as stated by Jesus start?
Answer #2: It started with the birth of our Lord Jesus who was born King.
“Where is the one who has been born king of the Judahites? We saw his star when it rose and have come to worship him.” Matthew 2:2
His dominion throughout the earth began spreading “officially” or “widely” on Pentecost in 30 AD. However, Jesus waited 40 years for the disobedient Hebrews to accept Him. Then, in 70 AD, He shut down the Old Covenant and overthrew Satan as god of this world, thus solidifying Himself as sole potentate.
Question #3: a. Jesus expressly said that His kingdom was not of this world.
b. When the Devil tempted Christ and told him to bow to him in order to rule the kingdoms of the world, Jesus refused the kingdoms. So why would Jesus want to establish his kingdom on earth when he refused to take it from the Devil?
c. This World is not fixable. All we have is faith and prayer. I do try to make myself perfect which is vain.
Answer #3: a. Jesus’s Kingdom may not be OF this world, but He came to establish it IN this world.
“From that time Jesus began to preach and say, ‘Repent, for the kingdom of heaven is at hand.’” Matthew 4:17
b. Jesus did not come to get anything from Satan, he came to destroy his works.
“The Son of God appeared for this purpose, to destroy the works of the devil.” 1 John 3:8
So why would Jesus accept anything from him? After he defeated the devil, His Heavenly Father gave Him everything.
“For God ‘has put everything under his feet.’” 1 Corinthians 15:27
c. God’s desire for us in this world is to do His will, which is to do His business until He returns.
“Occupy until I come.” Luke 19:13
And if this world is not fixable, then Jesus died for nothing. Of what use are your faith and prayers then?
Jesus came to fix mankind, so the world can in turn be fixed. Are you fixed? You don’t think you’re perfect?
As perfection takes hold, each man’s world in turn becomes perfect through the workings of Christ in our lives. And without said PERFECTION, we will not inherit the truly new PERFECT earth that Jesus will bring forth, because only PERFECT beings can inhabit a PERFECT place.
“Without holiness no one will see the Lord.” Hebrews 12: 14
“Then I saw a new heaven and a new earth; for the first heaven and the first earth passed away…” Revelation 21:1
“Blessed are the meek, for they will inherit the earth.” Matthew 5:5
Question #4: “Truly, truly, I say to you, he who believes in Me, the works that I do, he will do also; and greater works than these he will do; because I go to the Father. Whatever you ask in My name, that will I do, so that the Father may be glorified in the Son. If you ask Me anything in My name, I will do it.” John 14:12-14
In light of what Jesus said, what are these greater works of the Kingdom?
Answer #4: Each individual must go to God and find out the works he must do for the kingdom. However, even a cursory look would show how Jesus’s disciples “turned the world upside down” (Acts 17:6), and how Christians afterwards greatly managed to change the world from the time Jesus was around to today.
+++++++++++++
Re: God
Question #1: Isn’t God an unknowable essence?
Answer #1: No.
There may be things about God that are mysteries to us, just like there may be things about women that are plain mysteries to men; but that doesn’t prevent men from knowing their wives.
God Himself wants us to know Him.
“Let not the wise man boast in his wisdom, let not the mighty man boast in his might, let not the rich man boast in his riches, but let him who boasts boast in this, that he understands and knows me, that I am the Lord who practices steadfast love, justice, and righteousness in the earth. For in these things I delight, declares the Lord.” Jeremiah 9: 23-24
“This is eternal life, that they know you the only true God, and Jesus Christ whom you have sent.” John 17:3
God wants us so much to know Him that He became flesh and dwelt amongst us in the person of Jesus Christ.
“And the Word was made flesh, and dwelt among us, (and we beheld his glory, the glory as of the only begotten of the Father,) full of grace and truth.” John 1:14
You can know God. Click here. Then He’ll come and make His abode with you.
“My Father will love them, and we will come to them and make our home with them.” John 14:23
Question #2: To be consistent in your article The Trinity Doctrine Is Not In The Bible, if you conclude that the Trinity is not part of the Godhead, thus a lie, and that the Holy Spirit is not a person nor a sentient being, but is a thing, then you should change your own use of “he” to “it”, especially as said doctrine destroys the true Gospel of Jesus Christ.
Answer #2: First, the fact that mainstream Christianity does not adhere to the truth that the Holy Spirit is not God and does not form a Trinity with the Father and the Son in no way destroys the gospel of Jesus Christ, which is salvation in Christ alone – a totally separate disputation. You are simply forcing one onto the other in order to make a false point.
Second, we never concluded that the Holy Spirit was not sentient and that He was a Thing. Your argument of He or It is absurd. Why?
a. God is not a person either, in the sense that we understand a person to be a human. He is God. A Spirit. So which pronoun would you use for HIM?
“God is spirit, and his worshipers must worship Him in spirit and in truth.” John 4:24
b. Angels are not persons either. They’re spirits, neither male nor female – with wings, to boot. So which pronoun would use to describe one? He, She, or It?
“At the resurrection people will neither marry nor be given in marriage; they will be like the angels in heaven.” Matthew 22:30
Consequently, we’ll stick with He for the Holy Ghost, because the Power that He carries is to be respected as Christ succinctly pointed out.
“And everyone who speaks a word against the Son of Man, it will be forgiven him; but he who blasphemes against the Holy Spirit, it will not be forgiven him.” Luke 12:10
Since when can one blaspheme against an It or a Thing? The Holy Spirit is the one who guarantees our eternal inheritance, and a “Thing” is incapable of doing so.
“…the Holy Spirit of promise, who is given as a pledge of our inheritance, with a view to the redemption of God’s own possession, to the praise of His glory.” Ephesians 1:14
“And do not bring sorrow to God’s Holy Spirit by the way you live. Remember, he has identified you as his own, guaranteeing that you will be saved on the day of redemption.” Ephesians 4:30
Therefore you better be careful AND respectful.
“‘Ananias, why has Satan filled your heart to lie to the Holy Spirit…’ And as he heard these words, Ananias fell down and breathed his last…” Acts 5:3-5
+++++++++++++
Re: Hearing God
Question:In many of your articles you talk about hearing the voice of God, or that God would “show us” how to go about doing a certain thing. How do you hear God’s voice?
Answer: He tugs your heart gently and repeatedly until His will permeates your spirit – that is if you’re truly open to hearing Him. For His will to really permeate you, you have to be faithful in applying His commandments. After all, if you can’t be obedient to His written word, how will you be obedient to hearing His voice?
The more you study the bible, the more the Holy Spirit helps you cleave to the truth. The more you live out God’s commandments, the more sensitive you become to His guidance and His voice, the more cleansed your mind, the more attuned your soul, and the more fruitful your work.
Delve in our CHURCH REFORM series, which will get you on the right track to follow His ways, read the bible, spend time in prayer, and constantly apply what you learn. Then His voice will become as clear as a bell to your soul. We can confidently say, “We know!”
+++++++++++++
Ask us aquestion, but before you do make sure you peruse our various articles, since they may already contain an answer to your inquiry. Otherwise feel free to fill out the form below, and we’ll get back to you as soon as possible.
Name(required)
Email(required)
Website
Comment(required)
Share this:
Like this:
LikeLoading...
5 thoughts on “Riposte”
A partial list of literature on Jewish Khazars:
1. The Ashkenazic Jews: A Slavo-Turkic People in Search of a Jewish Identity by Paul Wexler
2. The Jews of Khazaria by Kevin Alan Brook.
3. The Invention of the Jewish People by Shlomo Sand.
4. The Kuzari and the Shaping of Jewish Identity, 1167–1900 by Adam Shear
5. The Thirteenth Tribe by Arthur Koestler.
6. Facts are facts by Benjamin H. Freedman
7. A Social & Religious History of the Jews by Salo W. Baron
8. History of the Jews by Prof H. Graetz
9. The Invention of the Land of Israel: From Holy Land to Homeland by Shlomo Sand
10. The History of Jewish Khazars by D. M. Dunlop
11. The World of the Khazars by Peter B. Golden, Haggari Ben-Shammai & Andrais Rona-Tas
12. The Origin of Ashkenazi Jewry: The Controversy Unraveled – Jits van Straten – East European Jews are mainly descendants of Ukrainians and Belarussians.
13. Robert G. Hoyland, In God’s Path: The Arab Conquest and the Creation of an Islamic Empire (New York: Oxford University, 2015)
14; Susan Wise Bauer, The History of the Medieval World: From the Conversion of Constantine to the First Crusade (New York: W. W. Norton, 2010), 363-364. Bauer seems to admit this reluctantly.
15. Charles King,The Black Sea: A History (New York: Oxford University Press, 2005), 74-75
16. Khazaria by Prof. Abram. N. Poliak, Professor of Medieval Jewish History at Tel Aviv University, published his book KHAZARIA in 1944, says:
“The descendants of this settlement (Khazars in Eastern Europe)—those who stayed there and those who emigrated to the United States, or went to Israel—constitute the largest majority of world Jewry.”
17.THE WORLD OF THE KHAZARS is a selection of papers from the Jersualem 1999 International Khazar Colloquium edited by Peter B. Golden, Haggai Ben-Shammai and Andras Rona-Tas. Many of the papers were subsequently updated and expanded and the volume was finally published by Brill in 2007 as part of their Handbook of Oriental Studies series.
As an Indo-European – Uralic – Turkic linguist, my main interest when it comes to the Khazars is their language, which is understood to be a member of the Turkic family but whose exact classification is elusive. Marcel Erdal’s “The Khazar Language” is a fine introduction to the debate. Erdal abundantly cites earlier discussions and then explains how none of the criteria used to prove that a language is Chuvash-type Turkic have proven conclusive. Andras Rona-Tas’ “The Khazars and the Magyars” helps us understand this aspect of early Turkic-Uralic contacts, though it is more a rough extract of his book HUNGARIANS AND EUROPE IN THE EARLY MIDDLE-AGES than a satisfying standalone paper.
Some of the papers are on general history and relations with other states. From Irina A. Arzhantseva we have “The Alans: Neighbours of the Khazars in the Caucasus”. Thomas S. Noonan contributes “The Economy of the Khazar Khagante”. James Howard-Johnson writes on Byzantine sources for Khazar history. Tatiaana Kalinina, David Wasserstein and Dan Shapira write on interactions between the Khazars and the Muslim world, while Vladimir Petrukhin examines Khazaria-Rus’ relations.
The remaining papers deal with the Khazars’ famous conversion to Judaism. Peter B. Golden’s contribution is a discussion of their adoption of the religion. Artem Fedorchuk offers “New Findings Relating to Hebrew Epigrahic Sources from the Crimea”. Victor Shnirelman contributes “The Story of A Euphemism”, a look at how Russian nationalists have viewed the Khazars as the first conspiracy against their country, and whose shadowy heirs continue to cause trouble. Paul Wexler offers “Yiddish Evidence for the Khazar Component in the Ashkenazic Ethnogenesis”.
Lothrop Stoddard, the leading racial theorist of the interwar period, described two races of Jews in his 1926 article in the Forum titled “The Pedigree of Judah. The “aristocratic” Sephardic Jews, who had entered the Mediterranean world […]. However, the Ashkenazic Jews were a mixture of diverse bloods, whose features reflected intermarriage with the Hittites. These eastern Jews had migrated into southern Russia, where they then blended with the Khazars, whom Stoddard regarded as a combination of Turkish and Mongoloid peoples.
By the 1960s, the Khazar ancestry of the Jews was a firm article of faith. Two books, widely read in this milieu, came to exercise a strong influence in this regard. John Beaty’s Iron Curtain over America (1951) focused especially on the roots of Russian Jewry. He claimed that the reforms of Czar Alexander II gave the “Judaized Khazars,” who had converted in the seventh century, the opportunity to infiltrate and corrupt Russia. Wilmot Robertson’s Dispossessed Majority (1972) repeated the Khazar thesis of Stoddard. Christian Identity teachings readily seized on this negative reference to Russian Jewry, but backdated Jewish intermarriage with the Khazars into biblical times. […]
The novel ‘When?’ describes an apocalyptic military climax to the Second World War set in Palestine. After the British retreat from Jerusalem, the city is captured by the evil forces of Gog, aided by Zionists—none other than inauthentic Jews who are the descendants of ancient intermarriages with impure races. […]
In 1948, the year of the creation of the state of Israel, C. F. Parker repeated the view that there were two races of Jews. He considered the Zionists to be almost exclusively Ashkenazim […] If the Sephardim were pious and apolitical, the Ashkenazic Zionists shamelessly mobilized the financial and political influence of European and American Jewry to support their campaign for a sovereign state. “The newly declared Jewish State of ‘Israel’ is as ersatz and barren as its predecessor, the Herodian-Jewish nation, for it still rejects Jesus Christ. . . . The Jews have seized the Holy Land from the rightful owners […].”12
Howard Rand also fulminated against the new state, branding it the work of “renegade Jews,” not “true Israelitish Jews.” He described these “renegades” as the same impostors who had led the Russian Revolution thirty years earlier. In a later article, he identified the Zionists with “a Great Conspiracy” and “programme of evil,” whereby the Jews had deceived Christians, so that Jews appeared to be the rightful heirs to the state of Israel. This grand deception, he argued, had extensive ramifications among the Nihilists, the Illuminati, the Fabians and the House of Rothschild.
I thought the same thing about the appearance of Jews as you mentioned when watching David Duke’s video about the Ashkenazim.
Until recently, never suspected anything other than progressive bias and progressive ideas leading to the downfall of our Christian culture and values. Didn’t realize who is behind the curtains, or who is really steering the ship.
In fact, learning quite a bit about Balfour declaration, WW1, and soon Nazi Germany along with Bolshevik revolution, and have the “The Invention of the Jewish People” book on order.
Finally, I’m just trying to learn the truth, and have come to understand that to find the truth one may have to go to places the Media censors, shuts down and/or deems deplorable. 😉
Thank you for the work you’re doing. Really enjoy reading the articles from your site.
The Israeli Mossad also infiltrated Iran back in the 1950’s to scare the Iranian Jews into migrating to Israel. Many Jews in the region were treated well until the Zionist infiltration at the turn of the century. lolol
I have learned a lot from your website… It’s well past time for the truth to come out. Christians have been deceived for way too long.
My forebears were “Jews”. My great-grandfather was one of ten men who founded the synagogue in Nashua, N.H. His tombstone is in Hebrew. I actually had my DNA tested because I wanted to see my connection to the “Jews”. |
{
"pile_set_name": "ArXiv"
} | ---
abstract: 'Garside’s results and the existense of the greedy normal form for braids are shown to be true for the singular braid monoid. An analogue of the presentation of J. S. Birman, K. H. Ko and S. J. Lee for the braid group is also obtained for this monoid.'
address:
- 'Département des Sciences Mathématiques, Université Montpellier II, Place Eugéne Bataillon, 34095 Montpellier cedex 5, France'
- ' Sobolev Institute of Mathematics, Novosibirsk, 630090, Russia '
author:
- 'V. Vershinin'
title: On the singular braid monoid
---
Introduction
============
Various questions concerning braid groups and their generalizations attracted attention during the last decade. Presentations of the braid groups and algorithmic problems for the singular braid monoid are among these questions
The canonical presentation of the braid group $Br_n$ was given by E. Artin [@Art1] and is well known. It has the generators $\sigma_1$, $\sigma_2$, $\dots$, $\sigma_{n-1}$, and relations $$\begin{cases} \sigma_i \sigma_j &=\sigma_j \, \sigma_i, \ \
\text{if} \ \ |i-j|>1, \ \ i,j =1, ..., n-1;
\\ \sigma_i \sigma_{i+1} \sigma_i &= \sigma_{i+1} \sigma_i \sigma_{i+1},
\ \ i =1, ..., n-2.
\end{cases} \label{eq:brelations}$$
Of course, there exist other presentations of the braid group. J. S. Birman, K. H. Ko and S. J. Lee [@BKL] introduced a presentation with generators $a_{ts}$ with $1 \leq s<t\leq n$, and relations
$$\begin{cases}
a_{ts}a_{rq}&=a_{rq}a_{ts} \ \ {\rm for} \ \ (t-r)(t-q)(s-r)(s-q)>0,\\
a_{ts}a_{sr} &=a_{tr}a_{ts}=a_{sr}a_{tr} \ \ {\rm for} \ \
1\leq r<s<t\leq n .
\end{cases}\label{eq:rebkl}$$
The generators $a_{ts}$ are expressed by canonical generators $\sigma_i$ in the following form: $$a_{ts}=(\sigma_{t-1}\sigma_{t-2}\cdots\sigma_{s+1})\sigma_s
(\sigma^{-1}_{s+1}\cdots\sigma^{-1}_{t-2}\sigma^{-1}_{t-1}) \ \
{\rm for} \ \ 1\leq s<t\leq n.$$
The [*Baez–Birman monoid*]{} $SB_n$ or [*singular braid monoid*]{} [@Bae], [@Bir2] is defined as a monoid with generators $\sigma_i, \sigma_i^{-1}, x_i$, $i=1,\dots,n-1,$ and relations $$\begin{cases}
&\sigma_i\sigma_j=\sigma_j\sigma_i, \ \text {if} \ \ |i-j| >1,\\
&x_ix_j=x_jx_i, \ \text {if} \ \ |i-j| >1,\\
&x_i\sigma_j=\sigma_j x_i, \
\text {if} \ \ |i-j| \not=1,\\
&\sigma_i \sigma_{i+1} \sigma_i = \sigma_{i+1} \sigma_i
\sigma_{i+1},\\
&\sigma_i \sigma_{i+1} x_i = x_{i+1} \sigma_i \sigma_{i+1},\\
&\sigma_{i+1} \sigma_ix_{i+1} = x_i \sigma_{i+1} \sigma_i,\\
&\sigma_i\sigma_i^{-1}=\sigma_i^{-1}\sigma_i =1.
\end{cases}
\label{eq:singrel}$$ In pictures $\sigma_i$ corresponds to the canonical generator of the braid group and $x_i$ represents an intersection of the $i$th and $(i+1)$st strand as in Figure \[fi:singene\].
singene
Motivation for introduction of this object was Vassiliev – Goussarov theory of finite type invariants.
The singular braid monoid on two strings is isomorphic to ${\mathbb Z}\oplus{\mathbb Z}^+$, so the word problem in this case is trivial. For the monoid with three strings this problem was solved by A. Járai [@Jar] and O. T. Dashbach and B. Gemein [@DG]. In general it was done by R. Corran in the complicated and technical paper [@Cor]. Here we hope to give a simple solution using almost nothing but Garside’s arguments. The initial idea is simple and geometric: Garside’s [*fundamental word*]{} $\Delta$ (for convenience the definition is given below) behaves the same way with respect to the singular generators $x_i$ as it behaves with respect to the braid generators $\sigma_i$: $$x_i\Delta \doteq \Delta x_{n-i},$$ as shown on Figure \[fi:deltax\].
deltax.tex
Word problem for the singular braid monoid
==========================================
Following Garside’s ideas we consider the [*positive singular braid monoid*]{} $SB_n^+$. It is defined as a monoid with generators $\sigma_i, x_i$, $i=1,\dots,n-1,$ and relations (\[eq:singrel\]) except the last one concerning the invertibility of $\sigma_i$. Two positive words $A$ and $B$ in the alphabet $\{\sigma_i, x_i$, $(i=1,\dots,n-1) \}$ will be said to be [*positively equal*]{} if they are equal as elements of $SB_n^+$. In this case we shall write $A\doteq B$. As usual, identity of words is denoted by the symbol $\equiv$. Proofs of statements below are the same as in Garside’s paper [@Gar] with some exceptions as, for example, the proof of Proposition \[pro:inj\]. Garside’s proof of this Proposition doesn’t work and we use the Malcev rule. Proposition \[pro:inj\] was proved by R. Corran [@Cor], Theorem \[theo:center\] was proved by R. Fenn, D. Rolfsen and J. Zhu [@FRZ] using different methods.
For $i,k = 1, ..., n-1 $, given $\sigma_i A \doteq \sigma_k B$, it follows that $$\text{if} \ \ k = i, \ \text{then} \ \ A \doteq B,$$ $$\text{if} \ \ |k - i| = 1,
\ \text{then} \ \ A \doteq \sigma_k\sigma_i Z, \ B\doteq \sigma_i\sigma_k Z
\ \ \text{for some} \ \ Z,$$ $$\text{if} \ \ |k - i| \geq 2, \ \text{then} \ \ A \doteq
\sigma_k Z, \ B\doteq \sigma_i Z \ \ \text{for some} \ \ Z,$$ given $\sigma_i A \doteq x_k B$, it follows that $$\text{if} \ \ |k - i| = 1,
\ \text{then} \ \ A \doteq \sigma_k x_i Z, \ B\doteq \sigma_i\sigma_k Z
\ \ \text{for some} \ \ Z,$$ $$\text{if} \ \ |k - i| \not= 1, \ \text{then} \ \ A
\doteq
x_k Z, \ B\doteq \sigma_i Z \ \ \text{for some} \ \ Z.$$ and given $x_i A \doteq x_k B$, it follows that $$\text{if} \ \ k = i, \ \text{then} \ \ A \doteq B,$$ $$\text{if} \ \ |k - i| \geq 2,
\ \text{then} \ \ A \doteq x_k Z, \ B\doteq x_i Z
\ \ \text{for some} \ \ Z,$$ $$\text{the case when } \ |k - i| = 1, \
\text{is impossible}.$$ The same is true for multiples of $\sigma_i$ or $x_k$ to the right. \[pro:div\]
Garside’s proof works here. We apply the induction on the length $s$ of $A$ and the length of chain of transformations from $a_iA$ to $a_kB$ where $a_i$ may be $\sigma_i$ or $x_i$ and $a_k$ may be $\sigma_k$ or $x_k$. The cases of $s=0$, $1$ are evident, so suppose that the statement is true for length $s\leq r$ and for $s=r+1$ it is true for chain-length $\leq t$. As an example we give a proof of the last statement, which is formally is not contained in Garside’s considerations. So, let $A$, $B$ be of word-length $r+1$ and let $x_i A \doteq x_kB$, $|i-k|=1$, through a transformation of chain-length $t+1$. We may suppose that $k=i+1$ and let the succesive words of transformations be $$W_1 \equiv x_iA, \dots W_{t+2}\equiv x_{i+1}B.$$ Choose arbitrary any intermediate word $W_g$, say, from the middle of the chain somewhere. We have $W\equiv aV$, where $a$ is a generator of $SB_n^+$. Suppose at first that $a$ commutes with $x_i$, $x_{i+1}$, then we have $x_i A\doteq a V\doteq x_{i+1}B$ and using induction we obtain: $$A\doteq a P, \ \ V\doteq x_i P, \ \ V\doteq x_{i+1} Q, \ \ B\doteq aQ.$$ So, $x_i P \doteq x_{i+1} Q$ what is impossible by induction.
The cases when $a= x_{i-1}, x_i, x_{i+1}, x_{i+2} $ are also impossible by induction. The cases which we need to consider are $a= \sigma_{i-1},
\sigma_i, \sigma_{i+1}, \sigma_{i+2} $. So, let $a=\sigma_{i-1}$, then $W_g\doteq \sigma_{i-1}V$. Using induction we get $$A\doteq \sigma_{i-1}\sigma_i P, \ \ V\doteq \sigma_i x_{i-1} P, \ \
V\doteq x_{i+1} Q, \ \ B\doteq \sigma_{i-1}Q.$$ Hence $\sigma_i x_{i-1} P \doteq x_{i+1} Q$, and so, $ x_{i-1} P \doteq \sigma_{i+1}x_i R$, $Q\doteq\sigma_i\sigma_{i+1}R$. Again using induction we get $P\doteq \sigma_{i+1}S$, $x_iR\doteq x_{i-1}S$, that is impossible. The rest cases may be considered the same way.
If $A\doteq P$, $B\doteq Q$, $AXB \doteq PYQ$, ($L(A)\geq 0$, $L(B) \geq 0$), then $X\doteq Y$. That is, monoid $SB_n$ is left and right cancellative.
For any word $W$ in the alphabet $\{\sigma_i$, $x_i$ $(i = 1, ..., n-1 ) \}$, let $S$ be a word in the alphabet $\{\sigma_i\}$ of maximal length, such that $W\doteq ST$ for some word $T$. Suppose also that $W\doteq AV$ for some word $A$ in the alphabet $\{\sigma_i\}$. Then $S$ is divisible by $A$. The same is true for the right division. \[pro:maxdiv\]
We use the induction on the length of $S$. If $S$ has the length 1, then $A$ also has the length 1 and the assertion follows from Proposition \[pro:div\]. Let the statement be true for the length less or equal to $k$ and let the length of $S$ be equal to $k+1$. Consider at first the case when the length of $A$ is equal to 1. This means that $A\equiv \sigma_j$. Let the first letter of $S$ be $\sigma_i$: $S\equiv \sigma_i S^\prime$, so we have the situation $\sigma_i S^\prime T\doteq \sigma_j V$. If $i=j$, then we are done. If $|i-j| \geq 2$, then $S^\prime T \doteq \sigma_j X$ and using the induction we have $S^\prime \doteq \sigma_j R^\prime$. Let $|i-j|=1$, then $S^\prime T \doteq \sigma_j\sigma_i Y$ and again using induction we obtain $S^\prime \doteq \sigma_j\sigma_i Q^\prime$. Suppose now that the length of $A$ is greater than l, then $A\equiv \sigma_j A^\prime$ for some $\sigma_j$. Using the previous case we have $S\doteq \sigma_j S^\prime$ and $S^\prime T \doteq A^\prime V$ and by induction we obtain $S^\prime\doteq A^\prime S^{\prime\prime}$. Hence $S$ is divisible by $A$.
For any element $w$ of $SB_n^+$ there exists a unique greatest left (right) diviser which belongs to $Br_n^+$.
Garside’s [*fundamental word*]{} for the braid group $Br_n$ is the following $$\Delta \equiv \sigma_1 \dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1.$$ If we use Garside’s notation $\Pi_t\equiv \sigma_1\dots \sigma_t$, then $\Delta \equiv \Pi_{n-1} \dots \Pi_1$. We keep the same notations for their images in $SB_n$. Garside’s transformation of words $\mathcal R$ and then the automorphism of $Br_n$ and the positive braid monoid $Br_n^+$, defined by the formula $$\mathcal R(\sigma_i) \equiv \sigma_{n-i},$$ we extend to letters $x_i$ and so to $SB_n^+$ and to $SB_n$ by $$\mathcal R(x_i) \equiv x_{n-i}.$$
There are equalities $$\sigma_i\Delta \doteq\Delta \mathcal R(\sigma_i),$$ $$x_i\Delta \doteq\Delta \mathcal R(x_i).$$
$$\begin{gathered}
x_1\Delta \equiv x_1\sigma_1 \dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \sigma_1 x_1\sigma_2 \dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \\
\sigma_1 x_1\sigma_2 \sigma_1\dots \sigma_{n-1}\sigma_2 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \sigma_1 \sigma_2 \sigma_1 x_2\sigma_3\dots \sigma_{n-1}\sigma_2 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \\
\sigma_1 \sigma_2 \sigma_1 \sigma_3\dots x_{n-2}\sigma_{n-1}\sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \sigma_1 \sigma_2 \sigma_1 \sigma_3\dots \sigma_{n-2}\sigma_{n-1}x_{n-1}
\dots \sigma_1\sigma_2\sigma_1
\doteq \\
\sigma_1 \sigma_2 \sigma_3\dots \sigma_{n-2}\sigma_{n-1}\sigma_1 \dots\sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1 x_{n-1}\equiv \Delta x_{n-1}.\end{gathered}$$
Let $i\geq 2$: $$\begin{gathered}
x_i\Delta \equiv x_i\sigma_1 \dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \sigma_1 \dots x_i\sigma_{i-1}\sigma_i \dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq \\
\sigma_1 \dots \sigma_{i-1}\sigma_i x_{i-1}\dots \sigma_{n-1}\sigma_1 \dots \sigma_{n-2}
\dots \sigma_1\sigma_2\sigma_1
\doteq
\Pi_{n-1}x_{i-1}\Pi_{n-2} \dots\Pi_1 \doteq \\
\Pi_{n-1}\dots\Pi_{n-i+1}x_{1}\Pi_{n-i}\Pi_{n-i-1} \dots\Pi_1 \doteq
\Pi_{n-1}\dots\Pi_{n-i+1}\Pi_{n-i}\Pi_{n-i-1}x_{n-i}\Pi_{n-i-2} \dots\Pi_1 \doteq \\
\Pi_{n-1}\dots\Pi_{n-i+1}\Pi_{n-i} \dots\Pi_1 x_{n-i}\doteq
\Delta x_{n-i}.\end{gathered}$$
If $W$ is any positive word in $SB_n^+$ such that either $$W\doteq \sigma_1 A_1\doteq\sigma_2 A_2\doteq\dots\doteq\sigma_{n-1}A_{n-1},$$ or $$W\doteq B_1\sigma_1 \doteq B_2\sigma_2 \doteq\dots\doteq
B_{n-1}\sigma_{n-1},$$ then $W\doteq\Delta Z$ for some $Z$.
Canonical homomorphism $$SB_n^+ \to SB_n$$ is a monomorphism. \[pro:inj\]
We need to prove that if two elements of $SB_n^+$, (expressed by positive words $A$ and $C$) are equal in $SB_n$ then they are positively equal. If elements defined by words $A$ and $B$ are equal in $SB_n$ then there exists a sequence of words $$A\equiv A_0 \to A_1 \to \dots \to A_j \to\dots \to A_k\equiv C,
\label{eq:seq}$$ where each arrow means an elementary operation which may be an application of one defining relation or insert or deletion of an expression $c c^{-1}$ or $c^{-1}c$ where $c$ is one of $\sigma_i$. In the first case the insert is called *left* and in the second it is called *right*. A right insert $$A_j \equiv Y_jZ_j \to Y_j c^{-1}cZ_j$$ is called *correct*, if the fragment $Y_j$ is not changed in the sequence (\[eq:seq\]) till the elimination of $c^{-1}$. For the left insert the same condition is made for the fragment $Z_j$.
We use the following Malcev rule [@Mal1], [@Mal2], [@Nov]:
*If all defining relations contain only positive degrees of letters of the alphabet then transformation of a word $A$ into a positive word $C$ can be done by a sequence of operations where all inserts are correct.*
Let us consider a subsequence of (\[eq:seq\]) starting with the last right insert and finishing with the deletion of the corresponding $c^{-1}$: $$A_j\equiv Y_jZ_j \to Y_j c^{-1}cZ_j \to Y_j c^{-1}V_{j+1}\to
\dots \to Y_j c^{-1}cZ_{j+r}\to Y_j Z_{j+r}.
$$ The fragment $Y_j$ does not change in this subsequence because the insert is correct. For any $c$ there exists a positive word $D_c$ such that $D_c c\doteq \Delta$. Define the sequence $$\begin{gathered}
\Delta A_j\equiv \Delta Y_jZ_j \mapsto \dots \mapsto
\mathcal R (Y_j) \Delta Z_j \mapsto \dots \mapsto
\mathcal{R}(Y_j) D_c c Z_{j} \hookrightarrow
\mathcal{R}(Y_j) D_c V_{j+1} \hookrightarrow \dots \\
\hookrightarrow \mathcal{R}(Y_j) D_c c Z_{j+r}
\mapsto \dots \mapsto \mathcal{R}(Y_j) \Delta Z_{j+r}\mapsto
\dots \mapsto \Delta Y_j Z_{j+r}
$$ where $\mapsto$ denote a positive operation and $\hookrightarrow$ denote a positive operation or deletion. So multiplying by $\Delta$ we eliminated one insert. Applying induction we construct a sequence of positive operations between $\Delta^m A\Delta^l$ and $\Delta^m C\Delta^l$ for some $m$ and $l$. After the cancellation this means that $A$ and $C$ are positive equivalent. As it was noted by V. V. Chainikov, one can get a proof without use of the Malcev rule but using the fact that relations (\[eq:singrel\]) are invariant with respect to the operation $\mathcal{R}$.
Among all positive words on the alphabet $\{\sigma_1, \dots, \sigma_{n-1}$, $x_1, \dots, x_{n-1} \}$ let us introduce a lexicographical ordering with the condition that $\sigma_1 < \sigma_2 < \dots < \sigma_{n-1} < x_1 < x_2 < \dots <x_{n-1} $. For a positive word $W$ the *base* of $W$ is the smallest positive word with respect to this ordering, which is positively equal to $W$. The base is uniquely determined. If a positive word $A$ is prime to $\Delta$, then for the base of $A$ the notation $\overline{A}$ will be used.
In $SB_n$ every word $W$ can be expressed uniquely in the form $ \Delta^m \overline{A}$, where $m$ is an integer. \[theo:garnf\]
First suppose $P$ is any positive word. Among all positive words positively equivalent to $P$ choose a word in the form $\Delta^t A$ with $t$ maximal. Then $A$ is prime to $\Delta$ and we have $$P\doteq \Delta^t \overline{A}$$ Now let $W$ be any word in $SB_n$. Then we may put $$W\equiv W_1(c_1)^{-1}W_2(c_2)^{-1} \dots (c_k)^{-1}W_{k+1},$$ where each $W_j$ is a positive word of length $\geq 0$, and $c_l$ are generators $\sigma_i$, the only possible invertable generators. As it was already mentioned for each $c_l$ there exists a positive word $D_l$ such that $c_l D_l\doteq \Delta$, so that $(c_l)^{-1} = D_l \Delta^{-1}$, and hence $$W = W_1 D_1 \Delta^{-1}W_2 D_2 \Delta^{-1} \dots
W_k D_k \Delta^{-1}W_{k+1}.$$ Hence, moving the factors $\Delta^{-1}$ to the left, we obtain $W=\Delta^k P$, where $P$ is positive, so we can express it in the form $\Delta^t\overline{A}$ and finally we get $$W = \Delta^m \overline{A}.
\label{eq:gnf}$$ It remains to show that the form (\[eq:gnf\]) is unique. Suppose $$\Delta^m \overline{A}= \Delta^p \overline{C}.
\label{eq:gnf2}$$ Let $p<m$, and $m-p=t>0$. Then (\[eq:gnf2\]) gives $\Delta^t\overline{A}= \overline{C}$, what is impossible. So $p =m$ and hence $\overline{A} = \overline{B}$. So from Proposition \[pro:inj\] we obtain $\overline{A}\doteq\overline{C}$, but the base is unique, hence $\overline{A}\equiv\overline{C}$ and the uniqueness of the form (\[eq:gnf\]) is established.
The form of a word $W$ established in this theorem we call the *Garside left normal form* and the index $m$ we call the *power* of $W$. The same way the *Garside right normal form* is defined and the corresponding variant of Theorem \[theo:garnf\] is true. The Garside normal form also gives a solution to the word problem in the braid group.
The necessary and sufficient condition that two words in $SB_{n}$ are equal is that their Garside normal forms (left or right) are identical. \[cor:gws\]
Garside normal form for the braid groups was precised in the subsequent papers [@Ad], [@E_Th], [@EM]. Namely, it was written in the *left-greedy form* (in the terminology of W. Thurston [@E_Th]) $$\Delta^t A_1 \dots A_k,$$ where $A_i$ are the succesive possible longest *fragments of the word* $\Delta$ (in the terminology of S. I. Adyan [@Ad]) or *positive permutation braids* (in the terminology of E. El-Rifai and H. R. Morton [@EM]). Certainly, the same way the *right-greedy form* is defined.
Consider these forms for the singular braid monoid. For any word $W$ first of all move to the left the greatest power of $\Delta$. To the right we have a positive word $W^\prime$ not divisible by $\Delta$. Consider the decomposition $W^\prime\doteq S_1T$ of Proposition \[pro:maxdiv\]. Then we take the fragments of the left-greedy form for $S_1$: $S_{1,1} \dots S_{1,t}$. Among all the $x_i$-divisers of $T$ we choose the smallest in the lexicographical order: $T\doteq x_{i_1} T_1$. Consider the decomposition of Proposition \[pro:maxdiv\] for $T_1$ and continue this process. We get the form $$W\doteq \Delta^t S_1 X_1 \dots S_kX_k,$$ where each $S_i$ consists of the fragments of the left-greedy form for the braid group and each $X_i$ is a lexicographically ordered product of $x_j$. We call this form the *left-greedy form* for the singular braid monoid. The same way the *right-greedy form* for the singular braid monoid is defined.
Each element of the singular braid monoid can be written uniquely in a left-greedy (right-greedy) form.
For $n=2$ the singular braid monoid $SB_n$ is commutative and isomorphic to ${\mathbb Z}\oplus{\mathbb Z}^+$. For $n\geq 3$ its center is the same as the center of $Br_n$ and so is generated by $\Delta^2$. \[theo:center\]
Conjugacy problem for the singular braid monoid
===============================================
Let $M$ be a monoid with unit group $G$. We call two elements $u, v\in M$ *conjugate* if $v = g^{-1} u g$ for some $g\in G$. This means that the elements $u$ and $v$ belong to the same orbit of the canonical action of the braid group $Br_n$ on $SB_n$. So, in this sense we understand the *conjugacy problem* for the singular braid monoid. Such approach to conjugacy appears in monoid theory, see [@Put], for example.
Relations (\[eq:singrel\]) are homogeneous with respect to both types of generators $\sigma_i$ and $x_i$, so, three homomorphisms which express the degree of an element with respect to $\sigma_i$, $x_i$ and the total degree are well defined: $\operatorname{deg}_\sigma :SB_n\to {\mathbb Z}$, $\operatorname{deg}_x :SB_n\to {\mathbb Z}^+$ and $\operatorname{deg} :SB_n\to {\mathbb Z}$.
The group of units of monoid $SB_n$ is equal to the image of the braid group $Br_n$.
Invertible elements must have invertible degree $\operatorname{deg}_x$, so $\operatorname{deg}_x = 0$.
Garside’s solution of the conjugacy problem for the braid groups works in the case of the singular braid monoid. In the proof of the following theorem concerning the structure of the Cayley diagram $D(W)$ of a positive word $W$ on the alphabet $\{\sigma_i, x_k\}$, containing $\Delta$, some additional considerations are necessary.
If $W \doteq \Delta V$ is any positive word (on the alphabet $\sigma_i$, $x_i$) containing $\Delta$, then each node of $D(W)$ is incident with each edge $\sigma_i$, $i=1,\dots n-1$.
To complete Garside’s proof by induction on the order of a node we must consider the case when the edge $x_i$ starts at some node $C$ of order $m$ and ends at a node $D$ of order $m+1$.
We first consider the case of the generators $\sigma_k$, with $|k -i| \not= 1$. If the edge $\sigma_k$ ends at $C$ then we have $\sigma_k x_i \doteq x_i\sigma_k$ what means that the edge $\sigma_k$ also ends at $D$. If $\sigma_k$ starts from $C$ then using Proposition \[pro:div\] we obtain the fragment of the Cayley graph, depicted on Figure \[fi:x\_sigabc\] a).
Let $|k-i| =1$. If the edge $\sigma_k$ starts at $C$, then using Proposition \[pro:div\] we obtain the fragment of the Cayley graph, depicted on Figure \[fi:x\_sigabc\] b). Consider now the case when the edge $\sigma_k$ ends at $C$ (and starts at some node $B$). The edge $\sigma_i$ must be incident to $C$, so it either ends or starts at $C$. Consider the first case, then using Proposition \[pro:div\] we obtain the fragment of the Cayley graph, depicted on Figure \[fi:x\_sigabc\] c). We complete the proof of this case using relation $\sigma_i\sigma_k x_i= x_{k}\sigma_i\sigma_k$. At the last case the edge $\sigma_i$ starts at $C$. Consider the node $B$ where starts $\sigma_k$. If the edge $\sigma_i$ ends at $B$ then we use relation $\sigma_i\sigma_k x_i= x_{k}\sigma_i\sigma_k$ and this case is finished. So suppose that the edge $\sigma_i$ also starts at $B$. Using Proposition \[pro:div\] we obtain the fragment of the Cayley graph, depicted on Figure \[fi:x\_sidab\] a). Using Proposition \[pro:div\] two times we obtain the fragment of the Cayley graph, depicted on Figure \[fi:x\_sidab\] b). Again using Proposition \[pro:div\] we come to the fragment of the Cayley graph, depicted on Figure \[fi:x\_sidcd\] c). To complete the proof of this case we use the relation $\sigma_i\sigma_k x_i= x_{k}\sigma_i\sigma_k$ and arrive to Figure \[fi:x\_sidcd\] d).
The definition of the summit set for the singular braid monoid is the same as Garside’s.
In $SB_n$ two elements are conjugate if and only if their summit sets are identical.
For any element of $SB_n$ the sumit set is finite and is obtained algorithmically, so this theorem gives a solution of the conjugacy problem.
Birman – Ko – Lee presentation for the singular braid monoid
============================================================
For the singular braid monoid we prove the existence of the analogue of the presentation of J. S. Birman, K. H. Ko and S. J. Lee (\[eq:rebkl\]). For $1\leq s<t\leq n$ and $1\leq p<q\leq n$ we consider the elements of $SB_n$ which are defined by $$\begin{cases}
a_{ts}&=(\sigma_{t-1}\sigma_{t-2}\cdots\sigma_{s+1})\sigma_s
(\sigma^{-1}_{s+1}\cdots\sigma^{-1}_{t-2}\sigma^{-1}_{t-1}) \ \
{\rm for} \ \ 1\leq s<t\leq n, \\
a_{ts}^{-1}&=(\sigma_{t-1}\sigma_{t-2}\cdots\sigma_{s+1})\sigma_s^{-1}
(\sigma^{-1}_{s+1}\cdots\sigma^{-1}_{t-2}\sigma^{-1}_{t-1}) \ \
{\rm for} \ \ 1\leq s<t\leq n, \\
b_{qp}&=(\sigma_{q-1}\sigma_{q-2}\cdots\sigma_{p+1}) x_p
(\sigma^{-1}_{p+1}\cdots\sigma^{-1}_{q-2}\sigma^{-1}_{q-1}) \ \
{\rm for} \ \ 1\leq p<q\leq n.
\end{cases}\label{eq:defab}$$ Geometrically the generators $a_{s,t}$ and $b_{s,t}$ are depicted in Figure \[fi:sbige\].
The singular braid monoid $SB_n$ has a presentation with generators $a_{ts}$, $a_{ts}^{-1}$ for $1\leq s<t\leq n$ and $b_{qp}$ for $1\leq p<q\leq n$ and relations $$\begin{cases}
a_{ts}a_{rq}&=a_{rq}a_{ts} \ \ {\rm for} \ \ (t-r)(t-q)(s-r)(s-q)>0,\\
a_{ts}a_{sr} &=a_{tr}a_{ts}=a_{sr}a_{tr} \ \ {\rm for} \ \
1\leq r<s<t\leq n , \\
a_{ts}a_{ts}^{-1} &=a_{ts}^{-1}a_{ts} =1 \ \ {\rm for} \ \ 1\leq s<t\leq n,\\
a_{ts}b_{rq}&=b_{rq}a_{ts} \ \ {\rm for} \ \ (t-r)(t-q)(s-r)(s-q)>0,\\
a_{ts}b_{ts}&=b_{ts}a_{ts} \ \ {\rm for} \ \
1\leq s<t\leq n , \\
a_{ts}b_{sr} &=b_{tr}a_{ts} \ \ {\rm for} \ \
1\leq r<s<t\leq n , \\
a_{sr}b_{tr} &=b_{ts}a_{sr} \ \ {\rm for} \ \
1\leq r<s<t\leq n , \\
a_{tr}b_{ts}&=b_{sr}a_{tr} \ \ {\rm for} \ \
1\leq r<s<t\leq n, \\
b_{ts}b_{rq}&=b_{rq}b_{ts} \ \ {\rm for} \ \ (t-r)(t-q)(s-r)(s-q)>0.
\end{cases}\label{eq:srebkl}$$
We follow the proof of J. S. Birman, K. H. Ko and S. J. Lee [@BKL] and we begin with the presentation of $SB_n$ using generators $\sigma_i, \sigma_i^{-1}, x_i$, $i=1,\dots,n-1,$ and relations (\[eq:singrel\]). Add the new generators $a_{ts}$, $a_{ts}^{-1}$ for $1\leq s<t\leq n$ and $b_{qp}$ for $1\leq p<q\leq n$ and relations (\[eq:defab\]). Relations (\[eq:srebkl\]) are described by isotopies of singular braids, so they must be the consequences of (\[eq:singrel\]), and we may add them too.
In the special case when $t = s+1$ relations (\[eq:defab\]) tell us that $
a_{(s+1) s} =\sigma_s,
$ $
a_{(s+1) s}^{-1} =\sigma_s^{-1},
$ $
b_{(s+1) s} =x_s,
$ so we may omit the generators $\sigma_1, \dots, \sigma_{n-1}$, $\sigma_1^{-1}, \dots, \sigma_{n-1}^{-1}$ to obtain a presentation with generators $a_{ts}$, $a_{ts}^{-1}$, $b_{pq}$. Defining relations are now (\[eq:srebkl\]) and $$a_{(i+1)i} a_{(j+1)j}= a_{(j+1)j} a_{(i+1)i}, \ \text {if} \ \ |i-j| >1,
\label{eq:comma}$$ $$a_{(i+1)i} a_{(i+2)(i+1)} a_{(i+1)i} = a_{(i+2)(i+1)} a_{(i+1)i}
a_{(i+2)(i+1)},
\label{eq:brel}$$ $$a_{ts}=(a_{t(t-1)}a_{(t-1)(t-2)}\cdots a_{(s+2)(s+1)})a_{(s+1)s}
(a^{-1}_{(s+2)(s+1)}\cdots a^{-1}_{(t-1)(t-2)}a^{-1}_{t(t-1)})
\label{eq:defaa}$$ $$a_{ts}^{-1}=(a_{t(t-1)}a_{(t-1)(t-2)}\cdots a_{(s+2)(s+1)})
a_{(s+1)s}^{-1}
(a^{-1}_{(s+2)(s+1)}\cdots a^{-1}_{(t-1)(t-2)}a^{-1}_{t(t-1)})
\label{eq:defaa-1}$$ $$b_{(i+1)i}b_{(j+1)j}=b_{(j+1)}b_{(i+1)i}, \ \text {if} \ \ |i-j| >1,
\label{eq:commb}$$ $$b_{(i+1)i} a_{(j+1)j}= a_{(j+1)j} b_{(i+1)i}, \
\text {if} \ \ |i-j| \not=1,
\label{eq:commab}$$ $$a_{(i+1)i} a_{(i+2)(i+1)} b_{(i+1)i} = b_{(i+2)(i+1)} a_{(i+1)i}
a_{(i+2)(i+1)},
\label{eq:brelab1}$$ $$a_{(i+2)(i+1)} a_{(i+1)i} b_{(i+2)(i+1)} = b_{(i+1)i} a_{(i+2)(i+1)}
a_{(i+1)i},
\label{eq:brelab2}$$ $$\begin{gathered}
b_{qp}=(a_{q(q-1)}a_{(q-1)(q-2)}\cdots a_{(p+2)(p+1)}) b_{(p+1)p}
(a^{-1}_{(p+2)(p+1)}\cdots a^{-1}_{(q-1)(q-2)} a^{-1}_{q(q-1)}) \\
{\rm for} \ \ 1\leq p<q\leq n.
\label{eq:defbab}\end{gathered}$$ Now we prove that relations (\[eq:comma\]) - (\[eq:defbab\]) are consequences of (\[eq:srebkl\]). It was proved by J. S. Birman, K. H. Ko and S. J. Lee that relations (\[eq:comma\]) - (\[eq:defaa\]) are consequences of the first two relations of (\[eq:srebkl\]). The proof for the relation (\[eq:defaa-1\]) is the same as for (\[eq:defaa\]). Relations (\[eq:commb\]) are special cases of the last relations in (\[eq:srebkl\]). Relations (\[eq:commab\]) are special cases of the forth and the fifth relations in (\[eq:srebkl\]). To deduce the relation (\[eq:brelab1\]) we use at first the sixth relation in (\[eq:srebkl\]): $$a_{(i+1)i} a_{(i+2)(i+1)} b_{(i+1)i} = a_{(i+1)i} b_{(i+2)i}
a_{(i+2)(i+1)},$$ and then the seventh relation in (\[eq:srebkl\]): $$a_{(i+1)i} b_{(i+2)i} a_{(i+2)(i+1)} = b_{(i+2)(i+1)} a_{(i+1)i}
a_{(i+2)(i+1)}.$$ To deduce the relation (\[eq:brelab2\]) we use the second, the eighth, the fifth and again the second relations in (\[eq:srebkl\]): $$\begin{gathered}
a_{(i+2)(i+1)} a_{(i+1)i} b_{(i+2)(i+1)} = a_{(i+1)i} a_{(i+2)i}
b_{(i+2)(i+1)}=
a_{(i+1)i} b_{(i+1)i} a_{(i+2)i} = \\
b_{(i+1)i} a_{(i+1)i}
a_{(i+2)i} = b_{(i+1)i} a_{(i+2)(i+1)}a_{(i+1)i}.\end{gathered}$$ To eliminate (\[eq:defbab\]) apply the second relation in (\[eq:srebkl\]) to change the center pair in (\[eq:defbab\]) $a_{(p+2)(p+1)} b_{(p+1)p}$ to $b_{(p+2)p} a_{(p+1)p}$. Then apply this process to the pair $a_{(p+3)(p+2)} b_{(p+2)p}$. Ultimately, this process will move the original center letter $b_{(p+1)p}$, to the leftmost position, where it becomes $b_{qp}$. Free cancellation eliminates everything to its right, and we are done.
Now we consider the [*positive singular braid monoid*]{} with respect to generators $a_{ts}$ and $b_{t,s}$ for $1\leq s < t \leq n$. Its relations are (\[eq:srebkl\]) except one concerning the invertibility of $a_{ts}$. Two positive words $A$ and $B$ in the alphabet $a_{ts}$ and $b_{t,s}$ will be said to be [*positively equivalent*]{} if they are equal as elements of this monoid. In this case, as in the previous section, we shall write $A\doteq B$.
The [*fundamental word*]{} $\delta$ of Birman, Ko and Lee is given by the formula $$\delta \equiv a_{n(n-1)}a_{(n-1)(n-2)}
\dots a_{21} \equiv \sigma_{n-1} \sigma_{n-2} \dots \sigma_2\sigma_1.$$ Its divisibility by any generator $a_{ts}$, proved in [@BKL], is convenient for us to be expressed in the following form.
The fundamental word $\delta$ is positively equivalent to a word that begins or ends with any given generator $a_{ts}$. The explicit expression for left divisibility is $$\delta \doteq a_{ts}a_{n(n-1)}a_{(n-1)(n-2)}
\dots a_{(t+1)s} a_{t(t-1)}\dots a_{(s+2)(s+1)} a_{s(s-1)}
\dots a_{21}.$$
For the fundamental word $\delta$ there are the following formulae of commutation $$\begin{cases}
a_{ts} \delta &\doteq \delta a_{(t+1)(s+1)} \ \ \text{for}
\ \ 1\leq r < s < t < n, \\
a_{ns} \delta &\doteq \delta a_{(s+1)1}, \\
b_{ts} \delta &\doteq \delta b_{(t+1)(s+1)} \ \ \text{for} \ \
1\leq r < s < t < n, \\
b_{ns} \delta &\doteq \delta b_{(s+1)1}.
\end{cases}$$
For the generators $a_{ts}$ it is proved in [@BKL]. Suppose that $1\leq r < s < t < n$, then using relations (\[eq:srebkl\]) we have $$\begin{gathered}
b_{ts} \delta \doteq b_{ts} a_{ts}a_{n(n-1)}a_{(n-1)(n-2)}
\dots a_{(t+1)s} a_{t(t-1)}\dots a_{(s+2)(s+1)} a_{s(s-1)}
\dots a_{21} \doteq \\
a_{ts} b_{ts}a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}
a_{t(t-1)}\dots a_{(s+2)(s+1)} a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots b_{ts}a_{(t+1)s}
a_{t(t-1)}\dots a_{(s+2)(s+1)} a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}b_{(t+1)t}
a_{t(t-1)}\dots a_{(s+2)(s+1)} a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}
a_{t(t-1)}b_{(t+1)(t-1)}
\dots a_{(s+2)(s+1)} a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}
a_{t(t-1)}\dots b_{(t+1)(s+2)}
a_{(s+2)(s+1)} a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}
a_{t(t-1)}\dots a_{(s+2)(s+1)} b_{(t+1)(s+1)}
a_{s(s-1)}\dots a_{21} \doteq \\
a_{ts} a_{n(n-1)}a_{(n-1)(n-2)} \dots a_{(t+1)s}
a_{t(t-1)}\dots a_{(s+2)(s+1)}
a_{s(s-1)}\dots a_{21}b_{(t+1)(s+1)} \doteq \delta b_{(t+1)(s+1)}.\end{gathered}$$ For $t= n$, we have $$\begin{gathered}
b_{ns} \delta \doteq b_{ns} a_{n(n-1)} a_{(n-1)(n-2)} \dots a_{21}
\doteq a_{n(n-1)}b_{(n-1)s} a_{(n-1)(n-2)} \dots a_{21} \doteq
\dots \doteq \\
a_{(n-1)n} a_{(n-1)(n-2)}\dots a_{(s+2)(s+1)}b_{(s+1)s}
a_{(s+1)s} \dots a_{21} \doteq \\
a_{(n-1)n} a_{(n-1)(n-2)}\dots a_{(s+1)s}b_{(s+1)s}
a_{s(s-1)} \dots a_{21} \doteq \\
a_{(n-1)n} a_{(n-1)(n-2)}\dots a_{s(s-1)}
b_{(s+1)(s-1)} a_{(s-1)(s-2)}\dots a_{21} \doteq \\
a_{(n-1)n} a_{(n-1)(n-2)}\dots a_{s(s-1)}
a_{(s-1)(s-2)}\dots a_{21}b_{(s+1)1}.\end{gathered}$$
Geometrically this commutation is shown on Figure \[fi:bdelta\].
The analogues of the other results proved by Birman, Ko and Lee (which are also analogues of the statements of Sections 2 and 3 of the present paper) remain valid for the singular braid monoid. Unfortunately the proof of the analogue of Proposition \[pro:div\] (which consists of many different cases already in [@BKL]) is very long and consists of even bigger amount of cases.
[References]{} *S. I. Adyan*, Fragments of the word $\Delta $ in the braid group. Mat. Zametki 36 (1984), no. 1, 25–34. (Russian) English transl. in Math. Notes 36 (1984) 505-510. *E. Artin*, Theorie der Zöpfe, Abh. Math. Semin. Univ. Hamburg, 1925, v. 4, 47–72. *J. C. Baez*, Link invariants of finite type and perturbation theory. Lett. Math. Phys. 26 (1992), no. 1, 43–51. *J. S. Birman*, New points of view in knot theory. Bull. Amer. Math. Soc. 1993, 28[, No 2]{}, 253–387. *J. S. Birman; K. H. Ko; S. J. Lee*, A new approach to the word and conjugacy problems in the braid groups. Adv. Math. 139 (1998), no. 2, 322–353. *R. Corran*, A normal form for a class of monoids including the singular braid monoids. J. Algebra. 223 (2000), no. 1, 256–282. *O. T. Dasbach; B. Gemein*, The Word Problem for the Singular Braid Monoid. Arxiv. math.GT/9809070. 18 pages. *E. El-Rifai and H. R. Morton*, Algorithms for positive braids. Quart. J. Math. Oxford Ser. (2) 45 (1994), no. 180, 479–497. *D. B. A. Epstein; J. W. Cannon; D. E. Holt; S. V. F.Levy; M. S. Paterson; W. P. Thurston*, Word processing in groups. Jones and Bartlett Publishers, Boston, MA, 1992. xii+330 pp. *R. Fenn; D. Rolfsen; J. Zhu*, Centralizers in the braid group and singular braid monoid. Enseign. Math. (2) 42 (1996), no. 1-2, 75–96. *F. A. Garside*, The braid group and other groups, Quart. J. Math. Oxford Ser. 1969, 20, 235–254. *A. J' arai, Jr.* On the monoid of singular braids, Topology Appl. 96, No.2, 109-119 (1999). *A. I. Malcev*, On the embedding of associative systems into groups. I, Mat. Sb. New. Ser. v. 6, No 2, 331-336 (1939). (Russian). *A. I. Malcev*, On the embedding of associative systems into groups. II, Mat. Sb. New. Ser. v. 8, No 2, 251-263 (1940). (Russian). *P. S. Novikov*, On the algorithmic unsolvability of the word problem in group theory Tr. Mat. Inst. Steklova 44, 140 p. (1955). (Russian) *M. S. Putcha*, Conjugacy classes and nilpotent variety of a reductive monoid. Can. J. Math. 50, No.4, 829-844 (1998).
|
{
"pile_set_name": "Github"
} | flaky
pytest
pytest-xdist
mock
Attrs
-e git+https://github.com/greysteil/unreachable#egg=unreachable
|
{
"pile_set_name": "OpenWebText2"
} | Last week, police in the Mexican resort city of Puerto Vallarta reported at least 11 cases of people completely stripped of their clothes tied to lamp posts and with the letter ‘R’ shaved on the back of their heads. So far, no one knows who orchestrated these attacks and why, as the victims all refuse to talk.
Police started receiving calls about naked men being tied to lamp posts in different areas of Puerto Vallarta last Monday. Between 9:26 PM on Monday, and 1:29 AM on Tuesday, four men were discovered in similar circumstances. They had all been stripped naked, had bruises on their buttocks like they had been repeatedly slapped, they were tied to lamp posts at various intersections across the city and they all had the letter ‘R’ shaved into the back of their heads. Authorities announced that they had started an investigation, but little did they know that these four cases was only the beginning.
Photo: Puerto Vallarta Independiente/Facebook
On Wednesday, September 26, more reports of naked men tied to lamp posts around Puerto Vallarta started coming in, and between 11:19 PM and 11:45 PM, six more people were discovered in similar conditions as the four found on the previous two days. They were all completely naked, with bruised buttocks and an ‘R’ shaved on the back of the head, and they were all tied to lamp posts.
With one exception, a man who claimed to have been taken from his home by people he didn’t know, taken to a farm and beaten, all the other victims refused to work with law enforcement. They either didn’t want to reveal the names of the people who had done this to them, or said that they didn’t remember anything, and one of them actually ran off as soon as he was freed.
Photo: El Informador
With no testimonies and no clues as to why these men were punished like this, police and local media could only speculate. One explanation would be that these men were suspected thieves and that they were punished by local vigilantes tired of police failing to do their jobs. The ‘R’ shaved in the back of their heads most likely stands for ‘rat’, which is how thieves are sometimes referred to. But just like in English, ‘rat’ is also slang for ‘snitch’, so this could be the work of a crime cartel teaching these men a lesson for not keeping quiet and also sending a clear message to others. The last theory is that this could be just be a conflict between rival gangs.
It’s worth noting that these 10 cases were the ones reported by police, but there may have been even more. One thing is for sure, so far, the mystery of the naked men of Puerto Vallarta is a long way from being solved. |
{
"pile_set_name": "Pile-CC"
} | Drug use among top issues for Legislature
January 7, 2013
Serious attention to this state’s elementary and secondary education system, and the twin problems of drug abuse and the crowded prison system that is a result of that abuse, should be some of the......
gottarideduc
As usual, regressive propagandist Tom Miller acts as a shill for the WV Democrat establishment.
Given the recent vote fraud convictions in Lincoln County, should it not be a top priority to ensure that everybody who tries to vote actually does have the right to vote and votes only once? Not a priority for Mr. Miller.
If Ms. Marple had the interest of the State at heart, she'd do what every working guy is expected to do when he's lost a job: Look for another one. But it's all about Marple, not about WV kids. With the help of Mr. Miller.
How do people who are no longer looking for work survive? They get money from the taxpayer. If they fail drug tests chances are they'll buy more drugs with our money. But according to Mr. Miller, drug policy is more important than job creation.
Last, but not least in typical regressive fashion Mr. Miller conflates military weapons with "traditional" firearms. I'm sure he knows the difference. It just doesn't fit his agenda. How inconven |
{
"pile_set_name": "Github"
} | .table th{
text-align: center;
height:38px;
}
.table>tbody>tr>td,.panel-heading{
text-align:center;
}
/* dataTables表头居中 */
.table>thead:first-child>tr:first-child>th{
text-align:center;
}
|
{
"pile_set_name": "Pile-CC"
} | 360-DEGREE LIVES: Wombat couple make rare joint appearance after a long wait
Editor's note: This is part of a series of videos offering an up-close perspective on the animal kingdom. A special 360-degree video camera system was set up in zoos and other facilities to show how the animals view their world as they interact.[Read More] |
{
"pile_set_name": "OpenWebText2"
} | På egen Facebook-side skriver Hareide:
«Det er ikke aktuelt for KrF å støtte en innføring av et tredje kjønn. Kjønnskategoriene mann og kvinne er grunnleggende for både familie og samfunn. Det er viktig å fastholde de to kjønnene som likeverdige og likestilte, men like fullt forskjellige. Å bestrebe kjønnsnøytralitet tror vi er en skivebom og en undergraving av faktiske og fysiske realiteter.»
– Vil ha tiltak for gruppen, ikke nytt kjønn
Hareide sier samfunnet må ta på alvor at noen ikke føler seg hjemme i de etablerte kjønnskategoriene, og at man må utrede hvordan man kan hjelpe disse.
– Hvorfor innebærer ikke det også å innføre en egen kjønnskategori?
– Det er ikke et tiltak vi vil gå for. Vi vil heller ha tiltak som treffer mennesker med utfordringer rundt sin kjønnsidentitet som ikke innebærer å åpne for et tredje kjønn. Det mener KrF at ikke er riktig, sier Hareide.
Tidligere denne uken ble det klart at Arbeiderpartiet i sitt utkast til nytt program skriver at partiet vurderer å innføre en tredje kjønnskategori.
Etter Arbeiderpartiets fremleggelse fikk Hareide spørsmål om KrFs standpunkt. Den gangen svarte partilederen:
– KrF er nok i utgangspunktet skeptisk til å åpne for en kjønnsbetegnelse med hen. Men vi ønsker å utrede det, og vi ønsker å vite konsekvensene av dette, før vi konkluderer.
Nå har KrF-lederen altså konkludert.
Splitter partiene på Stortinget
I tillegg til Arbeiderpartiet har Venstre, SV og MDG allerede stilt seg positive til innføring av hen.
Senterpartiet har gjort det klart at de ikke vil støtte en tredje kjønnskategori.
– Vi stemte imot en tredje kjønnskategori da saken var oppe i Stortinget. Slik jeg oppfatter Sp kommer vi ikke til å støtte en lovendring i denne saken. Det har ikke vært en sak vi har prioritert inn i vårt program, sa helsepolitisk talsperson Kjersti Toppe (Sp) da Arbeiderpartiets programutkast var klart. |
{
"pile_set_name": "StackExchange"
} | Q:
How to get list name through javascript?
I wrote javascript for getting list items but here I'm hard coded list name as "Projects"(my list name). How can I get list name automatically with out hard coding,
function DoLogicalDelete()
{
var clientContext = null;
var oList = null;
var oListItem = null;
//var lstItmIsDeleted = null;
var itmID = getQuerystring('ID');
clientContext = SP.ClientContext.get_current();
oList = clientContext.get_web().get_lists().getByTitle('Projects');
//var oListItemID = SP.ListOperation.Selection.getSelectedItems(clientContext);
oListItem = oList.getItemById(itmID); // getting ID
clientContext.load(oListItem,"Title", "IsDeleted"); // load items to oListItem
oListItem.set_item('IsDeleted', true);
oListItem.update();
clientContext.executeQueryAsync(Function.createDelegate(this, this.onQuerySucceeded),Function.createDelegate(this, this.onQueryFailed));
}
Appreciate if anyone help.
Thank you.
A:
You could change
oList = clientContext.get_web().get_lists().getByTitle('Projects');
to
oList = clientContext.get_web().get_lists().getById(_spPageContextInfo.pageListId)
|
{
"pile_set_name": "OpenWebText2"
} | Chris Wattie / Reuters
All of those proposals apparently contradicted the Conservative party line.
Wright's memo shows that the Prime Minister’s Office has strict control over what happens in the House of Commons, and rips in to LeBreton for not exercising the same control over the Tories in the Senate.
“What we have discovered is that the lines of communication and levers that are available to us on the House side, simply are not in place on the Senate side,” Wright says. “It was quickly apparent that Senator LeBreton's office had little influence over what other Senators did and said, and limited reach into the Senate caucus generally.”
“Consistently, Senator LeBreton does not embrace the work of your office to bring communication and direction with the Senate closer to the model that we have with the House Leader and Chief Government Whip.” |
{
"pile_set_name": "StackExchange"
} | Q:
Minimum value of $(a, b, c)$
If $a^2b^2+b^2c^2+c^2a^2-69abc=2016$, then, what can be said about the least value of $\min(a, b ,c)$, where $a, b, c\gt0$?
This problem is unyielding to the major inequalities like AM-GM, Cauchy-Schwarz, etc. I also tried relating it to $x^3+y^3+z^3-3xyz=(x+y+z)(\sum_{cyc}x^2+\sum_{cyc}xy)$, but of no use. Any ideas. Thanks beforehand.
PS: This is problem S395 in Issue 6 2016 of Mathematical Reflections.
A:
Let $a,c \in \mathbb{R}_{>0}$. Assume $a = \epsilon > 0$ and $c = 1$. This leads to the quadratic equation in $b$
$$(1+\epsilon^2)b^2-69\epsilon b+\epsilon^2-2016 = 0,$$
with a solution given by
$$ b = \frac{69\epsilon +\sqrt{8064+12821\epsilon^2 -4\epsilon^4}}{2(1+\epsilon^2)} $$
Thus, $b \in \mathbb{R}_{>0}$ if and only if $8064+12821\epsilon^2 -4\epsilon^4 \geq 0$, which is true for $0 < \epsilon \leq 56.6205...$.
Thus, it is easy to conclude about $\min (a,b,c)$.
|
{
"pile_set_name": "PhilPapers"
} | De Nederlandse economic in internationaal perspectief: 1960-1973-1982 DRS. A.S.W. DE VRIES* J. ARREMAN** H.L. VAN DER KOLK** Wat betreft economische groei en ontwikkeling van de werkloosheid heeft de Nederlandse economie het sinds 1973 slechter gedaan dan andere OECD-landen. Op de vraag naar de oorzaken van die slechte prestatie zijn in het verleden uiteenlopende antwoorden gegeven door o.m. Bomhoff en Clavaux. Ook zijn er diverse wegen aangegeven om op te rukken naar een betere positie. In dit artikel presenteren de auteurs de resultaten van een internationale doorsnee-analyse om de verschillen in economisch succes tussen landen met behulp van een eenvoudig neo-klassiek macro-economisch model te verklaren. Dit biedt de mogelijkheid om te traceren wat de rol van de exportgroei, de groei van de bevolking, de wisselkoers, de verhouding tussen de binnenlandse en de buitenlandse prijsontwikkeling en de investeringsquote voor verschillen in economische ontwikkeling is geweest. Vooral de uitvoer gecorrigeerd voor de omvang van de bevolking, de investeringsquote en de nominate wisselkoers komen als belangrijke verklarende variabelen naar voren. Op grond van hun analyse komen de auteurs tot de conclusie dat een beleid gericht op het verbeteren van de Nederlandse economische prestatie op lange termijn zich vooral zou moeten concentreren op het benutten van exportkansen en op een hoog investeringsniveau ter bevordering van technologische vernieuwing en daarmee verbetering van de concurrentiepositie. Daarbij moet worden voorkomen dat revaluatie van de gulden het exporteffect teniet doet. 1. Inleiding en probleemstelling In de jaren na de oliecrisis van 1973 is de economische ontwikkeling van de OECD op essentiele punten aanmerkelijk ongunstiger geweest dan in de jaren daarvoor. Bovendien heeft de Nederlandse economie zich sinds 1973 niet alleen aanzienlijk slechter ontwikkeld dan die van de OECD, maar ook slechter dan die van de EG. Daarbij moet in aanmerking worden genomen dat de ontwikkeling van de EG vrij aanzienlijk is achtergebleven bij die van de OECD. Een en ander kan met enkele cijfers treffend worden gei'llustreerd 1). De groei van het volume van het bruto binnenlands produkt (bbp) beliep over de jaren 1960-1973 zowel in Nederland als de EG en de OECD gemiddeld rond 5% per jaar. In de periode 1973-1982 was de jaarlijkse groei veel lager: in de OECD 2,7%, in de EG 2,2% en in Nederland 1,9%. Voor de meest recente jaren is het beeld niet anders en voor 1985 verwacht de OECD 3% groei voor de OECD als geheel, 2!/2% voor de EG en niet meer dan P/4% voor Nederland. Een wellicht nog treffender beeld van de relatief sterk stagnerende Nederlandse economie kan worden geschetst aan de hand van de ontwikkeling van de werkloosheid 2). In 1973 bedroeg het werkloosheidspercentage in Nederland 2,2 en bleef daarmee ruimschoots onder het percentage van 3 voor de EG. Sindsdien is de werkloosheid in Nederland voortdurend sterker opgelopen dan in de EG. In 1980 was het punt bereikt dat de werkloosheid in Nederland en de EG met 6% even hoog was. In 1983 was de discrepantie het grootst: Nederland 15%, tegen de EG minder dan 10%. Voor 1985 is naar verwachting het ecart weliswaar iets geringer, maar zijn de percentages hoger: de EG 103/i, tegen Nederland 15'/2. Daarmee zal de werkloosheid in Nederland bijna tweemaal zo hoog zijn dan gemiddeld in de OECD, die in 1985 naar verwachting 8 Vi % beloopt. De doelstelling van dit artikel is na te gaan welke factoren in welke mate als oorzaak kunnen worden beschouwd van de ondermaatse Nederlandse welvaartsontwikkeling ten opzichte van andere OECD-landen. Daarbij wordt als methode van analyse die van een transversale internationale vergelijking gehanteerd. Verder worden twee perioden geanalyseerd: de voorspoedige jaren 1960-1973 en derecessieve jaren 1973-1982. Deze opsplitsing hangt samen met de gehanteerde methode van doorsnee-analyse, die uitsluitend geschikt is voor een onderlinge vergelijking van landen en dan ook geen analyse toelaat van factoren die de sinds 1973 opgetreden internationale groeivertraging kunnen verklaren. Daarvoor is op zijn minst een uitgebreid econome- * Ten tijde van het onderzoek verbonden aan de vakgroep Microeconomic en economische orde van de Erasmus Universiteit Rotterdam; thans werkzaam op de hoofdafdeling Algemene Economische Vraagstukken van het Ministerie van Welzijn, Volksgezondheid en Cultuur. ** Doctoraal student aan de Erasmus Universiteit Rotterdam. 1) Bron: OECD, Historical Statistics 1960-1982, 1984 en OECD, Economic Outlook, nr. 36, december 1984. 2) We sluiten in dit verband aan bij de door de OECD gehanteerde definitie: het werkloosheidspercentage is het aantal werklozen uitgedrukt als procentuele fractie van de totale beroepsbevolking. 816 trisch model vereist. De ontwikkeling van een dergelijk model, dat van toepassing is op diverse landen, is evenwel met zeer veel moeilijkheden omgeven. Deze houden onder meer verband met de vaak aanzienlijke verschillen tussen landen qua institutionele structuur, waarvan de verschillende stelsels van sociale zekerheid slechts een voorbeeld zijn. We beperken ons dan ook tot hoofdlijnen en gaan daarom hier uit van een tamelijk eenvoudig macro-economisch model. Hoewel een nadeel van zo'n model is dat een aantal mechanismen slechts in een herleide vorm in een variabele is terug te vinden, is terzelfder tijd een voordeel dat met internationaal goed vergelijkbaar cijfermateriaal kan worden gewerkt. Deze voorkeur voor consistente statistische data heeft verder gestalte gekregen door gebruik te maken van slechts een oerbron, nl. de National Accounts van de OECD 3). De opzet van dit artikel is verder als volgt. In de tweede paragraaf wordt net eenvoudige macro-model beschreven. De resultaten van de empirische analyse worden gepresenteerd in de derde paragraaf, waarbij in dit verband de gehanteerde methode van internationale doorsnee-analyse er als vanzelfsprekend toe dwingt de bijdrage van Clavaux van vorig jaar in ESB en de reacties daarop in de beschouwing te betrekken 4). De laatste paragraaf bevat een slotbeschouwing. 2. Een eenvoudig macro-economisch model Een comparatieve analyse kan worden uitgevoerd met en zonder model, m.a.w. met of zonder specificatie van al dan niet theoretisch gefundeerde veronderstellingen over oorzakelijke verbanden en hun richting. De analyse van een vraagstuk van beleid dwingt evenwel tot de specificatie, hoe eenvoudig ook, van de relevant geachte verbanden. Daarmee sluiten wij aan bij Korteweg, die als bedenking tegen de bijdrage van Clavaux uitspreekt diens niet althans niet expliciet vermelden van zijn theoretische overwegingen voor de keuze van bepaalde verbanden 5). Deze paragraaf is dan ook gewijd aan een beknopte beschrijving van net door ons gepostuleerde model 6). Zoals in de inleiding al is aangegeven rechtvaardigt het doel van ons vergelijkend onderzoek, dat een groot aantal landen bestrijkt, de keuze van een relatief eenvoudig model, waarin niet meer dan de hoofdlijnen worden aangegeven. Omdat het verder gaat om een analyse van groeibepalende factoren op middellange tot lange termijn de onderscheiden perioden beslaan 13 respectievelijk 10 jaar - , is de keuze van een neoklassiek groeimodel op zijn plaats. In een dergelijk model hebben prijzen hun evenwicht genererende werk voor een belangrijk gedeelte gedaan en is sprake van een zekere mate van substitutie tussen produktiefactoren 7). Drie produktiefactoren worden onderscheiden, nl. arbeid, fysiek kapitaal en invoer. Hoewel sprake is van een zekere mate van onderlinge uitwisselbaarheid, zijn alle drie factoren onmisbaar voor de nationale produktie. Voorts is de technische ontwikkeling voor een belangrijk deel economisch bepaald gedacht. De groei van de technologic hangt af van de inspanningen op het gebied van innovatie, m.a.w. van de inspanningen op het terrein van onderwijs en research. Innovatie hangt samen met de reeds aanwezige kapitaalgoederenvoorraad en komt tot stand door middel van toevoegingen aan de kapitaalgoederenvoorraad. De technische vooruitgang is evenwel aan arbeid gebonden gedacht en neemt dan ook uitsluitend de vorm aan van verhoging van de arbeidsproduktiviteit. Behalve een produktiefunctie en een relatie die de economisch bepaalde technologische ontwikkeling beschrijft, bevat ons model relaties die de markten voor de produktiefactoren arbeid, kapitaal en invoer beschrijven. Daarvan is de kapitaalmarktvergelijking de eenvoudigste: we maken de gebruikelijke veronderstelling van een vast verband tussen investeringen en produktie. Ten aanzien van de vraag naar arbeid volgen we eveneens de gebruikelijke weg en veronderstellen gelijkheid tussen het ree'le loon en het marginale produkt van arbeid. De veronderstelling met betrekking tot het aanbod van arbeid is evenwel minder traditioneel. Op dit punt volgen we de benadering van Tinbergen in zijn al in 1942 verschenen artikel over neoklassieke economische groei 8) en veronderstellen dat het deelnemingspercentage, d.w.z. het deel van de (beroepsgeschikte) bevolking dat zich op de arbeidsmarkt aanbiedt, samenhangt met het loon dat wordt aangeboden. Daarenboven gaan we ervan uit dat het deelnemingspercentage samenhangt met het bereikte welvaartsniveau. Op deze wijze kan rekening worden gehouden met zowel de daling van de deelneming van met name oudere mannen en die van jongeren als gevolg van voortgezette opleiding als de stijging van de deelneming van vrouwen. In ons model, dat uitsluitend hoofdlijnen aangeeft, zijn beide verschijnselen samenhangend gedacht met de welvaartsvermeerdering. De ontwikkeling van de (beroepsgeschikte) bevolking zelf is autonoom gedacht zonder dat sprake is van enige invloed van economische grootheden: op een termijn van 10 a 15 jaar is dit een redelijke veronderstelling. Er is sprake van een voortdurend toenemende internationale verwevenheid in de wereldeconomie. Om deze reden is in ons model een aparte plaats ingeruimd voor de invoer, die vooral als produktiefactor is gezien 9). De vraag naar invoer is dan ook afhankelijk van de totale produktie en de concurrentiepositie. Deze laatste is gemeten als de binnenlandse ruilvoet, d.w.z. het binnenlands prijspeil ten opzichte van het prijspeil van de invoer. De uitvoer waarmee de invoer moet worden betaald, is bepaald gedacht door de ontwikkeling van de wereldhandel en eveneens van de concurrentiepositie, hier de buitenlandse ruilvoet d.w.z. het binnenlands prijspeil ten opzichte van het prijspeil van concurrenten op de wereldmarkt. Het is van belang op te merken dat, in afwijking van wat in de theorie gebruikelijk is, een onderscheid wordt gemaakt tussen het prijspeil van concurrenten en het invoerprijspeil. Zeker sinds de oliecrisis van 1973 is dit onderscheid relevant. Het model wordt tot slot gecompleteerd met een relatie die lange-termijnevenwicht op de handelsbalans definieert. Het zojuist beschreven model is in de grond traditioneel van opzet en sluit dan ook in veel opzichten aan bij gangbare macromodellen. De achtergrond van de lange termijn biedt de mogelijkheid gebruik te maken van de lange-termijnoplossing van ons model. Dit levert een herleide-vormoplossing voor de groeivoet van de produktie per hoofd van de bevolking op die is uitgedrukt in de variabelen die in onze analyse als exogeen zijn behandeld. Daarbij zijn cruciaal de veronderstelde mate van flexibiliteit op de arbeidsmarkt en de onvolledige substitutie tussen invoer en binnenlands geproduceerde factoren. Het laatste leidt ertoe dat internationale handelsvariabelen mede de lange-termijngroeivoet bepalen, terwijl het eerste tot gevolg heeft dat de ontwikkeling van het invoerprijspeil ten opzichte van loonvoet en de wisselkoers een rol spelen. 3) Het gaat om de in noot 1 vermelde publikaties, waar nodig aangevuld met data uit de meest recente National Accounts en Labour Force Statistics. 4) F.J. Clavaux, De Nederlandse economic: slachtoffer van een verkeerde diagnose (II), ESB, 22 februari 1984, biz. 184-189; A.P. Huyser, De verkeerde diagnose van Clavaux? (I), ESB, 2 mei 1984, biz. 405-406; G. Korteweg, De verkeerde diagnose van Clavaux (II), ESB, 2 mei 1984, biz. 406-410 en het naschrift van Clavaux in dezelfde aflevering van ESB; G. deJong, De verkeerde diagnose van Clavaux (III), ESB, 16 mei 1984, biz. 462. 5) Korteweg, op.cit. Het gaat met name om het verband tussen de groei van het reeel bruto nationaal produkt en de groei van de reele overheidsconsumptie. De reactie daarop van Clavaux overtuigt niet, zoals wij verderop zullen betogen. 6) De beschrijving is hier uitsluitend verbaal. Het volledige, in wiskundige termen uitgewerkte model is beschreven in een binnenkort te verschijnen rapport van de hand van de eerste auteur: A.S.W. de Vries, Labour market flexibility and indispensable imports in an export-led neoclassical growth model, Erasmus Universiteit, Rotterdam, 1985. Hierin is tevens een empirische toepassing opgenomen met ander cijfermateriaal ter vermijding van het mogelijke verwijt van keuze van bij het argument passend statistisch datamateriaal. 7) Hierbij moet worden bedacht dat ook sprake is van substitutie als gevolg van veranderingen in de sectorstructuur, die in een macro-model onzichtbaar blijven. 8) J. Tinbergen, Zur Theorie der langfristigen Wirtschaftsentwicklung, Weltwirtschaftsliches Archiv, jg. 55, 1942, biz. 511-549. 9) Hierbij dient te worden bedacht dat de wereldhandel voor het overgrote deel intermediaire goederen betreft. Dat geldt nog meer indien we daaronder ook de ingevoerde finale bestedingsgoederen rekenen, die immers nog de bewerking van distributie behoeven. ESB 21-8-1985 817 Samengevat leidt onze analyse tot de volgende determinanten van de groeivoet per hoofd van de bevolking: a. een positieve invloed gaat uit van de groei van de wereldeconomie en meer precies de groei van het voor het betrokken land relevante deel van de wereldhandel. Het laatste komt tot uitdrukking in de wereldinkomenselasticiteit, waarmee de groei van de wereldhandel is voorvermenigvuldigd. Met andere woorden, het gaat om de mate waarin een land erin slaagt te profiteren van de afzetmogelijkheden op de wereldmarkt. Een veel gebruikte benadering daarvoor is de (eventueel dubbel) herwogen wereldhandel. Hier gebruiken we de uitvoer zelf, die veel eenvoudiger beschikbaar is. Deze keuze is in onze eerste benadering aanvaardbaar, niettegenstaande het feit dat deze keuze discutabel is, omdat een deel van het te verklaren effect in de betrokken variabele ligt opgesloten. Ter illustratie: in de periode 1960-1973 beliep de volumegroei van de Nederlandse uitvoer ruim 9Vo per jaar en ging daarmee 1%-punt uit boven het OECD-gemiddelde; in 1984 bedroeg de Nederlandse uitvoergroei 5 '/2 % tegen 9 !/2 % voor de OECD; b. naarmate de technologische ontwikkeling sneller verloopt is de groeivoet per hoofd van de bevolking hoger. In zijn amendering van het standaard neoklassieke groeimodel heeft Conlisk afgeleid dat ter beschrijving van dit effect de investeringsquote de gee'igende variabele is 10). Wij nemen dan ook de investeringsquote in onze regressie op. Hierbij moet worden bedacht dat de negatieve invloed van de loonwig en van een sterk uitdijende collectieve sector in de investeringsquote gei'ncorporeerd is. In dit verband merken wij voor Nederland op dat in 1973 onze bruto investeringsquote nog lag op het gemiddeld OECD-niveau van ruim 23%, maar dat deze quote in 1984 bij de tot bijna 20% gedaalde OECD-quote ruim 1,5%-punt achterbleef; c. een rol speelt ook het verschil tussen de groei van het invoerprijspeil en de normale, min of meer autonome stijging van de loonvoet. In meer bekende termen geparafraseerd: loonmatiging in die zin dat de loonstijging achterblijft bij de groei van het invoerprijspeil, helpt op lange termijn; d. een gunstige invloed op de groeivoet heeft eveneens een gestage devaluatie van de nationale valuta: de wisselkoers speelt in onze analyse dan ook een rol. Van belang is dat van een politiek van depreciatie alleen gunstige resultaten kunnen worden verwacht, indien sprake is van een zekere mate van flexibiliteit op de arbeidsmarkt. De invloed van de wisselkoers verloopt namelijk via de arbeidsmarkt. Flexibiliteit op de arbeidsmarkt is overigens ook een voorwaarde voor gunstige resultaten van loonmatiging, die onder punt c is aangegeven. Aldus geeft onze analyse steun aan het recente betoog van Vandewalle ten aanzien van de door Zweden de laatste jaren gevolgde politiek van devaluatie in combinatie met matiging van looneisen door de vakbonden 11). Ten aanzien van het gebruik van de (effectieve) wisselkoers geldt hier een soortgelijk argument als bij de uitvoer: een deel van het te beschrijven effect zit in de ontwikkeling van de wisselkoers geborgen 12); e. een positieve invloed op de groei gaat uit van de verhouding tussen het prijspeil van concurrenten op de wereldmarkt en het invoerprijspeil. Data voor de eerstgenoemde variabele zijn, voor zover ons bekend, niet direct beschikbaar, terwijl het fabriceren van de betrokken data door de bepaling van de toe te passen gewichten een uitermate tijdrovende aangelegenheid is. Om deze redenen hebben wij gekozen voor het eigen uitvoerprijspeil: een - toegegeven matige proxy. Ondanks alle bezwaren hoeft dit niet zo'n slechte eerste benadering te zijn: de concurrentie op de wereldmarkt dwingt met name de wat kleinere landen tot een prijsstelling die niet langdurig al te veel kan afwijken van het wereldmarktprijspeil. IIlustratief in dit verband is de in Nederland tamelijk sterk gegroeide wig tussen het binnenlands en buitenlands prijspeil van internationaal verhandelde goederen, waarvan de desbetreffende tabellen D uit de Centraal Economische Plannen reeds een aantal jaren getuigen; f. tot slot speelt de groei van de bevolking een rol. De richting van de invloed daarvan is evenwel niet eenduidig en hangt af van de numerieke grootte van de betrokken parameters. Invulling voor deze parameters van waarden die in de internationale literatuur worden gevonden, leidt tot de conclusie dat de invloed van de omvang van de bevolking zeer gering zal zijn, indien de uitvoer per hoofd van de bevolking wordt genomen. Overigens moet worden opgemerkt dat alleen sprake is van het aangegeven positieve verband tussen groei per hoofd en de onder b, c en d genoemde factoren indien voldaan is aan de beroemde Marshall-Lerner-voorwaarde. De internationale literatuur leert dat als regel aan deze voorwaarde is voldaan en wij zullen hiervan in het vervolg van het betoog dan ook uitgaan. Het is duidelijk dat de door ons te hanteren relatie aanzienlijk afwijkt van de door Clavaux gepresenteerde eindvergelijking voor de periode 1972-1982. Clavaux neemt daarin als proxy voor de internationale concurrentiepositie de autonome kostenontwikkeling op, d.w.z. de kostenontwikkeling gecorrigeerd voor dat deel dat wordt geacht van buitenlandse oorsprong te zijn, en de wisselkoers. Deze beide variabelen zijn in een alternatieve vergelijking (variant 2) samengevoegd tot een variabele met een vergelijkbaar resultaat. Veel belangrijker zijn evenwel het ,,beleid", dat wordt gerepresenteerd door de groei van het volume van de overheidsconsumptie, en de groei uit de tienjaarsperiode daarvoor, die als indicator voor structurele of trendmatige verschillen in groeipotentieel tussen landen fungeert 13). Het opnemen van de laatste variabele in een analyse die de verklaring van groeiverschillen tussen landen tot doel heeft, is discutabel: de betrokken variabele beschrijft een proces dat wel wordt aangeduid als het zich ophijsen aan de eigen bretels. Dit klemt te meer daar de numerieke waarde van de betrokken coefficient niet minder dan 0,75 bedraagt. Ook de groei van de ree'le overheidsconsumptie hoort in de relatie niet thuis, omdat het hier niet om een korte-, maar om een lange-termijnanalyse gaat. Korteweg is blijkens zijn reactie eveneens deze mening toegedaan, maar hij motiveert zijn opvatting slechts ten dele 14). Toch moet het argument worden gezocht op zijn toenmalige arbeidsterrein, nl. het Ministerie van Financien, en wel in de wijze van totstandkoming van de begroting. Deze start immers met een raming van de belastingen premieopbrengst die hoort bij de voor het betrokken begrotingsjaar verwachte nationale groei. Deze opbrengst bepaalt in beginsel de ruimte voor de uitgaven van de overheid in ruime zin 15). Dat laat onverlet dat overheden 10) J. Conlisk, A modified neoclassical growth model with endogenous technical change, The Southern Economic Journal, jg. 34, 1967, biz. 199-208. 11) G. Vandewalle, De derde weg van Zweden, ESB, 30 januari 1985. 12) De wisselkoers is hier exogeen beschouwd. Dit betekent dat de opvatting dat de ontwikkeling van de wisselkoers onderlinge verschillen in de reele sfeer reflecteert, buiten beschouwing is gelaten. Aan onze opvatting kan dan ook een zekere eenzijdigheid niet worden ontzegd, hoewel de waarheid zonder twijfel in het midden ligt. In dit verband merken wij op dat in beleidsvarianten met modellen als FREIA vaak de variant van een wisselkoersaanpassing voorkomt met de toevoeging dat structurele onevenwichtigheld op de betalingsbalans aanleiding is voor een aanpassing van de koers. 13) Het grote belang van beide variabelen blijkt uit de t-waarden en de beta-coefficienten. De overeenkomende groottevolgorde van deze twee statistische grootheden duidt er overigens op dat de intercorrelaties tamelijk gering zijn, zodat de t-waarde tevens het relatieve belang van de betrokken variabele voor de verklaring aangeeft. 14) Korteweg, op.cit., biz. 409: ,,Ook is het aannemelijker dat de groei van het ree'le bnp een belangrijke bepalende factor is van de groei van de ree'le overheidsconsumptie, dan dat die laatste een duurzame positieve invloed zou kunnen uitoefenen op de eerste" (onze cursivering). 15) Illustratief zijn in dit verband de desbetreffende staatjes in Miljoenennota's en Centraal Economische Plannen, waarbij in de tekst voortdurend het woord ,,ruimte" voorkomt. Interessant is in dit verband de volgende onlangs verschenen bijdrage: Balvir Singh en Balbir S. Sahni, Causality between public expenditure and national income, The Review of Economics and Statistics, jg. 66, 1984, biz. 630-644. De auteurs komen - gebruik makend van jaarcijfers - met de Granger-methode tot de conclusie van een onderlinge afhankelijkheid tussen overheidsbestedingen en nationaal inkomen. Helaas maakt het feit dat de studie betrekking heeft op India doortrekken van deze conclusie naar de hoog ontwikkelde industrielanden bepaald hachelijk. 818 vervolgens een stimulerende politiek kunnen voeren. De door Clavaux met instemming geciteerde uitspraak van Pen dat daarmee ,,het intellectuele erfgoed van een generatie van economen wordt verworpen" is dan ook op zijn minst sterk overtrokken 16). In Nederland is onder de kabinetten-Den Uyl en -Van Agt ook een stimulerende politiek gevoerd en wel via een oplopend financieringstekort, hetgeen te zamen met een vergrote consumptie leidt tot een daling van de spaarquote 17). Net als vele andere landen het ene wat eerder dan het andere is Nederland nadien van dit pad teruggekeerd. 3. Empirische resultaten De in de vorige paragraaf afgeleide herleide-vormvergelijking voor de lange-termijngroeivoet van het bruto binnenlandse produkt per hoofd van de bevolking hebben wij geschat voor de periode 1960-1973 en de periode 1973-1982. De schattingen zijn uitgevoerd over alle OECD-landen waarvoor het vereiste dalamateriaal beschikbaar is. Dat zijn de 24 OECD-lidstaten met uitzondering van Nieuw Zeeland, Portugal, Turkije en IJsland, zodat twintig landen overblijven. De genoemde landen zijn overigens ook landen waarvan men zich kan afvragen of zij wel tot de industriele landen kunnen worden gerekend. Dat geldt tot zekere hoogte ook voor Griekenland en lerland. Voor deze twee landen geldt even wel ook dat zij deel uitmaken van de EG. Ten einde een vergelijking met de resultaten van Clavaux mogelijk te maken, zijn de berekeningen tevens uitgevoerd voor zijn landenkeuze bestaande uit 11 landen. Om de leesbaarheid van de navolgende tabellen te vergroten gebruiken we voor alle variabelen symbolen. In aanmerking nemend dat met uitzondering van de investeringsquote alle variabelen betrekking hebben op de gemiddelde jaarlijkse groeivoet van die variabelen over de twee onderscheiden perioden, is de betekenis van de symbolen als volgt: YP = volume van het bruto binnenlands produkt per hoofd van de bevolking; EP = volume van de export per hoofd van de bevolking; POP = bevolkingsomvang; XR = wisselkoers; RXR = ree'le wisselkoers; PM/W = verhouding van het invoerprijspeil en de loonvoet per werknemer; PE/PM= verhouding van het uitvoerprijspeil en het invoerprijspeil; INV = bruto investeringen als percentage van het bruto binnenlands produkt, gemeten in afwijking van het steekproefgemiddelde; C = de additieve constante. Ten aanzien van de wisselkoers tekenen wij aan dat deze is gedefinieerd als de binnenlandse prijs van de buitenlandse valuta. Depreciatie houdt dan een positieve mutatie van de wisselkoers in, appreciatie een negatieve. Alvorens de resultaten te presenteren is tot slot nog een opmerking van belang met betrekking tot de criteria die zijn gehanteerd bij de selectie van de variabelen. In de eerste plaats is een variabele alleen opgenomen, indien hij verschijnt met het in de vorige paragraaf langs theoretische weg afgeleide correcte teken. Bij de door ons gebruikte definities van de variabelen is dat teken steeds positief, in voorkomende gevallen met uitzondering uiteraard van de additieve constante en de bevolkingsvariabele. In de tweede plaats is een variabele slechts dan opgenomen, wanneer de bijbehorende t-waarde als indicatie van de betrouwbaarheid van de betrokken coefficient ten minste een bedraagt. Dit hangt hiermee samen dat alleen in dat geval opname van een variabele leidt tot een toename van de voor vrijheidsgraden gecorrigeerde meervoudige correlalie-coefficie'nt. Deze aanpassing is hier alleen al van belang vanwege het tamelijk geringe aantal waarnemingen. Dit speelt met name bij de landenkeuze van Clavaux met niet meer dan elf waarnemingen. We besteden eerst aandacht aan de periode 1960-1973. De resultaten voor de grote steekproef van 20 landen staan vermeld in label 1. De uitvoer gecorrigeerd voor de omvang van de bevolTabel 1. Groeiper hoofd van de bevolking in 20 OECD-landen, 1960-1973 Verklarende Vergevariabelen lijking Variant 1 Variant 2 EP 0,57 (14,97) 0,58 (12,42) INV 0,14 (4,71) 0,12 (2,98) XR 0,27 (3,33) RXR 0,13 (1,35) C 0,27 (0,36) 0,66 (0,88) R' 0,94 0,90 Toelichting: R2: kwadraat van de voor vrijheidsgraden aangepaste meervoudige correlatiecoefficient; tussen haakjes onder de coefficient de t-waarde. king blijkt met name de dragende variabele te zijn. Verschillen in de mate waarin landen er in slagen te profiteren van de mogelijkheden die de wereldmarkt biedt, tellen voor ruim de helft mee in de verklaring van groeiverschillen tussen landen. Ook de investeringsquote speelt een belangrijke rol: een hogere investeringsquote leidt tot een sterkere groei. Van belang blijkt ook de wisselkoers, waarbij opvalt dat de ree'le wisselkoers, d.w.z. de wisselkoers gecorrigeerd voor verschillen in inflatie tussen landen, een aanzienlijk lagere coefficient heeft. Dat de wisselkoers van belang is, is enigermate opmerkelijk in het licht van het bestaan van het stelsel van vaste wisselkoersen overeenkomstig de in Bretton Woods gemaakte afspraken, dat eerst tegen het einde van de onderhavige periode is losgelaten. De toen voorkomende schommelingen in de waarde van diverse valuta zijn klaarblijkelijk voldoende geweest om een redelijk betrouwbare coefficient mogelijk te maken. De additieve constante, ten slotte, is niet alleen klein, maar verschilt bovendien niet significant van nul. Een aantal van de in de vorige paragraaf genoemde variabelen ontbreekt. De reden daarvan is dat ze stuk voor stuk de significantietoets niet doorstaan, hoewel steeds het juiste theoretische teken te voorschijn komt. Dit betekent dat er weliswaar steun is voor ons model, maar dat deze steun tamelijk zwak is. Verder moet worden toegelicht dat bij toevoeging van deze variabelen de coe'fficienten van de wel opgenomen variabelen nauwelijks of niet wijzigen. Dit hangt nauw samen met de betrekkelijk geringe intercorrelaties. Hoewel Clavaux de periode 1960-1973 niet in zijn analyse betrekt, hebben wij om een vergelijking met de periode 1973-1982 mogelijk te maken niettemin een schatting gemaakt voor diens set van 11 landen. De belangrijkste resultaten staan vermeld in label 2. Daaruit blijkt dat ten opzichte van de resullalen van taTabel 2. Groei per hoofd van de bevolking in 11 OECD-landen (Clavaux), 1960-1973 Verklarende Vervariabegelijking len Variant 1 Variant 2 EP 0,42 (6,90) 0,49 (14,95) INV 0,09 (2,46) 0,05 (2,59) XR 0,22 (2,92) 0,30 (7,24) PE/PM 0,75 (5,15) POP -0,44 (-2,85) C 1,06 (1,05) 0,84 (1,80) R1 0,82 0,96 Toelichting: zie label 1. bel 1 de coefficie'nlen voor de uilvoer en de invesleringsquole enigszins zijn gedaald. Deze daling wordt evenwel gecompenseerd door een stijging van de addilieve conslanle, die bovendien aan belrouwbaarheid wint. Verder verschijnt de bevolking alleen mel een l-waarde groler dan een in absolule zin indien deze variabele wordl opgenomen le zamen mel de verhouding lussen uilvoerprijspeil en invoerprijspeil. De coefficienl van deze laalsle variabele, waarbij zoals eerder opgemerkl hel uilvoerprijspeil als (zoals eerder aangegeven malige) proxy fungeerl 16) Clavaux, op.cit., biz. 185. 17) Zie S.K. Kuipers, Het verslag van de Nederlandsche Bank over het jaar 1978: er is inderdaad iets grondig mis met de Nederlandse economie, ESB, 16 mei 1979, biz. 476-482, speciaal biz. 478. ESB 21-8-1985 819 voor het concurrerende uitvoerprijspeil, is tamelijk hoog. Niet uitgesloten is dat het een met het ander samenhangt. Overigens geldt dat weglaten van deze variabele als gevolg van de lage intercorrelaties nauwelijks van invloed is op de waarde van de overige coefficienten. Vermeldenswaard is voorts dat de verhouding lussen het invoerprijspeil en de loonvoet voortdurend het Iheoretisch onjuiste negatieve teken heeft. Een bijdrage aan de verklaringsgraad levert deze variabele echter nauwelijks, omdat de bijbehorende t-waarde maar net de grens van een overschrijdt. De resultaten voor de periode 1960-1973 dienen als ijkpunt voor de resultaten voor de periode 1973-1982, die vrijwel overeenkomt met de periode die door Clavaux is beschouwd 18). We starten onze analyse weer met de grote steekproef van 20 landen. De belangrijkste resultaten vindt men in label 3. Het opmerkelijkst is zonder twijfel de scherpe daling van de coefficient voor de uitvoer per hoofd vergeleken met die voor de periode 1960-1973. De additieve constante daarentegen is aan de hoge kant. Verder komt de verhouding tussen invoerprijspeil en loonvoet per werknemer, respectievelijk uitvoerprijspeil voor. De numerieke waarde van de betrokken coefficient is evenwel tamelijk laag. Dit laatste geldt zeker voor de coefficient van de wisselkoers. Dit is opmerkelijk gezien het feit dat in de onderhavige periode sprake is van meer flexibele wisselkoersen, terwijl de periode 1960-1973 juist wordt gekenmerkt door (officieel) vaste wisselkoersen. Opgemerkt zij dat wij in tegenstelling tot Clavaux geen vertraging van twee jaar hebben toegepast op de wisselkoers. Naar onze mening heeft zulks in een doorsnee-analyse over een vrije lange periode van 10 jaar niet zoveel zin 19). Ook zuiver statistisch gezien geldt dat bij een vertraging van twee jaar over een periode van 10 jaar de vertraagde en de onvertraagde variabele voor 80% hetzelfde zijn. De enkelvoudige correlaliecoefficienlen van ruim boven 0,90 bevestigen dat. De door ons opgenomen uitvoer per hoofd kan worden gezien als een variabele die onder meer de structurele kracht van een land representeert. In dat opzicht vervult deze variabele een rol die vergelijkbaar is met de produktiegroei uit de voorgaande periode bij Clavaux. Statistisch gezien blijkt dit tegen te vallen. Vervanging van de uitvoer per hoofd door de groei per hoofd uit de periode 1960-1973 levert voor de overige variabelen ruwweg dezelfde coefficienten met vergelijkbare betrouwbaarheid op; de coefficient van de vertraagde groei is evenwel met 0,10 zeer klein en voldoet bovendien niet aan de gestelde significantie-eis. Toevoeging van de vertraagde groei aan de relatie in label 3 levert ongeveer dezelfde numerieke waarde voor de coefficient, maar mel de belrouwbaarheid daarvan is hel bedroevend gesleld. Dil ligl anders wanneer de landenkeuze van Clavaux slrikl wordl gevolgd. Blijkens label 4 leidt vervanging van de uitvoer per hoofd door de groei per hoofd uit de voorafgaande periode Tabel3. Groei per hoofd van de bevolking in 20 OECD-landen, 1973-1982 Verklarende Vervariabegelijking len Variant 1 Variant 2 EP 0,14 (2,59) 0,23 (3,42) INV 0,16 (4,32) 0,13 (3,60) XR 0,08 (2,35) 0,04 (1,35) PM/W 0,12 (1,67) PE/PM 0,15 (1,92) POP -0,67 (-2,32) C 1,22 (1,58) 0,82 (1,06) R' 0,67 0,65 Toelichting: zie label 1. Tabel 4. Groei per hoofd van de bevolking in 11 OECD-landen (Clavaux), 1973-1982 Verklarende Vervariabegelijking len Variant 1 Varianl 2 EP 0,27 (2,59) INV 0,17 (2,63) 0,19 (3,16) XR 0,06 (1,39) 0,07 (2,08) PM/W 0,14 (1,52) 0,13 (1,57) POP -1,44 (-2,56) YPL 0,61 (2,86) C 0,45 (0,33) -0,51 (-0,44) R' 0,68 0,76 Toelichting: YPL: gemiddelde jaarlijkse groei van het bruto binnenlands produkt per hoofd van de bevolking, 1960-1973. Zie label 1 voor de overige variabelen. te zamen met de loevoeging van de bevolkingsvariabele wel tot een verbetering van de meervoudige correlalie-coefficient. Bovendien is de numerieke grootte van de coefficienl van 0,61 redelijk vergelijkbaar mel de 0,70 a 0,80 van Clavaux. Van vergelijkbaarheid is ook sprake voor de coefficienl van de wisselkoers 20). Volledigheidshalve hebben we voor ons daiamateriaal en voor de landenkeuze van Clavaux diens relatie geschat. Ook dan blijken de produkiiegroei uil de voorgaande periode en de groei van de reele overheidsconsumplie de dragende variabelen. Daarbij is de coefficienlenwaarde van beide variabelen om en nabij 0,50. De invloed van de wisselkoers (effectief of niel) is gering: de beIrokken posilieve coefficienl is steeds kleiner dan 0,05. De verklaringsgraad van onze vergelijking blijft evenwel aanmerkelijk achler bij die van Clavaux. 4. Slotbeschouwing In dil arlikel hebben wij verslag gedaan van een onderzoek dal beoogde de facloren le analyseren van de achlerblijvende oniwikkeling van de Nederlandse economie in de laalsle 10 a 15 jaar. Daarloe hebben we een eenvoudig macro-economisch model voor de lange lermijn onlwikkeld. De grole verschillen die tussen landen beslaan, rechlvaardigen daarbij de keuze voor een eenvoudig model. Terzelfder lijd echler dwingl deze keuze voor eenvoud lol lerughoudendheid bij de formulering van conclusies. Dil indachlig leidl onze analyse tot de slotsom dal herslel op lange lermijn van de Nederandse economische presialies moet worden gezocht in de reele sfeer: benulling van kansen op de wereldmarkl gesleund door een hoog investeringsniveau ter bevordering van lechnologische vernieuwing en daarmee verbelering van de concurreniieposilie. Op lange lermijn werkl een poliliek van loonmaliging en van geslage deprecialie van de gulden ook gunslig. Hierbij dient evenwel te worden bedachl dal afgaande op de door ons gevonden numerieke waarde van de coefficienten de effectiviteit van een dergelijke poliliek niet al te grool is 21). Bovendien vormen internationale afspraken len aanzien van de wisselkoers in dit kader een belemmering. Een moeilijk punt vorml in onze analyse de voor een doorsnee-analyse lamelijk grole aulonome residuele groei van rond 1 % per jaar, die wij vinden voor de periode 1960-1973 in de kleine sleekproef en voor de periode 1973-1982 in de grole sleek proef. Een mogelijke verklaring hiervoor is de verjonging van de factor menselijk kapitaal gedurende de periode 1960-1980. Voor Nederland komt deze lol uitdrukking in een daling van de gemiddelde leeftijd van de beroepsbevolking van 37 !/z lol 36 jaar, waarbij in Nederland bovendien de slerke loename van hel deelnemingspercenlage en dan speciaal dal van vrouwen een rol speell. Indien en voor zover deze verklaring houdl snijdl, kan de volgens CPB-prognoses verwachte verhoging van die leeftijd tot 40 jaar in 2010 nog aanleiding worden tol grole problemen 22). 18) Clavaux start met het jaar 1972; wij starten met 1973, aangezien het breekpunt ons inziens wordt gevormd door de eerste oliecrisis, die eind 1973 plaatsgreep. Gezien de enorme verstoring van diverse markten waarmee de oliecrisis gepaard ging, is het in ons geval wellicht goed verdedigbaar de steekproefperiode eerst in 1974 te laten beginnen. Wij hebben daarvan afgezien, ook al omdat het datamateriaal dan niettemin voor 90% ongewijzigd blijft. 19) Bovendien rijst de vraag waarom dan ook niet een of andere vertraging op andere variabelen in de specificatie is toegepast, althans is overwogen. 20) De effectieve wisselkoers levert een zelfde resultaat bij een lets grotere betrouwbaarheid. Dit is niet verwonderlijk gezien de zeer hoge enkelvoudige correlatiecoefficient tussen deze twee variabelen. 21) Ten aanzien van de wisselkoers blijkt dit ook uit beleidsvarianten met de CPB-modellen FRE1A en KOMPAS. Dit geldt ook voor het onlangs ontwikkelde meersectorenmodel VICTOR, waarvan recent een eerste versie is gepubliceerd: Johan Verbruggen, VICTOR: een viersectorenmodel voor de Nederlandse economie, Ministerie van Economische Zaken, Directie Algemene Economische Politiek, discussienota 8502. 22) Zie Jos van Kemenade, Jo Ritzen en Thijs Woltgens, Dilemma's van een werkbare toekomst, Socialisme en Democratie, jg. 42, nr. 3, maart 1985, biz. 100-105. 820 i Onze analyse is gericht op de middellange tot lange termijn. Op het vlak van het op wat kortere termijn te voeren beleid lijkt zich een consensus af tekenen voor een wat meer stimulerend beleid. In het onlangs verschenen Jaarverslag 1984 van De Nederlandsche Bank passeren daarvoor drie verschillende mogelijkheden de revue 23). De eerste mogelijkheid van rechtstreekse stimulering door belastingverlaging voor de burgers wordt afgewezen 24). Zo'n politick lijkt ook minder gunstig: in de jaren zeventig was het beleid sterk gericht op de binnenlandse sector, welk beleid wegens tegenvallende resultaten door de meeste landen - de een wat eerder dan de ander is verlaten. Hoewel een reductie van het financieringstekort als gevolg van stimulering niet uitgesloten mag worden geacht, brengt een dergelijke politiek nogal wat risico's met zich mee gezien de sterk gestegen rentelasten en aflossingen op de staatsschuld en daarmee verband houdend de omvang van het tekort. Sinds ook in Nederland de weg van de stimulering is verlaten, is in ons land sprake van een uitvoerbeleid. Het lijkt crop dat dit beleid effect begint te sorteren: voor 1985 verwacht de OECD een uitvoergroei van 6% voor de OECD als geheel tegen 5% voor Nederland, terwijl over de tienjaarsperiode 1974-1984 de groei van het volume van de uitvoer voor Nederland 2,8% gemiddeld per jaar beliep tegen 4,7% voor de OECD. Daarbij is de laatste vier jaar steeds sprake van een lichte stijging van ons aandeel op de wereldmarkt 25). Om deze reden is de weg van revaluatie, die in het Jaarverslag voorzichtig wordt geopperd, niet zonder risico's 26). Een revaluatiebeleid zou het exporteffect wel eens om zeep kunnen helpen. Het riskante zit hem vooral hier in dat de stimulans van de binnenlandse bestedingen als gevolg van de revaluatie niet leidt tot nieuwe investeringen, stijgende arbeidsproduktiviteit en aldus verbetering van de concurrentiepositie, die in eerste aanleg is verslechterd als gevolg van de autonome revaluatie. Sterker nog, als er al sprake moet zijn van opwaardering, dan dient binnen de slang herhaling van het achterblijven bij de Duitse mark serieuze overweging 27). Hiervoor pleit zowel het sterkere, want meer gevarieerde Duitse draagvlak als de veel grotere Duitse thuismarkt. Ten aanzien van de wisselkoersverhoudingen verdienen Denemarken en Zweden vermelding. De valuta van deze twee landen hebben de laatste jaren een aanmerkelijke effectieve devaluatie te zien gegeven en beide landen scoren binnen de OECD op het gebied van de uitvoer zeer goed. Beide landen groeien ook het hardst, samen met Finland. De Finse markka is evenwel nauwelijks effectief in waarde gedaald, maar de investeringsquote is daarentegen internationaal gezien in Finland zeer hoog. Denemarken en Zweden worden in het Jaarverslag van De Nederlandsche Bank om een andere reden ten tonele gevoerd, nl. als de landen die door beperking van de collectieve uitgaven en door lastenverhoging het financieringstekort het sterkst hebben verminderd 28). Daarbij past de kanttekening dat de omvang van de Deense en Zweedse collectieve sector weliswaar vergelijkbaar is met die van Nederland, maar dat het aandeel van de overdrachtsuitgaven daarin in Denemarken en Zweden veel kleiner is dan in Nederland. Dit laatste geldt ook voor Duitsland bij een veel minder omvangrijke collectieve sector en evenzeer voor Finland met een nog minder grote collectieve sector. Hiermee hangt onze voorkeur voor de derde stimuleringsmogelijkheid samen, nl. die van een gedifferentieerde inkomensverbetering. Dit betekent een relatief sterke verhoging in de wat sterkere sectoren en een relatief matige verhoging in de wat zwakkere sectoren, inclusief de uitkeringen. De differentiatie is hierbij van groot belang: daarin zit een belangrijk verschil met de meer generieke maatregel van een verlaging van de belastingen. Aan de ene kant kan met een gedifferentieerde inkomensverbetering de koopkracht gemiddeld worden vergroot. De exportsector hoeft daar nauwelijks onder te lijden omdat de loonmatiging daar tot dusverre is vertaald in prijsstijging ten behoeve van rendementsverbetering, die (toegegeven) dan enigszins wordt geremd 29). Aan de andere kant kan tegelijkertijd de omvang van de collectieve sector niet langer stijgen maar dalen, vooral als gevolg van de vermindering van het overdrachtsaandeel daarin 30). Schuilt er dan toch iets in de Operatic Finland van Bomhoff? 31). En heeft Haveman met zijn signaleren van zelfs een tweede Hollandse ziekte het juiste spoor aangeduid? 32). Alles bijeengenomen leidt onze het zij herhaald op de lange termijn gerichte analyse er toe dat weinig reden bestaat tot desavoueren van de doelstelling van het driesporenbeleid van het huidige kabinet. Er is evenwel ook geen reden voor een kruistocht ten behoeve van een devaluatie van de gulden, hoewel het Zweedse voorbeeld van devaluatie gesteund door loonmatiging enig succes heeft. Immers, zo devaluatie gezien internationale afspraken onder meer in het kader van het slang-arrangement al mogelijk is, moet in het licht van onze analyse over zowel de periode 1973-1982 als de periode 1960-1973 de effectiviteit ervan als tamelijk laag worden beoordeeld. Fons de Vries Jan Arreman Huib van der Kolk 23) De Nederlandsche Bank, Jaarverslag 1984, Amsterdam, 1985, biz. 22-23. 24) Idem, biz. 22-23. Het valt op dat de president hier uitsluitend over lastenverlichting voor de burgers spreekt. 25) Idem, biz. 27. 26) Idem, biz. 22. 27) Vgl. Wetenschappelijke Raad voor het Regeringsbeleid, Onder invloedvan Duitsland, 's-Gravenhage, Staatsuitgeverij, 1982, biz. 91 en H. Kamps, Een andere koers, ESB, 24 april 1985, biz. 381. 28) DNB, op.cit., biz. 16 en 51. 29) Redenen voor het nog nauwelijks omzetten van de rendementsverbetering in extra investeringen kunnen zijn zowel de nog beperkte afzetverwachtingen als het nog niet voldoen aan minimumeisen die aan de vermogenspositie worden gesteld. 30) Recente berekeningen door de OECD laten zien dat als gevolg van verwachte demografische, sociale en economische ontwikkelingen tot 1990 aan aehterblijven van de uitkeringen nauwelijks valt te ontkomen: ,,Then it should be possible for average real benefits to increase slightly between 1981 and 1990, although not as fast as real GDP per capita". OECD, Social expenditure I960-1990, Problems of growth and control, Parijs, 1985, biz. 46-53. 31) E.J. Bomhoff, Operatie Finland, ESB, 20 oktober 1982, biz. 1131-1134. 32) Robert H. Haveman, Does the we/fare state increase welfare? Reflections on hidden negatives and observed positives, H.E. Stenfert Kroese, Leiden, 1985. ESB 21-8-1985 |
{
"pile_set_name": "StackExchange"
} | Q:
How to communicate between links on the browser and a java program on background service.?
I m trying to develop an Anti-Phishing software. I want get the url which is been clicked on the browser and sent it to an java application which is running as a service in background before it visits the page of the url. I m new to this. I searched for the communication between browser and java in net, but i couldn't get the solution. Please help me, I want to know what are the languages and concepts i need to know to develop it.
A:
You need to use ajax and javascript to build asynchronous request.
Look here for a general description.
Then, you can use a javascript framework like jQuery to make easy request.
|
{
"pile_set_name": "StackExchange"
} | Q:
Best way to model a quota system for a subscription messaging service
I have a rails application that has a subscription aspect with three plan levels depending on price tier. For example, 0-1000 messages is $10, 1001-10000 is $20, and a $0.01 surcharge on both for going over the quota amount.
Each User has many Messages. What's the best way (high level) to keep track of each user's message usage and overages and charge them accordingly?
A:
I think you'll need these elements:
Way to track number of messages (caching)
Way to track payment system (how to calculate surcharges etc)
Scheduled process of charging
Messages
To track the sent messages, you need a caching system (calculating on the fly will be expensive). I don't have that much experience here, but I'd recommend looking at Redis (you may wish to research caching here)
I would use Redis to store a key/value pair for all the month's messages. So when a message is created in your DB, have a mechanism to add the update to a Redis hash (which will belong to a user ID)
Instagram info on Redis
Redis Hashes (store message date per username)
The Redis key/values will be to store the message timestamp (created_at) & the user_id of the message. This means you'll be able to reference the month's Redis store & dump to another db (to reference later on), allowing you to calculate how many messages each user sent
Payments
To enable a tier-based pricing structure, you'll need to be able to calculate the monthly invoices to send out. This should be an internal system, basically creating a mechanism to present a user with an invoice, and sending them to a payment provider to transfer the funds
To calculate the invoice, you'll basically need to run a rake task to do this:
Cycle through the user's Redis store
Store the Redis store in a db (maybe)
Take a "count" of messages
Use simple algorithm to determine price
Create priced invoice & associated record in invoice_messages table (where you can itemise message usage)
Scheduling
Although a relatively small feature, you'll need to schedule your invoice creation
I'm actually thinking about this currently (not much experience), so to do this, you'll need to set up a rake task to cycle through when a user should be invoiced. Depending on your app, you'll have to determine the right invoice date & then run the previous steps depending on it
|
{
"pile_set_name": "OpenWebText2"
} | The federal government is refusing to recognize the Islamic State atrocities as genocide, one day after U.S. Secretary of State John Kerry determined that the terror group has committed genocide against Christians and members of other minorities in Iraq and Syria.
Foreign Affairs Minister Stéphane Dion is not following in the footsteps of the U.S. administration in using the term genocide to describe the Islamic State's actions.
"Canada strongly condemns the crimes perpetrated by the so-called Islamic State of Iraq and the Levant, including those committed against religious and ethnic minorities," Mr. Dion's press secretary, Chantal Gagnon, said in a statement on Friday.
Story continues below advertisement
"Canada is committed to preventing and halting genocide, ethnic cleansing, war crimes and crimes against humanity."
Mr. Kerry made his declaration on Thursday, after Congress unanimously passed a non-binding resolution accusing the Islamic State of genocide earlier this week.
"In my judgment, Daesh [Islamic State] is responsible for genocide against groups in areas under its control, including Yezidis [Yazidis], Christians and Shia Muslims," he said.
The United States joins the likes of Pope Francis and the European Parliament in calling the terror group's actions genocide.
Speaking to The Globe and Mail, Interim Conservative Leader Rona Ambrose said Mr. Kerry's comments carry a lot of weight. She called on the Canadian government to follow suit.
"My hope is that Canada will recognize that [genocide], just as the U.S. did yesterday, and then act on it," Ms. Ambrose said.
"Now is the time for the world to come together to help the groups of people that are being slaughtered."
Story continues below advertisement
However, the NDP also refused to describe the Islamic State horrors as genocide.
Rather, foreign affairs critic Hélène Laverdière called them war crimes.
"ISIS has committed horrible acts against civilians, and from the beginning of our involvement in Iraq and Syria, the NDP has called for Canada to help uphold international law by providing support for the investigation and prosecution of war crimes in the region," Ms. Laverdière said in a statement.
Kyle Matthews, senior deputy director at the Montreal Institute for Genocide and Human Rights Studies at Concordia University, said he thinks that the federal government is avoiding the term because the Canadian mission against the Islamic State "does nothing to stop genocide."
The Liberal government revised Canada's mission against the terror organization in February, withdrawing its CF-18 fighter jets.
"The fighter jets are the ones that actually can go deep into ISIS-controlled territory in Syria and Iraq and actually take out the convoys, help ground troops stop their advances. That's been taken off the table," Mr. Matthews said.
Story continues below advertisement
"If you want to prevent genocide, there is nothing in the Canadian current plan that is doing that."
He called on the House of Commons to hold a vote declaring that the Islamic State is committing genocide.
Genocide is defined in the 1948 Convention on the Prevention and Punishment of the Crime of Genocide as "any of the following acts committed with intent to destroy, in whole or in part, a national, ethnical, racial or religious group."
If a signatory state describes a conflict as genocide, it has an obligation to act under the convention. Canada and the United States are both signatories.
While Mr. Matthews said there is no guarantee that the United States will do more to prevent genocide, the pressure is now on to do so.
"The genocide convention basically argues that inaction is not a policy option, that you have to be more forceful," he said. "It means going in and then going right to the root of the source. So we're talking about Raqqa [Syria] here." |
{
"pile_set_name": "Pile-CC"
} | Hate crimes hit seven-year high
WASHINGTON (JTA) — The incidence of hate crimes in the United States in 2008 hit a seven-year high, according to data released Monday by the FBI.
The 7,783 documented hate crimes in 2008 represented a 2.1 percent increase from 2007 and the highest since 2001.
Of the 1,519 religion-based hate crimes, also at a seven-year high, 1,013 — or 66 percent — were directed against Jews and Jewish institutions.
The FBI report also found the highest number of crimes directed at blacks, Jews and gay men and lesbians since 2001.
"While the increase in the number of hate crimes may be partially attributed to improved reporting, the fact that these numbers remain elevated — particularly the significant rise in the number of victims selected on the basis of religion or sexual orientation — should be of concern to every American," said ADL national director Abraham Foxman and ADL national chair Robert Sugarman.
In response, the ADL called for a "coordinated campaign to prevent, deter, and respond effectively to criminal violence motivated by bigotry and prejudice — including training on the provisions of the new Matthew Shepard and James Byrd Jr. Hate Crimes Prevention Act, more vigorous enforcement of existing laws, and anti-bias education and anti-bullying programs for schools and communities." |
{
"pile_set_name": "Pile-CC"
} | Search form
Site Menu
NIH Clinical Research Trials and You
Clinical trials help scientists find better ways to prevent, diagnose and treat disease. Read about the experiences of clinical trial volunteers and researchers, and learn more about how you might participate in these life-saving studies. |
{
"pile_set_name": "OpenWebText2"
} | Deftones announce headline U.S. tour
[ 21,569 views ]
Deftones have announced a spring headline tour in support of their forthcoming album, Gore, which is due out on April 8. The trek will feature direct support from Code Orange and the following shows have been confirmed:
5/8 Concord, NC @ Carolina Rebellion
5/10 Memphis, TN @ Minglewood Hall
5/11 Nashville, TN @ Ryman Auditorium
5/13 Pompano Beach, FL @ Pompano Beach Amphitheatre
5/14 Lake Buena Vista, FL @ House of Blues
5/15 Atlanta, GA @ Shaky Knees Festival (no Code Orange)
5/17 St. Augustine, FL @ St. Augustine Amphitheatre
5/18 New Orleans, LA @ Orpheum Theatre
5/20 Kansas City, MO @ Uptown Theatre
5/21 Maryland Heights, MO @ KPNT Pointfest (no Code Orange)
5/22 Columbus, OH @ Rock on the Range
5/24 Sioux Falls, SD @ The District
5/25 Wichita, KS @ Cotillion Ballroom
5/26 Oklahoma City, OK @ Criterion Theater
5/28 El Paso, TX @ Neon Desert Festival (no Code Orange)
Related News Stories |
{
"pile_set_name": "StackExchange"
} | Q:
What is the difference between ratio change vs percent change ? (finance question)
I had a question which asked us to calculate the percentage decrease in operating income between years 2012-2013 and wanted us to predict the decrease rate for the next year. When I calculated the %change, I used the typical formula of (2013 value/2012 value)-1 *100. However, the feedback in the textbook had us only calculate the "ratio of operating income which is 2013 value/2012 value" without subtracting 1.
Why is this?
Now this may seem like a basic question, but it totally changed the final answer.
A:
The ratio of $V'$ to $V$ is $V'/V.$ The change from $V$ to $V'$ is $V'-V.$ The proportionate change in $V,$ from $V$ to $V',$ is $\frac {V'}{V}-1=\frac {V'-V}{V}.$ The percent change in $V,$ from $V$ to $V'$, is $(\frac {V'}{V}-1)(100).$
The execrable phrase "times more than" became popular because of its widespread use by broadcasters and other journalists who do not understand any of this.
|
{
"pile_set_name": "Pile-CC"
} | Positively Schwall: Shilo
Out on East Lamar Alexander Parkway in Maryville, a new restaurant is breathing life into an old building.
http://www.wbir.com/video/2157908831001/46630795001/Positively-Schwall-Shilohttp://download.gannett.edgesuite.net/wbir/brightcove/29913744001/29913744001_2157933296001_th-5119547ee4b08286a9ab7b6e-782203289001.jpg?pubId=29913744001Positively Schwall: ShiloOut on East Lamar Alexander Parkway in Maryville, a new restaurant is breathing life into an old building.wbirschwall01:38 |
{
"pile_set_name": "Wikipedia (en)"
} | Holy Trinity Church, Marcross
Holy Trinity Church is a Grade I-listed church in Marcross (part of the community of St Donats), a village in the Vale of Glamorgan, south Wales. It received its status as a Grade I-listed building on 22 February 1963.
Early history
The English historian, John Capgrave, wrote that St Cyngar established a monastery in Glamorganshire with 12 canons dedicated to the Holy Trinity. It is believed this was the beginning of Holy Trinity Church. In 1874, the remains of what appeared to be a monastery were still visible. The parish consisted of Marcross Manor, owned by Sir Philip de Marcross from 1189 to 1200. De Marcross' only heir was a daughter; when she married in about 1250, the manor passed to William le Butler. The church was described as a rectory worth five marks in 1254, and was still described as such in 1535. By 1563, it was noted as having a parson and curate; by 1835, while it remained classified as a rectory, the listing for patron was the Chapter of Llandaff.
The church is in the village centre. The main structure dates from the 12th century; it is believed that the tower was added to the building in the 14th century. The tower, with its saddleback roof, may have been partially rebuilt in the 17th century, from evidence of a difference in masonry above its ridge. The rounded Norman arch at the church entrance dates from circa 1150 and the large font with rolled mouldings dates from the 12th century. There are no aisles in either the chancel or nave. One of the chancel walls has two trefoil light windows believed to be from the 13th century. One of these windows may have been used for the ringing of a Sanctus Bell. The building is constructed of stone with slate roofing, with the roof for the chancel being lower than the nave. Still in the chancel is the lepers' window, where those with contagious diseases could view church services without coming into contact with others.
19th century to present
By the late 19th century, it became evident that the church was in need of restoration work. The rector of Holy Trinity began a fundraising campaign for the work; it took four years to raise the needed funds. By 1892, enough donations were received to allow Kempton and Fowler of Llandaff to begin the project. During the restoration, the architects discovered many items of note which had been hidden by previous renovations to the church. While removing old plaster from the walls, a doorway leading to the rood loft on the north side of the chancel arch was uncovered. The plaster removal also located a 13th-century tomb in a recess of the north nave wall. During the restoration, a tomb in the chancel floor from circa 1200 and the church's original pillar piscina were also located.
When the restoration was completed, the church had been completely re-roofed, the church walls and tower were renovated, new floors were installed along with new pews, a new pulpit and reading desk, as well as a new altar and altar rail. Holy Trinity was reopened on 17 January 1897. The only changes made to the church since this restoration were to remove the pews in favour of chairs for seating. The church appears to now be in need of work, particularly after a series of spring storms in 2016. In May, 2016, a village fundraiser was held at the local pub to help with the necessary costs of repairing the church.
There is also a circa 15th century cross which holds a circa 18th century bronze sundial on the church property; these became Grade II listed buildings on 9 October 1982.
Notes
References
Category:Grade I listed churches in the Vale of Glamorgan |
{
"pile_set_name": "OpenWebText2"
} | U.S. Sen. Bernie Sanders detailed his plan to aid American seniors Friday, arguing that expanding Social Security and enacting his signature "Medicare for All" health care proposal are critical to providing necessary services.
"We have got to recognize that, as a nation, millions of senior citizens in this country are hurting," Sanders told the Des Moines Register in an interview. "We are the wealthiest country in the history of the world, and millions of older people should not have to struggle every single day to take care of their basic needs."
The senator from Vermont and 2020 presidential candidate shared details of his plan with the Register ahead of his scheduled appearance at a Saturday afternoon forum sponsored by the Register and the AARP in Council Bluffs. It is the last of five such forums attended by 17 Democrats running for president.
Sanders' Medicare for All plan would be phased in over four years to cover all Americans, and it would eliminate private health insurance.
Sanders said his Medicare for All proposal would lower the price of prescription drugs by requiring the federal program to negotiate drug prices and allowing patients, pharmacists and wholesalers to purchase lower-cost drugs from Canada and other countries. After that, the plan would cap out-of-pocket drug costs for consumers at $200 annually.
The expanded Medicare program also would add coverage for things such as dental care, hearing aids, vision exams and podiatry as well as home and community-based long-term care services.
Former Vice President Joe Biden spoke at one of the AARP forums earlier in the week and argued that Medicare for All would weaken the current health care program upon which millions of seniors depend.
Sanders said that was "just not accurate" and hoped to use Saturday's AARP/Register forum to make his case.
"I want Iowans and especially seniors to understand that under our proposal, we expand Social Security benefits in areas that they desperately need," he said.
To pay for an expansion of those Social Security benefits, Sanders supports lifting the payroll tax cap.
Currently, American workers pay a tax on wages up to $132,900 a year, and those taxes fund the Social Security program. That means someone earning millions of dollars a year in wages pays the same amount of money into the program as someone who makes far less, Sanders said. Sanders said the tax should be collected on all income over $250,000.
With that money, Sanders said he would support a benefit increase of $1,300 a year to seniors with incomes of $16,000 a year or less. He also called for increasing benefits paid to low-income workers when they retire and establishing a "Consumer Price Index for the Elderly" to ensure cost-of-living increases that keep pace with the products seniors use most.
He said he would "make no apology" for raising taxes if it means expanding Social Security benefits.
“We live in a society where the very rich are doing phenomenally well," he said. "Trump, despite that reality, has given over a trillion dollars in tax breaks to the top one percent and to large profitable corporations. ... Instead of giving huge tax breaks to billionaires, we demand that they start paying their fair share of taxes."
Sanders' plan also calls for:
Quadrupling funding for the Older Americans Act, which supports services such as home-delivered meals, and creating a new office within the Administration for Community Living to address social isolation among seniors
Signing an executive order to put a moratorium on future pension cuts and reverse cuts that have already been made
Expanding heating and cooling assistance through the Low Income Home Energy Assistance Program
Expanding the Supplemental Nutrition Assistance Program, commonly known as food stamps, as well as the Meals on Wheels program
Cracking down on scams and predatory financial practices that target seniors
In addition to attending the AARP/Register forum, Sanders plans to attend a senior issues roundtable in Council Bluffs on Saturday and have coffee with union workers and retirees in Ottumwa on Sunday. |
{
"pile_set_name": "Pile-CC"
} | Today’s news of the day centered (no pun intended) around the possibility of Houston’s Omer Asik being dealt by next Wednesday or Thursday. The Rockets have set a December 19th deadline, likely to heat up the bidding war for a very useful (and rare) piece. This is according to the NBA’s David Aldridge, one of the most credible sports journalists around:
ICYMI: Rockets will trade Asik next Wednesday or Thursday. And do not discount Cleveland/Varejao. Would be perfect fit next to Howard.
It has been well documented since Dwight Howard’s arrival in Houston that Asik has been unhappy. And while Asik would be a sexy piece to add to a contender or fringe contender, it’s hard to predict where he may land.
Aldridge suggested a deal with Cleveland that would involve the swap of Asik for Anderson Varejao. While the numbers matchup well, and the Cavaliers have shown serious interest in Asik in the past, it is unlikely they are serious about an Asik/Andy swap. While NBA nerds and Rockets fans might salivate at the thought of a wild Varejao running down long rebounds, flying into the crowd for loose balls and generally irritating the opposing team while Dwight protects the paint, it doesn’t make much sense for Cleveland to bring back Asik.
The main problem with the 2013-14 Cleveland Cavaliers is their lack of spacing and flow on the offensive end. Asik has no offensive game to speak of and would not help the Cavs’ spacing. Asik just doesn’t really fit on this roster as currently constructed.
Varejao has recently started playing better for the Cavaliers and is the last remaining link to Mike Brown’s former Cavs teams. For a team that is finally starting to figure things out and play together as a team, would it be wise to trade one of the few veteran players away?
After a slow start, Varejao has started to return to his near All-Star form of last season – in 25 games last season he posted averages of 14 points and 14 rebounds.
Pretty darn good.
He’s proven he can contribute at a high level as a starter and off the bench, where Mike Brown currently has him slotted. And he’s been giving Cleveland massive production with the second unit and in crunch time since Andrew Bynum was integrated into the starting lineup including an 18 point and 13 rebound performance against Denver last week.
Varejao gives Cleveland a second option when Brown feels a need to give Bynum some rest, or go to a different style of play if he feels Bynum is not suited physically for the matchup. Not to mention he is the only big on Cleveland with a consistent jumper to stretch the floor, something of high importance to Cleveland that Kaczmarek touches on. Bottom line: Cleveland needs scoring from the wing, not defense in the paint.
Marc Stein of ESPN believes that the Rockets would not do a straight up swap of Asik/Andy, and that they would require a future first round pick in addition. Stein breaks down the rest of the contenders — subject to change — for Asik:
Many league insiders maintain that the Rockets’ No. 1 target in an Asik deal is Hawks forward Paul Millsap, who will join more than 100 players who signed contracts in July in becoming trade-eligible Dec. 15, which happens to be Sunday. We caution, though, that gauging the Hawks’ true willingness to part with Millsap — after signing him to a two-year, $19 million deal that increasingly ranks as one of the league’s best bargains — remains a mystery thanks to ever-coy Hawks GM Danny Ferry.
ESPN.com reported last week that the Rockets are determined to trade Asik to an Eastern Conference destination in part to keep his highly rated defense away from current teammate Dwight Howard. Two more teams, then, that continue to be mentioned as potential trade partners for Asik in addition to Atlanta and Cleveland are Philadelphia (Thaddeus Young) and Milwaukee (Ersan Ilyasova).
What do Millsap, Young and Ilyasova have in common? All three can theoretically operate next to Howard as a power forward with the clear ability to play outside and stretch the floor. Let’s see how the fact that Varejao lacks the same range affects Houston’s appetite to pursue such a deal. If the Rockets are intent on completing the best trade they can make by Thursday, they might not wait around for a floor-spacer. |
{
"pile_set_name": "Pile-CC"
} | North Carr Ward
Nicola Agnew, Paul Grantley & Doreen Harrison are your local Lib Dem campaigners in North Carr Ward - for councillors who will work hard and keep in touch all year round.
Covering Kingswood to the east of Kesteven Way, North Bransholme, the Garths, Castle Grange and Midmere Avenue.
Please get in contact if you have any questions for the team or want to raise any issues with them.
Email: [email protected]
Telephone: coming soon
Facebook:@HullandHessleLibDems
Optional email code
Back the Lib Dem team in North Carr Ward today:
Yes, I'm backing the Lib Dem team:
Can we keep you updated?
Yes, I'd like to get emails from the local Liberal Democrats.
If you submit this form, the Liberal Democrats, locally and nationally, may use information in it, including your political views, to further our objectives, share it with our elected representatives and contact you in future using any of the means provided. Some contacts may be automated. You may opt out of some or all contacts or exercise your other legal rights by contacting us. Further details are in our Privacy Policy at www.libdems.org.uk/privacy
Thanks , will you help spread the word by sharing this page?
If you enter your details on this website, the Liberal Democrats, locally and nationally, may use information in it, including your political views, to further our objectives, share it with our elected representatives and/or contact you in future using any of the means provided. Some contacts may be automated. You may opt out of some or all contacts or exercise your other legal rights by contacting us. Further details are in our Privacy Policy at www.libdems.org.uk/privacy.
Published and promoted by and on behalf of Hull Liberal Democrats, all at Chamberlain Business Centre, Chamberlain Road, Hull, HU8 8HL
Published and promoted by Nick Harvey on behalf of the Liberal Democrats, 8-10 Great George Street, London, SW1P 3AE. Hosted by NationBuilder. |
{
"pile_set_name": "DM Mathematics"
} | 77588
What comes next: 5789, 11579, 17369, 23159, 28949, 34739?
40529
What is the next term in 870, 883, 896, 909?
922
What is next in 39, 191, 433, 771, 1211, 1759?
2421
What is the next term in -2218, -17790, -60064, -142390, -278118?
-480598
What is the next term in 536, 635, 748, 875, 1016, 1171?
1340
What is next in -287, -1012, -2217, -3902, -6067, -8712?
-11837
What comes next: 90, 130, 176, 228?
286
What is next in 534, 258, -16, -288, -558, -826?
-1092
What comes next: -204, -275, -340, -399, -452?
-499
What is next in -1088, -2128, -3168, -4208, -5248, -6288?
-7328
What is next in -1934, -1916, -1896, -1874, -1850, -1824?
-1796
What is next in 481, 2745, 6799, 12649, 20301, 29761?
41035
What comes next: -248, -911, -2016, -3563, -5552, -7983, -10856?
-14171
What is next in -78, -279, -710, -1449, -2574, -4163, -6294?
-9045
What is next in 985, 1018, 1053, 1090, 1129?
1170
What is the next term in 128, 196, 210, 176, 100, -12, -154, -320?
-504
What comes next: -3321, -6742, -10265, -13890?
-17617
What comes next: 518, 532, 544, 554, 562, 568, 572?
574
What is next in 349, 2691, 9053, 21445, 41877, 72359, 114901, 171513?
244205
What is next in 69, 94, 115, 138, 169, 214?
279
What is the next term in 503, 712, 1069, 1580, 2251, 3088, 4097, 5284?
6655
What comes next: 735, 742, 751, 762?
775
What is the next term in -283, -301, -331, -373, -427, -493, -571?
-661
What is the next term in -34862, -34864, -34866, -34868, -34870?
-34872
What comes next: 220, 147, 24, -149?
-372
What is next in -14879, -29760, -44641, -59522, -74403, -89284?
-104165
What is next in -1218, -1719, -2222, -2727?
-3234
What is next in -408, -817, -1462, -2349, -3484, -4873, -6522, -8437?
-10624
What is the next term in -3498, -3608, -3792, -4050, -4382?
-4788
What is the next term in 77119, 77120, 77121?
77122
What comes next: 7546, 7549, 7554, 7561, 7570?
7581
What is next in 328, 612, 1086, 1750, 2604, 3648?
4882
What comes next: 15, -131, -527, -1299, -2573, -4475, -7131?
-10667
What is next in -886, -3665, -8276, -14719, -22994, -33101, -45040?
-58811
What comes next: -12975, -51841, -116617, -207303?
-323899
What comes next: -229534, -459062, -688588, -918112, -1147634?
-1377154
What comes next: 2553, 9943, 22263, 39513?
61693
What is next in -3754, -7655, -11568, -15499, -19454, -23439, -27460, -31523?
-35634
What is next in 2440460, 4880923, 7321386, 9761849?
12202312
What is next in 81, 80, 63, 30, -19?
-84
What is next in 297, 241, 159, 39, -131?
-363
What comes next: -65784, -131567, -197348, -263127, -328904, -394679?
-460452
What comes next: -4602, -9212, -13824, -18438?
-23054
What is the next term in 89, 174, 317, 518?
777
What is next in 1060, 1020, 980?
940
What comes next: -11993, -23957, -35909, -47843, -59753?
-71633
What comes next: -307, -290, -263, -226, -179, -122?
-55
What comes next: -1438, -2885, -4340, -5803, -7274, -8753?
-10240
What is next in 216297, 216299, 216301?
216303
What comes next: 248, 728, 1222, 1736, 2276, 2848, 3458, 4112?
4816
What comes next: 8275, 8311, 8349, 8389, 8431?
8475
What is next in -678, -612, -532, -432, -306, -148, 48, 288?
578
What comes next: -9, -19, -47, -87, -133, -179?
-219
What is next in -16, -88, -260, -574, -1072, -1796, -2788?
-4090
What comes next: -2125, -4336, -6547?
-8758
What is next in 1774, 3168, 4562, 5956?
7350
What is next in 4055, 4053, 4049, 4043, 4035?
4025
What is the next term in -428, -1489, -3256, -5729, -8908, -12793?
-17384
What is the next term in 25, 517, 1897, 4609, 9097?
15805
What is next in -108, -175, -200, -183, -124?
-23
What is next in -557, -592, -637, -698, -781, -892, -1037, -1222?
-1453
What is the next term in 4203, 4344, 4579, 4908, 5331, 5848, 6459?
7164
What comes next: 3654, 3658, 3662, 3666?
3670
What is the next term in 35554, 35565, 35584, 35611, 35646, 35689?
35740
What is the next term in -379, -1017, -1895, -3013?
-4371
What is next in 13142, 13171, 13200?
13229
What is the next term in 3900, 1683, -526, -2721, -4896, -7045?
-9162
What is next in -1782, -3535, -5266, -6981, -8686, -10387?
-12090
What is next in -1640, -3241, -4828, -6401, -7960?
-9505
What comes next: 393, 206, 19?
-168
What is the next term in -37792, -75608, -113426, -151246, -189068, -226892?
-264718
What comes next: -4576264, -4576262, -4576260, -4576258?
-4576256
What is next in 82, 144, 206?
268
What comes next: -25407, -50784, -76157, -101526, -126891, -152252?
-177609
What comes next: 30330, 30322, 30308, 30288?
30262
What is next in -11535, -46077, -103637, -184209, -287787, -414365, -563937?
-736497
What is next in 4839, 9664, 14489?
19314
What is next in -17, -89, -213, -395, -641, -957, -1349, -1823?
-2385
What is next in 82048, 164095, 246142?
328189
What comes next: -409609, -409629, -409649, -409669, -409689?
-409709
What is the next term in 154, 123, 92?
61
What is next in 202498, 202497, 202494, 202489, 202482?
202473
What is the next term in -9759, -10233, -10707, -11181?
-11655
What comes next: -214, -68, 432, 1280, 2470, 3996?
5852
What comes next: 10231, 40958, 92179, 163900, 256127, 368866, 502123?
655904
What is next in -10240, -20469, -30698, -40927, -51156, -61385?
-71614
What comes next: 6595, 6593, 6591?
6589
What is next in -857, -6399, -21311, -50279, -97989, -169127, -268379?
-400431
What comes next: -115183, -115186, -115189, -115192, -115195?
-115198
What is next in -137865, -137864, -137863?
-137862
What comes next: -3086, -3066, -3046, -3026, -3006?
-2986
What is the next term in -34297, -34286, -34275, -34264, -34253, -34242?
-34231
What is the next term in -148, -468, -960, -1624?
-2460
What comes next: -2606, -2576, -2506, -2378, -2174, -1876, -1466?
-926
What is next in -179, -476, -855, -1322, -1883, -2544, -3311, -4190?
-5187
What is next in 96, 391, 1208, 2811, 5464, 9431, 14976?
22363
What is next in -112984, -112994, -113010, -113032, -113060, -113094?
-113134
What comes next: -164, -147, -130?
-113
What is next in -9525, -18981, -28435, -37887, -47337, -56785?
-66231
What is the next term in -118, -513, -1172, -2095?
-3282
What comes next: -642520, -642521, -642522, -642523?
-642524
What is next in 490, 364, 236, 106?
-26
What is next in 4356, 8686, 12988, 17256, 21484, 25666?
29796
What comes next: -114, -348, -742, -1314, -2082, -3064, -4278?
-5742
What is next in -57687, -57691, -57697, -57705?
-57715
What comes next: -3727, -3780, -3865, -3994, -4179, -4432?
-4765
What is next in -4322, -8949, -13576, -18203?
-22830
What is next in 4080, 8212, 12344?
16476
What comes next: -319, -743, -1167, -1591?
-2015
What comes next: -1, -9, -21, -37, -57, -81?
-109
What is next in -915, -3613, -8109, -14403?
-22495
What is next in 128, 396, 776, 1214, 1656, 2048, 2336?
2466
What is next in 195803, 195799, 195795, 195791, 195787, 195783?
195779
What is next in -6485, -13525, -20565, -27605?
-34645
What comes next: -24465, -24486, -24517, -24564, -24633, -24730, -24861, -25032?
-25249
What is next in 2476, 2739, 3002?
3265
What comes next: 14601, 29250, 43899, 58548, 73197?
87846
What comes next: 1403, 2098, 2793?
3488
What comes next: -708, -660, -612, -564, -516, -468?
-420
What comes next: 18492, 37018, 55544, 74070, 92596, 111122?
129648
What comes next: -332, -1367, -3078, -5465, -8528, -12267, -16682?
-21773
What is the next term in 82, 245, 490, 817, 1226, 1717?
2290
What is the next term in -508, -478, -480, -520, -604?
-738
What is next in -343, -370, -397?
-424
What is the next term in 6036, 24109, 54220, 96369, 150556?
216781
What is next in 43, 133, 265, 427, 607, 793, 973?
1135
What is the next term in 3082070, 3082067, 3082064?
3082061
What comes next: -73, -210, -411, -676?
-1005
What comes next: 85648, 85683, 85776, 85957, 86256, 86703, 87328?
88161
What is the next term in 551, 1874, 4073, 7142, 11075, 15866?
21509
What is the next term in 121, 269, 433, 619, 833?
1081
What is next in -64362, -64299, -64250, -64221, -64218, -64247, -64314?
-64425
What is the next term in 342, 1169, 2538, 4443, 6878?
9837
What is next in 1464961, 1464960, 1464959, 1464958?
1464957
What is the next term in -87, -77, -69, -69, -83, -117, -177, -269?
-399
What comes next: 169971, 170046, 170251, 170652, 171315, 172306, 173691, 175536?
177907
What is ne |
{
"pile_set_name": "StackExchange"
} | Q:
Trying to understand a particular part of code from microsoft tutorials regarding Word Add-Ins
private void ThisAddIn_Startup(object sender, System.EventArgs e)
{
this.Application.DocumentOpen +=
new Word.ApplicationEvents4_DocumentOpenEventHandler(WorkWithDocument);
((Word.ApplicationEvents4_Event)this.Application).NewDocument +=
new > Word.ApplicationEvents4_NewDocumentEventHandler(WorkWithDocument);
}
private void WorkWithDocument(Microsoft.Office.Interop.Word.Document Doc)
{
try
{
Word.Range rng = Doc.Range(0, 0);
rng.Text = "New Text";
rng.Select();
}
catch (Exception ex)
{
// Handle exception if for some reason the document is not available.
}
}
This is the full code. From what I understand it's supposed to initiate the Add-In, check if the document is avaliable. The part I have trouble understanding is this:
((Word.ApplicationEvents4_Event)this.Application).NewDocument ...
What I don't understand is the (Word.ApplicationEvents4_Event) right before this.Application. Is that some kind of an event-like typecast? I've got no idea.
A:
The documentation states that it is an interface, so the code is casting this.Application to that interface.
Documentation for Application explains this:
This is a .NET interface derived from a COM coclass that is required
by managed code for interoperability with the corresponding COM
object. Use this derived interface to access all method, property, and
event members of the COM object. However, if a method or event you
want to use shares the same name under the same COM object, cast to
the corresponding primary interface to call the method, and cast to
the latest events interface to connect to the event. Refer to this
topic for information about the COM object. For information about the
method and property members of the COM object, see _Application. For
information about the event members of the COM object, see
ApplicationEvents4_Event.
|
{
"pile_set_name": "PubMed Central"
} | Introduction {#s0001}
============
Hydrogel is composed of network polymers dispersed in a lot of water, which has been widely concerned in the field of biomedical research for its good formulation stability and bio-compatibility (Dou et al., [@CIT0009]; Zheng et al., [@CIT0034]). Currently, the preparation of *in situ* gel through a simple sol-gel method with no chemical reaction is a focus in the research for hydrogel, which allows the hydrogel more suitable for the application in controlled drug delivery and biomedical engineering (Wu et al., [@CIT0026]; Yu et al., [@CIT0030]). There are many advantages of the biodegradable injectable *in situ* gel system, such as *in situ* drug depot can be formed without surgery treatment and the drug-loading or dose adjustment is convenient (Jiang et al., [@CIT0015]; Wu et al., [@CIT0026]). Chitosan (CS) has been widely used in the field of pharmaceutics, medicine and tissue-engineering, because of its bio-degradability, low toxicity and good bio-compatibility. An interesting sol-gel phase transition of the combination of CS and glycerol phosphate disodium (GP) has been reported (Chenite et al., [@CIT0007]; Supper et al., [@CIT0023]). The injectable CS/GP thermogels were used as biomaterials for angiogenesis, fiber-cartilage regeneration and bone tissue repair (Cheng et al., [@CIT0006]). Paclitaxel-loaded CS-based thermogels were studied by intra-tumor injection into tumor-bearing mice, whose findings displayed that compared with Taxol injections, the paclitaxel-loaded thermogels could more effectively inhibit tumor growth and reduce systemic toxicity (Mahajan et al., [@CIT0018]).
Pingyangmycin (PYM), isolated from streptomycete in the soil of Pingyang county, is a new type of hydrophilic glycopeptide anti-tumor antibiotic. PYM has been applied in clinical in the Far East for over 30 years for treatment of Vascular malformation (VM) and different types of cancer of epidermal origin with an exact therapeutic effect (Chen et al., [@CIT0005]; Ochiai et al., [@CIT0020]). VM, which often occurs in oral and maxillofacial region, is a common disease and can be cured by many methods including embolization therapy, sclero-therapy, laser cosmetic treatments, cryo-therapy and radiation therapy (Zhang et al., [@CIT0031]; Zhao et al., [@CIT0032]; Li et al., [@CIT0016]). Best treatment strategies are related to the size and location of the lesion, for example, laser photocoagulation therapy would be adopted for the respiratory disease, while surgical treatment is the best choice for resectable lesion (Urban et al., [@CIT0024]). Over the years, the treatment of VM mainly focused on the traditional plastic surgery with its shortcomings for instance, visible scar, bad therapeutic dependence, and high risk resulted from the complexity of blood vessels distributed in oromaxillofacial region (Mohan et al., [@CIT0019]). In addition, the potential facial distortion brought by a surgery may result in mental problems for patients (Zhao et al., [@CIT0033]). Local and intravenous injection of PYM can lead to endothelial cell injury, thicken the blood vessel wall and vascular occlusion (Luo & Gan, [@CIT0017]). Now, PYM lyophilized powder for injection is the only commercial preparation. While, short half-life and lots of side effects (e.g. lung toxicity) of PYM have limited its wide application (Yang et al., [@CIT0029]). As a substitute for traditional surgery, interventional embolization treatment for VM has been utilized more accurately and adaptably to block blood vessels in the past few years (Abdel Aal et al., [@CIT0001]). Chemo-embolization method, which combines the advantages of embolic materials and therapeutic drugs, has become one of the promising treatments for VM recently (Ashrafi et al., [@CIT0002]). So, local and slow-release PYM formulation research is greatly essential to improve the therapeutic effect and reduce the adverse effects at the same time. There are some reports on the combination of PYM and bio-degradable embolic materials, such as PYM-loaded PLGA microspheres, PYM-loaded Zein/Zein-sucrose acetate isobutyrate thermogels and PYM-loaded Bovine serum albumin microspheres (Gao et al., [@CIT0011]; Wang et al., [@CIT0025]; Han et al., [@CIT0012]).
In our previous research, an injectable liposome was successfully obtained and optimized for the sustained release of PYM (Zheng et al., [@CIT0034]; Chen et al. [@CIT0004]). However, the preparation of PYM-loaded liposomes was critically challenging due to the limited local delivery of PYM in injection site, which could increase its side effects, especially the possibility of pulmonary injury. The incorporation of PYM liposomes with *in situ* thermogels is an effective strategy to overcome the above problem. Sustained and localized PYM delivery can be significantly improved by dissolving it in the liposomal thermogels system.
In the present study, thermosensitive *in situ* gel composed of CS and GP was investigated for PYM-loaded liposomes delivery in chemoembolization for VM, which could switch from solution into a semisolid embolic agent occluding blood vessels as temperature raise, in order to block nutrition supplement and release PYM-loaded liposomes sustainedly to maintain an effective therapeutic concentration. Herein, PYM-loaded liposomal CS/GP-based *in situ* gels were prepared and evaluated *in vitro* and *in vivo*. The effects of considered variables were investigated by the application of a three-level three-factorial Box--Behnken experimental design and the formulation variables were optimized by the utilization of response surface methodology (Imam et al., [@CIT0013]). This study laid the foundation for developing a PYM delivery system connecting the *in situ* thermogelling peculiarity of CS/GP with the advantages provided by liposomes.
Materials and methods {#s0002}
=====================
Materials {#s0003}
---------
Pingyangmycin (PYM) was purchased from Di Kang pharmaceutical Co., Ltd. (Liaoyuan, China). Soybean phospholipids and cholesterol were obtained from Shanghai Aikang Co, Ltd (Shanghai, China). Chitosan (CS, 50 kDa) was obtained from Haidebei Marine Bioengineering Co., Ltd. (Jinan, China). Glycerophosphate disodium (GP) was acquired from Sinopharm Chemical Reagent Co., Ltd. (Shenyang, China). Purified water was used after deionization and filtration in a Millipore® system. The human vascular endothelial cell line EA.hy926 was provided by The First Affiliated Hospital of China Medical University (Shenyang, China). Dulbecco's modified Eagle's medium (DMEM) was purchased from GIBCO Co., Ltd. (Shanghai, China). Fetal bovine serum (FBS) was the product of Beyotime Biotechnology (Shenyang, China). All other chemical reagents and solvents used were of analytical grade.
Preparation of PYM liposomes, PYM thermogels and PYM liposomal thermogels {#s0004}
-------------------------------------------------------------------------
In the present study, PYM-loaded liposomes were produced using the ammonium sulfate gradients technique (Zheng et al., [@CIT0034]; Chen et al., [@CIT0004]). Firstly, soybean phospholipids (100 mg) and cholesterol (22.2 mg) were added into flask with 10 ml ethyl alcohol solution. A layer of uniform phospholipid membrane was formed by the rotary-film evaporation method in a 42.3 °C water bath. After vacuum dry for 24 hours, 250 mmol/L ammonium sulfate solution (10 ml) was added to elute the lipid membrane, and then following the probe ultrasonic processing. The suspension of lipids was extruded through a 0.22-µm microporous membrane and then following incubation with PYM (18.3 mg) solution about 40 min in a 42.3 °C water bath. PYM-loaded liposomes thus obtained were stored at room temperature for further research. The starting conditions of PYM liposomes before embedding in thermogels were tested in our previous study and listed in [Table 1](#t0001){ref-type="table"} (Zheng et al., [@CIT0034]; Chen et al., [@CIT0004]).
######
The starting conditions of PYM liposomes before embedding in thermogels.
spc:chol (w/w) PYM:lipid (w/w) Liposome size (nm) Encapsulation efficiency (%) Zeta potential (mV)
---------------- ----------------- -------------------- ------------------------------ ---------------------
4.5 0.15 136 ± 18 63.7 ± 1.59 −28.55 ± 6.81
The 'cold' method was adopted for preparation of PYM thermogels and PYM liposomal thermogels. *In vitro* evaluation of gelation time and viscosity of CS/GP thermogels in our previous research showed that the better starting values for CS and GP were 1.8%(w/v) and 6%(w/v), respectively (Chen et al., [@CIT0003]). Typically, CS (1.8%--2.2%, w/v) powder was mixed with 0.1 mol/L acetic acid with agitation, and then, the mixture was kept stirring overnight to clarified. Then, the CS solution was cooled to 4 °C. GP (6%--14%, w/v) solution was prepared and kept at 4 °C for a period of 10 min. Then, GP solution was dropwise added into CS solution with agitating, and the mixture was stirred for 10 min. Finally, the PYM thermogels or PYM liposomal thermogels was acquired by mixing PYM solution or PYM liposomes with CS/GP solution with agitating for 10 min.
*In vitro* release studies of PYM formulations {#s0005}
----------------------------------------------
Firstly, 5 mL of the PYM liposomes (placed in a preswollen dialysis bag with a 12,000--14,000 Damolecular weight cutoff), PYM thermogels or PYM liposomal thermogels was placed in 10 mL glass vials (internal diameter about 20 mm) and warmed up in 37 °C water bath for 30 min with the aim of complete transition to gel. Then, 3 mL of PBS (pH 7.4) containing NaN~3~ (0.05%, w/v) was added into the above vials. The vials were placed at 37 °C with the shaking rate of 50 rpm. At predetermined time, the dissolution medium was withdrawn for analysis and replenished with equal volume of fresh medium. The drug concentration in the medium was determined as previously reported (Chen et al., [@CIT0003]). Each dissolution test *in vitro* was operated in triplicate, then the accumulative release ratio of drug from PYM liposomes, PYM thermogels or PYM liposomal thermogels was calculated.
Box--Behnken experimental design {#s0006}
--------------------------------
A three-level three-factorial Box--Behnken experimental design (Design-Expert, Version 7.1.3, USA) was carried out to assess the effects of the chosen factors including the loading of PYM, CS amount and GP content on the responses of the PYM release behavior *in vitro*, to optimize the preparation parameters of PYM-loaded liposomal CS/GP thermogels. This design applied to the exploration in quadratic response surfaces and the construction of second order polynomial models. The quadratic function produced by the experimental design was of the equation as follow: $$\text{Y\ =β}_{\text{0}}\text{+β}_{\text{1}}\text{X}_{\text{1}}\text{+β}_{\text{2}}\text{X}_{\text{2}}\text{+β}_{\text{3}}\text{X}_{\text{3}}\text{+β}_{\text{12}}\text{X}_{\text{1}}\text{X}_{\text{2}}\text{+β}_{\text{23}}\text{X}_{\text{2}}\text{X}_{\text{3}}\text{+β}_{\text{13}}\text{X}_{\text{1}}\text{X}_{\text{3}}\text{+β}_{\text{11}}\text{X}_{\text{1}}{}^{\text{2}}\text{+β}_{\text{22}}\text{X}_{\text{2}}{}^{\text{2}}\text{+β}_{\text{33}}\text{X}_{\text{3}}{}^{\text{2}}$$ where Y is the measured response associated with the combination of every factor level, β~0~ is the intercept, β~i~'s (for i = 1--3) are the linear effects, β~ii~'s (for i = 1--3) the quadratic effects, β~ij~'s (for i, j = 1--3, i \< j) the interaction between the ith and jth variables (Irani et al., [@CIT0014]). The factors selected and settings of factor levels were listed in [Table 2](#t0002){ref-type="table"}.
######
Factors and responses in Box--Behnken design.
Factors Levels
-------------------------------- ------------- ----- -----
X~1~ PYM (mg/mL) 2 4 6
X~2~ CS % (w/v) 1.8 2.0 2.2
X~3~ GP % (w/v) 6 10 14
Responses Constraints
Y~1~% Release of PYM in 1 day Minimize
Y~2~% Release of PYM in 9 days Maximize
Y~3~ Rate constant k Maximize
X~1~ is the factor of durg loading of the peraration, X~2~ is the factor of CS amount, X~3~ is the factor of GP content. Y~1~ is the response of cumulative release percentage of PYM in 1 day, Y~2~ is the response of cumulative release percentage of PYM in 9 days, Y~3~ is the response of rate constant.
*In vitro* cytological evaluation {#s0007}
---------------------------------
### Cell culture {#s0008}
EA.hy926 cells were cultured in DMEM Medium supplemented with 10% fetal bovine serum at 37 °C in a humidified 5% CO~2~ incubator. The cells were used for analysis at 3--7 passages.
### Cell morphology study {#s0009}
An inverted fluorescence microscope was used to observe the morphology change of EA.hy926 cells after incubation with blank liposomal thermogels, PYM liposomes and PYM liposomal thermogels (equaled to 10 μg/mL PYM). EA.hy926 cells were cultured in 24-well plates at a cell density of 2 × 10^4^ cells per well. A matched group was also utilized through the whole experiment. After post treatment process, cells were stained by hematoxylin and eosin (H&E), and fluorescent Hoechst 33258, respectively. Each well was tested with the microscope at 200 × and 400 × magnification, and each group got three micrographs by using a video capture system.
### Cell cycle analysis and apoptosis assay {#s0010}
EA.hy926 cells were seeded in 24-well plates (1 × 10^4^ cells/well) and cultured with DMEM for 24 h. Medium was then replaced by 3 mL of two different concentrations of PYM liposomes or PYM liposomal thermogels, and continued to incubate for another 24 h & 48 h to reach 80% confluency. Then the cells were harvested and washed twice with ice-cold PBS. All cells were firstly divided to two parts for different assays. One part was analyzed for cycle distribution, and the steps were summarized as follows: cells were fixed and permeabilized with 70% cold ethanol, then stained with PI and analyzed by using a flow cytometer (BD Biosciences, San Jose, CA). The percentage of cells in different cell cycle phases (G0/G1, S and G2/M phase) was calculated using CELL Quest software. The other part was analyzed for apoptosis and necrosis, details were as follows: cells were harvested and washed with ice-cold PBS, stained with Annexin V-FITC and PI according to the manufacturer's instructions of Annexin V-FITC/PI KIT. Finally, the samples were also analyzed by flow cytometer. Cells in media without PYM (negative control) and cells treated with blank liposomal thermogels were also analyzed as well.
*In vivo* pharmacokinetic study in rabbits {#s0011}
------------------------------------------
### Design of pharmacokinetic experiments {#s0012}
New Zealand rabbits were randomly divided into three groups (*n* = 6) and received an injection via auricular brim veins of PYM liposomes, PYM thermogels or PYM liposomal thermogels (PYM 10 mg/kg). Blood samples were collected from another ear marginal vein of rabbits to heparinized tubes at predetermined time intervals obtaining the plasma after centrifugation (8 min, 10000 rpm). The plasma was stored at −20 °C for further analysis.
### Plasma sample analysis {#s0013}
The plasma sample processing method was used in our previous research and analyzed using a HPLC method (Chen et al., [@CIT0003]). Briefly, after naturally melting at room temperature, the plasma sample was mixed with caffeine and trichloroacetic acid solution, and then centrifuged at 10,000 rpm for 10 min. The collected supernatant was injected into sampling valve for HPLC analysis. Pharmacokinetic parameters such as the area under the curve (AUC) and half-life were calculated by using DAS 2.1.1 Pharmacokinetic Software Version.
*In vivo* chemoembolization studies in rabbits {#s0014}
----------------------------------------------
Twenty New Zealand rabbits were used for *in vivo* chemoembolization studies, which were divided randomly into four groups (*n* = 5), including the groups of normal saline, blank liposomal thermogels, PYM liposomes and PYM liposomal thermogels. The above formulations were slowly injected via auricular brim veins (PYM 10 mg/kg), respectively. The administration site was pressed for 30 s after injection to stop the drug solution diffusing through the blood vessel. On 2, 7, 14, 21 days after injection, one rabbit of each group was sacrificed. The auricular brim veins were treated by Formalin-Fixed and Parrffin-Embedded method and then stained by H&E and watched under a light microscope to assess the effect of chemoembolization.
Results and discussion {#s0015}
======================
Formulation building and Box--Behnken design {#s0016}
--------------------------------------------
In this study, 17 experiments were conducted. The selected responses were cumulative release percentage of PYM in 1 day (Y~1~), 9 days (Y~2~) and the rate constant *k* (Y~3~). Higher cumulative release percentage of PYM in 9 days and larger rate constant *k* were better for the preparation controlling the PYM sustainedly release up to 9 days. An initial undesired fast release of the drug from liposomal thermogels may lead to problems of toxicity (Yan et al., [@CIT0028]). Thus, the adequate control of the release rate in the initial stage is one of the critical problems in the current research. Response data for all experimental runs of Box--Behnken experimental design were shown in [Table 3](#t0003){ref-type="table"}. The values of response Y~1~, Y~2~ and Y~3~ were separately in the range of 15.04 to 42.90, 98.96 to 62.18, and 0.0297 to 0.0823. The ratio of maximum to minimum for both the responses Y~1~, Y~2~ and Y~3~ were 2.85, 1.59 and 2.77, respectively. These results therefore implied that power transformation had low or no effect on the obtained values.
######
Observed responses for the Box--Behnken design..
Std/Run Independent variables Dependent variables
--------- ----------------------- --------------------- ----- ---- ------- ------- --------
9/7 0/−1/−1 4 1.8 6 38.26 97.06 0.0564
10/5 0/+1/−1 4 2.2 6 24.31 82.65 0.0458
11/3 0/−1/+1 4 1.8 14 33.45 94.78 0.0711
12/15 0/+1/+1 4 2.2 14 17.89 68.54 0.0688
5/4 −1/0/−1 2 2.0 6 37.12 98.04 0.0419
6/12 +1/0/−1 6 2.0 6 42.90 98.58 0.0520
7/16 −1/0/+1 2 2.0 14 29.78 89.04 0.0393
8/9 +1/0/+1 6 2.0 14 34.67 92.35 0.0816
1/17 −1/−1/0 2 1.8 10 35.24 96.87 0.0459
2/2 +1/−1/0 6 1.8 10 40.03 98.96 0.0774
3/1 −1/+1/0 2 2.2 10 15.04 62.18 0.0297
4/10 +1/+1/0 6 2.2 10 20.56 70.63 0.0806
14/6 0/0/0 4 2.0 10 19.48 85.74 0.0823
17/8 0/0/0 4 2.0 10 18.33 83.66 0.0659
16/11 0/0/0 4 2.0 10 19.09 84.79 0.0741
15/13 0/0/0 4 2.0 10 18.97 85.27 0.0692
13/14 0/0/0 4 2.0 10 19.20 82.23 0.0781
X~1~ is the factor of strength of the preparation, X~2~ is the factor of CS amount, X~3~ is the factor of GP content, Y~1~ is the response of cumulative release percentage of PYM in 1 day, Y~2~ is the response of cumulative release percentage PYM in 9 days, Y~3~ is the response of rate constant *k.*
Model fitting and analysis {#s0017}
--------------------------
All the response data observed from 17 formulations accorded with first order, two-factor interaction and quadratic models. Model selection for response analysis was carried out based on the sequential model sum of squares, lacking fit test and model summary statistics. The quadratic model was selected for all analyzing responses Y~1~, Y~2~ and Y~3~ for the reason that the Prob \> F value of *p* \< .0001, low standard deviation, high R-squared value and lower predicted residual error sum of square (PRESS) value. The fit summary for each response was listed in [Table 4](#t0004){ref-type="table"}. A difference less than 0.20 between the 'Pred R-squared' value for the responses and the 'Adj R-squared' value approved that the model predicted response values well.
######
Fit summary for responses Y~1~, Y~2~ and Y~3~.
Sum of squares df F-value *p* value (Prob \> F)
-------------------------------- ---------------- -------------------- --------------------- ----------------------- ----------- -------- --------- --------- -------- ---------- --------- ---------- ------ ------ ----------
Sequential sum of model square
Linear 733.52 1498.85 2.88E-03 3 3 3 16.71 10.39 7.27 \< .0001 .0009 .0041
2FI 0.78 48.65 3.71E-04 3 3 3 0.014 0.28 0.92 .9976 .8378 .4669
Quadratic 174.2 498.87 1.04E-03 3 3 3 26.72 14.94 8.09 .0003 .002 .0112
Cubic 14.49 69.95 1.27E-04 3 3 3 26.56 11.74 0.97 .0042 .0188 .4894
Residual 0.73 7.94 1.74E-04 4 4 4 -- -- -- -- -- --
Total 16435.04 1.39E + 05 0.071 17 17 17 -- -- -- -- -- --
Lack-of-fit
Linear 189.47 617.47 1.54E-03 9 9 9 115.78 34.55 3.93 .0002 .0019 .1002
2FI 188.68 568.82 1.17E-03 6 6 6 172.95 47.75 4.48 \< .0001 .0011 .0842
Quadratic 14.49 69.95 1.27E-04 3 3 3 26.56 11.74 0.97 .0042 .0188 .4894
Cubic 0 0 0 0 0 0 -- -- -- -- -- --
Pure Error 0.73 7.94 1.74E-04 4 4 4 -- -- -- -- -- --
R-squared Adjusted R-squared Predicted R-squared PRESS Std. Dev.
Y~1~ Y~2~ Y~3~ Y~1~ Y~2~ Y~3~ Y~1~ Y~2~ Y~3~ Y~1~ Y~2~ Y~3~ Y~1~ Y~2~ Y~3~
Model summary statistics
Linear 0.7941 0.7056 0.6265 0.7466 0.6376 0.5403 0.5772 0.4393 0.395 390.56 1191 2.78E-03 3.82 6.94 0.011
2FI 0.7949 0.7285 0.7072 0.6719 0.5656 0.5314 −0.0195 −0.1638 0.2306 941.73 2472.13 3.54E-03 4.35 7.59 0.012
Quadratic 0.9835 0.9633 0.9345 0.9624 0.9162 0.8502 0.7479 0.4673 0.4991 232.91 1131.57 2.30E-03 1.47 3.34 6.56E-03
Cubic 0.9992 0.9963 0.9621 0.9969 0.985 0.8482 -- -- -- -- -- -- 0.43 1.41 6.60E-03
Y~1~ is the response of cumulative release percentage of PYM in 1 day, Y~2~ is the response of cumulative release percentage of PYM in 9 days, Y~3~ is the response of rate constant *k*.
df: degree of freedom; PRESS: predicted residual error sum of squares; statistically significant terms are underlined (*p* value less than .05).
The analysis of variance (ANOVA) was used in determining the significance of the variable effects and their interactions. It validated the model obtained (quadratic model, *p* \< .05) for the responses of PYM-loaded liposomal CS/GP thermogels, at the same time, provided key factors affecting these responses. As is observed in [Table 5](#t0005){ref-type="table"}, the CS amount (X~2~) and GP content (X~3~) were considered significant for cumulative release of PYM in 9 days (Y~2~) and rate constant *k* (Y~3~), whereas the PYM concentration (X~1~) and GP content (X~3~) were identified significant for the cumulative release of PYM in 1 day (Y~1~), all of the PYM concentration (X~1~), CS amount (X~2~) and GP content (X~3~) were of significance. Details of ANOVA for response Y~1~, Y~2~ and Y~3~ were presented in [Table 5](#t0005){ref-type="table"}.
######
The analysis of variance for responses Y~1~, Y~2~ and Y~3~.
ANOVA Sum of squares df F-value *p*-value (Prob \> F)
------------- ---------------- --------- ---------- ----------------------- ---- ---- ---------- -------- ------- ---------- --------- -------
Model 908.5 2046.38 4.29E-03 9 9 9 46.45 20.43 11.09 \< .0001 .0003 .0022
X~1~ 50.85 22.41 2.27E-03 1 1 1 23.4 2.01 52.8 .0019 .1988 .0002
X~2~ 598.23 1343.43 8.39E-05 1 1 1 275.26 120.74 1.95 \<.0001 \<.0001 .2054
X~3~ 84.44 133.01 5.23E-04 1 1 1 38.85 11.95 12.16 .0004 .0106 .0102
X~1~X~2~ 0.13 10.11 9.41E-05 1 1 1 0.061 0.91 2.19 .8116 .3722 .1827
X~1~X~3~ 1.60E-03 3.55 2.59E-04 1 1 1 7.36E-04 0.32 6.03 .9791 .5897 .0438
X~2~X~3~ 0.65 34.99 1.72E-05 1 1 1 0.3 3.14 0.4 .602 .1195 .547
X~1~^2^ 39.7 10.66 5.26E-04 1 1 1 18.27 0.96 12.22 .0037 .3602 .0101
X~2~^2^ 80.3 471.89 7.96E-05 1 1 1 36.95 42.41 1.85 .0005 .0003 .216
X~3~^2^ 61.78 16.94 3.45E-04 1 1 1 28.43 1.52 8.01 .0011 .257 .0254
Residual 15.21 77.89 3.01E-04 7 7 7 -- -- -- -- -- --
Lack of Fit 14.49 69.95 1.27E-04 3 3 3 26.56 11.74 0.97 .0042 .0188 .4894
Pure Error 0.73 7.94 1.74E-04 4 4 4 -- -- -- -- -- --
Cor Total 923.72 2124.26 4.60E-03 16 16 16 -- -- -- -- -- --
X~1~ is the factor of PYM concentration, X~2~ is the factor of CS amount, X~3~ is the factor of GP content, Y~1~ is the response of cumulative release percentage of PYM in 1 day, Y~2~ is the response of cumulative release percentage of PYM in 9 days, Y~3~ is the response of rate constant *k*.
The resulted equations for responses Y~1~, Y~2~ and Y~3~ were stated below: $$\text{Y}_{\text{1}} = \text{29}.0\text{1} + \text{2}.\text{52X}_{\text{1}} - \text{8}.\text{65X}_{\text{2}} - \text{3}.\text{25X}_{\text{3}} + 0.\text{18X}_{\text{1}}\text{X}_{\text{2}} - 0.0\text{2X}_{\text{1}}\text{X}_{\text{3}} - 0.\text{4X}_{\text{2}}\text{X}_{\text{3}} + \text{3}.0\text{7X}_{\text{1}}{}^{\text{2}} - \text{4}.\text{37X}_{\text{2}}{}^{\text{2}} + \text{3}.\text{83X}_{\text{3}}{}^{\text{2}}$$$$\text{Y}_{\text{2}} = \text{94}.\text{34} + \text{1}.\text{67X}_{\text{1}} - \text{12}.\text{96X}_{\text{2}} - \text{4}.0\text{8X}_{\text{3}} + \text{1}.\text{59X}_{\text{1}}\text{X}_{\text{2}} + 0.\text{94X}_{\text{1}}\text{X}_{\text{3}} - \text{2}.\text{96X}_{\text{2}}\text{X}_{\text{3}} - \text{1}.\text{59X}_{\text{1}}{}^{\text{2}} - \text{1}0.\text{59X}_{\text{2}}{}^{\text{2}} + \text{2}.0\text{1X}_{\text{3}}{}^{\text{2}}$$$$\text{Y}_{\text{3}} = 0.0\text{74} + 0.0\text{17X}_{\text{1}} - 0.00\text{3237X}_{\text{2}} + 0.00\text{8}0\text{88X}_{\text{3}} + 0.00\text{485X}_{\text{1}}\text{X}_{\text{2}} + 0.00\text{8}0\text{5X}_{\text{1}}\text{X}_{\text{3}} + 0.00\text{2}0\text{75X}_{\text{2}}\text{X}_{\text{3}} - 0.0\text{11X}_{\text{1}}{}^{\text{2}} - 0.00\text{4347X}_{\text{2}}{}^{\text{2}} - 0.00\text{9}0\text{48X}_{\text{3}}{}^{\text{2}}$$
A plus sign represents a synergistic effect, conversely a minus sign shows an antagonistic effect. In case of Y~1~, positive coefficients of X~1~ in the model made reference to an increasing trend of PYM releasing in 1 day when the concentration of PYM increased. Likewise, the negative coefficients of X~2~ and X~3~ showed the decrease of PYM releasing in 1 day with increasing tendency of respective factors. In the matter of Y~2~, the negative coefficients of X~2~ and X~3~ in the model referred to that more PYM released in 9 days when the amounts of CS and GP decreased. Similarly, the positive coefficients of X~1~ suggested the enhanced release of PYM in 9 days with the increasing contents of respective factors. In case of Y~3~, positive coefficients of X~1~ and X~3~ displayed a promoting action of relevant factors on the rate constant k, and the minus sign of X~2~ illustrated that the rate constant k reduced as the amount of CS rose.
A noteworthy interaction effect of X~1~X~3~ could be observed for response Y~3~. This result might be attributed to the electro-static binding between ammonium groups of PYM liposome and phosphate groups of GP. The binding force closely associated with the gelification of the CS/GP *in situ* gel system has been speculated as: (a) the enhanced interchain hydrogen bonds of CS as a result of the decline of electro-static repulsive-force due to the neutralization reaction between GP and CS; (b) the electro-static pull reaction between ammonium groups of CS and phosphate groups of GP, and (c) the hydro-phobic reaction between intermolecular of CS (Fabiano et al., [@CIT0010]). The competition relationship of PYM liposome/GP electro-static attraction and CS/GP interaction may break the sol-gel change by the above hypothesis (a) and (b), which can lead to a boosted initial fractional release.
Evaluation of contour plots and response surface {#s0018}
------------------------------------------------
Perturbation graphs ([Figure 1](#F0001){ref-type="fig"}) were plotted to obtain the most influencing factors to responses. A steep curvature implies that a response is sensitive to a factor, whereas a relatively flat one means insensitive. In case of response Y~1~ ([Figure 1(a)](#F0001){ref-type="fig"}), factor B displayed a steep curvature, on the opposite, factor A and C both exhibited a slight slope. The result indicated that factor B was the most influential parameters of response. Whereas in case of response Y~2~ ([Figure 1(b)](#F0001){ref-type="fig"}) and Y~3~ ([Figure 1(c)](#F0001){ref-type="fig"}), factor B displayed steep curvatures compared with A and C in [Figure 1(b)](#F0001){ref-type="fig"}, and factor A exhibited steep curvatures comparing to factor B and C in [Figure 1(c)](#F0001){ref-type="fig"}. These results are consistent with the outcome from the ANOVA.
{#F0001}
A clear function of factors on responses was revealed in the two-dimension contour plots and three-dimension response surface plots ([Figure 2](#F0002){ref-type="fig"} and [Figure 3](#F0003){ref-type="fig"}), which were plotted based on the ANOVA and perturbation plot (Shaikh et al., [@CIT0022]). In all figures, we kept one factor at zero level. A nonlinear relationships of the all variables in the case of Y~1~, Y~2~ and Y~3~ was indicated in [Figure 2](#F0002){ref-type="fig"}, even more distinct in [Figure 3](#F0003){ref-type="fig"}. The relative high similarity of contour plots and response surface plots of response Y~2~ and Y~3~ indicated similar release mechanism, both responses were consistent with the prediction of the drug release behavior regardless of the initial release extent. Overall, there was a positive correlation between the increase of GP content and the raise of the initial PYM release and rate constant *k*, which further checked on the guess that the sol-gel change mechanism of the CS/GP *in situ* gel system was nucleation, growth and gelification finish. This reaction process occurred during the formation of microstructure of the CS/GP *in situ* gel with changes of the system temperature. In the nucleation process, the polymer system was constituted by numerous small parts that would grow and aggregate as the extension of reaction time, then leaded to a heterogeneous mixture of the thermogels. It was proved that a minimum concentration of GP was necessary for the gelification of CS/GP thermogels system. And then, electro-static pull reaction between ammonium of CS and phosphate of GP could lead to massive interchain hydrogen-bonding effects (Salis et al., [@CIT0021]).
{#F0002}
{#F0003}
Optimization of PYM liposomal thermogels {#s0019}
----------------------------------------
An optimal formulation was expected to obtain the minimum drug release in 1 day (Y~1~) and maximum drug release in 9 days (Y~2~), at same time maximized rate constant (Y~3~). All the formulation variables were investigated to establish a desirability function, further to forecast a desirable scope of variables which could constitute a optimal formulation. The objective function is as follow: $$\text{D~} = \ \left( {\text{d}_{\text{1}}\text{d}_{\text{2}}\text{d}_{\text{3}} \cdot \cdot \cdot \text{d}_{\text{n}}} \right)^{\text{1}/\text{n}}$$ where di is the desirable scope for respective response, n is the total number of responses in the experiment (Cong et al., [@CIT0008]). The desirable ranges for CS amount and GP content are from zero to one, respectively. The optimized ingredients were presented in [Table 5](#t0005){ref-type="table"}. In summary, an optimal formulation of PYM-loaded liposomal CS/GP thermogels for VM should be composed of PYM 4.68 mg/mL, CS 2.05% (w/v), and GP 11.57% (w/v), producing *in situ* gels with 17.24% PYM released in 1 day and 80.77% PYM released in 9 days, and rate constant of 0.0808. The drug release profile of PYM liposomes, PYM thermogels and PYM liposomal thermogels were determined in three parallel tests ([Figure 4](#F0004){ref-type="fig"}) for verifying the availability of the computed optimal factors and predicted responses. The result confirmed that the PYM liposomal thermogels was able to release PYM sustainedly up to 14 days without obvious burst release in the initial stage, which was much better than that of PYM liposomes or PYM thermogels. [Table 6](#t0006){ref-type="table"} revealed that the measured drug release values of the optimized formulation was highly close to the values of the predicted ones with low deviations, suggesting that the optimized formulation is reliable and reasonable.
{#F0004}
######
The predicted and experimental response values of the optimized formulations.
optimum conditions Level Measured responses Predicted values Experimental values Bias (%)
-------------------- ------- -------------------- ------------------ --------------------- ----------
X~1~ 4.68 Y~1~ 17.2411 16.9741 1.55
X~2~ 2.05 Y~2~ 80.7707 79.3259 1.79
X~3~ 11.57 Y~3~ 0.0808058 0.0800025 1.00
X~1~ is the factor of PYM concentration, X~2~ is the factor of CS amount, X~3~ is the factor of GP content, Y~1~ is the response of cumulative percentage PYM released in 1 day, Y~2~ is the response of cumulative percentage PYM released in 9 days, Y~3~ is the response of rate constant *k*.
Bias was calculated as (predicted value − observed value)/predicted value ×100%.
Morphological changes of EA.hy926 cells {#s0020}
---------------------------------------
[Figure 5](#F0005){ref-type="fig"} exhibited the morphological changes of EA.hy926 cells exposed to PYM liposomes, PYM liposomal thermogels and blank liposomal thermogels. Cells were stained with H&E and fluorescent dye, respectively. The cells in blank liposomal thermogels group grew well with high proliferation rate and arranged closely for 24 h, showing no obvious morphological changes compared with the control group. On the contrary, typical apoptosis morphological features including cell shrinkage and condensation and chromatin margination were widely observed in cells treated with PYM liposomes and PYM liposomal thermogels after 24 h, demonstrating obvious morphological changes compared to the control group.
{#F0005}
Cell cycle analysis and apoptosis assay {#s0021}
---------------------------------------
To further access the cytotoxicity of ingredients of liposomal thermogels, cell cycle analysis and apoptosis assay of EA.hy926 cells incubated with different preparations were carried out. As shown in [Table 7](#t0007){ref-type="table"} and [Figure 6](#F0006){ref-type="fig"}, blank liposomal thermogels group exhibited no differences with control in cell cycle and apoptosis assay, consistent with the result of morphological changes, which suggested that the ingredients selected for liposomal thermogels was cell-compatible and the cytotoxicity was caused by PYM and not by liposomal thermogels formulation components. Similarly, cell division G0/G1 stage proportion of PYM liposomes and PYM liposomal thermogels group slightly reduced, showing no significant statistical differences with the control group (*p* \> .05). However, there was an obvious decrease in the proportion of cell division S phase and a marked increase in the percentage of G2/M phase for PYM liposomes and PYM liposomal thermogels group, with significant statistical differences (*p* \< .05). The above results confirmed that PYM liposomes and PYM liposomal thermogels effectively inhibit the growth of EA.Hy926 by blocking the cell division in G2/M phase. As displayed in [Figure 6](#F0006){ref-type="fig"} and [Table 8](#t0008){ref-type="table"}, PYM liposomes and PYM liposomal thermogels had significant induction effect of apoptosis and necrosis, which obviously enhanced with the increase of PYM concentration and action time.
{#F0006}
######
Effects of PYM liposomes, PYM liposomal thermogels and blank liposomal thermogels on the cell cycle of EA.hy926 (*n* = 3,10 μg/mL,24 h).
G0/G1(%) S(%) G2/M(%)
---------------------------- ------------ ------------ ------------
Control 44.8 ± 0.7 43.5 ± 1.6 11.7 ± 0.6
Blank liposomal thermogels 46.5 ± 1.2 40.0 ± 1.0 13.5 ± 0.4
PYM liposomes 41.9 ± 0.6 17.1 ± 0.3 41.0 ± 1.1
PYM liposomal thermogels 42.3 ± 1.4 19.8 ± 0.6 37.9 ± 0.9
######
Apoptosis rate & Necrosis rate of EA.hy926 *in vitro* treated with blank liposomal thermogels, PYM liposomes and PYM liposomal thermogels (*n* = 3, 1 μg/mL & 10 μg/mL, 24 h & 48 h).
24 h 48 h
------------------------------------- ------------ ------------ ------------ ------------
Control 4.3 ± 0.2 2.2 ± 0.3 4.6 ± 0.3 2.5 ± 0.5
blank liposomal thermogels 4.5 ± 0.4 2.1 ± 0.5 4.5 ± 0.1 2.2 ± 0.4
PYM liposomes (1 μg/mL) 26.2 ± 1.0 4.7 ± 0.8 29.4 ± 1.3 13.6 ± 0.7
PYM liposomes (10 μg/mL) 30.8 ± 1.3 12.2 ± 0.9 32.3 ± 1.6 20.5 ± 0.7
PYM liposomal thermogels (1 μg/mL) 21.3 ± 0.6 8.4 ± 1.0 27.6 ± 1.4 15.4 ± 1.1
PYM liposomal thermogels (10 μg/mL) 29.5 ± 1.4 17.8 ± 1.2 33.9 ± 1.1 22.1 ± 1.2
Pharmacokinetics in rabbits {#s0022}
---------------------------
Plasma concentration-time profiles of PYM after injection of PYM liposomes, PYM thermogels and PYM lipsomal thermogels ([Figure 7](#F0007){ref-type="fig"}) clearly demonstrated that PYM liposomal thermogels had significant sustained-release characteristics compared with PYM thermogels and PYM liposomes. The main pharmacokinetic parameters of three groups are shown in [Table 9](#t0009){ref-type="table"}. The half-time (t~1/2~) of PYM liposomal thermogels was almost 2.4 times and 9.3 times longer than that of PYM thermogels and PYM liposomes, respectively. MRT of PYM liposomal thermogels was significantly prolonged (8.90 ± 2.25 h) compared to that of PYM thermogels (3.61 ± 0.34 h) and PYM lipsomes(1.08 ± 0.09 h). In addition, the decrease of *C*~max~ (from 37.08 ± 4.60 to 10.93 ± 2.19 μg·mL^−1^) and the delay in *t*~max~ (from 0.20 to 1.00 h) also indicated the liposomal thermogels had a better sustained delivery of PYM.
{#F0007}
######
Pharmacokinetic parameters of PYM liposomes, PYM thermogels and PYM liposomal thermogels.
Parameter Units PYM liposomal thermogels PYM thermogels PYM liposomes
----------- ------------ -------------------------- ---------------- ---------------
*C*~max~ μg·mL^−1^ 10.93 ± 2.19 16.81 ± 2.95 37.08 ± 4.60
*t*~1/2~ h 6.54 ± 1.75 2.69 ± 0.23 0.70 ± 0.11
AUC~0--t~ μg·L^−1^·h 70.44 ± 15.79 50.93 ± 11.82 51.60 ± 7.30
AUC~0--∞~ μg·L^−1^·h 91.36 ± 22.87 56.29 ± 17.24 63.22 ± 9.16
MRT~0--∞~ h 8.90 ± 2.25 3.61 ± 0.34 1.08 ± 0.09
Chemoembolization studies in rabbits {#s0023}
------------------------------------
[Figure 8](#F0008){ref-type="fig"} showed photomicrograph of crosscut tissues of rabbit's ear side veins stained by H&E after injection of normal saline solutions, blank liposomal thermogels, PYM liposomes and PYM liposomal thermogels. In the blank liposomal thermogels group, mild edema appeared after administration for 2 days. Whereas no obvious histological change was found after injection for 7 days, which confirmed that blank liposomal thermogels had considerable bio-compatibility for application in the injectable controlled drug release preparation. The result after treatment of PYM liposomes showed that vessel endothelial cells were swelling and diapedesis appeared obviously for the beginning 2 days. While, no other histological change of PYM liposomes group was discovered on the next 7--21 days, demonstrating that PYM liposomes had spread with blood flowing and local PYM concentration in the administration site decreased rapidly. In the PYM liposomal thermogels group, vessel embolism caused by PYM liposomal thermogels could be found obviously afer injection for the beginning 2 days. Vessel endothelial cells were exfoliated on the 7th day. After two weeks, the venous wall was thickened and the vessel lumen was narrowed. Obvious venous occlusion were discovered on the 21st day.
{#F0008}
It could be concluded that, compared with PYM liposomes, PYM liposomal thermogels displayed much better effect for therapy of VM. PYM-loaded liposomal thermogels showed multiple actions during the process of embolization after administration into auricular brim veins. At the beginning, vessel occlusion happened rapidly after the sol--gel change of the liposomal thermogels. And then, the hyperplasia of vessel endothelial cells formed along with the controlled and localized release of PYM from liposomal thermogels. The liposomal thermogels were degraded gradually by the lysozyme *in vivo* and then PYM was released sustainedly, which could make a local high level of PYM and increase the MRT of PYM and finally improve the curative effect.
Conclusions {#s0024}
===========
In the current study, an *in vitro* and *in vivo* evaluation of PYM-loaded liposomal CS/GP *in situ* thermogels was conducted for the treatment of VM. The liposomal CS/GP *in situ* thermogels for the controlled delivery of PYM were prepared and optimized by Box--Behnken experimental design. The optimal formulation was composed of PYM 4.68 mg/mL, CS 2.05% (w/v), and GP 11.57% (w/v), producing *in situ* gels with 17.24% and 80.77% PYM released in 1 day and 9 days, respectively, and rate constant of 0.0808. The induction effects of apoptosis and necrosis were both observed for PYM-loaded liposomal CS/GP *in situ* thermogels in inhibiting the growth of EA. hy926 cells. The rabbit *in vivo* pharmacokinetics and *in vivo* embolization study of PYM liposomal thermogels, compared with PYM thermogels and PYM liposomes, indicated that PYM liposomal thermogels could make sustained and localized drug release for a longer time, which reached the purpose of controlled drug delivery. Hence, it is believed that this study can facilitate the exploration of the interaction between drug and liposomal thermogels components, to offer an optimized PYM-loaded liposomal CS/GP thermogels for interventional embolization therapy of VM.
Disclosure statement {#s0025}
====================
The authors confirm that this article content has no conflicts of interest.
|
{
"pile_set_name": "OpenWebText2"
} | Does the Alt-Right stand with Wikileaks?
Donald Trump used to be Wikileaks’ biggest fan:
Trump seems to have changed his mind about Wikileaks. He recently gave an interview with AP:
AP: Jeff Sessions, your attorney general, is taking a tougher line suddenly on Julian Assange, saying that arresting him is a priority. You were supportive of what WikiLeaks was doing during the campaign with the release of the Clinton emails. Do you think that arresting Assange is a priority for the United States? TRUMP: When Wikileaks came out … never heard of Wikileaks, never heard of it. When Wikileaks came out, all I was just saying is, “Well, look at all this information here, this is pretty good stuff.” You know, they tried to hack the Republican, the RNC, but we had good defenses. They didn’t have defenses, which is pretty bad management. But we had good defenses, they tried to hack both of them. They weren’t able to get through to Republicans. No, I found it very interesting when I read this stuff and I said, “Wow.” It was just a figure of speech. I said, “Well, look at this. It’s good reading.” AP: But that didn’t mean that you supported what Assange is doing? TRUMP: No, I don’t support or unsupport. It was just information. They shouldn’t have allowed it to get out. If they had the proper defensive devices on their internet, you know, equipment, they wouldn’t even allow the FBI. How about this — they get hacked, and the FBI goes to see them, and they won’t let the FBI see their server. But do you understand, nobody ever writes it. Why wouldn’t (former Hillary Clinton campaign chairman John) Podesta and Hillary Clinton allow the FBI to see the server? They brought in another company that I hear is Ukrainian-based. AP: CrowdStrike? TRUMP: That’s what I heard. I heard it’s owned by a very rich Ukrainian, that’s what I heard. But they brought in another company to investigate the server. Why didn’t they allow the FBI in to investigate the server? I mean, there is so many things that nobody writes about. It’s incredible. AP: Can I just ask you, though — do you believe it is a priority for the United States, or it should be a priority, to arrest Julian Assange? TRUMP: I am not involved in that decision, but if Jeff Sessions wants to do it, it’s OK with me. I didn’t know about that decision, but if they want to do it, it’s OK with me.
Say what you will about Julian Assange. He’s not exactly Alt-Right by any stretch of the imagination. In many ways, he was the epitome of the rootless cosmopolitan, floating around from country to country, free-lancing and hacking (greyhat stuff) in his free time. He got very serious with his WikiLeaks project though and has undisputedly left his mark on history by releasing the information that he did when he did.
He’s a sort of information anarchist and while one can disagree with his views, no one can say that the man does not act on his principles. (For those interested in some of Assange’s ideas about freedom of information, Cypherpunks is a good primer.)
Julian Assange basically handed Trump the election on a silver platter with the release of the DNC hacks. You’d think the Don would be grateful. After all, Assange could have displayed typical Lefty hypocrisy and cowardice by sitting on the information. But no, he even went on King Jew’s show and called out the DNC on their corruption AND on Bill Maher’s hypocrisy:
Assange acts like a true neutral actor, unlike Edward Snowden who decided to lash out at Trump during the campaign in the hopes of getting off easy once Hillary won. It is probably because Assange actually practices what he preaches that he has never been claimed as a hero by the Left.
The Alt-Right is all about speaking hard uncompromising truth to power. In that sense, we have a lot in common with Julian Assange. We can respect someone who tells the truth, shorn of ideological bias, even at great personal cost. |
{
"pile_set_name": "OpenWebText2"
} | There will be no "spending sprees" in Wednesday's Budget, Chancellor Philip Hammond has warned.
Mr Hammond said any surplus cash would be used to ensure the UK had enough "gas in the tank" for the coming years.
He also acknowledged social care budgets were under particular pressure but said this was "not just about money".
Labour said the government was putting money aside to prepare for Brexit which should instead be spent on the NHS.
Speaking to the BBC's Andrew Marr Show after ruling out "huge spending sprees" in a Sunday Times article ahead of his first Budget, Mr Hammond said:
Better than expected economic figures did not represent "money in a pot" due to the UK's "huge" borrowing levels
A reported £60bn Brexit bill was "a piece of negotiating strategy" from Brussels but that the UK "abides by its international obligations"
The UK will "fight back" and not "slink off like a wounded animal" if a Brexit deal cannot be reached
He had "no intention" of publishing his tax return, criticising "demonstration politics"
The government has been under pressure to provide more money for the NHS and social care.
On Saturday tens of thousands of people marched in London to protest against "yet more austerity" in the health service.
Mr Hammond said the economy was "performing extremely well" but that spending reductions were putting pressure on services.
This was particularly the case with adult social care, he said, but added that some councils were performing "extremely well" while others were struggling.
The chancellor did say there was a case for taking a long-term, strategic view on how the costs of an ageing population can be met, but said that in the short term: "This is about good practice as well as budgets."
Writing in the Sunday Times, he said that calls for "massive borrowing to fund huge spending sprees" were "reckless, unsustainable and unfair on our young people who would be left to deal with the consequences".
Public sector net debt - not including public sector banks - was £1.68tn at the end of January 2017, equivalent to 85.3% of GDP, according to the Office for National Statistics.
It has increased by £91.7bn since January 2016, the ONS said.
Mr Hammond last year abandoned the timetable of his predecessor, George Osborne, to eliminate the deficit by 2020, instead pledging to invest in homes and transport.
Also on the Marr show was Labour shadow chancellor John McDonnell, who said the National Living Wage should be increased to give workers a "pay rise".
He said this, along with reversing changes to disability benefits and a cash injection for the NHS, could be funded by reversing £70bn in corporation, capital gains and inheritance tax cuts.
He also said Labour wanted to abolish university tuition fees and was looking at how this could be afforded.
Meanwhile Rebecca Long-Bailey, the shadow business secretary, suggested people might support paying more tax to support the NHS.
"People are so proud of their NHS and social care system that I don't think many people would argue with paying an extra pound or however much to ensure we actually have an NHS," she told Pienaar's Politics on BBC Radio Five live.
Wednesday's Budget takes place after the Bank of England revised up its growth forecast for this year.
Paul Johnson, director of the Institute for Fiscal Studies think tank, predicted the Office for Budget Responsibility would also revise its 2017 forecast upwards.
He said that with "an awful lot of uncertainty" in the years ahead, Mr Hammond was trying to create "headroom" to avoid extra spending cuts and tax rises to cope with any problems that arise.
He added: "However good the numbers look in a couple of days' time, we are still going to be borrowing at least £20bn more by 2020 than we were forecasting a year ago." |
{
"pile_set_name": "Pile-CC"
} | First On-Chip Nanoscale Optical Quantum Memory Developed
Smallest-yet optical quantum memory device is a storage medium for optical quantum networks with the potential to be scaled up for commercial use
For the first time, an international team led by engineers at Caltech has developed a computer chip with nanoscale optical quantum memory.
Quantum memory stores information in a similar fashion to the way traditional computer memory does, but on individual quantum particles—in this case, photons of light. This allows it to take advantage of the peculiar features of quantum mechanics (such as superposition, in which a quantum element can exist in two distinct states simultaneously) to store data more efficiently and securely.
"Such a device is an essential component for the future development of optical quantum networks that could be used to transmit quantum information," says Andrei Faraon (BS '04), assistant professor of applied physics and materials science in the Division of Engineering and Applied Science at Caltech, and the corresponding author of a paper describing the new chip.
The study appeared online ahead of publication by Science magazine on August 31.
"This technology not only leads to extreme miniaturization of quantum memory devices, it also enables better control of the interactions between individual photons and atoms," says Tian Zhong, lead author of the study and a Caltech postdoctoral scholar. Zhong is also an acting assistant professor of molecular engineering at the University of Chicago, where he will set up a laboratory to develop quantum photonic technologies in March 2018.
The use of individual photons to store and transmit data has long been a goal of engineers and physicists because of their potential to carry information reliably and securely. Because photons lack charge and mass, they can be transmitted across a fiber optic network with minimal interactions with other particles.
The new quantum memory chip is analogous to a traditional memory chip in a computer. Both store information in a binary code. With traditional memory, information is stored by flipping billions of tiny electronic switches either on or off, representing either a 1 or a 0. That 1 or 0 is known as a bit. By contrast, quantum memory stores information via the quantum properties of individual elementary particles (in this case, a light particle). A fundamental characteristic of those quantum properties—which include polarization and orbital angular momentum—is that they can exist in multiple states at the same time. This means that a quantum bit (known as a qubit) can represent a 1 and a 0 at the same time.
To store photons, Faraon's team created memory modules using optical cavities made from crystals doped with rare-earth ions. Each memory module is like a miniature racetrack, measuring just 700 nanometers wide by 15 microns long—on the scale of a red blood cell. Each module was cooled to about 0.5 Kelvin—just above Absolute Zero (0 Kelvin, or -273.15 Celsius)—and then a heavily filtered laser pumped single photons into the modules. Each photon was absorbed efficiently by the rare-earth ions with the help of the cavity.
The photons were released 75 nanoseconds later, and checked to see whether they had faithfully retained the information recorded on them. Ninety-seven percent of the time, they had, Faraon says.
Next, the team plans to extend the time that the memory can store information, as well as its efficiency. To create a viable quantum network that sends information over hundreds of kilometers, the memory will need to accurately store data for at least one millisecond. The team also plans to work on ways to integrate the quantum memory into more complex circuits, taking the first steps toward deploying this technology in quantum networks.
The study is titled "Nanophotonic rare-earth quantum memory with optically controlled retrieval." Other Caltech coauthors include postdoctoral researcher John G. Bartholomew; graduate students Jonathan M. Kindem (MS '17), Jake Rochman, and Ioana Craiciu (MS '17); and former graduate student Evan Miyazono (MS '15, PhD '17). Additional authors are from the University of Verona in Italy; the University of Parma in Italy; the National Institute of Standards and Technology in Colorado; and the Jet Propulsion Laboratory, which is managed for NASA by Caltech. This research was funded by the National Science Foundation, the Air Force Office of Scientific Research, and the Defense Advanced Research Projects Agency. |
{
"pile_set_name": "Wikipedia (en)"
} | Letter to the editor
A letter to the editor (sometimes abbreviated LTTE or LTE) is a letter sent to a publication about issues of concern from its readers. Usually, letters are intended for publication. In many publications, letters to the editor may be sent either through conventional mail or electronic mail.
Letters to the editor are most frequently associated with newspapers and newsmagazines. However, they are sometimes published in other periodicals (such as entertainment and technical magazines), and radio and television stations. In the latter instance, letters are sometimes read on the air (usually, on a news broadcast or on talk radio). In that presentation form, it can also be described as viewer mail or listener mail, depending on the medium.
In academic publishing, letters to the editor of an academic journal are usually open postpublication reviews of a paper, often critical of some aspect of the original paper. The authors of the original paper sometimes respond to these with a letter of their own. Controversial papers in mainstream journals often attract numerous letters to the editor. Good citation indexing services list the original papers together with all replies. Depending on the length of the letter and the journal's style, other types of headings may be used, such as peer commentary. There are some variations on this practice. Some journals request open commentaries as a matter of course, which are published together with the original paper, and any authors' reply, in a process called open peer commentary. The introduction of the "epub ahead of print" practice in many journals now allows unsolicited letters to the editor (and authors' reply) to appear in the same print issue of the journal, as long as they are sent in the interval between the electronic publication of the original paper and its appearance in print.
Subject matter
The subject matter of letters to the editor vary widely. However, the most common topics include:
Supporting or opposing a stance taken by the publication in its editorial, or responding to another writer's letter to the editor.
Commenting on a current issue being debated by a governing body – local, regional or national depending on the publication's circulation. Often, the writer will urge elected officials to make their decision based on his/her viewpoint.
Remarking on materials (such as a news story) that have appeared in a previous edition. Such letters may either be critical or praising.
Correcting a perceived error or misrepresentation.
History
LTEs always have been a feature of American newspapers. Much of the earliest news reports and commentaries published by early-American newspapers were delivered in the form of letters, and by the mid-18th century, LTEs were a dominant carrier of political and social discourse. Many influential essays about the role of government in matters such as personal freedoms and economic development took the form of letters — consider Cato's Letters or Letters from a Farmer in Pennsylvania, which were widely reprinted in early American newspapers. Through the 19th century, LTEs were increasingly centralized near the editorials of newspapers, so that by the turn of the 20th century LTEs had become permanent fixtures of the opinion pages.
Modern LTE forums differ little from those earlier counterparts. A typical forum will include a half-dozen to a dozen letters (or excerpts from letters). The letters chosen for publication usually are only a sample of the total letters submitted, with larger-circulation publications running a much smaller percentage of submissions and small-circulation publications running nearly all of the relatively few letters they receive. Editors generally read all submissions, but in general most will automatically reject letters that include profanity, libelous statements, personal attacks against individuals or specific organizations, that are unreasonably long (most publications suggest length limits ranging from 200 to 500 words) or that are submitted anonymously.
The latter criterion is a fairly recent development in LTE management. Prior to the Cold War paranoia of the mid-20th century, anonymous LTEs were common; in fact, the right to write anonymously was central to the free-press/free-speech movement (as in the 1735 trial against John Peter Zenger, which started with an anonymous essay). By the 1970s, editors had developed strong negative attitudes toward anonymous letters, and by the end of the 20th century, about 94 percent of newspapers automatically rejected anonymous LTEs. Some newspapers in the 1980s and '90s created special anonymous opinion forums that allowed people to either record short verbal opinions via telephone (which were then transcribed and published) or send letters that were either unsigned or where the author used a pseudonym. Although many journalists derided the anonymous call-in forums as unethical (for instance, someone could make an unfounded opinion without worry of the consequences or having to back the comment up with hard facts), defenders argued that such forums upheld the free-press tradition of vigorous, uninhibited debate similar to that found in earlier newspapers.
Although primarily considered a function of print publications, LTEs also are present in electronic media. In broadcast journalism, LTEs have always been a semi-regular feature of 60 Minutes and the news programs of National Public Radio. LTE's also are widespread on the Internet in various forms.
By the early 21st century, the Internet had become a delivery system for many LTEs via e-mail and news Web sites (in fact, after several envelopes containing a powder suspected to be anthrax were mailed to lawmakers and journalists, several news organizations announced they would only accept e-mail LTEs). Because the Internet broadly expanded the potential readership of editorials and opinion columns at small newspapers, their controversial editorials or columns could sometimes attract much more e-mail than they were used to handling — so much so that a few newspapers had their e-mail servers crash.
Editors are a frequent target of letter-writing campaigns, also called “astroturfing,” or “fake grass-roots” operations where sample letters are distributed on the Internet or otherwise, to be copied or rewritten and submitted as personal letters.
Although LTE management gets little attention in trade journals, one organization, the National Conference of Editorial Writers, often includes essays on LTE management in its newsletter, The Masthead, and at its annual meetings. Among the NCEW's strongest champions for LTEs was Ronald D. Clark of the St. Paul Pioneer Press, who wrote, "Consider letters as a barometer of how well (you are) engaging readers or viewers. The more you receive, the more you're connecting. The fewer you receive, the stronger the sign that you're putting the masses to sleep."
On the other hand many editors will allow the publication of anonymous letters where the details of name and address of the author are not printed, but are disclosed to the editor. This can promote a debate of issues that are personal, contentious or embarrassing, yet are of importance to raise in a public debate.
Sometimes a letter to the editor in a local newspaper, such as the Dear IRS letter written by Ed Barnett to the Wichita Falls Times Record News in Wichita Falls, Texas, will end up receiving attention from the national media.
Misrepresentation
Submitting a letter under a false name to shill in support or to criticize an opponent can have significant consequences. For example, Canadian politician Paul Reitsma's career ended in scandal in 1999, after he signed letters addressed to newspapers as "Warren Betanko" praising himself and attacking his political opponents. His local paper wrote a front-page story under the headline of "MLA Reitsma is a liar and we can prove it."
In 1966 Israel, the Herut Party of then opposition leader Menachem Begin was shaken by scandal when letters sharply attacking Begin, which had been published in major dailies, were proven to have been authored by Begin's rivals for the party leadership and sent to the papers under various aliases and false names. As a result, the rivals were discredited and eventually expelled from the party, which helped buttress Begin's leadership position up to win the 1977 general elections and become Prime Minister of Israel.
See also
Open letter
Comic book letter column
Disgusted of Tunbridge Wells
References
External links
Man of Letters by Andrew Ferguson (Wall Street Journal)
Category:Freedom of expression
editor, Letter to the
Category:Newspaper content
Category:Public opinion |
{
"pile_set_name": "StackExchange"
} | Q:
Next Nearest Number Divisible By X
What I want to do essentially, is take any number a user has input, and round it to the next closest whole number divisible by X, excluding 1.
IE (X = 300):
Input = 1 Output = 300
Input = 500 Output = 600
Input = 841 Output = 900
Input = 305 Output = 300
A:
Just (integer) divide by X, add one, then multiply by X.
int output = ((input / x) + 1) * x;
A:
Based on your example behaviour I would do something like this:
double GetNearestWholeMultiple(double input, double X)
{
var output = Math.Round(input/X);
if (output == 0 && input > 0) output += 1;
output *= X;
return output;
}
|
{
"pile_set_name": "PubMed Central"
} | 
Introduction
============
The conservation of molecular machinery across eukaryotes underlies the power of using model organisms for research. Many of these model systems facilitate the use of reverse-genetic approaches such as targeted gene knockouts to characterize the contribution of a gene product to a biological or disease process of interest. Gene disruption techniques in organisms such as zebrafish have historically relied on targeted introduction of frameshift mutations that result from imprecise repair of DSBs[@B0][@B1]. When a DSB is introduced into the genome, the DNA lesion is repaired through one of two pathways that are universally present in nearly all cell types and organisms: non-homologous end joining (NHEJ) and homology-directed repair (HDR)[@B2][@B3]. The imprecise nature of the NHEJ machinery frequently produces indels of various lengths[@B4][@B5][@B6][@B7][@B8]. Introduction of frameshift mutations in the coding sequence of a gene can produce a premature stop codon, which often renders the gene nonfunctional.
Early genome engineering strategies in zebrafish to promote indels included meganucleases, zinc-finger nucleases, and transcription activator-like effector nucleases, all of which utilized DNA-protein interactions to target a nuclease to a specific genomic target where it introduced a DSB[@B9][@B10][@B11][@B12][@B13][@B14]. However, these technologies are often difficult to apply due to the laborious and complex engineering needed to generate a nuclease that targets the DNA sequence of interest. Unlike previous strategies, CRISPR-based gene editing does not rely on protein-DNA interactions for targeting. Instead, the CRISPR-associated (Cas) endonuclease is directed via an RNA guide that uses nucleotide base pairing interactions to target a genomic site of interest[@B15][@B16][@B17][@B18][@B19][@B20]. Due to the simplicity of designing a RNA guide with the desired base pairing interactions for targeting it is relatively easy to target the Cas endonuclease to the desired locus. The type II CRISPR system in particular has been widely developed for genome editing applications due to several advantageous features including use of a single multidomain Cas nuclease (Cas9) that requires interaction with DNA to stimulate endonuclease activity and use of a single guide RNA (sgRNA) to target it to the cognate DNA sequence[@B17]. The sequence requirements necessary for targeting of the cognate sgRNA are well understood[@B18], and the desired sgRNA is easily generated by*in vitro*transcription. The simplicity and robustness of the CRISPR/Cas9 approach greatly facilitates targeted genetic modification in zebrafish and a wide variety of other organisms.
The enhanced ability to undertake targeted genome editing in zebrafish as a result of developing CRISPR-based reagents has significantly increased the opportunity to study processes emblematic of vertebrate organisms such as development of the central nervous system. The zebrafish genome contains orthologs of 70% of the protein-coding genes found in the human genome as well as 84% of genes associated with diseases in humans[@B21]. Zebrafish development exhibits several key qualities that enhance its use in reverse genetic studies: the embryos are laid in large clutches, develop externally from the mother making them amenable to genetic manipulation by microinjection, and adult zebrafish sexually mature by 3 months of age, allowing for rapid propagation of desired lines[@B22].
Numerous protocols are available that describe a variety of approaches to generate and identify CRISPR-derived indels in zebrafish[@B23][@B24][@B25][@B26][@B27][@B28][@B29][@B30]. However, many of these procedures are time intensive, require access to expensive equipment, and can be challenging for labs with limited expertise. The steps described herein provide a simple, robust, and economical CRISPR/Cas9-strategy to engineer zebrafish knockout lines. This protocol describes the use of a highly efficient kit to synthesize sgRNAs using DNA oligonucleotides (oligos), similar to other approaches that have been previously described[@B31]. The described protocol includes two steps in particular that greatly simplify analysis of CRISPR-mutated lines: step-by-step use of the PCR-based HMA[@B32] to easily determine the presence of genome modifications, and sequencing analysis of heterozygous zebrafish to rapidly and easily determine the nature of multiple indels in an economical fashion. In addition, step-by-step instructions are included for robust selection, reliable production, and injection of guide RNAs. The steps provided here exemplify a robust, relatively inexpensive protocol that enables laboratory personnel with a range of expertise to contribute to the identification of gene knockouts in zebrafish.
Protocol
========
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Purdue Animal Care and Use Committee (PACUC number 08-031-11).
1. Design of Template-specific Oligos for Guide RNA Production
--------------------------------------------------------------
1. Select the target region of interest to be modified in the coding region of the gene. This should be close to the 5\' end of the gene to generate a truncated protein, but not so close such that a subsequent in-frame start codon enables production of a protein with a modest N-terminal truncation. NOTE: One way to preclude this possibility is to scan the downstream coding region of the gene for an in frame start codon. In addition, using a guide RNA that targets the middle of a large exon, can help to identify PCR primers for subsequent scoring of the resulting indel.
2. Identify potential guide sites in the genomic region of interest using a guide RNA selection program (see **Table of Materials**)[@B33][@B34][@B35]. Set the browser data to *Danio rerio*and the protospacer adjacent motif (PAM) sequence to 5\'- NGG -3\'. NOTE: Ideal gRNA sequences contain a 5′-G in the first position of the gRNA for efficient T7 *in vitro* transcription. If no acceptable guide is found with a G at the 5′ position, the 5′ base of another guide can be altered to a G or a G can be added onto the 5′ end of the guide RNA, but this may reduce cutting efficiency[@B36]. To maximize the cutting efficiency, an optimal guide sequence has 40-80% GC content (higher is better), and contains a G at the 20^th^ position, adjacent to the PAM, but is not required[@B37]. An example of an ideal targeting sequence: 5′- G (N)~18~G -3′ -NGG (NGG is the PAM). In addition to examining the results from the guide RNA selection program to identify optimal guide RNAs as described above, care should be taken to avoid guide RNAs with predicted strong off-target effects which greatly complicate downstream analysis. In particular, guide RNAs with predicted off-target effects that fall within coding regions should be excluded, and the total off-target sites predicted should be minimized.
3. From the output of the guide RNA design tool, exclude the PAM sequence (5′- NGG -3′); it is not used for targeting but comprises the recognition sequence for Cas9 cleavage.
4. To the remaining 20 nucleotides (nts), add the T7 promoter sequence and the overlap sequence (region complementary to a scaffold oligo used to synthesize full length sgRNAs supplied in the recommended *in vitro*transcription kit) in the order indicated below to obtain a 54 nt oligo: T7 promoter sequence: 5′- TTCTAATACGACTCACTATA -3′; Guide RNA sequence 5′- G (N)~18~G -3′; Overlap sequence: 5′- GTTTTAGAGCTAGA -3′
5. Identify PCR primers that flank the predicted cut site (Cas9 cleaves 3 nt upstream of the PAM sequence) at a distance of 50--150 base pairs (bp) each from the cut using web-based software (see **Table of Materials**). NOTE: These will be used in a later step for measurement of cutting efficiency. If no suitable primers are identified using these constraints, another guide RNA site may need to be considered.
6. Order 54 nt oligonucleotides to produce the guide RNA and PCR primers for analysis of the target sites (see **Table of Materials**). NOTE: As an optional positive control, it may be helpful to produce a sgRNA targeting a gene necessary for production of pigment to verify the performance of this protocol using an easily scored visual phenotype (see [Figure 1](#F1){ref-type="fig"} for representative results). A common target is the gene *tyrosinase*, using the oligo (guide RNA sequence is underlined)[@B38]: 5′- TTCTAATACGACTCACTATA[GGACTGGAGGACTTCTGGGG]{.ul}GTTTTAGAGCTAGA -3′
2. Preparation of CRISPR-reagents for Embryo Microinjection
-----------------------------------------------------------
1. **Order commercially available Cas9 protein (see Table of Materials).** NOTE: Injection of Cas9 mRNA can also be used to generate indels in zebrafish[@B39][@B40], however zebrafish embryo microinjection with Cas9 protein has been shown to be more efficient[@B31][@B41]. Suspend the Cas9 protein in the supplied buffer to generate a 1 mg/mL solution. Store the solution in injection-ready aliquots in PCR tubes at -80 °C to minimize the number of freeze-thaw cycles. To generate a 5 µL injection solution, 2 µL of 1 mg/mL Cas9 solution is used, therefore the Cas9 can be aliquoted in 2 µL aliquots using PCR strip-tubes.
2. Synthesize the sgRNA using the sgRNA *in vitro* transcription kit (see **Table of Materials**). Perform the *in vitro*transcription as per the manufacturer\'s instructions. NOTE: Maintain RNase-free technique during all synthesis, clean-up, and injection solution preparation steps. For example, use disposable gloves and change them frequently, use tubes and tips that are certified RNase-free, and clean surfaces and pipettes with commercially available solutions to decontaminate labware (see **Table of Materials**).
3. **Purify the synthesized sgRNA using an ammonium/acetate precipitation using RNase-free technique.** NOTE: Alternatively, sgRNAs can be purified using a variety of commercially available column-based RNA clean up kits for a relatively modest cost. Add 25 µL of 5 M ammonium acetate and vortex to mix thoroughly. NOTE: Ammonium acetate solution is commercially available (see **Table of Materials**), or a 5 M solution can be made in house by adding 385.4 mg of molecular grade ammonium acetate to 1 mL of RNase-free water and stored at -20 °C.Add 150 µL of 200-proof nuclease-free ethanol to each sample. Place the reaction in a -80 °C freezer for a minimum of 20 min. NOTE: The samples can be stored overnight at -80 °C, but will not significantly increase the total RNA yield.Centrifuge the samples at maximum speed (\>16,000 x g) in a 4 °C microcentrifuge for 20 min.Remove the supernatant carefully by slowly pipetting off the liquid, ensuring the RNA pellet is not disturbed.Add 1 mL of 70% ethanol (created by diluting nuclease-free ethanol in RNase-free water) and gently mix the tube by inverting it several times to wash residual salt from the tube.Repeat the centrifugation step for 7 min.Remove the supernatant by first pipetting off most of the solution using a P1000 pipette, then use a P200 pipette to remove as much solution as possible without perturbing the pellet. Dry the RNA pellet in a clean space, such as a laminar flow hood or a bench top, being careful to avoid RNase contamination, for 15 min or until no more liquid drops are visible in the tube.Resuspend the pellet in 30 µL of RNase-free water, quantify the product (for example using a spectrophotometer), and aliquot the solution for long-term storage in a -80 °C freezer. NOTE: Typical concentrations range from 800--2,500 ng/µL.
4. **(OPTIONAL) Verify that full-length RNA has been generated using urea/PAGE. Alternatively, use an agarose gel to verify that the RNA is intact.** NOTE: However, if using an agarose gel a larger amount of gRNA must be run to visualize the RNA, and the length cannot be accurately determined. When analyzing the efficiency of target cutting after injection of the reagents into the fish, if there is no or little cutting present then the sgRNA should be checked for degradation. Cast an 8% polyacrylamide gel in TBE with 40% polyacrylamide (19:1) and 8 M urea using RNAse-free technique for the solutions and equipment[@B42]. NOTE: Commercially available materials can be used to clean equipment (see **Table of Materials**).After the gel has completely solidified (approximately 30 min), equilibrate the gel by placing it in TBE running buffer and performing electrophoresis for 30 min at 5 V/cm.Mix 300--500 ng of sgRNA with an equal volume of 2x RNA gel loading dye (see **Table of Materials**). Using a P1000, clear the wells of any debris by pipetting running buffer in each well several times. Load the solution(s) and run the gel at 10 V/cm for 2.5 h. NOTE: A marker lane here is useful to visualize the length of the RNA but is not required; generally it is readily apparent if full length RNA has been synthesized ([Figure 2](#F2){ref-type="fig"}).Visualize the bands using a nucleic acid stain (see **Table of Materials**). NOTE: sgRNA bands should appear as a single band, whereas smearing indicates RNA degradation ([Figure 2](#F2){ref-type="fig"}).
3. Microinjection of CRISPR-components into Zebrafish Embryos
-------------------------------------------------------------
1. Set up breeding tanks the night prior to injecting by placing the number of desired males and females (typically 2 females and 1 or 2 males) in a breeding tank with a divider in place[@B43].
2. Prepare a microinjection plate with 1.5% agarose in 1x E3 media (see **Table of Materials**) with 0.01% methylene blue (a fungicide) by pouring 35 mL of the melted agarose into a 10 cm Petri dish and gently lay a plastic mold to create wedge-shaped troughs into the solution, tapping the mold to eliminate air bubbles.
3. Allow the agarose to set, and store the dish with a small amount of media and wrapped in paraffin film to prevent the plate from drying out at 4 °C. NOTE: Injection plates are reusable for several weeks, until the wells become deformed or dry, or the plate begins to grow mold.
4. On the morning of injecting, thaw purified sgRNA and Cas9 protein on ice. Remember to handle all materials with gloves to prevent RNase contamination and to use RNase-free tips and tubes.
5. Generate a 5 µL injection solution by combining Cas9 protein and the sgRNA in a 2:1 ratio of Cas9:sgRNA to obtain final concentrations of 400 pg/nL Cas9 protein and 200 pg/nL sgRNA. Incubate the Cas9/sgRNA solution at room temperature for 5 min to allow the Cas9 and sgRNA to form a ribonucleoprotein complex. Add 0.5 µL of 2.5% wt/vol phenol red solution (see **Table of Materials**), and RNase-free water to a final volume of 5 µL. NOTE: The ionic strength of the solution has been shown to affect the solubility of the Cas9/sgRNA complex, therefore the addition of KCl may increase the cutting efficiency of sgRNAs that exhibit low indel formation[@B27].
6. Make an injection needle by pulling a 1.0 mm glass capillary using a micropipette puller. Cut the tip of the freshly-made needle using a new razor blade or forceps to obtain an angled opening that will easily pierce the chorion and yolk sac.
7. Place the needle in a micromanipulator attached to a microinjector with the air source turned on. Under a light microscope using the magnification suitable for the calibration determined for the particular apparatus, adjust the injection pressure until the needle consistently ejects a 1 nL solution into a Petri dish filled with mineral oil. NOTE: The quality of the needle is critical. Practice producing a needle and injecting into the yolk sac of embryos until this is skill is mastered before attempting further experiments[@B44].
8. Remove the divider and allow the fish to breed for approximately 15 min. NOTE: Longer breeding times will produce more embryos, however the injection should be completed while the embryos are at the 1-cell stage to maximize the chance that Cas9 cutting will occur early and therefore decrease genetic mosaicism. Embryos can be injected at later stages (2--4 cell stages), but this may possibly decrease the germline transmission rate of the modified allele.
9. Collect the eggs using a strainer and rinse them into a 10 cm Petri dish using 1x E3 media with 0.0001% methylene blue. Examine the health of the eggs under the light microscope, removing any unfertilized eggs and debris.
10. Set aside 10--15 embryos as an uninjected control in a separate, labeled Petri dish.
11. Using a transfer pipette, gently line up the eggs on the injection plate warmed to room temperature.
12. Under a dissection microscope at 2.5X magnification, inject 1 nL of the solution into the yolk sac of each embryo to inject a total of 400 pg of Cas9 protein and 200 pg of sgRNA. NOTE: To increase cutting if desired or necessary, increase the final concentration of Cas9 protein to 800 pg/nL and of sgRNA to 400 pg/nL in the injection solution; however, this may also increase off-target cutting and/or decrease embryo health. Cutting efficiency may also be increased by injecting directly into the cell[@B45]. However, injection into the yolk sack is technically less demanding and gives sufficient cutting to produce fish with high germline transmission (\>70% of offspring containing a modified allele).
13. Return the injected embryos to a properly labeled Petri dish, cover them with 1x E3 media with methylene blue, and put them in an embryo incubator set to 28 °C.
14. At 24 h post fertilization (hpf), inspect the health of the injected embryos, removing dead or abnormally developing individuals and change the media (See [Figure 3](#F3){ref-type="fig"}). Check the rate of survival against the uninjected control. NOTE: When targeting a nonessential gene, less than 10% lethality is expected relative to the uninjected control. If elevated levels of lethality are observed in the guide-injected populations compared to the uninjected control, it may indicate that the targeted gene is essential for development, or off-target effects are leading to failed development. Reducing the amount of injected CRISPR-reagents may be necessary or generation of a new sgRNA with reduced off-target effects may be required.
15. Return the embryos to the incubator and continue growing the embryos to 72 hpf, changing the media daily to maintain embryo health.
4. Analysis of Efficiency of Indel Formation Using an HMA
---------------------------------------------------------
1. Collect two sets of five embryos from the injected plates grown to 72 hpf into microcentrifuge tubes and collect one set of five embryos from an uninjected control.
2. Anesthetize the embryos by adding 0.004% MS-222 (tricaine) and wait 2 min.
3. To extract the gDNA, gently pipette the media off each embryo set and add 45 µL of 50 mM NaOH. Incubate the embryos at 95 °C for 10 min.
4. Remove embryos from the heat source and cool to room temperature. Add 5 µL of 1 M Tris-HCl pH = 8, and vortex the samples vigorously (5--10 s). Centrifuge the solution at max speed (\>16,000 x g) in a room temperature microcentrifuge for 3 min. Transfer the supernatant to a clean, labeled tube and store the gDNA at -20 °C DNA for up to 6 months. NOTE: DNA fragments of approximately 900 bp and smaller will be generated through use of this protocol.
5. Set up a 50 µL PCR reaction using 2 µL of the prepared gDNA from each sample (including an uninjected control) per the instructions included with the polymerase, using the previously designed primers flanking the predicted cut site.
6. Purify the PCR products using a PCR clean up kit (see **Table of Materials**), elute the samples in 30 µL of water or elution buffer and quantify the DNA using a spectrophotometer.
7. Reanneal all 30 µL of each purified PCR product by placing the tubes in a floatable rack in a boiling water bath (approximately 150 mL in a 500 mL beaker). After 3 min, turn off the heat source and allow the solutions to cool to room temperature, about 1 h. NOTE: This step first denatures the DNA and then allows the strands to reanneal randomly to generate possible heteroduplex bands, or mismatched double-strand DNA that contains polymorphisms created by CRISPR-mutagenesis and therefore have an altered electrophoretic mobility compared to homoduplexes. The last cycle of PCR or ramp-down program in the thermocycler can also be used to reanneal products[@B46][@B47], but use of the boiling bath may yield improved resolution of heteroduplex products.
8. Add 5 µL of 6x loading dye (see **Table of Materials**) to the reannealed PCR solutions.
9. Cast a 15% polyacrylamide/TBE gel using 30% polyacrylamide (29:1). After the gel has set, place it into an electrophoresis apparatus with TBE running buffer. Using a P1000, clear the wells of any debris such as residual salts or gel fragments that can obstruct the wells by gently pipetting buffer up and down into the wells several times.
10. Load 500 ng of the reannealed PCR products, and load a control (sample from uninjected fish) next to each set of sgRNA samples. Run the gel at 150 V for 2.5 h or until the dye front is at the bottom of the gel.
11. Visualize the bands using a nucleic acid stain (*e.g.*, ethidium bromide or SYBR green (see **Table of Materials**)).
12. Examine the band pattern for each control and CRISPR-injected pool of embryos. NOTE: The appearance of multiple bands that run slower in the injected versus uninjected lanes indicates formation of novel heteroduplex products ([Figure 4](#F4){ref-type="fig"}). The presence of novel heteroduplex DNA indicates that indels were generated by the CRISPR-injection. Reduction in the homoduplex band intensity in the injected solutions of approximately 50% or greater is generally sufficient to result in sufficient germline transmission. Additionally, extra bands are sometimes identified in the uninjected fish, and should not be considered heteroduplex bands when observed in the injected fish.
13. Choose the injections with highest cutting efficiencies relative to the uninjected control for each target; embryos from these injections can be used to grow up fish to look for indels causing premature stop codons. NOTE: For highly efficient cutting (reduction in the homoduplex band by approximately \> 50% intensity), screening 20--30 adult fish should be sufficient to obtain germline transmission. For sgRNAs that generate less cutting, more adult fish may be needed to increase the likelihood of identifying fish that exhibit germline transmission of modified alleles containing a premature stop codon. If indel formation is not observed it may be necessary to redesign the sgRNA to a different region of the gene. If no heteroduplex band formation is observed, the sgRNA may have degraded, and the sgRNA quality should be verified using a urea/PAGE gel.
5. Identification and Propagation of Knock-out Lines
----------------------------------------------------
1. To identify a potential founder parent fish, perform tail clips of the adult F0 fish (grown to approximately 2.5--3 months) to identify presence of indels. Anesthetize the fish in 0.62 mM tricaine (see **Table of Materials**), then use a clean, sharp razor blade to remove approximately 1/2-3/4 of the tail fin.
2. Place the tail in 45 µL of 50 mM NaOH, and return the fish to a recovery tank. Perform the gDNA extraction as described (steps 4.2--4.4). Once the fish resumes normal swimming behavior, place the fish back on flowing system water until the nature of the indel is identified. NOTE: It is critical to ensure that individual fish are identifiable, and can be appropriately matched to the results of the tail clips.
3. As described (steps 4.5--4.9), perform a HMA on the tail clip gDNA to determine if the fish was modified by the CRISPR injection ([Figure 5](#F5){ref-type="fig"}). To identify a founder fish, breed the adults that exhibit heteroduplex bands from tail gDNA to wild-type fish. Collect the embryos and grow them to 72 hpf.
4. At 72 hpf, collect 10 embryos and place each embryo in an individual tube. Perform a gDNA extraction as described above (steps 4.2--4.4) using 11.25 µL of 50 mM NaOH and 1.25 µL of 1 M Tris pH = 8.
5. Repeat the PCR and electrophoresis to identify heteroduplex bands as described above (steps 4.7--4.13) to determine if indel alleles have been passed on to this generation ([Figure 6](#F6){ref-type="fig"}).
6. Based on the percent transmission observed in single embryos using the HMA, grow an average of 20--30 embryos obtained by the cross for each CRISPR-lines of interest to adulthood. NOTE: This number may be increased or decreased depending on the frequency of germline transmission.
7. Perform tail clips of the adult F1 fish to identify presence of indels as described (steps 5.1--5.2). As described (steps 4.5--4.11), perform an HMA on the tail clip gDNA to determine if the fish carries an indel ([Figure 7](#F7){ref-type="fig"}).
8. **For fish that contain a heteroduplex band, prepare the DNA for sequencing analysis.** Perform PCR using new primers to amplify a 300--600 bp PCR product centered around the cut site.Use a PCR purification kit to clean up the DNA, and elute in 30 µL. Examine the DNA on an agarose gel to ensure a single band is present. NOTE: Some heteroduplex banding may be present on the agarose gel and appears as a small smear or double band just above the PCR product at the expected size.
9. If one to three indels are analyzed, sequence the PCR products using Sanger sequencing and determine the sequence of the indel using a bioinformatics tool[@B48]. Otherwise, the determination of the sequence of multiple PCR products using NGS analysis (see **Table of Materials**) is more economical.
10. Determine if a premature stop codon has been obtained by analyzing the sequence using a bioinformatics tool (see **Table of Materials**).
11. Place the fish containing desired mutant allele into a new tank with appropriate labels.
12. Design PCR primers for specific indel alleles for future genotyping needs. These primers should span the mutated sequence and not amplify the wild-type sequence.
13. In-cross heterozygous zebrafish to generate a segregating population that will contain 25% knock-out lines.
Representative Results
======================
The experimental approaches described in this protocol allow for efficient, cost-effective production of zebrafish knock-out lines using CRISPR/Cas9 technology. The following figures have been included in this article to facilitate interpretation and troubleshooting of the results obtained using this protocol. Following successful production and microinjection of CRISPR-reagents, the zebrafish embryos can be analyzed for overt phenotypes and for indel formation using HMA. A helpful control to visualize the success of the CRISPR-experiment is the use of the sgRNA described in step 1.5 to target the pigment-producing gene *tyrosinase.*Cas9-induced indel formation at *tyrosinase* results in loss of pigmentation and is easily scored by 48 hpf ([Figure 1](#F1){ref-type="fig"}). Another helpful control to ensure that preparation of the CRISPR-reagents for injection has been successful, is to verify that full-length (120 nt) sgRNA has been synthesized using a denaturing polyacrylamide gel ([Figure 2](#F2){ref-type="fig"}, Lane 1 and 2). If the RNA has been degraded it may appear as a smear, for example Lane 3 ([Figure 2](#F2){ref-type="fig"}) shows degraded RNA that is not suitable for injection.
To analyze the indel formation frequency of genes targeted by CRISPR-Cas9 that do not result in overt phenotypes such as *tyrosinase,*HMA analysis is a simple and reliable method. sgRNA/Cas9 injected embryos analyzed using HMA results in the formation of heteroduplex bands, and reduction of the intensity of the homoduplex band ([Figure 4](#F4){ref-type="fig"}). The presence of heteroduplex bands is further utilized in this protocol to identify potential founder fish from the microinjected embryos and as adults ([Figure 4](#F4){ref-type="fig"} and [Figure 5](#F5){ref-type="fig"}), to analyze the germline transmission efficiency of a founder ([Figure 6](#F6){ref-type="fig"}), and to verify presence of an indel in a heterozygous F1 fish ([Figure 7](#F7){ref-type="fig"}). The heterozygous fish that contain an indel are candidates for NGS to identify the nature of the indel and to determine if a premature stop codon is present in the coding region of the target gene.
[Figure 1](#F1){ref-type="fig"}**: Zebrafish embryos exhibit a pigment defect when injected with a sgRNA targeting *tyrosinase*at the one-cell stage.**(**A**) Wild-type, uninjected embryo at 48 hpf and (**B**) injected embryo at 48 hpf. [Please click here to view a larger version of this figure.](https://cloudflare.jove.com/files/ftp_upload/56969/56969fig1large.jpg)
[Figure 2](#F2){ref-type="fig"}**: *In vitro* transcription of sgRNA using synthesis kit.**Oligos were synthesized using *in vitro* transcription according to the sgRNA synthesis kit instructions. 500 ng of RNA was run on a urea/PAGE gel as described. sgRNA loaded in lanes 1 and 2 shows a band corresponding to the full length, intact 120 nt RNA. The sgRNA in lane 3 shows a degraded RNA sample that is not suitable for injection.
[Figure 3](#F3){ref-type="fig"}**: Comparison of the health of 24 hpf injected embryos.** A living embryo (**A**) developed to 24 hpf, is easily distinguished from an embryo that has aborted development (**B**). Embryos that resemble (B) or have drastically altered features to (A), such as spinal curvature or altered head and eye development should be removed from dish. [Please click here to view a larger version of this figure.](https://cloudflare.jove.com/files/ftp_upload/56969/56969fig3large.jpg)
[Figure 4](#F4){ref-type="fig"}**: Heteroduplex mobility assay of sgRNA-Cas9 microinjected zebrafish embryos.** Pools of 5 embryos per sample were collected at 72 hpf and gDNA was extracted. Heteroduplex analysis was performed as described, samples were loaded equally with 500 ng of DNA. Lanes: M = 100 bp marker; 1 = uninjected control; 2 = injection sample 1; 3 = injection sample 2. Expected band size = 98 bp.
[Figure 5](#F5){ref-type="fig"}**: Heteroduplex mobility assay of gDNA extracted from the tail of an adult CRISPR-injected zebrafish.** Embryos that were injected with an sgRNA and Cas9 protein were grown to adulthood (3 months). Fish B and C exhibit heteroduplex bands and were subsequently bred to identify germline transmitted indels; fish A was not used in subsequent analysis because it does not exhibit a positive heteroduplex band. Lanes: 1 = wild-type control; 2 = Fish A; 3 = Fish B; 4 = Fish C. Expected band size = 98 bp. [Please click here to view a larger version of this figure.](https://cloudflare.jove.com/files/ftp_upload/56969/56969fig5large.jpg)
[Figure 6](#F6){ref-type="fig"}**: Heteroduplex mobility assay of single embryos generated by breeding a F0 CRISPR-injected zebrafish to a wild-type fish to identify germline transmitted indels.** Zebrafish were mated, and the F1 embryos grown for 72 h. Single embryos were collected and heteroduplex analysis performed as described. Lanes: 1 = wild-type control; 2-10 = a single F1 embryo per lane. This gel shows that 7 out of 10 embryos show a positive heteroduplex band, indicating a germline transmission rate of 70% of the indel. Expected band size = 98 bp. [Please click here to view a larger version of this figure.](https://cloudflare.jove.com/files/ftp_upload/56969/56969fig6large.jpg)
[Figure 7](#F7){ref-type="fig"}**: Heteroduplex mobility assay of adult F1 zebrafish tail clips.** Adult F1 fish were scored by HMA to identify indels. Fish that exhibited a positive heteroduplex band were PCR amplified and submitted for wide sequencing analysis to determine the nature of the mutation. (**A**) Lanes: 1 = wild-type control; 2 = fish A (4 bp deletion, 1 bp mismatch). (**B**) These F1 fish were identified from the same founder, and yet show different heteroduplex patterning, indicating germline transmission of multiple modified alleles from a single founder. Lanes: 1 = wild-type control; 2 = fish B (4 bp insertion, 7 bp mismatch), 3 = fish C (4 bp deletion, 4 bp mismatch). Each of these indels created a premature stop codon in the coding sequence of the target gene, as determined by NGS. [Please click here to view a larger version of this figure.](https://cloudflare.jove.com/files/ftp_upload/56969/56969fig7large.jpg)
Discussion
==========
This protocol describes the production of gene knockouts in the zebrafish vertebrate model system using CRISPR-Cas9 technology. A number of protocols have previously been described to undertake CRISPR-mediated genome engineering in zebrafish[@B14][@B24][@B25][@B49][@B50][@B51]. This protocol builds on previous efforts by combining a number of simple yet reproducibly consistent experimental techniques, in particular HMA and NGS of multiple heterozygous fish, to create a straightforward, economical, and experimentally robust protocol for CRISPR-mediated mutagenesis in zebrafish that is appropriate for labs staffed with personnel with a range of training and experience, as well as teaching labs.
Recommendations for design and synthesis of guide RNAs are included in this protocol. A major consideration in guide RNA design is the minimization of off-target effects. Several prediction algorithms have been developed to allow CRISPR-users to access computation tools with user-friendly graphical interfaces that predict both the activity of the on-target guide and the chance of off-target effects[@B33][@B34][@B35]. A specific advantage of the zebrafish system is lowered rates of off-target effects because the Cas9 is injected into the embryos and therefore expression is transient, which has been shown in mice to result in decreased off-target effects[@B52]. Nevertheless, off-target effects have been demonstrated to occur in zebrafish[@B53]. One way to control for off-target effects is to phenotype founder zebrafish that have been generated by two independent guide RNAs that target the same gene, as these guides would be very likely to affect different off-target sites. An alternative method to minimize off-target effects that is not described in this protocol is the use of a mutated Cas9 that generates single strand breaks at the target DNA, which are repaired with high efficiency. Pairing DNA nicks within proximity of one another that are complementary to the opposite strands results in effective indel formation at the desired locus and minimizes off-target effects[@B54][@B55].
In addition to having different rates of off-target effects, different sgRNAs can have different rates of mutagenesis of the desired target[@B56][@B57][@B58]. This protocol uses HMA to analyze the efficiency of mutagenesis of a given sgRNA using heteroduplex band formation[@B32][@B39]. Heteroduplex bands are created by hybridization of PCR-generated DNA strands that contain mismatches, and can be easily resolved using gel electrophoresis. Unlike other methods commonly used to measure indel formation, such as the T7 endonuclease assay or high resolution melt analysis[@B24][@B25], HMA does not require an expensive enzyme to cut mismatched DNA, and does not require complicated analysis of PCR melt curves. Importantly, using HMA to verify high rates of indel formation in the injected population also enables the investigator to minimize the number of fish needed for subsequent production of knock-out lines, which reduces the cost of identifying a mutation with the desired characteristics.
The relative ease of generating CRISPR-based indels enables creation of multiple alleles of multiple genes at once. Web-based software is available for analysis of single mutations from heterozygous fish using Sanger sequencing of PCR products[@B48]. In the case where three or more CRISPR-mutated alleles are analyzed, NGS to characterize the nature of the indel is likely to be more cost effective to characterize the nature of the indel as this approach allows a pool of up to 50 different alleles to be characterized at once (see **Table of Materials**)[@B59][@B60][@B61]. Such economy of scale would likely be particularly useful in an undergraduate laboratory setting.
In summary, this protocol provides step-by-step directions for reproducibly generating high quality CRISPR-reagents (in particular, sgRNA) such that fewer adult fish need to be created and analyzed to successfully identify the mutant alleles of interest, which also reduces the time and cost of generating the desired lines. Importantly, this protocol has been designed such that it can be applied by laboratories with limited resources to produce mutant zebrafish in an affordable manner. Furthermore, we have found that this approach is suitable for undergraduates and thus expands the opportunities for education and training of undergraduate students interested in hands-on experience in CRISPR-based genome editing.
Disclosures
===========
Publication of this video article is sponsored by New England Biolabs.
This work was supported by the National Institutes of Health (R21CA182197 to J.O.), the Ralph W. and Grace M. Showalter Research Trust, and by the Purdue Agricultural Science and Extension for Economic Development (AgSEED) program. Sanger sequencing data were acquired by the Purdue Genomics Core facility supported by P30 CA023168. Mary Witucki was supported by the Purdue University Center for Cancer Research Summer Undergraduate Research Program supported by the Carroll County Cancer Association. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. We thank Benjamin Carter, Ellen Denning, and Taylor Sabato for providing critical feedback on the manuscript. We thank the Department of Biochemistry for support of this work, and the Center for Zebrafish Research at Purdue University for their dedication in the care and welfare of our zebrafish colony. Finally, we thank the Purdue Genomics Core Facility, and contributions of Phillip San Miguel regarding the NGS services.
[^1]: Correspondence to: Joseph Ogas at <[email protected]>
|
{
"pile_set_name": "PubMed Abstracts"
} | Age-related decline in striatal D2-dopamine receptors is subject to 'economic correction'.
We have previously reported a correlation between the number (Bmax) of striatal D2-dopamine receptors in youth and the magnitude of the decrease to the 40th to 60th week of age. This correlation was observed in five inbred strains of mice, which differ over a 2-fold range in youthful Bmax. To determine the extent to which this correlation can predict changes in strains, other than those so far examined, we measured the binding of [3H]spiperone to striatal membranes in two additional strains (MRL/Mp-++ and DBA/2NNia), in one strain previously tested, C57BL/6, but now maintained in pathogen-free conditions (C57BL/6NNia), and in hybrids (C6D2F1) of C57BL/6NNia and DBA/2NNia mice. The results were as expected from the correlation observed with other strains; that is, the magnitude of decline in Bmax with age is correlated with the density of receptors in youth. To test the stability of these age-related changes, we examined the effect of feeding diets with high (4.5) and low (0.2) polyunsaturated to saturated fatty acid (P/S) ratios to SJL/J and MRL/Mp-++ mice and found both receptor density and affinity and their age-related change to be independent of the dietary P/S ratio. In conclusion, our data are consistent with 'economic correction', i.e. with a direct correlation between youthful quantity of striatal D2-dopamine receptors and subsequent extent of decrease with aging. |
{
"pile_set_name": "Github"
} | /* -*- mode: C; c-basic-offset: 4; indent-tabs-mode: nil; -*- */
/* vim:set et sts=4: */
/* ibus - The Input Bus
* Copyright (C) 2008-2010 Peng Huang <[email protected]>
* Copyright (C) 2008-2010 Red Hat, Inc.
* Copyright (c) 2012 Google, Inc.
*
* This library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2 of the License, or (at your option) any later version.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library; if not, write to the
* Free Software Foundation, Inc., 59 Temple Place - Suite 330,
* Boston, MA 02111-1307, USA.
*/
#include "global.h"
gchar **g_argv = NULL;
gchar *g_address = "unix:tmpdir=/tmp";
gchar *g_cache = "auto";
gboolean g_mempro = FALSE;
gboolean g_verbose = FALSE;
gint g_gdbus_timeout = 5000;
#ifdef G_THREADS_ENABLED
gint g_monitor_timeout = 0;
#endif
|
{
"pile_set_name": "Pile-CC"
} | Logan Long is the man of his rental property. Until he gets into some trouble with the landlord. When he rents his Air B and Bang, he does not expect to end up banging the homeowner. However, Silvia Saige and Jessica Jaymes are begging for his big, thick cock. So he does what any man would do….he gives it to them. These two whores suck his big, juicy cock, then he plows them into oblivion. They want one thing…his cum….and he gives it to them. |
{
"pile_set_name": "OpenWebText2"
} | Last updated on .From the section Irish Rugby
Tadhg Furlong and Iain Henderson have a total of 57 Test appearances for Ireland
Six Nations: Ireland v Scotland Venue: Aviva Stadium, Dublin Date: Saturday, 10 March Kick-off: 14:15 GMT Coverage: Live on BBC Radio 5 live sports extra, BBC Radio Ulster, BBC Radio Scotland & BBC Sport website and BBC Sport app, plus live text commentary.
Ireland's hopes of having Tadhg Furlong and Iain Henderson fit for Saturday's Six Nations game against Scotland appear to have improved.
Both missed the win over Wales because of hamstring injuries but an Irish Rugby statement on Monday said they were expected to train fully this week.
Ireland coach Joe Schmidt tends not to select players unable to train on the Tuesday of match weeks.
Rob Herring has rejoined the squad after recovering from an elbow injury.
Niall Scannell, who replaced the Ulster hooker in the squad in the week of the Wales game, suffered a recurrence of a rib injury while playing for Munster against Glasgow 10 days ago but is expected to be available for the Six Nations contest in Dublin.
With Munster utility back Andrew Conway still unavailable because of a knee injury, uncapped Leinster wing Barry Daly has been added to the squad as cover.
Connacht lock Ultan Dillane, who can also play in the back row, will join the Ireland squad on Wednesday after returning from the Irish province's trip to South Africa.
Furlong came off early in Ireland's second Six Nations game against Italy while fellow British and Irish Lion Henderson was replaced at half-time.
Andrew Porter stood out as he filled in for Leinster team-mate Furlong against Wales while lock James Ryan came in for his third Test start.
Ryan impressed in the last-gasp win over France as he started in the second row alongside Henderson, but his minor groin strain led to Devin Toner's inclusion for the game against Italy. The giant Leinster lock remained in the team for the Wales game as the Ulsterman missed out.
Ireland are without injured centres Robbie Henshaw and Chris Farrell for Scotland's Aviva Stadium visit, with fit-again Garry Ringrose the front-runner to start at outside centre.
Joe Schmidt's side are the only team still with Grand Slam ambitions after the Scots shocked England at Murrayfield on 24 February.
Another Ireland win over Sunday will leave them in position to complete the Grand Slam at Twickenham on 17 March - Ireland's national holiday St Patrick's Day.
Listen to coverage of Saturday's game live from 14:00 GMT, on BBC Radio 5 live sports extra, BBC Radio Ulster and BBC Radio Scotland. |
{
"pile_set_name": "PubMed Abstracts"
} | How to encode arterial pressure into carotid sinus nerve to invoke natural baroreflex.
The purpose of this study was to develop an artificial baroreceptor that was capable of invoking the "natural" baroreflex by electrically stimulating the afferent nerve. In six anesthetized, vagotomized dogs, we first identified, using the white-noise method, the transfer function from carotid sinus pressure to aortic pressure (HCSP.AoP) and that from the electrical carotid sinus nerve stimulation to aortic pressure (HCSN.AoP). We then backcalculated the transfer function required for the artificial baroreceptor (HCSP.CSN) as the ratio of HCSP.AoP to HCSN.AoP. To activate the artificial baroreceptor, we electrically stimulated the carotid sinus nerve with the frequency-modulated pulse train obtained in real time by convolving the impulse response of HCSP.CSN with instantaneous aortic pressure. We tested performance of the artificial baroreceptor by imposing random changes in blood volume. The pressure-stabilizing effects of the artificial baroreceptor were indistinguishable from those of the native one. We conclude that the artificial baroreceptor can invoke the natural baroreflex. The proposed framework generally would be applicable to interface artificial devices with the central nervous system. |
{
"pile_set_name": "OpenWebText2"
} | Heeello folks!
Halloween is unfortunately over buuuuut there’s always next year! From what we’ve gathered on social media, the forums and Discord, you peeps had a blast playing Capture the Pumpkin (and honestly, we did too). So we’ve decided to keep it, but re-skin it to match the universe of Castle Story!
Hence, Capture the Pumpkin is now known as Grab The Gems!
Pumpkins have been replaced by gems and pumpkin patches have been replaced by gem patches. Everything else is back to normal – the moon is no longer a spoopy pumpkin and your home crystal has returned to its former, crystally glory. :)
For those who haven’t had a chance to play it during Halloween, GTG for short is a multiplayer only gamemode that where the shards on the map have been replaced by gem patches! Over time, gems will appear in the gem patches and the first faction to collect 10 gems will win the game! Naturally, you’re encouraged to slice and dice enemy workers trying to collect the gems back to their home crystal and steal their gems!
The first 5 gems will appear after 12 minutes in random patches. After that, 5 more gems will appear every 8 minutes. Keep in mind that only workers can pick up gems by selecting the worker and right-clicking the gem. Right-click your home crystal with a worker carrying a gem selected to make them drop it in your home crystal!
Pro-tip: Make your workers “hold position” by pressing H or via the pie-menu to stop them from dropping the gem and going back to work if you forget about them after sending them to pick up a gem. :) Don’t forget to set them back to automated mode (H again) after they’ve dropped the gem in your home crystal though.
Keep an eye on the counter below the minimap to prepare for when the next gems will appear!
Full changelogs
Renamed “Capture the Pumpkin” to “Grab the Gems”.
Added new gem mesh to replace the pumpkin thematic one.
Added new gem patches mesh to replace the pumpkin patch thematic one.
Made the sound of shards and crystals being captured or neutralized play across the map, alerting players it’s happening. Remember to check the minimap to see which shards are being captured.
Added new footsteps sounds for snow, plants, different kinds of grass, etc.
Added new sound variations for doors.
Returned the moon to its original mesh.
Returned the home crystal to its original mesh.
Removed Halloween disguises from Bricktrons.
Have fun and let us know what you think! :D |
{
"pile_set_name": "OpenWebText2"
} | The "In My Feelings" challenge took social media by storm this month, with thousands of people recording themselves dancing to rapper Drake's new hit song. The dance challenge was started by online personality Shiggy, but since then it's escalated to a new, dangerous level, with some people recording themselves jumping out of moving cars to dance.
Police departments and safety officials around the world are warning against the trend, and in some cases reprimanding people who take part in this extreme version of it.
On June 29, Shiggy posted a video to Instagram showing himself dancing in the street to Drake's "In My Feelings." The video went viral, and thousands of people, including celebrities, started filming and posting their own homemade music videos.
Singer Ciara and her husband, NFL star Russell Wilson, shot their video in Cape Town, South Africa. Will Smith did his own "In My Feelings" dance on top of a bridge in Budapest. And that's just a start. A search of the hashtag #InMyFeelingsChallenge on Instagram pulls up over 200,000 posts.
Get Breaking News Delivered to Your Inbox
But the challenge soon morphed into something more extreme. Not only are people dancing to "In My Feelings," but they are jumping out of moving cars and busting a move in the middle of a street. People are trying to top others' videos, and are getting hurt in the process.
While some people appeared to successfully hop out of a slow-moving car and dance alongside it, others have been injured trying to replicate the stunt. Some people recorded themselves falling out of the moving car. Others danced alongside their cars on a busy street, running the risk of getting hit by oncoming vehicles. A few have even posted videos of themselves getting hit while dancing in the street.
The challenge has promoted some police departments in the U.S. and worldwide to issue warnings. In Methuen, Massachusetts, Police Chief Joseph Solomon called the challenge "super dangerous" and urged people not to try it, CBS Boston reports.
On Tuesday, the National Transportation Safety Board (NTSB) got into the act and issued a warning against the challenge as well. The NTSB shared a link to its statement via Twitter, saying "We have some thoughts about the #InMyFeelings challenge. #Distraction in any mode is dangerous & can be deadly."
"In transportation, distraction kills. Drivers and operators in all modes of transportation must keep their hands, eyes, and minds focused on operating their vehicle," the warning on NTSB's website says.
In Abu Dhabi, three social media influencers have been arrested for taking part in the challenge, which "endangered their lives, offended public morals and violated the traffic law," Gulf News reports. In Dubai, anyone caught performing what has also become known as the "Kiki challenge" will get 23 black points on their licenses as well as their car impounded for 60 days, according to the Federal Traffic Law, Gulf News reports.
Police in Spain have also issued a warning against the dangerous challenge, AFP reports. The Mossos d'Esquadra police force, in the country's Catalonia region, tweeted that those who partake in the #InMyFeelingsChallenge could face criminal charges.
⚠ Fer un repte com #InMyFeelingsChallenge pot acabar en denúncia
⛔ Gravar amb el mòbil mentre condueixes
⛔ Conduir sense parar atenció
⛔ Descordar-se el cinturó en circulació
⛔ Posar en perill a tercers
‼ La seguretat viària NO és cap joc pic.twitter.com/iJjKQ4d1fq — Mossos (@mossos) July 20, 2018
While many celebrities, like infamous N-Zone dancer Odell Beckham Jr., are dancing in the street, others are participating in the "In My Feelings" challenge safely. NBA star Steph Curry's daughter, Riley, did the challenge while getting out of a car -- but it was a miniature kiddie car in their driveway. And comedian Kevin Hart did the challenge on a stage -- an appropriate place for dancing. |
{
"pile_set_name": "OpenWebText2"
} | Alex steps back and swings his arm. This leaves him open when used, but the result is that the next attack Alex lands will count as a counter hit (or crush counter depending on the attack). Successfully landing a hard hit will add to your V-Gauge.
If Alex hits his opponent, is blocked, or is hit himself then he will lose the effect of this V-Skill. |
{
"pile_set_name": "OpenWebText2"
} | Avengers Campus, the all-new land opening this summer at the Disneyland Resort, imagines a version of the Marvel Cinematic Universe where warmonger Thanos never used the collective cosmic power of the six Infinity Stones to snap away half of all life in the universe as he did in Marvel Studios' Avengers: Infinity War, a disaster only reversed when Earth's mightiest heroes travelled back through time in Avengers: Endgame. The blockbuster acts as a point of divergence for the events of Avengers Campus, which calls on the infinite possibilities of the Marvel multiverse to explain its place in the Marvel Cinematic Universe canon.
"So the Avengers and all of us, the guests, we're recruits. We're here to just have eyes on the prize there. I think that you'll find that these events are really happening. It's really happening," Dan Fields, Executive Creative Director, Disney Parks Live Entertainment, said during an Avengers Campus preview attended by ComicBook.com. "This campus exists in the real world, and therefore, those heroes are here and keep an eye on us, keep us all safe. There's no apocalyptic snap happening in this campus."
Fields confirmed Thanos never wiped out half of all living beings in this version of events, inspired by but not canon with the Marvel Cinematic Universe the way Star Wars: Galaxy's Edge is set within the Star Wars film universe.
"As I mentioned, there's no snap. What I mean by that is we want there to be some conflict, but we don't want anyone to feel that there's an apocalyptic threat to the end of humanity," Fields said. "Our friends in the studio do a great job with that. So we want the conflict to be a little more accessible to the daily guests here."
The big screen Marvel Cinematic Universe is now without an Iron Man after Tony Stark valiantly sacrificed himself using the power of the Infinity Gauntlet to destroy the invading alien army commanded by Thanos, who threatened to shred the universe down to its last atom and create a new one.
At Avengers Campus, Stark is alive and well, and has a designated area where he'll meet with recruits and pose for pictures while showcasing his Disney Parks exclusive Mark 80 armor.
"The lovely thing about the comic books and the films is that between them we've seen a million different versions of the multiverse, a million different versions of these characters. Avengers: Endgame especially gave us the opportunity to go back in time and then split off in a different timeline," Walt Disney Imagineering staff writer and Avengers Campus story lead Jillian Pagan explained to ComicBook.com. "So that's how we like to look at our activation that we have, if you think about when [the Avengers] went back to 2012 and Endgame, they had a shared history. The two timelines had a shared history up until that point."
"And then there was a divergence and Loki takes the Tesseract over here and they're doing things over there, and in our timeline we have a shared history with the films," Pagan continued. "We will continue to have a shared history as we move forward, so there'll be a little bit of fluidity to that timeline, but clearly we live in a version of the multiverse where there are some characters who did not sacrifice themselves for us. They are alive and well and now welcome you to it."
Avengers Campus opens July 18 inside Disney California Adventure Park at the Disneyland Resort. Purchase tickets. |
{
"pile_set_name": "Pile-CC"
} | Members’ Spotlight
Pervaiz, Sadaf
Malhaar (The Raag of the rain)
Aimunn ( Raag of the Dawn)
The sunset and the evening
The Night Raag
Deepak (the intense Raag of passion)
Sadaf Pervaiz
Glass and the dance of color and light within the 3D forms inspired me to learn glassblowing. Having a back ground in traditional miniature painting and a passion for drawing, I have done a lot of experimental work in imagery on glass as well. In future, I intend to carry on working with imagery on 2D and 3D glass glass forms.
Details about work or recent projects
This project is all about the seven Raags(songs) that are sung in subcontinent at seven different times of the day. Deeply connected to the colours of the sky. Sky which is the ancient and authentic emblem of change. I have translated this connection of the song and sky, time and change through colour and form. All vessels are mouth blown, hand polished and inspired by the traditional twin Indian drums Tabla. |
{
"pile_set_name": "Pile-CC"
} | If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
3D Dot Game Heroes
Demon's Souls
Disgaea
God of War
Theatgamecompany games
inFamous
Journey
Killzone series
LittleBigPlanet
MotorStorm
PixelJunks games
Rachet & Clank
Resistance series
THe Last of Us
The Last Guardian (please still come out and be good)
Uncharted
Valkyria Chronicles
White Knight
WipeOut HD
Digital PSOne, PS2 games. + HD collection releases
Xbox 360
Rock Band - Rock Band Network
Kinect (other than Dance Central/knock offs its mostly used as party/kid games or voice add on for AAA games)
Fable
Halo
Gears
Lost Odyssey
A handful of Xbox games as digital purchases. Makes me sad since there was some great games on Xbox (Crimson Skies, Phantom Dust) that MS does not care about the old games plus what make them great was Online Play. Due to infrastructure restrictions and not wanting to support
it anymore Xbox online was shut down. People would still being playing Halo 2 today if given the choice. One great thing about the PC. People can still play CS, UT, Quake. Hell I can still play Heroes 3 online (thank you GameRanger).
And as mentioned, Wii has good library of unique and exclusives, but you can do more with the PS3 while still having a good set of games to play.
I used to have a PSP before it got hosed. The only few worthwhile games that I could think of in that platform was Monster Hunter, Disgaea and Lumines. And possibly Patapon. Why Capcom won't release MH on the Vita is beyond me. I mean, it has the perfect control scheme to play the game, two sticks and they still would rather release the game on the 3DS. Not that I have anything against the 3DS but really...
I honestly like the Xbox exclusives a lot more than the theoretically more diverse PS3 exclusives, but then I'm not a fan of a lot of Japanese games and actually like Halo for what it is, despite having a PC to play "real" shooters with a mouse. Also, Forza (which is much better than GT, IMO) and Viva Piñata are awesome, and the Fable games are good too (not the best games ever but they're fun). The exclusive Xbox lineup does have a lot of action titles and mediocre JRPGs, but claiming it's just Halo and Gears of War is unfair.
To me the reason to get either of the big consoles for games is about 50-50 which is why I eventually ended up with both. They have both good and uninteresting exclusives, Xbox often had better performing cross-platform games but then loses out when games like Final Fantasy need the PS3's BD storage capacity for more pre-rendered cutscenes. PS3 games need the option to install to HDD in the game I think, and many don't have it - Xbox games can all be installed from the dashboard for improved loading times. The PS3 has no regional locks on games, but inexplicably on DLC. The Xbox is mostly the other way around, plenty of games and I think all DLC are region-free, but there are still a bunch of games which are not.
To me all the advice about backwards-compatible early models is misguided because you'll get otherwise inferior hardware (loud, hot) and European models only ever had crippled BC in the first place (until the first "slim" refresh removed it completely). Don't bother with that, if you want to play PS2 games get a PS2 or PCSX2 or buy the made-for-PS3 re-releases. Xbox 360 has software-based backwards compatibility for a bunch of Xbox classics, at least.
Regardless, the big thing to me is the PS3 is generally the more customer friendly option. Sometimes it decides to bite you in the ass with stuff like regional DLC pricing and -availability if you import, but you can otherwise import without care. Sometimes cross-platform games like Bayonetta run like ass because porting is hard. But you can use it as a BD-player and online is free. You can buy DLC directly with a credit card (for regionally inflated prices, but still) above a certain threshold, wireless controllers can be recharged with a mini-USB cable, and the console takes any 2.5" SATA HDD. It has backup functionality (never tried that so I don't know how well it works with all the DRM on savegames because of :achievements: these days) for user data/savegames built in.
Microsoft on the other hand just loves to suck their customers dry. Then make the console dashboard an ad-filled nightmare anyway. Having to pay a monthly fee to get full access to your 60$ games for peer-to-peer matches is an abomination and hiding even the most basic online stuff (like using the player marketplace or downloading gifted cars in Forza, or sharing your characters for the full game in the Saints Row 3 Initiation Station which is like the whole point of the character creator) behind that paywall is a massive dick move. Their marketplace works off funbux you have to buy in bulk, hiding the real price and leaving customers with leftover points often. Play and charge kit for controllers and bigger harddisks are way overpriced, as well, and a transfer kit if you want to move to a new harddisk costs money.
I really love my Xbox 360 games but without XBL they are always gimped and actually love to rub it in my face all the time. Prominently presenting online functions and -news, even if I can't use any of that to play with friends, can't even use basic online functionality. Just because I'm not paying another 1-2 games worth of fee every year to be allowed to host a game for myself and friends on my console with my bandwith. It's insulting. No Microsoft hardware for me next generation, that's for sure.
hot shots golf and hotshots tennis (both amazing games) ,Jeanne d'arc, puzzle quest, patapon, final fantasy 7 on psx emulator, maybe kingdom hearts, castlevania and outrun.
Good for hundreds of hours of entertainment on the go.
Tip: stay far away from shooters and console like games on psp, they are all shit. There are enough portable games that are good (listed above).
Make sure you jailbreak the psp and put the games on a memory stick, loading times are extremely fast on the memory stick, UMD loading times suck horribly.
Jailbroken psp with a library of games on flash memory and a few emulators installed is amazing, I would have killed for one when I was a kid.
Modern consoles on the other hand I wouldn't want to burden my younger self with.
I'd recommend a PS3 for two reasons: God of War 3 and it doubles as a very capable blu-ray player you don't need to buy a separate wireless adapter to hook up to your network. Microsoft also charges monthly for their online service so that's a massive black mark on them.
Xbox does have Live Arcade which has a selection of indie titles, but many of those are making the leap to PC as well so it's difficult for me to find any real reason to have one these days unless you don't plan on ever having a PC powerful enough to run The Witcher 2. Shame on you in that case.
Don't buy any console as media player, if you want to watch movies just get a HTPC... ps3 doesn't even support subtitles or mkv.
MKV is only just now starting to get recognized by blu-ray players. It's not a popular format right now, so I wouldn't make a decision on whether that alone.
I bought mine for the two reasons above: I wanted a blu-ray player and I figured God of War 3 was a nice bonus. When I watch movie files they're usually not 1080p because hardly anyone encodes them that high so watching them on my TV is probably sub-optimal. I use my PC much more than my TV anyway.
Don't buy any console as media player, if you want to watch movies just get a HTPC... ps3 doesn't even support subtitles or mkv.
I've got a PS3 and an HTPC, and BluRay and Netflix are a lot easier to work with on the PS3 (using a remote). Not sure the Netflix API is even available outside the U.S. and Canada, so you'd be forced to browse Netflix in a browser on an HTPC.
Personally, owning the lot (360 & ps3, had a wii for a while, but sold it cos it's that bad, and thanks to dolphin the three wii games I wanted to play I can play at 2560x1440 and with AA & AF), I'd get a ps3. 360 has given me some good times over the years, but now, it's long in the tooth.
Five years ago I'd have told you to buy one for gears of war alone, now, ps3 stomps in terms of exclusives. Sure the shooter playerbase isn't 'there' for multiplayer like on xbox, and xbox arguably has the better of the console racing sims (But then PC has the best ones, it's like asking if you'd prefer cancer or aids, so, moot point). But shooters are best on PC, so xbox has ... trials 2 I guess.
As for playing media, you can use PS3 Media server for ps3 or xbox, bear in mind that it can be a piece of crap sometimes, I'd just skip it, and get something along the lines of a WDTV, a Roku, heck, even a raspberry pi & xbmc (my current preferred choice) for consuming mkv's. ps3 media server is ok, just it's wonky sometimes.
As for the important bits, the games. My PS3 gets fired Up probably once a week or fortnight, my xbox, when I feel like playing trials. Pretty much in the last year that's the only game i've played on my xbox, trials. PS3 has the exclusives, the awesome japanese games that only come out on it, the wicked little downloadable games (Journey, nuff said), The okami HD re-release (wiiicked game). Free Multiplayer (Screw Xbox gold and paying for p2p multiplayer, sure, if it was dedicated servers & was optional, i'd be all for it for better pings, but pay money for p2p matchmaking? Hell No.)
PS3 just flat out wins. Not to mention, whilst backwards compatibility might suck a bit on them (it's ps1 or don't bother basically), the 'decent' ps2 games have been re released in collections. God of War 1 & 2, Ico & SOTC etc, etc.
you can use a bluetooth keyboard if your room is not 25 meters away from the living room.
If you're PC is playing a netflix movie in the living room you can't use. At least you can't have audio and when doing stuff that doesn't require audio you always have a chance of screwing up the stream.
I don't know if anyone's mentioned this yet, but a big thing to ask yourself when choosing a console is: How much will I be using the internet with it?
If the answer is "a lot," then your best bet is always the PS3. It doesn't require a monthly fee for gold to use subscription services like Netflix and if you're only playing one online game at a time, it's pretty much like paying a subscription to play that game online when you could get it free on other platforms.
I've got a PS3 and an HTPC, and BluRay and Netflix are a lot easier to work with on the PS3 (using a remote). Not sure the Netflix API is even available outside the U.S. and Canada, so you'd be forced to browse Netflix in a browser on an HTPC.
The Netflix API isn't available in Europe, but the service has been released in the UK, Ireland, Sweden, Denmark, Norway and Finland. We pay for the service and have some local content, but cannot use the Netflix API, so XBMC Flicks doesn't work, can't even download the Netflix plug-in for Plex. Windows Media Center on Windows 7 supposedly has a Netflix plug-in that can be downloaded, but it doesn't work outside the U.S.
i have a wii,360 and ps3. at first i would have favoured the xbox for its exclusives and eventually bought the ps3 for its. i only use it for netflix now but just bought gold again just for halo 4. but for best exclusives...go for the wii. mario galaxy is pretty much gamin perfection. |
{
"pile_set_name": "PubMed Abstracts"
} | [Effect of histamine on the action potential of the maxillary nerve in rabbits].
The significant enhancement of action potential as recorded from rabbit maxillary nerve with topically applied 1.0 mmol/L histamine on the nasal mucosa was completely blocked by pretreatment with diphenhydramine (H1 antagonist) but not with cimetidine (H2 antagonist). This fact gives new support to the concept that histamine exerts its pathological effect on nasal mucosa at least partly via an afferent nervous pathway of the trigeminal nerve. |
{
"pile_set_name": "OpenWebText2"
} | ISRO
Distress Alert Transmitter
country chicken
PLANS TO AMP UP ARTIFICIAL INTELLIGENCE
FUND FOR CLIMATE CHANGE KNOWLEDGE CENTRE
Bengaluru
SOPS FOR AUTO RICKSHAW AND TAXI DRIVERS
PLEASING ALL THE GODS
MILLETS TO BE CHEAPER?
DRONE TECHNOLOGY FOR RE-SURVEYS
NEW AIRPORT IN BIDAR, 3 MORE IN SIGHT
Interestingly, the Budget presented by CM HD Kumaraswamy on Friday has responded to many issues reported by BM. Here is the list
The Budget has announced a grant of Rs 3 crore for “assistance of 50 per cent of subsidy for installation ofauthorised ‘(DAT) equipment on fishing boats.” Inventions made for the Indian space programme have started to trickle down to civilian use.DAT, based on the INSAT satellite systems of ISRO, transmits emergency conditions and position or location of the boat it is installed on to a central hub station through the INSAT satellite. Whenever the boat is in an emergency situation, all the crew need to do is switch on the DAT unit.“The user is required to select a message (e.g. fire in boat) by pressing the corresponding switch provided in the system. The DAT combines the message with position of the boat obtained through GPS, and transmits the same to a central HUB station. The DAT will repeat the message every minute for first five minutes and then every five minutes till it is switched off manually or until the battery life gets over. Intended for emergency message communication transmission for all type of sea going vessels, it is especially useful for fishermen,” explained ISRO.In Tamil Nadu, thousands of such ‘DAT-90’ equipment, each costing Rs 15,920, were distributed to fishing boats. The Central government bore 75 per cent of the cost while the TN government gave 15 per cent.The State Budget allotted Rs 5 crore “to encourage poultry farming of’ (nati koli sakanike) among 10,000 unemployed youth.” Dr BL Chidananda, head of Animal Sciences, University of Agricultural Sciences, says the successful Kerala model can be modified and adopted. “Kutumbashree is a successful backyard chicken-farming model. 25-50 day-old country chicks can be provided to village youth. If the poultry is for meat, the season will be spread over a few months. If it is for eggs, there is more risk as the season will last through a year. The Poultry Department of Veterinary College and the Central Poultry Development Organisation in Hesarghatta have parent stock to produce chicks,” he said.The Budget has also allocated Rs 2 crore for “the establishment of laboratory for genetic improvement (twin births) of indigenous ram.” The Nimbalkar Agricultural Research Institute in Maharashtra has been successful in producing a breed called Nari Suvarna sheep which produce twin sheep.Sheep usually give birth to only one lamb at a time. The Borula gene found in a breed of sheep in West Bengal was introduced in local sheep in Maharashtra and in a few farm clusters in the Sira taluk of Tumakuru in Karnataka. The success rate has been 40-60 per cent. “The Budget allocation is enough to introduce Borula gene in enough rams across the State,” said Chidananda.******HDK has plans to invest in artificial intelligence. He has proposed that his government will provide required infrastructure for using latest chat bot and big data technologies. The government will make the use of “e-Office” mandatory in all the offices of the Secretariat to enhance the efficiency. The development of websites of various State Government departments is also a priority.The CM has announced a grant of Rs 2 crore to Climatic Change Strategic Knowledge Centre under Environmental Management and Policy Research Institute (EMPRI). This centre will now take up research and study relating to climate change in, which till date, has not been explored fully. Hope, we get to hear recommendations soon.The auto rickshaw drivers in Bengaluru, a popular subject for Sandalwood, had taken a huge hit in their revenues after the cab aggregators ventured into the market. The CM has earmarked Rs 50 crore for the Saarathiya Sooru scheme, which proposes rental housing for auto drivers and taxi drivers in Bengaluru. HDK has also proposed of a group insurance facility for auto and tax drivers and a subsidy for conversion of petrol autos into electric autos. In fact, CM has also announced a ‘Drivers’ Day’ to recognise their services.The budget allocates Rs 25 crore to establish a world class cultural and heritage centre at Veerapura village (the birth place of Shivakumar Swamiji) and another Rs 25 crore for developing Bananduru village (birth place of Bal Gangadhara Swamiji). HDK has increased subsidy for pilgrimage to Manasa Sarovara up to Rs 30,000, while he has allocated Rs 200 crore to set up a Christian Development Corporation for the comprehensive development of the Christian community. Rs 10 crore was earmarked for providing basic amenities at Muslim graveyards.Karnataka government is in the forefront of popularising millets. However, the steep price of millets is a stumbling block. The CM offered a cash incentive of Rs 10,000 per hectare under “Raitha Siri” scheme with a grant of Rs 10 crore. He also encourages the production of minor millets and proposed marketing millets through HOPCOMS, Nandini and other outlets in near future.Drones seem to be the new buzzword for the government as it wants to optimise the technology. The CM wants drones to help in re-survey work in the districts of Kalaburagi, Vijayapura, Dakshina Kannada, Mysuru, Gadag, Davanagere and Kodagu. “For the first time in India, survey of mine leases will be done with drone and GPS technology at a cost of Rs.82 crore. Implement ation of a drone surveillance system to monitor and maintain the law and order and to prevent crimes will be taken up,” HDK said.Revenue Minister RV Deshpande had recently met the Centre to get clearance from GMR for setting up an airport in Bidar (as it falls under the 150-km radius from Hyderabad airport). CM HDK has allocated Rs 32 crore for construction of new terminal building at Bidar airport. He has also pitched in for operationalisation of the Kalaburagi Airport, development of Chikkamagalur and Shivamogga airstrips under the public-private partnership model.******HDK’s budget talks of the problems created by lantana in forest. CM has announced Rs.5 crore to remove Lantana and Eupatorium weeds to make way for the growth of grass, which is congenial to forests.With water pollution at an all-time high, government has allocated Rs 9 crore for establishment of 17 Continuous Water Quality Monitoring Stations at polluted water-banks.With schools in ramshackle condition, the budget has highlighted the modernisation of infrastructure in schools; construction of 1,500 new class rooms and upgradation of 5,000 class rooms.Govt wants to study the feasibility of design for Multi Modal Transport Hub at Hebbal, Byappannahalli, K.R.Puram, Kadugodi, Challaghatta and Peenya areas.With many monuments being encroached, the government has proposed to take up a survey of 600 out 834 monuments in order to protect them. |
{
"pile_set_name": "PubMed Abstracts"
} | Distribution of anisakid nematodes parasitizing rajiform skates under commercial exploitation in the Southwestern Atlantic.
In order to evaluate the infestation by anisakids present in elasmobranchs and their distribution in the Argentine Sea, this study was carried at a regional scale with the following aims: 1) to identify those anisakid species present in skates under exploitation; 2) to characterize quantitatively these infestations and 3) to determine those factors driving the variability in parasite burdens across skate species. A total of 351 skates, belonging to 3 species (218 Sympterygia bonapartii, 86 Zearaja chilensis and 47 Atlantoraja castelnaui) and from different localities of the Argentine Sea were examined for anisakids. Parasites were found in the stomach wall at high prevalence in some samples. Based on morphology and mtDNA cox2 sequences analyses (from 24 larval worms), specimens were identified as Anisakis berlandi, A. pegreffii and Pseudoterranova cattani; the last two known as potentially pathogenic for humans. Differential distribution patterns were observed across parasite and hosts species. In general, fish caught in southern and deeper waters exhibited higher loads of Anisakis spp., whereas infestation levels by P. cattani increase in larger skates. Taking into account that the mere presence of worms or their antigens in fish meat can provoke allergic responses, information on distribution of parasites and their variability is essential for the implementation of food safety practices. |
{
"pile_set_name": "OpenWebText2"
} | Firefighters were called to a fire at the Manners St McDonald's.
Flames rose above the golden arches after deep frying turned bad in central Wellington early on Thursday.
The fire, in the Manners St McDonald's fast food restaurant, caused buses between Willis St and Lambton Quay to be diverted for about an hour.
Do you know anything about the fire? Email [email protected]
SHONA GARWOOD/SUPPLIED Flames were seen coming out of the restaurant's roof.
Fire crews from around the Wellington region were called in to battle the blaze, senior station officer Craig Gold said.
When crews arrived, the deep fryer was on fire and flames were coming out of the restaurant's roof.
Firefighters used ladders to pour water down the flue and onto deep fryer.
The restaurant was filled with smoke.
Assistant commander Gareth Hughes said an unattended deep-fryer was most likely the cause but he could not rule out an equipment fault.
Smoke could earlier be seen inside the building.
Power was cut to the kitchen, to avoid a second flare-up.
The situation was causing traffic backups around the city. Bus lanes opened again by about 8am. |
{
"pile_set_name": "StackExchange"
} | Q:
Getting unity to resolve multiple instances of the same type
I want to do a simple resolve of multiple type registrations (ultimately constructor injected, but using .Resolve to see if Unity is even capable of such things.
In every case below, Unity resolves 0 items where it should be resolving 2.
Is there some switch in unity that turns on post-2007 behavior? Or am I just drastically missing something?
Here is my code:
public interface IFoo {}
public class Foo1 : IFoo{}
public class Foo2 : IFoo{}
class Program
{
static void Main(string[] args)
{
var container = new UnityContainer();
container.RegisterType<IFoo, Foo1>();
container.RegisterType<IFoo, Foo2>();
// container.Resolve<IEnumerable<IFoo>>(); returns 0
// container.ResolveAll<IFoo>(); returns 0
var foos = container.Resolve<IFoo[]>();
Console.WriteLine(foos.Count());
Console.ReadLine();
}
}
A:
In Unity there can only be one default registration (A registration without a name as in container.RegisterType<IFoo, Foo1>();
). If multiple default registrations are performed, the last one wins.
In order to register multiple implementation for the same interface, you need to assign names to those registrations:
container.RegisterType<IFoo, Foo1>("registration1");
container.RegisterType<IFoo, Foo2>("registration2");
Also, Unity only understand arrays by default. If you want to resolve as an array then you will be fine with the default behaviour. Otherwise you will need to register a mapping between the array and the collection you are interested in, like:
container.RegisterType<IEnumerable<IFoo>, IFoo[]>();
Another important note is that the default registration won't be returned when resolving a collection.
For example given:
container.RegisterType<IFoo, Foo1>();
container.RegisterType<IFoo, Foo2>("registration1");
container.RegisterType<IFoo, Foo3>("registration2");
container.RegisterType<IEnumerable<IFoo>, IFoo[]>();
If you resolve IEnumerable<IFoo>, the result will only contain instances of Foo2 and Foo3, but there will not be an instance of Foo1 because the default registration is not included.
|
{
"pile_set_name": "Pile-CC"
} | Scottish – Irish – Celtic
The Perfect Wedding Officiant for Your Traditional Celtic Wedding in Mountainair, New Mexico
Celebrations honoring Celtic roots and traditions have long been preferred. From the stirring cry of the bag pipe to the gown of official tartan and kilt, weddings based on aspects of Celtic practice can offer lasting memories. Facets of these wedding celebrations can include part or all of the following:
Anam Cara - Actually, the Hearts other Half, this practice is a unique ceremony celebrating the creation of an ageless love now and forever more. This event of the aspects; to the Celts the four components Earth, Fire, Water and Air were the foundations on which an effective connection were developed.
Anam Cara
This tradition was adapted as Christianity moved into the Celtic lands and also continues to be a remarkable way to include loved ones in your ceremony.
Handfasting
Handfasting - An event going back right to antiquity, Handfasting is a custom of marriage before the accessibility of rings and also rare-earth elements. The couple would take an item of cloth or rope and before their friends and families, proclaim their love and purpose by stating a few words as well as binding themselves together symbolically with the rope. It is from this practice we still describe marriage as "tying the knot".
Oathing Stone -- Exactly what better place to put the guarantees of a life time and eternity than in the heart of a stone? The oathing stone is held by the groom and bride while their promises are stated, after that in some practices is tossed right into a deep body of water to hold those guarantees for evermore. Today that stone may be kept as a remembrance of this big day.
Oathing Stone
The Quaich - Initially crafted from wood the twin handled Quaich was a Scotsman's canteen, mess kit as well as drinking mug rolled right into one. King James of Scotland gave his betrothed Anne of Denmark a Quaich as a sign of his love for her during the marriage ceremony, From that point on the Quaich has been called the "loving cup". This beautiful ceremony communicates the blessings of Kith and also Kin to the couple.
The Quaich
Pinning of the Tartan
Pinning of the Tartan - A new bride is officially approved right into the bridegroom's family through this ceremony. Typically the oldest woman member of the bridegroom's family gives a piece of the family member 's Tartan to the bride-to-be symbolizing she is currently linked right into all the behaviors of the clan.
The presentation of the family sword - The martial origins of the Celtic peoples revolved around the protection of hearth and also home. This event is the acknowledgement of the male members of the bride's family members that they also now have a new connection and also a brand-new sibling in arms.
Family Arms
At Life's Minutes weddings we can provide detailed guidance on Celtic/Scottish/Irish ceremonies, from construction of the ceremony to the final true blessing in Gaelic we can help you create the day of your dreams ... |
{
"pile_set_name": "Pile-CC"
} | Experts say: "My channel is all about finding support for creating a body-affirming yoga practice that fits people's regular lives. On the channel, folks can find pose tips, practices, and discussion about making yoga work for people of all shapes and sizes and how yoga can be a powerful tool for body acceptance." — Anna Guest-Jelley, Yoga Teacher and Founder of Curvy Yoga
On an inhale, reach your front hand as far forward toward as you can, bringing the rib cage forward. On an exhale, hinge forward from the hip joint, reaching your right arm down and your left arm up, creating straight line up and down. Place your right fingertips either on top of your right ankle, on the floor, or on a block just outside the ankle. Extend the arms and open the chest.
There are so many reasons to heart yoga (after all, the practice boosts brainpower, increases strength, and can calm you down), but sometimes it’s tricky to pencil a class into a packed schedule.Does yoga therapy reduce blood pressure in patients with hypertension?: an integrative review. Okonta NR. Holistic nursing practice, 2012, Aug.;26(3):1550-5138. Long-term concentrative meditation and cognitive performance among older adults. Prakash R, Rastogi P, Dubey I. Neuropsychology, development, and cognition. Section B, Aging, neuropsychology and cognition, 2011, Dec.;19(4):1744-4128. Not to mention how quickly the cost can add up.
I just got mine so cannot review on how long it lasts. I love the color. I prefer a thin mat so I feel grounded and can hold my poses but when I do restorative or other yogas that I feel I need a bit more cushion I just place this one on top of another thin one and it is perfect. I am not experiencing that my mat is slick like some other reviews stated. I like sticky mats and I think this one is perfect and I do not slide around at all. I am 5'7 and fit on this mat fine but wish they offered a longer mat as I prefer a little more length.
The mat’s open-cell design provides an excellent textured feel, but it also absorbs moisture, meaning you’ll have to dedicate more time to keeping it clean. It’s perfect for home practice, but you may not want to lug it around because it is pretty darn heavy. The natural rubber also comes with a few trade-offs. The Jade Fusion Yoga Mat has a distinct rubber smell that takes time to go away, it loses its stickiness if left in the direct sun, it won’t last as long as some synthetic mats, and it’s near the top of the range in terms of price.
Shop a large range of styles, including loose-fitting pants, compression pants and shorts, comfortable tank tops, sports bras that offer support where you need it and much more. Tailored to allow a maximum range of motion without adding resistance, this incredibly comfortable apparel will move with your body as you work your way through a variety of poses. Shop the full collection of yoga pants to find the perfect pant for your workout. |
{
"pile_set_name": "Wikipedia (en)"
} | Laußnitz
Laußnitz (Sorbian: Łužnica) is a municipality in the district of Bautzen, in Saxony, Germany.
References
Category:Bautzen (district)
Category:Kingdom of Saxony
Category:Bezirk Dresden |
{
"pile_set_name": "Wikipedia (en)"
} | Manisha Kalyan
Manisha Kalyan is an Indian footballer who plays for the India women's national football team.
Career
India U17
Manisha get selected for 2018 BRICS U-17 Football Cup. Where she scored 1 goal against China U17 Girls in 4 caps.
References
Category:Living people
Category:Women from Punjab, India
Category:Indian footballers
Category:Gokulam Kerala F.C. players
Category:2001 births
Category:Indian women's footballers
Category:India women's international footballers
Category:Women's association football forwards |
{
"pile_set_name": "Github"
} | <?php
/**
* Implements the User class for the %MediaWiki software.
* @file
*/
/**
* \int Number of characters in user_token field.
* @ingroup Constants
*/
define( 'USER_TOKEN_LENGTH', 32 );
/**
* \int Serialized record version.
* @ingroup Constants
*/
define( 'MW_USER_VERSION', 6 );
/**
* \string Some punctuation to prevent editing from broken text-mangling proxies.
* @ingroup Constants
*/
define( 'EDIT_TOKEN_SUFFIX', '+\\' );
/**
* Thrown by User::setPassword() on error.
* @ingroup Exception
*/
class PasswordError extends MWException {
// NOP
}
/**
* The User object encapsulates all of the user-specific settings (user_id,
* name, rights, password, email address, options, last login time). Client
* classes use the getXXX() functions to access these fields. These functions
* do all the work of determining whether the user is logged in,
* whether the requested option can be satisfied from cookies or
* whether a database query is needed. Most of the settings needed
* for rendering normal pages are set in the cookie to minimize use
* of the database.
*/
class User {
/**
* \type{\arrayof{\string}} A list of default user toggles, i.e., boolean user
* preferences that are displayed by Special:Preferences as checkboxes.
* This list can be extended via the UserToggles hook or by
* $wgContLang::getExtraUserToggles().
* @showinitializer
*/
public static $mToggles = array(
'highlightbroken',
'justify',
'hideminor',
'extendwatchlist',
'usenewrc',
'numberheadings',
'showtoolbar',
'editondblclick',
'editsection',
'editsectiononrightclick',
'showtoc',
'rememberpassword',
'editwidth',
'watchcreations',
'watchdefault',
'watchmoves',
'watchdeletion',
'minordefault',
'previewontop',
'previewonfirst',
'nocache',
'enotifwatchlistpages',
'enotifusertalkpages',
'enotifminoredits',
'enotifrevealaddr',
'shownumberswatching',
'fancysig',
'externaleditor',
'externaldiff',
'showjumplinks',
'uselivepreview',
'forceeditsummary',
'watchlisthideminor',
'watchlisthidebots',
'watchlisthideown',
'watchlisthideanons',
'watchlisthideliu',
'ccmeonemails',
'diffonly',
'showhiddencats',
'noconvertlink',
'norollbackdiff',
);
/**
* \type{\arrayof{\string}} List of member variables which are saved to the
* shared cache (memcached). Any operation which changes the
* corresponding database fields must call a cache-clearing function.
* @showinitializer
*/
static $mCacheVars = array(
// user table
'mId',
'mName',
'mRealName',
'mPassword',
'mNewpassword',
'mNewpassTime',
'mEmail',
'mOptions',
'mTouched',
'mToken',
'mEmailAuthenticated',
'mEmailToken',
'mEmailTokenExpires',
'mRegistration',
'mEditCount',
// user_group table
'mGroups',
);
/**
* \type{\arrayof{\string}} Core rights.
* Each of these should have a corresponding message of the form
* "right-$right".
* @showinitializer
*/
static $mCoreRights = array(
'apihighlimits',
'autoconfirmed',
'autopatrol',
'bigdelete',
'block',
'blockemail',
'bot',
'browsearchive',
'createaccount',
'createpage',
'createtalk',
'delete',
'deletedhistory',
'deleterevision',
'edit',
'editinterface',
'editusercssjs',
'hideuser',
'import',
'importupload',
'ipblock-exempt',
'markbotedits',
'minoredit',
'move',
'movefile',
'move-rootuserpages',
'move-subpages',
'nominornewtalk',
'noratelimit',
'override-export-depth',
'patrol',
'protect',
'proxyunbannable',
'purge',
'read',
'reupload',
'reupload-shared',
'rollback',
'siteadmin',
'suppressionlog',
'suppressredirect',
'suppressrevision',
'trackback',
'undelete',
'unwatchedpages',
'upload',
'upload_by_url',
'userrights',
'userrights-interwiki',
'writeapi',
);
/**
* \string Cached results of getAllRights()
*/
static $mAllRights = false;
/** @name Cache variables */
//@{
var $mId, $mName, $mRealName, $mPassword, $mNewpassword, $mNewpassTime,
$mEmail, $mOptions, $mTouched, $mToken, $mEmailAuthenticated,
$mEmailToken, $mEmailTokenExpires, $mRegistration, $mGroups;
//@}
/**
* \bool Whether the cache variables have been loaded.
*/
var $mDataLoaded, $mAuthLoaded;
/**
* \string Initialization data source if mDataLoaded==false. May be one of:
* - 'defaults' anonymous user initialised from class defaults
* - 'name' initialise from mName
* - 'id' initialise from mId
* - 'session' log in from cookies or session if possible
*
* Use the User::newFrom*() family of functions to set this.
*/
var $mFrom;
/** @name Lazy-initialized variables, invalidated with clearInstanceCache */
//@{
var $mNewtalk, $mDatePreference, $mBlockedby, $mHash, $mSkin, $mRights,
$mBlockreason, $mBlock, $mEffectiveGroups, $mBlockedGlobally,
$mLocked, $mHideName;
//@}
/**
* Lightweight constructor for an anonymous user.
* Use the User::newFrom* factory functions for other kinds of users.
*
* @see newFromName()
* @see newFromId()
* @see newFromConfirmationCode()
* @see newFromSession()
* @see newFromRow()
*/
function User() {
$this->clearInstanceCache( 'defaults' );
}
/**
* Load the user table data for this object from the source given by mFrom.
*/
function load() {
if ( $this->mDataLoaded ) {
return;
}
wfProfileIn( __METHOD__ );
# Set it now to avoid infinite recursion in accessors
$this->mDataLoaded = true;
switch ( $this->mFrom ) {
case 'defaults':
$this->loadDefaults();
break;
case 'name':
$this->mId = self::idFromName( $this->mName );
if ( !$this->mId ) {
# Nonexistent user placeholder object
$this->loadDefaults( $this->mName );
} else {
$this->loadFromId();
}
break;
case 'id':
$this->loadFromId();
break;
case 'session':
$this->loadFromSession();
wfRunHooks( 'UserLoadAfterLoadFromSession', array( $this ) );
break;
default:
throw new MWException( "Unrecognised value for User->mFrom: \"{$this->mFrom}\"" );
}
wfProfileOut( __METHOD__ );
}
/**
* Load user table data, given mId has already been set.
* @return \bool false if the ID does not exist, true otherwise
* @private
*/
function loadFromId() {
global $wgMemc;
if ( $this->mId == 0 ) {
$this->loadDefaults();
return false;
}
# Try cache
$key = wfMemcKey( 'user', 'id', $this->mId );
$data = $wgMemc->get( $key );
if ( !is_array( $data ) || $data['mVersion'] < MW_USER_VERSION ) {
# Object is expired, load from DB
$data = false;
}
if ( !$data ) {
wfDebug( "Cache miss for user {$this->mId}\n" );
# Load from DB
if ( !$this->loadFromDatabase() ) {
# Can't load from ID, user is anonymous
return false;
}
$this->saveToCache();
} else {
wfDebug( "Got user {$this->mId} from cache\n" );
# Restore from cache
foreach ( self::$mCacheVars as $name ) {
$this->$name = $data[$name];
}
}
return true;
}
/**
* Save user data to the shared cache
*/
function saveToCache() {
$this->load();
$this->loadGroups();
if ( $this->isAnon() ) {
// Anonymous users are uncached
return;
}
$data = array();
foreach ( self::$mCacheVars as $name ) {
$data[$name] = $this->$name;
}
$data['mVersion'] = MW_USER_VERSION;
$key = wfMemcKey( 'user', 'id', $this->mId );
global $wgMemc;
$wgMemc->set( $key, $data );
}
/** @name newFrom*() static factory methods */
//@{
/**
* Static factory method for creation from username.
*
* This is slightly less efficient than newFromId(), so use newFromId() if
* you have both an ID and a name handy.
*
* @param $name \string Username, validated by Title::newFromText()
* @param $validate \mixed Validate username. Takes the same parameters as
* User::getCanonicalName(), except that true is accepted as an alias
* for 'valid', for BC.
*
* @return \type{User} The User object, or null if the username is invalid. If the
* username is not present in the database, the result will be a user object
* with a name, zero user ID and default settings.
*/
static function newFromName( $name, $validate = 'valid' ) {
if ( $validate === true ) {
$validate = 'valid';
}
$name = self::getCanonicalName( $name, $validate );
if ( $name === false ) {
return null;
} else {
# Create unloaded user object
$u = new User;
$u->mName = $name;
$u->mFrom = 'name';
return $u;
}
}
/**
* Static factory method for creation from a given user ID.
*
* @param $id \int Valid user ID
* @return \type{User} The corresponding User object
*/
static function newFromId( $id ) {
$u = new User;
$u->mId = $id;
$u->mFrom = 'id';
return $u;
}
/**
* Factory method to fetch whichever user has a given email confirmation code.
* This code is generated when an account is created or its e-mail address
* has changed.
*
* If the code is invalid or has expired, returns NULL.
*
* @param $code \string Confirmation code
* @return \type{User}
*/
static function newFromConfirmationCode( $code ) {
$dbr = wfGetDB( DB_SLAVE );
$id = $dbr->selectField( 'user', 'user_id', array(
'user_email_token' => md5( $code ),
'user_email_token_expires > ' . $dbr->addQuotes( $dbr->timestamp() ),
) );
if( $id !== false ) {
return User::newFromId( $id );
} else {
return null;
}
}
/**
* Create a new user object using data from session or cookies. If the
* login credentials are invalid, the result is an anonymous user.
*
* @return \type{User}
*/
static function newFromSession() {
$user = new User;
$user->mFrom = 'session';
return $user;
}
/**
* Create a new user object from a user row.
* The row should have all fields from the user table in it.
* @param $row array A row from the user table
* @return \type{User}
*/
static function newFromRow( $row ) {
$user = new User;
$user->loadFromRow( $row );
return $user;
}
//@}
/**
* Get the username corresponding to a given user ID
* @param $id \int User ID
* @return \string The corresponding username
*/
static function whoIs( $id ) {
$dbr = wfGetDB( DB_SLAVE );
return $dbr->selectField( 'user', 'user_name', array( 'user_id' => $id ), 'User::whoIs' );
}
/**
* Get the real name of a user given their user ID
*
* @param $id \int User ID
* @return \string The corresponding user's real name
*/
static function whoIsReal( $id ) {
$dbr = wfGetDB( DB_SLAVE );
return $dbr->selectField( 'user', 'user_real_name', array( 'user_id' => $id ), __METHOD__ );
}
/**
* Get database id given a user name
* @param $name \string Username
* @return \types{\int,\null} The corresponding user's ID, or null if user is nonexistent
*/
static function idFromName( $name ) {
$nt = Title::makeTitleSafe( NS_USER, $name );
if( is_null( $nt ) ) {
# Illegal name
return null;
}
$dbr = wfGetDB( DB_SLAVE );
$s = $dbr->selectRow( 'user', array( 'user_id' ), array( 'user_name' => $nt->getText() ), __METHOD__ );
if ( $s === false ) {
return 0;
} else {
return $s->user_id;
}
}
/**
* Does the string match an anonymous IPv4 address?
*
* This function exists for username validation, in order to reject
* usernames which are similar in form to IP addresses. Strings such
* as 300.300.300.300 will return true because it looks like an IP
* address, despite not being strictly valid.
*
* We match \d{1,3}\.\d{1,3}\.\d{1,3}\.xxx as an anonymous IP
* address because the usemod software would "cloak" anonymous IP
* addresses like this, if we allowed accounts like this to be created
* new users could get the old edits of these anonymous users.
*
* @param $name \string String to match
* @return \bool True or false
*/
static function isIP( $name ) {
return preg_match('/^\d{1,3}\.\d{1,3}\.\d{1,3}\.(?:xxx|\d{1,3})$/',$name) || IP::isIPv6($name);
}
/**
* Is the input a valid username?
*
* Checks if the input is a valid username, we don't want an empty string,
* an IP address, anything that containins slashes (would mess up subpages),
* is longer than the maximum allowed username size or doesn't begin with
* a capital letter.
*
* @param $name \string String to match
* @return \bool True or false
*/
static function isValidUserName( $name ) {
global $wgContLang, $wgMaxNameChars;
if ( $name == ''
|| User::isIP( $name )
|| strpos( $name, '/' ) !== false
|| strlen( $name ) > $wgMaxNameChars
|| $name != $wgContLang->ucfirst( $name ) ) {
wfDebugLog( 'username', __METHOD__ .
": '$name' invalid due to empty, IP, slash, length, or lowercase" );
return false;
}
// Ensure that the name can't be misresolved as a different title,
// such as with extra namespace keys at the start.
$parsed = Title::newFromText( $name );
if( is_null( $parsed )
|| $parsed->getNamespace()
|| strcmp( $name, $parsed->getPrefixedText() ) ) {
wfDebugLog( 'username', __METHOD__ .
": '$name' invalid due to ambiguous prefixes" );
return false;
}
// Check an additional blacklist of troublemaker characters.
// Should these be merged into the title char list?
$unicodeBlacklist = '/[' .
'\x{0080}-\x{009f}' . # iso-8859-1 control chars
'\x{00a0}' . # non-breaking space
'\x{2000}-\x{200f}' . # various whitespace
'\x{2028}-\x{202f}' . # breaks and control chars
'\x{3000}' . # ideographic space
'\x{e000}-\x{f8ff}' . # private use
']/u';
if( preg_match( $unicodeBlacklist, $name ) ) {
wfDebugLog( 'username', __METHOD__ .
": '$name' invalid due to blacklisted characters" );
return false;
}
return true;
}
/**
* Usernames which fail to pass this function will be blocked
* from user login and new account registrations, but may be used
* internally by batch processes.
*
* If an account already exists in this form, login will be blocked
* by a failure to pass this function.
*
* @param $name \string String to match
* @return \bool True or false
*/
static function isUsableName( $name ) {
global $wgReservedUsernames;
// Must be a valid username, obviously ;)
if ( !self::isValidUserName( $name ) ) {
return false;
}
static $reservedUsernames = false;
if ( !$reservedUsernames ) {
$reservedUsernames = $wgReservedUsernames;
wfRunHooks( 'UserGetReservedNames', array( &$reservedUsernames ) );
}
// Certain names may be reserved for batch processes.
foreach ( $reservedUsernames as $reserved ) {
if ( substr( $reserved, 0, 4 ) == 'msg:' ) {
$reserved = wfMsgForContent( substr( $reserved, 4 ) );
}
if ( $reserved == $name ) {
return false;
}
}
return true;
}
/**
* Usernames which fail to pass this function will be blocked
* from new account registrations, but may be used internally
* either by batch processes or by user accounts which have
* already been created.
*
* Additional character blacklisting may be added here
* rather than in isValidUserName() to avoid disrupting
* existing accounts.
*
* @param $name \string String to match
* @return \bool True or false
*/
static function isCreatableName( $name ) {
global $wgInvalidUsernameCharacters;
return
self::isUsableName( $name ) &&
// Registration-time character blacklisting...
!preg_match( '/[' . preg_quote( $wgInvalidUsernameCharacters, '/' ) . ']/', $name );
}
/**
* Is the input a valid password for this user?
*
* @param $password \string Desired password
* @return \bool True or false
*/
function isValidPassword( $password ) {
global $wgMinimalPasswordLength, $wgContLang;
$result = null;
if( !wfRunHooks( 'isValidPassword', array( $password, &$result, $this ) ) )
return $result;
if( $result === false )
return false;
// Password needs to be long enough, and can't be the same as the username
return strlen( $password ) >= $wgMinimalPasswordLength
&& $wgContLang->lc( $password ) !== $wgContLang->lc( $this->mName );
}
/**
* Does a string look like an e-mail address?
*
* There used to be a regular expression here, it got removed because it
* rejected valid addresses. Actually just check if there is '@' somewhere
* in the given address.
*
* @todo Check for RFC 2822 compilance (bug 959)
*
* @param $addr \string E-mail address
* @return \bool True or false
*/
public static function isValidEmailAddr( $addr ) {
$result = null;
if( !wfRunHooks( 'isValidEmailAddr', array( $addr, &$result ) ) ) {
return $result;
}
return strpos( $addr, '@' ) !== false;
}
/**
* Given unvalidated user input, return a canonical username, or false if
* the username is invalid.
* @param $name \string User input
* @param $validate \types{\string,\bool} Type of validation to use:
* - false No validation
* - 'valid' Valid for batch processes
* - 'usable' Valid for batch processes and login
* - 'creatable' Valid for batch processes, login and account creation
*/
static function getCanonicalName( $name, $validate = 'valid' ) {
# Force usernames to capital
global $wgContLang;
$name = $wgContLang->ucfirst( $name );
# Reject names containing '#'; these will be cleaned up
# with title normalisation, but then it's too late to
# check elsewhere
if( strpos( $name, '#' ) !== false )
return false;
# Clean up name according to title rules
$t = ($validate === 'valid') ?
Title::newFromText( $name ) : Title::makeTitle( NS_USER, $name );
# Check for invalid titles
if( is_null( $t ) ) {
return false;
}
# Reject various classes of invalid names
$name = $t->getText();
global $wgAuth;
$name = $wgAuth->getCanonicalName( $t->getText() );
switch ( $validate ) {
case false:
break;
case 'valid':
if ( !User::isValidUserName( $name ) ) {
$name = false;
}
break;
case 'usable':
if ( !User::isUsableName( $name ) ) {
$name = false;
}
break;
case 'creatable':
if ( !User::isCreatableName( $name ) ) {
$name = false;
}
break;
default:
throw new MWException( 'Invalid parameter value for $validate in '.__METHOD__ );
}
return $name;
}
/**
* Count the number of edits of a user
* @todo It should not be static and some day should be merged as proper member function / deprecated -- domas
*
* @param $uid \int User ID to check
* @return \int The user's edit count
*/
static function edits( $uid ) {
wfProfileIn( __METHOD__ );
$dbr = wfGetDB( DB_SLAVE );
// check if the user_editcount field has been initialized
$field = $dbr->selectField(
'user', 'user_editcount',
array( 'user_id' => $uid ),
__METHOD__
);
if( $field === null ) { // it has not been initialized. do so.
$dbw = wfGetDB( DB_MASTER );
$count = $dbr->selectField(
'revision', 'count(*)',
array( 'rev_user' => $uid ),
__METHOD__
);
$dbw->update(
'user',
array( 'user_editcount' => $count ),
array( 'user_id' => $uid ),
__METHOD__
);
} else {
$count = $field;
}
wfProfileOut( __METHOD__ );
return $count;
}
/**
* Return a random password. Sourced from mt_rand, so it's not particularly secure.
* @todo hash random numbers to improve security, like generateToken()
*
* @return \string New random password
*/
static function randomPassword() {
global $wgMinimalPasswordLength;
$pwchars = 'ABCDEFGHJKLMNPQRSTUVWXYZabcdefghjkmnpqrstuvwxyz';
$l = strlen( $pwchars ) - 1;
$pwlength = max( 7, $wgMinimalPasswordLength );
$digit = mt_rand(0, $pwlength - 1);
$np = '';
for ( $i = 0; $i < $pwlength; $i++ ) {
$np .= $i == $digit ? chr( mt_rand(48, 57) ) : $pwchars{ mt_rand(0, $l)};
}
return $np;
}
/**
* Set cached properties to default.
*
* @note This no longer clears uncached lazy-initialised properties;
* the constructor does that instead.
* @private
*/
function loadDefaults( $name = false ) {
wfProfileIn( __METHOD__ );
global $wgCookiePrefix;
$this->mId = 0;
$this->mName = $name;
$this->mRealName = '';
$this->mPassword = $this->mNewpassword = '';
$this->mNewpassTime = null;
$this->mEmail = '';
$this->mOptions = null; # Defer init
if ( isset( $_COOKIE[$wgCookiePrefix.'LoggedOut'] ) ) {
$this->mTouched = wfTimestamp( TS_MW, $_COOKIE[$wgCookiePrefix.'LoggedOut'] );
} else {
$this->mTouched = '0'; # Allow any pages to be cached
}
$this->setToken(); # Random
$this->mEmailAuthenticated = null;
$this->mEmailToken = '';
$this->mEmailTokenExpires = null;
$this->mRegistration = wfTimestamp( TS_MW );
$this->mGroups = array();
wfRunHooks( 'UserLoadDefaults', array( $this, $name ) );
wfProfileOut( __METHOD__ );
}
/**
* @deprecated Use wfSetupSession().
*/
function SetupSession() {
wfDeprecated( __METHOD__ );
wfSetupSession();
}
/**
* Load user data from the session or login cookie. If there are no valid
* credentials, initialises the user as an anonymous user.
* @return \bool True if the user is logged in, false otherwise.
*/
private function loadFromSession() {
global $wgMemc, $wgCookiePrefix;
$result = null;
wfRunHooks( 'UserLoadFromSession', array( $this, &$result ) );
if ( $result !== null ) {
return $result;
}
if ( isset( $_COOKIE["{$wgCookiePrefix}UserID"] ) ) {
$sId = intval( $_COOKIE["{$wgCookiePrefix}UserID"] );
if( isset( $_SESSION['wsUserID'] ) && $sId != $_SESSION['wsUserID'] ) {
$this->loadDefaults(); // Possible collision!
wfDebugLog( 'loginSessions', "Session user ID ({$_SESSION['wsUserID']}) and
cookie user ID ($sId) don't match!" );
return false;
}
$_SESSION['wsUserID'] = $sId;
} else if ( isset( $_SESSION['wsUserID'] ) ) {
if ( $_SESSION['wsUserID'] != 0 ) {
$sId = $_SESSION['wsUserID'];
} else {
$this->loadDefaults();
return false;
}
} else {
$this->loadDefaults();
return false;
}
if ( isset( $_SESSION['wsUserName'] ) ) {
$sName = $_SESSION['wsUserName'];
} else if ( isset( $_COOKIE["{$wgCookiePrefix}UserName"] ) ) {
$sName = $_COOKIE["{$wgCookiePrefix}UserName"];
$_SESSION['wsUserName'] = $sName;
} else {
$this->loadDefaults();
return false;
}
$passwordCorrect = FALSE;
$this->mId = $sId;
if ( !$this->loadFromId() ) {
# Not a valid ID, loadFromId has switched the object to anon for us
return false;
}
if ( isset( $_SESSION['wsToken'] ) ) {
$passwordCorrect = $_SESSION['wsToken'] == $this->mToken;
$from = 'session';
} else if ( isset( $_COOKIE["{$wgCookiePrefix}Token"] ) ) {
$passwordCorrect = $this->mToken == $_COOKIE["{$wgCookiePrefix}Token"];
$from = 'cookie';
} else {
# No session or persistent login cookie
$this->loadDefaults();
return false;
}
if ( ( $sName == $this->mName ) && $passwordCorrect ) {
$_SESSION['wsToken'] = $this->mToken;
wfDebug( "Logged in from $from\n" );
return true;
} else {
# Invalid credentials
wfDebug( "Can't log in from $from, invalid credentials\n" );
$this->loadDefaults();
return false;
}
}
/**
* Load user and user_group data from the database.
* $this::mId must be set, this is how the user is identified.
*
* @return \bool True if the user exists, false if the user is anonymous
* @private
*/
function loadFromDatabase() {
# Paranoia
$this->mId = intval( $this->mId );
/** Anonymous user */
if( !$this->mId ) {
$this->loadDefaults();
return false;
}
$dbr = wfGetDB( DB_MASTER );
$s = $dbr->selectRow( 'user', '*', array( 'user_id' => $this->mId ), __METHOD__ );
wfRunHooks( 'UserLoadFromDatabase', array( $this, &$s ) );
if ( $s !== false ) {
# Initialise user table data
$this->loadFromRow( $s );
$this->mGroups = null; // deferred
$this->getEditCount(); // revalidation for nulls
return true;
} else {
# Invalid user_id
$this->mId = 0;
$this->loadDefaults();
return false;
}
}
/**
* Initialize this object from a row from the user table.
*
* @param $row \type{\arrayof{\mixed}} Row from the user table to load.
*/
function loadFromRow( $row ) {
$this->mDataLoaded = true;
if ( isset( $row->user_id ) ) {
$this->mId = intval( $row->user_id );
}
$this->mName = $row->user_name;
$this->mRealName = $row->user_real_name;
$this->mPassword = $row->user_password;
$this->mNewpassword = $row->user_newpassword;
$this->mNewpassTime = wfTimestampOrNull( TS_MW, $row->user_newpass_time );
$this->mEmail = $row->user_email;
$this->decodeOptions( $row->user_options );
$this->mTouched = wfTimestamp(TS_MW,$row->user_touched);
$this->mToken = $row->user_token;
$this->mEmailAuthenticated = wfTimestampOrNull( TS_MW, $row->user_email_authenticated );
$this->mEmailToken = $row->user_email_token;
$this->mEmailTokenExpires = wfTimestampOrNull( TS_MW, $row->user_email_token_expires );
$this->mRegistration = wfTimestampOrNull( TS_MW, $row->user_registration );
$this->mEditCount = $row->user_editcount;
}
/**
* Load the groups from the database if they aren't already loaded.
* @private
*/
function loadGroups() {
if ( is_null( $this->mGroups ) ) {
$dbr = wfGetDB( DB_MASTER );
$res = $dbr->select( 'user_groups',
array( 'ug_group' ),
array( 'ug_user' => $this->mId ),
__METHOD__ );
$this->mGroups = array();
while( $row = $dbr->fetchObject( $res ) ) {
$this->mGroups[] = $row->ug_group;
}
}
}
/**
* Clear various cached data stored in this object.
* @param $reloadFrom \string Reload user and user_groups table data from a
* given source. May be "name", "id", "defaults", "session", or false for
* no reload.
*/
function clearInstanceCache( $reloadFrom = false ) {
$this->mNewtalk = -1;
$this->mDatePreference = null;
$this->mBlockedby = -1; # Unset
$this->mHash = false;
$this->mSkin = null;
$this->mRights = null;
$this->mEffectiveGroups = null;
if ( $reloadFrom ) {
$this->mDataLoaded = false;
$this->mFrom = $reloadFrom;
}
}
/**
* Combine the language default options with any site-specific options
* and add the default language variants.
*
* @return \type{\arrayof{\string}} Array of options
*/
static function getDefaultOptions() {
global $wgNamespacesToBeSearchedDefault;
/**
* Site defaults will override the global/language defaults
*/
global $wgDefaultUserOptions, $wgContLang;
$defOpt = $wgDefaultUserOptions + $wgContLang->getDefaultUserOptionOverrides();
/**
* default language setting
*/
$variant = $wgContLang->getPreferredVariant( false );
$defOpt['variant'] = $variant;
$defOpt['language'] = $variant;
foreach( $wgNamespacesToBeSearchedDefault as $nsnum => $val ) {
$defOpt['searchNs'.$nsnum] = $val;
}
return $defOpt;
}
/**
* Get a given default option value.
*
* @param $opt \string Name of option to retrieve
* @return \string Default option value
*/
public static function getDefaultOption( $opt ) {
$defOpts = self::getDefaultOptions();
if( isset( $defOpts[$opt] ) ) {
return $defOpts[$opt];
} else {
return '';
}
}
/**
* Get a list of user toggle names
* @return \type{\arrayof{\string}} Array of user toggle names
*/
static function getToggles() {
global $wgContLang, $wgUseRCPatrol;
$extraToggles = array();
wfRunHooks( 'UserToggles', array( &$extraToggles ) );
if( $wgUseRCPatrol ) {
$extraToggles[] = 'hidepatrolled';
$extraToggles[] = 'newpageshidepatrolled';
$extraToggles[] = 'watchlisthidepatrolled';
}
return array_merge( self::$mToggles, $extraToggles, $wgContLang->getExtraUserToggles() );
}
/**
* Get blocking information
* @private
* @param $bFromSlave \bool Whether to check the slave database first. To
* improve performance, non-critical checks are done
* against slaves. Check when actually saving should be
* done against master.
*/
function getBlockedStatus( $bFromSlave = true ) {
global $wgEnableSorbs, $wgProxyWhitelist;
if ( -1 != $this->mBlockedby ) {
wfDebug( "User::getBlockedStatus: already loaded.\n" );
return;
}
wfProfileIn( __METHOD__ );
wfDebug( __METHOD__.": checking...\n" );
// Initialize data...
// Otherwise something ends up stomping on $this->mBlockedby when
// things get lazy-loaded later, causing false positive block hits
// due to -1 !== 0. Probably session-related... Nothing should be
// overwriting mBlockedby, surely?
$this->load();
$this->mBlockedby = 0;
$this->mHideName = 0;
$this->mAllowUsertalk = 0;
$ip = wfGetIP();
if ($this->isAllowed( 'ipblock-exempt' ) ) {
# Exempt from all types of IP-block
$ip = '';
}
# User/IP blocking
$this->mBlock = new Block();
$this->mBlock->fromMaster( !$bFromSlave );
if ( $this->mBlock->load( $ip , $this->mId ) ) {
wfDebug( __METHOD__.": Found block.\n" );
$this->mBlockedby = $this->mBlock->mBy;
$this->mBlockreason = $this->mBlock->mReason;
$this->mHideName = $this->mBlock->mHideName;
$this->mAllowUsertalk = $this->mBlock->mAllowUsertalk;
if ( $this->isLoggedIn() ) {
$this->spreadBlock();
}
} else {
// Bug 13611: don't remove mBlock here, to allow account creation blocks to
// apply to users. Note that the existence of $this->mBlock is not used to
// check for edit blocks, $this->mBlockedby is instead.
}
# Proxy blocking
if ( !$this->isAllowed('proxyunbannable') && !in_array( $ip, $wgProxyWhitelist ) ) {
# Local list
if ( wfIsLocallyBlockedProxy( $ip ) ) {
$this->mBlockedby = wfMsg( 'proxyblocker' );
$this->mBlockreason = wfMsg( 'proxyblockreason' );
}
# DNSBL
if ( !$this->mBlockedby && $wgEnableSorbs && !$this->getID() ) {
if ( $this->inSorbsBlacklist( $ip ) ) {
$this->mBlockedby = wfMsg( 'sorbs' );
$this->mBlockreason = wfMsg( 'sorbsreason' );
}
}
}
# Extensions
wfRunHooks( 'GetBlockedStatus', array( &$this ) );
wfProfileOut( __METHOD__ );
}
/**
* Whether the given IP is in the SORBS blacklist.
*
* @param $ip \string IP to check
* @return \bool True if blacklisted.
*/
function inSorbsBlacklist( $ip ) {
global $wgEnableSorbs, $wgSorbsUrl;
return $wgEnableSorbs &&
$this->inDnsBlacklist( $ip, $wgSorbsUrl );
}
/**
* Whether the given IP is in a given DNS blacklist.
*
* @param $ip \string IP to check
* @param $base \string URL of the DNS blacklist
* @return \bool True if blacklisted.
*/
function inDnsBlacklist( $ip, $base ) {
wfProfileIn( __METHOD__ );
$found = false;
$host = '';
// FIXME: IPv6 ??? (http://bugs.php.net/bug.php?id=33170)
if( IP::isIPv4($ip) ) {
# Make hostname
$host = "$ip.$base";
# Send query
$ipList = gethostbynamel( $host );
if( $ipList ) {
wfDebug( "Hostname $host is {$ipList[0]}, it's a proxy says $base!\n" );
$found = true;
} else {
wfDebug( "Requested $host, not found in $base.\n" );
}
}
wfProfileOut( __METHOD__ );
return $found;
}
/**
* Is this user subject to rate limiting?
*
* @return \bool True if rate limited
*/
public function isPingLimitable() {
global $wgRateLimitsExcludedGroups;
global $wgRateLimitsExcludedIPs;
if( array_intersect( $this->getEffectiveGroups(), $wgRateLimitsExcludedGroups ) ) {
// Deprecated, but kept for backwards-compatibility config
return false;
}
if( in_array( wfGetIP(), $wgRateLimitsExcludedIPs ) ) {
// No other good way currently to disable rate limits
// for specific IPs. :P
// But this is a crappy hack and should die.
return false;
}
return !$this->isAllowed('noratelimit');
}
/**
* Primitive rate limits: enforce maximum actions per time period
* to put a brake on flooding.
*
* @note When using a shared cache like memcached, IP-address
* last-hit counters will be shared across wikis.
*
* @param $action \string Action to enforce; 'edit' if unspecified
* @return \bool True if a rate limiter was tripped
*/
function pingLimiter( $action='edit' ) {
# Call the 'PingLimiter' hook
$result = false;
if( !wfRunHooks( 'PingLimiter', array( &$this, $action, $result ) ) ) {
return $result;
}
global $wgRateLimits;
if( !isset( $wgRateLimits[$action] ) ) {
return false;
}
# Some groups shouldn't trigger the ping limiter, ever
if( !$this->isPingLimitable() )
return false;
global $wgMemc, $wgRateLimitLog;
wfProfileIn( __METHOD__ );
$limits = $wgRateLimits[$action];
$keys = array();
$id = $this->getId();
$ip = wfGetIP();
$userLimit = false;
if( isset( $limits['anon'] ) && $id == 0 ) {
$keys[wfMemcKey( 'limiter', $action, 'anon' )] = $limits['anon'];
}
if( isset( $limits['user'] ) && $id != 0 ) {
$userLimit = $limits['user'];
}
if( $this->isNewbie() ) {
if( isset( $limits['newbie'] ) && $id != 0 ) {
$keys[wfMemcKey( 'limiter', $action, 'user', $id )] = $limits['newbie'];
}
if( isset( $limits['ip'] ) ) {
$keys["mediawiki:limiter:$action:ip:$ip"] = $limits['ip'];
}
$matches = array();
if( isset( $limits['subnet'] ) && preg_match( '/^(\d+\.\d+\.\d+)\.\d+$/', $ip, $matches ) ) {
$subnet = $matches[1];
$keys["mediawiki:limiter:$action:subnet:$subnet"] = $limits['subnet'];
}
}
// Check for group-specific permissions
// If more than one group applies, use the group with the highest limit
foreach ( $this->getGroups() as $group ) {
if ( isset( $limits[$group] ) ) {
if ( $userLimit === false || $limits[$group] > $userLimit ) {
$userLimit = $limits[$group];
}
}
}
// Set the user limit key
if ( $userLimit !== false ) {
wfDebug( __METHOD__.": effective user limit: $userLimit\n" );
$keys[ wfMemcKey( 'limiter', $action, 'user', $id ) ] = $userLimit;
}
$triggered = false;
foreach( $keys as $key => $limit ) {
list( $max, $period ) = $limit;
$summary = "(limit $max in {$period}s)";
$count = $wgMemc->get( $key );
if( $count ) {
if( $count > $max ) {
wfDebug( __METHOD__.": tripped! $key at $count $summary\n" );
if( $wgRateLimitLog ) {
@error_log( wfTimestamp( TS_MW ) . ' ' . wfWikiID() . ': ' . $this->getName() . " tripped $key at $count $summary\n", 3, $wgRateLimitLog );
}
$triggered = true;
} else {
wfDebug( __METHOD__.": ok. $key at $count $summary\n" );
}
} else {
wfDebug( __METHOD__.": adding record for $key $summary\n" );
$wgMemc->add( $key, 1, intval( $period ) );
}
$wgMemc->incr( $key );
}
wfProfileOut( __METHOD__ );
return $triggered;
}
/**
* Check if user is blocked
*
* @param $bFromSlave \bool Whether to check the slave database instead of the master
* @return \bool True if blocked, false otherwise
*/
function isBlocked( $bFromSlave = true ) { // hacked from false due to horrible probs on site
wfDebug( "User::isBlocked: enter\n" );
$this->getBlockedStatus( $bFromSlave );
return $this->mBlockedby !== 0;
}
/**
* Check if user is blocked from editing a particular article
*
* @param $title \string Title to check
* @param $bFromSlave \bool Whether to check the slave database instead of the master
* @return \bool True if blocked, false otherwise
*/
function isBlockedFrom( $title, $bFromSlave = false ) {
global $wgBlockAllowsUTEdit;
wfProfileIn( __METHOD__ );
wfDebug( __METHOD__.": enter\n" );
wfDebug( __METHOD__.": asking isBlocked()\n" );
$blocked = $this->isBlocked( $bFromSlave );
$allowUsertalk = ($wgBlockAllowsUTEdit ? $this->mAllowUsertalk : false);
# If a user's name is suppressed, they cannot make edits anywhere
if ( !$this->mHideName && $allowUsertalk && $title->getText() === $this->getName() &&
$title->getNamespace() == NS_USER_TALK ) {
$blocked = false;
wfDebug( __METHOD__.": self-talk page, ignoring any blocks\n" );
}
wfProfileOut( __METHOD__ );
return $blocked;
}
/**
* If user is blocked, return the name of the user who placed the block
* @return \string name of blocker
*/
function blockedBy() {
$this->getBlockedStatus();
return $this->mBlockedby;
}
/**
* If user is blocked, return the specified reason for the block
* @return \string Blocking reason
*/
function blockedFor() {
$this->getBlockedStatus();
return $this->mBlockreason;
}
/**
* If user is blocked, return the ID for the block
* @return \int Block ID
*/
function getBlockId() {
$this->getBlockedStatus();
return ($this->mBlock ? $this->mBlock->mId : false);
}
/**
* Check if user is blocked on all wikis.
* Do not use for actual edit permission checks!
* This is intented for quick UI checks.
*
* @param $ip \type{\string} IP address, uses current client if none given
* @return \type{\bool} True if blocked, false otherwise
*/
function isBlockedGlobally( $ip = '' ) {
if( $this->mBlockedGlobally !== null ) {
return $this->mBlockedGlobally;
}
// User is already an IP?
if( IP::isIPAddress( $this->getName() ) ) {
$ip = $this->getName();
} else if( !$ip ) {
$ip = wfGetIP();
}
$blocked = false;
wfRunHooks( 'UserIsBlockedGlobally', array( &$this, $ip, &$blocked ) );
$this->mBlockedGlobally = (bool)$blocked;
return $this->mBlockedGlobally;
}
/**
* Check if user account is locked
*
* @return \type{\bool} True if locked, false otherwise
*/
function isLocked() {
if( $this->mLocked !== null ) {
return $this->mLocked;
}
global $wgAuth;
$authUser = $wgAuth->getUserInstance( $this );
$this->mLocked = (bool)$authUser->isLocked();
return $this->mLocked;
}
/**
* Check if user account is hidden
*
* @return \type{\bool} True if hidden, false otherwise
*/
function isHidden() {
if( $this->mHideName !== null ) {
return $this->mHideName;
}
$this->getBlockedStatus();
if( !$this->mHideName ) {
global $wgAuth;
$authUser = $wgAuth->getUserInstance( $this );
$this->mHideName = (bool)$authUser->isHidden();
}
return $this->mHideName;
}
/**
* Get the user's ID.
* @return \int The user's ID; 0 if the user is anonymous or nonexistent
*/
function getId() {
if( $this->mId === null and $this->mName !== null
and User::isIP( $this->mName ) ) {
// Special case, we know the user is anonymous
return 0;
} elseif( $this->mId === null ) {
// Don't load if this was initialized from an ID
$this->load();
}
return $this->mId;
}
/**
* Set the user and reload all fields according to a given ID
* @param $v \int User ID to reload
*/
function setId( $v ) {
$this->mId = $v;
$this->clearInstanceCache( 'id' );
}
/**
* Get the user name, or the IP of an anonymous user
* @return \string User's name or IP address
*/
function getName() {
if ( !$this->mDataLoaded && $this->mFrom == 'name' ) {
# Special case optimisation
return $this->mName;
} else {
$this->load();
if ( $this->mName === false ) {
# Clean up IPs
$this->mName = IP::sanitizeIP( wfGetIP() );
}
return $this->mName;
}
}
/**
* Set the user name.
*
* This does not reload fields from the database according to the given
* name. Rather, it is used to create a temporary "nonexistent user" for
* later addition to the database. It can also be used to set the IP
* address for an anonymous user to something other than the current
* remote IP.
*
* @note User::newFromName() has rougly the same function, when the named user
* does not exist.
* @param $str \string New user name to set
*/
function setName( $str ) {
$this->load();
$this->mName = $str;
}
/**
* Get the user's name escaped by underscores.
* @return \string Username escaped by underscores.
*/
function getTitleKey() {
return str_replace( ' ', '_', $this->getName() );
}
/**
* Check if the user has new messages.
* @return \bool True if the user has new messages
*/
function getNewtalk() {
$this->load();
# Load the newtalk status if it is unloaded (mNewtalk=-1)
if( $this->mNewtalk === -1 ) {
$this->mNewtalk = false; # reset talk page status
# Check memcached separately for anons, who have no
# entire User object stored in there.
if( !$this->mId ) {
global $wgMemc;
$key = wfMemcKey( 'newtalk', 'ip', $this->getName() );
$newtalk = $wgMemc->get( $key );
if( strval( $newtalk ) !== '' ) {
$this->mNewtalk = (bool)$newtalk;
} else {
// Since we are caching this, make sure it is up to date by getting it
// from the master
$this->mNewtalk = $this->checkNewtalk( 'user_ip', $this->getName(), true );
$wgMemc->set( $key, (int)$this->mNewtalk, 1800 );
}
} else {
$this->mNewtalk = $this->checkNewtalk( 'user_id', $this->mId );
}
}
return (bool)$this->mNewtalk;
}
/**
* Return the talk page(s) this user has new messages on.
* @return \type{\arrayof{\string}} Array of page URLs
*/
function getNewMessageLinks() {
$talks = array();
if (!wfRunHooks('UserRetrieveNewTalks', array(&$this, &$talks)))
return $talks;
if (!$this->getNewtalk())
return array();
$up = $this->getUserPage();
$utp = $up->getTalkPage();
return array(array("wiki" => wfWikiID(), "link" => $utp->getLocalURL()));
}
/**
* Internal uncached check for new messages
*
* @see getNewtalk()
* @param $field \string 'user_ip' for anonymous users, 'user_id' otherwise
* @param $id \types{\string,\int} User's IP address for anonymous users, User ID otherwise
* @param $fromMaster \bool true to fetch from the master, false for a slave
* @return \bool True if the user has new messages
* @private
*/
function checkNewtalk( $field, $id, $fromMaster = false ) {
if ( $fromMaster ) {
$db = wfGetDB( DB_MASTER );
} else {
$db = wfGetDB( DB_SLAVE );
}
$ok = $db->selectField( 'user_newtalk', $field,
array( $field => $id ), __METHOD__ );
return $ok !== false;
}
/**
* Add or update the new messages flag
* @param $field \string 'user_ip' for anonymous users, 'user_id' otherwise
* @param $id \types{\string,\int} User's IP address for anonymous users, User ID otherwise
* @return \bool True if successful, false otherwise
* @private
*/
function updateNewtalk( $field, $id ) {
$dbw = wfGetDB( DB_MASTER );
$dbw->insert( 'user_newtalk',
array( $field => $id ),
__METHOD__,
'IGNORE' );
if ( $dbw->affectedRows() ) {
wfDebug( __METHOD__.": set on ($field, $id)\n" );
return true;
} else {
wfDebug( __METHOD__." already set ($field, $id)\n" );
return false;
}
}
/**
* Clear the new messages flag for the given user
* @param $field \string 'user_ip' for anonymous users, 'user_id' otherwise
* @param $id \types{\string,\int} User's IP address for anonymous users, User ID otherwise
* @return \bool True if successful, false otherwise
* @private
*/
function deleteNewtalk( $field, $id ) {
$dbw = wfGetDB( DB_MASTER );
$dbw->delete( 'user_newtalk',
array( $field => $id ),
__METHOD__ );
if ( $dbw->affectedRows() ) {
wfDebug( __METHOD__.": killed on ($field, $id)\n" );
return true;
} else {
wfDebug( __METHOD__.": already gone ($field, $id)\n" );
return false;
}
}
/**
* Update the 'You have new messages!' status.
* @param $val \bool Whether the user has new messages
*/
function setNewtalk( $val ) {
if( wfReadOnly() ) {
return;
}
$this->load();
$this->mNewtalk = $val;
if( $this->isAnon() ) {
$field = 'user_ip';
$id = $this->getName();
} else {
$field = 'user_id';
$id = $this->getId();
}
global $wgMemc;
if( $val ) {
$changed = $this->updateNewtalk( $field, $id );
} else {
$changed = $this->deleteNewtalk( $field, $id );
}
if( $this->isAnon() ) {
// Anons have a separate memcached space, since
// user records aren't kept for them.
$key = wfMemcKey( 'newtalk', 'ip', $id );
$wgMemc->set( $key, $val ? 1 : 0, 1800 );
}
if ( $changed ) {
$this->invalidateCache();
}
}
/**
* Generate a current or new-future timestamp to be stored in the
* user_touched field when we update things.
* @return \string Timestamp in TS_MW format
*/
private static function newTouchedTimestamp() {
global $wgClockSkewFudge;
return wfTimestamp( TS_MW, time() + $wgClockSkewFudge );
}
/**
* Clear user data from memcached.
* Use after applying fun updates to the database; caller's
* responsibility to update user_touched if appropriate.
*
* Called implicitly from invalidateCache() and saveSettings().
*/
private function clearSharedCache() {
$this->load();
if( $this->mId ) {
global $wgMemc;
$wgMemc->delete( wfMemcKey( 'user', 'id', $this->mId ) );
}
}
/**
* Immediately touch the user data cache for this account.
* Updates user_touched field, and removes account data from memcached
* for reload on the next hit.
*/
function invalidateCache() {
$this->load();
if( $this->mId ) {
$this->mTouched = self::newTouchedTimestamp();
$dbw = wfGetDB( DB_MASTER );
$dbw->update( 'user',
array( 'user_touched' => $dbw->timestamp( $this->mTouched ) ),
array( 'user_id' => $this->mId ),
__METHOD__ );
$this->clearSharedCache();
}
}
/**
* Validate the cache for this account.
* @param $timestamp \string A timestamp in TS_MW format
*/
function validateCache( $timestamp ) {
$this->load();
return ($timestamp >= $this->mTouched);
}
/**
* Get the user touched timestamp
*/
function getTouched() {
$this->load();
return $this->mTouched;
}
/**
* Set the password and reset the random token.
* Calls through to authentication plugin if necessary;
* will have no effect if the auth plugin refuses to
* pass the change through or if the legal password
* checks fail.
*
* As a special case, setting the password to null
* wipes it, so the account cannot be logged in until
* a new password is set, for instance via e-mail.
*
* @param $str \string New password to set
* @throws PasswordError on failure
*/
function setPassword( $str ) {
global $wgAuth;
if( $str !== null ) {
if( !$wgAuth->allowPasswordChange() ) {
throw new PasswordError( wfMsg( 'password-change-forbidden' ) );
}
if( !$this->isValidPassword( $str ) ) {
global $wgMinimalPasswordLength;
throw new PasswordError( wfMsgExt( 'passwordtooshort', array( 'parsemag' ),
$wgMinimalPasswordLength ) );
}
}
if( !$wgAuth->setPassword( $this, $str ) ) {
throw new PasswordError( wfMsg( 'externaldberror' ) );
}
$this->setInternalPassword( $str );
return true;
}
/**
* Set the password and reset the random token unconditionally.
*
* @param $str \string New password to set
*/
function setInternalPassword( $str ) {
$this->load();
$this->setToken();
if( $str === null ) {
// Save an invalid hash...
$this->mPassword = '';
} else {
$this->mPassword = self::crypt( $str );
}
$this->mNewpassword = '';
$this->mNewpassTime = null;
}
/**
* Get the user's current token.
* @return \string Token
*/
function getToken() {
$this->load();
return $this->mToken;
}
/**
* Set the random token (used for persistent authentication)
* Called from loadDefaults() among other places.
*
* @param $token \string If specified, set the token to this value
* @private
*/
function setToken( $token = false ) {
global $wgSecretKey, $wgProxyKey;
$this->load();
if ( !$token ) {
if ( $wgSecretKey ) {
$key = $wgSecretKey;
} elseif ( $wgProxyKey ) {
$key = $wgProxyKey;
} else {
$key = microtime();
}
$this->mToken = md5( $key . mt_rand( 0, 0x7fffffff ) . wfWikiID() . $this->mId );
} else {
$this->mToken = $token;
}
}
/**
* Set the cookie password
*
* @param $str \string New cookie password
* @private
*/
function setCookiePassword( $str ) {
$this->load();
$this->mCookiePassword = md5( $str );
}
/**
* Set the password for a password reminder or new account email
*
* @param $str \string New password to set
* @param $throttle \bool If true, reset the throttle timestamp to the present
*/
function setNewpassword( $str, $throttle = true ) {
$this->load();
$this->mNewpassword = self::crypt( $str );
if ( $throttle ) {
$this->mNewpassTime = wfTimestampNow();
}
}
/**
* Has password reminder email been sent within the last
* $wgPasswordReminderResendTime hours?
* @return \bool True or false
*/
function isPasswordReminderThrottled() {
global $wgPasswordReminderResendTime;
$this->load();
if ( !$this->mNewpassTime || !$wgPasswordReminderResendTime ) {
return false;
}
$expiry = wfTimestamp( TS_UNIX, $this->mNewpassTime ) + $wgPasswordReminderResendTime * 3600;
return time() < $expiry;
}
/**
* Get the user's e-mail address
* @return \string User's email address
*/
function getEmail() {
$this->load();
wfRunHooks( 'UserGetEmail', array( $this, &$this->mEmail ) );
return $this->mEmail;
}
/**
* Get the timestamp of the user's e-mail authentication
* @return \string TS_MW timestamp
*/
function getEmailAuthenticationTimestamp() {
$this->load();
wfRunHooks( 'UserGetEmailAuthenticationTimestamp', array( $this, &$this->mEmailAuthenticated ) );
return $this->mEmailAuthenticated;
}
/**
* Set the user's e-mail address
* @param $str \string New e-mail address
*/
function setEmail( $str ) {
$this->load();
$this->mEmail = $str;
wfRunHooks( 'UserSetEmail', array( $this, &$this->mEmail ) );
}
/**
* Get the user's real name
* @return \string User's real name
*/
function getRealName() {
$this->load();
return $this->mRealName;
}
/**
* Set the user's real name
* @param $str \string New real name
*/
function setRealName( $str ) {
$this->load();
$this->mRealName = $str;
}
/**
* Get the user's current setting for a given option.
*
* @param $oname \string The option to check
* @param $defaultOverride \string A default value returned if the option does not exist
* @return \string User's current value for the option
* @see getBoolOption()
* @see getIntOption()
*/
function getOption( $oname, $defaultOverride = '' ) {
$this->load();
if ( is_null( $this->mOptions ) ) {
if($defaultOverride != '') {
return $defaultOverride;
}
$this->mOptions = User::getDefaultOptions();
}
if ( array_key_exists( $oname, $this->mOptions ) ) {
return trim( $this->mOptions[$oname] );
} else {
return $defaultOverride;
}
}
/**
* Get the user's current setting for a given option, as a boolean value.
*
* @param $oname \string The option to check
* @return \bool User's current value for the option
* @see getOption()
*/
function getBoolOption( $oname ) {
return (bool)$this->getOption( $oname );
}
/**
* Get the user's current setting for a given option, as a boolean value.
*
* @param $oname \string The option to check
* @param $defaultOverride \int A default value returned if the option does not exist
* @return \int User's current value for the option
* @see getOption()
*/
function getIntOption( $oname, $defaultOverride=0 ) {
$val = $this->getOption( $oname );
if( $val == '' ) {
$val = $defaultOverride;
}
return intval( $val );
}
/**
* Set the given option for a user.
*
* @param $oname \string The option to set
* @param $val \mixed New value to set
*/
function setOption( $oname, $val ) {
$this->load();
if ( is_null( $this->mOptions ) ) {
$this->mOptions = User::getDefaultOptions();
}
if ( $oname == 'skin' ) {
# Clear cached skin, so the new one displays immediately in Special:Preferences
unset( $this->mSkin );
}
// Filter out any newlines that may have passed through input validation.
// Newlines are used to separate items in the options blob.
if( $val ) {
$val = str_replace( "\r\n", "\n", $val );
$val = str_replace( "\r", "\n", $val );
$val = str_replace( "\n", " ", $val );
}
// Explicitly NULL values should refer to defaults
global $wgDefaultUserOptions;
if( is_null($val) && isset($wgDefaultUserOptions[$oname]) ) {
$val = $wgDefaultUserOptions[$oname];
}
$this->mOptions[$oname] = $val;
}
/**
* Reset all options to the site defaults
*/
function restoreOptions() {
$this->mOptions = User::getDefaultOptions();
}
/**
* Get the user's preferred date format.
* @return \string User's preferred date format
*/
function getDatePreference() {
// Important migration for old data rows
if ( is_null( $this->mDatePreference ) ) {
global $wgLang;
$value = $this->getOption( 'date' );
$map = $wgLang->getDatePreferenceMigrationMap();
if ( isset( $map[$value] ) ) {
$value = $map[$value];
}
$this->mDatePreference = $value;
}
return $this->mDatePreference;
}
/**
* Get the permissions this user has.
* @return \type{\arrayof{\string}} Array of permission names
*/
function getRights() {
if ( is_null( $this->mRights ) ) {
$this->mRights = self::getGroupPermissions( $this->getEffectiveGroups() );
wfRunHooks( 'UserGetRights', array( $this, &$this->mRights ) );
// Force reindexation of rights when a hook has unset one of them
$this->mRights = array_values( $this->mRights );
}
return $this->mRights;
}
/**
* Get the list of explicit group memberships this user has.
* The implicit * and user groups are not included.
* @return \type{\arrayof{\string}} Array of internal group names
*/
function getGroups() {
$this->load();
return $this->mGroups;
}
/**
* Get the list of implicit group memberships this user has.
* This includes all explicit groups, plus 'user' if logged in,
* '*' for all accounts and autopromoted groups
* @param $recache \bool Whether to avoid the cache
* @return \type{\arrayof{\string}} Array of internal group names
*/
function getEffectiveGroups( $recache = false ) {
if ( $recache || is_null( $this->mEffectiveGroups ) ) {
$this->mEffectiveGroups = $this->getGroups();
$this->mEffectiveGroups[] = '*';
if( $this->getId() ) {
$this->mEffectiveGroups[] = 'user';
$this->mEffectiveGroups = array_unique( array_merge(
$this->mEffectiveGroups,
Autopromote::getAutopromoteGroups( $this )
) );
# Hook for additional groups
wfRunHooks( 'UserEffectiveGroups', array( &$this, &$this->mEffectiveGroups ) );
}
}
return $this->mEffectiveGroups;
}
/**
* Get the user's edit count.
* @return \int User'e edit count
*/
function getEditCount() {
if ($this->getId()) {
if ( !isset( $this->mEditCount ) ) {
/* Populate the count, if it has not been populated yet */
$this->mEditCount = User::edits($this->mId);
}
return $this->mEditCount;
} else {
/* nil */
return null;
}
}
/**
* Add the user to the given group.
* This takes immediate effect.
* @param $group \string Name of the group to add
*/
function addGroup( $group ) {
$dbw = wfGetDB( DB_MASTER );
if( $this->getId() ) {
$dbw->insert( 'user_groups',
array(
'ug_user' => $this->getID(),
'ug_group' => $group,
),
'User::addGroup',
array( 'IGNORE' ) );
}
$this->loadGroups();
$this->mGroups[] = $group;
$this->mRights = User::getGroupPermissions( $this->getEffectiveGroups( true ) );
$this->invalidateCache();
}
/**
* Remove the user from the given group.
* This takes immediate effect.
* @param $group \string Name of the group to remove
*/
function removeGroup( $group ) {
$this->load();
$dbw = wfGetDB( DB_MASTER );
$dbw->delete( 'user_groups',
array(
'ug_user' => $this->getID(),
'ug_group' => $group,
),
'User::removeGroup' );
$this->loadGroups();
$this->mGroups = array_diff( $this->mGroups, array( $group ) );
$this->mRights = User::getGroupPermissions( $this->getEffectiveGroups( true ) );
$this->invalidateCache();
}
/**
* Get whether the user is logged in
* @return \bool True or false
*/
function isLoggedIn() {
return $this->getID() != 0;
}
/**
* Get whether the user is anonymous
* @return \bool True or false
*/
function isAnon() {
return !$this->isLoggedIn();
}
/**
* Get whether the user is a bot
* @return \bool True or false
* @deprecated
*/
function isBot() {
wfDeprecated( __METHOD__ );
return $this->isAllowed( 'bot' );
}
/**
* Check if user is allowed to access a feature / make an action
* @param $action \string action to be checked
* @return \bool True if action is allowed, else false
*/
function isAllowed( $action = '' ) {
if ( $action === '' )
return true; // In the spirit of DWIM
# Patrolling may not be enabled
if( $action === 'patrol' || $action === 'autopatrol' ) {
global $wgUseRCPatrol, $wgUseNPPatrol;
if( !$wgUseRCPatrol && !$wgUseNPPatrol )
return false;
}
# Use strict parameter to avoid matching numeric 0 accidentally inserted
# by misconfiguration: 0 == 'foo'
return in_array( $action, $this->getRights(), true );
}
/**
* Check whether to enable recent changes patrol features for this user
* @return \bool True or false
*/
public function useRCPatrol() {
global $wgUseRCPatrol;
return( $wgUseRCPatrol && ($this->isAllowed('patrol') || $this->isAllowed('patrolmarks')) );
}
/**
* Check whether to enable new pages patrol features for this user
* @return \bool True or false
*/
public function useNPPatrol() {
global $wgUseRCPatrol, $wgUseNPPatrol;
return( ($wgUseRCPatrol || $wgUseNPPatrol) && ($this->isAllowed('patrol') || $this->isAllowed('patrolmarks')) );
}
/**
* Get the current skin, loading it if required
* @return \type{Skin} Current skin
* @todo FIXME : need to check the old failback system [AV]
*/
function &getSkin() {
global $wgRequest, $wgAllowUserSkin, $wgDefaultSkin;
if ( ! isset( $this->mSkin ) ) {
wfProfileIn( __METHOD__ );
if( $wgAllowUserSkin ) {
# get the user skin
$userSkin = $this->getOption( 'skin' );
$userSkin = $wgRequest->getVal('useskin', $userSkin);
} else {
# if we're not allowing users to override, then use the default
$userSkin = $wgDefaultSkin;
}
$this->mSkin =& Skin::newFromKey( $userSkin );
wfProfileOut( __METHOD__ );
}
return $this->mSkin;
}
/**
* Check the watched status of an article.
* @param $title \type{Title} Title of the article to look at
* @return \bool True if article is watched
*/
function isWatched( $title ) {
$wl = WatchedItem::fromUserTitle( $this, $title );
return $wl->isWatched();
}
/**
* Watch an article.
* @param $title \type{Title} Title of the article to look at
*/
function addWatch( $title ) {
$wl = WatchedItem::fromUserTitle( $this, $title );
$wl->addWatch();
$this->invalidateCache();
}
/**
* Stop watching an article.
* @param $title \type{Title} Title of the article to look at
*/
function removeWatch( $title ) {
$wl = WatchedItem::fromUserTitle( $this, $title );
$wl->removeWatch();
$this->invalidateCache();
}
/**
* Clear the user's notification timestamp for the given title.
* If e-notif e-mails are on, they will receive notification mails on
* the next change of the page if it's watched etc.
* @param $title \type{Title} Title of the article to look at
*/
function clearNotification( &$title ) {
global $wgUser, $wgUseEnotif, $wgShowUpdatedMarker;
# Do nothing if the database is locked to writes
if( wfReadOnly() ) {
return;
}
if ($title->getNamespace() == NS_USER_TALK &&
$title->getText() == $this->getName() ) {
if (!wfRunHooks('UserClearNewTalkNotification', array(&$this)))
return;
$this->setNewtalk( false );
}
if( !$wgUseEnotif && !$wgShowUpdatedMarker ) {
return;
}
if( $this->isAnon() ) {
// Nothing else to do...
return;
}
// Only update the timestamp if the page is being watched.
// The query to find out if it is watched is cached both in memcached and per-invocation,
// and when it does have to be executed, it can be on a slave
// If this is the user's newtalk page, we always update the timestamp
if ($title->getNamespace() == NS_USER_TALK &&
$title->getText() == $wgUser->getName())
{
$watched = true;
} elseif ( $this->getId() == $wgUser->getId() ) {
$watched = $title->userIsWatching();
} else {
$watched = true;
}
// If the page is watched by the user (or may be watched), update the timestamp on any
// any matching rows
if ( $watched ) {
$dbw = wfGetDB( DB_MASTER );
$dbw->update( 'watchlist',
array( /* SET */
'wl_notificationtimestamp' => NULL
), array( /* WHERE */
'wl_title' => $title->getDBkey(),
'wl_namespace' => $title->getNamespace(),
'wl_user' => $this->getID()
), __METHOD__
);
}
}
/**
* Resets all of the given user's page-change notification timestamps.
* If e-notif e-mails are on, they will receive notification mails on
* the next change of any watched page.
*
* @param $currentUser \int User ID
*/
function clearAllNotifications( $currentUser ) {
global $wgUseEnotif, $wgShowUpdatedMarker;
if ( !$wgUseEnotif && !$wgShowUpdatedMarker ) {
$this->setNewtalk( false );
return;
}
if( $currentUser != 0 ) {
$dbw = wfGetDB( DB_MASTER );
$dbw->update( 'watchlist',
array( /* SET */
'wl_notificationtimestamp' => NULL
), array( /* WHERE */
'wl_user' => $currentUser
), __METHOD__
);
# We also need to clear here the "you have new message" notification for the own user_talk page
# This is cleared one page view later in Article::viewUpdates();
}
}
/**
* Encode this user's options as a string
* @return \string Encoded options
* @private
*/
function encodeOptions() {
$this->load();
if ( is_null( $this->mOptions ) ) {
$this->mOptions = User::getDefaultOptions();
}
$a = array();
foreach ( $this->mOptions as $oname => $oval ) {
array_push( $a, $oname.'='.$oval );
}
$s = implode( "\n", $a );
return $s;
}
/**
* Set this user's options from an encoded string
* @param $str \string Encoded options to import
* @private
*/
function decodeOptions( $str ) {
$this->mOptions = array();
$a = explode( "\n", $str );
foreach ( $a as $s ) {
$m = array();
if ( preg_match( "/^(.[^=]*)=(.*)$/", $s, $m ) ) {
$this->mOptions[$m[1]] = $m[2];
}
}
}
/**
* Set a cookie on the user's client. Wrapper for
* WebResponse::setCookie
* @param $name \string Name of the cookie to set
* @param $value \string Value to set
* @param $exp \int Expiration time, as a UNIX time value;
* if 0 or not specified, use the default $wgCookieExpiration
*/
protected function setCookie( $name, $value, $exp=0 ) {
global $wgRequest;
$wgRequest->response()->setcookie( $name, $value, $exp );
}
/**
* Clear a cookie on the user's client
* @param $name \string Name of the cookie to clear
*/
protected function clearCookie( $name ) {
$this->setCookie( $name, '', time() - 86400 );
}
/**
* Set the default cookies for this session on the user's client.
*/
function setCookies() {
$this->load();
if ( 0 == $this->mId ) return;
$session = array(
'wsUserID' => $this->mId,
'wsToken' => $this->mToken,
'wsUserName' => $this->getName()
);
$cookies = array(
'UserID' => $this->mId,
'UserName' => $this->getName(),
);
if ( 1 == $this->getOption( 'rememberpassword' ) ) {
$cookies['Token'] = $this->mToken;
} else {
$cookies['Token'] = false;
}
wfRunHooks( 'UserSetCookies', array( $this, &$session, &$cookies ) );
#check for null, since the hook could cause a null value
if ( !is_null( $session ) && isset( $_SESSION ) ){
$_SESSION = $session + $_SESSION;
}
foreach ( $cookies as $name => $value ) {
if ( $value === false ) {
$this->clearCookie( $name );
} else {
$this->setCookie( $name, $value );
}
}
}
/**
* Log this user out.
*/
function logout() {
global $wgUser;
if( wfRunHooks( 'UserLogout', array(&$this) ) ) {
$this->doLogout();
}
}
/**
* Clear the user's cookies and session, and reset the instance cache.
* @private
* @see logout()
*/
function doLogout() {
$this->clearInstanceCache( 'defaults' );
$_SESSION['wsUserID'] = 0;
$this->clearCookie( 'UserID' );
$this->clearCookie( 'Token' );
# Remember when user logged out, to prevent seeing cached pages
$this->setCookie( 'LoggedOut', wfTimestampNow(), time() + 86400 );
}
/**
* Save this user's settings into the database.
* @todo Only rarely do all these fields need to be set!
*/
function saveSettings() {
$this->load();
if ( wfReadOnly() ) { return; }
if ( 0 == $this->mId ) { return; }
$this->mTouched = self::newTouchedTimestamp();
$dbw = wfGetDB( DB_MASTER );
$dbw->update( 'user',
array( /* SET */
'user_name' => $this->mName,
'user_password' => $this->mPassword,
'user_newpassword' => $this->mNewpassword,
'user_newpass_time' => $dbw->timestampOrNull( $this->mNewpassTime ),
'user_real_name' => $this->mRealName,
'user_email' => $this->mEmail,
'user_email_authenticated' => $dbw->timestampOrNull( $this->mEmailAuthenticated ),
'user_options' => $this->encodeOptions(),
'user_touched' => $dbw->timestamp($this->mTouched),
'user_token' => $this->mToken,
'user_email_token' => $this->mEmailToken,
'user_email_token_expires' => $dbw->timestampOrNull( $this->mEmailTokenExpires ),
), array( /* WHERE */
'user_id' => $this->mId
), __METHOD__
);
wfRunHooks( 'UserSaveSettings', array( $this ) );
$this->clearSharedCache();
$this->getUserPage()->invalidateCache();
}
/**
* If only this user's username is known, and it exists, return the user ID.
*/
function idForName() {
$s = trim( $this->getName() );
if ( $s === '' ) return 0;
$dbr = wfGetDB( DB_SLAVE );
$id = $dbr->selectField( 'user', 'user_id', array( 'user_name' => $s ), __METHOD__ );
if ( $id === false ) {
$id = 0;
}
return $id;
}
/**
* Add a user to the database, return the user object
*
* @param $name \string Username to add
* @param $params \type{\arrayof{\string}} Non-default parameters to save to the database:
* - password The user's password. Password logins will be disabled if this is omitted.
* - newpassword A temporary password mailed to the user
* - email The user's email address
* - email_authenticated The email authentication timestamp
* - real_name The user's real name
* - options An associative array of non-default options
* - token Random authentication token. Do not set.
* - registration Registration timestamp. Do not set.
*
* @return \type{User} A new User object, or null if the username already exists
*/
static function createNew( $name, $params = array() ) {
$user = new User;
$user->load();
if ( isset( $params['options'] ) ) {
$user->mOptions = $params['options'] + $user->mOptions;
unset( $params['options'] );
}
$dbw = wfGetDB( DB_MASTER );
$seqVal = $dbw->nextSequenceValue( 'user_user_id_seq' );
$fields = array(
'user_id' => $seqVal,
'user_name' => $name,
'user_password' => $user->mPassword,
'user_newpassword' => $user->mNewpassword,
'user_newpass_time' => $dbw->timestamp( $user->mNewpassTime ),
'user_email' => $user->mEmail,
'user_email_authenticated' => $dbw->timestampOrNull( $user->mEmailAuthenticated ),
'user_real_name' => $user->mRealName,
'user_options' => $user->encodeOptions(),
'user_token' => $user->mToken,
'user_registration' => $dbw->timestamp( $user->mRegistration ),
'user_editcount' => 0,
);
foreach ( $params as $name => $value ) {
$fields["user_$name"] = $value;
}
$dbw->insert( 'user', $fields, __METHOD__, array( 'IGNORE' ) );
if ( $dbw->affectedRows() ) {
$newUser = User::newFromId( $dbw->insertId() );
} else {
$newUser = null;
}
return $newUser;
}
/**
* Add this existing user object to the database
*/
function addToDatabase() {
$this->load();
$dbw = wfGetDB( DB_MASTER );
$seqVal = $dbw->nextSequenceValue( 'user_user_id_seq' );
$dbw->insert( 'user',
array(
'user_id' => $seqVal,
'user_name' => $this->mName,
'user_password' => $this->mPassword,
'user_newpassword' => $this->mNewpassword,
'user_newpass_time' => $dbw->timestamp( $this->mNewpassTime ),
'user_email' => $this->mEmail,
'user_email_authenticated' => $dbw->timestampOrNull( $this->mEmailAuthenticated ),
'user_real_name' => $this->mRealName,
'user_options' => $this->encodeOptions(),
'user_token' => $this->mToken,
'user_registration' => $dbw->timestamp( $this->mRegistration ),
'user_editcount' => 0,
), __METHOD__
);
$this->mId = $dbw->insertId();
// Clear instance cache other than user table data, which is already accurate
$this->clearInstanceCache();
}
/**
* If this (non-anonymous) user is blocked, block any IP address
* they've successfully logged in from.
*/
function spreadBlock() {
wfDebug( __METHOD__."()\n" );
$this->load();
if ( $this->mId == 0 ) {
return;
}
$userblock = Block::newFromDB( '', $this->mId );
if ( !$userblock ) {
return;
}
$userblock->doAutoblock( wfGetIp() );
}
/**
* Generate a string which will be different for any combination of
* user options which would produce different parser output.
* This will be used as part of the hash key for the parser cache,
* so users will the same options can share the same cached data
* safely.
*
* Extensions which require it should install 'PageRenderingHash' hook,
* which will give them a chance to modify this key based on their own
* settings.
*
* @return \string Page rendering hash
*/
function getPageRenderingHash() {
global $wgUseDynamicDates, $wgRenderHashAppend, $wgLang, $wgContLang;
if( $this->mHash ){
return $this->mHash;
}
// stubthreshold is only included below for completeness,
// it will always be 0 when this function is called by parsercache.
$confstr = $this->getOption( 'math' );
$confstr .= '!' . $this->getOption( 'stubthreshold' );
if ( $wgUseDynamicDates ) {
$confstr .= '!' . $this->getDatePreference();
}
$confstr .= '!' . ($this->getOption( 'numberheadings' ) ? '1' : '');
$confstr .= '!' . $wgLang->getCode();
$confstr .= '!' . $this->getOption( 'thumbsize' );
// add in language specific options, if any
$extra = $wgContLang->getExtraHashOptions();
$confstr .= $extra;
$confstr .= $wgRenderHashAppend;
// Give a chance for extensions to modify the hash, if they have
// extra options or other effects on the parser cache.
wfRunHooks( 'PageRenderingHash', array( &$confstr ) );
// Make it a valid memcached key fragment
$confstr = str_replace( ' ', '_', $confstr );
$this->mHash = $confstr;
return $confstr;
}
/**
* Get whether the user is explicitly blocked from account creation.
* @return \bool True if blocked
*/
function isBlockedFromCreateAccount() {
$this->getBlockedStatus();
return $this->mBlock && $this->mBlock->mCreateAccount;
}
/**
* Get whether the user is blocked from using Special:Emailuser.
* @return \bool True if blocked
*/
function isBlockedFromEmailuser() {
$this->getBlockedStatus();
return $this->mBlock && $this->mBlock->mBlockEmail;
}
/**
* Get whether the user is allowed to create an account.
* @return \bool True if allowed
*/
function isAllowedToCreateAccount() {
return $this->isAllowed( 'createaccount' ) && !$this->isBlockedFromCreateAccount();
}
/**
* @deprecated
*/
function setLoaded( $loaded ) {
wfDeprecated( __METHOD__ );
}
/**
* Get this user's personal page title.
*
* @return \type{Title} User's personal page title
*/
function getUserPage() {
return Title::makeTitle( NS_USER, $this->getName() );
}
/**
* Get this user's talk page title.
*
* @return \type{Title} User's talk page title
*/
function getTalkPage() {
$title = $this->getUserPage();
return $title->getTalkPage();
}
/**
* Get the maximum valid user ID.
* @return \int User ID
* @static
*/
function getMaxID() {
static $res; // cache
if ( isset( $res ) )
return $res;
else {
$dbr = wfGetDB( DB_SLAVE );
return $res = $dbr->selectField( 'user', 'max(user_id)', false, 'User::getMaxID' );
}
}
/**
* Determine whether the user is a newbie. Newbies are either
* anonymous IPs, or the most recently created accounts.
* @return \bool True if the user is a newbie
*/
function isNewbie() {
return !$this->isAllowed( 'autoconfirmed' );
}
/**
* Is the user active? We check to see if they've made at least
* X number of edits in the last Y days.
*
* @return \bool True if the user is active, false if not.
*/
public function isActiveEditor() {
global $wgActiveUserEditCount, $wgActiveUserDays;
$dbr = wfGetDB( DB_SLAVE );
// Stolen without shame from RC
$cutoff_unixtime = time() - ( $wgActiveUserDays * 86400 );
$cutoff_unixtime = $cutoff_unixtime - ( $cutoff_unixtime % 86400 );
$oldTime = $dbr->addQuotes( $dbr->timestamp( $cutoff_unixtime ) );
$res = $dbr->select( 'revision', '1',
array( 'rev_user_text' => $this->getName(), "rev_timestamp > $oldTime"),
__METHOD__,
array('LIMIT' => $wgActiveUserEditCount ) );
$count = $dbr->numRows($res);
$dbr->freeResult($res);
return $count == $wgActiveUserEditCount;
}
/**
* Check to see if the given clear-text password is one of the accepted passwords
* @param $password \string user password.
* @return \bool True if the given password is correct, otherwise False.
*/
function checkPassword( $password ) {
global $wgAuth;
$this->load();
// Even though we stop people from creating passwords that
// are shorter than this, doesn't mean people wont be able
// to. Certain authentication plugins do NOT want to save
// domain passwords in a mysql database, so we should
// check this (incase $wgAuth->strict() is false).
if( !$this->isValidPassword( $password ) ) {
return false;
}
if( $wgAuth->authenticate( $this->getName(), $password ) ) {
return true;
} elseif( $wgAuth->strict() ) {
/* Auth plugin doesn't allow local authentication */
return false;
} elseif( $wgAuth->strictUserAuth( $this->getName() ) ) {
/* Auth plugin doesn't allow local authentication for this user name */
return false;
}
if ( self::comparePasswords( $this->mPassword, $password, $this->mId ) ) {
return true;
} elseif ( function_exists( 'iconv' ) ) {
# Some wikis were converted from ISO 8859-1 to UTF-8, the passwords can't be converted
# Check for this with iconv
$cp1252Password = iconv( 'UTF-8', 'WINDOWS-1252//TRANSLIT', $password );
if ( self::comparePasswords( $this->mPassword, $cp1252Password, $this->mId ) ) {
return true;
}
}
return false;
}
/**
* Check if the given clear-text password matches the temporary password
* sent by e-mail for password reset operations.
* @return \bool True if matches, false otherwise
*/
function checkTemporaryPassword( $plaintext ) {
global $wgNewPasswordExpiry;
if( self::comparePasswords( $this->mNewpassword, $plaintext, $this->getId() ) ) {
$this->load();
$expiry = wfTimestamp( TS_UNIX, $this->mNewpassTime ) + $wgNewPasswordExpiry;
return ( time() < $expiry );
} else {
return false;
}
}
/**
* Initialize (if necessary) and return a session token value
* which can be used in edit forms to show that the user's
* login credentials aren't being hijacked with a foreign form
* submission.
*
* @param $salt \types{\string,\arrayof{\string}} Optional function-specific data for hashing
* @return \string The new edit token
*/
function editToken( $salt = '' ) {
if ( $this->isAnon() ) {
return EDIT_TOKEN_SUFFIX;
} else {
if( !isset( $_SESSION['wsEditToken'] ) ) {
$token = $this->generateToken();
$_SESSION['wsEditToken'] = $token;
} else {
$token = $_SESSION['wsEditToken'];
}
if( is_array( $salt ) ) {
$salt = implode( '|', $salt );
}
return md5( $token . $salt ) . EDIT_TOKEN_SUFFIX;
}
}
/**
* Generate a looking random token for various uses.
*
* @param $salt \string Optional salt value
* @return \string The new random token
*/
function generateToken( $salt = '' ) {
$token = dechex( mt_rand() ) . dechex( mt_rand() );
return md5( $token . $salt );
}
/**
* Check given value against the token value stored in the session.
* A match should confirm that the form was submitted from the
* user's own login session, not a form submission from a third-party
* site.
*
* @param $val \string Input value to compare
* @param $salt \string Optional function-specific data for hashing
* @return \bool Whether the token matches
*/
function matchEditToken( $val, $salt = '' ) {
$sessionToken = $this->editToken( $salt );
if ( $val != $sessionToken ) {
wfDebug( "User::matchEditToken: broken session data\n" );
}
return $val == $sessionToken;
}
/**
* Check given value against the token value stored in the session,
* ignoring the suffix.
*
* @param $val \string Input value to compare
* @param $salt \string Optional function-specific data for hashing
* @return \bool Whether the token matches
*/
function matchEditTokenNoSuffix( $val, $salt = '' ) {
$sessionToken = $this->editToken( $salt );
return substr( $sessionToken, 0, 32 ) == substr( $val, 0, 32 );
}
/**
* Generate a new e-mail confirmation token and send a confirmation/invalidation
* mail to the user's given address.
*
* @return \types{\bool,\type{WikiError}} True on success, a WikiError object on failure.
*/
function sendConfirmationMail() {
global $wgLang;
$expiration = null; // gets passed-by-ref and defined in next line.
$token = $this->confirmationToken( $expiration );
$url = $this->confirmationTokenUrl( $token );
$invalidateURL = $this->invalidationTokenUrl( $token );
$this->saveSettings();
return $this->sendMail( wfMsg( 'confirmemail_subject' ),
wfMsg( 'confirmemail_body',
wfGetIP(),
$this->getName(),
$url,
$wgLang->timeanddate( $expiration, false ),
$invalidateURL ) );
}
/**
* Send an e-mail to this user's account. Does not check for
* confirmed status or validity.
*
* @param $subject \string Message subject
* @param $body \string Message body
* @param $from \string Optional From address; if unspecified, default $wgPasswordSender will be used
* @param $replyto \string Reply-To address
* @return \types{\bool,\type{WikiError}} True on success, a WikiError object on failure
*/
function sendMail( $subject, $body, $from = null, $replyto = null ) {
if( is_null( $from ) ) {
global $wgPasswordSender;
$from = $wgPasswordSender;
}
$to = new MailAddress( $this );
$sender = new MailAddress( $from );
return UserMailer::send( $to, $sender, $subject, $body, $replyto );
}
/**
* Generate, store, and return a new e-mail confirmation code.
* A hash (unsalted, since it's used as a key) is stored.
*
* @note Call saveSettings() after calling this function to commit
* this change to the database.
*
* @param[out] &$expiration \mixed Accepts the expiration time
* @return \string New token
* @private
*/
function confirmationToken( &$expiration ) {
$now = time();
$expires = $now + 7 * 24 * 60 * 60;
$expiration = wfTimestamp( TS_MW, $expires );
$token = $this->generateToken( $this->mId . $this->mEmail . $expires );
$hash = md5( $token );
$this->load();
$this->mEmailToken = $hash;
$this->mEmailTokenExpires = $expiration;
return $token;
}
/**
* Return a URL the user can use to confirm their email address.
* @param $token \string Accepts the email confirmation token
* @return \string New token URL
* @private
*/
function confirmationTokenUrl( $token ) {
return $this->getTokenUrl( 'ConfirmEmail', $token );
}
/**
* Return a URL the user can use to invalidate their email address.
* @param $token \string Accepts the email confirmation token
* @return \string New token URL
* @private
*/
function invalidationTokenUrl( $token ) {
return $this->getTokenUrl( 'Invalidateemail', $token );
}
/**
* Internal function to format the e-mail validation/invalidation URLs.
* This uses $wgArticlePath directly as a quickie hack to use the
* hardcoded English names of the Special: pages, for ASCII safety.
*
* @note Since these URLs get dropped directly into emails, using the
* short English names avoids insanely long URL-encoded links, which
* also sometimes can get corrupted in some browsers/mailers
* (bug 6957 with Gmail and Internet Explorer).
*
* @param $page \string Special page
* @param $token \string Token
* @return \string Formatted URL
*/
protected function getTokenUrl( $page, $token ) {
global $wgArticlePath;
return wfExpandUrl(
str_replace(
'$1',
"Special:$page/$token",
$wgArticlePath ) );
}
/**
* Mark the e-mail address confirmed.
*
* @note Call saveSettings() after calling this function to commit the change.
*/
function confirmEmail() {
$this->setEmailAuthenticationTimestamp( wfTimestampNow() );
return true;
}
/**
* Invalidate the user's e-mail confirmation, and unauthenticate the e-mail
* address if it was already confirmed.
*
* @note Call saveSettings() after calling this function to commit the change.
*/
function invalidateEmail() {
$this->load();
$this->mEmailToken = null;
$this->mEmailTokenExpires = null;
$this->setEmailAuthenticationTimestamp( null );
return true;
}
/**
* Set the e-mail authentication timestamp.
* @param $timestamp \string TS_MW timestamp
*/
function setEmailAuthenticationTimestamp( $timestamp ) {
$this->load();
$this->mEmailAuthenticated = $timestamp;
wfRunHooks( 'UserSetEmailAuthenticationTimestamp', array( $this, &$this->mEmailAuthenticated ) );
}
/**
* Is this user allowed to send e-mails within limits of current
* site configuration?
* @return \bool True if allowed
*/
function canSendEmail() {
global $wgEnableEmail, $wgEnableUserEmail;
if( !$wgEnableEmail || !$wgEnableUserEmail ) {
return false;
}
$canSend = $this->isEmailConfirmed();
wfRunHooks( 'UserCanSendEmail', array( &$this, &$canSend ) );
return $canSend;
}
/**
* Is this user allowed to receive e-mails within limits of current
* site configuration?
* @return \bool True if allowed
*/
function canReceiveEmail() {
return $this->isEmailConfirmed() && !$this->getOption( 'disablemail' );
}
/**
* Is this user's e-mail address valid-looking and confirmed within
* limits of the current site configuration?
*
* @note If $wgEmailAuthentication is on, this may require the user to have
* confirmed their address by returning a code or using a password
* sent to the address from the wiki.
*
* @return \bool True if confirmed
*/
function isEmailConfirmed() {
global $wgEmailAuthentication;
$this->load();
$confirmed = true;
if( wfRunHooks( 'EmailConfirmed', array( &$this, &$confirmed ) ) ) {
if( $this->isAnon() )
return false;
if( !self::isValidEmailAddr( $this->mEmail ) )
return false;
if( $wgEmailAuthentication && !$this->getEmailAuthenticationTimestamp() )
return false;
return true;
} else {
return $confirmed;
}
}
/**
* Check whether there is an outstanding request for e-mail confirmation.
* @return \bool True if pending
*/
function isEmailConfirmationPending() {
global $wgEmailAuthentication;
return $wgEmailAuthentication &&
!$this->isEmailConfirmed() &&
$this->mEmailToken &&
$this->mEmailTokenExpires > wfTimestamp();
}
/**
* Get the timestamp of account creation.
*
* @return \types{\string,\bool} string Timestamp of account creation, or false for
* non-existent/anonymous user accounts.
*/
public function getRegistration() {
return $this->getId() > 0
? $this->mRegistration
: false;
}
/**
* Get the timestamp of the first edit
*
* @return \types{\string,\bool} string Timestamp of first edit, or false for
* non-existent/anonymous user accounts.
*/
public function getFirstEditTimestamp() {
if( $this->getId() == 0 ) return false; // anons
$dbr = wfGetDB( DB_SLAVE );
$time = $dbr->selectField( 'revision', 'rev_timestamp',
array( 'rev_user' => $this->getId() ),
__METHOD__,
array( 'ORDER BY' => 'rev_timestamp ASC' )
);
if( !$time ) return false; // no edits
return wfTimestamp( TS_MW, $time );
}
/**
* Get the permissions associated with a given list of groups
*
* @param $groups \type{\arrayof{\string}} List of internal group names
* @return \type{\arrayof{\string}} List of permission key names for given groups combined
*/
static function getGroupPermissions( $groups ) {
global $wgGroupPermissions;
$rights = array();
foreach( $groups as $group ) {
if( isset( $wgGroupPermissions[$group] ) ) {
$rights = array_merge( $rights,
// array_filter removes empty items
array_keys( array_filter( $wgGroupPermissions[$group] ) ) );
}
}
return array_unique($rights);
}
/**
* Get all the groups who have a given permission
*
* @param $role \string Role to check
* @return \type{\arrayof{\string}} List of internal group names with the given permission
*/
static function getGroupsWithPermission( $role ) {
global $wgGroupPermissions;
$allowedGroups = array();
foreach ( $wgGroupPermissions as $group => $rights ) {
if ( isset( $rights[$role] ) && $rights[$role] ) {
$allowedGroups[] = $group;
}
}
return $allowedGroups;
}
/**
* Get the localized descriptive name for a group, if it exists
*
* @param $group \string Internal group name
* @return \string Localized descriptive group name
*/
static function getGroupName( $group ) {
global $wgMessageCache;
$wgMessageCache->loadAllMessages();
$key = "group-$group";
$name = wfMsg( $key );
return $name == '' || wfEmptyMsg( $key, $name )
? $group
: $name;
}
/**
* Get the localized descriptive name for a member of a group, if it exists
*
* @param $group \string Internal group name
* @return \string Localized name for group member
*/
static function getGroupMember( $group ) {
global $wgMessageCache;
$wgMessageCache->loadAllMessages();
$key = "group-$group-member";
$name = wfMsg( $key );
return $name == '' || wfEmptyMsg( $key, $name )
? $group
: $name;
}
/**
* Return the set of defined explicit groups.
* The implicit groups (by default *, 'user' and 'autoconfirmed')
* are not included, as they are defined automatically, not in the database.
* @return \type{\arrayof{\string}} Array of internal group names
*/
static function getAllGroups() {
global $wgGroupPermissions;
return array_diff(
array_keys( $wgGroupPermissions ),
self::getImplicitGroups()
);
}
/**
* Get a list of all available permissions.
* @return \type{\arrayof{\string}} Array of permission names
*/
static function getAllRights() {
if ( self::$mAllRights === false ) {
global $wgAvailableRights;
if ( count( $wgAvailableRights ) ) {
self::$mAllRights = array_unique( array_merge( self::$mCoreRights, $wgAvailableRights ) );
} else {
self::$mAllRights = self::$mCoreRights;
}
wfRunHooks( 'UserGetAllRights', array( &self::$mAllRights ) );
}
return self::$mAllRights;
}
/**
* Get a list of implicit groups
* @return \type{\arrayof{\string}} Array of internal group names
*/
public static function getImplicitGroups() {
global $wgImplicitGroups;
$groups = $wgImplicitGroups;
wfRunHooks( 'UserGetImplicitGroups', array( &$groups ) ); #deprecated, use $wgImplictGroups instead
return $groups;
}
/**
* Get the title of a page describing a particular group
*
* @param $group \string Internal group name
* @return \types{\type{Title},\bool} Title of the page if it exists, false otherwise
*/
static function getGroupPage( $group ) {
global $wgMessageCache;
$wgMessageCache->loadAllMessages();
$page = wfMsgForContent( 'grouppage-' . $group );
if( !wfEmptyMsg( 'grouppage-' . $group, $page ) ) {
$title = Title::newFromText( $page );
if( is_object( $title ) )
return $title;
}
return false;
}
/**
* Create a link to the group in HTML, if available;
* else return the group name.
*
* @param $group \string Internal name of the group
* @param $text \string The text of the link
* @return \string HTML link to the group
*/
static function makeGroupLinkHTML( $group, $text = '' ) {
if( $text == '' ) {
$text = self::getGroupName( $group );
}
$title = self::getGroupPage( $group );
if( $title ) {
global $wgUser;
$sk = $wgUser->getSkin();
return $sk->makeLinkObj( $title, htmlspecialchars( $text ) );
} else {
return $text;
}
}
/**
* Create a link to the group in Wikitext, if available;
* else return the group name.
*
* @param $group \string Internal name of the group
* @param $text \string The text of the link
* @return \string Wikilink to the group
*/
static function makeGroupLinkWiki( $group, $text = '' ) {
if( $text == '' ) {
$text = self::getGroupName( $group );
}
$title = self::getGroupPage( $group );
if( $title ) {
$page = $title->getPrefixedText();
return "[[$page|$text]]";
} else {
return $text;
}
}
/**
* Increment the user's edit-count field.
* Will have no effect for anonymous users.
*/
function incEditCount() {
if( !$this->isAnon() ) {
$dbw = wfGetDB( DB_MASTER );
$dbw->update( 'user',
array( 'user_editcount=user_editcount+1' ),
array( 'user_id' => $this->getId() ),
__METHOD__ );
// Lazy initialization check...
if( $dbw->affectedRows() == 0 ) {
// Pull from a slave to be less cruel to servers
// Accuracy isn't the point anyway here
$dbr = wfGetDB( DB_SLAVE );
$count = $dbr->selectField( 'revision',
'COUNT(rev_user)',
array( 'rev_user' => $this->getId() ),
__METHOD__ );
// Now here's a goddamn hack...
if( $dbr !== $dbw ) {
// If we actually have a slave server, the count is
// at least one behind because the current transaction
// has not been committed and replicated.
$count++;
} else {
// But if DB_SLAVE is selecting the master, then the
// count we just read includes the revision that was
// just added in the working transaction.
}
$dbw->update( 'user',
array( 'user_editcount' => $count ),
array( 'user_id' => $this->getId() ),
__METHOD__ );
}
}
// edit count in user cache too
$this->invalidateCache();
}
/**
* Get the description of a given right
*
* @param $right \string Right to query
* @return \string Localized description of the right
*/
static function getRightDescription( $right ) {
global $wgMessageCache;
$wgMessageCache->loadAllMessages();
$key = "right-$right";
$name = wfMsg( $key );
return $name == '' || wfEmptyMsg( $key, $name )
? $right
: $name;
}
/**
* Make an old-style password hash
*
* @param $password \string Plain-text password
* @param $userId \string User ID
* @return \string Password hash
*/
static function oldCrypt( $password, $userId ) {
global $wgPasswordSalt;
if ( $wgPasswordSalt ) {
return md5( $userId . '-' . md5( $password ) );
} else {
return md5( $password );
}
}
/**
* Make a new-style password hash
*
* @param $password \string Plain-text password
* @param $salt \string Optional salt, may be random or the user ID.
* If unspecified or false, will generate one automatically
* @return \string Password hash
*/
static function crypt( $password, $salt = false ) {
global $wgPasswordSalt;
$hash = '';
if( !wfRunHooks( 'UserCryptPassword', array( &$password, &$salt, &$wgPasswordSalt, &$hash ) ) ) {
return $hash;
}
if( $wgPasswordSalt ) {
if ( $salt === false ) {
$salt = substr( wfGenerateToken(), 0, 8 );
}
return ':B:' . $salt . ':' . md5( $salt . '-' . md5( $password ) );
} else {
return ':A:' . md5( $password );
}
}
/**
* Compare a password hash with a plain-text password. Requires the user
* ID if there's a chance that the hash is an old-style hash.
*
* @param $hash \string Password hash
* @param $password \string Plain-text password to compare
* @param $userId \string User ID for old-style password salt
* @return \bool
*/
static function comparePasswords( $hash, $password, $userId = false ) {
$m = false;
$type = substr( $hash, 0, 3 );
$result = false;
if( !wfRunHooks( 'UserComparePasswords', array( &$hash, &$password, &$userId, &$result ) ) ) {
return $result;
}
if ( $type == ':A:' ) {
# Unsalted
return md5( $password ) === substr( $hash, 3 );
} elseif ( $type == ':B:' ) {
# Salted
list( $salt, $realHash ) = explode( ':', substr( $hash, 3 ), 2 );
return md5( $salt.'-'.md5( $password ) ) == $realHash;
} else {
# Old-style
return self::oldCrypt( $password, $userId ) === $hash;
}
}
/**
* Add a newuser log entry for this user
* @param $byEmail Boolean: account made by email?
*/
public function addNewUserLogEntry( $byEmail = false ) {
global $wgUser, $wgContLang, $wgNewUserLog;
if( empty($wgNewUserLog) ) {
return true; // disabled
}
$talk = $wgContLang->getFormattedNsText( NS_TALK );
if( $this->getName() == $wgUser->getName() ) {
$action = 'create';
$message = '';
} else {
$action = 'create2';
$message = $byEmail ? wfMsgForContent( 'newuserlog-byemail' ) : '';
}
$log = new LogPage( 'newusers' );
$log->addEntry( $action, $this->getUserPage(), $message, array( $this->getId() ) );
return true;
}
/**
* Add an autocreate newuser log entry for this user
* Used by things like CentralAuth and perhaps other authplugins.
*/
public function addNewUserLogEntryAutoCreate() {
global $wgNewUserLog;
if( empty($wgNewUserLog) ) {
return true; // disabled
}
$log = new LogPage( 'newusers', false );
$log->addEntry( 'autocreate', $this->getUserPage(), '', array( $this->getId() ) );
return true;
}
}
|
{
"pile_set_name": "Pile-CC"
} | Aim: To evaluate attractiveness of a smile subjected to computerized variations as perceived by orthodontic residents, operative dentistry residents, art students, and laypeople. Methods: Frontal facial photographs of 1 male and 1 female subject were altered using Adobe Photoshop 8.0. The judges who evaluated these 46 images (23 of each subject) comprised 4 groups: orthodontic residents, operative dentistry residents, art students, and laypeople. This cross-sectional study took place between December 2005 and February 2006 at the orthodontic clinic of the Aga Khan University Hospital, Fatima Jinnah Dental College, Altamash Institute of Dental Medicine, Karachi Medical & Dental College, Indus Valley School of Art & Architecture, and the waiting area of the AKUH dental clinic. A 5-point visual analog grading scale on the data-collection form was used to rate images. Descriptive statistics and Kruskal-Wallis test were used to analyze data. Results: A medium-broad to broad smile, full incisor display with 2 mm of gingival exposure, and a consonant smile arc were preferred in the female subject, while a broad smile, full incisor display, and a flat smile arc were preferred in the male subject. Variation in incisor angulation was better received than midline deviation. Conclusion: Although smile therapy is still in its infancy, society has already placed a great demand on dentists to evaluate and treat smiles. Our responsibility as orthodontists is to face this new challenge and acquire the skills to identify various smile patterns so as to better rehabilitate our patients’ smiles. World J Orthod 2008;9:132–140.
Adobe Acrobat Reader is required to view PDF files. This is a free program
available from the Adobe web site. Follow the download directions on the
Adobe web site to get your copy of Adobe Acrobat Reader. |
{
"pile_set_name": "Pile-CC"
} | Binary options age requirement
7 Binary Options – Banc de Binary
OptionRobot.com are one of the most recognised names in the binary options world and their auto trading robot software has been widely used since its inception in 2014. They offer a choice of brokers, many of whom are licensed, and their offering and terms are very clearly and concisely displayed on their website.
Binary No Deposit Bonus Archives - Binary Option Pro
Binary Options are designed for short term investment periods and can be used to hedge your trading portfolio. They have incredibly high payout rates and with minimal requirement for investment amounts.
Binary Options Bet Size - binarytribune.com
2018/11/23 · Binary Options Regulators; Trading News; First, and most important in this media age, she is photogenic, and that matters in a media-dominated world. Second, and even more important, If one brings up the requirement of profits and losses, free prices, and private property that are necessary for economic calculation, they
Algorithmic Trading Binary Options - Is the Algo Trading
Top Nigerian Binary Options Brokers | BinaryOptionsNigeria
Binary options trading is tough in itselfbut when you are having problems navigating the web demo too, you demo find that the trading takes a secondary role when compared options trying to use the platform.
What is the maximum withdrawal amount allowed by a binary
There are several different Binary Option brokers that will allow anyone over the age of 18 to open a trading account. We have done the hard work for you, and listed the top rated sites that have met our strict criteria for trading platforms.
NBOT [ New Age Binary Options Trading ] LEGIT or SCAM
2016/10/23 · NEW AGE BINARY OPTION TRADING is one of the trending binary options trading System and software in the market rebuilt and fully equipped for release and mouth-watering profits when used in your trading.
Personal Details | Binary.com
Vanuatu Regulation Increasingly Popular among Binary Options and FX Brokers. Vanuatu has a very user friendly Act, the Prevention of Frauds Act which allows an individual or a company to apply for a Securities Dealers License.
Binary Options Demo Account Traderush - suzysparkles.org
3 Easy Steps To Get Your Money Back From a Binary Options Scam
One of the major issues for the traders from India is usually the high minimum deposit requirement for most of the brokers. The majority of our best brokers have a minimum deposit of $250. Binary options brokers are essentially a one-stop site for all of your trading needs. .I was interested about trading from small age itself.i used to
Binary Options Magnet Review - artstudio107.com
Binary Options – New and Democratic Way of Trading Binary options defined a whole new era of financial trading. Nowadays, financial trading is not reserved for the chosen few but is accessible to teachers, nurses, students, and all other people over the age of 18 (or 21, depending on the country).
BEGINNER’S GUIDE TO - Most Reliable Binary Options Broker
Well most Binary Options brokers are non too bothered as any money you deposit is going to be lost so they will not be paying anything out this millenium. You cannot win at a gambling game where the wager is greater than your expected payout and the outcome is binary.
Vanuatu Binary Options and FX Brokers – TBA & Associates
The amount of Binary Options purchased at or around the same time, on the same trading asset but in different directions (Call and Put) [in other words, hedged positions], will not be considered towards the trading requirement of the refer-a-friend bonus.
HeightOption - Binary Options Trading Platform
Binary No Deposit Bonus. $200 No Deposit Bonus Options – OptionBanque BinaryOptionPro.com would like to remind you that the online trading is not permitted to minors under the age of 18. In addition, we assume no liability with respect to any incurred losses related to the speculation that you could implement. I’ve tried a lot of
System Requirements | Nadex Binary Options
Binary options have a relatively short history in the financial markets, and the market is trying to determine the relevance of binary options trading in the modern context of financial investments. BetOnline has several products in its portfolio, with BOL Financial receiving prominence for traders willing to invest in binary options. |
{
"pile_set_name": "PubMed Abstracts"
} | Brucella-Agglutinating Antibodies: Relation of Mercaptoethanol Stability to Complement Fixation.
Brucella-agglutinating antibodies from selected bovine blood serums and milk samples did not fix complement, and after treatment with 2-mercaptoethanol they lost agglutinating power. After infection of calves with Brucella abortus, strain 19, agglutinins for Brucella that were inactivated by mercaptoethanol appeared earlier than those stable to mercaptoethanol. Under the conditions of these experiments, the appearance and development of complement-fixing capacity coincided closely with the mercaptoethanol stability of the agglutinins for Brucella. |
{
"pile_set_name": "Pile-CC"
} | Occupational Safety and Health
The Advisory Council for Occupational Safety and Health is established under section 28 of the Occupational Safety and Health Act 2005. The functions of the Advisory Council are, inter alia , to give advice and assistance to the Minister of Labour, Industrial Relations and Employment in respect of matters affecting the safety, health and welfare of employees at their place of work or lodging accommodation , or any other persons whose safety, health and welfare may be affected by work activities.
The composition of the Advisory Council for Occupational Safety and Health as last reconstituted for a period of two years with effect from 31 August 2013 is as follows:-
Public Officers:
Director, Occupational Safety and Health (Chairperson);
Representative of Ministry of Civil Service & Administrative Reforms;
Representative of Ministry of Health & Quality of Life;
Representative of Ministry of Public Infrastructure, National Development Unit, Land Transport and Shipping (Public Infrastructure Division)
Representative of Ministry of Environment and Sustainable Development
Representative of Ministry of Education and Human Resources
Representative of Ministry of Energy and Public Utilities
Representative of Ministry of Agro-Industry and Food Security
Representative of Ministry of Labour, Industrial Relations and Employment
Representative of Employers:
Mr. Vinod Bhujoo
Mr Philippe K. L. Lai Choo
Ms Sylvana Ah-Hang
Mrs M Martine Rosy Appave
Mr Jacques M Florine
Mr RJacques Rohan
Mr Dayanand Kurrumchand
Mr Pradeep Dursun
Representative of Employees:
Mr. Benniparsad Seewsagur
Mr Jean-Bruneau Dorasami
Mr Yahya Paraouty
Mr Ram Nowzadick
Mr Randheer Kumar Bundhoo
Mr Mohammad Iqbal Amiran
Mr Reeaz Cuttoo
Miss Bhoopa Brizmohun
Members with wide experience in Occupational Safety and Health :
Mr Hurrychand Budhoo
Dr Parmanund Brizmohun
Subscribe to newsletter
Subscribe to the monthly newsletter, to be informed of the latest news portal, and
new services added. |
{
"pile_set_name": "Wikipedia (en)"
} | House of Leaves
House of Leaves is the debut novel by American author Mark Z. Danielewski, published in March 2000 by Pantheon Books. A bestseller, it has been translated into a number of languages, and is followed by a companion piece, The Whalestoe Letters.
The plot is centered on a (possibly fictional) documentary about a family whose house is impossibly larger on the inside than the outside. The format and structure of House of Leaves is unconventional, with unusual page layout and style, making it a prime example of ergodic literature. It contains copious footnotes, many of which contain footnotes themselves, including references to fictional books, films or articles. In contrast, some pages contain only a few words or lines of text, arranged in strange ways to mirror the events in the story, often creating both an agoraphobic and a claustrophobic effect. At points, the book must be rotated to be read. The novel is also distinctive for its multiple narrators, who interact with each other in elaborate and disorienting ways.
While some have attempted to describe the book as a horror story, many readers, as well as the author, define the book as a love story. Danielewski expands on this point in an interview: "I had one woman come up to me in a bookstore and say, 'You know, everyone told me it was a horror book, but when I finished it, I realized that it was a love story.' And she's absolutely right. In some ways, genre is a marketing tool." House of Leaves has also been described as a "satire of academic criticism."
Plot summary
House of Leaves begins with a first-person narrative by Johnny Truant, a Los Angeles tattoo parlor employee and professed unreliable narrator. Truant is searching for a new apartment when his friend Lude tells him about the apartment of the recently deceased Zampanò, a blind, elderly man who lived in Lude's apartment building.
In Zampanò's apartment, Truant discovers a manuscript written by Zampanò that turns out to be an academic study of a documentary film called The Navidson Record, though Truant says he can find no evidence that the film or its subjects ever existed.
The rest of the novel incorporates several narratives, including Zampanò's report on the (possibly fictional) film; Truant's autobiographical interjections; a small transcript of part of the film from Navidson's brother, Tom; a small transcript of interviews of many people regarding The Navidson Record by Navidson's partner, Karen; and occasional brief notes by unidentified editors, all woven together by a mass of footnotes. There is also another narrator, Truant's mother, whose voice is presented through a self-contained set of letters titled The Whalestoe Letters. Each narrator's text is printed in a distinct font, making it easier for the reader to follow the occasionally challenging format of the novel (Truant in Courier New in the footnotes, and the main narrative in Times New Roman in the American version, the unnamed editors are in Bookman, and the letters from Johnny's mother are in Dante).
The Navidson Record
Zampanò's narrative deals primarily with the Navidson family: Will Navidson, a photojournalist (partly based on Kevin Carter); his partner, Karen Green, an attractive former fashion model; and their two children, Chad and Daisy. Navidson's brother, Tom, and several other characters also play a role later in the story. The Navidson family has recently moved into a new home in Virginia.
Upon returning from a trip to Seattle, the Navidson family discovers a change in their home. A closet-like space shut behind an undecorated door appears inexplicably where previously there was only a blank wall. A second door appears at the end of the closet, leading to the children's room. As Navidson investigates this phenomenon, he finds that the internal measurements of the house are somehow larger than external measurements. Initially there is less than an inch of difference, but as time passes the interior of the house seems to expand while maintaining the same exterior proportions. A third and more extreme change asserts itself: a dark, cold hallway opens in an exterior living room wall that should project outside into their yard, but does not. Navidson films the outside of the house to show where the hallway should be but clearly is not. The filming of this anomaly comes to be referred to as "The Five and a Half Minute Hallway". This hallway leads to a maze-like complex, starting with a large room (the "Anteroom"), which in turn leads to a truly enormous space (the "Great Hall"), a room primarily distinguished by an enormous spiral staircase which appears, when viewed from the landing, to spiral down without end. There is also a multitude of corridors and rooms leading off from each passage. All of these rooms and hallways are completely unlit and featureless, consisting of smooth ash-gray walls, floors, and ceilings. The only sound disturbing the perfect silence of the hallways is a periodic low growl, the source of which is never fully explained, although an academic source "quoted" in the book hypothesizes that the growl is created by the frequent re-shaping of the house.
There is some discrepancy as to where "The Five and a Half Minute Hallway" appears. It is quoted by different characters at different times to have been located in each of the cardinal directions. This first happens when Zampanò writes that the hallway is in the western wall (House of Leaves, page 57), directly contradicting an earlier page where the hallway is mentioned to be in the northern wall (House of Leaves, page 4); Johnny's footnotes point out the contradiction.
Navidson, along with his brother Tom and some colleagues, feel compelled to explore, photograph, and videotape the house's seemingly endless series of passages, eventually driving various characters to insanity, murder, and death. Ultimately, Will releases what has been recorded and edited as The Navidson Record.
Will and Karen purchased the house because their relationship was becoming strained with Will's work-related absences. While Karen was always adamantly against marriage (claiming that she valued her freedom above anything else), she always found herself missing and needing Will when he was gone: "And yet even though Karen keeps Chad from overfilling the mold or Daisy from cutting herself with the scissors, she still cannot resist looking out the window every couple of minutes. The sound of a passing truck causes her to glance away" (House of Leaves, pp. 11–12).
Zampanò's narrative is littered with all manner of references, some quite obscure, others indicating that the Navidsons' story achieved international notoriety. Luminaries such as Stephen King, Stanley Kubrick, Douglas Hofstadter, Ken Burns, Harold Bloom, Camille Paglia, Hunter Thompson, Anne Rice, and Jacques Derrida were apparently interviewed as to their opinions about the film. However, when Truant investigates, he finds no history of the house, no evidence of the events experienced by the Navidsons, and nothing else to establish that the house or film ever existed anywhere other than in Zampanò's text.
Many of the references in Zampanò's footnotes, however, are real, existing both within his world and our world outside the novel. For example, several times Zampanò cites an actual Time-Life book, Planet Earth: Underground Worlds (House of Leaves, page 125).
Johnny's story
An adjacent story line develops in Johnny's footnotes, detailing what is progressing in Johnny's life as he is assembling the narrative. It remains unclear if Johnny's obsession with the writings of Zampanò and subsequent delusions, paranoia, etc. are the result of drug use, insanity, or the effects of Zampanò's writing itself. Johnny recounts tales of his various sexual encounters, his lust for a tattooed dancer he calls Thumper, and his bar-hopping with Lude throughout various footnotes. The reader also slowly learns more about Johnny's childhood living with an abusive foster father, engaging in violent fights at school, and of the origin of Johnny's mysterious scars (House of Leaves, p. 505). More information about Johnny can be gleaned from the Whalestoe Letters, letters his mother Pelafina wrote from The Three Attic Whalestoe Institution. Though Pelafina's letters and Johnny's footnotes contain similar accounts of their past, their memories also differ greatly at times, due to both Pelafina's and Johnny's questionable mental states. Pelafina was placed in the mental institution after supposedly attempting to strangle Johnny, only to be stopped by her husband. She remained there after Johnny's father's death. Johnny claims that his mother meant him no harm and claimed to strangle him only to protect him from missing her. It is unclear, however, if Johnny's statements about the incident—or any of his other statements, for that matter—are factual.
The Whalestoe Letters
This story is included in an appendix near the end of the book, as well as in its own, self-contained book (with additional content included in the self-contained version). It consists of Johnny's mother's letters to him from a psychiatric hospital. The letters start off fairly normal but Pelafina quickly descends into paranoia and the letters become more and more incoherent. There are also secret messages in the letters which can be decoded by combining the first letters of consecutive words.
Characters
Johnny's story
Johnny Truant
Johnny Truant serves a dual role, as primary editor of Zampanò's academic study of The Navidson Record and protagonist as revealed through footnotes and appendices.
In the beginning of the book, Truant appears to be a normal, reasonably attractive young man who happens upon a trunk full of notes left behind by the now deceased Zampanò. As Truant begins to do the editing, however, he begins to lose the tenuous grip he has on reality, and his life begins to erode around him. He stops bathing, rarely eats, stops going to work, and distances himself from essentially everyone, all in pursuit of organizing the book into a finished work that, he hopes, will finally bring him peace.
Initially intrigued by Zampanò's isolative tendencies and surreal sense of reality, Johnny unknowingly sets himself up as a victim to the daunting task that awaits him. As he begins to organize Zampanò's manuscripts, his personal footnotes detail the deterioration of his own life with analogous references to alienation and insanity: once a trespasser to Zampanò's mad realm, Truant seems to become more comfortable in the environment as the story unfolds. He even has hallucinations that parallel those of Zampanò and members of the house search team when he senses "...something inhuman..." behind him (House of Leaves, page 26).
Zampanò
Zampanò is the blind author of The Navidson Record. Approximately eighty years old at the time of his death, he is recognized by his neighbors as "eccentric" and "crazy." He was known to employ the services of volunteers (exclusively female) from local community centers to come to his apartment and read books to him. While little information is given explicitly about Zampanò's past, blindness, or personality, Johnny's introduction does state that Zampanò went blind sometime in the 1950s. Zampanò also suffers from Graphomania.
Danielewski made Zampanò blind as a reference to blind authors Homer, John Milton and Jorge Luis Borges.
Pelafina H. Lièvre
Pelafina, more commonly referred to as simply "P.", is Johnny's institutionalized mother who appears in the appendix to the text. Her story is more fully developed in The Whalestoe Letters.
Minor characters in Johnny's story
Lude: Johnny Truant's best friend, Lude is also the one that informs him of Zampanò's vacant apartment. Lude is a minor character, but some of his characteristics and actions are important in understanding Johnny. Lude assists Johnny many times in obtaining phone numbers of girls when they visit bars, clubs, and restaurants. Several times, Johnny mentions that he wishes he hadn't answered Lude's call late at night. Every time Johnny and Lude are together they seem to involve themselves in difficult situations. He is killed in a motorcycle accident near the end of the novel.
Thumper: A stripper who is a regular client of the tattoo parlour where Truant works. Although Johnny has encounters with many women, he remains fixated on Thumper throughout. Thumper's real name is eventually revealed to Johnny, but never to the reader.
The Navidson Record
Will Navidson
Will is the central character in The Navidson Record subplot of the novel. A stint in the army early in his life leads him to a very successful career as a photographer, primarily in war-torn parts of the world; his role as an impartial documentarist of war affects him deeply. Later in his life, he moves to the eponymous house (located in the southeastern Virginia countryside), in an effort to find "[a] place to drink lemonade and watch the sun set", a place to "once and for all stay in and explore the quieter side of life" (House of Leaves, page 9). However the unnatural events that occur thereafter have a profound effect upon him and his relationship with his partner, Karen.
Karen Green
Karen is Will's partner and a former fashion model. She suffers from claustrophobia, and throughout the novel refuses to enter the labyrinth within her house. She also seems to be extremely insecure regarding her relationship with Will; he is 'her rock,' though it is confirmed that she had at least three long-term affairs during the course of their relationship. Curiously, the events of the novel only seem to reduce her dependence on Will (as well as contributing to the eventual dissolution of their relationship). It is speculated that, during Karen's childhood, her stepfather once took Karen and her sister into a barn in their backyard. He put one sister in a well while he raped the other, and vice versa. This event is widely considered to be the cause of her claustrophobia. However, several footnotes and comments about the incident question this claim (another of many examples of the use of an unreliable narrator in the novel). In the aftermath of the events in the house, she becomes an unlikely editor, approaching many real characters (including Stephen King, Stanley Kubrick, Hunter S. Thompson, Douglas Hofstadter, Harold Bloom, and Jacques Derrida) for comment on The Navidson Record, albeit comment within the fictional universe of the novel. Eventually, she is reunited with Navidson after she conquers her claustrophobia and saves him from the abyss of the labyrinth.
Tom Navidson
Tom is Will Navidson's somewhat estranged twin brother; Tom is a carpenter with substance addiction problems, who is markedly less successful than Will in his personal and professional life. After approximately 8 years of little contact, Will contacts Tom when he notices that his house is larger on the inside than the outside. A section of the novel, called "Tom’s Story" is a partial transcript of documentary evidence and radio communication with the outside world during his vigil within the labyrinth, which he spends alone with his radio, waiting for Will. This section is referred to in the book as a "sometimes funny, sometimes bizarre history of thoughts passing away in the atrocity of that darkness" (House of Leaves, page 252). He often refers to "Mr. Monster" and many of the jokes and anecdotes he provides are religious in nature. However, in a test of his true character, he bravely saves Will's kids from being swallowed by the house before being swallowed himself.
Billy Reston
Billy is an engineer and a friend of Will's, whom Will enlists early on in the story to help him try to find a rational explanation for the house's oddities. Billy uses a wheelchair, having been paralyzed from the waist down in a freak engineering accident in India; Will happened to be on the scene and took a photo of Billy moments before he became paralyzed. Billy came across the photo after his accident and kept it as a reminder that he was fortunate to have survived. Once the house's irregularities become more extreme, Billy joins Will and Tom in a thorough analysis; after Holloway and his men go missing, Billy insists on joining Will on the rescue mission, navigating the maze in his wheelchair. He eventually saves Will and Holloway's men from Holloway by engaging in a firefight with him, holding him back long enough for the house to "consume" Holloway. Billy survives the journey into the maze, but suffers persistent cold spells afterward as well as sustaining damage to his wheelchair.
Holloway Roberts
Holloway is an experienced explorer whom Will contacts in an effort to properly explore the labyrinth beneath his house. Holloway is presented as the consummate outdoorsman: He has successfully engaged in numerous expeditions which would have killed normal men, and is an expert in all forms of survivalist equipment, from spelunking gear to firearms. He engages in two brief explorations of the labyrinth before deciding to take his men on a third, prolonged expedition, prior to which they load themselves up with enough food and water to last several days and enough provisions to—they believe—safely guide them back home. During the course of this exploration, Holloway reaches the bottom of the Great Staircase and becomes deranged due to finding nothing but more empty hallways. The house's bizarre architecture leads him to believe an image he sees down a hall is the "monster" stalking them when, in fact, he is actually looking at his own men; he shoots one of them, and, upon realizing what he's done, suffers a complete psychological breakdown and tries to murder them. Eventually, the house "traps" him by sealing him inside a series of locked chambers; alone and insane, Holloway records a series of unsettling final messages on a video camera before filming himself committing suicide. The tape of his death is recovered by Will from the labyrinth. The seconds leading up to the end of the tape reveal that either 1) Holloway's corpse is devoured by the "monster" he is convinced is real or 2) Holloway merely disappears into the blackness of the house.
When the House begins to attempt to harm the others late in the novel, Reston calls out Holloway's name. Whether Holloway had some influence on the house's actions (before or after his suicide) is left ambiguous.
Minor characters in The Navidson Record
Kirby 'Wax' Hook: Another explorer of the labyrinth in Navidson's house. He is ultimately shot in the shoulder by Holloway; however, he goes on to survive. The House leaves him with limited functionality in that shoulder, and an inexplicable case of impotence. However, after Navidson reenters the House for a fifth and final exploration, these symptoms disappear. Wax has a reputation as a flirt, who constantly attempts to hook up with women. He kisses Karen Green, a scene which Will later witnesses on camera.
Jed Leeder: The third explorer of the labyrinth in Navidson's house. He is shot by Holloway in the jaw, killing him.
Chad Navidson: Will Navidson and Karen Green's son, the older sibling. Around the times of the explorations, Chad is described as becoming increasingly aggressive and wandering.
Daisy Navidson: Will Navidson and Karen Green's daughter. During the explorations of the house, Daisy is described as suffering from echolalia.
Format
Danielewski wrote the book in longhand and revised it with a word processor. He then flew to Pantheon's NY headquarters to do the typesetting himself in QuarkXPress because he only trusted himself with the book's vision.
Colors
House of Leaves includes frequent and seemingly systematic color changes. While Danielewski leaves much of the interpretation of the choice of colors up to the reader, several distinct patterns emerge upon closer examination.
Notable examples include:
The word "house" is colored blue (gray for non-color editions of the book and light gray for red editions), as in house. In many places throughout the book, it is offset from the rest of the text in different directions at different times. Foreign-language equivalents of house, such as the German Haus and the French maison, are also blue.
In all colored editions, the word Minotaur and all struck passages are colored red, as in minotaur.
Many references to Johnny's mother are colored purple, as in my mother.
Font changes
Throughout the book, various changes in font serve as a way for the reader to quickly determine which of its multiple narrators’ work they are currently following. In the book, there are four fonts utilized by the four narrators. These are: Times New Roman (Zampanò), Courier (Johnny), Bookman (The Editors), and Dante (Johnny's mother). (Additional font changes are used intermittently—Janson for film intertitles, Book Antiqua for a letter written by Navidson, and so on.)
Companion works
The book was followed by a companion piece called The Whalestoe Letters, a series of letters written to the character Johnny Truant by his mother while she was confined in a mental institution. Some (but not all) of the letters are included in the second edition.
House of Leaves was accompanied by a companion piece (or vice versa), a full-length album called Haunted recorded by Danielewski's sister, Anne Danielewski, known professionally as Poe. The two works cross-pollinated heavily over the course of their creations, each inspiring the other in various ways. Poe's statement on the connection between the two works is that they are parallax views of the same story. House of Leaves references Poe and her songs several times, not only limited to her album Haunted, but Hello as well. One example occurs when the character Karen Green is interviewing various academics on their interpretations of the short film "Exploration #4"; she consults a "Poet," but there is a space between the "Poe" and the "t," suggesting that Poe at one point commented on the book. It may also be a reference to Edgar Allan Poe.
The album Haunted also draws heavily from the novel, featuring tracks called "House of Leaves", "Exploration B" and "5&½ Minute Hallway", and many less obvious references. The video for "Hey Pretty" also features Mark Danielewski reading from House of Leaves (pp. 88–89), and in House of Leaves, the band Liberty Bell's lyrics were also songs on Poe's album.
In 2017, Danielewski entered talks to adapt the novel into a TV series. If a deal is not made by February 2020, the project will be abandoned.
Reception
Stephen Poole, writing in the Guardian, admired the book's parody of academia: "Danielewski...weaves around his brutally efficient and genuinely chilling story a delightful and often very funny satire of academic criticism." Steven Moore, writing in The Washington Post, also praised the novel: "Danielewski's achievement lies in taking some staples of horror fiction – the haunted house, the mysterious manuscript that casts a spell on its hapless reader – and using his impressive erudition to recover the mythological and psychological origins of horror, and then enlisting the full array of avant-garde literary techniques to reinvigorate a genre long abandoned to hacks." The Village Voice's Emily Barton was less impressed: "Danielewski’s bloated and bollixed first novel certainly attempts to pass itself off as an ambitious work; the question for each reader is if the payoff makes the effort of slogging through its endless posturing worthwhile."
References
Citations
paperback. hardcover. hardcover/signed.
Further reading
External links
House of Leaves official forum
Random House Readers Guide
Powells Books review
The Modern Word review
The Modern Word interview
"House of Leaves by Mark Z. Danielewski", reviewed by Ted Gioia (The New Canon (blog))
Category:2000 American novels
Category:American horror novels
Category:American romance novels
Category:American satirical novels
Category:Debut novels
Category:Fictional houses
Category:Fiction with unreliable narrators
Category:Metafictional novels
Category:Novels by Mark Z. Danielewski
Category:Novels set in Los Angeles
Category:Novels set in Virginia
Category:Pantheon Books books
Category:Postmodern novels |
{
"pile_set_name": "USPTO Backgrounds"
} | This section is intended to introduce the reader to various aspects of the art that may be related to various aspects of the present invention. The following discussion is intended to provide information to facilitate a better understanding of the present invention. Accordingly, it should be understood that statements in the following discussion are to be read in this light, and not as admissions of prior art.
Most file systems today lack certain features useful for supporting mixed types of storage, as well as huge amounts of storage. In addition, most file systems today have meta data bottlenecks that limit their performance scaling in multi-core and distributed systems. The invention presented here is a novel file system implementation addressing these issues. |
{
"pile_set_name": "OpenWebText2"
} | Why one-dimensional Larsson wasn’t enough for Hall The Edmonton Oilers have bolstered their blueline, but the defenceman they added isn’t worth the premium of an elite scorer, Travis Yost writes.
Last Wednesday, the hockey world was exposed to two of the biggest one-for-one trades in the salary cap era.
Though I think the biggest winner on the day was Nashville in their ability to acquire all-world defender P.K. Subban, I do recognize that there were other factors at play with the deal. Montreal has been very guarded about the how and why behind the Subban trade, but it’s more than reasonable to assume that there was something well beyond on-ice performance that drove that transaction. There’s also the realization that Nashville was very incentivized to pull the trigger on the proposal – not only were they getting one of the better players in the universe, but they were getting out from a truly poisonous contract.
That’s why the Edmonton and New Jersey swap is a bit more interesting. This was a bona fide hockey trade – a team moving a talented winger at an extremely high cost to obtain a young defender. Oilers GM Peter Chiarelli described the high cost associated with the trade as the market cost for acquiring a first-pairing defenceman. There were, undoubtedly, additional pressures in the sense that Edmonton felt the need to shake up the roster to some degree. A repeat of last season, I’m sure, would be considered unacceptable by the decision makers there.
The problem with this trade is that I’m not sure Adam Larsson is the player that Edmonton thinks he is, and the Oilers are thus assuming significant risk in this deal. The piece moving from the organization is one of the best scorers in the game, a top-10 5-on-5 point producer on a team that’s struggled mightily to do much of anything in recent years.
In return, the Oilers have acquired a steady, defensively talented blueliner who has all of nine goals in 274 games played. Larsson can certainly play, but is a seemingly one-dimensional player worth the cost of a Taylor Hall?
I’ll be the first to remind all that goals (and points) aren’t the best indicator of production for defencemen. The more concerning part here is that from a shot analysis, the Devils were generally better with Larsson on the bench than not (about +2.5 per 60 minutes). That’s something we rarely see from first-pairing defenders. You can go through the list if you don’t believe me – the names higher on the list tend to be Norris Trophy contenders every season, while the names lower on the list seem more ripe for a buyout.
There’s an important caveat here, and that’s the fact that Larsson was brutally deployed by the Devils coaching staff over the last few years. There were many games where just about every single defensive zone start saw Adam Larsson and his partner sent over the boards to stop the bleeding and try and flip the run of play. That, understandably, has been a counterpoint made by observers regarding his average-to-middling shot differentials over the years.
If the theory is that Larsson’s been in a really tough developmental spot because of his brutal deployment, it stands to reason that a more friendly two-way approach for Todd McLellan might do wonders for both Larsson and his team. We would theorize the following would occur with more favourable zone starts: (a) more favourable shot differentials; (b) more offensive opportunities created; and (c) more favourable on-ice goal-scoring rates.
The cool thing is we can take a stab at whether or not this theory holds water. After all, Larsson wasn’t buried in every game for New Jersey – there were plenty of instances in which he saw decent or favourable offensive zone starts, and in those games, we can analyze how New Jersey performed with his role having changed.
So, below is a distribution of Larsson’s performance by offensive zone start percentage from both a Corsi% and Expected Goal% (shot differentials weighted by location) perspective, all numbers adjusted for score effects. Did Larsson’s performance change any?
So, the good news is that Larsson’s negative impact on shot differentials seems to dissipate some with more favourable offensive zone starts. Larsson’s career norms are right around the 25-45 per cent rate, which is why you see his numbers historically in the red. But when he’s really getting a lot of offensive zone looks relative to teammates, his team-relative shot differential improves to a small degree.
The troubling piece of it is that the tough zone start issue doesn’t seem to explain his poor impact on team goal-scoring rates. You can see that as his offensive zone start% climbs, the team’s goal differentials – both actual and expected – either stagnate or decline. That’s the discouraging piece of this.
Where are we left? Well, I think it’s reasonable to note that Larsson’s not a team drag on shot differential. I also think it’s reasonable to point out that he’s been thrust into that role because there are no significant returns when he sees more favourable minutes. Maybe his true talent is in shot and scoring chance suppression. Maybe his offensive game – and the offensive game of his teammates when he is out there – is just not going to materialize as we initially thought. Maybe New Jersey found an optimized role for Larsson because of all of this, and maybe Edmonton should carry over his deployment to an Oilers group that definitively needs help on the goal prevention front.
Larsson can definitely play, and I think he’s going to provide real tangible benefits to an Oilers team sorely in need of blueline help. But, the other side of the coin is that he seems to be a somewhat one-dimensional defender. That one dimension is great, but is it worth the premium of an elite scorer like Hall?
I certainly don’t think so. |
{
"pile_set_name": "PubMed Abstracts"
} | [Succinylcholine use by anesthesiologists in Croatia--is it really abandoned?].
The aim was to establish the prevalence of succinylcholine use among Croatian anesthesiologists in adult elective and emergency surgery, as well as in pediatric surgery, regarding gender, position, working place, and working experience of physicians. The anesthesiologists were expected to express their personal opinions regarding the drug, as well as experienced side effects in their own clinical practice. A total of 125 anesthesiologists (out of 590 in Croatia) from both university and county hospitals in Croatia anonymously filled out the questionnaire regarding the use of succinylcholine (Appendix 1). The questionnaire was structured to assess the use of succinylcholine in adult elective and emergency surgery, and in pediatric anesthesia, to obtain the reasons for the preference or rejection of succinylcholine, and information about observed side effects. The differences in use regarding gender, position, working place, and working experience were tested using chi-squared test and Fisher's exact test. p < 0.05 was considered significant. Vast majority (approximately 70%) of anesthesiologists in Croatia still use succinylcholine. The percentages of anesthesiologists that never use succinylcholine in adult elective, adult emergency and pediatric surgery were 20%, 6%, and 31%, respectively. There were no significant differences in the use of succinylcholine regarding position, working place, and working experience, but male anesthesiologists used it less frequently in pediatric anesthesia compared with their female colleagues (chi2 = 5.08; p = 0.02). Forty-two per cent never experienced a complication from the drug use. The most frequently reported side effects were bradycardias (67%) and myalgias (54%), followed by prolonged blockade (33%), and allergy (33%). Asystole was reported by 10% of the respondents. In conclusion, succinylcholine is still widely used by anesthesiologists in Croatia. The majority of surveyed physicians were aware of its possible dangerous adverse effects, but still use it in certain situations. Therefore, indications and contraindications for its use deserve expert consensus guidelines based on the available scientific evidence. |
{
"pile_set_name": "Pile-CC"
} | The Pittsburgh Penguins signed forward Kasperi Kapanen, their first-round pick (No. 22) at the 2014 NHL Draft, to a three-year, entry-level contract, the team announced Friday.
Kapanen, 17, is the first 2014 draft pick to sign an NHL contract. He was the No. 1-rated European skater by NHL Central Scouting after finishing with seven goals and seven assists in 47 games for KalPa in Finland's top professional league.
Penguins general manager Jim Rutherford drafted Sami Kapanen, in the fourth round (No. 87) in the 1995 NHL Draft, when he was GM of the Whalers.
Kasperi (6-foot, 180 pounds) has starred internationally many times for Finland; he scored five goals at the 2013 World Under-18 Championships, including the game-winner in the bronze-medal game. He was an alternate captain at the 2013 World Under-17 Challenge and led Finland in scoring with nine points (three goals, six assists).
Kapanen was selected to play for Finland at the 2014 World Junior Championship but was unable to participate due to injury.
He's only 17 but he can see the ice so well and he moves the puck and goes to the open ice all the time, so I just think he's a player that is ready to play in the NHL. I'm really looking forward to coaching someone like this.
— U.S. National Junior Team coach Ron Wilson on Auston Matthews, the projected No. 1 pick of the 2016 NHL Draft |
Subsets and Splits