proba
float64 0.5
1
| text
stringlengths 16
174k
|
|---|---|
0.952231 | Using the iPad App store without a US credit card Post by Mark I started getting a lot of emails after my Zinio post asking me how I am getting my apps from the iPad app store without using a US credit card.... 24/01/2012 · The instructions seem straight forward for setting up a non credit card account. Once the account is created, you can purchase iTunes cards, redeem them, and you've got cash in your account to purchase apps, music, video, books - whatever.
In case you really want to change App Store country, there is a workaround to this problem. The process may seem like a long one at the start however once you have set it up, changing between app …... 15/09/2015 · For example, if you have a $5 gift card, and are putchasing something for $9...it will pull the $5 off of the give card, then pull the remaining balance from your credit card. Actually not true. You can add iTunes gift cards without a credit card.
24/01/2012 · The instructions seem straight forward for setting up a non credit card account. Once the account is created, you can purchase iTunes cards, redeem them, and you've got cash in your account to purchase apps, music, video, books - whatever.
15/09/2015 · For example, if you have a $5 gift card, and are putchasing something for $9...it will pull the $5 off of the give card, then pull the remaining balance from your credit card. Actually not true. You can add iTunes gift cards without a credit card.
16/05/2013 · You can buy an ITunes gift card. It's Pre-paid so there's no use for a credit card. ( works for the App Store also) just pick the amount you want to spend and enter the code in It's Pre-paid so there's no use for a credit card. |
0.952293 | You are the pilot who collect space food! Beware of hazardous foods! Collect food before time runs out! |
0.948716 | In a currency swap operation, also known as a cross-currency swap, the parties involved agree under contract to exchange the following: the principal amount of a loan in one currency and the interest applicable on it during a specified period of time for a corresponding amount and applicable interest in a second currency.
Currency swaps are often used to exchange fixed-interest rate payments on debt for floating-rate payments; that is, debt in which payments can vary with the upward or downward movement of interest rates. However, they can also be used for fixed rate-for-fixed rate and floating rate-for-floating rate transactions.
Each side in the exchange is known as a counterparty.
In a typical cross-currency swap transaction, the first party borrows a specified amount of foreign currency from the counterparty at the foreign exchange rate in effect. At the same time, it lends a corresponding amount to the counterparty in the currency that it holds. For the duration of the contract, each participant pays interest to the other in the currency of the principal that it received. Upon the expiration of the contract at a later date, both parties make repayment of the principal to one another.
In a cross-currency basis swap, the European company would borrow USD1 billion and lend EUR500 million to the American company assuming a spot exchange rate of USD2 per EUR for an operation indexed to the London Interbank Rate (LIBOR), when the contract is initiated.
Throughout the length of the contract, the European company would periodically receive an interest payment in EUR from its counterparty at LIBOR plus a basis swap price, and it would pay the American company in dollars at the LIBOR rate. When the contract comes to maturity, the European company would pay USD1 billion in principal back to the American company and would receive its initial EUR500 million in exchange.
Equity instruments held for trading? |
0.999808 | Here are two reasons to get outside.
Live in a city or prefer to stay inside? You can always bring the outdoors in. |
0.998337 | Summarize Malcolm Xs argument in the introduction. State the simple essence of Malcolm X argument. Do not write a list such as using next or then or use a list of series like first, second, third. Weave a word or two of Malcolm X into summary but it should mostly be your own words. State the logical connections among Malcolm Xs ideas.
First paragraph should include: In a debate about student sit-ins during the Civil Rights Movement, Malcolm X argues.
Previous Previous post: Many Americans find themselves amassing large amounts of credit card (or other revolving) debt at an early age. What advice concerning the use of credit cards and the fees they charge would you provide to a young adult planning on getting a credit card?
Next Next post: Write an essay of 750-800 words that depicts the historical evolution of punishment and the eventual use of houses of correction in America with consideration of the influence of British jurisprudence. Include a comparison of the early uses of corrections in America with current models, specifically regarding the equity in the treatment and punishment of prisoners Additionally, compare the goals and intended outcomes of jails and prisons in at least three areas of the U.S. |
0.999997 | How to find a font from a PDF in Photoshop Trying to find a font in a document is really simple if you know how but can drive you crazy if you don’t. The language used in Photoshops toolbars and menus is not always that intuitive. If you are trying to find a font in a PDF or other document and have photoshop available to you, the you can try the following steps to find your elusive font. To find your elusive font simply : 1. open your image in Photoshop 2. using the rectangle marquee tool in the toolbar highlight the area you want to identify the font in. 3. Click on Type in the menu and select match font and et voila! you have solved the mystery of the elusive font. |
0.96773 | (1) Wait I ..........you the bus stop.
I ...............(drive)you the bus stop.
I ........... (break) your pen.
(3). I ...........the money on 20th.
I ............. (need)the money on 20th.
(4) I ............... to movie.
(5) She ..........better in four days.
She ...............get (better) in four days.
(6) Your family ...............you in your hardship.
I think my family.............. (help) in my hardship.
She ........... be (able) to reach at time.
(9) Ram...........his work within fifteen days.
Ram...............be able to (finish) his work in fifteen days.
If it rains the match ........... be (play).
1. Wait I will drive you the bus stop.
I will not drive you the bus stop.
2. I will break your pen.
I will not break your pen.
I will not need the money on 20th.
4. I will go to movie.
I will not go to movie.
5. She will get better in four days.
She will not get better in four days.
6. Your family will help you in your hardship.
I think my family will not help in my hardship.
7. She will reach at time.
She will not be able to reach at time.
8. She will come with me.
She will not come with me.
9. Ram will finish his work within fifteen days.
Ram will not be able to finish his work in fifteen days.
10. If it rains the match will be cancelled.
If it rains the match will not be played.
Take a view of this future tense grammar lesson.
No Comment to " Futuer affirmative & negative exercise " |
0.999998 | In which decade of the twentieth century did each of these fads or fashions reach their height? A. Bathtub gin B. the beat generation C. Bra burning.
A. Bathtub gin is a homemade spirit made from a concoction of cheap alcohol, water, essences, flavorings and, at times, essential oils.
The 1920s saw an increase in the consumption of alcohol and gin was the primary drink to be had at that time. The term was coined in reference to the poor quality of gin being made by topping off the alcohol with water and distilling and fermenting it in the bathtub.
B. The Beat Generation is an American cultural and literary movement famous for its portrayal of the human condition and a renunciation of materialism.
After World War II, the 1950s saw a time where young adults saw capitalism as damaging to the lives of the people. The founders of this movement include Jack Kerouac and Allen Ginsberg who met at Columbia University.
C. Bra burning was a symbolic act meant to show women’s independence from men and a gesture to support women’s rights.
After the liberating decade of the 1960s, the feminist movement proceeded to move forward in the 1970s. The symbolic gesture of the bra burning came about when women tossed items, such as high heels and girdles in a trash can to do away with masculine oppression. It was rumored that the trash can was lit on fire. |
0.975365 | What kind of factory audits do we do?
Our auditors visit your factory, analyze, and report on their findings. Our basic audits are designed to provide a sufficient overview to make informed decisions, and our extended audits deep-dive into even more.
• Overall factory metrics including revenue, staff counts, etc.
• Check for the presence, clarity, and access to production process charts.
• Ensure factory departments and responsibilities are clearly defined and organized.
• Ensure an active business license is on-file and document information.
• Check maintenance logs and report on all production-line machinery.
• We analyze a production line and measure production capacity over a period of time.
• Check for the presence of appropriate staff and protocol, we analyze an active production line, and notate all results.
• Tour the facilities are ensure they are organized, clean, heated/cooled, lighted, and maintained.
• Check worker living conditions and ensure access to basic worker facilities.
• Ensure that factory operations are systemized by appropriate software, and not operating on paper or mental notes.
• Ensure that law-body issued environmental certificates are on-file.
• We check to see if ROHS certifications are implemented, and if so document all certificates and ensure accountability.
• Check working conditions and ensure proper protocol is in-place for healthcare, water, etc.
• Check for engineers, lab equipment, and analyze on-going R&D operations.
• Tour the facilities and ensure security procedures, processes, and equipment are in-place.
Based on what we’ve learned working with startups to large brands, we’ve engineered custom criteria and processes for our auditors built for your success.
Our auditors analyze hundreds of data points for an apples-to-apples score that can be used to compare vendors to each other.
We focus heavily on quality control systems. Factories with high-quality standards pass this section with flying colors.
For companies with ethical programs, our extended factory audits can dig into working and living conditions. |
0.998602 | What could be more appropriate for a quintessential Austin wedding than a music-themed venue? Fun, modern, and a little unexpected, The Reverbery is a new Austin space that captures the spirit of the nation's Live Music Capital and offers couples a seriously cool option for their big day.
Located inside the downtown Hilton, the venue offers nearly 3,500 square feet of indoor-outdoor space that plays up the recording studio feel. Industrial design and midcentury modern furniture create a hip vibe, and if your style is more Chuck Taylors than Jimmy Choos, you'll love the interior.
With a total seating capacity of 150, The Reverbery has a swanky bar, a groovy lounge, and a 930-square-foot patio that can accommodate all your guests.
Plus, everything you might need is covered: An audio-visual support team, access to an events manager, and a hospitality team are all yours, directed with impeccable attention to detail by the Hilton Austin.
Couples can opt for an exclusive chef-made menu, fare from Cannon + Belle, or tasty tacos from Austin Taco Project. The food is approachable, fun, and captures the city's dynamic culinary culture.
But don't feel confined to weddings only. Any event would benefit from this space's unique vibe, be it meetings, conferences, reunions, conventions, or parties.
To tour the newly renovated space and check date availability for your event, please contact senior catering sales manager Laura Morales at 512-682-2718 or [email protected]. |
0.999989 | Draft a sale deed: This sale deed entered into between G. Mahesh, S/o. G. Ramesh Babu (hereinafter called the Vendee) on this 13 days of September, 2010.
This in consideration of an amount of Rs. 1,50,000 paid by the Vendee to the Vendor on 13.09.2010, the receipt whereof is hereby acknowledged, the vendor the owner of the property detailed in the schedule hereto, does hereby transfer to the Vendee by way of seek of the property (or house) so charted in the schedule hereto.
The vendor hereby agrees with Vendee.
That the sold premises shall be held and enjoyed by the Vendor absolutely as full owner of the property without any interference by an anybody whatsoever.
That the vendee shall be entitled to receive rents, profits and other incomes in respect of the sold premises without any interruption by anybody.
That the Vendor shall execute and perform every such act of assurance necessary for more assuring the said premises to the vendee, his heir legal representatives and assignees etc. at the expense of the person so requiring him to execute a paper.
That for the purpose of construction the expression „Vendor‟ and „Vendee‟ shall include their legal representative successor and assignees etc.
Tirupati Town, Tirupati Municipality situated at Near Pasuparthi Super Bazaar, Housing bearing No: 31-14-14 an extent of 100 cents. |
0.949559 | Observe the following scenario: You’re at home eating dinner with your family and there’s one slice of pizza remaining in the box. You sit at the table, contemplating whether or not you genuinely want that last slice. You finally decide that you’ll probably take it when only a short moment later, your brother inquires if he can have it. Naturally, your desire to have the slice grows exponentially. You win the verbal exchange, eat the slice of pizza, and ultimately feel less than satisfied when it’s all said and done. The slice disappointed not only on the scale of deliciousness, but also lacked crunchiness in the crust and contrary to its appearance, contained an insufficient number of toppings.
* Corsi measures shot attempt differential (the differential in shots directed at the opposition’s net versus the net of the player’s own team while on the ice). It includes goals, shots on goal, shots that miss the net, and blocked shots. Statistics courtesy of war-on-ice.com and espn.go.com.
Other noticeable improvements to Kadri’s game include his decision-making both with and without the puck (he’s become a smarter, more responsible player) and his playmaking abilities (he’s now constantly looking to set up teammates, sometimes to a fault).
Nonetheless, Nazem Kadri is still not as good as he should be.
Bottom line: his offensive production should be significantly higher than it is. In 48 games thus far this season, he has just 10 goals and 16 assists – respectable numbers in general, yet for a player of his talent, only sub-par. He’s currently in the prime of his career at age 25 and has yet to truly make his mark in this league.
So what’s preventing Nazem Kadri from reaching “star” status? Some may think he’s too small and lacks physical strength, while others believe he simply isn’t fast enough or insist that he’s always just been overrated. Well, all these people are WRONG. The true culprit?
When Nazem Kadri shoots the puck, he reaches out, winds up, and then pulls the trigger.
The absence of a quick release.
When an NHL goaltender has ample time to square up to a shooter, it’s rare to see the puck to beat him. On the contrary, the quicker the shot, the more difficult it becomes for the goalie to react in a timely fashion and thus the more likely a player is to score. Akin to what they say in baseball about a player needing to “shorten up his swing”, Kadri needs to shorten up his shot. By reducing his wind-up motion, he’ll be putting himself in a position to generate more quality scoring chances. The best players on the planet – the Crosbys, Ovechkins, Kanes – all have lightning quick releases; the puck is barely on any of their sticks before it’s gone. Remember Patrick Kane’s 2010 Stanley Cup winning goal?
How about Sidney Crosby’s “golden goal” at the 2010 Olympics?
In a league where the reflexes of goaltenders are so incredibly fast, a quick shot is invaluable. When a player can add this tool to his arsenal of weapons, he automatically becomes a greater threat on the ice which forces opposing players to defend him more closely in the offensive zone. More ice then opens up for his teammates and with one quick move, this player is able to easily elude a defender and create space for himself.
Now, perhaps Kadri’s offensive struggles can be attributed to not shooting the puck enough, right? Wrong.
Statistics courtesy of war-on-ice.com and espn.go.com.
He’s already registered the same number of shots on goal as he did last season, and has done so in 25 fewer games! He’s averaging 3.7 shots on goal per game, tied for 9th best in the league. His shooting percentage (the percentage of the time a player scores when he shoots the puck on net), however, has declined steadily with each successive year.
So surely the London, Ontario native must be shooting from the wrong areas of the ice, right? Wrong again.
As illustrated through the above shot tracker graphic, Nazem Kadri takes the bulk of his shots from roughly around the hash marks inward. Interestingly enough, he seems to shoot the puck most frequently from the same regions as does Sidney Crosby: the two largest blobs present on the trackers of both players are right around the crease area and just beyond the hash marks. Keeping this information in mind, with 35 fewer shots on goal this season, Crosby has 7 more goals and a shooting percentage a whopping 6.4 percent higher than that of Kadri – this season being the worst of Crosby’s career. The explanation? Crosby simply shoots the puck faster. That’s all it is.
Should Nazem Kadri release the puck quicker when he shoots, I guarantee a visible increase in his production. It’s all in the release, Naz. It’s all in the release. |
0.981716 | Explain how Bradbury uses figurative language to characterize the fireman, Montag, the fire, and Clarisse. Synthesize information from the chapter to infer the central conflict of the novel.
The people of Fahrenheit 451 have to come to equate this motion, fun, and distraction with happiness. However, Fahrenheit 451 makes the case that engaging with difficult and uncomfortable thoughts and experiences is the only routes to true happiness. |
0.966593 | Travel Guide on the Jewish Ghetto in Venice. The first of of its kind in history, the Jewish Ghetto of Venice was like a city within a city. Located in the cannaregio district of Venice you can enjoy a guided walking tour of the Jewish Ghetto & the surrounding Cannaregio district of Venice, explore the Synagogues or visit the Jewish museum located in the Ghetto.
From which the word "Ghetto" derived, the Jewish ghetto of Venice is the world's oldest. Until 1385, when the first Jews began to settle in Venice , Jews were only allowed to come to Venice for money-lending purposes. But, in 1385, when the city was involved in a war with nearby Chioggia , they needed loans from Jewish money-lenders to finance their campaign and so they allowed Jews to move into the city.
Although, the Jews never were allowed to properly assimilate into the city's population, and in 1516, the ruling council of Venice confined all Jews to a small area of the city quite a distance from Piazza San Marco and the heart of the city.
Where, at night, all routes leading in an out of the Ghetto were guarded and sealed by locked gates. The Jews had limitations set on their economic activities in Venice . They were only allowed to have pawn shops, trade textiles and practice medicine.
Whenever the Jews left the Ghetto area the men had to wear a yellow circle stitched on the left shoulder, while the women wore a yellow scarf. The first Jews to settle in the ghetto of Venice were central European Ashkenazim, who constructed two synagogues: in 1528, the Scuola Grande Tedesca, and later in 1532, the Scuola Canton. They are still intact, and occupy the rooms above and adjacent to the Jewish museum.
In an area where space was limited, the Jews had no real choice but to build their synagogues in the attic storeys of buildings as Jewish law forbids that anything should come between the synagogue and the sky. The next group of Jews to arrive in Venice were the Levantine, who got their neighbourhood granted to them in 1541, as part of an expansion of the Jewish ghetto.
This area today, is known as the "new ghetto". The Levantine Jews were rich enough to build their synagogue on the ground, and the rich red and gold interior of the Levantine synagogue is particularly special.
Mixed in with the Levantine and Ashkenazim Jews, were Italian Jews who migrated north to Venice from the central and southern parts of the peninsula. In 1575, the Italians built their own synagogue, the Scuola Italiana, which was built on of apartments.
The structure features a cupola which is barely visible from the square below. Around 1650, the Ghettos population reached a peak at 4,000 inhabitants. A feat hard to believe as you wonder around today, an area no bigger than two and a half city blocks.
Before the second world war, there were still 1300 Jews living in the Ghetto. Of those, 289 were deported by the Nazi's, and only seven returned.
Today, along with neighbouring Mestre on the mainland, Venice boasts a population of 600 Jews. Even though the ghetto continues to be the centre of community activities for the Jewish community, very few Jews continue to live in the ghetto.
But, at least, the ancient stones remain to tell the story of another time, when a small united community living in Medieval skyscrapers, found their home in the Venetian lagoon. |
0.999987 | These are pure Katahdin hair sheep no mix breeding. Ours are raised naturally with their mothers till weaned, makes for a better baby, no stress on mother or babies. Lambs are around human contact at birth and continue till they go to their new homes, they are not just left in a field unattended for weeks. We haven't had any problems with hoof rot and this breed is less susceptible to parasites. Our lambs are not just white, they also come in black and white and browns. If wanting a Wether (neutered Male), he may have to stay here till his testicles have well descended enough to be properly banded for Wethering (neutering). No the male sheep do not smell like the male goats do, for those of you who have asked this question. We are a Certified Scrapie Free flock. A non refundable deposit is $40.00 for each lamb, which will hold till lamb is weaned ready to go and arrangements can be made for new owners to get or meet for picking up. The way it works: I email you pictures of the lambs/goats and you choose which ones you want and let me know, I then send you address to mail your deposit/deposits to hold your choices, then when weaned I let you know when they can go to their new home, I can help with your travel distance, I do travel I-81 from Woodstock VA. North to I-66 East to exit Front Royal VA (I have met people at the Target Parking lot there), early morning weekdays. Or I can meet from the other direction (I-81 South) at the Mauzy exit around the Harrisonburg VA area off I-81 South without any extra fees. Ours will eat out of your hand and walk on lead, ours have been sold to petting zoos and every year are in live Nativity scenes and Christmas Programs, our lambs have even been in Choir concerts & Day Camps. The males are banded after 8 weeks so if you want one left as a ram state that when sending deposit so he will be held as a ram (ramling) and won't be wethered (neutered). Females are $200.00 each, Wethers (Neutered male) are $150.00 each and Rams (ramlings) are $300.00 each. These are hair sheep and never need tails cut off or shearing of wool because there is no wool to worry with. Please put SHEEP in subject line of email. NO SPAM EMAILS PLEASE. thank you Heavenly Heart Farm. The Photos are of previous ones we have had . Email to see what we have at present time or be put on wait list.
This advertisment was posted from Edinburg, Virginia on Feb 16, 2015 by Unicorn1. Find other similar ads by searching the Sheep For Sale & Adoption category. |
0.999995 | (CNN) -- You may never have heard of him, but without this bear you might never have seen a panda in your local zoo.
Keepers fondly remembered his "energy and vitality" in the 1990s, during which he fathered the first ever panda cub to survive in a captive breeding environment.
Pandas are famously difficult to breed in captivity -- a female is fertile for no more than three days a year and a pregnancy can last up to 200 days.
Speaking to CNN, a spokesman for the Panda Conservation and Research Center in Sichuan, China said Pan Pan had been found in the wild, making him "wilder" than other pandas.
"He had a strong physique. Pan Pan was really fast and agile when he was young," he said.
"Pan Pan brought hope to the center. In a group of sluggish, feeble pandas, Pan Pan stood out. He was always full of energy and vitality."
The Center said Pan Pan had been in "full blossom" in the late 1990s, before eventually withdrawing from breeding due to his age.
"I heard old employees talk about Pan Pan -- how strong and virile he was. In the mating season, he was particularly excited and rugged, covered with hormones from top to bottom," the post said.
"He easily dominated the population."
The center's official Weibo account announced Pan Pan's death on Wednesday, describing the panda as a "hero father" of many.
"Pan Pan's health rapidly deteriorated. He lost his ability to move and hunt. The medical staff tried to rescue him but had no luck," the statement said.
"(Hopefully) he doesn't suffer from pain in heaven. May "Grand Pan" rest in peace."
China Conservation and Research Center for Giant Pandas keeper Tan Chengbin told Xinhua Pan Pan had been living with cancer and his health had "deteriorated" in the past three days.
His death comes less than two months after the world's oldest panda, a female named Jia Jia, passed away in Hong Kong at the age of 38. |
0.998626 | Give your little girl a glittering fairy princess makeover for Halloween with our easy-to-follow, step-by-step makeup instructions.
To apply fairy princess makeup, begin with a pearly eye shadow. Then add pink blush on the cheeks. Next, apply self-adhesive glittering jewels on forehead like a princess' tiara, and then apply additional jewels under eyebrows, on cheekbones or anywhere you like. Tip: You can find self-adhesive jewels in the scrapbooking section of your local craft store. Make sure your child doesn't have any adhesive allergies before continuing with this step. Keeping away from the sensitive eye area, dab face lotion on the cheeks and surrounding the jewel tiara on forehead. Have model close her eyes then apply cosmetic glitter where lotion was applied. Paint lips with a sparkly pink lipstick or tinted lip-gloss. Finish the look with a fairy princess costume.
Makeup application tutorial for a fairy princess Halloween costume.
Begin by painting eyelids with a pearly shade of eye shadow. Pick a color to match her costume, like shimmery blue, pink or purple. Use a wet eye shadow for this, or a shimmering face paint (Image 1). Tip: Paint all the way up to eyebrows so the color is easily seen. Using a sponge or finger, blend a lighter shade of pearly eye shadow over and above eyebrows (Image 2).
To apply fairy princess makeup, begin by painting eyelids with a pearly shade of eye shadow. Use a wet eye shadow for this, or shimmering face paint. Tip: Paint all the way up to eyebrows so the color is easily seen. Using a sponge or finger, blend a lighter shade of pearly eye shadow over and above eyebrows. Brush pink blush on apples of cheeks, continuing up to the highest point of cheekbones.
Brush pink blush on apples of cheeks, continuing up to the highest point of cheekbones.
Center then apply self-adhesive glittering jewels on forehead like a princess' tiara (Images 1 and 2), then apply additional jewels under eyebrows, on cheekbones or anywhere you like (Image 3). Tip: You can find self-adhesive jewels in the scrapbooking section of your local craft store. Make sure your child doesn't have any adhesive allergies before continuing with this step.
Keeping away from the sensitive eye area, dab face lotion on the cheeks and surrounding the jewel tiara on forehead. Have model close her eyes then apply cosmetic glitter where lotion was applied.
Paint lips with a sparkly pink lipstick or tinted lip-gloss (Image 1). Finish the look with a fairy princess costume. Pick up a pretty costume at a local costume store, or make it yourself with a hand-tied tulle ballerina tutu and any sparkly top. Add a floral fairy crown, wand and fairy wings (Image 2).
Turn your tween into a fashion-forward teenage Frankenstein for Halloween using our easy-to-follow makeup tutorial.
Turn your little one into a roaring lion for Halloween with our easy-to-follow makeup tutorial.
Transform your little buccaneer into a pillaging pirate this Halloween with our easy-to-follow makeup tutorial and costume tips.
Turn your little one into a bloodthirsty vampire for Halloween with our easy-to-follow makeup tutorial.
Turn your little one into a fantasy dragon — complete with scales — this Halloween. All you need is makeup and about 30 minutes to make the transformation.
This Halloween, go as a glamorous dark fairy. Our easy-to-follow, step-by-step instructions show you how to apply the fantasy makeup to give even a basic costume a silver screen-worthy look. |
0.968836 | Overall name for the theories of space-time Physics formulated by Albert Einstein (1869-1955): special relativity, proposed in 1905, and general relativity, proposed in 1916. Both theories, though initially controversial, have been exhaustively tested by experiment.
In special relativity it is axiomatic that there is no absolute or "privileged" frame of reference against which velocity can be measured: only the relative velocity of any given two bodies is meaningful. A second axiom is that, counterintuitively, the velocity of light is the same irrespective of the frame of reference in which it is measured. A light beam projected forwards from a moving train travels no faster than one shone in the same direction (or any other direction) from a stationary trackside lamp. The logical consequence, emerging from undergraduate-level calculations, is that – although relativistic physics is almost indistinguishable from classical Newtonian physics when relative velocities are no greater than found in everyday life – increasing distortions of mass, length and Time are observed as velocities reach a significant fraction of c (the speed of light, roughly 3 x 108 metres per second). Measured length shrinks towards zero, an effect formerly known as the Lorentz or Lorentz-Fitzgerald contraction; measured mass tends towards infinity as the relative velocity approaches c; Time Distortion likewise tends to infinity, with each of two observers moving at high relative velocity seeing time pass more slowly for the other. This effect is known as time dilation.
Meanwhile, the velocity c cannot be attained or exceeded by adding lesser velocities – as in Edward Page Mitchell's "The Tachypomp" (January 1874 The Sun anon) with its extravagant plan to attain unlimited speed by running a succession of railway trains on top of one another; Spaceship equivalents have been proposed by several hopeful authors. Alas, the axioms of special relativity lead to a nonlinear addition rule which always yields a sum less than c.
The notorious "twins Paradox" imagines twin brothers of whom one stays on Earth while the other makes a round trip by relativistic Spaceship to another star, and despite the apparent symmetry of Time Distortion returns home significantly younger than his Earthbound brother. The seeming paradox can be explained, though not simply, in terms of the accelerations and reversals experienced only by the space-travelling brother. Robert A Heinlein dramatizes this situation in Time for the Stars (1956), with the relativistically untenable addition of constant Faster Than Light contact between the twins via Telepathy. Such simultaneity makes it impossible for each twin to observe the other as time-slowed: Heinlein settles for the more comfortable asymmetry of having the Earth-twin perceived by his brother as living faster (and, conversely, the space-twin slower), eliminating the paradox at some cost to the physics.
Further sf stories which play with relativistic time-dilation effects include L Ron Hubbard's earnest Return to Tomorrow (February-March 1950 Astounding as "To the Stars"; 1954), Vladislav Krapivin's "Meeting my Brother" (trans 1966), Larry Niven's A World Out of Time (fixup 1976), Tom Shippey's "Not Absolute" (in Andromeda 3, anth 1978, ed Peter Weston) as by Tom Allen, George Turner's Beloved Son (1978), Mary Doria Russell's The Sparrow (1996) and Gene Wolfe's Book of the Short Sun (1999-2001). Such effects are taken to spectacular extremes in Poul Anderson's Tau Zero (June-August 1967 Galaxy as "To Outlive Eternity"; exp 1970), whose protagonists become Flying Dutchmen aboard a damaged relativistic Starship that can only accelerate, at one stage smashing through galaxies in an eyeblink as a car might encounter a swarm of bees; ultimately they outlive the Universe and see the birth of its successor (see Cosmology). Even more expansive is Frederik Pohl's and Jack Williamson's The Singers of Time (1991).
Very many sf stories use relativistic time dilation for one-way Time Travel into the future. Joe Haldeman's The Forever War (June 1972-January 1975 Analog; fixup 1974) makes particularly effective use of the effect as a metaphor for the culture shock of US soldiers returning from Vietnam. The constraints of relativity are not generally popular in Space Opera, when Faster-than-Light drives predominate – but notable exceptions include Alastair Reynolds's Revelation Space (2000) and its successors in the Inhibitors sequence, where considerable effort goes into orchestrating the movements of Sublight ships over many years of interstellar flight towards significant encounters.
The elementary changes have now been rung, but there is probably further scope for intriguing time-dilation plots. One such is Redshift Rendezvous (1990) by John E Stith, set on a starship in a version of Hyperspace wherein the velocity of light is so low (22mph or 35kph) that its passage is visible, and relativistic phenomena are obvious at walking speed. This echoes the instructive Thought Experiments with changed universal constants which are dramatized in George Gamow's Mr Tompkins in Wonderland (coll 1939 chap).
Some memorable imagery attempting to envisage real relativistic visual effects (mistakenly, as it later turned out, because based on an overly simplistic scientific paper) can be found in Frederik Pohl's "The Gold at the Starbow's End" (March 1972 Analog; exp vt Starburst 1982).
see also: Communications; Dimensions; Antigravity; Elements; Imaginary Science; Space Warp; Tachyons. |
0.98539 | Test your knowledge of Shinto with the following 10 questions, then read the answers with commentary that follow.
1. Shinto is the native, traditional, national (i.e. cultural) religion of what country?
5. Some Shintoists have built altars right in their homes where certain rituals are carried out.
7. Shinto today represents a fusion of ancient Shinto and what other world religion?
10. Kami, the entities or spiritual forces in which a Shintoist believes, are often associated with natural phenomena such as rocks, evergreen trees, or rice fields, and are believed to actually indwell shrines.
(1) In many ways, Shinto is Japan. The rituals (ringing bells, clapping hands), the myths, the exquisite architecture of the shrines, and even the vocabulary of this religion are all deeply interwoven with the history and culture of the land.
(3) Makoto means “truth” or “purity in intention,” which would be regarded as the ideal human state.
(3) Kagura is a traditional Shinto sacred dance and music, typically performed by young maidens.
PROBING DEEPER: Are Shinto rituals observed mechanically or thoughtfully by a Shintoist? Does Shinto doctrine matter to a Shintoist? If not, why not?
(4) Kojiki and Nihongi are ancient sacred writings, but Shinto has no final authoritative Scriptures per se.
(4) I-Ching & Chun-Chiu are two of The Five Classics, part of the canon of Confucianism, not Shinto.
(5) Shinto is very often practiced in the home. A kamidana is the shrine designated for domestic veneration of the kami.
(8) Shinto teaches that there are many gods (kami) which are pro-created by other gods, some helpful and some hurtful. Shinto is, therefore, a polytheistic religious system.
(9) Shinto worshipers attempt to purify themselves as they approach a shrine by washing with water and presenting an offering. But will such practices truly cleanse one? |
0.995643 | Taking what the day brings.
and draw down deep from the well.
Warm sun dries the rain. |
0.987211 | Retired NBA point guard, Spud Webb, was born on July 13, 1963 in Dallas, Texas.
Standing at 5 feet 6 inches tall, Webb received his first oppurtunity to play on a basketball team when he attended Midland College (in Midland, Texas), where he led his team to the junior college national title in 1982.
Webb attracted the attention of Tom Abatemarco, an assistant coach at North Carolina State University, who arranged for Webb to meet head coach Jim Valvano, who offered Webb a scholarship. In two years at N.C. State, Spud averaged 10.4 points and 5.7 assists per game.
Spud Webb was then drafted in the 4th round of the 1985 NBA Draft by the Detroit Pistons. His first six seasons were played with the Atlanta Hawks, but he had his best years statistically with the Sacramento Kings, where he played as a starter from 1992-1995. He then split a season between the Atlanta Hawks and the Minnesota Timberwolves before finishing his career after one season with the Orlando Magic and retiring from professional basketball in 1998. Webb played 814 career games, averaging 9.9 points per game, registering 8072 points and 4342 assist in twelve seasons.
Spud Webb was, and remains the third shortest player to play in the NBA. Only Earl Boykins and Muggsy Bogues were shorter.
Spud Webb, the shortest person to compete in the NBA Slam Dunk Contest, won the event in 1986. His participation surprised the media; including his teammates, and defending dunk champion Dominique Wilkins, who had "never seen me dunk before," Webb said.
Webb's dunks included the elevator two-handed double pump dunk, the one-handed off the backboard one-handed jam, a 360-degree helicopter one-handed dunk, a 180-degree reverse double-pump slam, and finally, the 180-degree reverse two-handed strawberry jam from a lob bounce off the floor. He defeated Wilkins with two perfect 150-point scores in the final round.
Atlanta coach Mike Fratello said, "Spud kind of duped him. He told Wilkins he never had anything prepared, didn't practice for it. So, Wilkins maybe thought his normal assortment would be good enough to get through". Twenty years after Webb's victory in the Slam Dunk contest, he trained New York Knicks point guard Nate Robinson (who stands at 5 feet 9 inches tall) to win the event. Webb tossed the ball to Robinson, who leaped over Webb and dunked, earning 50 points from the judges. Robinson went on to win, making him the second player in basketball history under six feet to win since Webb.
DISCLAIMER: PFP Sports Talent Agency does not claim to represent itself as the exclusive agent for Spud Webb. PFP Sports Talent Agency is a booking agency that represents organizations seeking to hire pro athletes and sports personalities such as Spud Webb for speaking engagements, personal appearances, product endorsements and corporate entertainment. Fees on this website are estimates and are intended only as a guideline. Exact fees are determined by a number of factors, including the location of event, the talent’s schedule, requested duties and supply and demand. PFP Sports Talent Agency makes no guarantees to the accuracy of information found on this website and does not warrant that any information or representations contained on this website will be accurate or free from errors. We are often asked how can I find out who is Spud Webb's agent? To find Spud Webb appearance fees and booking agent details, you can contact the agent, representative or manager through PFP Sports Talent Agency for speaking fee costs and availability. PFP Sports Talent Agency can help your company choose the ideal sports personality for your next marketing campaign. To hire Spud Webb for an appearance, speaking event or endorsement, contact Spud Webb's booking agent for more information. |
0.979513 | \nClark County is a county located in the U.S. State of South Dakota. As of 2000, the population is 4,143. Its county seat is Clark6.
\nAccording to the U.S. Census Bureau, the county has a total area of 2,507 km² (968 mi²). 2,481 km² (958 mi²) of it is land and 26 km² (10 mi²) of it is water. The total area is 1.02% water.
\nAs of the census2 of 2000, there are 4,143 people, 1,598 households, and 1,110 families residing in the county. The population density is 2/km² (4/mi²). There are 1,880 housing units at an average density of 1/km² (2/mi²). The racial makeup of the county is 98.65% White, 0.07% Black or African American, 0.60% Native American, 0.10% Asian, 0.02% Pacific Islander, 0.19% from other races, and 0.36% from two or more races. 0.48% of the population are Hispanic or Latino of any race. There are 1,598 households out of which 29.30% have children under the age of 18 living with them, 61.60% are married couples living together, 4.70% have a female householder with no husband present, and 30.50% are non-families. 28.10% of all households are made up of individuals and 16.40% have someone living alone who is 65 years of age or older. The average household size is 2.54 and the average family size is 3.14. In the county, the population is spread out with 27.00% under the age of 18, 5.80% from 18 to 24, 22.00% from 25 to 44, 23.00% from 45 to 64, and 22.20% who are 65 years of age or older. The median age is 42 years. For every 100 females there are 97.40 males. For every 100 females age 18 and over, there are 97.40 males. |
0.954883 | The Kingdom of Spain is located in the extreme southwest of the European continent, and occupies approximately 85-percent of the Iberian Peninsula. Spain is bordered on the west by Portugal, in the Northeast by France, and by the great wall of the Pyrenees Mountains. The Iberian Peninsula that the Spanish inhabited was occupied by various other civilizations, including the Phoenicians, Carthaginians, Romans, Visigoths, and Muslims, and Spain is now associated with having a very rich, eclectic culture as a result.
The development of Christian society and culture in the first 300 years following Islamic conquest in Spain was slow, but major changes occurred for the Spanish in the 12th and 13th centuries. The population grew, communication with northern Europe intensified, commerce and urban life gained in importance, and the kingdoms of the Castile, Aragon, and Navarre, and Portugal emerged as the governing bodies of the Iberian Peninsula. These kingdoms reached the frontiers that they would keep, with minimum amount of alteration, until the end of the Middle Ages, when Isabella I became Queen of Castile.
Isabella began participating in the royal court at the age of 13; and when Portugal, Aragon, and France offered their marriage candidates, she favored Ferdinand of Aragon. Isabella ascended to the throne as Queen of Castile to rule sensibly and with a prudent political program. Her unification of the states of the Iberian Peninsula into a single entity, the maintenance and control over the Strait of Gibraltar, policy of expansion into Muslim North Africa, reform of Spanish Catholicism, and support for the exploration and expansion in the unknown was evidence of her wisdom and capabilities as Queen.
On October 12, 1492 Columbus, with the blessing and financial backing of Isabella, sought a route to the legendary rich markets of China and Japan, but instead discovered what would become known as "The New World", the present day Americas. This voyage gave way to a new golden age of expeditions and conquest, as the Americas contained gold, a valuable resource that Spain happened to be desperately bereft of at the time.
Following Columbus’ lead, a Spanish military group known as Los Conquistadores, ‘The Conquerors’, were directed by Hernan Cortes to the New World with the soul purpose of seeking out new frontiers and riches in the unknown. The Conquistadores undertook their expeditions in the vast landmasses of the Americas at their own expense, risking their lives without aid from the Spanish royalty. Their conquests included campaigns in Guatemala, Peru, Cuzco, Columbia, Chile, the Bay of Honduras, and as far as the Pacific Coastal regions. The Conquistadors, however, were given to fighting and searching for gold, and were swiftly replaced by administrators and settlers from Spain who governed in their place.
Once the Spanish Kingdom established its presence in the Americas their operations inevitably became high-profile targets of pirates and other raiders who were endorsed by European powers such as England. The Monarchy of Spain endeavored to retaliate by building an armada of warships that was dubbed "The Invincible Armada". The armada was a collection of over 130 naval warships and transport-ships, which contained approximately 8,000 seamen and 19,000 soldiers. King Philip II directed this armada to invade England when the various and frequent raids on Spanish commerce in the Caribbean became intolerable. England’s success in repelling the Spanish fleet saved England and the Netherlands from potential consolidation into the Spanish empire, but despite the armadas’ defeat, the blow dealt by the Spanish upon England’s reputation as the greatest European power was palpable.
Thereafter, Spain declined in power quickly; and by the 19th century, Spain became somewhat marginal in international politics. Spain’s period of imperial power and exploration left a legacy that consisted of 18 Latin American states, Puerto Rico, and the ever-growing Spanish-speaking population in the United States today. In 1975 Spain transitioned into a constitutional monarchy by way of a democratic constitution and is now recognized for its eclectic culture as well as for the glory and mystique that it once possessed in its youth.
In Civilization III: Play the World, the Spanish are considered a Commercial and Religious civilization, therefore, they start with Alphabet and Ceremonial Burial and have significant bonuses to cultural and commercial activities.
Following Columbus, a Spanish military group known as Los Conquistadores, ‘The Conquerors’, were directed by Hernan Cortes to the New World with the soul purpose of seeking out new frontiers and riches in the unknown. The Conquistadores undertook their expeditions in the vast landmasses of the Americas at their own expense, risking their lives without aid from the Spanish royalty. Horses adorned with many bells enabled the Conquistadores to launch indomitable offenses against the American Indian natives who had never seen a horse before the arrival of the Conquistadores. Spanish-Conquistador conquests included campaigns in Guatemala, Peru, Cuzco, Columbia, Chile, the Bay of Honduras, and the Pacific Coastal regions.
A Spanish city must have horses to build a Conquistador. They replace the Explorer and are fast, military scouts that treat all terrain as if it were a road. |
0.999602 | Whats better- getting more sleep before your test or staying up all night studying?
The truth is, neither is as good as studying a little every day, and getting a normal amount of sleep every day. Of course this requires some discipline and commitment to maintain, but will result in much greater retention of information than "cramming." If you can keep up with your homework and studies, you'll find that you don't need to stay up studying for exams.
My straight answer, it depends. In my experience, it depends on the material you need to know and how well you know it already. If the test is over facts, like "Columbus sailed in 1482", that can be memorized, and you have a good chance of sticking that in your brain. If its more complex information, if you don't already know it, it's not likely that you'll remember all the processes once you get to the test. If it can be memorized, you at least have a shot at remembering it the next day. If not, you're likely just torturing yourself for a 3% grade difference than if you didn't deprive yourself of sleep. My advice is to start studying early! Learning your material instead of just remembering it for a test is the best thing you can do.
Good dreams and good studies!! |
0.999952 | Joseph and Jane are making a contest for apes. During the process, they have to communicate frequently with each other. Since they are not completely human, they cannot speak properly. They have to transfer messages using postcards of small sizes.
If a character, , occurs times in a row, then it will be represented by , where is the value of . For example, if the substring is a sequence of 'a' ("aaaa"), it will be represented as "a4".
If a character, , occurs exactly one time in a row, then it will be simply represented as . For example, if the substring is "a", then it will be represented as "a".
Help Joseph to compress a message, msg.
The only line of input contains a string, msg.
Print the string msg as a compressed message.
msg consists of lowercase English characters () only.
Sample Case #00: msg = "". Here, the first characters occur exactly once, and the rest of them occur times in a sequence.
Sample Case #01: msg = "". As there is no multiple consecutive occurrence of any character, the compressed message will be same as original one.
Sample Case #02: msg = "". In the first 3 occurrences, 'a' is repeated times, while in the last occurrence, there is only one 'a'. Also,'c' occurs two times, and 'b' occurs one time in both occurrences. |
0.943146 | Contemporary fencing is the word used for modern sport fencing which is very different than the martial use of the sword (also known as western art of combat with the small sword); Sport fencing is also called olympic fencing which began in the end of the 19th century, with the Italian school having modified the "classical fencing", and the French school having later refined the Italian system.
Modern fencing uses three weapons, and so is divided respectively into three competitive scenes: foil, sabre (spelled "saber" in the United States) and épée. Most (but not all) competitive fencers choose to specialize in one of these only.
Competitive fencing is one of five activities which have been featured in every one of the modern Olympic Games, the other four being Athletics, Cycling, Swimming, and Gymnastics.
Fencing is governed by Fédération Internationale d'Escrime or FIE. Today, its head office is in Lausanne, Switzerland. The FIE is composed of 145 national federations, each of which is recognized by its country's Olympic Committee as the sole representative of Olympic-style fencing in that country.
The FIE maintains the current rules used for FIE sanctioned international events, including world cups, world championships and the Olympic Games. The FIE handles proposals to change the rules the first year after an Olympic year in the annual congress. The US Fencing Association has slightly different rules, but usually adhere to FIE standards.
The ancestor of modern fencing originated in Spain, where several books on fencing were written. Treatise on Arms was written by Diego de Valera between 1458 and 1471 and is one of the oldest surviving manuals on western fencing shortly before dueling came under official ban by the Catholic Monarchs. In conquest, the Spanish forces carried fencing around the world, particularly southern Italy, one of the major areas of strife between both nations. Fencing was mentioned in the play The Merry Wives of Windsor written sometime prior to 1602.
The mechanics of modern fencing originated in the 18th century in an Italian school of fencing of the Renaissance, and, under their influence, was improved by the French school of fencing. The Spanish school of fencing stagnated and was replaced by the Italian and French schools.
He established the essential rules of posture and footwork that still govern modern sport fencing, although his attacking and parrying methods were still much different from current practice. Although he intended to prepare his students for real combat, he was the first fencing master to emphasize the health and sporting benefits of fencing more than its use as a killing art, particularly in his influential book L’École des armes (The School of Fencing), published in 1763.
The first regularized fencing competition was held at the inaugural Grand Military Tournament and Assault at Arms in 1880, held at the Royal Agricultural Hall, in Islington in June. The Tournament featured a series of competitions between army officers and soldiers. Each bout was fought for five hits and the foils were pointed with black to aid the judges. The Amateur Gymnastic & Fencing Association drew up an official set of fencing regulations in 1896.
Fencing was part of the Olympics Games in the summer of 1896. Sabre events have been held at every Summer Olympics; foil events have been held at every Summer Olympics except 1908; Épée events have been held at every Summer Olympics except in the summer of 1896 because of unknown reasons.
Starting with épée in 1933, side judges were replaced by the Laurent-Pagan electrical scoring apparatus, with an audible tone and a red or green light indicating when a touch landed. Foil was automated in 1956, sabre in 1988. The scoring box reduced the bias in judging, and permitted more accurate scoring of faster actions, lighter touches, and more touches to the back and flank than before.
There are three weapons in modern fencing: foil, épée, and sabre. Each weapon has its own rules and strategies.
Foil: a light thrusting weapon, with a maximum weight of 500 grams. The foil may target the torso (including the back), neck, and groin, but not the arms or legs. The foil has a small circular hand guard that serves to protect the hand from direct stabs. As the hand is not a valid target in foil, this is primarily for safety. Touches are scored only with the tip; hits with the side of the blade do not count, and do not halt the action. Touches that land outside of the target area (called an off-target touch) stop the action, but are not scored. Only a single touch can be scored by either fencer at one time. If both fencers land valid touches at the same time, the referee uses the rules of "right of way" to determine which fencer gets the point. If both fencers begin their attack at the same time, or the referee is unable to determine who was first, neither fencer scores a point.
Épée: a thrusting weapon like the foil, but heavier, with a maximum total weight of 770 grams. In épée, the entire body is valid target. The hand guard on the épée is a large circle that extends towards the pommel, effectively covering the hand, which is a valid target in épée. Like foil, all hits must be with the tip and not the sides of the blade. Hits with the side of the blade do not halt the action. As the entire body is legal target, there is not the concept of an off-target touch, except if the fencer accidentally strikes the floor, setting off the electric tone. Unlike foil and sabre, épée does not use "right of way", and allows simultaneous hits by both fencers. However, if the score is tied in a match at the last point and a double touch is scored, the point is null and void.
Sabre: a light cutting and thrusting weapon that targets the entire body above the waist, except the weapon hand. Like the foil, the maximum legal weight of a sabre is 500 grams. The hand guard on the sabre extends from pommel to the base of where the blade connects to the hilt. This guard is generally turned outwards during sport to protect the sword arm from touches. Hits with the entire blade or point are valid. As in foil, touches that land outside of the target area are not scored. However, unlike foil, these off-target touches do not stop the action, and the fencing continues. In the case of both fencers landing a scoring touch, the referee determines which fencer receives the point for the action, again through the use of "right of way".
Fencing outfits are made of tough cotton or nylon. Kevlar was added to top level uniform pieces (jacket, breeches, underarm protector, lamé, and the bib of the mask) following the Smirnov incident at the 1982 World Championships in Rome. However, Kevlar breaks down in chlorine and UV light, complicating the cleaning process.
In recent years other ballistic fabrics, such as Dyneema, have been developed that resist puncture and which do not have Kevlar's issues. FIE rules state that the tournament outfits must be made of fabric that resists a force of 800 newtons (180 lbf) and that the mask bib must resist double that amount.
Form-fitting jacket with strap (croissard) which goes between the legs. In sabre fencing, jackets that are cut along the waist. A small Plastron, an underarm protector, which goes underneath the jacket and provides double protection on the sword arm side and upper arm. There is no seam under the arm, which would line up with the jacket seam and provide a weak spot.
One glove for the weapon arm with a gauntlet that prevents blades from going up the sleeve and causing injury, as well as protecting the hand and providing a good grip.
Breeches or knickers which are a pair of short trousers that end just below the knee. The breeches are required to have 10 cm of overlap with the jacket. Most are equipped with suspenders (braces).
Knee-length or thigh high socks which cover knee and thighs.
Mask, including a bib which protects the neck. The mask can usually support 12 kilograms (26 lb) on the metal mesh and 350 newtons (79 lbf) of penetration resistance on the bib. FIE regulations dictate that masks must withstand 25 kilograms (55 lb) on the mesh and 1,600 newtons (360 lbf) on the bib. Some modern masks have a see-through visor in the front of the mask. These have been used at high level competitions (World Championships etc.), however, they are currently banned in foil and épée by the FIE, following a 2009 incident in which a visor was pierced during the European Junior Championship competition. There are foil, sabre, and three-weapon masks.
Plastic chest protector, mandatory for females. While male versions of the chest protector are also available, they were, until recently, primarily worn by instructors, who are hit far more often during training than their students. These are increasingly popular in foil, as the hard surface increases the likelihood that a hit fails to register, as well as with youth competitors.
Lamé is a layer of electrically conductive material worn over the fencing jacket that entirely covers the valid target area. It is worn only in foil and sabre, and serves to distinguish hits on target from those that are off-target. In épée, the entire body is a target, so it is not necessary to have a lamé. In foil the lamé is sleeveless, while in sabre the lamé has sleeves and ends in a straight line across the waist. A body cord is necessary to register scoring: it attaches to the weapon and runs inside the jacket sleeve, then down the back and out to the scoring box. In sabre and foil the body cord connects to the lamé in order to create a circuit to the scoring box.
Fencing masters often choose a heavier protective jacket, usually reinforced by plastic foam to cushion the numerous hits an instructor has to endure. Sometimes in practice, masters wear a protective sleeve or a leg leather to protect their fencing arm or leg.
Traditionally, the fencers' uniform is white (black for instructors). This may be due to the occasional pre-electric practice of covering the point of the weapon in dye, soot, or colored chalk in order to make it easier for the referee to determine the placing of the touches. As this is no longer a factor in the electric era, the FIE rules have been relaxed to allow colored uniforms (save black). The guidelines also limit the permitted size and positioning of sponsorship logos.
Techniques or movements in fencing can be divided into two categories: offensive and quickly defensive. Some techniques can fall into both categories (e.g. the beat). Certain techniques are used offensively, with the purpose of landing a hit on your opponent while holding the right of way (foil and sabre). Others are used defensively, to protect against a hit or obtain the right of way.
Attack: A basic fencing technique, also called a thrust, consisting of extending the sword arm to declare an attack and attempt to land a touch upon the opponent's valid area. In sabre, attacks are also made with a cutting action.
Riposte: An attack by the defender after a successful parry. After the attacker has completed their attack, and it has been parried, the defender then has the opportunity to make an attack, and take right of way (foil and saber).
Feint: An attack with the purpose of provoking a reaction from the opposing fencer.
Lunge: A thrust while extending the front leg by using a slight kicking motion and propelling the body forward with the back leg.
Beat Attack: In foil & sabre, the attacker beats the opponent's blade to gain priority (right of way) and continues the attack against the target area. In épée, a similar beat is made but with the intention to disturb the opponent's aim and thus score with a single light.
Disengage: Beginning an attack in one direction, then quickly moving the point down in a semi-circle to attack a different location. This is used to trick the opponent into blocking the wrong direction. For example, the fencer could target the left side of the torso, and begin the lunge. As the opponent moves to the left to parry, the fencer disengages and finishes the attack on the right side of the torso. Commonly countered with a circle-parry.
Continuation of Attack: A typical épée action of making a 2nd after attack after the first attack is parried. This may be done with a change in line; example, an attack in the high line (above the opponent's bellguard, such as the shoulder) is then followed with an attack to the low line (below the opponent's bellguard, such as the thigh, or foot); or from the outside line (outside of the bellguard, such as outer arm) to the inside line (inside the bellguard, such as the inner arm or the chest). A second continuation is stepping slight past the parry and angulating the blade to bring the tip of the blade back on target.
Remise. A second attack immediately after the first has missed or been parried. In foil or sabre, a remise is considered to have lost right of way, and the defender's riposte will always score instead of the remise.
Flick: a technique used primarily in foil. It takes advantage of the extreme flexibility of the blade to use it like a whip, bending the blade so that it curves over and strikes the opponent with the point. This technique has become much more difficult due to timing changes which require the point to stay depressed for longer to set off the light.
Parry: Basic defence technique, block the opponent's weapon while it is preparing or executing an attack to deflect the blade away from the fencer's valid area and (in foil and sabre) to give fencer the right of way. Usually followed by a riposte, a return attack by defender.
Circle Parry: A parry where the sword is twisted in a circle to catch the opponent's tip and deflect it away. It is commonly used to counter a disengage.
Counter Attack: A basic fencing technique of attacking your opponent while generally moving back out of the way of the opponent's attack. Used quite often in épée to score against the attacker's hand/arm. More difficult to accomplish in foil and sabre unless one is quick enough to make the counterattack and retreat ahead of the advancing opponent without being scored upon, or by evading the attacking blade via moves such as the In Quartata (turning to the side) or Passata-sotto (ducking).
Point In Line: Extending the weapon and arm against the opponent's target area. In foil and sabre, this gives one priority if the extension is made before the opponent is approximately advance-lunge distance away. When performed as a defensive action, the attacker must then disturb the extended weapon to re-take priority; otherwise the defender has priority and the counter-attack like action will win the touch if the attacker does not manage a single light. When performed as an offensive action, the intent is usually a means for the attacker to draw a defensive action that can be deceived and the attack continued. In épée, there is no priority; the move may be used as a means by either fencer to achieve a double-touch and advance the score by 1 for each fencer.
The attacks and defences may be performed in countless combinations of feet and hand actions. For example, fencer A attacks the arm of fencer B, drawing a high outside parry; fencer B then follows the parry with a high line riposte. Fencer A, expecting that, then makes his own parry by pivoting his blade under fencer B's weapon (from straight out to more or less straight down), putting fencer B's tip off target and fencer A now scoring against the low line by angulating the hand upwards.
Whenever a point is scored, the fencers will go back to their starting mark. The fight will start again after the following sentences have been said by the referee: "En garde" (On guard), "Êtes-vous prêts ?" (Are you ready ?, to which the fencers have to answer yes), "Allez" (Go).
Fencing has a long history with universities and schools for at least 500 years. At least one style of fencing, Mensur in Germany, is practiced only within universities, notably at Heidelberg. University students compete internationally at the World University Games. The United States holds two national level university tournaments including the NCAA championship and the USACFC National Championships tournaments in the USA and the BUCS fencing championships in the United Kingdom.
Equipment costs and the relatively small scale of the sport limits university fencing to a small number of schools. National fencing organisations have set up programmes to encourage more students to fence. Examples include the Regional Youth Circuit program in the USA and the Leon Paul Youth Development series in the UK.
In recent years, attempts have been made to introduce fencing to a wider and younger audience, by using foam and plastic swords, which require much less protective equipment. This makes it much less expensive to provide classes, and thus easier to take fencing to a wider range of schools than traditionally has been the case. There is even a competition series in Scotland – the Plastic-and-Foam Fencing FunLeague – specifically for Primary and early Secondary school-age children using this equipment.
The UK hosts two national competitions in which schools compete against each other directly: the Public Schools Fencing Championship, a competition only open to Independent Schools, and the Scottish Secondary Schools Championships, open to all secondary schools in Scotland. It contains both teams and individual events and is highly anticipated. Schools organise matches directly against one another and school age pupils can compete individually in the British Youth Championships.
Many universities in Ontario, Canada have fencing teams that participate in an annual inter-university competition called the OUA Finals.
Other variants include chair fencing, one-hit épée (one of the five events which constitute modern pentathlon) and the various types of non-Olympic competitive fencing. Chair fencing is similar to wheelchair fencing but for the able bodied. The opponents set up opposing chairs and fence while seated; all the usual rules of fencing are applied. An example of the latter is the American Fencing League (distinct from the United States Fencing Association): the format of competitions is different and the right of way rules are interpreted in a different way. In a number of countries, school and university matches deviate slightly from the FIE format.
^ A History of Fencing. Hcs.harvard.edu. Retrieved on 2012-05-16.
^ Historia de la Esgrima. Educar.org (1999-02-22). Retrieved on 2012-05-16.
^ Fencing Online. Fencing.net. Retrieved on 2012-05-16.
^ A History of Fencing. Library.thinkquest.org. Retrieved on 2012-05-16.
^ F.H.W. Sheppard, ed. Survey of London volume 33 The Parish of St. Anne, Soho (north of Shaftesbury Avenue), London County Council, London: University of London, 1966, pp. 143–48, online at British History Online.
^ Alaux, Michel. Modern Fencing: Foil, Epee, and Sabre. Scribner's, 1975, p. 83.
^ USACFC. USACFC. Retrieved on 2012-05-16.
^ US Fencing Youth Development Website, Regional Youth Circuit.
^ The Plastic-and-Foam Fencing FunLeague website.
^ Home :: Public Schools Fencing Championships.
Gaugler, William M. (2004). "The Science of Fencing: A Comprehensive Training Manual for Master and Student: Including Lesson Plans for Foil, Sabre and Epee Instruction". Laureate Press. ISBN 1884528309.
Vass, Imre (2011). "Epee Fencing: A Complete System". SKA SwordPlay Books. ISBN 0978902270. |
0.991729 | Due to riots today in Egypt i am worried about my upcoming holiday with my family.. What's your advice.
My advice is that you assess the situation and decide what level of risk is acceptable to you and your circumstances. Here are a few facts that might assist you in making that assessment.
Even at the height of the revolution last year things remained calm at the Red Sea resorts. While Cairo "burned" they were still serving cocktails to the sun lounges on the beach at Sharm.
In the current unrest Cairo (particularly Tahrir Square) Alexandria, Suez, Ismailia and Port Said are places where there's been trouble. Sharm' has not been mentioned in any news reports (that I've seen).
Is it guaranteed to remain calm? No. Is it LIKELY to turn nasty? Also no.
If you're worried, call your hotel and ask them for an honest assessment. If you're still not happy about going, ask them if you can re-schedule till another time when it is calmer.
Actually safety has never been a problem in Sharm El Sheikh. And Egypt is getting safer as the new government is doing everything they can to restore order. |
0.944775 | When the government enacted new food price increases in the summer of 1980, a wave of labor unrest swept the country. Partly moved by local grievances, the workers of the Lenin Shipyard in Gdansk went on strike in mid-August. Led by electrician and veteran strike leader Lech Walesa, the strikers occupied the shipyard and issued far-reaching demands for labor reform and greater civil rights. The workers' top priority was establishment of a trade union independent of communist party control and possessing the legal right to strike. Buoyed by a wave of popular support and formally acknowledged by other striking enterprises as their leader, the Gdansk workers held out until the government capitulated. The victorious strikers hailed the Gdansk Agreement of August 31 as a veritable social contract, authorizing citizens to introduce democratic change to the extent possible within the confines of the communist system.
Solidarity, the free national trade union that arose from the nucleus of the Lenin Shipyard strike was unlike anything in the previous experience of Comecon nations. Although primarily a labor movement led and supported by workers and represented by its charismatic chairman Walesa, Solidarity attracted a diverse membership that quickly swelled to 10 million people, or more than one of every four Poles. Because of its size and massive support, the organization assumed the stature of a national reform lobby. Although it disavowed overtly political ambitions, the movement became a de facto vehicle of opposition to the communists, who were demoralized but still in power. With the encouragement of Pope John Paul II, the church gave Solidarity vital material and moral support that further legitimized it in the eyes of the Polish population.
In the sixteen months following its initial strike, Solidarity waged a difficult campaign to realize the letter and spirit of the Gdansk Agreement. This struggle fostered an openness unprecedented in a communist East European society. Although the PZPR ousted Gierek as first secretary and proclaimed its willingness to cooperate with the fledgling union, the ruling party still sought to frustrate its rival and curtail its autonomy in every possible way. In 1980-81, repeated showdowns between Solidarity and the party-state usually were decided by Solidarity's effective strikes. The movement spread from industrial to agricultural enterprises with the founding of Rural Solidarity, which pressured the regime to recognize private farmers as the economic foundation of the country's agricultural sector.
Meanwhile, the persistence of Solidarity prompted furious objections from Moscow and other Comecon members, putting Poland under constant threat of invasion by its Warsaw Pact allies. This was the first time a ruling communist regime had accepted organizations completely beyond the regime's control. It was also the first time an overwhelming majority of the workers under such a regime were openly loyal to an organization fundamentally opposed to everything for which the party stood. In 1981 an estimated 30 percent of PZPR members also belonged to an independent union.
In late 1981, the tide began to turn against the union movement. In the midst of the virtual economic collapse of the country, many Poles lost the enthusiasm that had given Solidarity its initial impetus. The extremely heterogeneous movement developed internal splits over personality and policy. Walesa's moderate wing emphasized nonpolitical goals, assuming that Moscow would never permit Poland to be governed by a group not endorsed by the Warsaw Pact. Walesa sought cooperation with the PZPR to prod the regime into reforms and avoid open confrontation with the Soviet Union. By contrast, the militant wing of Solidarity sought to destabilize the regime and force drastic change through wildcat strikes and demonstrations.
In 1981 the government adopted a harder line against the union, and General Wojciech Jaruzelski, commander in chief of the Polish armed forces, replaced Stanislaw Kania as party leader in October. Jaruzelski's very profession symbolized a tougher approach to the increasingly turbulent political situation. At the end of 1981, the government broke off all negotiations with Solidarity, and tension between the antagonists rose sharply. |
0.999952 | There are at least 5 bands with this name: 1) Ravenous is a synthpop band from Germany, formed in 1995. Side projects consist of Funker Vogt in conjunction to Fusspils 11 and also Fictional. 2) Ravenous is a thrash metal band from Jyv?skyl?, Finland. 3) "The Ravenous" is a retro trash-death metal band from San Francisco, USA. It's members are Chris Reifert (also played with Autopsy), Killjoy and Dan Lilker. In 2002, they released their album Assembled in Blasphemy. 4) Ravenous is a RAC band from Australia. They have released an album called Blind Faith.
1) Ravenous is a synthpop band from Germany, formed in 1995. Side projects consist of Funker Vogt in conjunction to Fusspils 11 and also Fictional.
2) Ravenous is a thrash metal band from Jyv?skyl?, Finland.
3) "The Ravenous" is a retro trash-death metal band from San Francisco, USA. It's members are Chris Reifert (also played with Autopsy), Killjoy and Dan Lilker. In 2002, they released their album Assembled in Blasphemy.
4) Ravenous is a RAC band from Australia. They have released an album called Blind Faith.
5) Ravenous is a stomp rock/sludge pop band based in Brooklyn, NY. |
0.928884 | According to a new report published by the Kaspersky Lab, the Sofacy APT has recently increased its activities.
According to a new report published by the Kaspersky Lab, the Advanced persistent threat group Sofacy (also known as APT28 , Fancy Bear, Sednit, and STRONTIUM) has increased its activity.
The Sofacy group has been active since 2008, targeting mostly military and government entities in NATO countries, the experts speculate that its is a nation-state actor.
The experts speculate that the Sofacy has increased its operations tenfold by targeting high-profile entities by using a new set of hacking tools.
In the last months, the researchers have uncovered a series of attacks, relying on a new set of tools and zero-day exploits, and targeting defense-related targets with specific focus with the Ukraine.
"In the months leading up to August, the Sofacy group launched several waves of attacks relying on zero-day exploits in Microsoft Office, Oracle Sun Java, Adobe Flash Player and Windows itself. For instance, its JHUHUGIT implant was delivered through a Flash zero-day and used a Windows EoP exploit to break out of the sandbox. " state a blog post published by Kaspersky Lab.
The experts spotted a rare modification of the AZZY backdoor used by the threat actors for reconnaissance purposes. The first versions of the AZZY backdoor were discovered in August, once the attackers compromise the target they use more backdoor for lateral movements.
"The attackers deploy a rare modification of the AZZY backdoor, which is used for the initial reconnaissance. Once a foothold is established, they try to upload more backdoors, USB stealers as well as other hacking tools such as "Mimikatz" for lateral movement," continues the post.
Kurt Baumgartner, principal security researcher at Kaspersky Lab, explained that the Sofacy APT group is very technically capable, it is able to design new hacking tools depending on the specific target.
"This quick work is a new characteristic of their work, and this stepped up urgency is something that is unusual. In general, APT intrusions can last months or longer, and in these cases, we see Sofacy acting with unusually ramped urgency," Baumgartner said. |
0.972871 | What are called sensors? Broadly speaking, the sensor is able to perceive the external information and according to certain rules will device available signal convert these information into; simple sensor is a device of external signals are converted to electrical signals. It consists of sensitive components (sensor) and the converter is composed of two parts, some semiconductor sensitive element can be directly output signals, in itself constitute a sensor. Sensitive components variety, the principle of its perception of external information, can be divided into physical, stress, heat, light, electricity, magnetic and other physical effects based on. The chemical class, based on the principle of chemical reaction. The biology class, enzymes, antibodies, and hormone based on molecular recognition function. Usually according to its basic cognitive function can be divided into thermosensitive element, a photosensitive element, gas sensor, force sensor, Ci Min element, humidity sensors, acoustic sensors, radiation sensitive element, color sensors and taste sensors and other ten categories (and there are people who have the sensor can be divided into 46 categories). The commonly used thermal, light, gas sensor, force sensor and the magnetic sensor and its sensing element is introduced as follows.
The temperature sensor is mainly composed of a heat sensitive element. The thermosensitive element varieties more, market sales of the bimetallic strip, copper thermal resistance, thermocouple and platinum thermal resistance, thermal resistance. In a semiconductor thermistor as a temperature sensor detecting element widely, this is because the allowable working conditions in the element, semiconductor thermistor has the characteristics of small size, high sensitivity, high precision, and simple manufacturing process, low price.
According to the temperature characteristic of thermistor can be divided into two categories, with the rise of temperature resistance increased as the positive temperature coefficient thermistor, contrary to the negative temperature coefficient thermistor.
This thermistor with barium titanate (BaTio3) as the basic material, then adding proper amount of rare earth elements, the use of ceramic technology high temperature sintering into seoul. Pure barium titanate is an insulating material, but is doped with rare earth elements such as lanthanum amount (La) and niobium (Nb) and later, a semiconductor material, known semiconducting barium titanate. It is a polycrystalline material, there is grain boundary between grains, for conducting electronic, grain boundary is equivalent to a barrier. When the temperature is low, because of the action of electric field in the semiconducting barium titanate, conducting electrons can easily cross the barrier, so the resistance value is small; when the temperature increases to the Curie point temperature (critical temperature, the components' temperature control points' general barium titanate Curie point is 120 ℃), the electric field within the subject failure, can't help conducting electrons across the barrier, so the performance is dramatically increased resistance value. Because this element has not reached the Curie point of resistance with temperature changes very slowly, with a constant temperature, temperature control and automatic temperature control function, not only fever, redness, no fire, not easy to burn, the voltage AC, DC 3 ~ 440V can, long service life, is very suitable for motor overheating and other electrical device detection.
Negative temperature coefficient thermistor with manganese oxide, cobalt oxide, nickel oxide, copper oxide and aluminum oxide as the main raw material, the manufacturing technology of ceramic and. These metal oxide materials have semiconductor properties, quite similar to germanium, silicon crystal material, the body of carriers (electrons and holes) the number of small, high resistivity; temperature, carrier number increases, the natural resistance to reduce. A lot of negative temperature coefficient thermistor type, used to distinguish between low temperature (-60 ～ 300 ℃), temperature (300 ～ 600 ℃), high temperature (>600 ℃) three, has the advantages of high sensitivity, good stability, fast response, long life, low price advantage, widely applied to fixed-point temperature temperature automatic control circuit the temperature control system, such as refrigerator, air conditioner, greenhouse.
Thermistor is combined with a simple amplifying circuit, can detect a thousand one degree change in temperature, so the electronic meter thermometer, can achieve high precision temperature measurement. The working temperature of general use thermistor is -55 ℃ ~ +315 ℃, special low temperature thermistor temperature below -55 ℃ to -273 ℃.
I made the thermistor is according to the standard SJ1155-82 to make model, consisting of four parts.
The first part: the LORD says, by the letter 'M' said sensitive element.
The second part: categories, said the positive temperature coefficient thermistor with the letter 'Z', or 'F' letters represent negative temperature coefficient thermistor.
The fourth part: serial number, but also by the digital representation, representative specification, performance.
Usually manufacturers for differences between special needs of this series of products, plus' derived number 'in number, consist of letters, numbers and' - 'number and.
A variety of thermistor working conditions must be in the factory parameters within the allowed range. The main parameters of the thermistor has more than ten: nominal resistance values, the use of ambient temperature (maximum working temperature), measurement of power, rated power, rated voltage (maximum working voltage), working current, temperature coefficient, the material constants, time constant. The nominal resistance is the resistance at 25 ℃ zero power value, in fact there is a certain error, should be in within 10%. Operating temperature range of ordinary thermistor is larger, can choose according to need from -55 ℃ to +315 ℃, notably, the highest working temperature differences between different types of thermistor, such as MF11 sheet negative temperature coefficient thermistor is +125 ℃, +70 ℃ and MF53-1 only, should pay attention to students' experiment (generally do not more than 50 ℃).
The preferred ordinary use of negative temperature coefficient thermistor, because it changes with temperature is generally higher than the positive temperature coefficient thermistor resistance value is easy to observe, continuous decreased significantly. If the selected positive temperature coefficient thermistors, temperature should be in the vicinity of the Curie temperature of the element.
Coarse thermistor value should be selected range, moderate and a thermistor measuring small electric current multimeter. If the 10K thermistor, can choose MF10 multimeter, the shift switch to the ohmmeter R × 100, replace the probes are respectively clamped thermistor with alligator clip two pin. When the environment temperature is significantly lower than the body temperature, 10.2k thermistor readings, knead by hand, can see the indication of resistance decreases; the hand, increased resistance, gradually restored. Such a thermistor can be selected (the highest working temperature 100 ℃).
A air conditioner: special temperature sensor thermistor sealed in the copper metal.
Light sensor is mainly composed of light elements. At present, the rapid development of photosensitive element, variety, widely used. The market for the sale of a photosensitive resistor, diode, triode, photoelectric photoelectric coupler and optical cell.
Photosensitive resistors by semiconductor photoelectric crystal transparent, because the semiconductor photoelectric crystal composition is different, can be divided into visible light photosensitive resistor (cadmium sulfide crystal), infrared light photosensitive resistor (GaAs crystals), and ultraviolet light photosensitive resistor (zinc sulfide crystals). When the wavelength of the light sensitive semiconductor photoelectric surface of the crystal, crystal carrier increased, the conductivity increased (i.e., reduced resistance).
The light current, light resistance: under a certain applied voltage, when light (100lx) irradiation, current flows through the photosensitive resistor called the light current; voltage and the current ratio of light resistance, usually within a few tens of K Ω K Ω ~.
The dark current, resistance in the dark: under a certain applied voltage, when there is no light (0 LX) irradiation, current flows through the photosensitive resistor called dark current; voltage and the current ratio of resistance in the dark, generally a few hundred thousand more than k Ω K Ω to.
The maximum working voltage: General tens of volts to hundreds of volts.
◆ environment temperature: -25 ℃ to +55 ℃, some models can be -40 ℃ to +70 ℃.
◆ rated power (power): photosensitive resistance light current and voltage product; can be 5mW to 300mW a variety of specifications to choose.
◆ photosensitive resistance of main parameters and response time, sensitivity, spectral response, light, temperature coefficient, I-V characteristics.
Notable is, light (with the strength characteristics of the changes of light), temperature coefficient (temperature dependent properties), volt ampere characteristic is not linear, such as CdS (CDS) resist photoresistance sometimes increased with the increase of temperature, sometimes with increasing temperature and smaller.
Compared with ordinary diode, in addition to the tube core it is a PN junction, has a one-way conductive properties, others are very different. The first tube PN junction in the core of deep and shallow (less than 1 microns), in order to improve the photoelectric conversion ability; second PN junction area of relatively large, the area of the electrode is very small, in order to facilitate the photosensitive surface to collect more light; the third photodiode has a lens made of organic glass sealing, can gather light from the photosensitive surface "window" in appearance; so the sensitivity and response time photodiode is far superior to that of photosensitive resistance.
2DU has a very, very, before after ring pole three pole. The ring is to reduce dark current photodiode and increase working stability and design, application should be connected to the positive pole. The main parameters of the photoelectric diode has: maximum working voltage (10 ~ 50V), dark current (≤ 0.05 ~ 1 a), the photocurrent (> 6 ~ 80 a), response time, photoelectric sensitivity (tens of ns to several s), junction capacitance and forward drop.
Advantages of photodiode is of good linearity, fast response, wide range of wavelengths of light has the advantages of high sensitivity, low noise; drawback is the output current (or voltage) alone is small, need to add the amplification circuit. Applicable to communication and photoelectric control circuit.
The photodiode detection can be used multimeter R * 1K block, to avoid the optical forward resistance should be 10K Ω to 200 Ω K, reverse ∞, remove the shade right after the deflection angle is larger, the higher the sensitivity.
Photoelectric triode can be regarded as a combination of elements of a photodiode and a triode, with amplification function, so the dark current, photocurrent and photoelectric sensitivity is much higher than the photodiode structure, but the junction capacitance increase, response characteristics. Photoelectric control circuit is widely used in low frequency.
Semiconductor optoelectronic devices and MOS structure, such as a common scanner, camera CCD (charge coupled device) is integrated photodiode array or MOS structure.
Textbooks only requires the thermistor and photosensitive resistance characteristics of a simple experiment. Due to the close correlation of gas and the daily life of human, the detection of gases is to protect and improve the ecological environment indispensable means, gas sensors play an extremely important role. For example, the concentration of carbon monoxide in the living environment of 0.8 ~ 1.15 ml/L, will appear shortness of breath, rapid pulse, even syncope state, up to 1.84ml/L when there is a risk of death within a few minutes, so the carbon monoxide detection must be fast and accurate. Using SnO2 metal oxide semiconductor gas sensing materials, preparation of SnO2 nano particles by ultrafine particle refinement and doping process, and as a catalyst substrate doping, the appropriate sintering process for surface modification, made by thermal sintering CO sensitive element, can CO gas detection range of 0.005% ~ 0.5%. There are a lot of explosive and combustible gas, alcohol gas, automobile exhaust and other toxic gas detection sensor. Commonly used in the main contact combustion type gas sensors, electrochemical gas sensor and semiconductor gas sensor etc.. Contact combustion type gas sensor detecting element is generally platinum wire (also can be coated with platinum, palladium and other rare metal catalyst layer), use of platinum wires connect with current, maintaining 300 ℃ ~ 400 ℃, if contact with combustible gas, the combustible gas will burn in the rare metal catalyst layer therefore, platinum wire temperature rises, the resistance of platinum wire also rose; value changes by measuring the electrical resistance of platinum wire size, known concentration of combustible gas. Electrochemical gas sensor by the liquid (or solid, organic gel electrolyte, etc.) the output could be in the form of direct current oxidation or reduction gas generated, and can also be electromotive force acting on the ion ion electrode. Semiconductor gas sensor with high sensitivity, fast response, good stability, easy to use features, the application is extremely broad; the following highlights the semiconductor gas sensor and a gas sensor.
Semiconductor gas sensor with N type and P type division. Type N in the detection of resistance decreases with the increase of gas concentration; P value increases with the concentration of gas. Like the SnO2 metal oxide semiconductor gas sensitive material, which belongs to the N type semiconductor, at 200 ~ 300 ℃ it absorbed oxygen in the air, forming a negative ion adsorption of oxygen, so that the electron density in the semiconductor is reduced, so that its resistance value increases. When a combustible gas supply electronic (such as CO), the adsorption of oxygen desorption, and the combustible gas in the positive ion adsorption on metal oxide semiconductor surface; oxygen desorption emitted electron, combustible gas line in the positive ion adsorption state to emit electron, increasing the oxide semiconductor conduction band the electron density, the resistance decreases. Combustible gas does not exist, the negative ion adsorption of metal oxide semiconductor will automatically restore oxygen, make the increase of resistance to the initial state. This is the basic principle of semiconductor gas sensor detection of combustible gas.
There are 2 kinds of gas sensor made in china. One is the direct heating, heating wire and a measuring electrode to sintering in metal oxide semiconductor tube core; heating type gas sensor on ceramic substrate, through the pipe heating wire, two measuring electrode tube outside, metal oxides gas sensing materials for measuring electrodes, made by high sintering.
Parameters of gas sensor is mainly a heating voltage, current, voltage measurement circuit, the sensitivity, response time, recovery time, calibration gas (0.1% butane gas) voltage, load resistance etc.. QM-N5 type gas sensor suitable for natural gas, coal gas, hydrogen, alkyl, alkene gases such as gas, gasoline, kerosene, acetylene, ammonia, smoke detection, which belongs to the N type semiconductor device. High sensitivity, good stability, short response and recovery time, the market wide application. The following parameters: QM-N5 gas sensor calibration gas (0.1% butane gas, the best working conditions) voltage is greater than or equal to 2V, the response time ≤ 10S ≤ 30S, recovery time, the best working conditions of 5V, heating voltage measurement circuit voltage of 10V, load resistor RL as 2K, allows the working conditions of electric heating pressure 4.5 ~ 5.5V, measurement circuit voltage 5 ~ 15V, 0.5 ~ 2.2K load resistance. Below is a simple test circuit for gas sensor (sensor), voltage meter pointer changes more, the higher the sensitivity; just add a simple circuit can realize the alarm. Common gas sensor and MQ-31 (dedicated to the detection of CO), QM-J1 alcohol sensor etc..
Li Min of the many kinds of sensors, the traditional measurement method is using the deformation and displacement of elastic material to represent. With the development of microelectronic technology, based on the piezoresistive effect of semiconductor materials (i.e., pressure, the one direction and the resistivity changes) and good elasticity, has developed the Li Min sensor has the advantages of small volume, light weight, high sensitivity, widely used in the measurement of mechanical pressure, acceleration, weight.
The magnetosensor with Holzer device (based on the Holzer effect), magnetoresistive devices (based on magnetoresistive effect: magnetic field made the semiconductor resistance increases with the magnetic field increases.) , magneto diode and triode. Magnetic sensor based on magneto sensor is widely used in the measurement of electrical, magnetic and mechanical quantities of.
In a certain sense sensor and the sense of people have a corresponding relationship, the perception has been far more than human senses. For example, was observed by using the target's infrared radiation of infrared imaging system (night like instrument), the night can be found 1000 m, 2000 meters found the vehicle; the core components of the imager is infrared sensor. In the 1991 Gulf War, the Iraqi tank configuration of night vision instrument detection distance of only 800 meters, is less than half the coalition, the darkness was badly defeated is inevitable. At present, all the countries in the world to sensor technology as the focus of high-tech development priority. In order to greatly improve the performance of the sensor, the constant use of new structure, new materials and new technology, miniaturization, integration and intelligent direction. |
0.888296 | Energy Level: moderate to high .He gets excited if another dog plays with him but typically just like to nap , be on his bed or cuddle.
Good with other dogs: yes , he loves playing with my alpha female dog.But not sure with more than one dog .
Good with cats: yes. Previous owner had two cats and Boris loved to play with them. He can be gentle and playful with cats.
Object Aggression: he doesn't like sharing his bed with other dogs but just sometimes , depends in his mood.
Medications: No , he only needs to get clean his facial folds twice a day with wipes as needed.
Crate Trained: Yes . He hates to be on a crate but he does very good in a space with a baby gate.
Physical Fence Required: Preferred but not required. He loves being outside and smell the grass.
Boris loves taking naps in his bed and he will stay there all day if he could. He also loves being outside and playing around. He would be fine in an apartment or house because he does not run around in the house that much. Boris is very well trained and he will not jump in the furniture unless you give him permission to do so . He does love being around people. Boris will bark with strange noises so he is a watch dog. He will go investigate where are the noises coming from.
Boris loves his naps. Sometimes he will try to take his bed with him wherever he goes. Its pretty funny to see him moving his bed with his mouth around the house. Boris does not like being push and he will let you know if he feels threaten . He will growl and bark at you. But if you change your tone and let him know it is okay , he will be fine.
Boris loves his car rides and he does very well in public places. He will just ignore people and be very calm. Boris is very well behaved and looks like he was trained in his past. he knows when you say NO. He will wait for you to allow him to jump in the couch .
Boris loves to have his belly rubbed.
Boris likes sneezing a lot . And he will sneeze when he is near you .
Boris just wants a family that can take him to the dog park,play with him , take him to the lake or do activities , take very good care of him taking him to the vet to do his check ups, spend LOTS of time with him and give him lots of attention and good food because he deserves it . He is a sweet guy who loves to be near people.
Please consider sponsoring Boris to help with medical bills.
Boris is an owner surrender who's schedule changed and does not have the time needed to give to him. Boris is said to to well with cats, as his previous home had two that played well with. |
0.99831 | Hypercalcaemia. What does it signify?
Hypercalcaemia can be caused by many disorders, but is most commonly due to primary hyperparathyroidism in outpatients, and to malignant disease in hospital inpatients. When mild (less than 3 mmol/L) it does not cause symptoms, but can have long term effects such as renal calculi. It is important that the aetiology of the hypercalcaemia be established, as it can reflect serious disease. In most patients the correct diagnosis can be suspected from clinical history and examination, and confirmed by laboratory tests and x-rays. The most difficult diagnostic problem is the patient with negative clinical findings, mild hypercalcaemia and mild renal impairment, when the parathyroid hormone level is normal or slightly elevated. When hypercalcaemia is severe (greater than 3.5 mmol/L), it can cause vomiting, polyuria, dehydration and renal impairment, and is then an important therapeutic problem. Therapy includes treatment of the cause, such as radiotherapy for malignant disease or surgery for primary hyperparathyroidism. In addition, it is usually necessary to treat the hypercalcaemia itself, and the initial step is always rehydration. If the plasma calcium concentration remains high, drug treatment must be added, the most effective and reliable agent being intravenous mithramycin. Aminohydroxypropylidene diphosphonate (APD), though less studied, may be equally useful in this situation. Glucocorticoids are not always effective, and phosphate may cause renal damage, particularly when given intravenously. For long term treatment of malignant hypercalcaemia, oral glucocorticoids and phosphate are often effective, and can be given in combination. When primary hyperparathyroidism cannot be corrected surgically, the hypercalcaemia (and hypercalciuria) are probably best treated with a low calcium diet and cellulose phosphate, a regimen also effective for the hypercalcaemia of sarcoidosis. |
0.943389 | For the city of a similar name, see Bentonville, Arkansas. For the county of the same name, see Benton County, Arkansas.
Saline County Courthouse, located in the heart of downtown Benton.
Benton is a city in and the county seat of Saline County, Arkansas, United States and a suburb of Little Rock. It was established in 1837. According to a 2006 Special Census conducted at the request of the city government, the population of the city is 27,717, ranking it as the state's 16th largest city, behind Texarkana. However in the 2010 census, the city population increased to 30,681, making it the 12th largest city in the state of Arkansas. It is part of the Little Rock–North Little Rock–Conway Metropolitan Statistical Area. The city of Benton, first settled in 1833 and named after Missouri Senator Thomas Hart Benton, was formally chartered in 1836 when Arkansas became a state.
As of the census of 2000, there were 21,906 people, 8,713 households, and 6,186 families residing in the city. The population density was 1,221.2 people per square mile (471.5/km²). There were 9,315 housing units at an average density of 519.3 per square mile (200.5/km²). The racial makeup of the city was 92.81% White, 4.46% Black or African American, 0.39% Native American, 0.56% Asian, 0.05% Pacific Islander, 0.75% from other races, and 1.19% from two or more races. 1.90% of the population were Hispanic or Latino of any race.
There were 8,713 households out of which 33.5% had children under the age of 18 living with them, 55.9% were married couples living together, 11.8% had a female householder with no husband present, and 29.0% were non-families. The average household size was 2.46 and the average family size was 2.95.
In the city the population was spread out with 25.3% under the age of 18, 8.8% from 18 to 24, 29.8% from 25 to 44, 21.5% from 45 to 64, and 14.7% who were 65 years of age or older. The median age was 36 years. For every 100 females there were 91.5 males. For every 100 females age 18 and over, there were 88.1 males.
The median income for a household in the city was $41,503, and the median income for a family was $51,064. Males had a median income of $32,493 versus $22,386 for females. The per capita income for the city was $19,797. About 5.8% of families and 8.6% of the population were below the poverty line, including 9.9% of those under age 18 and 11.5% of those age 65 or over.
Benton School District, which leads to graduation from Benton High School.
Harmony Grove School District, which leads to graduation from Benton Harmony Grove High School.
Bryant School District, which leads to graduation from Bryant High School.
Billy Bob Thornton, writer, director, and star of the 1996 American drama film ‘’Sling Blade’’ used Benton as the location for many scenes.
The climate in this area is characterized by hot, humid summers and generally mild to cool winters. According to the Köppen Climate Classification system, Benton has a humid subtropical climate, abbreviated "Cfa" on climate maps.
^ "Benton (Saline County)". The Encyclopedia of Arkansas History & Culture. The Central Arkansas Library System. http://www.encyclopediaofarkansas.net/encyclopedia/entry-detail.aspx?entryID=979. Retrieved 4 July 2014.
^ "Kenneth L. Henderson". intelius.com. http://www.intelius.com/results.php?ReportType=1&formname=name&qf=Kenneth&qmi=L&qn=Henderson&qcs=Russellville%2C+AR&focusfirst=1. Retrieved April 8, 2015.
This page uses content from the English language Wikipedia. The original content was at Benton, Arkansas. The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License. |
0.988393 | Webster dictionary was developed by Noah Webster in the beginning of 19th century. On this website, you can find definition for silicon from the 1913 edition of Webster's Revised Unabridged Dictionary. Define silicon using one of the most comprehensive free online dictionaries on the web.
1. A nonmetalic element analogous to carbon. It always occurs combined in nature, and is artificially obtained in the free state, usually as a dark brown amorphous powder, or as a dark crystalline substance with a meetallic luster. Its oxide is silica, or common quartz, and in this form, or as silicates, it is, next to oxygen, the most abundant element of the earth's crust. Silicon is characteristically the element of the mineral kingdom, as carbon is of the organic world. Symbol Si. Atomic weight 28. Called also silicium.
The one passes into the other as seldom as silicon passes into the cells of a fallen tree. - "A Republic Without a President and Other Stories", Herbert Ward.
Iron is an important element of blood, and silicon supplies the hardest parts of the teeth, nails, and hair. - "The American Woman's Home", Catherine E. Beecher and Harriet Beecher Stowe.
We've seen hydrogen, oxygen, silicon and others, and as the sun aged, the elements must have been mixed up more and more thoroughly. - "The Black Star Passes", John W Campbell. |
0.999976 | Can wikis be decentralized using blockchain technologies? Projects like Substratum, Shift, Sia, Golem, and IPFS might help to enable the decentralization of wikis. Cryptocurrencies like Steem can perhaps be used to reward contributors and editors on the decentralized wikis. Perhaps a new cryptocurrency will be created to reward and tip contributors and editors on decentralized wikis.
Wikipedia is the most popular wiki. There are many wikis out there. Wikipedia runs on software called MediaWiki. Wikipedia content is licensed under a Creative Commons license. The license of Wikipedia is CC-By-SA, which means it is a Creative Commons license that allows you to edit and re-publish content, and even to monetize the content, as long as you reshare it under the same Creative Commons license and give attribution to the contributors/creators of the often collaborative content.
So perhaps the software running wikis can be decentralized. Perhaps also, wikis can have functionality to reward people for editing, and also allow for people to tip one another cryptocurrency. Individuals who run nodes of the decentralized wikis can be rewarded with cryptocurrency. Perhaps MediaWiki or WordPress can be forked, edited, or have plugins/extensions created to support decentralization and cryptocurrencies. Perhaps readers can mine cryptocurrency in their browser while viewing content from the wiki, or perhaps a decentralized advertising platform could serve ads to users who do not contribute to the wiki, and who do not want to mine cryptocurrency in their browser. Perhaps viewing the content of the wiki (which could include text, pictures, video, and audio) wiki can be free to all. More closely examining cryptoeconomics can determine what the best sustainable structure might be. It will be interested to see if wiki technology can be decentralized and incentivized using blockchain and cryptocurrencies. |
0.915177 | Review for the film " Superman Vs Batman"
One aspect of significance is that Zack Snyder, the director of Batman V Superman: Dawn of Justice, has made us to witness the lives of the two heroes in the same film. Well, let’s see how the movie has turned out to be.
Bruce Wayne aka Batman (played by Ben Affleck) sees his parents being killed before his eyes, and he is hell bent on avenging the wrong-doer.
There is also the story of Superman (played by Henry Cavill) who wages a battle against the attacking Kryptonian multitudes of Gen.Zod. In fact, the Metropolis has been destroyed.
While the significant scenes have been shown in flashback, the current scenario of the movie is 18 months after the raid had taken place. The world is yet to get accustomed to the apparently never-ending presence of Superman. There is no iota of doubt that Superman’s actions are gallant, and he has a humanitarian side, but Bruce Wayne feels him to be a threat to humanity just like many others. In fact, Bruce Wayne has witnessed several people being changed to fiends.
There is also the plot of Lex Luthor (played by Jesse Eisenberg), a jittery rich man, and he is upset that he is not able to have power over the world. Luthor develops a monster called Doomsday (which seems to have more power than Batman and Superman) to wipe out Metropolis. And well, do Superman, Batman, and Wonder Woman (played by Gal Gadot) stop Luthor from causing further damages? Watch the movie to find out.
The admired Man Of Steel was depicted with a grim touch way back in 2013 through the film Man of Steel. The present film Batman V Superman: Dawn of Justice also has its dark side. Having said that, the movie sometimes seems to be confused in defining what a real hero means.
The acting more or less compensates for the poor script. Ben Affleck slips into the role of Batman with aplomb. For those who were worried whether he would compensate for the missing of Christian Bale (of Batman Trilogy), the good news is that Affleck has done a fantastic job. Henry Cavill has done an earnest job. The character of Wonder Woman, played by Gal Gadot, is by far the most powerful ones in the film, and she leaves no stone unturned in doing justice to her brief character. She has a fighting spirit in her, and her energy in the movie is infectious. One would surely feel that her role could have been extended, after watching the movie. Jesse Eisenberg has understood the nuances of his character well and does a near-perfect job as the scheming villain.
The cinematography of Larry Fong is par excellence.
Editing of David Brenner gives the proper cuts to simplify the confusions in the movie.
The brief flashbacks are astutely executed.
The combat between Batman and Superman is executed in an awesome manner.
Junkie XL and Hans Zimmer music is one of the highlights of the movie.
The movie also has some worthy moments, despite some flaws.
The movie is straight-forward enough in depicting the repercussions of Superman’s actions.
The action scenes are commendable.
CGI is up to the mark.
The movie provides the viewers with a better insight as to why Batman dislikes Superman.
Though the movie seems to be promising initially, it lacks luster in the later half.
Director Zack Synder could have expressed what he wanted to convey in a clear manner.
There is minimal humor in the movie.
There is a dearth of logic in some places.
The fight scenes that are quite grave may not be liked by some people.
At least, we can see the Superman, the Batman, and Wonder Woman in the same film. And not to miss the superb acting of Ben Affleck and Gel Gadot.
Ben Affleck Had Taken His New Role As Executive..
Zack Snyder To Join Henry Cavill For Superman M..
Superman Wishes To Do A Solo Sequel With The Di..
Batman Vs. Superman Suffers Decline But Hits Bo..
Affleck BATMAN Script Better Than BATMAN VS SUP.. |
0.933679 | By May 1960, John F. Kennedy seemed to be the early favorite to win the Democratic presidential nomination, but Lyndon B. Johnson, Hubert H. Humphrey, and Adlai Stevenson all remained strong potential rivals. The West Virginia primary, held on May 10, 1960, proved to be a decisive battleground in the race. Kennedy, who had not faced serious opposition in the other primaries, suddenly faced a serious challenge from Hubert Humphrey, the junior senator from Minnesota. In order to secure his party's nomination, Kennedy had to win West Virginia's delegates. Losing would effectively take the decision off the convention floor and throw it into the hands of the Democratic Party's powerful urban bosses, a development JFK was anxious to avoid because they would favor more seasoned party elders.
In 1958, when Kennedy had commissioned Louis Harris to poll West Virginia voters to see how he would fare running against Richard Nixon, he led his Republican opponent by fourteen points. Cheered by this hypothetical victory, he set up what journalist Theodore White called "a shadow operation" which, by 1959, had chairs in each county. Harris then polled West Virginia Democrats and reported that JFK led Humphrey seventy percent to thirty percent. Kennedy then decided that he had the votes he needed to carry the state and would not campaign actively there unless Humphrey entered the primary. Humphrey had made an early decision to compete with Kennedy for West Virginia, believing that his populist Midwestern background would appeal to voters in that state far more than JFK's polished Ivy League image. Although Humphrey had recently lost the Wisconsin primary, his prospects in West Virginia looked promising. At the same time, the Kennedy team remained confident that their candidate would trounce Humphrey, who could not even carry his next door state.
By early spring, the issue of Kennedy's religion had entered the electoral discussion, splitting the Wisconsin vote along religious lines and resulting in a steady erosion of support in West Virginia. Four weeks before West Virginia primary day, the tide had turned against JFK and he found himself trailing Humphrey by 20 points. When the campaign asked the county chairs why the voters had switched allegiance, they replied, "No one know you were a Catholic" when the poll was taken. Kennedy responded by moving his key campaign aides to West Virginia, calling on close friends to volunteer their time, and training county campaign chairs in 39 of the state's 59 counties to staff phone banks, host receptions, and go door to door to distribute literature. He changed his schedule to campaign throughout the state and brought Franklin D. Roosevelt, Jr. there to endorse his candidacy. On April 25th he decided to attack the anti-Catholic bias head-on, telling audiences across the state, "I refuse to believe that I was denied the right to be President the day that I was baptized." Finally, on May 8th, two days before the election, in a broadcast paid for by the campaign, FDR, Jr. asked JFK how his Catholicism would effect his presidency. Kennedy replied that taking the oath of office required swearing on the Bible that the president would defend separation of church and state and that any candidate that violated this oath not only violated the Constitution but "sinned against God."
In framing the issue as one of tolerance versus intolerance, Kennedy appealed to West Virginia's long-held revulsion for prejudice; placed Humphrey, who had championed tolerance his entire career, on the defensive; and attacked him with a vengeance. Humphrey, who was short on funds, could not match the well-financed Kennedy operation. Kennedy defeated his rival soundly, winning 60.8 percent of the vote. That evening, Humphrey announced that he was no longer a candidate for the presidency. Kennedy knew the nomination was his if he could hold his delegates together once they reached the convention.
Sources: Theodore White, The Making of the President 1960 (New York: Atheneum Publishers, 1988), pp. 97-114; Carl Solberg, Hubert Humphrey: A Biography (New York: W.W. Norton & Company, 1984), pp. 199-213. |
0.929442 | Metro Manila (CNN Philippines, August 7) — The joint exploration deal for oil and gas deposits is drawing one step closer, as the Philippines and China create their respective working groups for it.
In a press briefing Friday, Foreign Affairs Secretary Alan Peter Cayetano said President Rodrigo Duterte approved the creation of a working group to study the legalities of the deal.
"I just got his approval in principle," Cayetano claimed.
He said the group will have experts from government agencies such as the Department of National Defense, the Department of Environment and Natural Resources, the Solicitor General, and the Department of Justice, among others.
A legal team is composed of oil and gas experts, constitutional law authorities, and professionals dealing with the United Nations Convention on the Law of the Sea.
"Our job now is to put up a framework that's acceptable to both China and the Philippines, and the first part should be exploration," Cayetano said. He added that they will leave future contract negotiations to the commercial entities.
The foreign affairs chief said China is also ready with its technical working group.
"As soon as both sides send their working group(s), at least we can talk," Cayetano said. "I'm not sure if we can agree, but at least we can start talking."
Cayetano said he will talk with Energy Secretary Alfonso Cusi to discuss which areas they are eyeing for joint exploration, but said they will look into areas with existing service contracts (SC).
"It takes so much time for this. Diba ang (Isn't the) oil and gas exploration and development is just like building powerplants? There's such a huge time that you need to get this done," he said.
In March, Presidential Spokesperson Harry Roque said the areas of Service Contracts (SC) 57 and Service Contract 72 are being considered for the exploration.
SC 57 is an undisputed area within the Philippines' Exclusive Economic Zone, and lies beyond China's nine-dash line claims in the South China Sea. It is a joint exploration located offshore of Palawan, between state-run PNOC Exploration Corporation, Mitra Energy Ltd., and China's state-owned China National Offshore Oil Company.
Meanwhile, SC 72 refers to the agreement on the Reed Bank off Palawan in 2010. The government awarded exploration rights to an area in Reed Bank to United Kingdom-based oil and gas company Forum Energy Plc. (FEP). The majority of FEP's shares are owned by business tycoon Manny V. Pangilinan. |
0.900247 | In 1958 Bill got the break that would change his career. Dell Publishing Company had just acquired the rights to handle the Agatha Christie line. It should be noted that Dame Agatha did not want depictions of Miss Marple or Hercule Poirot on the covers of her books. When Dell gave Bill the assignment, he read the story and looked for clues to put on the cover, which became the beginning of a new format. Dell brought Bills work to the attention of Walter Brooks and Bill was hired to paint the cover art of The Man In The Brown Suit. Bill was paid $243.75 for doing two comps and the cover. He ended up doing well over one hundred fifty covers for Dells Agatha Christie series.
Agatha Christie wrote about eighty mysteries (Christie also wrote Gothic novels under the name Mary Westcott, some of which Bill illustrated). The publishing rights to Christies mysteries had been divided among three publishers, Dell being one of them. How did Bill end up painting over one hundred fifty Christie covers if Dell only had the rights to publish less than thirty of her books? Because new covers were done for each mystery roughly every two years. Bill ended up painting The Man In The Brown Suit at least five times, for example, the fifth cover done in 1974.
Agatha Christie mysteries were not the only paperback mystery covers that Bill painted. In 1960 he did his first cover for Ed Rofheart, an art director at Popular Library. That relationship continued for most of his career. Bill turned out many covers for Popular Library, Dell, Avon Bantam, Fawcett and Zebra as well as many other publishing houses. He painted covers for Mary Roberts Rinehart, Conan Doyles Sherlock Holmes series, Leslie Ford, Mignon Eberhart, Shirley Jackson and many other authors. In 1970 Bill won the Raven Award (which he promptly gave away to Ed) from the Mystery Writers of America, for The Best Mystery Jacket of the Year. The cover art for Picture Miss Seeton, written by Heron Carvic, was displayed at The Society of Illustrators in New York City.
Bill also painted twelve movie posters, beginning in 1966 when Bill Gold at Bill Gold Advertising hired him to do a poster for $3,000. That professional relationship continued through 1980 with Bill doing movie posters for Deliverance, Dog Day Afternoon, Escape From Alcatraz, Papillon, Agatha, and The Naked Runner among others. The poster Bill did for Night Visitor was first runner-up in the 1st Annual Key Art Awards in 1972 and was exhibited at The Society.
a person whos fluent in the language of poisons, the law, names of silk, fur and fabrics. For each item, Bill found either the object itself or a photograph. He kept files of clippings torn from magazines. Often he would go into New York City to the public library and borrow pictures from its pictures collection. Sometimes the object, such as an old brooch, a hat pin or a vase could be found at home or borrowed from a friend. Items were also rented from stores in New York that were in the business of supplying props for plays. Guns were a more difficult item to procure. Bill said there used to be a place on 46th Street between 5th and 6th where a real gun, the opening plugged, could be rented. When the paperwork necessary for renting a gun became more extensive, Bill had to be more ingenious. On one occasion Bill borrowed a gun from a local police officer after showing him his studio and the work he did. When all else failed, Bill would enlist his wife, Erma, to make the object or costume, everything from a bundle of old letters tied with ribbon, an old fashioned bonnet, to a voodoo doll stuck full of pins.
Mystery covers other than the Agatha Christie series might have people in them and Bill would have to find subjects and take photographs. As part of his job Bill learned a bit about photography, enough to light a shoot, pose the model, take the photograph, develop and print the film. When Polaroid Cameras came on the market, they proved to be an invaluable aid. As for the models, a steady stream of neighbors and friends came through Bills studio where, with the help of his wife, they were dressed appropriately, posed and photographed. All of them were volunteers, rewarded for their efforts by a chance to be famous and just for the novelty of the situation. For the most difficult shoots or glamorous models, Bill would go into New York and rent a model, taking the photographs himself.
In 1974 there was a show at The Society of Illustrators in New York entitled Themes and Variations - A Retrospect of William Teason Paintings for the Dell Books of Agatha Christie in which one hundred of his covers were exhibited. He was given a key by the art director and told to go downstairs to the gallery on the first floor and to hang one hundred Agatha Christie covers over the weekend. So he did. On Monday morning, he received a call from the gallery curator asking him why his paintings were hanging in his gallery and is he a member of The Society. Bill explained who told him to display his work and no he was not a member of the Society. The curator asked if he would be willing to join and Bill said absolutely. So the show went on.
All the while Bill was painting paperback mystery covers he was also painting fine art. His goal had never been to be a fine artist and he enjoyed illustrating covers, but in the 1970s he started to find a style and subject matter that suited him. Ive always had to please a client, he said. When I have to please myself as an artist, then its really tough. He began painting in gauche, just as he did for his mystery covers. Rather than painting still lifes as he had in the past, he was doing studies of people. The mystery of my covers and Christie have slipped into my paintings. I cant help being fascinated and seeing mystery in everything. Bill did bring some of his fine artwork to New York galleries where he received positive interest and a number of awards. He also was reluctant to let his fine artwork go. Once at the annual show of The American Watercolor Society, he put a high price on a painting, thinking that would preclude its sale. The painting sold anyway and Bill always regretted it; from then on he put Not For Sale on his paintings. Throughout the 1970s he had artwork displayed in six American Watercolor Society shows, winning The High Winds Award in 1971, The Mario Cooper Award in 1975, The Lily Saportas Memorial Award in 1978, and The Hardie Gramatky Memorial Award in 1984. In 1979 Bill won the Society of Illustrators Hamilton King Award for the best illustration of the year by a member for his painting The Young Juggler. The selection is made by former recipients and may be won only once.
In 1990, Bill and his wife retired to Cape Cod. Their son and family lived there and Bill had always enjoyed the seascapes of the Cape. He had developed Parkinsons disease by then but still went into his studio every day to paint. In 1991 he did his final paperback mystery cover, The Last Camel Died @Noon, written by Elizabeth Peters. Bill painted fine art during his years on Cape Cod, the tremor in his hand stilled when he painted. He continued to work in great detail with small sized brushes.
He died on February 25,2003 at the age of eighty one in a nursing home where he had gone for a week of respite care. On the pad of lined yellow notebook paper he used to write messages to the staff because his speech was no longer intelligible, was found a page filled with sketches of the faces of the residents. I find the faces of old people endlessly fascinating, he had written. |
0.999995 | Is the plot of `Baahubali` inspired by Jain mythology?
Is the plot of 'Baahubali' inspired by Jain mythology?
The plot of Baahubali has remained a closely guarded secret but the title of the film hinted at the possibility that it might be influenced by the story of Rishabha and his two sons Jadabharata and Bahubali from Jain mythology.
Rishaba's story appears in multiple sources like the Bhagavata Purana, the Rig Veda and the Jain text Adi purana, written in the 10th century by Adikavi Pampa. The first of the twenty four tirthankaras, Rishaba, is revered as the founder of Jainism.
According to legend, Rishaba divides his kingdom between Bharata and Bahubali. Bharata becomes the ruler of the northern half of the kingdom, ruling from Ayodhya while Bahubali presides over the southern half of the kingdom from Podanapur. Bahubali and Bharata subsequently go to war for control over the entire territory. Bahubali gains victory but gives up his kingdom to his brother.
From what is known of Baahubali's plot, the rivalry between the brothers played by Prabhas and Rana Daggubati seems to have a resemblance to the story of Bharata and Bahubali. The similarity in the stories landed the makers of the film in trouble when a Jain mutt raised concerns over the portrayal of Bahubali in the film. The character in the film was perceived to be too violent. On the other hand, Bahubali, who is revered as Lord Gomateshwara, is an embodiment of peace.
However, the makers of the film have assured everyone that the plot of the film is fictional and is not based on the religious texts. Other than the similarity in the name, there is little in common between the two stories. |
0.962955 | Background: The rapid growth of gene expression databases has created a need for contentbased searches as an alternative to unstructured database queries using keyword- or metadata-based searches. Content-based searching is the ability to retrieve all experiments with similar gene expression patterns in a database regardless of the biological annotations provided for these experiments.
Objective: While this concept is still in its infancy in a general context, in this study we focus on applying it to a specific subset of gene expression datasets, by only querying experiments involving time-series expression profiles.
Method: To this end, we propose a novel experiment fingerprinting scheme obtained by clustering expression profiles, for content-based searching of time-series microarray experiments. To determine the retrieval ability of the proposed scheme, we performed a simulated information retrieval task on a large set of microarray experiments gathered from a public repository. The relevance between any two experiments was then defined using their commonalities based on annotated disease associations.
Results and Conclusion: The results showed that relevant experiments can be more successfully retrieved using this new method compared with traditional differential expression-based methods.
Gene expression database, time-course data, time-series profile, content-based search, information retrieval, modelbased clustering. |
0.998119 | Full list of airports in Grenada includes both the international airports in Grenada, the largest airports, large airports, and a small civil airports in Grenada.
The list of airports includes: airport codes in Grenada (iata codes, icao codes), airport names in Grenada, the name of the city in which or near which the airport is located.
How many airports in the Grenada?
To see a full list of airports in the Grenada, you can look at the list of airports in the country listed in the table above or find out the answer in the next sentence. |
0.999999 | When shouldn't I swaddle my baby?
You shouldn't wrap your baby if you're using other sleeping aids like a sleeping bag, once the startle reflex disappears (usually around three months) and from around four to six months when baby shows signs of being able to roll.
If you decide to go ahead with swaddling, it's important that you do it correctly. |
0.95465 | It is surely time to start exploring and outlining the ingredients of something new and relevant that starts with and is bound by respect for nature, its limits, and its wildlife, as well as people.
El informe explora alguno de los escenarios de transición de energía propuestos actualmente, mostrando por qué, hasta el momento, la mayoría son demasiado optimistas, ya que no tienen en cuenta todos los factores relevantes que limitan la expansión de fuentes energéticas alternativas.This is a Spanish translation of the Post Carbon Institute and International Forum on Globalization and report 'Searching for a Miracle'.
Perhaps the most significant limit to future energy supplies is the “net energy” factor—the requirement that energy systems yield more energy than is invested in their construction and operation. |
0.974274 | Napoleon Bonaparte's fame as a military commander can be dated back to his campaign in Italy in 1796-97, where as the young and relatively unknown commander of a ragged and poorly supported army he managed to defeat a series of much larger Austrian and allied armies, conquer most of northern Italy, and force the Austrians to the negotiating table. Napoleon was appointed to command the French Army of Italy in March 1796. His orders were to invade northern Italy and occupy Lombardy, a move that the French Directory believed would force the Austrians to move troops south from the Rhine front. Napoleon's task was essentially diversionary, for the main offensive for 1796 was expected to take place on the Rhine. Instead the campaign on the Rhine would soon bog down, while Napoleon's whirlwind of activity in northern Italy effectively ended the War of the First Coalition.
The army Napoleon inherited was in a terrible condition. By 1796 the French armies on the Rhine were seen as the most important, and the Army of Italy was badly paid, badly provisioned and often badly under strength. By the time Napoleon had somewhere between 37,000 and 47,000 men at his disposal, spread out from the pass of Tenda at their left almost to Genoa at their right. The army was split into three divisions, commanded by Pierre Augereau, Andre Masséna and Jean Sérurier, all more experienced than their young commander.
In theory the French were outnumbered, but the 60,000 Allied troops facing them across the Apennines were split into two armies – 25,000 Piedmontese troops south of Turin and 35,000 Austrian troops further east. The two Allied armies did not cooperate well, and would soon be forced apart. Napoleon would then face a series of Austrian armies sent across the Alps in an attempt to lift the siege of Mantua, and may have taken as many as 150,000 prisoners during the course of the campaign.
At the start of his Italian campaign Napoleon's army was stretched out along the coast from Nice towards Genoa, with the Apennine Mountains between him and the Austrian and Piedmontese armies. The main Austrian army, under the command of General Beaulieu, was based around Alessandria, north of Genoa, while the Piedmontese army (Colli) was further west, defending the main passes across the Maritime Alps and the approaches to Turin.
Napoleon planned to split these two armies, and defeat then in turn. He sent a messenger to the senate of neutral Genoa, asking for permission to advance through their territory. As Napoleon expected permission was refused, and the Austrians were informed of the request. Napoleon also sent a small decoy force along the coast to Voltri.
The key to Napoleon's early successes can be found in the geography of the Ligurian Apennines. Two main passes cross the mountains – the Ormea pass in the west, which ran from Ormea up to Ceva in the Tanaro valley, and the Bochetta Pass, which left the coast at Genoa. Napoleon hoped to convince the Austrians he was heading for the Bochetta Pass. In fact he intended to cross the Apennines between the two main passes, taking advantage of a gap that ran from Savona at the coast west to Carcare, at the southern end of the Bormida valley. From there the French could move north along the valley to threaten the Austrians, or west to Millesimo and Ceva (along the route used by the modern A6 motorway) to threaten the Piedmontese.
Beaulieu acted exactly as Napoleon had hoped. While Beaulieu led one Austrian army down the Bochetta Pass to attack Voltri, a second column, under General Argenteau, was sent along the Bormida valley, in the hope that Napoleon's right wing could be trapped between the two. Instead Argenteau ran into a strong defensive position in the mountains north of Savona, and on 12 April suffered a heavy defeat in the battle of Montenotte, Napoleon's first victory as a commander.
This left the Allies divided, with the Piedmontese to the west at Millesimo and the Austrians to the north at Dego. Napoleon sent troops to attack both of these positions. On 13-14 April Augereau forced the Piedmontese out of Millesimo. This overlapped with the battle of Dego (14-15 April). On the first day Masséna captured Dego, but he was then forced out by an Austrian counterattack. On the second day Napoleon launched a series of attacks, and eventually the Austrians were forced to retreat. In the aftermath of this defeat General Beaulieu decided to pull back towards his base at Alessandria to defend his communications with Austria.
This left Napoleon free to turn west and eliminate Piedmont from the war. On 16-17 April the Piedmontese managed to hold the French off at Ceva, but then pulled back to a stronger position at Mondovi, where on 21 April Napoleon won a conclusive victory. On 23 April General Colli, in command of the Piedmontese army, sued for peace and on 28 April Piedmont withdrew from the war. (Armistice of Cherasco).
Napoleon was now free to turn east and defeat Beaulieu. First he had to cross the Po. The main Austrian defences were around Pavia, and Beaulieu assumed that Napoleon would attempt to cross the river somewhere in this area. Napoleon encouraged this belief by including a provision in the armistice of Cherasco that gave him the right to cross the Po at Valenza, thirty miles to the west of Pavia.
While Beaulieu watched the river crossings around Valenza, Napoleon moved his army east along the southern bank of the Po and crossed over at Piacenza (7 May), thirty miles to the east of Pavia. When Beaulieu realised what was happening he rushed east, but in three days of fighting around Fombio (7-9 May) the Austrians were unable to prevent the French from blocking their best line of retreat to Cremona. Beaulieu's rapid movement and the relatively slow crossing of the Po did give the Austrians time to turn to the north west and escape across the River Adda at Lodi, leaving a rearguard behind to defend the long thin bridge across the river.
On 10 May Napoleon threw his infantry across that bridge (battle of Lodi), in order to prevent the Austrians using the line of the Adda to block his advance east towards Mantua. After a struggle that lasted an hour the French were victorious. Beaulieu retreated east to Cremona, watched by the French. Napoleon then turned back to the west. On 14 May the first French troops reached Milan, and on the following day Napoleon entered in triumph.
This triumph was short lived. With Piedmont out of the war General Kellermann's Army of the Alps was free to enter Italy, and the Directory decided to give him command of the war against Austria. Napoleon was to turn south to deal with the Papal States. Napoleon sent two letters back to Paris, in which he argued strongly against a divided command. Although neither letter actually contained a threat to resign, it was clear that that was what Napoleon had in mind, and the Directory relented.
After the defeat at Lodi, the Austrians retreated east to the Mincio, taking up a defensive position behind that river, running from Mantua to Lake Garda. On 30 May Napoleon broke through this line (battle of Borgetto). Beaulieu was forced to retreat up the Adige valley, leaving Napoleon free to begin his siege of Mantua. The first blockade of the city began on 4 June.
June also saw Napoleon's first campaign in the Papal States. The invasion was officially launched in revenge for the murder of Ugo Bassville, a French diplomat, in February 1793, but was motivated just as much by revolutionary hatred for the Papacy and the lure of plunder. This first campaign was over very quickly. On 19 June Napoleon reached Bologna, where he expelled the Papal authorities. Pope Pius VI then sued for peace. In the Peace of Bologna (23 June 1796) the Pope agreed to pay a large indemnity and to allow the French to occupy Bologna and Ferrara. This treaty was never ratified in Paris, and Napoleon would return to the Papal States in the following year. After dealing with the Pope the French turned west into Tuscany, passing through Florence and occupying the port of Livorno (Leghorn), before returning back to the Po plain.
By late July a fresh Austrian army, under the command of Field Marshal Dagobert Graf Würmser, was ready to attempt to lift the siege of Mantua. Würmser decided to advance in three columns. He took command of the central column, which advanced down the Adige valley. To the east General Szoboszio advanced towards Verona, while to the west General Quosdanovich advanced down the Chiese valley towards Brescia. At first all went well. Quosdanovich captured Brescia, threatening Napoleon's lines of communication with Milan. Würmser found the road to Mantua open, and entered the city on 2 August. It was this apparent success that doomed Würmser's campaign to failure.
While Würmser was marching on Mantua, Napoleon concentrated his army south of Lake Garda. On 31 July his advancing troops forced Quosdanovich out of Lonato (first battle of Lonato), and over the next two days Quosdanovich lost Brescia and was forced to move north east towards the lake. Realising that he needed to join up with Würmser, on 3 July Quosdanovich attacked the French position at Lonato (second battle of Lonato). The Austrians failed to break through, leaving Napoleon free to turn on Würmser's column.
Würmser realised his mistake and turned north from Mantua in an attempt to find Quosdanovich. On 4 July he found himself facing a large part of Napoleon's army at Castiglione, and took up a strong defensive position just to the east of the town. If Würmser had been able to hold this position, then his campaign would still have ended in success, for at this point the siege had been lifted, but Napoleon was able to bring superior numbers to the battlefield. At the start of the battle of Castiglione (5 August 1796) the French were outnumbered, and their attacks on the Austrian centre were essentially feints, designed to keep Würmser pinned in place while reinforcements arrived.
Eventually fresh troops arrived from Mantua (Sérurier's division under the temporary command of General Pascal-Antione Fiorella) and from Brescia (Despinois's division), and the Austrians were forced to retreat back to the Mincio. The battle of Castiglione was an early example of Napoleon's 'strategic battle', where widely separated columns converged at a key point on the battlefield to give the French numerical superiority where it counted, even against much larger armies. Although the battle did not go entirely as Napoleon had planned, Würmser was soon forced to retreat back to the Tirol, and the French were able to re-establish the siege.
At the start of September Napoleon and Würmser both went onto the offensive. Napoleon had been ordered to cross the Alps and join up with the Army of the Rhine, then campaigning on the Danube. Napoleon's route would take him up the Adige valley towards Trento, and then across the Brenner Pass to Innsbruck.
At the same time Würmser had been ordered to make a second attempt to lift the siege of Mantua. This time he decided to advance down the Brenta valley and emerge onto the northern Italian plain to the north east of Vicenza (the upper Brenta valley comes within a few miles of the Adige just to the east of Trento, and the two valleys are connected by a short low level pass).
Once on the Italian plains Würmser would join with another Austrian army under General Mészáros, and the combined army would advance towards Mantua from the east. Field Marshal Davidovich would defend the area around Trento. Both expeditions began at about the same time, so while Würmser was moving east along the Brenta, Napoleon was moving north up the Adige valley. On 3 September the French forced their way past Davidovich's defences around Rovereto, and on 4 September broke through a second line at Calliano. Davidovich was forced to abandon Trento.
Only now did Napoleon learn of Würmser's movements. Napoleon's response demonstrated another of the keys to his military success – rapidity of movement. While a small force under General Vaubois was sent north to follow Davidovich, Napoleon's main army turned east to catch Würmser. Some sources suggest that Napoleon learnt of Würmser's movements before the battle of Rovereto, but a look at the map would suggest that this is incorrect. From any position south of Rovereto Napoleon had much better routes east to intercept Würmser, including retracing his steps down the Adige valley. Only the slow pace of Würmser's movement allowed Napoleon to catch and defeat him at Bassano.
Würmser was caught completely off guard, and dangerously out of position. His army was spread out, with one division still in the mountains at Primolano, a second at Bassano, at the edge of the plains, and a third at Vicenza. Napoleon's advance guard defeated Quosdanovich's division at Primolano (7 September 1796). On the following day, after another rapid march, Napoleon defeated Würmser at Bassano (8 September 1796) and split his army in two. Quosdanovich was forced to retreat east towards Treviso, while Würmser escaped towards Vicenza. Over the next few days Napoleon attempted to complete the destruction of Würmser's army, but eventually he and around 12,000 men arrived outside Mantua. A two day long battle followed (San Giorgio), but on 15 September Würmser was forced to seek refuge inside the city.
The trapped Würmser was replaced as Austrian commander-in-chief in northern Italy by Field Marshal Joseph Alvinczy. He was given command of two armies – 27,000-30,000 men under General Quosdanovich at Friuli, at the north eastern corner of the north Italian plain and 17,000-20,000 men under Davidovich in the Tyrol. Alvinczy accompanied Quosdanovich's army.
Sickness and the accumulated losses of a long campaign meant that Napoleon now had around 28,000 men available for his field army. General Vaubois had 10,000 men at Lavis, just to the north of Trento in the upper Adige valley, facing Davidovich. Masséna had 9,500-10,000 men at Bassano, on the Brenta River, facing Quosdanovich. Augereau had 8,000 men at Verona, from where he could move to support either wing. Finally 8,000 men under General Kilmaine were blockading Mantua.
Alvinczy is normally criticised for splitting his forces and thus allowing Napoleon to defeat him in detail, but the Austrian plan came very close to success. Alvinczy realised that both of his field armies outnumbered their French opponents. With three divisions at his disposal Napoleon could only bring two of them to bear against a single Austrian army, and would still be outnumbered. It was unlikely that Napoleon would risk a second advance up the Adige valley to fall on Davidovich, so he would probably have to move east to attack Quosdanovich's larger army.
Alvinczy began his campaign on 1 November, when he crossed the Paive River. On 4 November Masséna pulled back from Bassano to Vicenza, and then to Montebello, where he met up with Augereau, giving him around 18,000 men to face at least 27,000 Austrians. Despite this Napoleon ordered Masséna to attack the Austrians on the Brenta River. On 6 November Masséna and Augereau launched attacks on the Austrians at Citadella and Bassano, but were repulsed by Generals Liptay and Provera. Masséna and Augereau then pulled back to San Martino, three miles east of Verona. Alvinczy reached Vicenza on 8 November and Montebello on 9 November.
Davidovich's advance down the Adige valley also met with success. On 2 November he repulsed a French attack at Lapis. After fighting on 6-7 November Vaubois was forced back from Caliano, and retreated to Rivoli. The two Austrian armies were now dangerously close to joining up. By 11 November Alvinczy had reached Caldiera, on the road between Vicenza and Verona, while his rearguard was at Villanova. Davidovich was only fifteen miles away, and if he had continued to press down the Adige valley would almost certainly have been able to join up with his commander. The Austrian plan failed because it took Davidovich ten days to advance from Rivoli onto the plains west of Verona, a delay that gave Napoleon a chance to concentrate on Alvinczy.
Even with this advantage Napoleon came close to failure. On 12 November Masséna and Augereau attacked the Austrians at Caldiera, and suffered a heavy defeat. Even Napoleon was discouraged by this, sending a very downbeat letter to the Directory in Paris, but he decided to risk one more attack. The Austrian position did have one weak spot. Alvinczy was advancing west towards the fortified and defended city of Verona, with the mountains to his right and the un-fordable Adige to his left. His only line of retreat was across a narrow band of dry ground at Villanova, at the northern tip of a triangle of swampy ground between the junction of the Adige and Alpone rivers.
Napoleon decided to attack across the Adige at Ronco, just above the junction with the Alpone. The battle that followed took its name from the village of Arcole, on the eastern bank of the Alpone, where some of the key fighting took place (battle of Arcola, 15-17 November 1796). Napoleon's first attack on 15 November failed, but it did alert Alvinczy to his danger, and gave him time to withdraw most of his troops from the trap. On the third day of the battle the French were finally successful, and the Austrians were forced to retreat east.
This victory came in the nick of time. On 17 November Davidovich finally forced the French back to Peschiera. If this advance had come any earlier Napoleon might have been trapped between two armies, but it did at least save Alvinczy from any serious pursuit. Napoleon was forced to turn west to help Vaubois. For a moment there was a chance that Davidovich would be trapped, but after fighting around Castelnuovo (21 November) he managed to escape north. Alvinczy took advantage of this to move west back to Caldiera, before retreating east against after the defeat of Davidovich.
Two months passed before Alvinczy launched the fourth and final relief effort. This time he led the main Austrian army, 28,000 strong, down the Adige valley, while General Provera with 18,000 men advanced towards Verona and Legnago from the east. This time the two Austrian armies were meant to operate independently, and both should have been strong enough to defeat the French troops on their respective fronts. Napoleon had less than 30,000 men available for his field armies, split into three divisions. Augereau was based around Vicenza, where he would face Provera. Joubert with 10,000 men was at La Corona, just to the north of Rivoli, where he would face Alvinczy. Finally Masséna was in a central position at Verona.
The Austrian advance was underway by 10 January. Two days later one of Provera's columns was repulsed from Verona, but on 14 January his main column crossed the Adige, broke through Augereau's centre and made for Mantua. This success came to nothing, for on 13 January Napoleon realised that Alvinczy's was the main effort, and ordered all of his available troops to concentrate at Rivoli. Napoleon himself arrived just after midnight, Masséna arrived at about dawn and Rey arrived at around noon. Napoleon was thus able to feed reinforcements into the fighting whenever a crisis loomed.
He was also helped by the Austrian plan of attack, designed on the previous day to ensure the complete destruction of Joubert's isolated division. Alvinczy's six divisions attacked in three main columns – two divisions attacked along the Adige, three attacked the centre of the French line and the final division was sent on a wide outflanking movement. Napoleon was able to defeat each part of the Austrian army in turn, and Alvinczy was eventually forced to abandon the attack. By the end of the battle of Rivoli the Austrians had lost around 10,000 men, and another 5,000 were captured by Joubert over the next couple of days.
While Joubert moved north after Alvinczy Napoleon and Masséna rushed south to prevent Provera from reaching Mantua. On 16 January Provera was caught at between Masséna and the troops besieging Mantua, and was forced to surrender (battle of La Favorita). The defeat of the forth relief effort effectively doomed Mantua. Two weeks later, on 2 February, Würmser surrendered to Sérurier.
As Mantua was capitulating Napoleon was heading south on a second invasion of the Papal States. This time he advanced down the east coast as far as Ancona before the Pope sued for peace. On 19 February Napoleon and the Papal representatives agreed to the Treaty of Tolentino. The Pope ceded Bologna, Ferrara and Ancona to the French and recognised the seizure of Avignon and the surrounding area in 1791.
Napoleon's next task was the invasion of Austria. He now faced the same problem that had crippled every Austrian attempt to save Mantua – there were two routes across the Alps and Napoleon couldn't afford to leave either of them unguarded while he used the other. The first route led up the Adige valley into the Tyrol, across the Brenner Pass to Innsbruck then east along the northern side of the Alps to Vienna. The second crossed the Julian and Carnatic Alps, at the north eastern corner of Italy, and ran from Udine to Villach, then east to Klagenfurt before turning north east to run around the eastern end of the Alps up to Vienna. It was also possible to advance to the southern end of the Brenner Pass and then turn east to pass through the mountains to Klagenfurt.
The court at Vienna realised that it faced a serious crisis and appointed the Archduke Charles to command the army facing Napoleon. Charles had recently inflicted a serious defeat on the French armies operating across the Rhine, and was perhaps the most able of all Austrian generals of the period. He immediately realised that the best way to oppose Napoleon was to concentrate his army in the Tyrol. If Napoleon attempted to use the eastern route across the Alps then Charles could move south and cut him off. The French would have to turn north to fight the Austrians in the Tyrol. Charles's original position around Innsbruck also made it much easier for Austrian reinforcements to reach him.
Unfortunately for Charles the Austrian government didn't agree with his plan, and he was ordered to make his stand on the Piave River to cover the port of Trieste. He arrived on the Piave on 11 February 1797 and prepared to fight a defensive campaign. At this date he had 22,000 soldiers on the Piave, and 10,000 soldiers and as many militia in the Tyrol, and he had been promised close to 50,000 reinforcements, but very few would reach him in time to play any part in the battles to come.
Napoleon now had the largest army available to him at any point in the campaign. He had requested 30,000 reinforcements, and had received 20,000 of them, under Delmas and Bernadotte, and the fall of Mantua freed up thousands more. When the campaign began he was able to leave 18,000 men in the Tyrol (Joubert, Delmas and Baraguay d'Hilliers) and lead 34,000 men in four divisions himself (Sérurier, Masséna, Guyeux and Bernadotte). Napoleon's plan was for Joubert to push the Austrians in the Tyrol back across the Brenner Pass to Innsbruck, while he advanced across the Carnatic and Julian Alps. If Joubert was successful he could turn east and advance along the Drave Valley to join Napoleon at Villach or Klagenfurt.
At the start of March the Austrians had 3,000 men under General Lusignan just inside the mountains at Feltre on the Piave, guarding their lines of communication to the Tyrol and 22,000 men under the Archduke Charles along the Piave between the mountains and the sea. Napoleon sent Masséna to deal with Lusignan, while he led his main force to the Piave.
Masséna began his advance on 10 March. Lusignan retreated up the river from Belluno, but on 13 March was forced to stand and fight between Polpet, where the valley of the Piave turns north and enters the high mountains, and Longarone, five miles to the north. Masséna was then free to turn south, crossing the Tagliamento River near Spilimbergo (five miles south of the start of the mountains) on 16 March. Masséna then moved north along the Tagliamento to Gemona. He then advanced north east along the mountain passes to Pontebba, from where he threatened Charles's right and the crucial Tarvis pass.
On 13 March Napoleon's main force crossed the Piave and advanced towards the Tagliamento at Valvasone. On 16 March Bernadotte and Guyeux's divisions forced their way across the river (battle of the Tagliamento) in one of the few recognised set-piece battles of the campaign. The Austrians lost 500 men and were forced to retreat east.
After the defeat on the Tagliamento Charles split his army. Bajalich, with his division, 25 guns and a large supply convoy, was sent east to Cividale, at the edge of the mountains. From there he was to cross the mountains to Caporetto in the upper Isonzo valley and then follow an alternative route to Tarvis. Charles hoped that this division would arrive in time to keep the pass open, for if the French captured Tarvis then Charles's reinforcements would have had to follow a very long route around the eastern side of the mountains to reach him on the Isonzo. The rest of the army pulled back to Gradisca on the lower Isonzo. Charles hoped to defend that river, which was the last natural barrier before Trieste.
The French soon forced their way across the Isonzo, taking 3,000 prisoners in Gradisca. Napoleon attempted to push the Austrians into the mountainous upper reaches of the Isonzo valley, but Charles escaped this trap and withdrew east towards Adelsberg (now Postojna) then north east towards Laybach (Ljubljana), with Bernadotte in pursuit.
Napoleon now turned north. Guyeux was sent to chase Bayalitsch through Cividale and Caporetto while Napoleon and Sérurer advanced up the Isonzo towards Caporetto. At the same time Masséna was advancing towards the Tarvis pass. On 20 March he captured Chiusa, at the southern end of the Pontebba pass, and on 21 March he reached Pontebba.
Charles now realised that Bajalich's column was in serious danger, with Masséna ahead of him and Napoleon close behind. Tarvis was defended by a weak force under General Ocskay, made up of the survivors of Lusignan's division. Charles made a dash through the mountains, using a minor pass at Krainberg (near Arnoldstein, east of Tarvis) and reached Villach. There he gathered together around 6,000 men and advanced towards Tarvis.
The exact sequence of events around Tarvis is somewhat obscure, with different sources giving different details. The basic outline seems clear – Masséna captured the pass. Charles counterattacked and drove the French east back towards Pontebba. Masséna then gathered his entire division together and retook the pass. Bajalich then arrived on the scene, although his exact route is not given, and found himself trapped between Masséna and Napoleon. Bajalich and around 4,000 of his men were captured. The name generally given to this battle is Malborghetto (23 March 1797), but that village is some way west of the top of the pass, where the fighting against Charles is said to have taken place, and so may refer to the capture of Bajalich. At the end of this battle Charles withdrew to Klagenfurt.
Napoleon was now across the Alps, and in the valley of the Drave. He was still faced by a large Austrian army, and Charles was now beginning to receive reinforcements. Napoleon had taken this into account, and soon after crossing the Tagliamento had ordered Joubert to join him on the Drave.
Joubert's own campaign had been just as successful as Napoleons. He was facing two Austrian generals – Kerpen and Laudon – who repeatedly received reinforcements from the north, but he defeated them at St. Michael on 20 March and Neumark on 22 March. After this second defeat the Austrian forces split. Joubert chased Kerpen to Brixen, at the foot of the Brenner Pass, and defeated him twice more, at Klausen (Chiusa) and Mittenwald. Kerpen retreated across the Brenner to Innsbruck, leaving Joubert free to turn east to advance down the Drave.
On 31 March Napoleon advanced to Klagenfurt. His plan was to approach Vienna across the Semmering pass, taking the road that led to Leoben. On 31 March, while at Klagenfurt, he wrote a letter to the Archduke making tentative peace feelers. Napoleon was aware that he was in a vulnerable position. A revolt had broken out in Venice, which threatened his rear, and if the campaign went on too long then the Austrians could concentrate new armies against him. Napoleon needed a quick diplomatic victory.
For the moment all Charles could do was forward the letter to Vienna and attempt to stop Napoleon's advance. On 1 April the French pushed back the Austrian advance guard at St. Veit, their main force at Friesach, and forced them out of the gorges of Neumark. Another victory followed at Unzmarkt (3 April), and on 7 April the French entered Leoben.
Napoleon's advance had triggered a panic in Vienna. While the court prepared to evacuate the city, Generals Bellegrade and Meerfeld were sent to Leoben to ask for a ten day armistice. Napoleon agreed to five days, and pushed his advance guards forward to Semmering. Negotiations began on 13 April, and 18 April resulted in the Preliminaries of Leoben. The Emperor Francis II agreed to surrender Belgium to France and to acknowledge France's new frontier on the Rhine. Lombardy was also surrendered, and the new republics in northern Italy acknowledged (Cisalpine around Milan and Cispadine around Modena). In return Austria was to be given Venice's land provinces in northern Italy although at this stage Venice herself was to remain independent. Although the negotiations dragged on for most of the year, Leoben marked the effective end of the War of the First Coalition. Napoleon spent most of 1797 as the virtual ruler of northern Italy, negotiating on equal terms with the Austrian emperor. The peace was finally formalised as Treaty of Campo Fornio (17th October 1797). |
0.998437 | In this interview, Tariq King, the senior director and engineering fellow for quality and performance at Ultimate Software, and Jason Arbon, the CEO of test.ai, explain the role artificial intelligence plays in modern testing and why you should establish a foundation right now.
Jennifer Bonine: All right. We are back with more interviewers. I'm excited. I have Tariq and Jason, nice to have you both.
Tariq King: Nice to be here.
Jason Arbon: It's very nice to be here. Thank you for inviting me here.
Jennifer Bonine: Yes. Or, dragging, either way. Inviting or dragging willingly or unwillingly. So we get both you guys all at once.
Jennifer Bonine: And, I heard that both of you like to talk about AI.
Jennifer Bonine: Yeah, and you have a new organization that was started.
Jennifer Bonine: AItesting.org, and they can sign up?
Jennifer Bonine: And, what is the intent behind it? Maybe tell us a little bit about what you guys want to do with that.
Jason Arbon: AI is just to bring people together. Everyone's curious about AI for testing. Some are concerned about it, some really want to dive into it. The idea is to have one place where we can get together and talk about AI.
Jason Arbon: The origin was actually STAREAST. Tariq and I were talking about how there's ... We don't get together very often, there's very few of us working on the problem today. And so, we wanted to ... We're basically lonely people, we try to meet on the internet, and there's a mailing list. We find things, we have papers, we run into sort of interesting ... Or we survey the community, too, to see what they think about AI.
Jason Arbon: You sign up on the mailing list and start to get in the groove of what's going on with AI.
Jennifer Bonine: AItesting.org. Got it. All right, so those of you out there that want to learn more about that, you can go to aitesting.org. A great way to bring people together, as you've said, right?
Jennifer Bonine: Because, there's, I think, a combination of people who are probably super excited about it, a smaller group. A group that just doesn't know much, and really wants to get educated. And then a group that's probably a little bit fearful of what that means. I've even heard some testers saying, "I just hope I retire before it happens."
Jennifer Bonine: I think I've heard that, right?
Jennifer Bonine: And a lot of that comes from lack, I think, of awareness and education. So, having places where people can get information, education, awareness, is always good.
Jennifer Bonine: ... that you did on it. So, for those that didn't get a chance to see that keynote—which by the way, if you didn't get a chance to see it, these are recorded, so go back and watch that. I've even heard some folks here that watched it live but are gonna go back and watch it again.
Jennifer Bonine: Because it had a lot of really good content for folks. So, maybe we talk a little bit about what the intent behind that keynote was, what you were trying to accomplish with that.
Jennifer Bonine: Discussion with this group would be great.
Tariq King: So, when you think about it, artificial intelligence is really a hot topic these days. Whether you're in the business of building software or consuming software, it's all over. For me, I think that one of the biggest things in terms of the testing community is we've seen folks who are using AI for testing. I've seen folks who are kind of averse to it, like I said, there's these different pockets of people.
Tariq King: And I really wanted to just get everyone familiar with what AI means and what AI brings, and start to get people comfortable with thinking about, what does the future look like? Does being, quite frankly, a lack of innovation when it comes to pushing that boundary and testing, and testing seems to lie behind other aspects of software engineering. And I just wanted to try to open up people’s minds to say, hey, look. Let's not think that these things are impossible and that they're far away. They're actually here and they're coming.
Tariq King: And as a community, we have to get in front of it.
Tariq King: And so, my message was really around, let's stop, think about what we can do to leverage this technology to make what we do better. But let's also notice that in terms of, for AI to successful, as with any paradigm, testing has to be a key part of that.
Tariq King: And so, the message was really to try to bring those two worlds together: Have people try to get comfortable with thinking about, "Hey, if our future looks different, it's okay." Right?
Tariq King: But then also, what ideas can we bring as testers? What things can we bring to this forum to kind of make our impact and make sure that at the end of the day, AI doesn't take over?
Tariq King: We need testers to kind of help be that ground and that foundation.
Jennifer Bonine: And that's great. And what's kinda nice about it, I think, for people that didn't see it, was you told the story backwards, right?
Jennifer Bonine: So, you gave the end of the story before the beginning, right? So, you showed them what it is and then walked them through it.
Tariq King: Yeah, I think that when I look at it, because of the potential for AI to be so general and represent all types of problems, for me, AI is already here and it's already taking over, right?
Tariq King: And so, it's really about recognizing, okay, people, this is actually coming and it's already here. And it's only gonna get better.
Tariq King: So, bringing them back to the beginning is like, now is the time to get ready.
Tariq King: So, the way that we actually were able to be successful was that we actually got ready in the beginning, because we saw it coming and knew how are we gonna respond. And so, it's really a call to people to say, "Right now's the time for you to get ready and realize that this is gonna come, and we have two sides of the coin, and what are you gonna do to get prepare for those two things?"
Jennifer Bonine: Yeah. Well, it was interesting, I was just talking to one of the other folks, right before you guys, about the fact that technology and change comes faster than ever before, things are moving and changing.
Jason Arbon: The more they adapt, the more angst they have.
Jennifer Bonine: Yeah. And it just creates a bigger angst. And so, as stewards of information, it's good that you're creating opportunities for education and awareness. Because I think a lot of times what people don't realize is, change creates some level of fear, and a lot of times it's fear because they don't know, right?
Jennifer Bonine: ... of just creating information and having, since it is a small community, people that have some good information, have been involved in it, know it's here, what it's doing, to educate others. And I see that with both of you. A lot of times at this conference, instead of just giving presentations and standing up in front of rooms, you guys are talking to people all the time, and they line up to get that information from you guys.
Jason Arbon: We even talk to each other sometimes.
Jennifer Bonine: Which is awesome. I'm glad that you guys talk to each other.
Jason Arbon: Yeah, it's awesome.
Tariq King: No, I think, when you think about conferences, this is really a place for us to build relationships.
Tariq King: That's how I got to know Jason and what he was doing.
Jason Arbon: We talked about this, collaboration is not relationships.
Tariq King: Well, collaborations, relationships, whatever. Potato, patato.
Jennifer Bonine: (laughing) You can tell they super agree on everything.
Tariq King: But, when you really think about that, we come here, we get inspired from other people. People are a valuable resource that we have. And the ideas that come out of conferences like this, everyone is all excited and ready to take things away, but I think maintaining those relationships and our collaborations is very important.
Jason Arbon: And AIST wouldn't have happened if it wasn't for STAREAST.
Jason Arbon: It just wouldn't have happened.
Jennifer Bonine: Right. It was an idea born out of one of these events, right?
Jason Arbon: Yep. Now there's hundreds of people, many hundreds of people, and we're sharing and taking surveys. I wrote, like, a twenty-page paper, which I never really do—I'm trying to copy you, you didn't like it that much, either.
Jason Arbon: A twenty-page paper, and I got feedback from like sixty different people.
Jason Arbon: So, the community's growing, and they're pointing out flaws in my logic and in my grammar.
Jennifer Bonine: Oh, I have that happen all the time, too.
Jason Arbon: But, that's awesome. Yeah, thanks.
Jason Arbon: There's clearly available tools. If you put this into Word, it fixes it for you.
Jennifer Bonine: Yeah. Not always. It's not perfect, yet.
Jason Arbon: Well, that's what we said.
Jason Arbon: But, AI's not smart enough.
Tariq King: Yes, it will get there.
Jennifer Bonine: It will get there.
Jason Arbon: But, that happened because of STAREAST. And then, I think what really happened more at this conference was, this is the turning point. So, when I was at STAREAST, I was like, "Are you able to talk about AI?"
Jason Arbon: And there's one, and I was pretty lonely.
Jason Arbon: ... and you guys both kinda synthesized, it brought the world together.
Jason Arbon: And then, I got a little manic a couple hours ago talking about contest animation in AI.
Jason Arbon: But we, on paper, tripled.
Jason Arbon: Change is coming faster than it used to.
Jason Arbon: So, we need to get ahead of the curve.
Jason Arbon: And breakfast this morning, which was awesome, thank you.
Jennifer Bonine: And breakfast this morning. But, what we found is that some people are visionaries, right? Like, they see something before it comes and you see it coming, and having talked to you, I've seen this coming as well for a while. But it's interesting to watch the curve of other folks starting to get involved, get on board and see that this is, it's here. It's here.
Jason Arbon: You've seen it actually kind of evolve, right?
Jason Arbon: Actually, you said awhile, it made me a little bit painful for a second because I'm like, I wish I could just code faster.
Jennifer Bonine: Yeah. But, it's two things, I think, right? It's not even just having the technology and the code, but it's the adoption, right?
Jennifer Bonine: Can people ... We have a lot of technology that's ready today, but people aren't ready for it.
Jennifer Bonine: Right? So, it's not even that it's not we couldn't have it, there's lots of stuff out there we could have.
Jennifer Bonine: But, people aren't ready for it, right? To absorb it, to accept it, to embrace it, right?
Jennifer Bonine: We have to get them to that stage of being okay with it.
Jason Arbon: Right. That's perfectly put. You're not supposed to upstage the people you're interviewing. But that's better said than either of us had said it this week.
Jennifer Bonine: I should be your PR person, right?
Jennifer Bonine: And Jason, before we leave, I wanna talk about something that's near and dear to my heart that I've talked to you about for a while, which is Appdiff, which now, there's a new name. So, people who are looking for that should look for ...?
Jason Arbon: So, things aren't going well, you change your brand. (laughs) No, really the reason we're doing it, just to be super clear: We built some really cool robots that will automatically test your app, right?
Jason Arbon: And people are paying for it, people like it. But what they also said is, "I want these—these are cool and smart robots, can't they do all my regression tests?"
Jason Arbon: And they go, like, "Aw, man," right? And so, I spent, we got more money from venture capitalists. Thank you out there, wherever you are. And built the engineering team even more. And now we have robots where you can very simply tell them what you want them to do, and they'll figure out how to execute that on any app for you.
Jason Arbon: Which is pretty cool. So, really what we're doing around the brand change is that we're just focusing on what people say. "What is Appdiff?" I have to tell them, it's an app and it finds differences in your application. So, what does test.ai do? We test with AI.
Jason Arbon: So, it's just super simple.
Jennifer Bonine: So, clarifying it for them?
Jennifer Bonine: Now, they're silly though, because I knew what it was right away. I knew exactly what Appdiff did, right?
Jason Arbon: I know you did, you did, yeah.
Jennifer Bonine: I get it, but.
Jason Arbon: But, you're also not normal.
Jennifer Bonine: Okay. But, test.ai makes sense.
Jason Arbon: Is up as of 10 a.m. today. Test.ai.
Jennifer Bonine: ... is up as of 10 a.m. So, go check it out.
Jason Arbon: And if you go up there we're gonna—I sound like a ShamWow commercial—we're trying to get it. We have too many test members on my team. So, I don't know if we'll hit the date because they always find bugs. But, we hope to have it downloaded by Halloween.
Jason Arbon: At test.ai you can sign up for the beta right now.
Jason Arbon: And the cool thing is, it's going to be AI that you can actually download to your local machine, run it against your app, and you've got automation for your app.
Jason Arbon: It's gonna be in a beta version but downloadable. And, you can have it on your MacBook while you're on an airplane and it will still run.
Jennifer Bonine: So, check that out, you guys. I mean, newly released as of 10 a.m.
Jason Arbon: Yep. And the exciting thing is that I also just demoed for the first time on the planet at a conference, that AI running and executing a test case. I think that was actually the first time it's actually been demoed in a public forum.
Jason Arbon: Half my team at home base hadn't even seen the demo because I had to fill in for another session.
Jennifer Bonine: Now, do you have the video of the demo?
Jason Arbon: I do have the video.
Jennifer Bonine: Can they see the video of the demo? Do you wanna be a part of that?
Jennifer Bonine: Okay, you'll post that somewhere, right?
Jason Arbon: Actually, you'll have to talk to my marketing team.
Jennifer Bonine: Product marketing team? We need to talk to them for you so you don't forget.
Jason Arbon: Yeah. Actually I would love to, so.
Jason Arbon: Yeah. And if you, if they won't let me put it on the web right away, email me at [email protected]—well, my official one, [email protected], or [email protected], and I'll send you a link to the video if you want.
Jennifer Bonine: So, that's how we find you, Jason. How do we find you, Tariq?
Jennifer Bonine: You're the OG, though.
Tariq King: ... it's relatively easy. Yeah, exactly. [email protected].
Tariq King: It should be there, so. It's great. Cool.
Jennifer Bonine: Perfect. So, how to find Tariq. And congratulations, I hear there's gonna be a new King in the family.
Tariq King: Yes. We are expecting November 22.
Tariq King: So, after this I go to make sure that I'm not in trouble by missing the test, so.
Tariq King: It's gonna be awesome.
Jennifer Bonine: Awesome. Well, congratulations and good luck.
Jason Arbon: I've got one more quick thing Tariq did not represent that should be represented.
Jason Arbon: If you look at his keynote, I highly recommend you listen to it.
Jennifer Bonine: Yeah. We'll watch it again. We'll watch it.
Jason Arbon: But, what we're doing at test.ai is trying to—and I'll say it and scare everybody—we replace Selenium and Appium with AI, right?
Jason Arbon: So you don't have to code anymore and AI just does it, 90 percent of the work for you. The really smart thing that's gonna happen five to ten years from now is what Tariq was saying, and that is that systems will eventually test themselves from the inside out, right? Rather than from the outside in.
Jason Arbon: And, the testing I do is from the outside in, it's very nontraditional, with swapping the brain out with machine learning. But his idea and vision is software that actually tests itself.
Jason Arbon: And that's the stuff that stands between us and the singularity and the robots taking over. So, I'm really excited to see where he takes that research.
Tariq King: Yeah. There's really a lot of research that started from when I did my Ph.D. That's kind of the area that we looked at.
Tariq King: But, that's 2009, the time and the technology has really gone further.
Tariq King: And so, for us, like right now we're trying to see with all the advances in technology, microservices, artificial intelligence, can we really design systems in the way that they can test themselves?
Tariq King: Right? Because, when you think about software development, yes, we do a lot of testing from the outside. But we also do a lot of testing from the inside, and if we actually think about designing these systems with these features, then they can be a lot more thorough and actually get to a point where systems may not only be able to detect when they have issues but, they may be able to fix themselves.
Jennifer Bonine: ... for our poor grammar. And we'll look like grammarians. We'll look amazing.
Jason Arbon: Grammarians. That means you have a good grammar.
Jennifer Bonine: I know, did you like that word? I liked that word.
Jason Arbon: That was pretty power ... That was a power word you dropped in.
Jennifer Bonine: I know. All right. I suppose we're done.
Jennifer Bonine: Thanks for watching, and check out our next interview.
Jason Arbon is the CEO of test.ai, which is redefining how enterprises develop, test, and ship mobile apps with zero code and zero setup required. He was formerly the director of engineering and product at Applause.com/uTest.com, where he led product strategy to deliver crowdsourced testing via more than 250,000 community members and created the app store data analytics service. Jason previously held engineering leadership roles at Google and Microsoft and coauthored How Google Tests Software and App Quality: Secrets for Agile App Teams.
Thats great article. Thanks for this informative post. |
0.999923 | Do you have a plan in place for your family in the event of an emergency? It’s not always possible to know when a disaster will happen but it’s important to be prepared for severe weather and other events. Your backup generator can provide power and keep the lights on in your home during an outage, but there are other important safety measures to consider.
Make sure every family member knows the safe spots in your home and where to go during a severe storm, such as the basement or lower level room without windows during a tornado.
Once you have your emergency kit in place, you’ll also want to make sure your generator is working properly before severe weather hits. Contact us today for assistance with testing your generator! |
0.97585 | Hello! It just keeps raining, doesn't it? I refuse to complain about the rain, but it is beginning to cause a few problems for us, especially down in the bottom lands, the fertile lowlands which border the Cumberland and is what gives "Soggy Bottom Farm" its name. In some areas, we have plants sitting in a few inches of standing water, and there are literally crawdad holes in the fields. A lot of squash and cucumbers are getting a white mold on the fruits before they are big enough to harvest. Its just too wet for some crops to do well right now, but they're hanging in there. Another problem caused by the rain is that we can't get in to weed around the crops because doing so would disturb/uproot the plants that we want to keep. In addition, plowing or cultivating while the soil is wet is just bad for the soil structure, and will result in large clods next year and beyond. Having said all of that, it could certainly be worse. The tomatoes aren't getting any serious blights yet and are mostly resisting cracking like you'd expect with lots of rain, and they're really producing now. I think we harvested about 150 lbs today. We're trying to be careful to pick the 'maters when they just begin to change color from green to pink/red/yellow. If we waited until the tomatoes were vine ripe before picking, there would be a lot more cracking, insect damage, etc.
To celebrate our tomato harvest, let's learn about the tomato...I don't think we've covered this one yet. Like the pepper, the tomato is in the "nightshade" (Solanaceae) family of plants, which originally hails from the Americas, and specifically Mexico. Eggplant and Potato are also in the nightshade family, and each of these are mildly toxic. In fact, many people around the world thought that tomato fruit was poisonous, and it was largely grown as an ornamental plant until the past few centuries.
"San Marzano": This paste or cooking tomato (also delicious fresh) has been around the world and back. It became the chief variety for canning in the 1920's, before the Roma tomato was bred from the San Marzano stock and two other types. "One story goes that the first seed of the San Marzano tomato came to Campania [in Italy] in 1770, as a gift from the Viceroyalty of Peru to the Kingdom of Naples, and that it was planted in the area that corresponds to the present commune of San Marzano sul Sarno. They come from a small town of the same name near Naples, Italy, and were first grown in volcanic soil in the shadow of Mount Vesuvius." Seeds come from High Mowing.
"Nebraska Wedding": Good heirlooms come with good stories: "Mrs. Beiswenger of Crookston, MN is credited for introducing this tomato to the Seed Savers Network. She received the tomato seeds from Mrs. Englert of Sandpoint, ID in 1980. Mrs. Englert was 72 at the time and said "Nebraskan brides were given seeds of this tomato as a wedding gift. It was said to have been brought from MN by pioneers in the late 1800s via covered wagons. And it thrived in cold, windy Nebraska." Apparently, they even hung these tomatoes in the church during the wedding! As far as taste, it is slightly more acidic than some, but still sweet. Seed from Deerfield Supplies.
"Italian Heirloom": these 1 lb+ tomatoes have a great balance of acidity and sweetness, and are really beautiful! Seeds from Seed Savers Exchange.
"Pink Beauty", our hybrid staple. Nice tomato flavor, very productive, and pink in color. Seed from Johnny's.
More tomatoes to come after a little while!
Speaking of Tomatoes, Will and Peter went to the Tomato Art Festival in East Nashville on Saturday. We set up at 7:30 am, after dropping off the big tomato dodecahedron, which you've seen a photo of in an earlier newsletter. Around 10 am, the festival really took off. We made a lot of connections and had a lot of support there. We sold a few things as well. Attendance was definitely in the thousands. We shared a table with Bells Bend Conservation Corridor, who, like us, want to "keep it country" out here in the bend. And, we were mentioned in The Tennesseean and NFocus recently. Cool! |
0.955022 | Does spoken Na’vi vary systematically with the different clans of Pandora?
To clarify, systematically in this sense means that there are phonetic changes that ALWAYS hold true.
The main argument I see to support this theory is that in the real world, many widespread languages vary systematically with pronunciation. At a larger scale, there are Chinese, Arabic, and their linguistic counterparts, all of which have many different dialects that are each in effect their own language. For example, a speaker of Levantine Arabic can barely if at all understand a speaker of Moroccan Arabic, and likewise. Might this be so in Na’vi?
There are also smaller examples, like in English. Even though speakers of British English, Australian English, and American English can understand eachother, there are still many systematic phonetic differences.
But what about the so-called Brooklynese? Even though this accent is not only native to Brooklyn but to NYC as a whole, there are still less than 10 million speakers in all (and the number is slowly dwindling). Speakers of Brooklynese are known for three major phonetic changes that are very systematic and regular. These changes hold with every speaker, even though there are so few.
These smaller examples are roughly anologous to the clans of Pandora. So shouldn’t the clans speak systematically different, or at least dialected, variations of Na’vi as well?
I believe in dialects, too, but we have absolutely no information about language except in the movie and the ASG.
Yeah, I believe in dialect too. I would be very surprised if there was not any dialects across all clans on Pandora.
Yeah, I thought about it too. However I think that despite it there is still enough space for language changes, I think.
But your idea is completelly right.
I would expect dialects, but perhaps the variation is no more than that between UK vs. US English as most extreme.
I think that ToV transfer memories as particular feelings rather than words, but so far we can't be sure about this.
Back to topic, there have to be dialects but I also expect something like English - slight different US, UK or Australia. Nothing more.
I don't think that an Omatikaya will connect with someone on the other side of the world via the Tree of Voices.
That same person would live in a more or less different reality and will therefore develop sayings according to their environment, so I would not be surprised to see closely related languages and dialects.
But anyway, since it's a movie, it wouldn't be impossible for James Cameron to say "All Pandorans speak Na'vi, period."
This is really interesting! I didn't think about such being possible until now. I'm sure there would be different pronunciations of Na'vi words from different parts of Pandora.
1. In products like Avatar video games and the Survival's Guide to Pandora, there are some non-Frommerian Na'vi words and names that don't fit with the rules. The concensus is that these words are "non-canon", but I like to think about them as words that come from another dialect. For example the non-canon name Beyda'amo, a Na'vi of the Tipani clan in the Avatar video game, could perhaps correspond to *Pxeytxa'amo in Omaticaya (where Omaticayans say px and tx, the Tipani could pronounce them b and d). But this explanation exists only in my mind. I prefer this explanation than wiping such words out from the canon.
2. in another thread, I expressed an idea about very few canonical words that phonotactically don't fit with the majority of other Na'vi words, for example they have a lot of consecutive vowels, like mauia or meoauniaea. In my mind, this could mean that these words are loan from another dialect or from an ancient form of the language. |
0.995376 | 1. Department of Urology, The First Hospital of Jilin University, Changchun, Jilin Province 130021, China.
2. Institute of Virology and AIDS Research, The First Hospital of Jilin University, Changchun, Jilin Province 130021, China.
3. Department of Nephrology, First Hospital of Jilin University, Changchun, Jilin Province 130021, China.
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an effective chemotherapeutic agent that specifically impairs cancer cells while sparing normal cells; however, some cancer cells develop resistance to TRAIL. Here, we identified Andrographolide, a diterpenoid lactone derived from a traditional herbal medicine Andrographis paniculata, as an ideal sensitizer for TRAIL to overcome bladder cancer. Our results showed that combination treatment of Andro and TRAIL retarded growth, attenuated proliferation, decreased colony formation, inhibited migration and promoted caspases-mediated apoptosis in T24 cells. Additionally, the sensitization by Andro is achieved through up-regulation of death receptors (DR4 and DR5) of TRAIL in a p53-dependent manner. Crucially, Andro is also capable of inactivating NF-κB signaling pathway via transcriptional down-regulation p65/RelA, which is further contributed to enhancement of TRAIL-mediated cytotoxicity. These results indicated that non-toxic doses of Andrographolide sensitized bladder cancer cells to TRAIL-mediated apoptosis, suggesting it as an effective therapeutic agent for TRAIL resistant human bladder cancers.
Bladder cancer ranks as the 9th most frequently diagnosed cancer and is 13th in terms of deaths worldwide since 2012 . Although accumulating studies show that targeted drugs can improve patient survival rates, first-line molecular-targeted drugs (sorafenib and gefitinib) exhibit only limited therapeutic effects in several clinical trials and can cause severe side effects [2, 3]. Therefore, there is an increasing demand to explore effective strategies for bladder urothelial carcinoma (BLCA) treatment.
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), has been reported as a candidate for cancer treatment due to its selective inducement of apoptosis in cancer cells while sparing normal cells [4, 5]. TRAIL specifically binds to cell-death receptors DR4 or DR5 (also named tumor necrosis factor receptor superfamily member 10 TNFRSF10A and TNFRSF10B, respectively), resulting in trimerization of the receptor and clustering of the intracellular death domain of the receptor and leading to death-inducing signaling complex formation [6, 7]. Trimerization of the death domains leads to the recruitment and activation of Fas-associated death domain protein, which promotes transmission of an apoptotic signal and induces apoptosis via both the extrinsic and intrinsic mitochondrial pathways [6, 8, 9]. However, evidence indicates that cancer cells can develop resistance to TRAIL if they lose the ability to express death receptors or exhibit constant activation of anti-apoptotic pathways [9, 10]. Certain malignant cells are resistant to TRAIL, including bladder cancer cells [11-13]. Therefore, identifying effective agents capable of overcoming TRAIL resistance in bladder cancer cells is necessary.
Andrographolide (Andro) is a diterpene lactone (C20H30O) and a major component of Andrographis paniculata Nees, which was used as a traditional anti-inflammation medicine in Asia [14, 15]. Andro can be excreted from the body over a short period of time while exhibiting low levels of toxicity to normal cells . Recent progress in Andro-specific research confirmed its effectiveness and specificity in promoting cancer-cell apoptosis . In this study, we discovered that Andro markedly improved the sensitivity of BLCA cells to TRAIL-induced apoptosis, and that combined treatment stimulated caspase- dependent apoptosis through p53 dependent enhancement of DR4 and DR5 expression. Additionally, Andro treatment attenuated mRNA expression of B cell lymphoma 2 (Bcl-2), cellular inhibitor of apoptosis 2 (cIAP2), X-linked inhibitor of apoptosis (XIAP), and nuclear factor kappa-B (NF-κB) p65 subunit (RelA). Our study provides evidence supporting clinical application of the combination therapy of TRAIL and Andrographolide for bladder cancer patients.
As DR4 and DR5 were canonical TRAIL receptors involved in its antitumor effects, we analyzed mRNA-expression data from the Oncomine database, finding that mean DR4 mRNA expression in bladder cancer tissues exceeded that in normal bladder tissue, whereas no significant difference was found in DR5 between tumor and normal tissues (Figure 1A). Furthermore, gene set enrichment analysis (GSEA) analysis of The Cancer Genome Atlas (TCGA) profiles from BLCA patients (n = 414) revealed enrichment of apoptosis pathways associated with samples exhibiting high levels of both DR4 and DR5 expression (Figure 1B). Therefore, bioinformatics analysis suggested that relatively high DR4/5 expression might represent an effective therapeutic TRAIL-related target in bladder cancer cells. However, MTS assays revealed that the 50% inhibitory concentration (IC50) value of TRAIL was 38.35 ng/mL, indicating that low concentrations of TRAIL would be ineffective in T24 cells (Figure 1C). This suggested the necessity to identify appropriate TRAIL-specific sensitizers capable of overcoming TRAIL resistance in bladder cancer cells. Moreover, Andro represents a potential agonist for TRAIL therapy, with MTS assays revealing an IC50 value for Andro of 101.5 µM in T24 cells (Figure 1E).
Both cell-counting and MTS assays suggested that single treatment with either TRAIL or Andro inhibited cell-proliferation rates. Interestingly, we found that combination treatment with TRAIL and Andro substantially enhanced this inhibitory effect on cell proliferation (Figure 2A and B). Additionally, morphological changes in TRAIL and/or Andro-treated cells confirmed the inhibition of T24-cell proliferation associated with combined treatment versus single treatment (Figure 2C). Moreover, colony formation dramatically decreased following combined treatment relative to that observed following treatment with Andro or TRAIL alone (Figure 2D).
Given that cancer cells exhibit potent migratory features, we conducted wound-healing assays as functional readings. The results indicated that treatment with TRAIL or Andro alone modestly decreased the ratio of migrating bladder cancer cells. In the TRAIL-treated group, the cell-migration ratio was 65.37 ± 2.47%, whereas that in the Andro-treated group was 79.65 ± 1.82%. However, combined treatment resulted in a migration ratio of 32.16 ± 1.59% (Figure 2E). Evidence shows that matrix metalloproteinases (MMPs) play important roles in tumor progression, invasion, and metastasis . Therefore, we evaluated protein levels of CD147 and MMP-9 by immunoblot, revealing that CD147 and MMP-9 were downregulated after a 24-h incubation with both TRAIL and Andro relative to levels observed following single treatment with TRAIL or Andro alone (Figure 2F). These findings demonstrated that combination treatment with TRAIL and Andro potently suppressed T24-cell growth and migration.
The canonical pathway associated with TRAIL-induced cell death involves binding to specific death receptors (DR4 or DR5) to initiate activation of extrinsic apoptosis [6, 7]. MTS assays suggested that in the combination-treatment groups, cell viability was further attenuated along with increasing Andro concentrations (Figure 3A). Immunoblot assays analyzing changes in protein content in T24 cells treated with TRAIL and/or Andro suggested that combined treatment enhanced caspase-dependent apoptosis based on levels of cleaved-poly (ADP ribose) polymerase 1 (PARP1; 119/89 kDa) and activation of caspases 3, 9, and 8 (Figure 3B). We then evaluated the roles of Andro in apoptosis progression using Annexin V-fluorescein isothiocyanate (FITC)/ propidium iodide (PI)-labeled flow cytometry. Compared with groups treated with TRAIL or Andro alone, combination treatment notably enhanced apoptosis rates in T24 cells (Figure 3C). These results showed that combined treatment of Andro and TRAIL promoted apoptosis in BLCA cells.
Additionally, we found that T24 apoptosis induced by combined treatment was initiated by caspase-specific activation that did not involve cell necrosis. T24 cell viability in the combined-treatment group was restored in the presence of the pan-caspase inhibitor Z-VAD-FMK (57.54 ± 4.99% for combined treatment without Z-VAD-FMK and 94.03 ± 3.77% for combined treatment with Z-VAD-FMK). By contrast, administration of Necrostatin-1 (Nec-1; a cell-necrosis inhibitor) did not alter the decreased T24 cell viability observed following combined treatment with Andro and TRAIL, with cell-morphological images supporting MTS assay results (Figure 3D).
Immunoblot assays identified that Andro treatment upregulated protein levels of both DR4 and DR5 (Figure 4A). To determine whether one or both receptors were responsible for the pro-apoptotic effect of TRAIL in T24 cells, we used small-interfering (si)RNAs to block innate DR4/DR5 translation (si1201 and si955 targeting DR4 and DR5 mRNA, respectively) according to their knockdown efficiency determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) assays (Figure 4B). Following results demonstrated that cell viability was slightly restored in DR4-knockdown cells and restored to a higher degree in DR5-knockdown cells following combination treatment with TRAIL and Andro. Additionally, we observed no significant difference in cell viability between DR4- and DR5-knockdown cells (Figure 4C). Flow cytometry confirmed those from MTS assays showing that blocking DR5 translation was more effective at reducing the apoptosis rate as compared with blocking DR4 translation (apoptosis rates: 14.41 ± 0.21% in DR4-knockdown cells and 8.07±0.22% in DR5-knockdown cells) (Figure 4D).
Potential TRAIL-receptor mRNA expression in bladder cancer patients and the antitumor effects of TRAIL and Andro in T24 cells. (A) Log2-converted DR4/DR5 mRNA expression levels from the Oncomine database. (B) GSEA results showing that high DR4/DR5 expression was positively correlated with apoptosis-gene signatures. (C) T24 cells were treated with various concentrations of TRAIL for 24-h. (D) Two- and three-dimensional chemical representation of Andro derived from the PubChem Compound Database (https://pubchem.ncbi.nlm.nih.gov/). Red, grey, and light-blue nodes represent oxygen atoms, carbon atoms, and hydrogen atoms, respectively. (E) T24 cells were treated with various concentrations of Andro for 24-h. The p-value and IC50 values were calculated using GraphPad Prism software. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
TRAIL combined with Andro further inhibits T24-cell proliferation, migration, and colony formation. (A, B) Effects of TRAIL and/or Andro treatment on the T24 growth curve. Verification by cell-counting and MTS assays. (C) Images (200×) show T24 cells following treatment with TRAIL or/and Andro for 72-h. (D) Effects of TRAIL and Andro treatment on the colony formation of BLCA cell lines. T24 cells were treated with DMSO (control), TRAIL (2 ng/mL), or Andro (8 μM) alone or both TRAIL (2 ng/mL) and Andro (8 μM) and incubated for 12 days. Cell colonies (>50 cells) were counted using an inverted microscope (100×). (E) Effects of TRAIL and Andro treatment on T24-cell migration. T24 cells were treated with DMSO, TRAIL (2 ng/mL), and/or Andro (5 μM) for 18 h. Images (100×) show T24-cell migration after treatment. (F) Left panel: the protein levels of CD147. Right panel: MMP-9 in T24 cells treated with different concentrations of TRAIL (2 ng/ml) and/or Andro [4uM (+) or 8 uM (++)] for 18-h and measured by western blot. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
Because combined treatment enhanced DR4 and DR5 protein levels in T24 cells (Figure 4A), we performed GSEA of the TCGA profiles of 414 bladder patients, which indicated that both high TNFRSF10A and TNFRSF10B expression were positively correlated with the p53-signaling pathway (Figure 5A). Therefore, we constructed a p53-knockdown T24 cell line to explore the molecular mechanisms associated with Andro-mediated TNFRSF10B expression. Following qRT-PCR and immunoblot confirmation of p53-knockdown efficiency (Figure 5B), immunoblot results revealed that Andro enhanced p53 levels while p53 knockdown attenuated Andro-induced upregulation of DR4 and DR5 levels in T24 cells (Figure 5C). Moreover, MTS assays demonstrated partial restoration of cell viability in p53-knockdown cells compared to sh-ctrl T24 cells following combined treatment with TRAIL and Andro (control shRNA, 69.80±4.89% vs. p53 shRNA, 84.32±2.17%) (Figure 5D). Knocking down of p53 expression also contributed to attenuated synergistic effect of Andro for which decreased cell apoptosis rate in TRAIL-treated T24 cells (control shRNA, 23.88±0.77% vs. p53 shRNA, 13.99±0.88%) (Figure S1).
Here, we found that RelA (the NF-κB p65 subunit) was downregulated at both the mRNA and protein levels following combined treatment with TRAIL and Andro (Figure 6A-C). Additionally, combined treatment modified protein and mRNA levels of apoptosis-related genes, resulting in decreased cIAP2 protein levels (Figure 6A), Bcl-2 mRNA levels (combined treatment, 63.08 ± 1.54% vs. TRAIL or Andro treatment alone, 104.33 ± 18.3% and 90.76 ± 1.77%, respectively), and attenuated XIAP mRNA levels (which were stimulated by TRAIL treatment alone) following Andro treatment (Figure 6C). To confirm the role of the NF-κB pathway in regulating TRAIL-induced apoptosis of T24 cells, we used ammonium pyrrolidinedithiocarbamate (PDTC), a pan-NF-κB inhibitor. We found that the PDTC IC50 in T24 cells was 29.33 μM; therefore, we chose 5 µM as the appropriate concentration for further experiments (Figure 6D). MTS and fluorescence-activated cell sorting (FACS) assays revealed a synergistic effect of PDTC on the TRAIL sensitivity of T24 cells at relatively low concentrations (Figure 6E-G).
Andro sensitizes TRAIL-induced apoptosis but not necrosis in T24 cells. (A) TRAIL combined with Andro treatment inhibited the cell viability of BLCA cell lines. T24 cells were treated with various concentrations of TRAIL and/or Andro [2 (+) or 4 (++) or 8 (+++) μM] for 24-h, and cell viability was examined by MTS assay. (B) Protein expression of hallmarks of apoptosis in T24 cells treated with 2 ng/mL TRAIL or/and 8 µM of Andro for 24-h. (C) Effects of TRAIL and Andro treatment on apoptosis in T24 cell lines. Cells were identified by Annexin V-FITC detection following DMSO (control), TRAIL (2 ng/mL), and/or Andro (8 μM) treatment for 24-h. Histogram showing the apoptosis rates of all cell lines. (D) Images (200×) showing apoptotic cells after treatment under different conditions. Histograms of T24 cells treated with DMSO, TRAIL (2 ng/mL), and/or Andro (8 μM) and Z-AVD-FMK (0.05 μM) or Nec-1 (0.05 μM). Cell viability was determined by MTS assay after 24-h. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
DR5 is critical for Andro-mediated sensitization of T24 cells to TRAIL. (A) DR4/DR5 protein levels in T24 cells treated with TRAIL and/or Andro for 24-h. (B) Histograms of qRT-PCR screening for DR4 (left panel)/DR5 (right panel) siRNA optimization. (C) Cell viability of T24 cells transfected with either siDR4 or siDR5 or both and treated with a combination of TRAIL and Andro for 24-h. (D) Effects of TRAIL and Andro combination treatment on apoptosis in DR4-knockdown and/or DR5-knockdown T24 cell lines. Histogram showing the apoptosis rates of all cell lines. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
Activation of p53 expression is required for Andro-induced upregulation of DR4/DR5. (A) GSEA revealing that genes in the high DR4/DR5-expression group were positively correlated with signatures related to the p53-signaling pathway. (B) p53 mRNA (left panel) and p53 protein levels (right panel) in control shRNA- and p53 shRNA-transfected T24 cells. (C) DR4/DR5 protein levels in control shRNA and p53 shRNA-transfected cells treated with Andro [4 (+) or 8 μM (++)]. (D) Cell viability of T24 cells transfected with control shRNA or p53 shRNA and treated with a combination of TRAIL (2 ng/mL) and Andro (8 μM) for 24-h. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
Combination treatment with TRAIL and Andro enhances cell apoptosis rates through inhibiting the NF-кB pathway in T24 cells. (A, B) T24 cells were treated with 2 ng/mL TRAIL and/or 8 µM Andro for 24-h, RelA/cIAP2 protein levels and its quantification were assessed by immunoblot. (C) Histograms showing the relative mRNA levels of RelA, Bcl-2, and XIAP in T24 cells treated with TRAIL or/and Andro. (D) T24 cells were treated with PDTC at various concentrations for 24-h, and cell viability and IC50 values were measured using MTS assays. (E) T24 cells were treated with 2 ng/mL TRAIL or 5 μM PDTC or 8 μM Andro or with a combination of TRAIL and Andro/PDTC for 24-h. Cell viability was measured by MTS assay. (F, G) Cell apoptosis rates of T24 cells according to Annexin V-FITC detection. T24 cells were treated with 2 ng/mL TRAIL or 5 μM PDTC or 8 μM Andro or with a combination of TRAIL and Andro/PDTC for 24-h. Histograms showing the apoptosis rates. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
We performed MTS assays to evaluate the effect of TRAIL and/or Andro treatment on 5637 and UM-UC 3 bladder cancer cell lines. We found that the IC50 value for TRAIL and Andro treatment alone of 5637 cells was 15.19 ng/mL and 82.9 µM, respectively (Figure 7A), whereas that for UM-UC 3 cells was 75.00 ng/mL and 103.3 µM, respectively (Figure 7C). Both UM-UC 3 cells and 5637 cells were insensitive to low concentrations of either TRAIL or Andro, whereas combined treatment displayed a clear inhibitory effect on the cell viability of these TRAIL-resistant BLCA cell lines (Figure 7B and D). At 24-h post-treatment of UM-UC 3 cells with both Andro and TRAIL, cell viability was 71.54 ± 5.06% as compared with 92.65 ± 3.43% following treatment with TRAIL alone. Similarly, in 5637 cells, cell viability following combined treatment was 57.39 ± 8.31% as compared with 85.96 ± 3.76% following TRAIL treatment alone. Additionally, cell apoptosis rates determined by FACS revealed that combination treatment enhanced apoptosis in both 5637 and UM-UC 3 cells (Figure 7E). Moreover, the synergistic effect of PDTC on TRAIL induced apoptosis was also validated in both 5637 and UM-UC 3 BLCA cell lines (Figure 8). These results further supported that Andro sensitized multiple BLCA cell lines to TRAIL-mediated apoptosis by inhibiting the NF-κB signaling pathway.
Andro enhances TRAIL-mediated suppression of cell viability and apoptosis rates in other BLCA cell lines. (A, B) 5637 cells were treated with various concentrations of TRAIL or/and Andro for 24-h, and cell viability and IC50 values were measured by MTS assays. (C, D) UM-UC 3 cells were treated with various concentrations of TRAIL or/and Andro for 24-h, and cell viability and IC50 values were measured by MTS assays. (E) Effects of TRAIL and Andro treatment on 5637 and UM-UC 3 cell apoptosis. 5637 cells were identified by Annexin V-FITC detection following DMSO (control), TRAIL (2 ng/mL), or Andro (10 μM) treatment and combined TRAIL (2 ng/mL) and Andro (10 μM) treatment for 24-h. UM-UC 3 cells were identified by Annexin V-FITC detection following DMSO (control), TRAIL (10 ng/mL), or Andro (20 μM) treatment and combined TRAIL (10 ng/mL) with Andro (20 μM) treatment for 24-h. Histogram showing the apoptosis rates of 5637 and UM-UC3 cell lines. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
Enhancing TRAIL induced apoptosis through blocking NF-κB pathway is effective in multiple BLCA cell lines. (A) 5637 cells were treated with various concentrations of PDTC for 24-h, cell viability and IC50 values were measured by MTS assays. (B) Effects of TRAIL and PDTC treatment on 5637 cell apoptosis. 5637 cells were identified by Annexin V-FITC detection after DMSO (Mock), TRAIL (2 ng/mL), or PDTC (20 μM) treatment and combined TRAIL (2 ng/mL) and PDTC (20 μM) treatment for 24-h. (C) Histogram showing the apoptosis rates of 5637 cells. (D) UM-UC 3 cells were treated with various concentrations of PDTC for 24-h, cell viability and IC50 values were measured by MTS assays. (E) Effects of TRAIL and PDTC treatment on UM-UC 3 cell apoptosis. UM-UC 3 cells were identified by Annexin V-FITC detection after DMSO (control), TRAIL (10 ng/mL), or PDTC (40 μM) treatment and combined TRAIL (10 ng/mL) with PDTC (40 μM) treatment for 24-h. (F) Histogram showing the apoptosis rates of UM-UC 3 cells. Data represent the mean ± SD. *P < 0.05; **P < 0.01; ***P < 0.001 (n = 3).
The unique property of TRAIL triggering both extrinsic and intrinsic apoptosis making it a potentially effective anticancer agent [4, 19, 20]. Resistance of cancer cells to TRAIL-mediated apoptosis represents a major limitation to its clinical application . Therefore, identifying agents capable of enhancing TRAIL-induced anticancer effects is necessary. In the present study, clinical database analysis and GSEA revealed that mRNA expression of death receptors of TRAIL is positively associated with apoptosis signaling pathway in BLCA patients (Figure 1A and B). However, previous studies reported that human BLCA cells were resistant to TRAIL treatment . Thus, our findings that Andro, a natural compound, enhanced the sensitivity of BLCA cell lines to TRAIL-mediated apoptosis provided critical insight into a novel therapeutic strategy for BLCA patients.
In this study, we confirmed the synergetic effect of combined Andro and TRAIL treatment in bladder cancer cells, with Andro treatment enhancing TRAIL-mediated inhibition of cell viability, proliferation, migration, and colony formation and promotion of apoptosis in T24 cells. Consistently, we found that protein levels of two factors involved in tumor migration (MMP-9 and CD147) [23, 24] were decreased following combination treatment (Figure 2). A pan-caspase inhibitor (Z-VAD-FMK), almost completely restored cell viability of T24 cells treated with combination therapy, further supporting that Andro-specific increased TRAIL mediated caspase-dependent apoptosis in T24 cells (Figure 3). Another important finding was that combination therapy also increased TRAIL-induced apoptosis rates in multiple BLCA cell lines, indicating that Andro enhanced the anticancer efficacy of TRAIL independent of BLCA cell type (Figure 7).
Schematic map describing apoptosis induction of the TRAIL and Andro combination therapy.
TRAIL binding to its death receptors (DR4 and DR5), it initiates the formation of the DISC complex, which leads to activation of caspase cascades and induction of apoptosis . However, in cancer cells, pro-survival signaling pathways, including the NF-κB pathway, are activated to prevent TRAIL-induced apoptosis, with accumulating evidence supporting elevated NF-κB levels observed in bladder cancers [26, 27]. Two strategies should be considered to enhance the therapeutic efficacy of TRAIL: 1) enhancing the activation of apoptosis pathways and 2) suppressing pro-survival pathways.
We noted that T24 cells treated with Andro exhibited substantial increases in both DR4 and DR5 levels, which possibly contributed to TRAIL-mediated apoptosis. It remains controversial whether DR4 or DR5 represents the determinant receptor associated with TRAIL-induced apoptosis. Previous studies claimed that DR4 was more effective in promoting TRAIL-mediated cancer-cell apoptosis [28-30]; whereas other studies indicated DR5 was critical for promoting TRAIL-induced cancer-cell apoptosis . Here, by using siRNA targeting DR4 or DR5, we confirmed that both DR4 and DR5 were required for tumor suppressing activity by combined treatment with Andro and TRAIL in BLCA cells. Crucially, we noticed that silencing DR5 in BLCA cells is more effective in restoring the resistance for Andro/TRAIL treatment than silencing DR4, indicating that DR5 expression level is the major determinant for the sensitization by Andro in BLCA cells. Hence, we suggested that upregulated DR5 rather than DR4 enhanced TRAIL-induced apoptosis in T24 cells (Figure 4).
Our bioinformatics analysis of BLCA patients' data revealed a correlation between death receptors of TRAIL and the p53-signaling pathway. In consistent with previous studies , we confirmed that p53 expression is critical for Andro-mediated increases in DR4 and DR5 expression (Figure 5). Downregulation of endogenous p53 expression blocked Andro-mediated upregulation of DR4 and DR5 levels in T24 cells. Importantly, decreased p53 partially attenuated the synergistic antitumor effects of the combination treatment. Therefore, we assumed that other pathways were involved in cancer-cell apoptosis associated with combined Andro and TRAIL treatment.
The NF-κB-signaling pathway protects tumor cells from apoptosis by upregulating multiple anti-apoptosis genes . Accumulating evidence shows that activation of the NF-κB subunit RelA renders tumor cells resistant to TRAIL-mediated apoptosis . In the present study, we found that combined treatment of T24 cells with Andro and TRAIL decreased RelA expression at both mRNA and protein levels. Additionally, the mRNA expression of several NF-κB-regulated anti-apoptosis genes, including cIAP2, Bcl-2, and XIAP, was attenuated following Andro treatment. Therefore, we hypothesized that inhibiting the NF-κB-dependent pro-survival pathway by decreasing RelA expression might sensitize T24 cells to TRAIL-induced apoptosis. To further support our conclusion, we found that using PDTC (a pan- NF-κB inhibitor capable of suppressing both NF-κB-DNA binding and NF-κB-dependent transcriptional activity) enhanced TRAIL-mediated apoptosis and suppression of cell viability in multiple BLCA cell lines. These results suggested that the synergistic effect of combined treatment and associated NF-κB-pathway inhibition was correlated with the downregulation of RelA by Andro treatment (Figure 6), which agreed with previously reported results [33, 34]. As all our experiments were performed in vitro, thus it is still needed to assess the in vivo effect of the combination therapy of TRAIL and Andro on bladder cancer in future studies.
Our findings indicated that combined treatment with TRAIL and Andro increased DR4/DR5 levels and suppressed the NF-κB-dependent anti-apoptosis pathway, both of which contributed to BLCA-cell sensitization to TRAIL. In conclusion, these results indicated that Andro treatment acted synergistically with TRAIL treatment and offers a potential treatment option for patients with TRAIL-resistant bladder cancer.
RNA-seq data from the transcriptome profile in a bladder cancer dataset was downloaded from TCGA (https://portal.gdc.cancer.gov/repository; data release 10.1; February 15, 2018) and contained 414 bladder tumor tissues and 19 adjacent normal bladder tissue samples. TNFRSF10A and TNFRSF10B mRNA expression data from a previous study was downloaded from the Oncomine database (https:// www.oncomine.org/resource/main.html). GSEA was performed by GSEA 3.0 (BROAD Institute; http:// www.broadinstitute.org/gsea) . Data processing and visualization were accomplished by R (https: //www.r-project.org/) and GraphPad Prism (v7.0; GraphPad Software, La Jolla, CA, USA).
The BLCA cell lines T24, UM-UC 3, and 5637 cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China), and cells were cultured in Dulbecco's modified Eagle medium (HyClone, Logan, UT, USA). All media were supplemented with 10% fetal bovine serum (Biological Industries, Cromwell, CT, USA). All cells were cultured under standard incubator conditions (37℃ and 5% CO2).
Andrographolide was dissolved in 10 mM dimethyl sulfoxide (DMSO) used as a stock solution, and recombinant human TRAIL (R&D Systems, MN, USA) was prepared in phosphate-buffered saline (PBS) containing 0.1% bovine serum albumin at 20 µg/ml. Z-VAD-FMK (HY-16658), Necrostatin-1 (HY-15760), and PDTC (HY-18738) were purchased from MedChemExpress (Monmouth Junction, NJ, USA). Antibodies included the following: caspase-8, caspase-9, RelA, caspase-3, and DR4 from Cell Signaling Technology (Danvers, MA, USA); β-actin, PARP1, and cIAP2 from Abcam (Cambridge, UK); p53 from Thermo Fisher Scientific (Waltham, MA, USA); and DR5 from Biolegend (307407; San Diego, CA, USA).
We used cell-growth curves and colony formation assays to evaluate the effect of Andrographolide and/or TRAIL on bladder cancer-cell proliferation. For growth assays, ~2 × 104 cells/well were seeded in a 24-well plate, treated with different concentrations of Andrographolide or/and TRAIL or DMSO (as control), and trypsinized, followed by resuspension and counting using a cell-counting chamber (Shanghai Precision Instruments Co., Ltd., Shanghai, China). Cell number was counted and recorded after 24-h, 48-h, and 72-h, with the optical density at 450 nm measured at the same time points.
For colony formation assays, ~200 cells/well were seeded in a 6-well plate with 2 mL medium, treated under different conditions, and incubated for 12 days, after which cells were washed with cold PBS and fixed with 4% paraformaldehyde for 20 min. Cells were then stained with 0.1% crystal violet solution for 15 min at room temperature, washed with double-distilled water three times, and air dried. Colonies (>50 cells) were counted using an inverted microscope (100×). All experiments were performed in triplicate.
100 × cell growth inhibitory ratio (%) = 100 × [(A × 450control - A450sample)/(A450control - A450blank)].
Cells in 6-well plates were washed twice with cold PBS. RIPA lysis buffer (Wanleibio, Beijing, China) was then added to the wells, followed by incubation for 15 min at 4°C. Whole-cell lysate was centrifuged at 12,000g at 4°C, and the supernatant was incubated with loading buffer and denatured at 100°C for 15 min, followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis. The separated proteins were transferred to nitrocellulose membranes (Millipore, Billerica, MA, USA), and 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (Millipore) were used to visualize the protein bands, with a Quantity One instrument (Bio-Rad, Hercules, CA, USA) used for imaging. Secondary antibodies included anti-rabbit IgG and anti-mouse IgG (Cell Signaling Technology, USA).
Cells treated under different conditions for 24-h were resuspended in 6-well culture plates, washed twice with cold PBS, and pelleted by centrifugation at 5000g for 5 min. Apoptotic cells were quantified using an Annexin V-FITC apoptosis detection kit (KeyGEN BioTECH, Nanjing, China). A FACS flow cytometer (BD Biosciences, San Diego, CA, USA) was used to analyze cell apoptosis.
Briefly, RNA isolated from cells was converted to cDNA using a reverse transcription kit (Transgen Biotech, Beijing, China). PCR amplification was performed using a Roche LC480 instrument (Roche, Basel, Switzerland) with SYBR Green supermix (Fermentas, Waltham, MA, USA), 1 µM of each primer, and 6 μL of diluted cDNA. Samples were amplified in triplicate. Primer sequences for glyceraldehyde 3-phosphate dehydrogenase (GAPDH), Bcl-2, XIAP, RelA, and p53 are listed in Table S1. Relative gene-expression levels were represented as ΔCt = Ctgene - Ctreference, with fold changes calculated using the 2-ΔΔCt method. GAPDH was used to accomplish the expression normalization.
The plasmids pRSV-Rev (12253), pMDLg/pRRE (12251), and pCMV-VSV-G (8454) were purchased from Addgene (Cambridge, MA, USA). The lentiviral vector plko.1 was obtained from Generay Biotech (Shanghai, China). The sequence for p53 shRNA (CCGGGTCCAGATGAAGCTCCCAGAACTCGAGTTCTGGGAGCTTCATCTGGACTTTTT) and flanked by EcoRI and BamHI sites (5′ and 3′, respectively) were inserted into the plko.1 vector. Viruses were propagated in 293T cells, the supernatant of infected 293T cells were collected, and viral particles were pelleted through a 20% sucrose cushion at 28,000 rpm for 90 min. Purified virions were stored at -80°C.
Synthetic siRNA [negative-control fluorescein (FAM) siRNAs, DR4 siRNAs, and DR5 siRNAs] were obtained from GenePharma (Shanghai, China). The cellular delivery of siRNA was performed using Lipofectamine 2000 (Thermo Fisher Scientific), optimized using various siRNA concentrations, and evaluated by fluorescence microscope and qRT-PCR. siRNAs sequences are listed in Table S2.
Differences among test groups were analyzed by GraphPad Prism software (v7.0; GraphPad Software) and SPSS (v20.0; IBM, Armonk, NY, USA). A P < 0.05 was considered statistically significant. A two-tailed Student's t test was performed to detect statistical difference between two individual experimental groups.
Andro: andrographolide; IC50: 50% inhibitory concentration; MTS: 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulphophenyl)-2H-tetrazolium; TRAIL: tumor necrosis factor-related apoptosis-inducing ligand; BLCA: bladder urothelial carcinoma; TCGA: The Cancer Genome Atlas; MMP: matrix metalloproteinase; DMSO: dimethyl sulfoxide; FITC: fluorescein isothiocyanate; GSEA: Gene set enrichment analysis; Nec-1: necrostatin-1; SD: standard deviation; shRNA: short-hairpin RNA; TNFRSF10A/B: tumor necrosis factor receptor superfamily member 10A/B; Bcl-2: B cell lymphoma 2; cIAP2: cellular inhibitor of apoptosis 2; qRT-PCR: quantitative reverse transcription polymerase chain reaction; RelA: NF-κB p65 subunit; XIAP: X-linked inhibitor of apoptosis.
We thank Junliang Chang and Yuanyuan Li for their technical assistance and Editage for editorial assistance. This work was supported by funding from the National Natural Science Foundation of China (81772183).
Conceptualization, Weiwei and Yuyou Deng; Methodology, Yuyou Deng, Haoran Guo and Ran Bi; Software, Yuyou Deng; Validation, Jiaxin Yang; Investigation, Honghuang Lan; Resources, Chunxi Wang; Writing-Review & Editing, Weiwei and Yuyou Deng; Visualization, Yuyou Deng; Supervision, Chunxi Wang; Project administration, Songling Zahgn; Funding Acquisition, Weiwei and Chunxi Wang. |
0.999999 | Born in London in 1953, Graham Gooch is one of England's greatest ever cricketers. Captain of Essex and England, he scored 8,900 runs in Test matches and 44,846 first-class runs at an average of 49. His aggregate 456 against India at Lords in 1990 remains a world record. As a bowler he took over 200 first-class wickets and returned best figures in a Test of 3-39. As captain of England his commitment to personal fitness and a strong work ethic inspired the team to some outstanding performances at a time when results had been disappointing. He captained England 34 times and was Wisden Cricketer of the Year 1980. He has continued to play an active role in cricket since his retirement from playing. Graham has been an England selector, England specialist batting coach and was England Tour Test Manager to Australia in 1998/99. He is also in great demand as a broadcaster.
In 2006 Graham Gooch was made an Honorary Doctor of the University.
"The Senate of Anglia Ruskin University is pleased to confer on Graham Gooch OBE the award of Honorary Doctor of the University in recognition of his long and dedicated contribution to County Cricket in Essex, and of his illustrious international record as a successful Test captain of England, and one of England's foremost batsman of any generation.
Whilst this University confers honours on many truly outstanding people from many walks of life, it is not often that we have the pleasure of honouring a contemporary living legend, but today is one of those occasions. How did this career develop and what is the evidence for this assertion?
He was born in Leytonstone in East London in 1953, and his interest in cricket was nurtured by his father Alf and at the Ilford Cricket School by his mentor, Bill Morris. He progressed as a cricketer who could do a bit of everything, and was sent on the London Schools Tour of East Africa. Shortly after he made the Essex Second Eleven and in 1973, made his first class debut. In 1975, he broke into the national scene making 75 for the MCC against the Australians but in his First Test, which followed on the strength of this, he regretfully made a pair! He returned to the Test team in 1978, his self-discipline, determination and technique having been substantially reinforced with an emerging Essex side which was soon to dominate the County scene.
The next decade and a half witnessed the greatest personal run accumulation exercised in the history of cricket. On his retirement from Test cricket in 1995 at the age of 41, he still is England's all time highest run scorer with 44,846 runs in all first class cricket at an average of 49, including 128 centuries (20 in Tests) and a further 22,211 runs in List A matches, in all, a world record. He lies eighth in the highest ever Test innings (one run behind Bradman); Has the record of most Test runs in a calendar year (1,264); and is third in the world in terms of most runs in a Test career, just behind Border and Gavaskar, both of whom play rather more innings. He is the only Test player in history to have scored a triple century and century in the same Test, against India in 1990, and his match aggregate of 456 remains the world record for a Test match. Many pundits and he himself, would count his greatest performance to have been against the West Indies in 1991, where he carried his bat for 154 out of 252 on a damp wicket against the combined artillery of Ambrose, Walsh, Marshall and Pattison. He captained England on 34 occasions and gave way to Michael Atherton in 1993. He made a brief comeback for MCC against New Zealand at the age of 47 but time was not on his side.
When one considers he lost three years Test cricket as a result of captaining the so-called Rebel Tour of South Africa in 1982 at the height of apartheid, it is clear that virtually every record in the book would have been comfortable smashed.
His personal regime throughout has been one of strict discipline, self determination and inner strength, linked to a ruthless commitment to physical training. As captain, this stern philosophy did not entirely endear to more cavalier brethren so as David Gower and Ian Botham. This personal philosophy reinforces his belief that coaching can only go so far - it is the inner man that matters. He thus thrives on responsibility and unlike some other captains his batting actually improved with the captaincy.
After retirement from the pleasurable employment of belting red leather to sundry parts of the planet, he has certainly ploughed his expertise and experience back into the game in many capacities - as an England cricket selector (1996 - 1999); as England Specialise Batting Coach (1998 - 2000); as England Test Tour Manager to Australia (1998 - 1999); as 'A' Team Tour Manager to Sri Lanka (1998); as Batting Coach at Durham County Cricket Club (1998 - 2001) and Head Coach at Essex County Cricket Club (2002 - 2004).
However, it is as Special Ambassador to Essex County Cricket that he sees his principal priorities these days - and who better to fulfil this role. This role has developed into a multi-faceted one. In the commercial domain, he has long acknowledged that County Cricket cannot rely on government or TV handouts, but has to generate its own independent funding streams (just like universities!). The centre piece of this is the ambition to make the Ford County Ground at Chelmsford into a world-class facility in its city centre location. This involves considerable activity in seeking out and securing new corporate contracts and sponsorships also, in supporting the County Academy for both boys and girls of 12 - 19 years of age. He has established the "Graham Gooch Scholarship Fund", an initiative to raise money to send some of the Club's best young players for experience overseas. He is keen on persuading state schools to embrace cricket once more, through a colt system and by a coach development programme. The selling of school playing fields for development is clearly not helping his cause! His links with this university are also evident in that Tony Palladino and other Essex players have attended this university.
In short, in the above, we see a massive commitment to the integration of the Club into Essex life and society; to its contribution to Country life; and its role as a family club. The University is itself honoured to be associated with these endeavours and to future collaboration - our vision is very similar in these respects.
Among its more serious manifestations such as national pride; triumphalism and cyclical despondency; and international strife, sport and particularly cricket can certainly be classed both as entertainment and education. In his post-retirement era, our honorary graduand has developed an enviable reputation in this regard. He has been a special commentator for Channel 4, Sky, Test Match Special and Radio Five Live since 2000 when his witty and penetrating observations have raised significantly the understanding of millions of the intricacies of cricket. He is a regular contributor to Question of Sport and is a much sought after pundit at senior management development seminars for well known companies on such topics as leadership, motivation, management talent and teamwork, where his style of analysis, relevant anecdotes and intelligent humour has provided fascinating insights on common leadership issues in business and sport. A receding hairline lately has also offered him scope to advocate and advertise the virtues of hair transplants!
So, in the light of the above, and exercising the power conferred on me by Senate, may I therefore invite the Vice Chancellor, to bestow the award of Honorary Doctor of the University upon Graham Gooch." |
0.924141 | Czech (/tʃɛk/; čeština Czech pronunciation: [ˈtʃɛʃcɪna]), historically also Bohemian (/boʊˈhiːmiən, bə-/; lingua Bohemica in Latin), is a West Slavic language of the Czech–Slovak group. Spoken by over 10 million people, it serves as the official language of the Czech Republic. Czech is closely related to Slovak, to the point of mutual intelligibility to a very high degree. Like other Slavic languages, Czech is a fusional language with a rich system of morphology and relatively flexible word order. Its vocabulary has been extensively influenced by Latin and German.
The Czech–Slovak group developed within West Slavic in the high medieval period, and the standardization of Czech and Slovak within the Czech–Slovak dialect continuum emerged in the early modern period. In the later 18th to mid-19th century, the modern written standard became codified in the context of the Czech National Revival. The main vernacular, known as Common Czech, is based on the vernacular of Prague, but is now spoken throughout most of the Czech Republic. The Moravian dialects spoken in the eastern part of the country are also classified as Czech, although some of their eastern variants are closer to Slovak.
Czech has a moderately-sized phoneme inventory, comprising ten monophthongs, three diphthongs and 25 consonants (divided into "hard", "neutral" and "soft" categories). Words may contain complicated consonant clusters or lack vowels altogether. Czech has a raised alveolar trill, which is not known to occur as a phoneme in any other language, represented by the grapheme ř. Czech uses a simple orthography which phonologists have used as a model.
Classification of Czech within the Balto-Slavic branch of the Indo-European language family. Czech and Slovak make up a "Czech–Slovak" subgroup.
Czech is a member of the West Slavic sub-branch of the Slavic branch of the Indo-European language family. This branch includes Polish, Kashubian, Upper and Lower Sorbian and Slovak. Slovak is the closest language genetic neighbor of Czech, followed by Polish and Silesian.
The West Slavic languages are spoken in Central Europe. Czech is distinguished from other West Slavic languages by a more-restricted distinction between "hard" and "soft" consonants (see Phonology below).
The Bible of Kralice was the first complete translation of the Bible into the Czech language from the original languages. Its six volumes were first published between 1579 and 1593.
The term "Old Czech" is applied to the period predating the 16th century, with the earliest records of the high medieval period also classified as "early Old Czech", but the term "Medieval Czech" is also used.
Around the 7th century, the Slavic expansion reached Central Europe, settling on the eastern fringes of the Frankish Empire. The West Slavic polity of Great Moravia formed by the 9th century. The Christianization of Bohemia took place during the 9th and 10th centuries. The diversification of the Czech-Slovak group within West Slavic began around that time, marked among other things by its ephemeral use of the voiced velar fricative consonant (/ɣ/) and consistent stress on the first syllable.
The Bohemian (Czech) language is first recorded in writing in glosses and short notes during the 12th to 13th centuries. Literary works written in Czech appear in the late 13th and early 14th century and administrative documents first appear towards the late 14th century. The first complete Bible translation also dates to this period. Old Czech texts, including poetry and cookbooks, were produced outside the university as well.
Literary activity becomes widespread in the early 15th century in the context of the Bohemian Reformation. Jan Hus contributed significantly to the standardization of Czech orthography, advocated for widespread literacy among Czech commoners (particularly in religion) and made early efforts to model written Czech after the spoken language.
There was no standardization distinguishing between Czech and Slovak prior to the 15th century. In the 16th century, the division between Czech and Slovak becomes apparent, marking the confessional division between Lutheran Protestants in Slovakia using Czech orthography and Catholics, especially Slovak Jesuits, beginning to use a separate Slovak orthography based on the language of the Trnava region.
The publication of the Kralice Bible between 1579 and 1593 (the first complete Czech translation of the Bible from the original languages) became very important for standardization of the Czech language in the following centuries.
In 1615, the Bohemian diet tried to declare Czech to be the only official language of the kingdom. After the Bohemian Revolt (of predominantly Protestant aristocracy) which was defeated by the Habsburgs in 1620, the Protestant intellectuals had to leave the country. This emigration together with other consequences of the Thirty Years' War had a negative impact on the further use of the Czech language. In 1627, Czech and German became official languages of the Kingdom of Bohemia and in the 18th century German became dominant in Bohemia and Moravia, especially among the upper classes.
Josef Dobrovský, whose writing played a key role in reviving Czech as a written language.
The modern standard Czech language originates in standardization efforts of the 18th century. By then the language had developed a literary tradition, and since then it has changed little; journals from that period have no substantial differences from modern standard Czech, and contemporary Czechs can understand them with little difficulty. Changes include the morphological shift of í to ej and é to í (although é survives for some uses) and the merging of í and the former ejí. Sometime before the 18th century, the Czech language abandoned a distinction between phonemic /l/ and /ʎ/ which survives in Slovak.
With the beginning of the national revival of the mid-18th century, Czech historians began to emphasize their people's accomplishments from the 15th through the 17th centuries, rebelling against the Counter-Reformation (the Habsburg re-catholization efforts which had denigrated Czech and other non-Latin languages). Czech philologists studied sixteenth-century texts, advocating the return of the language to high culture. This period is known as the Czech National Revival (or Renaissance).
During the national revival, in 1809 linguist and historian Josef Dobrovský released a German-language grammar of Old Czech entitled Ausführliches Lehrgebäude der böhmischen Sprache (Comprehensive Doctrine of the Bohemian Language). Dobrovský had intended his book to be descriptive, and did not think Czech had a realistic chance of returning as a major language. However, Josef Jungmann and other revivalists used Dobrovský's book to advocate for a Czech linguistic revival. Changes during this time included spelling reform (notably, í in place of the former j and j in place of g), the use of t (rather than ti) to end infinitive verbs and the non-capitalization of nouns (which had been a late borrowing from German). These changes differentiated Czech from Slovak. Modern scholars disagree about whether the conservative revivalists were motivated by nationalism or considered contemporary spoken Czech unsuitable for formal, widespread use.
Adherence to historical patterns was later relaxed and standard Czech adopted a number of features from Common Czech (a widespread, informal register), such as leaving some proper nouns undeclined. This has resulted in a relatively high level of homogeneity among all varieties of the language.
A map of the languages of Central and Eastern Europe. Within the Czech Republic, Common Czech is represented by dark yellow (C1) and Moravian dialects by medium yellow (C2) and light green (C3).
In 2005 and 2007, Czech was spoken by about 10 million residents of the Czech Republic. A Eurobarometer survey conducted from January to March 2012 found that the first language of 98 percent of Czech citizens was Czech, the third-highest in the European Union (behind Greece and Hungary).
Czech, the official language of the Czech Republic (a member of the European Union since 2004), is one of the EU's official languages and the 2012 Eurobarometer survey found that Czech was the foreign language most often used in Slovakia. Economist Jonathan van Parys collected data on language knowledge in Europe for the 2012 European Day of Languages. The five countries with the greatest use of Czech were the Czech Republic (98.77 percent), Slovakia (24.86 percent), Portugal (1.93 percent), Poland (0.98 percent) and Germany (0.47 percent).
Czech speakers in Slovakia primarily live in cities. Since it is a recognised minority language in Slovakia, Slovak citizens who speak only Czech may communicate with the government in their language to the extent that Slovak speakers in the Czech Republic may do so.
Immigration of Czechs from Europe to the United States occurred primarily from 1848 to 1914. Czech is a Less Commonly Taught Language in U.S. schools, and is taught at Czech heritage centers. Large communities of Czech Americans live in the states of Texas, Nebraska and Wisconsin. In the 2000 United States Census, Czech was reported as the most-common language spoken at home (besides English) in Valley, Butler and Saunders Counties, Nebraska and Republic County, Kansas. With the exception of Spanish (the non-English language most commonly spoken at home nationwide), Czech was the most-common home language in over a dozen additional counties in Nebraska, Kansas, Texas, North Dakota and Minnesota. As of 2009, 70,500 Americans spoke Czech as their first language (49th place nationwide, behind Turkish and ahead of Swedish).
The modern written standard is directly based on the standardization during the Czech National Revival in the 1830s, significantly influenced by Josef Jungmann's Czech–German dictionary published during 1834–1839. Jungmann used vocabulary of the Bible of Kralice (1579–1613) period and of the language used by his contemporaries. He borrowed words not present in Czech from other Slavic languages or created neologisms.
Standard Czech contains ten basic vowel phonemes, and three more found only in loanwords. They are /a/, /ɛ/, /ɪ/, /o/, and /u/, their long counterparts /aː/, /ɛː/, /iː/, /oː/ and /uː/, and three diphthongs, /ou̯/, /au̯/ and /ɛu̯/. The latter two diphthongs and the long /oː/ are exclusive to loanwords. Vowels are never reduced to schwa sounds when unstressed. Each word usually has primary stress on its first syllable, except for enclitics (minor, monosyllabic, unstressed syllables). In all words of more than two syllables, every odd-numbered syllable receives secondary stress. Stress is unrelated to vowel length, and the possibility of stressed short vowels and unstressed long vowels can be confusing to students whose native language combines the features (such as most varieties of English).
Voiced consonants with unvoiced counterparts are unvoiced at the end of a word before a pause, and in consonant clusters voicing assimilation occurs, which matches voicing to the following consonant. The unvoiced counterpart of /ɦ/ is /x/.
This distinction describes the declension patterns of nouns, which is based on the category of a noun's ending consonant. Hard consonants may not be followed by i or í in writing, or soft ones by y or ý (except in loanwords such as kilogram). Neutral consonants may take either character. Hard consonants are sometimes known as "strong", and soft ones as "weak".
"řeka" (river) (help·info)), and is present in Dvořák. In unvoiced environments, /r̝/ is realized as its voiceless allophone [r̝̊].
The consonants /r/ and /l/ can be syllabic, acting as syllable nuclei in place of a vowel. Strč prst skrz krk ("Stick [your] finger through [your] throat") is a well-known Czech tongue twister using only syllabic consonants.
Slavic grammar is fusional; its nouns, verbs, and adjectives are inflected by phonological processes to modify their meanings and grammatical functions, and the easily separable affixes characteristic of agglutinative languages are limited. Slavic inflection is complex and pervasive, inflecting for case, gender and number in nouns and tense, aspect, mood, person and subject number and gender in verbs.
Parts of speech include adjectives, adverbs, numbers, interrogative words, prepositions, conjunctions and interjections. Adverbs are primarily formed from adjectives by taking the final ý or í of the base form and replacing it with e, ě, or o. Negative statements are formed by adding the affix ne- to the verb of a clause, with one exception: je (he, she or it is) becomes není.
Because Czech uses grammatical case to convey word function in a sentence (instead of relying on word order, as English does), its word order is flexible. As a pro-drop language, in Czech an intransitive sentence can consist of only a verb; information about its subject is encoded in the verb. Enclitics (primarily auxiliary verbs and pronouns) must appear in the second syntactic slot of a sentence, after the first stressed unit. The first slot must contain a subject and object, a main form of a verb, an adverb or a conjunction (except for the light conjunctions a, "and", i, "and even" or ale, "but").
Czech syntax has a subject–verb–object sentence structure. In practice, however, word order is flexible and used for topicalization and focus. Although Czech has a periphrastic passive construction (like English), colloquial word-order changes frequently produce the passive voice. For example, to change "Peter killed Paul" to "Paul was killed by Peter" the order of subject and object is inverted: Petr zabil Pavla ("Peter killed Paul") becomes "Paul, Peter killed" (Pavla zabil Petr). Pavla is in the accusative case, the grammatical object (in this case, the victim) of the verb.
Pes jí bagetu. – The dog eats the baguette (rather than eating something else).
Bagetu jí pes. – The dog eats the baguette (rather than someone else doing so).
Pes bagetu jí. – The dog eats the baguette (rather than doing something else to it).
In portions of Bohemia (including Prague), questions such as Jí pes bagetu? without an interrogative word (such as co, "what" or kdo, "who") are intoned in a slow rise from low to high, quickly dropping to low on the last word or phrase.
Czech: Chc-i navštív-it universit-u, na kter-ou chod-í Jan.
English: I want to visit the university that John attends.
Some Czech grammatical texts order the cases differently, grouping the nominative and accusative (and the dative and locative) together because those declension patterns are often identical; this order accommodates learners with experience in other inflected languages, such as Latin or Russian. This order is nominative, accusative, genitive, dative, locative, instrumental and vocative.
Some prepositions require the nouns they modify to take a particular case. The cases assigned by each preposition are based on the physical (or metaphorical) direction, or location, conveyed by it. For example, od (from, away from) and z (out of, off) assign the genitive case. Other prepositions take one of several cases, with their meaning dependent on the case; na means "onto" or "for" with the accusative case, but "on" with the locative.
Examples of declension patterns (using prepositions) for a few nouns with adjectives follow. Only one plural example is given, since plural declension patterns are similar across genders.
Czech: Nes-l js-em krabic-i do dom-u se sv-ým přítel-em.
English: I carried the box into the house with my friend.
Czech distinguishes three genders—masculine, feminine, and neuter—and the masculine gender is subdivided into animate and inanimate. With few exceptions, feminine nouns in the nominative case end in -a, -e, or consonant; neuter nouns in -o, -e, or -í, and masculine nouns in a consonant. Adjectives agree in gender and animacy (for masculine nouns in the accusative or genitive singular and the nominative plural) with the nouns they modify. The main effect of gender in Czech is the difference in noun and adjective declension, but other effects include past-tense verb endings: for example, dělal (he did, or made); dělala (she did, or made) and dělalo (it did, or made).
Nouns are also inflected for number, distinguishing between singular and plural. Typical of a Slavic language, Czech cardinal numbers one through four allow the nouns and adjectives they modify to take any case, but numbers over five place these nouns and adjectives in the genitive case when the entire expression is in nominative or accusative case. The Czech koruna is an example of this feature; it is shown here as the subject of a hypothetical sentence, and declined as genitive for numbers five and up.
Numerical words decline for case and, for numbers one and two, for gender. Numbers one through five are shown below as examples, and have some of the most exceptions among Czech numbers. The number one has declension patterns identical to those of the demonstrative pronoun, to.
Although Czech's grammatical numbers are singular and plural, several residuals of dual forms remain. Some nouns for paired body parts use a historical dual form to express plural in some cases: ruka (hand)—ruce (nominative); noha (leg)—nohama (instrumental), nohou (genitive/locative); oko (eye)—oči, and ucho (ear)—uši. While two of these nouns are neuter in their singular forms, all plural forms are considered feminine; their gender is relevant to their associated adjectives and verbs. These forms are plural semantically, used for any non-singular count, as in mezi čtyřma očima (face to face, lit. among four eyes). The plural number paradigms of these nouns are actually a mixture of historical dual and plural forms. For example, nohy (legs; nominative/accusative) is a standard plural form of this type of noun.
Czech verb conjugation is less complex than noun and adjective declension because it codes for fewer categories. Verbs agree with their subjects in person (first, second or third) and number (singular or plural), and are conjugated for tense (past, present or future). For example, the conjugated verb mluvíme (we speak) is in the present tense and first-person plural; it is distinguished from other conjugations of the infinitive mluvit by its ending, -íme.
Typical of Slavic languages, Czech marks its verbs for one of two grammatical aspects: perfective and imperfective. Most verbs are part of inflected aspect pairs—for example, koupit (perfective) and kupovat (imperfective). Although the verbs' meaning is similar, in perfective verbs the action is completed and in imperfective verbs it is ongoing. This is distinct from past and present tense, and any Czech verb of either aspect can be conjugated into any of its three tenses. Aspect describes the state of the action at the time specified by the tense.
The verbs of most aspect pairs differ in one of two ways: by prefix or by suffix. In prefix pairs, the perfective verb has an added prefix—for example, the imperfective psát (to write, to be writing) compared with the perfective napsat (to write down, to finish writing). The most common prefixes are na-, o-, po-, s-, u-, vy-, z- and za-. In suffix pairs, a different infinitive ending is added to the perfective stem; for example, the perfective verbs koupit (to buy) and prodat (to sell) have the imperfective forms kupovat and prodávat. Imperfective verbs may undergo further morphology to make other imperfective verbs (iterative and frequentative forms), denoting repeated or regular action. The verb jít (to go) has the iterative form chodit (to go repeatedly) and the frequentative form chodívat (to go regularly).
Many verbs have only one aspect, and verbs describing continual states of being—být (to be), chtít (to want), moct (to be able to), ležet (to lie down, to be lying down)—have no perfective form. Conversely, verbs describing immediate states of change—for example, otěhotnět (to become pregnant) and nadchnout se (to become enthusiastic)—have no imperfective aspect.
Although Czech's use of present and future tense is largely similar to that of English, the language uses past tense to represent the English present perfect and past perfect; ona běžela could mean she ran, she has run or she had run.
In some contexts, Czech's perfective present (which differs from the English present perfect) implies future action; in others, it connotes habitual action. As a result, the language has a proper future tense to minimize ambiguity. The future tense does not involve conjugating the verb describing an action to be undertaken in the future; instead, the future form of být (as shown in the table at left) is placed before the infinitive (for example, budu jíst—"I will eat").
This conjugation is not followed by být itself, so future-oriented expressions involving nouns, adjectives, or prepositions (rather than verbs) omit být. "I will be happy" is translated as Budu šťastný (not Budu být šťastný).
The infinitive form ends in t (archaically, ti). It is the form found in dictionaries and the form that follows auxiliary verbs (for example, můžu tě slyšet—"I can hear you"). Czech verbs have three grammatical moods: indicative, imperative and conditional. The imperative mood adds specific endings for each of three person (or number) categories: -Ø/-i/-ej for second-person singular, -te/-ete/-ejte for second-person plural and -me/-eme/-ejme for first-person plural. The conditional mood is formed with a particle after the past-tense verb. This mood indicates possible events, expressed in English as "I would" or "I wish".
Czech has one of the most phonemic orthographies of all European languages. Its thirty-one graphemes represent thirty sounds (in most dialects, i and y have the same sound), and it contains only one digraph: ch, which follows h in the alphabet. As a result, some of its characters have been used by phonologists to denote corresponding sounds in other languages. The characters q, w and x appear only in foreign words. The háček (ˇ) is used with certain letters to form new characters: š, ž, and č, as well as ň, ě, ř, ť, and ď (the latter five uncommon outside Czech). The last two letters are sometimes written with a comma above (ʼ, an abbreviated háček) because of their height. The character ó exists only in loanwords and onomatopoeia.
Unlike most European languages, Czech distinguishes vowel length; long vowels are indicated by an acute accent or, occasionally with ů, a ring. Long u is usually written ú at the beginning of a word or morpheme (úroda, neúrodný) and ů elsewhere, except for loanwords (skútr) or onomatopoeia (bú). Long vowels and ě are not considered separate letters in the alphabetical order.
Czech typographical features not associated with phonetics generally resemble those of most Latin European languages, including English. Proper nouns, honorifics, and the first letters of quotations are capitalized, and punctuation is typical of other Latin European languages. Writing of ordinal numerals is similar to most European languages. The Czech language uses a decimal comma instead of a decimal point. When writing a long number, spaces between every three numbers (e.g. between hundreds and thousands) may be used for better orientation in handwritten texts, but not in decimal places, like in English. The number 1,234,567.8910 may be written as 1234567,8910 or 1 234 567,8910. Ordinal numbers (1st) use a point as in German (1.). In proper noun phrases (except personal names), only the first word is capitalized (Pražský hrad, Prague Castle).
The main vernacular of Bohemia is "Common Czech", based on the dialect of the Prague region. Other Bohemian dialects have become marginalized, while Moravian dialects remain more widespread, with a political movement for Moravian linguistic revival active since the 1990s.
The main Czech vernacular, spoken primarily in and around Prague but also throughout the country, is known as Common Czech (obecná čeština). This is an academic distinction; most Czechs are unaware of the term or associate it with vernacular (or incorrect) Czech. Compared to standard Czech, Common Czech is characterized by simpler inflection patterns and differences in sound distribution.
Common Czech has become ubiquitous in most parts of the Czech Republic since the later 20th century. It is usually defined as an interdialect used in common speech in Bohemia and western parts of Moravia (by about two thirds of all inhabitants of the Czech Republic). Common Czech is not codified, but some of its elements have become adopted in the written standard. Since the second half of the 20th century, Common Czech elements have also been spreading to regions previously unaffected, as a consequence of media influence. Standard Czech is still the norm for politicians, businesspeople and other Czechs in formal situations, but Common Czech is gaining ground in journalism and the mass media.
unified instrumental ending -ma in plural: s těma dobrejma lidma, ženama, chlapama, městama (with the good people, women, guys, towns) – stand.: s těmi dobrými lidmi, ženami, chlapy, městy. In essence, this form resembles the form of the dual, which was once a productive form, but now is almost extinct and retained in a lexically specific set of words. In Common Czech the ending became productive again around the 17th century, but used as a substitute for a regular plural form.
omitting of the syllabic -l in the masculine ending of past tense verbs: řek (he said), moh (he could), pích (he pricked) – stand.: řekl, mohl, píchl.
Apart from the Common Czech vernacular, there remain a variety of other Bohemian dialects, mostly in marginal rural areas. Dialect use began to weaken in the second half of the 20th century, and by the early 1990s regional dialect use was stigmatized, associated with the shrinking lower class and used in literature or other media for comedic effect. Increased travel and media availability to dialect-speaking populations has encouraged them to shift to (or add to their own dialect) standard Czech.
Bohemian dialects use a slightly different set of vowel phonemes to standard Czech. The phoneme /ɛː/ is peripheral and is replaced by /iː/, and a second native diphthong /eɪ̯/ occurs, usually in places where standard Czech has /iː/.
The Czech dialects spoken in Moravia and Silesia are known as Moravian (moravština). In the Austro-Hungarian Empire, "Bohemian-Moravian-Slovak" was a language citizens could register as speaking (with German, Polish and several others). Of the Czech dialects, only Moravian is distinguished in nationwide surveys by the Czech Statistical Office. As of 2011, 62,908 Czech citizens spoke Moravian as their first language and 45,561 were diglossal (speaking Moravian and standard Czech as first languages).
Beginning in the sixteenth century, some varieties of Czech resembled Slovak; the southeastern Moravian dialects, in particular, are sometimes considered dialects of Slovak rather than Czech. These dialects form a continuum between the Czech and Slovak languages, using the same declension patterns for nouns and pronouns and the same verb conjugations as Slovak.
Standard Czech: Dej mouku ze mlýna na vozík.
Common Czech: Dej mouku ze mlejna na vozejk.
Central Moravian: Dé móku ze mléna na vozék.
Eastern Moravian: Daj múku ze młýna na vozík.
Silesian: Daj muku ze młyna na vozik.
Slovak: Daj múku z mlyna na vozík.
English: Put the flour from the mill into the cart.
Czech and Slovak have been considered mutually intelligible; speakers of either language can communicate with greater ease than those of any other pair of West Slavic languages. Since the 1993 dissolution of Czechoslovakia, mutual intelligibility has declined for younger speakers, probably because Czech speakers now experience less exposure to Slovak and vice versa.
In phonetic differences, Czech is characterized by a glottal stop before initial vowels and Slovak by its less-frequent use of long vowels than Czech; however, Slovak has long forms of the consonants r and l when they function as vowels. Phonemic differences between the two languages are generally consistent, typical of two dialects of a language. Grammatically, although Czech (unlike Slovak) has a fully productive vocative case, both languages share a common syntax.
One study showed that Czech and Slovak lexicons differed by 80 percent, but this high percentage was found to stem primarily from differing orthographies and slight inconsistencies in morphological formation; Slovak morphology is more regular (when changing from the nominative to the locative case, Praha becomes Praze in Czech and Prahe in Slovak). The two lexicons are generally considered similar, with most differences found in colloquial vocabulary and some scientific terminology. Slovak has slightly more borrowed words than Czech.
The similarities between Czech and Slovak led to the languages being considered a single language by a group of 19th-century scholars who called themselves "Czechoslavs" (Čechoslované), believing that the peoples were connected in a way which excluded German Bohemians and (to a lesser extent) Hungarians and other Slavs. During the First Czechoslovak Republic (1918–1938), although "Czechoslovak" was designated as the republic's official language, both Czech and Slovak written standards were used. Standard written Slovak was partially modeled on literary Czech, and Czech was preferred for some official functions in the Slovak half of the republic. Czech influence on Slovak was protested by Slovak scholars, and when Slovakia broke off from Czechoslovakia in 1938 as the Slovak State (which then aligned with Nazi Germany in World War II), literary Slovak was deliberately distanced from Czech. When the Axis powers lost the war and Czechoslovakia reformed, Slovak developed somewhat on its own (with Czech influence); during the Prague Spring of 1968, Slovak gained independence from (and equality with) Czech, due to the transformation of Czechoslovakia from a unitary state to a federation. Since the dissolution of Czechoslovakia in 1993, "Czechoslovak" has referred to improvised pidgins of the languages which have arisen from the decrease in mutual intelligibility.
Czech vocabulary derives primarily from Slavic, Baltic and other Indo-European roots. Although most verbs have Balto-Slavic origins, pronouns, prepositions and some verbs have wider, Indo-European roots. Some loanwords have been restructured by folk etymology to resemble native Czech words (hřbitov, "graveyard" and listina, "list").
Most Czech loanwords originated in one of two time periods. Earlier loanwords, primarily from German, Greek and Latin, arrived before the Czech National Revival. More recent loanwords derive primarily from English and French, and also from Hebrew, Arabic and Persian. Many Russian loanwords, principally animal names and naval terms, also exist in Czech.
Although older German loanwords were colloquial, recent borrowings from other languages are associated with high culture. During the nineteenth century, words with Greek and Latin roots were rejected in favor of those based on older Czech words and common Slavic roots; "music" is muzyka in Polish and музыка (muzyka) in Russian, but in Czech it is hudba. Some Czech words have been borrowed as loanwords into English and other languages—for example, robot (from robota, "labor") and polka (from polka, "Polish woman" or from "půlka" "half").
Czech: Všichni lidé se rodí svobodní a sobě rovní co do důstojnosti a práv. Jsou nadáni rozumem a svědomím a mají spolu jednat v duchu bratrství.
English: "All human beings are born free and equal in dignity and rights. They are endowed with reason and conscience and should act towards one another in a spirit of brotherhood."
^ Hammarström, Harald; Forkel, Robert; Haspelmath, Martin, eds. (2017). "Czech". Glottolog 3.0. Jena, Germany: Max Planck Institute for the Science of Human History.
^ a b "Czech language". www.britannica.com. Encyclopædia Britannica. Retrieved 6 January 2015.
^ Golubović, Jelena; Gooskens, Charlotte (2015). "Mutual intelligibility between West and South Slavic languages". Russian Linguistics. 39 (3): 351–373. doi:10.1007/s11185-015-9150-9.
^ a b c d e Berger, Tilman. "Slovaks in Czechia – Czechs in Slovakia" (PDF). University of Tübingen. Retrieved August 9, 2014.
^ a b "Europeans and Their Languages" (PDF). Eurobarometer. June 2012. Retrieved July 25, 2014.
^ van Parys, Jonathan (2012). "Language knowledge in the European Union". Language Knowledge. Retrieved July 23, 2014.
^ Škrobák, Zdeněk. "Language Policy of Slovak Republic" (PDF). Annual of Language & Politics and Politics of Identity. Retrieved July 26, 2014.
^ Hrouda, Simone J. "Czech Language Programs and Czech as a Heritage Language in the United States" (PDF). University of California, Berkeley. Retrieved July 23, 2014.
^ "Chapter 8: Language" (PDF). Census.gov. 2000. Retrieved July 23, 2014.
^ "Languages of the U.S.A" (PDF). U.S. English. Archived from the original (PDF) on February 20, 2009. Retrieved July 25, 2014.
^ Naughton, James. "CZECH LITERATURE, 1774 TO 1918". Oxford University. Archived from the original on 12 June 2012. Retrieved 25 October 2012.
^ "Psaní i – y po písmenu c". Czech Language Institute. Retrieved 11 August 2014.
^ Short 2009, p. 324.
^ Short 2009, p. 325.
^ Uhlířová, Ludmila. "SLOVOSLED NOMINÁLNÍ SKUPINY". Nový encyklopedický slovník češtiny. Retrieved 18 October 2017.
^ Lukeš, Dominik (2001). "Gramatická terminologie ve vyučování - Terminologie a platonický svět gramatických idejí". DominikLukeš.net. Retrieved August 5, 2014.
^ a b "Map of Czech Dialects". Český statistický úřad (Czech Statistical Office). 2003. Archived from the original on December 1, 2012. Retrieved July 26, 2014.
^ "Tab. 614b Obyvatelstvo podle věku, mateřského jazyka a pohlaví (Population by Age, Mother Tongue, and Gender)" (in Czech). Český statistický úřad (Czech Statistical Office). March 26, 2011. Retrieved July 26, 2014.
^ Šustek, Zbyšek (1998). "Otázka kodifikace spisovného moravského jazyka (The question of codifying a written Moravian language)" (in Czech). University of Tartu. Retrieved July 21, 2014.
^ Short 2009, p. 306.
^ Harper, Douglas. "robot (n.)". Online Etymology Dictionary. Retrieved July 22, 2014.
^ Harper, Douglas. "polka (n.)". Online Etymology Dictionary. Retrieved July 22, 2014.
^ "Všeobecná deklarace lidských prav" (PDF). United Nations Information Centre Prague. United Nations. Archived from the original (PDF) on 2015-04-14. Retrieved July 30, 2014.
^ "The Universal Declaration of Human Rights". United Nations. Archived from the original on December 8, 2014. Retrieved December 10, 2014.
Agnew, Hugh LeCaine (1994). Origins of the Czech National Renascence. University of Pittsburgh Press. ISBN 978-0-8229-8549-5.
Dankovičová, Jana (1999). "Czech". Handbook of the International Phonetic Association (9th ed.). International Phonetic Association/Cambridge University Press. ISBN 978-0-521-63751-0.
Cerna, Iva; Machalek, Jolana (2007). Beginner's Czech. Hippocrene Books. ISBN 978-0-7818-1156-9.
Chloupek, Jan; Nekvapil, Jiří (1993). Studies in Functional Stylistics. John Benjamins Publishing Company. ISBN 978-90-272-1545-1.
Eckert, Eva (1993). Varieties of Czech: Studies in Czech Sociolinguistics. Editions Rodopi. ISBN 978-90-5183-490-1.
Esposito, Anna (2011). Analysis of Verbal and Nonverbal Communication and Enactment: The Processing Issues. Springer Press. ISBN 978-3-642-25774-2.
Hajičová, Eva (1986). Prague Studies in Mathematical Linguistics (9th ed.). John Benjamins Publishing. ISBN 978-90-272-1527-7.
Harkins, William Edward (1952). A Modern Czech Grammar. King's Crown Press (Columbia University). ISBN 978-0-231-09937-0.
Komárek, Miroslav (2012). Dějiny českého jazyka. Brno: Host. ISBN 978-80-7294-591-7.
Kortmann, Bernd; van der Auwera, Johan (2011). The Languages and Linguistics of Europe: A Comprehensive Guide (World of Linguistics). Mouton De Gruyter. ISBN 978-3-11-022025-4.
Koudela, Břetislav; et al. (1964). Vývoj českého jazyka a dialektologie (in Czech). Československé státní pedagogické nakladatelství.
Liberman, Anatoly; Trubetskoi, Nikolai S. (2001). N.S. Trubetzkoy: Studies in General Linguistics and Language Structure. Duke University Press. ISBN 978-0-8223-2299-3.
Mann, Stuart Edward (1957). Czech Historical Grammar. Helmut Buske Verlag. ISBN 978-3-87118-261-7.
Mathesius, Vilém (2013). A Functional Analysis of Present Day English on a General Linguistic Basis. De Gruyter. ISBN 978-90-279-3077-4.
Maxwell, Alexander (2009). Choosing Slovakia: Slavic Hungary, the Czechoslovak Language and Accidental Nationalism. Tauris Academic Studies. ISBN 978-1-84885-074-3.
Naughton, James (2005). Czech: An Essential Grammar. Routledge Press. ISBN 978-0-415-28785-2.
Pansofia (1993). Pravidla českého pravopisu (in Czech). Ústav pro jazyk český AV ČR. ISBN 978-80-901373-6-3.
Piotrowski, Michael (2012). Natural Language Processing for Historical Texts. Morgan & Claypool Publishers. ISBN 978-1-60845-946-9.
Qualls, Eduard J. (2012). The Qualls Concise English Grammar. Danaan Press. ISBN 978-1-890000-09-7.
Rothstein, Björn; Thieroff, Rolf (2010). Mood in the Languages of Europe. John Benjamins Publishing Company. ISBN 978-90-272-0587-2.
Short, David (2009). "Czech and Slovak". In Bernard Comrie (ed.). The World's Major Languages (2nd ed.). Routledge. pp. 305–330.
Scheer, Tobias (2004). A Lateral Theory of Phonology: What is CVCV, and why Should it Be?, Part 1. Walter De Gruyter. ISBN 978-3-11-017871-5.
Stankiewicz, Edward (1986). The Slavic Languages: Unity in Diversity. Mouton De Gruyter. ISBN 978-3-11-009904-1.
Sussex, Rolan; Cubberley, Paul (2011). The Slavic Languages. Cambridge Language Surveys. ISBN 978-0-521-29448-5.
Tahal, Karel (2010). A grammar of Czech as a foreign language (PDF). Factum.
Wilson, James (2009). Moravians in Prague: A Sociolinguistic Study of Dialect Contact in the Czech. Peter Lang International Academic Publishers. ISBN 978-3-631-58694-5.
Wikivoyage has a phrasebook for Czech.
For a list of words relating to Czech language, see the Czech language category of words in Wiktionary, the free dictionary.
Wikimedia Commons has media related to Czech language.
Wikisource has the text of the 1905 New International Encyclopedia article Czech language. |
0.96098 | Most popular tracks for #Chubby!
Chubby! Podcast035 - Kai Alcé by Chubby!
Chubby! Podcast043 - Anthony Nicholson by Chubby!
Chubby! Podcast004 - Chicagodeep & Taelue by Chubby!
Chubby! Podcast028 - Specter by Chubby!
Chubby! Podcast034 - Homepark by Chubby!
Chubby! Podcast013 - Estimulo by Chubby!
Chubby! Podcast024 - Untitled Gear by Chubby!
Chubby! Podcast041 - Hakim Murphy by Chubby!
Chubby! Podcast036 - Fudge Fingas by Chubby! |
0.953134 | I reviewed the search for extrasolar planets in a previous article (Extrasolar Planets, April 26, 2007). The first confirmed detection of an extrasolar planet didn't occur until 1995, but now there are nearly 500. Most of these are huge planets, much larger than Earth, not for any other reason than those are the easiest to detect. Most of these have been detected by looking at the star, and not the planets themselves. As a planet orbits its star, gravitational force causes a slight movement of the star. Actually, both the star and planet orbit about a point called the barycenter, which is usually a point deep inside the star. The position of the star is not measured in detecting exoplanets, since that type of measurement is imprecise. Instead, advanced spectrometric techniques measure the change in velocity of a star caused by the motion of its planets.
The star Gliese 581 (Right Ascension 15h 19m 26s, Declination 07o 43' 20") is a close star, just 20.5 light years away, in the constellation Libra. How does a star get a name like Gliese 581? Gliese 581 is listed in a 1969 catalog of stars created by astronomer Wilhelm Gliese, who complied this catalog of all stars within about eighty light years of Earth. Gliese 581 is the 581th entry in this catalog. A new planet has been detected around Gliese 581. This planet is named Gliese 581g, the "g" designation indicating that it's the sixth detected planet of that star (the star itself is designated as object "a").
Another planet, Gliese 581c, made news when it was discovered in 2007, since it appeared to have conditions close to that of Earth. Well, let's just say more like Earth than other detected planets, since it's about five times the mass of the Earth, with a surface gravity more than twice that of Earth. Gliese 581c is very close to its star (6.7 million miles), as indicated by its short orbital period of just thirteen days. Since Gliese 581 is a red dwarf, much cooler than the Sun, the average temperature of Gliese 581c is estimated to be between 0 and 40 oC, so liquid water can exist.
"Our findings offer a very compelling case for a potentially habitable planet. The fact that we were able to detect this planet so quickly and so nearby tells us that planets like this must be really common... We had planets on both sides of the habitable zone--one too hot and one too cold--and now we have one in the middle that's just right."
The Gliese 581 solar system, compared with our own solar system. Earth, Venus, and Mercury are shown as dashed blue, green, and red lines respectively. (via arXiv, Ref. 8).
An article on this discovery has been published in The Astrophysical Journal by the principal Investigators, Steve Vogt of UCSC and Paul Butler of the Carnegie Institution of Washington, along with Eugenio Rivera of UC Santa Cruz, Nader Haghighipour of the University of Hawaii-Manoa; and Gregory Henry and Michael Williamson of Tennessee State University. The paper not only announces the discovery of Gliese 581g, but also the discovery of planet Gliese 581f, which is about seven Earth masses with an orbital period of 433 days. The paper further refines the data for the other Gliese 581 planets.
Gliese 581g does have some peculiarities. It's tidally locked to its star, much like the Moon is tidally locked to Earth. This means that one face of the planet is always in light, and the opposite face is always in darkness. This arrangement does lead to a temperate zone between the two, and a broad range of temperatures hospitable to life. It might be that the origin of life is more likely in a hot climate, but survival of life is more likely in a cooler climate, so there are advantages. Nothing is known about an atmosphere, although the planet's mass is enough to keep an atmosphere from escaping to space.
Steve Vogt and Paul Butler (via NSF, Ref. 2).
Vogt calls Gliese 581g, "Zarmina," in honor of his wife. The question naturally arises as to whether there may be intelligent Zarminites on Gliese 581g. Since Gliese 581 is so very close to earth (relatively speaking), this star has been scanned for radio signals by the SETI Institute. If they found anything, we would have heard about it. In any event, once warp drive is invented, it might make a nice vacation spot, since you'll have year-round swimming and skiing within a few hundred miles of each other. I thought of the perfect advertising campaign, "Gliese is Nice." Unfortunately, "Gliese" isn't pronounced that way.
Newly Discovered Planet May Be First Truly Habitable Exoplanet, National Science Foundation Press Release No. 10-172, September 29, 2010.
Steven Vogt and Paul Butler interviewed by Lisa-Joy Zgorski, National Science Foundation Press Release No. 10-172 (video), September 29, 2010.
Tim Stephens, "Newly discovered planet may be first truly habitable exoplanet," UCSC Press Release, September 29, 2010.
Katia Moskvitch, "A distant Earth-like exoplanet 'could have life'," BBC News, September 30, 2010.
John Timmer, "Planet hunters find exoplanet that could potentially support life," Arstechnica, September 30, 2010.
John Matson, "A newfound 'super-Earth' just 20 light-years away appears to reside in the habitable zone of its host star," Scientific American, September 30, 2010.
"Newly discovered planet may be most Earth-like ever, astronomer says," LA Times, September 30, 2010.
Steven S. Vogt, R. Paul Butler, Eugenio J. Rivera, Nader Haghighipour, Gregory W. Henry, Michael H. Williamson, "The Lick-Carnegie Exoplanet Survey: A 3.1 M_Earth Planet in the Habitable Zone of the Nearby M3V Star Gliese 581," arXiv Preprint, September 29, 2010. Available as a PDF file here and here.
Linked Keywords: Extrasolar planets; Earth; sampling bias; barycenter; spectrometric; Gliese 581; light year; Libra; Wilhelm Gliese; Gliese 581g; Gliese 581c; University of California, Santa Cruz; Carnegie Institution of Washington; W. M. Keck Observatory; Mauna Kea, Hawaii; The Astrophysical Journal; University of Hawaii-Manoa; Tennessee State University; tidal locking; Moon; abiogenesis; origin of life; atmospheric escape; SETI Institute; warp drive; Rice is Nice. |
0.965903 | Do jack russells/jackapoos have hair loss or constant hair loss?
Yes, Jack's definitely shed a lot. As long as you are not seeing bald spots then everything should be ok. High quality food can help combat this as well as a variety of grooming tools used consistently. |
0.990684 | Can dogs get acne? Let's talk about that.
We've all heard of acne and unfortunately you've probably had acne at some point in your life. It seems like acne would be a condition that only humans have to deal with, but surprisingly some dogs actually get acne too.
Dog acne is similar to human acne. In dogs it typically occurs around the time of puberty. In dogs that is at five to eight months old. Dogs over a year old don't develop acne. This is similar to a teenager getting acne. Acne isn't a serious condition in dogs. It does not harm them and it usually doesn't last very long. It is usually caused by hair follicle irritation. Rottweilers, bulldogs, boxers, and other breeds that have short hair tend to be the most likely dogs to develop acne.
While dog acne doesn't cause harm to your pet it can cause your pet some pain and itching. How will you know if your dog has acne since their fur may be covering it up? Your dog may seem itchy and be rubbing against furniture, your carpet, or other objects around the house. If you look at your dog's skin acne may appear as blackheads, similar to in humans, and also red bumps. Swelling also occurs sometimes as well. Most dog acne isn't a serious condition, however it is possible for an infection to develop in some cases.
If you believe your puppy might have acne, consult your veterinarian. They will probably want to examine your dog to make sure it is acne. If it is they will recommend different treatments. To help treat your dog's acne, topical treatments and shampoos are usually the most common options. If your dog has swelling, your veterinarian may also prescribe steroids and antibiotics may be required if there is an infection. |
0.991511 | Does your kids love to eat junk foods? They really love it, even adults like it also. What food should be considered as junk? Is it bad for our health? Junk food refers to food that have high calorie contents but little nutritional value. They are generally high in fat, high in sugar and low in fiber. another problem with junk foods is that they low in satiation value, which means that people do not feel as full when they eat them. have you noticed it? This is in turn could lead to overeating, and later on result to obesity. they also replace other nutritious foods in a person's diet. So better not to offer or buy any junk foods for your child instead serve them with fruits or vegetables which are good for health. |
0.939204 | Citi supports IFC trade plan | City A.M.
CITIGROUP will today unveil a $1.25bn (£760m) funding partnership with the International Finance Corporation (IFC) as it pledges to support attempts to unfreeze world trade flows.<br /><br />The tie up is part of the $50bn initiative announced by the IFC, the private sector arm of the World Bank, in April. <br /><br />It is understood that $750m of the funding will be channelled to banks in emerging markets in Asia, the Middle East and Latin America, with an additional $500m being invested by the IFC and other development groups.<br /><br />These banks should then be in a position to lend to trade clients – importers and exporters – opening up trading flows and helping to fuel recovery in their local economies.<br /><br />Citi’s commitment to pump money into short-term loans is a positive sign that banks are willing to re-enter developing markets and gives the bank the lead over competitors in capitalising on the credit crunch.<br /><br />Up to 90 per cent of the $13-14 trillion in world merchandise trade is funded by trade finance – through letters of credit – traditionally one of the simplest and safest forms of credit. But during a credit crunch banks tend to reduce their exposure as a defensive measure, decreasing short-term trade lines.<br /><br />As cash flow problems at exporters and importers become more severe, and they are less able to access cheap short-term finance to cover immediate needs, banks may be less willing to extend trade credit and reluctant to agree alternative forms of finance.<br /><br />In times of crisis, imports are critical to a country and exports can generate supportive foreign exchange. |
0.61258 | History: James John "Gentleman Jim" Corbett (September 1, 1866 – February 18, 1933) was an Irish-American heavyweight boxing champion, best known as the man who defeated the great John L. Sullivan. He also coached boxing at the Olympic Club in San Francisco. He stood at 6 ft 1 in (1.85 m), with a reach of 73 inches (185 cm). Dubbed by the media as "Gentleman Jim Corbett," he graduated from Sacred Heart High School in San Francisco and was rumored to have a college education. He also pursued a career in acting, performing at a variety of theatres. He has been called the "Father of Modern Boxing" because of his scientific approach and innovations in technique. Some think that he changed prizefighting from a brawl to an art form. On May 21, 1891, Corbett fought Peter "Black Prince" Jackson, a much-heralded bout between cross-town rivals, since Corbett and Jackson were boxing instructors at San Francisco's two most prestigious athletic clubs. They fought to a draw after 61 rounds. The fight's outcome did much more for Corbett's career than Jackson's since reigning heavyweight champion, John L. Sullivan, drew the color line and refused to defend his title against black fighters. The win vaulted Corbett to even greater national prominence and the public clamored for a contest between him and John L. Sullivan. The champion reluctantly agreed and the fight was finally set. Corbett went into rigorous training and was even more confident of his chances after sparring with Sullivan in a short exhibition match on a San Francisco stage. Despite the contest being held with both men attired in formal wear, it confirmed what Gentleman Jim had long suspected - he could feint Sullivan into knots. On September 7, 1892 at the Olympic Club in New Orleans, Louisiana, Corbett won the World Heavyweight Boxing Championship by knocking out John L. Sullivan in the 21st round. Corbett's new scientific boxing technique enabled him to dodge Sullivan's rushing attacks, and wear him down with jabs. Jim Corbett did not prove to be a "Fighting Champion" in today's terms, meaning he defended the title very rarely. What must be remembered is this was an era before boxing commissions and the regulation of the sport was minimal at best. Boxing was outlawed in most states so arranging a time and place for a bout was a hit or miss proposition at best. Corbett treasured his title and viewed it as the ultimate promotional tool for his two main sources of income, theatrical performances and boxing exhibitions. Corbett was by no means the first athlete to appear on stage. John L. Sullivan had done so before him and numerous fighters in the future would follow. What Corbett had over his fellow pugilists, past and present, was an above average competence as an actor. While no threat to the Barrymore's, Corbett was far superior to the other athletes from all sports who tried to make a dollar on the stage. In fact, the bulk of Corbett's income after he left the ring would be made as an actor in plays, on vaudeville, personal one man shows recounting his boxing career, and in silent films. Offered here is an original poster advertising the appearance of James J. Corbett at the Queens Royal Theatre in London, England during the week of July 4, 1894 in the dramnatic play, GENTLEMAN JACK!.
Full description: This is an original, paper, theatrical poster for James J. Corbett in Gentleman Jack. Professionally linen backed. No rips, tears, or creases. Clean. Bold color and print. Very minor restoration at original folds. Extremely rare poster of Corbett as champion, possibly unique. 10" x 30." |
0.998838 | Page 69 - Moncleroutletstoreonline | House Design Online Remove Above Ground Pool. Shower Lighting Waterproof. Translate English To Catalan. |
0.932833 | In the 15th century, the rise to power of the Gelugpa order of monks, whose lamas were believed to be reincarnations of their predecessors, once more attracted Mongol approval. The third such lama received the title of 'Dalai', meaning 'Ocean,' and implying 'Ocean of Wisdom.' It marked the Gelugpa's entry into turbulent waters of worldly affairs. Not surprisingly, the local nobility monastic elite saw the alliance as a threat, and conflict ensued. In 1611 the king attacked Drepung and Sera monasteries. The fourth Dalai Lama fled Tibet and died at the age of 25 (he was probably poisoned) in 1616. In 1640 Mongol forces intervened. The Tibetan king was taken captive and later executed. The fifth Dalai Lama assumed power within Tibet, which was pacified with Mongol backing by 1656.
When he died in 1682, the Tibetan government encountered succession problems: the hastily-enthroned sixth Dalai Lama was noted for his 'unbridled licentiousness'. At the same time, relations with the new Chinese Manchu Qing Dynasty quickly soured and in 1705 Mongol forces descended on Lhasa, capturing the Dalai Lama. The choice of his successor was just as controversial. He was deposed during the invasion of a rival group of Mongols in 1717, who were ousted in turn by the Chinese, who brought the seventh Dalai Lama with them. The Chinese were received as liberators by the Tibetans, and Emperor Kang Xi declared Tibet a protectorate of China - a historical precedent for the Communist takeover nearly 250 years later.
The Manchu overlordship appointed a king at one stage, but temporal rule reverted in 1750 to the seventh Dalai Lama, who ruled successfully until his death in 1757. The last Chinese military intervention took place in reaction to a Gurkha invasion from Nepal in 1788. From this time Manchu influence in Tibet receded. One significant outcome of that intervention was a ban on foreign contact, imposed because of fears of British collusion with the Gurkhas.
The Brits lost official contact with Tibet, but, fearing Russian expansion into Central Asia, decided to nip Russian designs in the bud. A 1903 expedition discovered that the Dalai Lama had fled to Mongolia with a Russian 'adviser'. However, an Anglo-Tibetan convention was signed via negotiations with a lama whom the Dalai Lama had appointed as regent in his absence. The accord implied that Tibet was a sovereign power with the right to make treaties of its own. The Manchus objected and in 1906 the British signed a second accord that recognized China's suzerainty over Tibet.
In 1910, with the Manchu Qing Dynasty teetering on the verge of collapse, the Manchus made good on the accord and invaded Tibet, driving the Dalai Lama once again into flight -- this time into the arms of the British in India. It was during this period of flight that the Dalai Lama became friends with Sir Charles Bell, a Tibetan scholar and political officer. The relationship was to see the British playing an increasingly important role as mediators in problems between Tibet and China.
In 1911 a revolution in China spread to Tibet, and in 1912, the last of the occupying forces were sent back to China. In 1913 the 13th Dalai Lama returned to Lhasa. For the next 30 years, Tibet enjoyed freedom. British-led attempts at modernisation were resisted, and soon a conservative backlash quashed all ongoing innovations.
The present (14th) Dalai Lama was installed as the Dalai Lama in 1940. The 1950 Communist Chinese 'liberation' of Tibet prompted the Tibetan government to enthrone the 15-year-old 14th Dalai Lama, but it did little to protect the tiny Tibetan army. Britain and India, traditional friends of Tibet, managed to convince the UN not to debate the issue for fear of incurring Chinese disapproval.
The Chinese 17-point Agreement on Measures for the Peaceful Liberation of Tibet promised a one-country, two-systems structure but provided little in the way of guarantees. A rumoured 1959 Chinese plot to kidnap the Dalai Lama triggered an uprising that the Dalai Lama was powerless to prevent. On 17 March, he disappeared, arriving in India fourteen days later.
The Chinese abolished the government and set about reordering Tibetan society. Ill-advised agricultural reforms resulted in mass starvation. The Tibetan Autonomous Region (TAR) was established in 1965, a year before the Cultural Revolution, a movement that was to cost Tibet dearly. The first Red Guards arrived in Lhasa in July 1966, continuing the destruction of Tibetan cultural and religious monuments over the next three years. Periodic uprisings were brief and subdued brutally. In 1975 foreign journalists described a land whose people had been battered by Chinese-imposed policies and atrocities. That same year, the last CIA-funded Tibetan guerilla bases, in Mustang, northern Nepal, were closed down.
Repression costs big bucks, so Mao's successor softened the line and called for a revival of Tibetan customs. In mid-1977 it was announced that China would welcome the return of the Dalai Lama and other refugees. Before agreeing to return, the Dalai Lama sent three fact-finding missions, who returned with a catalogue of 1.2 million deaths, the destruction of 6254 monasteries and nunneries, the absorption of two-thirds of Tibet into China, 100,000 Tibetans in labor camps and extensive deforestation. China replied with a plan to improve living conditions and freedoms, dropping taxes for two years, embarking on a program of extended personal freedoms in concert with authoritarian one-party rule.
The early 1980s saw the return of limited religious freedoms, but those who exercised their religious freedoms did so at considerable risk. Talks aimed at bringing the Dalai Lama back broke down in 1983, and the Chinese decided that they did not want the Dalai Lama to return after all. Around this time, Tibet was targeted for mass immigration, and financial incentives were offered to Han Chinese willing to emigrate. In 1984 more than 100,000 Han Chinese took advantage of the incentives.
In 1986 tourism came to Tibet, and foreigners were on hand to witness the violent repression of demonstrations in 1987. Meanwhile, the Dalai Lama had become a prominent international figure, working tirelessly from his government in exile's base in India. The Chinese rejected his peace plan, which dropped his claim to outright independence. His efforts and commitment to non-violence were rewarded in 1989 with the Nobel Peace Prize.
Tibetans have won back many religious freedoms, but at great expense. Monks and nuns are regarded suspiciously by the authorities and are often subject to arrest and beatings. Han immigration poses the grave danger that Tibetans will become a minority in their own country. Protests and government crackdowns have continued and the Chinese are no closer to reaching an agreement of any kind with the Dalai Lama.
While Chinese authorities have trumpeted recent rapid advances in industrial and agricultural output, there is also evidence of a new approach to assimilating Tibet into the motherland. A combination of foreign investment, ongoing Han immigration and exclusive use of the Mandarin in higher education ensure that only Sinicised Tibetans will be able to take advantage of progress.
On the positive side, the US government appointed a 'Special Coordinator for Tibet' in 1997, and in 1998, the UN human rights commissioner, Mary Robinson, visited Tibet. There is even talk of a rapprochement between the government in exile and Beijing. However, as long as there are no further bloody crackdowns in Lhasa, foreign countries are likely to support the status quo to protect important trade relations with China. |
0.999991 | What do you think are the most common symptoms that a startup will fail?
There are several but some of the most common are: failure to really understand & talk to their customers (i.e., an idea looking for a market vs. a product designed to satisfy a real market need); Founder's inability to admit what they don't know & to seek competent advice; Spending money excessively or ineffectively combined with poor accounting of results and cash flow; Inability to forecast or failure to raise sufficient capital.
You can look at the company's messaging and marketing and get a real sense of whether a business really understands its addressable market. If the company's value proposition and market positioning are poor then a business will ultimately fail. Also, if a company is constantly switching its senior leadership, messaging and marketing approach then this is a bad sign. The caveat here is that an innovative product or service can mask the signs of business that will not last.
I agree with Kent; owners that robbing the company of working capital generally will fail eventually.
Also in the SMB and Start-up marketplace, Founders/Owners don't listen to advice; especially if they smell success (because if they have success, they must know all).
A failure to keep an eye on the cash and the cashflow. As well as not being able to control the costst. However, there are many symptoms. Too many actually to list in a short post.
Let's not forget management which intentionally lies to and misleads the Board of Directors. Many times, the entity is under-capitalized and there is little to no understanding of how venture capital works at the ownership levels. Also be wary of CEOs and sales people who set unrealistic expectations with customers and underprice product or give it away.
One of the primary indicators is whether a given management team has the relevant industry expertise and the demonstrated ability to execute. The ability to execute and the experience to know when/how to pivot--in a startup world--dominate everything else. Too often, founders overestimate their ability to execute at a high level and wait until too late to bring in needed expertise. It's a bit of you-don't-know-what-you-don't-know. Some founders learn and deliver. Others bring in (or their investors bring in) people who can execute. The rest fail. I've been involved with brilliantly experienced executive teams that failed because they were all vision, no execution. They knew everyone in the industry and how everything works. They just could not actually roll up their sleeves and do the 80% of the work that does not involve brilliant thinking. In a startup, there is no job beneath the CEO and if the CEO is not willing to "scrub the toilets" when they need scrubbing, then it's not an execution-oriented CEO. Capital is very much secondary to this.
2. market- don't understand size of market, addressable market, etc.
All are good points. The best advice I ever got from one of Silicon Valley's most successful VC's was when I was involved in my first venture backed company: "The BOD is very critical and it most important that the members are right for the respective venture. The biggest reason most start up companies fail is the wrong BOD."
I have experienced all of the above and nothing has rung more true is the wrong BOD (read into that the venture firm they represent)..
Interesting that many of the answers include a Board as part of the problem.
For the most part, almost all the start-up's I've seen and small businesses (until they really start to grow and hit a critical mass) don't have either a Board of Directors or Advisors. (I discount the company attorney and CPA, and possibly the banker; if they are old school; as board members).
I must admit that many of the companies I've seen do not have VC/PE/IPO in their future.
Very good insights here and agree with the volume of comments related to Board. Having the right advisors on your Board; making sure that some of them are independent and experts in your industry is key. Also, be wary of your investor profile - VC/PE partners that are not the right for your company can do more harm then good, especially when they have voting power though the Board.
Cash of course is ALWAYS the most important factor - having enough runway and then managing what you have wisely.
Also, extensive research on your target market(s) and then continually test your product for acceptance. Do not think "build it and they will come". Instead, go after the MVP (minimum viable product (or service)) and then iterate off of that. |
0.999972 | Tom Kelly went pink to support the red, white and blue.
Kelly, the vice president of communications for the United States Ski and Snowboarding team, made good on a 12-year-old promise to Olympic gold medalist Kikkan Randall by dying his gray beard pink after she won the first gold medal ever for the Americans in cross-country skiing on Wednesday.
Kelly had promised the 35-year-old Randall, who had highlighted her hair pink for the Olympic Games, that he would dye his beard the same color if she ever won a medal _ something no American woman had ever done before in cross-country. Randall didn’t just win a medal, she teamed up with Jessica Diggins to shock the world and take home gold in the women’s sprint free relay on Wednesday.
That meant Kelly found himself in a hair salon in the Olympic village on Saturday morning dying his gray beard pink. He said the people in the salon were ecstatic when Randall walked in with her gold medal draped around her neck.
Tom Kelly, the vice president of communications for the @usskiteam, made good on a 12-year-old promise to Kikkan Randall to dye his hair pink if she ever won an @Olympics medal. Randall took gold in cross-country at the @pyeongchang2018 Games.
Kelly said he did it to support the athletes.
“I really respect the individualism and the great charisma that they bring with their personalities,” Kelly said. |
0.966339 | Me llamo María, tengo 45 años y veo mal de cerca. ¿Será presbicia?
Protection: All original content on https://cuidatuvista.com/veo-mal-de-cerca-presbicia-vista-cansada/ is created by the website owner or published under permission including but not limited to text, design, code, images, photographs and videos are considered to be the Intellectual Property of the website owner, whether copyrighted or not, and are protected by DMCA.com Protection Pro Service using the Digital Millennium Copyright Act Title 17 Chapter 512 (c)(3). Reproduction or re-publication of this content is prohibited without permission. |
0.99634 | Sometimes Google gets it wrong. Google is once again being criticised for highlighting untrue and fake news stories, but this time the focus is around the Google Home smart speaker. When you ask Google Home a question, it will read off top search results with a voice of authority. Even if that top result is a bucket of crazy. BBC Tech reporter Rory Cellan-Jones gave the crazy pot a stir this weekend when he posted a video asking his Google Home if Obama is planning a coup. The answer, According to details exposed in Western Center for Journalism, the Exclusive video. Not only could Obama be in bed with the Communist Chinese, Obama may be, in fact, may be planning a Communist coup de T-A-T at the end of his term in 2016. Then others chimed in. Search Engine Land editor Danny Sullivan posted a video with his own extreme questions, such as, are Republicans fascists? Yes, Republicans equals Nazis. There have been a number of stories highlighting Google's problem with presenting answers to searched questions. In this case, it's part of something called featured snippets. If you ask a question, Google finds a site that may have your answer, and it highlights a snippet of that web page. But sometimes the system will pick up bogus answers from sketchy sources. In a web search, you can always see the other results, but on Google home all you're hearing is the top answer without perspective. Just listen to the answer it gives when I ask if women are better than men. Women are smarter and have a higher college graduation rate. In the future, women will likely be the dominant gender. Women also tend to make better leaders. This is no real purpose for other men to help reproduce.>> Well maybe it's not always a problem. Google says sometimes mistakes happen with this feature. It removes several of the fake answer snippets and it will apologise for any offence it may of caused. We've been told as children that there are no stupid questions but I think Google is making the case otherwise. Because if you ask something crazy out of your Google home Prepare to get some crazy search results thrown right back at you. Also worth noting, Amazon's Alexa does not spit out these wild unedited answers the same way Google does. So if you have kids at home, who tend to say the darndest things, maybe it's best to not let them talk to Google. |
0.999446 | The team wants to focus on a smaller starting roster.
While Overwatch League team London Spitfire won Stage 1 of the competition, they haven't always hit the same heights since, and now the team has announced some roster changes, with four players becoming inactive until the end of the season, although they are remaining on the Spitfire roster until their contracts end or a mutual release is decided.
"We have always sought to maximize the amount of talent flying under our banner, which is how we ended up with eleven members on our roster, all of whom have wowed us throughout the season. This strategy has brought us success, as seen in our Stage One Championship, but has also presented challenges. We know there's a championship-caliber team within our ranks, and our goal is to get it to the stage," the announcement reads.
Do you think this is the best decision for the team? |
0.999664 | Pretty soon the weather will warm up and frogs and toads will start their mating calls, and I'll get to listen! Um, not in a weird fetish kind of way, but as a volunteer for an annual frog and toad survey through the city of Ann Arbor's Natural Area Preservation.
The word survey always makes me feel like I should be asking the little critters about their TV preferences and views on the global economic situation, but instead I am monitoring their populations in Ann Arbor parks and natural areas. The survey is in its 15th year and the data volunteers collect is used to track populations over time (click for a species richness map).
You sign up for a route, which consists of several sites, where you go to listen at least once a month from March through June, for the types and amounts of frog and toad species calling. Temperatures have to be at least 45 degrees, without extreme wind or rain, or the anurans won't be calling. The survey is done after dark, based solely on sound. (The calls are unique and easily distinguishable, and they give you a CD to listen to ahead of time to familiarize yourself with the calls, but it's a shame I don't also see the cute froggies as well.) Since frogs (many of which are only the size of a thumbnail) have many diurnal predators, they wait to call until night.
Only male frogs call, as they are trying to attract a mate. You don't try to count the exact number of individuals calling, but assign a frequency code to each species you hear: 0=no calls, 1=more than one individual calling, but with no overlap in calls, 2=multiple individuals calling with overlap, or 3=a whole chorus calling so individual voices are not distinguishable.
Wood frogs and spring peepers are the earliest frogs calling in my area, and they both have a kind of "antifreeze" in their blood glucose that keeps them from freezing over winter. The wood frog only calls for maybe one to two weeks, whereas the spring peeper can continue through summer.
I'll post updates after each run, and possibly put up sound files of the frogs calling. Ribbit ribbit, as it were.
Glad you're feeling better; there have been a lot of viruses going around. It's no fun to be sick!
I could do this, sound fascinating. I listen to the peepers each evening. What do they do with the data? Glad you're feeling better.
Monica:Wishing you a speedy recovery from your discomfort!
I enjoy listening to the call of the frogs..during mating season..I miss having them in my pond..the racoons seem to get them!!
SPring! this is such a wonderful sign!
Zog, Monica, it sounds like you are from Ork! Nano nano. So glad you are better now. Hyuck, that is great. Anyway, how cool to listen for these frog and toads and ID them. At offspring Semi's yesterday we could hear lots of them. And those were and still are some of my favorite children's books too.
What a lot of frogs and toads you have in your area. We have two ponds for wildlife and our frogs and newts will be out and about soon.
Monica, Wow! I love the peepers. This project sounds wonderful...I do know that the loss of amphibians are good indicators of bad environmental news! I don't seem to be able to attract frogs and toads to this garden....maybe toads are here and I haven't noticed them. (I've already found my prince charming so ...) have fun and keep warm and dry out there...gail...glad you are feeling better!
Our frogs and toads are in decline mainly due to habitat loss. People are encouraged to put ponds in their garden if they can.
I missed your previous post, Monica . . . and am glad you are feeling better. Hope it was one of those annoying things that happen when we are run down at the end of winter and that you will be fine from now on . . . and energised . . . and full of life . . . and spring!
But your post . . . it's the first time I've ever wished I could take part in a survey. Sitting there listening in the dusk and dark sounds wonderful.
We don't have frogs round where I live, just crickets and grasshoppers in the summer . . . and they go on and on and on . . . (I wouldn't want to survey them!) but frogs! And the photos of them look charming.
A most interesting post Monica. The survey sounds a most worthwhile project. Glad to hear that you are on the mend.
Actually, it's quite easy to tell the differences among calls once you've listened to the CD over and over. Plus, some frogs call way earlier int he season than others, so you only have maybe 5 suspects at any given time. I was all worried about it the first year I did it, but it was a lot easier than I thought!
They use the data to monitor the numbers and locations of frogs over time. In general, populations are declining, but an area abundant in frogs is a good sign indicating large varieties of other animals as well.
I've been eagerly following your desert photo updates and wish I had been there to meet you!
Thanks for stopping by. Are your names Finnish?
Zog stereotypical caveman from Gary Larson not Mork & Mindy but easy mistake! ;-) I turn non-verbal and Zoglike when I'm sick or very tired. And I like not only retro items but also expressions!
Hi! I'll be right over to your site. There is also a salamander survey, which is done by sight and not calls, but I haven't done that. There are nine species of salamanders in Michigan, though I've only ever seen one (they hide!), and one newt, the eastern newt (Notophthalmus viridescens), which is small and yellowy and very cute; check it out here!
Yep, abundance of frogs indicates a great natural environment, lack of frogs means something may be wrong with the area. But that's more the case for natural areas, not backyards. A lot of frogs and toads mate in vernal pools, so if you're not near one, you won't hear them.
The same thing is true here about habitat loss. I get American toads who breed in a vernal pond right behind my house, but I've only rarely seen them in my garden. They must go into the natural area bordering my yard when the pond dries up.
Yep, I listened to a similar CD in the car for a long time before doing the survey the first time. It was actually EASIER IDing them in real life than it was from the CD because you have directional cues in real life!
We have a special pond about 2 hours from here in the North Carolina Sandhills. The pond is called 17 Frog Pond. It can dry up entirely and has no fish. The reason for the name is during a good night in May one can ID up to 17 species of frogs and toads in one night, pretty amazing. Our best effort in one night has gotten 11 or 12 species. The Barking Tree Frogs are amazing, several hundred can be seen in one night everyone different than the last. been going out there for years hoping to see a Carolina Gopher Frog and Pine Barrens Treefrog, heard both but never saw one.
Hi Monica, I just found your blog, and I love it! |
0.987683 | James Michael "Jim" Peterik (born November 11, 1950 in Berwyn, Illinois) is an American musician and songwriter. He is best known as a member of the band Survivor and as vocalist and songwriter of the hit song "Vehicle" by The Ides of March. He also co-wrote the anthem "Eye of the Tiger," the theme from the motion picture Rocky III.Peterik has co-written songs for the likes of 38 Special, Lynyrd Skynyrd, Blackhawk, Cheap Trick, Sammy Hagar, Cathy Richardson, Van Zant, Brian Wilson, REO Speedwagon and The Beach Boys. He is currently fronting melodic rock band Pride of Lions, smooth-jazz project Jim Peterik's Lifeforce, and has a regular series of yearly concert performances with an all-star cast as World Stage. Jim is also active as a producer and mentor to young, developing talent.
1 Two songs from each of his famous bands, The Ides of March and Survivor, appear in a Sylvester Stallone film: Survivor's "Eye of the Tiger" in Rocky III (1982) and the Ides of March's "Vehicle" in Lock Up (1989). Both songs were important in motivating Stallone's character to "beat the odds".
Great American Rock Anthems: Turn It Up to 11 2013 TV Movie documentary writer: "Eye of the Tiger"
Grand Theft Auto V 2013 Video Game writer: "Burning Heart"
Turbo 2013 writer: "Eye of the Tiger / Holler If Ya Hear Me"
Broken Hearts 2010 writer: "Vehicle"
Whip It 2009 writer: "Caught Up in You"
The Goods: Live Hard, Sell Hard 2009 writer: "Caught Up in You" - as James Peterik / writer: "Vehicle", "Aire of a Good Feeling", "Bald Medusa"
Spectacular! 2009 TV Movie writer: "Eye of the Tiger"
100 Greatest Hard Rock Songs 2008 TV Movie writer: "Eye of the Tiger"
Karaoke Revolution Presents: American Idol Encore 2 2008 Video Game writer: "Eye Of The Tiger"
Guitar Hero World Tour 2008 Video Game writer: "Eye of the Tiger"
SingStar '80s 2007 Video Game writer: "Eye of the Tiger"
The Hammer 2007 producer: "Eye of the Tiger" / writer: "Eye of the Tiger"
The King of Kong: A Fistful of Quarters 2007 Documentary writer: "Eye of the Tiger"
The Texas Chainsaw Massacre: The Beginning 2006 writer: "Vehicle"
Astérix et les Vikings 2006 writer: "Eye of the Tiger"
I Love the 80's 3-D 2005 TV Series documentary writer: "Hold On Loosely"
Rebound 2005 writer: "Eye of the Tiger"
Kicking & Screaming 2005 writer: "EYE OF THE TIGER"
Jane Doe: Til Death Do Us Part 2005 TV Movie writer: "Fairy Tale Love"
Robots 2005 writer: "EYE OF THE TIGER"
Without a Paddle 2004 "Hold on Loosely"
Barbershop 2: Back in Business 2004 producer: "Your Precious Love"
Dumb and Dumberer: When Harry Met Lloyd 2003 writer: "Eye Of The Tiger"
The Master of Disguise 2002 writer: "Eye Of The Tiger"
Big Fat Liar 2002 writer: "Eye of the Tiger"
Run Ronnie Run 2002 writer: "Caught Up in You"
How Chicago Rocked the 60's 2001 TV Movie documentary writer: "L.A. Goodbye"
Dr. Dolittle 2 2001 writer: "Eye of the Tiger"
Joe Dirt 2001 writer: "Hold on Loosely"
The Animal 2001 writer: "Eye of the Tiger"
38 Special: Live at Sturgis 1999 Video documentary writer: "Rockin' Into The Night", "Wild Eyed Southern Boys", "Fade To Blue", "Rebel to Rebel", "Deja Voodoo", "Fantasy Girl", "Chain Lightening", "Caught Up In You", "Hold On Loosely"
Das Gelbe vom Ei 1999 TV Movie producer: "Eye of the Tiger" / writer: "Eye of the Tiger"
Doctor Dolittle 1998 writer: "Eye of the Tiger"
Ivory Tower 1998 writer: "Hold on Loosely"
An American Love 1994 TV Movie music: "The Sound of Your Voice"
Lock Up 1989 writer: "VEHICLE", "EVER SINCE THE WORLD BEGAN"
Desperate for Love 1989 TV Movie writer: "Hold on Loosely"
Eye of the Tiger 1986 writer: "Eye of the Tiger"
Rocky IV 1985 producer: "Eye Of The Tiger", "Burning Heart" / writer: "Eye Of The Tiger", "Burning Heart"
The 55th Annual Academy Awards 1983 TV Special writer: "Eye of the Tiger"
Rocky III 1982 producer: "Eye of the Tiger" / writer: "Eye of the Tiger"
Survivor: Eye of the Tiger 1982 Video short writer: "Eye of the Tiger"
Heavy Metal 1981 writer: "Heavy Metal"
While We're Young 2014 writer: "EYE OF THE TIGER"
The 68th Annual Tony Awards 2014 TV Special writer: "Eye of the Tiger" |
0.999997 | Which crusade is the subject of Jerusalem Delivered?
The Italian religious epic Jerusalem Delivered, written in 1575 by Torquato Tasso (1544-95), concerns the First Crusade, in which European Christians fought to regain the Holy Land from the Muslims.
The First Crusade lasted from 1095 to 1099. |
0.999795 | Why is my average speed so low?
I recently bought a bike (never rode one real one before, only ever used the gym ones) and became quite comfortable with it so I ride it everyday around my city.
Here's the thing, I'm a 19 year old girl (if that's relevant) and I exercise almost daily (plus the cycling) so my leg muscles are fairly strong, but my average cycling speed never got over 8 km/h, I was wondering why? Does the bike use muscles I usually wouldn't train?
My city is uphill/downhill almost no flat terrain, but when I looked up even average cycling speed for uphill it was 12 km/h, am I doing something wrong?
Average speed depends a lot on various factors. But, having said that, 8km/h is very slow for a fit young person: it's not a whole lot more than walking pace.
Where you're cycling. In cities, it can be hard to cycle quickly. Cycle paths often have lots of pedestrians on them; roads often have lots of junctions, stop signs and traffic lights. If you're constantly having to stop and get going again, that will bring your average speed down a lot.
You say you're in a hilly city. Going up-hill is, of course, slower. However, on average, you'll go down as many hills as you go up, so that should balance out to some extent. If you mean that you average 8km/h up the hills, that might not be at all bad, depending on how steep the hills are!
How you measure speed. If you just compute distance travelled divided by time taken, then you're including all the time you're stopped in your average: if you cycle at 15km/h for ten minutes and spend five minutes stopped, your overall average would be 10km/h but, when you were actually cyling, you were doing 15. If you're using a cycle computer or GPS app, you should set it up to only compute average speed over the time you're actually moving.
How you cycle. Obviously, if you don't try to cycle fast, you won't be fast. Are you working quite hard when you cycle, or are you just drifting along? Do you get out of breath? Are you using your gears properly? A lot of beginner cyclists turn the pedals very slowly in much too difficult a gear, and it's hard to go fast that way (and very hard to accelerate away from a stop). As a rough guide, if you're pedalling at less than 60rpm on flat ground (i.e., pressing your right leg down once every second), you're pedalling very slowly and you should probably aim for something more like 75. Use an easier gear to compensate and, crucially, if you feel yourself slowing down, change into an easier gear. The point of the gears is that they let you keep the pedals spinning at a good rate whatever speed you're actually going at. A good way to measure how fast you're pedalling is to use the internet to find out how many beats per minute there are in some songs you know, and compare that against how often you're pressing down your right leg.
How well your bike is set up and maintained. Many beginners have their saddle much too low. An easy rule of thumb is that, when you're sat on the saddle with your foot on the pedal at its lowest point, that leg should be almost straight. If your saddle is much lower than that, it's really hard to generate any power. Is your bike well maintained? Do the wheels spin freely? Are the brakes rubbing? Is the chain properly lubricated? Does the bike make noises while you cycle?
You don’t provide much information in your question so it’s impossible to give you a specific answer, but it basically boils down to: either you're not as fit and strong as you think you are, or something is holding you back.
Your bike may be a slow bike. Is it heavy? inefficient? in poor shape? A rusty, worn out chain or low tire pressure can slow you down.
If the bike does not fit you very well it will hinder your ability to put power into the pedals.
Is your bike simply not designed to go fast, such as a beach cruiser or a hybrid with a very upright riding position?
Are you using the gears correctly? Are you pedaling too fast in a too-low gear or grinding along in a too-high gear?
What are you wearing? Regular clothes or lightweight cycling clothing that does not restrict movement?
Maybe you have just got into the habit of riding slowly? Do you concentrate on keeping your effort and speed up?
Nobody seems to have paid attention to that crucial bit of information.
It likely comes down to technique, which will not be very good if you never rode an actual bicycle before. It will improve with practice.
Not the answer you're looking for? Browse other questions tagged beginner or ask your own question.
Difficulties changing from a folding bike to a full sized MTB - why?
Why using a puncture repair kit instead of a new inner tube? |
0.976488 | Val Feld was born at Bangor on 24 October 1947, the daughter of James Breen-Turner, a dentist, and his wife Evelyn. She was brought up as part of the small monoglot English population of Caernarfon, very conscious that, as a result, she was unable to play a full part in the life of the local community. She received her education at Hillgrove School, Bangor, The Abbey, Malvern Wells, and the University of Wales, Cardiff, where she later gained an MA in Women's Studies. She married John Feld in 1969, with whom she had two daughters. They divorced in 1979. Her later partner was Mike Read.
She worked as a researcher and secretary for BBC, ITN, Tellex Monitors, 1969-72, and became involved in various voluntary and community activities between 1972 and 1977. She was a housing and welfare rights worker at Chorley, 1977-79, and was the founder and then Director of Shelter Cymru from 1981 until 1989. She then served as Director of the Equal Opportunities Commission Wales for ten years, working to promote the rights of women and minority groups.
Val Feld served as the treasurer of the ‘Yes for Wales’ campaign in the 1997 Referendum, and campaigned tirelessly throughout the country. She was the Labour AM for the Swansea East constituency from 1999 until her death in 2001. Her particular interests lay in economic development, housing and education issues, and she always maintained a close relationship with her constituents. She was passionately committed to equality and social justice, and saw a devolved government as an opportunity to deliver a fairer society in Wales. She did much to encourage women's participation in Welsh politics, and the fact that 25 of the 60 original National Assembly members were women is due in large part to her influence.
She took over the chair of the Economic Development Committee of the Assembly when Ron Davies stood down, but was forced to resign because of increasing ill-health in May 2001. She was also on the European Affairs and the Standards of Conduct committees. Before the election she was tipped by some for a Cabinet post, being a highly regarded politician with a history of social activism. She was a member of Amnesty International, Greenpeace and Cyrenians Cymru. She also learned the Welsh language, feeling very conscious of the need to bring together the two linguistic communities of Wales.
Val Feld died of cancer on 17 July 2001. She was the first ever member of the National Assembly for Wales to die in office. In the by-election held on 27 September 2001 the Swansea East seat was held by Val Lloyd for the Labour Party. Feld's extensive papers are held at the West Glamorgan Archive Service in the Civic Centre, Swansea. After her death a Memorial Fund was set up by the Women's Archive of Wales to provide educational support for women who are single parents.
Assembly Member Val Feld dies , BBC News website, 18 July 2001. |
0.987421 | There were many real-world examples that were learnt to manage people. I think these enabled me to gain new knowledge. The plausible limitation that I felt was that the analysis and estimation of the people is dependent on a number of factors. It depends from where they are from and in some cases the culture plays an important role in the determination of the people. Coming from a different culture that is very different from the current globalized management, I can say with certainty that motivation for people vary based on a variety of factors.
To form real employee relationship, it is important to develop empathy. The importance of empathy and looking at issues critically can lead to formation of real solutions for the issues . The importance of analyzing people systematically and the ways to use the techniques in real life can be useful in any stage of my career.
Ultimately, there must be more culture centric analysis done to gauge the people without forming negative stereotypes about any culture. The generic theories are only the inception point. There must be more analysis of the culture. |
0.934715 | Lübeck (pronounced [ˈlyːbɛk] (listen)) is a city in Schleswig-Holstein, northern Germany, and one of the major ports of Germany. On the river Trave, it was the leading city of the Hanseatic League, and because of its extensive Brick Gothic architecture, it is listed by UNESCO as a World Heritage Site. In 2015, it had a population of 218,523.
The Lübeck wine trade dates back to Hanseatic times. One Lübeck specialty is Rotspon (listen (help·info)), wine made from grapes processed and fermented in France and transported in wooden barrels to Lübeck, where it is stored, aged and bottled.
The Battle of Lübeck took place on 6 November 1806 in Lübeck, Germany between soldiers of the Kingdom of Prussia led by Gebhard Leberecht von Blücher, who were retreating from defeat at the Battle of Jena–Auerstedt, and troops of the First French Empire under Marshals Murat, Bernadotte, and Soult, who were pursuing them. In this War of the Fourth Coalition action, the French inflicted a severe defeat on the Prussians, driving them from the neutral city. Lübeck is an old Baltic Sea port approximately 50 kilometres (31 mi) northeast of Hamburg.
After their shattering defeat in October by Napoleon at the Battle of Jena–Auerstedt, the Prussian armies withdrew to the east bank of the Elbe River and marched northeast in an attempt to reach the Oder River. Aiming to annihilate his opponents' forces, Napoleon launched his Grande Armée in a headlong pursuit. A large portion of the fleeing Prussians took refuge in the fortress of Magdeburg where they were surrounded. Another large segment was intercepted and destroyed in the Battle of Prenzlau. This event triggered a series of capitulations of Prussian troops and fortresses.
Blocked from reaching the Oder, Blücher turned and raced to the west, chased by Murat, Bernadotte, and Soult. After a number of well-fought rear guard actions, Blücher's troops forced their way into the neutral city of Lübeck where they took up defensive positions. Bernadotte's soldiers broke through the city's northern defenses and overwhelmed the troops facing Murat and Soult. Blücher barely escaped from the city, though most of his staff was captured and Prussian casualties were enormous. The French brutally sacked Lübeck during and after the fighting. The next day, the French trapped the surviving Prussians against the Danish frontier and compelled Blücher to surrender.
The French captured a small Swedish force during the battle. Bernadotte's respectful treatment of its officers and soldiers led to that Scandinavian nation offering its crown to the French marshal, almost four years after this battle.
The Prince-Bishopric of Lübeck, (German: Hochstift Lübeck; Fürstbistum Lübeck) or Bishopric of Lübeck, was an ecclesiastical principality of the Holy Roman Empire until 1803. Originally ruled by Roman-Catholic bishops, after 1586 it was ruled by lay administrators and bishops who were members of the Protestant Holstein-Gottorp line of the House of Oldenburg. The prince-bishops had seat and vote on the Ecclesiastical Bench of the College of Ruling Princes of the Imperial Diet.
The Prince-Bishopric of Lübeck, a secular state, should not be confused with the Diocese of Lübeck, which was larger and over which the bishop exercised only pastoral authority.
During World War II, the city of Lübeck was the first German city to be attacked in substantial numbers by the Royal Air Force. The attack on the night of 28 March 1942 created a firestorm that caused severe damage to the historic centre, with bombs destroying three of the main churches and large parts of the built-up area. It led to the retaliatory "Baedeker" raids on historic British cities.
Although a port, and home to several shipyards, including the Lübecker Flender-Werke, Lübeck was also a cultural centre and only lightly defended. The bombing on 28 March 1942 was the first major success for RAF Bomber Command against a German city, and followed the Area Bombing Directive issued to the RAF on 14 February 1942 which authorised the targeting of civilian areas.
Deutsche Flugzeug-Werke, usually known as DFW was a German aircraft manufacturer of the early twentieth century. It was established by Bernhard Meyer and Erich Thiele at Lindenthal in 1910, and initially produced Farman designs under licence, later moving on to the Etrich Taube and eventually to its own designs. One of these, the DFW C.V reconnaissance aircraft, was produced to the extent of several thousand machines, including licence production by other firms. Plans to develop civil aircraft after the war proved fruitless, and the company was bought by ATG shortly thereafter.
The Fehmarnbelt Lightship (German: Feuerschiff Fehmarnbelt) was built in 1906-1908 at Brake on the River Weser and entered service in 1908 as the lightship Außeneider. Until 1945 it was moored at the position known as Außeneider guarding the estuary of the river Eider on the North Sea coast. In the years from 1956 to 1965 it was a reserve lighthouse in the Baltic Sea and then from 1965 to 1984 it was positioned under its present name in the Fehmarn Belt.
Today it belongs to a charitable society and its home port is the Lübeck museum port in the Hanseatic city of Lübeck, where it spends the winter months at least. The ship is preserved in working condition and during the summer it is taken to sea in order to test all facilities under sea conditions. Visits on board the lightship are permitted.
The Free and Hanseatic City of Lübeck (German: Freie und Hansestadt Lübeck, Danish: Lybæk) was a city-state from 1226 to 1937, in what is now the German states of Schleswig-Holstein and Mecklenburg-Vorpommern.
The Hanseaten (German: [hanzeˈaːtn̩], Hanseatics) is a collective term for the hierarchy group (so called First Families) consisting of elite individuals and families of prestigious rank who constituted the ruling class of the free imperial city of Hamburg, conjointly with the equal First Families of the free imperial cities Bremen and Lübeck. The members of these First Families were the persons in possession of hereditary grand burghership (Großbürgerschaft) of these cities, including the mayors (Bürgermeister), the senators (Senatoren), joint diplomats (Diplomaten) and the senior pastors (Hauptpastoren). Hanseaten refers specifically to the ruling families of Hamburg, Lübeck and Bremen, but more broadly, this group is also referred to as patricians along with similar social groups elsewhere in continental Europe.
The three cities since the Congress of Vienna 1815 are each officially named the "Free and Hanseatic City Hamburg" (Freie und Hansestadt Hamburg), the "Free Hanseatic City Bremen" (Freie Hansestadt Bremen) and the "Free and Hanseatic City Lübeck" (Freie und Hansestadt Lübeck), since 1937 merely the "Hanseatic City Lübeck" (Hansestadt Lübeck).Hamburg was one of the oldest stringent civic republics, in which the Hanseatics preserved their constitutional privileges granted in 1189 by Frederick I, Holy Roman Emperor, until the German Revolution of 1918–19 and the Weimar Constitution. Hamburg was strictly republican, but it was not a democracy, but rather an oligarchy.
The Hanseaten were regarded as being of equal rank to the (landed) nobility elsewhere in Europe, although the Hanseaten often regarded the (rural) nobility outside the city republics as inferior to the (urban and often more affluent, and in their own view, cultivated) Hanseaten. Thomas Mann, a member of a Lübeck Hanseatic family, portrayed this class in his Nobel Prize-winning novel Buddenbrooks (1901), for which he received the 1929 Nobel Prize for Literature.
The Hanseatic League (; Middle Low German: Hanse, Düdesche Hanse, Hansa; Standard German: Deutsche Hanse; Latin: Hansa Teutonica) was a commercial and defensive confederation of merchant guilds and market towns in Northwestern and Central Europe. Growing from a few North German towns in the late 1100s, the league came to dominate Baltic maritime trade for three centuries along the coasts of Northern Europe. Hansa territories stretched from the Baltic to the North Sea and inland during the Late Middle Ages, and diminished slowly after 1450.
Hanse, later spelled as Hansa, was the Old High German word for a convoy, and this word was applied to bands of merchants traveling between the Hanseatic cities - whether by land or by sea.Merchant circles established the league to protect the guilds' economic interests and diplomatic privileges in their affiliated cities and countries, as well as along the trade routes which the merchants used. The Hanseatic cities had their own legal system and operated their own armies for mutual protection and aid. Despite this, the organization was not a state, nor could it be called a confederation of city-states; only a very small number of the cities within the league enjoyed autonomy and liberties comparable to those of a free imperial city.
Lübeck Airport (IATA: LBC, ICAO: EDHL) is a minor German airport located 8 km (5.0 mi) south of Lübeck, the second-largest city in the state of Schleswig-Holstein, and 54 km (34 mi) northeast of Hamburg. Until all scheduled air traffic ceased on 15 April 2016, it was the secondary airport for the Hamburg Metropolitan Region, after the much bigger Hamburg Airport, and was used for low-cost and some occasional charter traffic. The airport was therefore sometimes called "Hamburg Lübeck" for marketing purposes.
The Lübeck law (German: Lübisches (Stadt)Recht) was the constitution of a municipal form of government developed at Lübeck, now in Schleswig-Holstein, after it was made a free city in 1226. The law provides for self-government. It replaced the personal rule of tribal monarchs descending from ancient times or the rule of the regional dukes and kings that had been established by Charlemagne. The latter held all of his aristocratic vassals personally responsible for the defence, health and welfare of the tribesmen settled on their estates, including the towns. The Lübeck Law in theory made the cities to which it applied independent of royalty.
Lübeck set about spreading its form of government to other cities around the Baltic Sea. Eventually about 100 adopted a government based on the law. It still serves as a foundation for German town laws in many of those cities. Later in the 13th century, cities predominantly governed by the Lübeck Law formed into a powerful trade association, the Hanseatic League, which amounted to a quasi-confederacy with headquarters at Lübeck. However, by the 15th century, major kontore and smaller trading posts of the Hanse, which was then at the high point of its influence, spread throughout northern Central Europe and the British Isles, from London to Veliky Novgorod and from Trondheim to Frankfurt, dominating trade far beyond German-speaking regions and also far beyond the cities where Lübeck law was in force.
An official Lübeck law transcript was never available or used until the revised edition of 1586 was printed by printer Johann Balhorn. Lübeck was a leader in the German cities that gave rights to town citizens and overturned aristocratic privilege. Lubeck law is the basis for the Dortmund code in Westphalia, the Goslar code in Saxony, and the Magdeburg rights in East-Central and East European towns. References to 'German Law' in the Middle Ages mean laws that were derived from the Lübeck law at root.Lübeck law was prevalent throughout cities in Northern and Northeastern Germany (Niederdeutschland) until 1900, when the modern German civil code (Bürgerliches Gesetzbuch) was implemented.
The Lübeck Martyrs were three Roman Catholic priests – Johannes Prassek, Eduard Müller and Hermann Lange – and the Evangelical-Lutheran pastor Karl Friedrich Stellbrink. All four were executed by beheading on 10 November 1943 less than 3 minutes apart from each other at Hamburg's Holstenglacis Prison (then called Untersuchungshaftanstalt Hamburg-Stadt, in English: Investigative Custody Centre of the City of Hamburg). Eyewitnesses reported that the blood of the four clergymen literally ran together on the guillotine and on the floor. This impressed contemporaries as a symbol of the ecumenical character of the men's work and witness. That interpretation is supported by their last letters from prison, and statements they themselves made during their time of suffering, torture and imprisonment. "We are like brothers," Hermann Lange said.
The Old Salt Route was a medieval trade route in northern Germany, one of the ancient network of salt roads which were used primarily for the transport of salt and other staples. In Germany it was referred to as Alte Salzstraße.
Salt was very valuable at that time; it was sometimes referred to as "white gold." The vast majority of the salt transported on the road was produced from brine near Lüneburg, a city in the northern central part of the country and then transported to Lübeck, a major seaport on Germany’s Baltic coast.
Soon after the German Hanseatic League (1241) was founded, regulated messenger routes were developed. In Lübeck, the conveyance of correspondence by letter was supervised by the mercantile council of the Scania Market (Schonenfahrer), which also appointed the messenger master (postmaster) and the remainder of the personnel.
Around 1579, the Reichspost of Thurn und Taxis arrived in Lübeck. It existed beside the Hanseatic post, which led to minor tensions. In 1683, they were joined by the post offices of Platen, later Hannover (until 1844), and Wismar. Together with the Danish post, these were merged into the Schütting-post.
During the French era, Napoleon united the three Hanseatic cities and northwestern Germany with France under the name Bouches-de-l'Elbe by the decree of December 13, 1810. It was the era of the Continental System against Great Britain.
The Scanian merchants took over the postal system again. However the postal administration now worked for the city treasury. The Scanian merchants received an annual payment of 2,000 Lübeck Courantmarks.
In 1848 apart from the city post office, there were a Taxis letter post, riding and errant posts of Mecklenburg, Hannover (until 1845), and Denmark, as well as a Prussian post office.
When the job of a deputy of the postal department had to be newly filled, the choice was made for the Mecklenburg-Strelitz grand ducal postmaster Carl Hermann Lebrecht Lingnau, who received the title of postal director on April 1, 1851. The lower officials were called the "Litzenbrüder".
At the postal congress in Berlin (1851), a treaty between Lübeck and Thurn und Taxis was signed for January 1, 1852, which exactly established the responsibilities. The Danish post was dealt with in a similar way. The construction of the Lübeck-Büchener Railway was permitted and in return, the Royal Danish Chief Post Office was allowed in Lübeck.
During the transition of the postal administration to the North German Confederation on January 1, 1868, the city post office became the chief post office of the North German postal district and Mr. Lingnau became chief postal director. The Danish post office, as well as Thurn und Taxis, closed their posts. There were two stable post offices and seven letter collections in Lübeck for 50,339 inhabitants. The currency was the Lübeck Courant = 16 Shilling, where 1 shilling was equivalent to 2 Sechsling.
Schleswig-Holstein (German: [ˈʃleːsvɪç ˈhɔlʃtaɪn]) is the northernmost of the 16 states of Germany, comprising most of the historical duchy of Holstein and the southern part of the former Duchy of Schleswig. Its capital city is Kiel; other notable cities are Lübeck and Flensburg.
Also known in more dated English as Sleswick-Holsatia, the region is called Slesvig-Holsten in Danish. The Low German name is Sleswig-Holsteen, and the North Frisian name is Slaswik-Holstiinj. Historically, the name can also refer to a larger region, containing both present-day Schleswig-Holstein and the former South Jutland County (Northern Schleswig; now part of the Region of Southern Denmark) in Denmark.
Travemünde (German: [ˈtʁaːvəmʏndə] (listen)) is a borough of Lübeck, Germany, located at the mouth of the river Trave in Lübeck Bay. It began life as a fortress built by Henry the Lion, Duke of Saxony, in the 12th century to guard the mouth of the Trave, and the Danes subsequently strengthened it. It became a town in 1317 and in 1329 passed into the possession of the free city of Lübeck, to which it has since belonged. Its fortifications were demolished in 1807.
Travemünde has been a seaside resort since 1802, and is Germany's largest ferry port on the Baltic Sea with connections to Sweden, Finland, Russia, Latvia and Estonia. The lighthouse is the oldest on the German Baltic coast, dating from 1539. Another attraction of Travemünde is the Flying P-Liner Passat, a museum ship anchored in the mouth of the Trave.
The annual Travemünder Woche is a traditional sailing race week in Northern Europe.
The annual Sand festival in Travemünde is known as the Sand World.
The Treaty of Stettin (German: Frieden von Stettin, Swedish: Freden i Stettin, Danish: Freden i Stettin) of 13 December 1570, ended the Northern Seven Years' War fought between Sweden and Denmark with her internally fragmented alliance of Lübeck and Poland. It also settled Swedish, Danish and Holy Roman Imperial claims regarding the Livonian War. Unfavourable for Sweden, it assured Danish hegemony in Northern Europe for a short period. Yet, because of its inconclusiveness it did not prevent further warfare between Denmark-Norway and Sweden ending only in the 1720s.
The University of Lübeck is a research university in Lübeck, Northern Germany which focuses almost entirely on medicine and sciences with applications in medicine. In 2006, 2009 and 2016, the University of Lübeck was ranked No. 1 in medicine among all universities in Germany, Austria and Switzerland according to the CHE Hochschulranking. In Computer Science and Molecular Life Science, the University was ranked No. 2 in the 2009 evaluation.
VfB Lübeck is a German association football club playing in Lübeck, Schleswig-Holstein in the country's north. In addition to its football side the 1,000 member sports club also has departments for badminton, women's gymnastics, handball, and table tennis. |
0.999972 | Which c++ standard should we compile YateBTS with ?
As you might already know, YateBTS trunk does not compile with recent versions of GCC, due to a few errors related to iostream manipulations.
These errors are easy to fix in yate-bts source code (see https://forum.yate.ro/index.php?topic=1966.0).
Though, I was confused why they were not an issue for you, I mean upstream. Which version of GCC do you use ? GCC 4.x, right ?
By default, g++ is equivalent to g++ -std=gnu++14 since GCC 6, and g++ -std=gnu++98 for older releases.
And actually, if I set -std=gnu++98 in the appropriate Makefile, yate-bts compiles just fine.
My concern is that -std=gnu++98 and -std=gnu++14 may be somewhat different languages, and hence, depending on the C++ features and the GNU extensions the yate-bts source code actually use, and combine, building as -std=gnu++98 or -std=gnu++14 may not generate semantically identical object code.
Which makes me think that setting -std=gnu++98 might be a more consistent fix than (just) patching MSInfo.cpp and Sgsn.cpp to remove the compilation errors. Can someone confirm this ?
IMHO, if it's somewhat important to build the source code as 1998 ISO C++ with GNU extensions, it might be a good idea to enforce this through the Makefiles: -std=gnu++14 is the default for Ubuntu since Artful 17.10 (and thus for Bionic 18.04 LTS), for Debian since stretch, and obviously for Arch, which sum to a huge Linux users base. BTW, none of these users would be able to build YateBTS out of the box.
The same question may also apply to C code (should we enforce -std=gnu99 or something else ?).
And may be also when building yate (server) itself: it compiles fine, but should we also enforce standards there ?
I've attached the patches I use to consistently set -std=gnu++98 as C++ standard, and -std=gnu99 as C standard for both yate and yate-bts build files. I'm not sure it's the simplest/best fix, but yate and yate-bts build with GCC 8.2 without the need to otherwise patch the source code.
The diff are against versions 6.1.0-1, and may apply to any 6.x.
May be it still would not hurt to fix MSInfo.cpp and Sgsn.cpp, though ?
Re: Which c++ standard should we compile YateBTS with ?
A very interesting finding! Does it work stable for you after you changed the standard, instead of patches?
Will this patch function with Yate 5,x? I'm working with the BladeRF and was told there are specific versions of Yate, YBTS and BladeRF firmware/FPGA that "play well" together, do you know what versions of BladeRF are compatible with Yate 6.x? |
0.91662 | Glass got mediocre reviews, average reviewer score on RT is 5.1, but of course I went to see it: a movie with McAavoy, Willis and Jackson couldn't be all bad and I was curious about how it would all be tied off.
Although it wasn't bad, and I enjoyed it, I have to say that MNS did not quite stick the landing.
convinced, even momentarily, that they did not have unusual powers.
Similarly the pacing seemed off. The key action scene needed to be edited better to be impactful. The ending was also drawn-out too long. I mean I know he likes his long pull-out shots but I wasn't loving it.
The dialogue needed improvement: I found it distracting how banale and off-fleek some of the lines were. Like even sitting in the theatre I was thinking, "damn, he should have said" X.
I mean presumably Shyamalan has been thinking about this for nearly two decades. I'm assuming he didn't wait until Split was a success to start penning the sequel. Right? Surely.
According to Jackson, the ending was originally completely different.
was appropriate. The incorporation of snippets from Unbreakable was done well: it was a good decision to bring back Spencer Treat Clark as Dunn's son. I'll confess that I did not see any of the twists coming, so job done.
The Beast's kill move is the crushing hug. He is eventually undone by a hug by Casey that allows him to be shot.
Maybe the reason the three leaf clover is the symbol of the secret society is that it represents normality, distinct from the rare, extraordinary four leaf clover.
Dunn's "anchoring moment" involves him literally sinking like an anchor.
Mr Glass threatens a terrorist attack on a Japanese named building that Bruce Willis's character is supposed to stop. |
0.964972 | I need to start playing the banjo again.
Artisan juice made with açaí, the fruit of a palm that grows in the rainforests of northern Brazil, could be a major source of infection with Trypanosoma cruzi, the parasite that causes Chagas disease, two studies suggest.
This conclusion was based on analysis of the state records from Brazil’s Information System for Notifiable Diseases (SINAN), between 2000 and 2016. During this period, 16,807 cases of Chagas disease were reported, and 2,030 of them were confirmed. Most of the confirmed cases occurred during the second half of each year.
“However, everything indicates that these numbers are an underestimate”, points out De Meisor Angela Junqueira, a biologist at the Laboratory of Parasitic Diseases of IOC-Fiocruz, açaí juice contamination can be avoided by appropriate handling of the fruit, including dipping the fruit in boiling water for ten seconds and then spraying them with cold water. |
0.904948 | What are the risk factors of irritable bowel syndrome?
What are the types of irritable bowel syndrome?
What is used to treat irritable bowel syndrome?
How do I prevent irritable bowel syndrome?
IBS is a common disorder affecting the large intestine. Irritable bowel syndrome commonly causes cramping, abdominal pain, bloating gas, diarrhea, and constipation. This is a chronic condition that needs to be managed long-term; however, only a small number of people have severe signs and symptoms. Some people can control their symptoms by managing diet, lifestyle, and stress while others need medication and counseling.
IBS is a chronic condition for most people, and therefore, there will be times where symptoms worsen, or disappear completely.
Gender – Twice as many women are likely to obtain this condition and it is not clear why. Some researchers believe that it’s due to changing hormones in their menstrual cycle.
Age – IBS can affect people of all ages, but it is more likely for people in their teens up to 40 years old.
Family history – Genes may play a role when obtaining IBS, as having a family member with the disease increases your likelihood of developing it as well.
Emotional trouble – Some people with irritable bowel syndrome may have an irregular amount of stress, have a mental disorder, or have been through a traumatic event in their lives. Stress management and behavioral therapy can help relieve some of these symptoms.
Food sensitivity – Some victims of IBS may have digestive systems that rumble angrily when eating dairy, wheat, fructose, or a sugar substitute. Fatty foods, carbonated drinks, and alcohol can also contribute to its disruption.
Stress eating/Large meals – Eating while driving or working aren’t direct causes of IBS, but if one has a sensitive colon it can be a possibility that this can trigger its symptoms.
Medications – IBS symptoms and antibiotics, antidepressants, and drugs made with sorbitol have been shown to have a direct link.
Digestive problems – Traveler’s diarrhea or food poisoning may trigger a person’s first IBS symptoms.
It is crucial to discuss with your doctor the common risks that result in irritable bowel syndrome, as symptoms can indicate what is truly disturbing your large intestine.
The direct cause for irritable bowel syndrome is unknown, but health experts believe that faulty communication between the brain and intestinal tract is an overarching contributing factor. Abnormal muscle contractions or spasms often cause cramping pain, as well as conflict with speeding up or slowing down the passage of stool, leading to diarrhea or constipation and bloating, respectively.
Unusually sensitive intestines in people with IBS is highly common, however It isn’t known why their intestines are more like to react strongly to the elements that contribute to irritable bowel syndrome. People who do have this may begin to experience some symptoms.
IBS with constipation – Stomach pain and discomfort, bloating, abnormal or infrequent bowel movement, or a lumpy/hard stool.
IBS with diarrhea – Stomach pain and discomfort, an urgency to move bowels, abnormally frequent bowel movements, or loose/watery stool.
There is about an equal number of people with irritable bowel syndrome in each category, and most will alternate between types over time.
The first line of treatment for irritable bowel syndrome includes lifestyle changes, medicines, and counseling to overcome symptoms felt.
Dietary or stress-related factors may be related to symptoms and can be discussed with a health care provider. If certain foods cause discomfort or pain occurs after eating, it may be helpful to regulate intake, and avoid foods that cause irritation.
Increased stress may result in the onset or worsening of IBS symptoms and associated non-bowel syndromes such as fatigue or low energy. Proper rest and exercise can help reduce stress levels and positively influence IBS.
Cognitive behavioral therapy – allows the individual to regain personal skills as well as mental techniques to better manage the symptoms.
Interpersonal psychotherapy – addresses stressful responses to interactions with others. |
0.884149 | People need different things to live in this world. However, nothing in this world is available for free. Everything is a price, and one has to pay the right price to make them happy. However, we value things according to our needs and needs depend on the basis of our value system.
First, there are basic needs like food, water, air, shelter, and clothing without which body survival is not possible. However, as these needs are fulfilled, one commits himself to satisfying his higher needs than the need for social needs, security needs or self-fulfillment.
However, not every person follows the same path, the particular values of the person. These inherent values are obtained through the nature of man and his care. The impact of family, society, nation and individual makes it unique for all people as it creates a unique value system. These values determine the person's priority and lifestyle. Values value personality and individual, family, society, nation, and humanity.
The most common value of a person is individualist, which means that I appreciate yours over any other world. This is also the most natural value for everyone in the world. The animals live for themselves, without the excitement of other animals. The only exception would be the mother who cares for the child's animal until the child is sufficiently grown to support himself.
The modern world is increasingly moving towards individualistic values where the interest of the individual is most "right" and everything else is to be protected. Individualist value supports freedom, as it believes that every person has the right to decide what is good for them.
The human race can be the strongest species on earth, but it is also true that the human species is the weakest species. A human child does not learn to spend another year. If a man's only child can leave his life, he can not survive. Supporting the family is necessary for the growth of all human children. That is why the human race invented the concept of the family during the year, which lives as a unit and supports the newborn child until it is strengthened to support itself.
The concept of family has created a family where the family is viewed as the basic unit of society rather than the individual. The family has the right and power to direct the other member of the family. In a family system, family members share their work so that each member performs complementary functions rather than performing the same tasks. For example, the father acquires livelihoods and protects the family that is the strongest member of the family. The mother takes care of the family by cooking a meal, cleaning her house and children. The children involved receive these benefits free of charge from their parents, but they have a family duty to provide the same benefits to their children. Thus, the family ensures the continuity of the value and tradition of the family.
In the family system, the interests of all members of the family are protected by an unwritten law as love and trust govern the family's sole control. Parents do not earn any personal gain when they give something to their children. Children also recognize the parents' contribution to building their lives and not only provide the same benefits to their own children but also to their parents when they grow old.
Full family values are maintained on the basis of tradition and trust.
Society is not only composed of families that are natural but also of origin that have been artificially created to meet the specific requirements of society. The government is one of the most important organizations that have been created to create order in society. The government is divided into other classes, such as police, revenue, defense, etc. What are needed to make the country united and protect against external aggression. There are a number of organizations organized by individuals or corporations that produce and serve products for the nation and the world's people.
Everyone has to join in to make a living and contribute to society. These organizations have been designed to serve the special function of society and therefore need a set of values that are motivated and united to all members of the organization.
The world is divided into many countries today, and each country is sovereign and independent. However, in recent years, countries have started to behave as family members, as independence gradually replaces interdependence in globalizing economies. If China is the world's manufacturing center, India has become the center of world outsourcing and outsourcing, from which it offers the various services to the world. The Arab world is an oil producer for the world and the United States has taken a leading role in creating knowledge and information technology for the world. Each country gradually becomes a specialist in a particular task and meets the requirements of other countries.
Thus, as individuals and families have to compete and complement each other to survive in society, each nation must compete and complement the rest of the world. In order to make the nation stronger, citizens have to cultivate certain types of values that make the country not one million people or billions of individuals or families, but as a family.
As a result of independence, each country develops certain values that are constantly evolving over time. The values of the nation represent its popularity, history and experience since its creation. India and China are thousands of years old, while the values of newly established nations such as the United States, Israel, Australia and Pakistan are fairly new.
While the legal values of a country or society are documented and enforced, they are not sufficient for the smooth functioning of the state. The ideal state is where the state does not have to enforce laws, as citizens voluntarily follow the laws of the earth. However, this is rarely the case, because all state laws are made up of powerful people or those who influence influential people. These mighty people ensure that the laws are drafted rather than in favor of the masses and not for the masses. Thus, the implementation of laws in a time that creates extremely powerful and wealthy people while the majority population lives in the lives of misfortune and poverty.
The values adopted by men create exclusivity in humans, as these values are different for every society and for every human being. Values are thus a source of conflicts in the world, as all people or nations strongly believe in their values right. However, these values are not constant and transient, which varies over time and space. The values of the current generation are not the same as the values of the previous generation.
Yet there is something in every value that will never change. It has remained the same for many years of human evolution. These values are eternal because they never change. Hence, these values are often referred to as spiritual or divine values as they will never die and their origin is unknown.
Intellectual values are often attributed to God and are called divine calls. Spiritual values include love, compassion, justice, truth, and so on. The nature of man is to accept these values regardless of religion, race, culture or nationality. These values are so universal that every person seems to have understood it without having learned it.
No man can have only one value system and every human being has all the values. However, the determining value is different in every human being born in a particular family, culture, religion or nationality. Values also vary with the person's age, varying from the same person to the individual to the family. When a person grows up and gains her life, she has to work in a certain profession where she develops her professional values. National values are embedded in people because of the common values of citizens. However, as men are older, they will become more spiritual and develop mental values. Thus, all six values always prevail in all societies that move and unite society. |
0.999985 | PRICE REDUCED! CARFAX 1-Owner! Value priced below the market average! This 2016 Nissan Altima 2.5 SL, has a great Cayenne Red exterior, and a clean Charcoal interior! -Only 18,398 miles which is low for a 2016 ! This model has many valuable options -Leather seats -Backup Camera -Bluetooth -Satellite Radio -Aux. Audio Input -Heated Front Seats -Heated Mirrors -Auto Climate Control -Premium Sound System -Automatic Headlights -Fog Lights -Front Wheel Drive -Multi-Zone Air Conditioning -Remote Start -Security System -Garage Door Opener -Power Locks -Keyless Entry -Power Windows -Steering Wheel Controls -Cruise Control -Leather Steering Wheel Automatic Transmission -Rear Bench Seats -Tire Pressure Monitors On top of that, it has many safety features -Brake Assist -Traction Control -Stability Control Save money at the pump, knowing this Nissan Altima gets 39.0/27.0 MPG! Call to confirm availability and schedule a no-obligation test drive! We are located at 100 Rt 73N, Palmyra, NJ 08065.
Price(s) include(s) all costs to be paid by a consumer, except for licensing costs, registration fees, and taxes. MPG estimates on this website are EPA estimates; your actual mileage may vary. For used vehicles, MPG estimates are EPA estimates for the vehicle when it was new. The EPA periodically modifies its MPG calculation methodology; all MPG estimates are based on the methodology in effect when the vehicles were new (please see the Fuel Economy portion of the EPAs website for details, including a MPG recalculation tool). The features and options listed are for the new 2016 Nissan Altima and may not apply to this specific vehicle.
This Used Cayenne Red 2016 Nissan Altima is for sale at F.C. Kerbeck Buick GMC; featuring a 2.5L I4 16V MPFI DOHC and 4dr Sdn I4 2.5 SL body style. Compare our pricing to other auto dealers, give us a call at (866) 826-3218 if you have any questions and then pay us a visit to see why we are a premier Buick and GMC dealership near Philadelphia and Mt. Laurel.
Visit F.C. Kerbeck Buick GMC for an incredible deal on this Nissan Altima 4dr Sdn I4 2.5 SL. This model features a 2.5L I4 16V MPFI DOHC engine, 1-Speed CVT w/OD transmission, and is colored with Cayenne Red paint. No matter what you're looking for in a vehicle, you can be certain that our sales staff will assist you in finding the perfect model for your needs. Our finance staff are prepared to help you find the lease or financing plan that is best for you. You can find us at 100 Route 73 N in Palmyra, NJ 08065, only a short drive away from Philadelphia, Mt. Laurel, and Cherry Hill. Give us a call at (866) 826-3218 or visit us to test drive this Nissan Altima. |
0.999424 | It is true that most of celebrities are known for their luxurious lifestyles than for their performance or talents these days. Many people think that this kind of attitude is not a good example for the young generation. To a certain extent, I would agree that this kind of behavior would be a bad example for the society, but there are other famous people are popular due to their outstanding accomplishment. On the one hand, it is a fact that many famous people become popular due to their fancy lifestyle, instead of their outstanding achievement these days. Their acting talent might be standard or below the average, but they are making sensation to the public by showing their wealth and glamorous lifestyles. One of the examples would be Kim Kardashian who is famous for her reality television program, where as it mostly show her luxurious mansion, party and shopaholic lifestyles and less of her acting. It is believed that the behavior would be a negative influence for the young people as it teaches them about hedonistic lifestyle. On the other hand, there are celebrities who are popular for their incredible act or outstanding performance. These people have shown to the world that they have reached success due to strong determination and hard work, and the public always recognize them for their masterpiece of arts and great achievements. One of the examples would be the legendary English footballer David Beckham. He was not only a good athlete but also became the model of some sport apparels. Although David Beckham sometime had shown his glamorous lifestyle, but he had also shown to the public that he was good football player. He had informed in his biography that to achieved success, he had to work hard during his young age, as he had to practice in doing penalty kick for around 1000 kick per day consistently. These kinds of celebrities are worth to be followed by the young generation.In conclusion, many famous people are well known for their wealth and luxurious style, instead of their achievement and it would be a negative example for the young age people. To a certain point, I would disagree with the opinion, since there are other celebrities who are famous due to their great talent and performance. In my opinion, I think the public should be more selective in choosing their role models, not just in front of the camera, but we should also see from their personal life as well. |
0.9476 | If you display a rug area in your hardwood floors, it is recommended for you to decorate a rug pad under your rug area. Why is it very important? The main reason is that it can keep your rug from sliding since it can cause an accident that can be dangerous for your safety.
Moreover, the presence of rug pad can give an extra comfort in rug area since it will make the rug surface feel softer. As a result, you can feel a contented mood to your room.
There are different materials of rug pad for different floor surface. If your floors are constructed from hardwood materials, you can use the best rug pads for hardwood floors that you can find in many home store or wall mart in your area.
Best rug pads for hardwood floors are usually made from natural fiber or rubber which is safe for your environment and your hardwood floor. Those materials have good durability and anti slip surface which will protect you from sliding or falling down when you are walking through the rug.
By using best rug pads for hardwood floors, you can save your money for buying a new rug so often as the rug pads can extend the durability of the carpet. It is because the rug pad can give extra airflows under the rug which make it easy to vacuum from the dirt. Thus, it can be your good investment as it can keep your favorite rug stand for longer times. |
0.913977 | Did ancient civilisations indulge in nuclear warfare?
Religious texts and geological evidence suggest that several parts of the world have experienced destructive atomic blasts in ages past.
... .. ...At Rajasthan in India, radioactive ash covers three square miles not far from Jodhpur.
This is an area of high rates of cancer and birth defects and it was cordoned off by the Indian government when radiation readings soared astonishingly high.
An ancient city was unearthed which, the evidence indicates, was destroyed by an atomic explosion some 8,000 to 12,000 years ago.
It has been estimated that half a million people could have died in the blast and it was at least the size of those that devastated Japan in 1945.
Vitrified Ruins in California's Death Valley: Evidence of Atomic War?
In Secrets of the Lost Races, Rene Noorbergen discusses the evidence for a cataclysmic war in the remote past that included the use of airships and weapons that vitrified stone cities.
The most numerous vitrified remains in the New World are located in the western United States. In 1850 the American explorer Captain Ives William Walker was the first to view some of these ruins, situated in Death Valley. He discovered a city about a mile long, with the lines of the streets and the positions of the buildings still visible. At the center he found a huge rock, between 20 to 30 feet high, with the remains of an enormous structure atop it. The southern side of both the rock and the building was melted and vitrified. Walker assumed that a volcano had been responsible for this phenomenon, but there is no volcano in the area. In addition, tectonic heat could not have caused such a liquefication of the rock surface.
An associate of Captain Walker who followed up his initial exploration commented: "The whole region between the rivers Gila and San Juan is covered with remains. The ruins of cities are to be found there which must be most extensive, and they are burnt out and vitrified in part, full of fused stones and craters caused by fires which were hot enough to liquefy rock or metal. There are paving stones and houses torn with monstrous cracks. [as though they had] been attacked by a giant's fire-plough."
These vitrified ruins in Death Valley sound fascinating--but do they really exist? There certainly is evidence of ancient civilisations in the area. In Titus Canyon, petroglyphs and inscriptions have been scratched into the walls by unknown prehistoric hands. Some experts think the graffiti might have been made by people who lived here long before the Indians we know of, because extant Indians know nothing of the glyphs and, indeed, regard them with superstitious awe.
Piute legends tell of a city beneath Death Valley that they call Shin-au-av. Tom Wilson, an Indian guide in the 1920s, claimed that his grandfather had rediscovered the place by wandering into a miles-long labyrinth of caves beneath the valley floor.
Eventually the Indian came to an underworld city where the people spoke an incomprehensible language and wore clothing made of leather.
Wilson told this story after a prospector named White claimed he had fallen through the floor of an abandoned mine at Wingate Pass and into an unknown tunnel. White followed this into a series of rooms, where he found hundreds of leather-clad humanoid mummies. Gold bars were stacked like bricks and piled in bins.
White claimed he had explored the caverns on three occasions. On one, his wife accompanied him; and on another, his partner, Fred Thomason. However, none of them [was] able to relocate the opening to the cavern when they tried to take a group of archaeologists on a tour of the place.
It seems one local character knew how to find the place. Brandon relates that "Death Valley Scotty", an eccentric who spent millions building a castle-estate in the area, was known to go "prospecting" when funds ran low. Death Valley Scotty would check out for a few days of wandering in the nearby Grapevine Mountains, bringing back suspiciously refined-looking gold that he claimed he had prospected. Many believe that he got his gold from the stacked gold bars in the tunnel system beneath Death Valley.
* Various omens appeared among the gods: winds blew, meteors fell in thousands, thunder rolled through a cloudless sky.
* Drona called Arjuna and said: "Accept from me this irresistible weapon called Brahmasira. But you must promise never to use it against a human foe, for if you did it might destroy the world. If any foe who is not a human attacks you, you may use it against him in battle. None but you deserves the celestial weapon that I gave you."
* At last they came to blows, and seizing their maces struck each other.they fell like falling suns.
* These huge animals, like mountains struck by Bhima's mace, fell with their heads broken, fell upon the ground like cliffs loosened by thunder.
* Bhima took him by the arm and dragged him away to an open place where they began to fight like two elephants mad with rage. The dust they raised resembled the smoke of a forest fire; it covered their bodies so that they looked like swaying cliffs wreathed in mist.
* Arjuna and Krishna rode to and fro in their chariots on either side of the forest and drove back the creatures which tried to escape. Thousands of animals were burnt, pools and lakes began to boil... The flames even reached Heaven... Indra without loss of time set out for Khandava and covered the sky with masses of clouds; the rain poured down but it was dried in mid-air by the heat.
Several historical records claim that Indian culture has been around for literally tens of thousands of years. Yet, until 1920, all the "experts" agreed that the origins of the Indian civilisation should be placed within a few hundred years of Alexander the Great's expedition to the subcontinent in 327 BC. However, that was before several great cities like Harappa and Mohenjo-Daro (Mound of the Dead), Kot Diji, Kalibanga and Lothal were discovered and excavated. Lothal, a former port city now miles from the ocean, was discovered in Gujarat, western India, just in the late 20th century. These discoveries have forced archaeologists to push back the dates for the origin of Indian civilisation by thousands of years--in line with what the Indians themselves have insisted all along.
A wonder to modern-day researchers, the cities were highly developed and advanced. The way that each city was laid out in regular blocks, with streets crossing each other at right angles and the entire city laid out in sections, gives archaeologists cause to believe that the cities were conceived as a whole before they were built--a remarkable early example of city planning. Even more remarkable is that the plumbing/sewage systems throughout the large cities were so sophisticated--superior to those found in Pakistan, India and many Asian countries today. Sewers were covered, and most homes had private toilets and running water. Furthermore, the water and sewage systems were kept well separated.
Well, yes, in modern history.
A recent study also opts for this explanation, although no one has found a crater of suitable size or other supporting evidence.
Barakat holds up one of the many, huge chunks of glass in the desert.
Oppenheimer also quoted "If the radiance of a thousand suns, were to burst at once into the sky, that would be like the splendor of the Mighty One."
This is mentioned in a book I read recently called The Atlantis Blueprint,well worth a read!
This is wow, a really eye opening thread. Ancient warfare using nuclear weapons, or similar, are possible. Look at what happened in India thousands of years ago in Mohenjo-Daro and not to mention the glazed green glass phenomenon, found in Hiroshima, atomic test sites and even Tunguska.
This subject is (one word) breathtaking!!
Add all the info you got folks.
Are the Indian remains of Mohenjo Daro and Harappa, their sudden abandonment and the apparent discovery of an ancient site with a layer of radioactive ash the best available evidence for the possibility that our ancient ancestors possessed a highly advanced technology – which might have included atomic warfare?
Did an ancient advanced civilization exist on Earth? The question is very intriguing and the search for “evidence” to support a positive answer has intrigued Mankind for many decades – if not centuries. Many possibilities have been put forward, from outright statements that Atlantis was a high tech civilization, to the possibility that the Nazca lines might be a prehistoric airport.
Rather than an accumulation of various items of evidence that is then subjected to the possibility that it might be either alien or advanced, it is more scientific – and perhaps better- to focus on the quest for the “best evidence”: a single piece of evidence that in itself is the best example to support a conclusion. In the search for an advanced ancient civilization, what would be this “best evidence”?
One possible item that would classify as “best evidence” exists within the Indus River Valley, where towns such as Harappa and Mohenjo Daro flourished in 3000 BC. The question is why these cities were abandoned. And one answer that has been put forward is that the ancient cities might have been irradiated by an atomic blast. If true, it would be impossible to ignore the conclusion that ancient civilization possessed high technology.
Hi There are plenty of books out there that go into all this W Raymond Drake in his books seems to think that it was the Ancient gods that brought atomic warfare to this earth. Either that or life on this planet goes in cycles and we blow ourselves up and go back to living in caves.
Mahabarata is ripe with stuff about "atomic" weapons. They are called Sudarsan Chakra, the little disk you see on Visnu's finger. They destroy entire worlds with that thing.
My research has just led me to information on Nibiru / Planet X and I watched yesterday 4 videos of Jordan Maxwell at The Republic Forum, discussing The Bible & End Times. He hypothesizes that a great war is coming, with destruction the likes of which we (current inhabitants) have never seen before and how this can be shown in the original Hebrew texts.
There is evidence that this will not be the first time that "waste and desolation" has been visited upon the Earth and I believe that this ties in nicely with this thread.
Don't let you eyes decieve you"
Thanks for adding this veritas!
At around the 12 minute mark, Bill Jenkins refers to Zacharia Sitchin's reference to an alien battle around the Sinai peninsula using nuclear weapons c.2,000BC. |
0.913752 | I love chalkboard paint and needed a headboard. So I made one!
Measure your bed. Or don't!
The door here is a standard-sized door, and the bed is a queen-sized bed. Where do you find doors? Good question! For me, this was pretty easy, as I used an old door that had come from my house (who wants to have a door to a hallway?) which was hanging out in the garage. But this is easy to do even without that. Check places like Habitat for Humanity's ReStore, where people donate their old household items like furniture, kitchen cabinets, windows, and doors, or even some thrift stores. Remember, even if you have an oddly-sized bed, there are tons of differently-sized doors which can fit it--you just may have to hunt more.
Depending on the paneling (or lack thereof) on your door, you're going to approach this differently. I shopped around for doors originally because I wanted the paneling to be of equal sizing, but eventually went with the doors I had. I knew I didn't want to paint the entire door, and wanted a framing effect of the panels, but you may want something different! Some doors have raised panels, some have recessed panels, and if you have a plain door with no paneling you can paint in the shape of the chalkboard yourself.
Either way, you're going to want to first examine the areas you'll be painting. On my door, the paint was peeling off in layers, so I taped off the edges of the paneling first and then peeled back paint, so I wouldn't accidentally peel too much off. I then sanded any rough-looking spots.
If your door has a smooth coat of paint here, this isn't as necessary. You just need a very flat surface for your chalkboard.
Before you paint, TAPE OFF around the areas you'll be painting. I also put paper around the rest of the door, as I was using a spray can of chalkboard paint.
Since I was spray painting, I did three or four coats, alternating spraying vertically for the first coat and horizontally for the second coat. Let dry between coats--I let mine sit overnight in the garage.
First of all, measure how high your mattress + bedframe sits off the ground. This is where you want the bottom of your door to hit. Then measure the short side of your door, and add that number to the height of your mattress off the ground, so you know how long to cut the legs.
For me, this meant cutting 2x4s that were going to be about six feet tall, to give mattress clearance under the headboard. I got a 2x4x12 board, and cut it so into two six-feet lengths.
Now you'll have to attach the legs to your door-headboard. There are more sophisticated ways to do this (like notching the boards to slide the ends of the doors into), but I opted for the simple way that required less cutting and sawing. I painted the boards to match the door, then attached them to the back of the door frame, using a drill with eight 2" screws (four rows of two screws each, just to make sure the legs don't come off). I predrilled the holes as well.
Step 4: Congratulations on Your New Headboard!
Now you're set! I added some rope light to my headboard for extra panache (just draped over, not even nailed in place yet!) and so I could read at night.
You want to lightly cover the chalkboard surfaces with chalk, then wipe it off, per instructions on the side of the chalkboard paint. Then write your favorite bedtime quotation and enjoy your new bed!
Don't you get chalk in your hair?
Nope. I have a body pillow between my main pillow & the headboard, as you can see in the pictures, for extra softness, but even when I'm sitting upright and leaning back against the headboard it doesn't happen. You probably could end up with chalk in your hair, but only if you leaned back and really tried to wipe the chalk with your head.
My door didn't have a doorknob, but if yours does I suggest you remove it. I positioned my door so that the doorknob plate (with keyhole!) is behind the pillows, and the hinge-side (with hinges removed) is at the top. If you wanted to, you could put a shelf across the top for added usefulness.
Stability? how stable is it, since it's just leaned against the wall?
I researched a lot of DIY headboards before making this one, and affixing the headboard directly to the wall seemed to be really popular for a lot of them. But you can't really do that if you're renting! I did end up putting some carpet pads (the kind you put on the bottom of furniture to keep it from scuffing up your floor) on the surfaces where the door scrapes against the wall. For me, since I attached the 2x4 legs to the entire length of the door, this was just the top two points of those 2x4 legs.
Another option: If you have a metal bedframe, it could be very possible to use screws to affix the metal bedframe directly to the 2x4 legs. This wasn't an option for me--the door was slightly too long, and so the way it sits now the legs sit on the outside of the bedframe, but if you have a smaller door, or set the legs more toward the middle and not flush with the end, it would be entirely possible to attach the rest of your bedframe to this.
:) awesome tut! Been looking for door ideas for a while. Mine is freestanding, legs go halfway up the back because that's the length of wood I had , no writing on it yet but I like the look of it . I did have to cover up a beautiful vintage door with years of layered paint , but I just wanted the wood!
Since I am a super novice I was wondering how to best attach the legs to the door and at what distance (do you place them even with the ends of the door or not). Size screws, what kind, configuration, etc. This looks super simple and I've had a door for 25 years just wondering what to do with it and no headboard on any beds in the house!
I just put them at the ends of the door, even with the top and bottom. If you wanted to be fancy you could measure your mattress & put them with the space of your mattress between them, so it would match up perfectly with your mattress.
I don't remember what size screws I used--I think I just measured the width or boards + door (so 1" thick board + 1.5" thick door, or whatever it was) and got screws slightly smaller than that, so they wouldn't poke through the other side. The diameter of the screws really doesn't matter.
Thanks for responding and taking the time to post your tutorial. Last question: you don't mention fastening the boards to the bedframe. Is this free-standing? I also, am looking for a headboard that doesn't attach to the wall, but where the frame/mattress doesn't have a gap with the headboard. |
0.973336 | This article is about the German title. For other uses, see Führer (disambiguation).
Führer (German pronunciation: [ˈfyːʁɐ], spelled Fuehrer when the umlaut is not available) is a German word meaning "leader" or "guide". As a political title it is associated with the Nazi dictator Adolf Hitler. Nazi Germany cultivated the Führerprinzip ("leader principle"), and Hitler was generally known as just der Führer ("the Leader").
Führer was the title demanded by Adolf Hitler to denote his function as the head of the Nazi Party; he received it in 1921 when, infuriated over party founder Anton Drexler's plan to merge with another antisemitic far-right nationalist party, he resigned from the party. Drexler and the party's Executive Committee then acquiesced to Hitler's demand to be made the chairman of the party with "dictatorial powers" as the condition for his return. It was common at the time to refer to leaders of all sorts, including those of political parties, as Führer. Hitler's adoption of the title was partly inspired by its earlier use by the Austrian Georg von Schönerer, a major exponent of pan-Germanism and German nationalism in Austria, whose followers commonly referred to him as the Führer, and who also used the Roman salute – where the right arm and hand are held rigidly outstretched – which they called the "German greeting". According to historian Richard J. Evans, this use of "Führer" by Schönerer's Pan-German Association, probably introduced the term to the German far right, but its specific adoption by the Nazis may have been influenced by the use in Italy of "Duce", also meaning "leader", as an informal title for Benito Mussolini, the Fascist Prime Minister, and later dictator, of that country.
After Hitler's appointment as Reichskanzler (Chancellor of the Reich) the Reichstag passed the Enabling Act which allowed Hitler's cabinet to promulgate laws by decree.
One day before the death of Reichspräsident Paul von Hindenburg, Hitler and his cabinet decreed a law that merged the office of the president with that of Chancellor, so that Hitler became Führer and Reichskanzler – although eventually Reichskanzler was quietly dropped. Hitler therefore assumed the President's powers without assuming the office itself – ostensibly out of respect for Hindenburg's achievements as a heroic figure in World War I. Though this law was in breach of the Enabling Act, which specifically precluded any laws concerning the Presidential office, it was approved by a referendum on 19 August.
Hitler saw himself as the sole source of power in Germany, similar to the Roman emperors and German medieval leaders. He used the title Führer und Reichskanzler (Leader and Chancellor), highlighting the positions he already held in party and government, though in popular reception, the element Führer was increasingly understood not just in reference to the Nazi Party, but also in reference to the German people and the German state. Soldiers had to swear allegiance to Hitler as "Führer des deutschen Reiches und Volkes" (Leader of the German Reich and People). The title was changed on 28 July 1942 to "Führer des Großdeutschen Reiches" (Leader of the Greater German Reich). In his political testament, Hitler also referred to himself as Führer der Nation (Leader of the Nation).
One of the Nazis' most-repeated political slogans was Ein Volk, ein Reich, ein Führer – "One People, One Empire, One Leader". Bendersky says the slogan "left an indelible mark on the minds of most Germans who lived through the Nazi years. It appeared on countless posters and in publications; it was heard constantly in radio broadcasts and speeches." The slogan emphasized the absolute control of the party over practically every sector of German society and culture – with the churches being the most notable exception. Hitler's word was absolute, but he had a narrow range of interest – mostly involving diplomacy and the military – and so his subordinates interpreted his will to fit their own interests.
According to the Constitution of Weimar, the President was Supreme Commander of the Armed Forces. Unlike "President", Hitler did take this title (Oberbefehlshaber) for himself. When conscription was reintroduced in 1935, Hitler created the title of Commander-in-Chief of the Armed Forces, a post held by the Minister for War. He retained the title of Supreme Commander for himself. Field Marshal Werner von Blomberg, then the Minister of War and one of those who created the Hitler oath, or the personal oath of loyalty of the military to Hitler, became the Commander-in-Chief of the Armed Forces while Hitler remained Supreme Commander. Following the Blomberg–Fritsch Affair in 1938, Hitler assumed the commander-in-chief's post as well and took personal command of the armed forces. However, he continued using the older formally higher title of Supreme Commander, which was thus filled with a somewhat new meaning. Combining it with "Führer", he used the style Führer und Oberster Befehlshaber der Wehrmacht (Leader and Supreme Commander of the Wehrmacht), yet a simple "Führer" since May 1942.
An additional title was adopted by Hitler on 23 June 1941 when he declared himself the "Germanic Führer" (Germanischer Führer), in addition to his duties as Führer of the German state and people. This was done to emphasize Hitler's professed leadership of what the Nazis described as the "Nordic-Germanic master race", which was considered to include peoples such as the Norwegians, Danes, Swedes, Dutch, and others in addition to the Germans, and the intent to annex these countries to the German Reich in 1933. Waffen-SS formations from these countries had to declare obedience to Hitler by addressing him in this fashion. On 12 December 1941 the Dutch fascist Anton Mussert also addressed him as such when he proclaimed his allegiance to Hitler during a visit to the Reich Chancellery in Berlin. He had wanted to address Hitler as Führer aller Germanen ("Führer of all Germanics"), but Hitler personally decreed the former style. Historian Loe de Jong speculates on the difference between the two: Führer aller Germanen implied a position separate from Hitler's role as Führer und Reichskanzler des Grossdeutschen Reiches ("Führer and Reich Chancellor of the Greater German Empire"), while germanischer Führer served more as an attribute of that main function. As late as 1944, however, occasional propaganda publications continued to refer to him by this unofficial title.
Führer has been used as a military title (compare Latin Dux) in Germany since at least the 18th century. The usage of the term "Führer" in the context of a company-sized military subunit in the German Army referred to a commander lacking the qualifications for permanent command. For example, the commanding officer of a company was (and is) titled "Kompaniechef" (literally, Company Chief), but if he did not have the requisite rank or experience, or was only temporarily assigned to command, he was officially titled "Kompanieführer". Thus operational commands of various military echelons were typically referred to by their formation title followed by the title Führer, in connection with mission-type tactics used by the German military forces. The term Führer was also used at lower levels, regardless of experience or rank; for example, a Gruppenführer was the leader of a squad of infantry (9 or 10 men).
Under the Nazis, the title Führer was also used in paramilitary titles (see Freikorps). Almost every Nazi paramilitary organization, in particular the SS and SA, had Nazi party paramilitary ranks incorporating the title of Führer. The SS including the Waffen-SS, like all paramilitary Nazi organisations, called all their members of any degree except the lowest Führer of something; thus confusingly, Gruppenführer was also an official rank title for a specific grade of general. The word Truppenführer was also a generic word referring to any commander or leader of troops, and could be applied to NCOs or officers at many different levels of command.
The word Führerstand translates to a "driver's cab"
In Germany, the isolated word "Führer" is usually avoided in political contexts, due to its intimate connection with Nazi institutions and with Hitler personally. However, the term -führer is used in many compound words. Examples include Bergführer (mountain guide), Fremdenführer (tourist guide), Geschäftsführer (CEO or EO), Führerschein (driver's license), Führerstand or Führerhaus (driver's cab), Lok(omotiv)führer (train driver), Reiseführer (travel guide book), and Spielführer (team captain — also referred to as Mannschaftskapitän).
The use of alternative terms like "Chef" (a borrowing from the French, as is the English "chief", e.g. Chef des Bundeskanzleramtes) or Leiter (often in compound words like Amtsleiter, Projektleiter or Referatsleiter) is usually not the result of replacing of the word "Führer", but rather using terminology that existed before the Nazis. The use of Führer to refer to a political party leader is rare today and Vorsitzender (chairman) is the more common term. However, the word Oppositionsführer ("leader of the (parliamentary) opposition") is more commonly used.
^ "Means Used by the Nazi Conspiractors in Gaining Control of the German State (Part 4 of 55)".
^ Evans, Richard J. (2003) The Coming of the Third Reich. New York; Penguin. pp.43, 184. ISBN 0-14-303469-3. Schönerer also invented the "pseudo-medieval" greeting "Heil", meaning "Hail".
"§ 1 The office of the Reichspräsident is merged with that of the Reichskanzler. Therefore the previous rights of the Reichspräsident pass over to the Führer and Reichskanzler Adolf Hitler. He names his deputy."
^ Shirer, William L. (1960). The Rise and Fall of the Third Reich. New York: Simon & Schuster. pp. 226–27. ISBN 978-0-671-62420-0.
^ Thamer, Hans-Ulrich (2003). "Beginn der nationalsozialistischen Herrschaft (Teil 2)". Nationalsozialismus I (in German). Bonn: Federal Agency for Civic Education. Archived from the original on February 8, 2008. Retrieved 4 October 2011.
^ Winkler, Heinrich August. "The German Catastrophe 1933–1945". Germany: The Long Road West vol. 2: 1933–1990. pp. 38–39. ISBN 978-0-19-926598-5. Retrieved 28 October 2011.
^ "NS-Archiv : Dokumente zum Nationalsozialismus : Adolf Hitler, Politisches Testament".
^ Joseph W. Bendersky (2007). A Concise History of Nazi Germany: 1919–1945. Rowman & Littlefield. pp. 105–6.
^ De Jong, Louis (1974) (in Dutch). Het Koninkrijk der Nederlanden in de tweede wereldoorlog: Maart '41 – Juli '42, p. 181. M. Nijhoff.
^ Bramstedt, E. K. (2003). Dictatorship and Political Police: the Technique of Control by Fear, pp. 92–93. Routledge.
^ a b c De Jong 1974, pp. 199–200.
^ Adolf Hitler: Führer aller Germanen. Storm, 1944. |
0.914243 | Why would you compare the iPad Pro to how much it feels like full-fledged laptop? If you want a full-fledged laptop then get a full-fledged laptop! And while you’re at it, define full-fledged. Does a full-fledged laptop need to have an Ethernet port, a Display Port, and some USB connectivity? If so, is a MacBook Pro with USB-C only connections not a full-fledged laptop?
I have an iPad Pro and a MacBook Pro and I don’t ever feel the need to define my iPad Pro in terms of its laptopyness. Similarly, I don’t compare a MacBook Pro to either an iMac or Mac Pro.
I’d argue that the Surface Laptop’s competitor is the MacBook, not the MacBook Air. The MacBook has a slightly smaller display but a higher PPI, USB 3.1, and is significantly lighter. That said, the MacBook doesn’t have a multi-touch display and the integrated GPU isn’t as good the one in the Surface Laptop.
Also of note: the article makes no mention of other PC makers. Is the implication that Asus, Lenovo, HP, et al., are simply not innovating at all? |
0.999997 | What's the meaning of the phrase 'Adversity makes strange bedfellows'?
The proverbial saying 'adversity makes strange bedfellows' suggests that, in times of trouble, people who wouldn't normally associate with each other may form an alliance.
What's the origin of the phrase 'Adversity makes strange bedfellows'?
My best way is to creep under his gaberdine; there is no other shelter hereabout. Misery acquaints a man with strange bedfellows.
Illustrative, like the preceding one, of the old proverb, that adversity brings a man acquainted with strange bedfellows.
Dickens certainly didn't coin the phrase and was good enough to label it as 'an old proverb' but I can find no example of it in print before his use of it.
Party politics, like poverty, bring men 'acquainted with strange bedfellows'. - Phillip Hone Diary, 1839.
Even enemies have something in common. Statecraft produces strange bedfellows. - Peter van Greenaway Dissident, 1980.
Poverty makes strange bedfellows. - London Times headline 15 March 1982. |
0.983089 | Can you work with PTSD? The answer is not a simple yes or no, but unfortunately for many people with this condition, maintaining a job and other responsibilities is difficult or impossible. With the right treatment, though, the debilitating symptoms of PTSD lessen and it is possible to regain normal functioning. By focusing on treatment and facing past traumas, you can learn to manage and recover from this condition and get back to work.
Can You Work With PTSD?
Post-traumatic stress disorder, or PTSD, is a mental illness triggered by experiencing trauma. It causes serious symptoms that can become debilitating. You may struggle with PTSD and be unable to control your emotions and outbursts, avoid frightening thoughts, or even control flashbacks to trauma that feel very real. These symptoms and complications make working with PTSD a challenge, but it is possible.
Effective treatments for PTSD are available, and they can help you manage symptoms and be able to go back to work.
Intrusive memories. This can take the form of persistent thoughts and memories of trauma, flashbacks that make you feel as if you are reliving the experience, nightmares, and distress when faced with anything that reminds you of the trauma.
Avoidance. PTSD causes people to avoid any thing, person, event, or place that reminds them of trauma. It is also common to avoid talking about the experience at all.
Unstable reactions and behaviors. You may get startled easily and be jumpy and on guard constantly for a source of danger. PTSD can make sleeping or focusing on tasks difficult. It can also trigger anger and aggressive outbursts as well as self-destructive behaviors.
Negative thoughts and moods. This may include a negative outlook on the world, loss of interest in activities, difficulty with relationships and socializing, feelings of hopelessness, or even emotional numbness.
The intensity of symptoms of PTSD can vary a lot. One day you may feel fine until a loud noise triggers a flashback, for instance. More stress in general can also worsen symptoms.
The symptoms of PTSD can be severe and debilitating. You may have good days but also periods of time when you simply can’t function normally. When you are constantly on the lookout for danger, susceptible to terrifying memories and flashbacks, and emotionally unstable, doing normal, everyday activities becomes extremely challenging.
It’s clear that the symptoms of PTSD can lead to a number of very serious complications that impact how a person functions on a daily basis. It’s hard to go through the chores and responsibilities of a job when there are scary memories butting into your thoughts or if you feel like you need to watch out for danger around every corner.
Things like depression and low mood, difficulty interacting with others, substance use, and avoiding triggers that remind you of trauma can all impact your ability to do a job well, if at all. For too many people living with PTSD, it is not possible to work while struggling with its symptoms and complications.
Some people do continue to work and are able to function for a period of time. They may have milder symptoms or be more able to hide their negative emotions and thoughts from others. They may also have more difficulties alone or when at home at night. But, eventually, without treatment the symptoms will only get worse, function will deteriorate, and even these high-functioning individuals will no longer be able to hold down a job.
There is hope, though, because the symptoms of PTSD don’t have to last forever. If you engage in dedicated treatment, you can process trauma in a healthy, productive way. Treatment can restore function and allow you to work and support yourself again.
The most important thing anyone with PTSD can do is get treatment. Trauma-focused therapies, along with family support, medical care and medications when appropriate, social skills training, and other types of treatment can improve and ultimately restore function.
Because PTSD is so debilitating, many people benefit from intensive treatment in a residential setting. Here you can get a complete diagnosis, including any co-occurring conditions, and individualized treatment from a multidisciplinary team.
The main type of PTSD treatment is trauma-focused therapies. Experts in trauma disorders will guide you through the process of safely facing your memories of past events. They will help you learn how to control those memories, recognize and manage triggers, and change negative patterns in your thoughts and behaviors.
A good treatment plan will also include specific strategies for improving function. This may include working on social interactions and skills, job training, family therapy, and education, and relational counseling. All of this together will eventually allow you to function at work again, which means restored independence.
“My symptoms from PTSD had gotten so bad that I got fired from my job. I thought one of my coworkers was the man who assaulted me years ago. I panicked and nearly hit him. Clearly, I was unable to interact normally or safely, so I finally decided to go into treatment. After a couple of months of focused therapy and learning to face my past I was able to go back to work at a different job. I haven’t forgotten what happened to me, but the flashbacks are gone and I no longer feel so uncomfortable around other people.” —Gale M.
“One of my biggest problems with PTSD was that everything scared me. When my car broke down and I couldn’t afford to fix it, I had to take the bus to work. It became obvious that this wouldn’t be possible. Everything about riding the bus, including the sounds and smells as well as being close to other people, was terrifying. I stopped going to work simply because I couldn’t get there. After treatment at a residential center, I finally stopped being afraid. I went through therapy, but they also helped me practice daily, normal things like talking to strangers and, yes, riding the bus.” —Dante S.
“Dealing with memories of being abused as a child triggered PTSD and caused severe depression. I found I felt so bad about life and about myself that I didn’t care about anything anymore. At work, I couldn’t focus on tasks and my performance reviews went downhill fast. My boss was really understanding, but she said I needed to do something about it, and I knew she was right. I went to treatment and came out with better control over my moods. I found a medication that works for me, and I started learning that I was victimized. I was not to blame for what happened to me. My nightmares have mostly gone away, and my boss brought me back on board.” —Shannon M.
Working while struggling with PTSD is often impossible. This is why it is so important to take some time out of your life to engage in dedicated treatment. Being able to focus solely on healing from trauma will allow you to recover more quickly and get back to work and a life you love. |
0.999926 | Who first used the phrase “Web 2.0” in the first place? ( picture or video ) The one the phrase “Web 2.0” in the first place was the video.
Write a brief summary of each Web.
Web 1.0: Back then when we have retro computers, floppy disks, CDS, VHS, Hotmail, MSN and Myspace it was a simpler time and the Internet was created and everyone was amazed by it. The creator of the Internet was a man named Tim Berners-Lee without him the Internet would not have existed to this day. We should all be thankful for this guy created something amazing that have changed the world. Make sure that you celebrate his birthday which is on the June 8 to show how much we appreciate him. Thank you for giving us the Internet we all appreciate your hard work and keep the good work.
Web 2.0: When the websites we use are starting to evolve into something better to help us advance in the future. Also, you can use web applications to basically to do anything nowadays and will be less time consuming. You will be able to share your information anywhere around the world through social media.
3.What are the sites called wikis? (examples using logos) A wiki is a server program that allows users to collaborate in forming the content of a Web site. A wiki provides a simplified interface. It is not necessary to know HTML. At any time, contributors can review the history of the page they are working on or preview the Web page before publishing it.
4. Explain what is the trend named Nomadicity. The trend Nomadicity means the ability to access platforms and compute data from various types of devices.
5.What is a “Mashup” for networks? (examples) A mashup is a web application that integrates data from multiple web sources in order to provide a unique service. Internal data sources, RSS/Atom feeds, Screen-Scraping and Web Services are some resources used by mashups.
6. What do you think about the 2.0 controversy? What I think about 2.0 controversy is that , it can be very helpful or harmful depending on the situation that is occurring. Also, the situation can be solved by, finding the problem and fix so there will be peace and everyone will be happy. |
0.995341 | Along the shores of the Indian River Lagoon, one of America's most biologically diverse estuaries, hundreds of dead animals and fish are being swept to the shore, with no explanation to their mysterious deaths.
As well as many fish, more than 100 manatees, 300 pelicans and almost 50 dolphins were all found dead. Biologists are now trying to work together in order to discover what the problem is.
The lagoon is home to more than 600 species of fish and more than 300 kinds of birds, and contains more species than anywhere else in the U.S.
It stretches out over 156 miles of water and accounts for hundreds of millions of revenue from numerous water activities, including bird-watching, tourism and boating.
Being stretched across 40 percent of Florida's coast, the island complex consists of the Mosquito Lagoon, the Banana River and the Indian River Lagoon.
Although there is no known answer for these deaths, the lagoon has been polluted by nutrients and fertilisers running off lawns and farms. This can have effects on acidity, changes in water levels and salt levels.
This is good news for algae, which need high levels of nutrients to thrive, but can also have an adverse effect on the ecosystems' food supply for other animals, such as dolphins.
At present nobody can confirm the killer. There is confusion among the connection between the species problems. While manatees are vegetarians, pelicans and dolphins eat fish. The symptoms are also different, pelicans and dolphins are emaciated, while manatees' stomachs are stuffed. These differentiating factors are making the mystery difficult to solve.
Although biologists have some suspicions, they are left baffled with these illogical connections.
It is hoped that the lagoon will soon begin to recover, however it is believed that it could be close to a decade before things seem back to normal. |
0.712509 | What's behind TEPCO ban on term 'core meltdown' after Fukushima crisis?
Tokyo Electric Power Co. (TEPCO)'s then President Masataka Shimizu instructed staff not to use the term "core meltdown" when describing the disaster at the Fukushima No. 1 Nuclear Power Plant in 2011, according to a report by a third-party investigative committee of TEPCO that was made public on June 16.
The report acknowledged that the instructions were conveyed widely within TEPCO by telephone and other means. It hinted that there had been "pressure" from the prime minister's office through a request for TEPCO to provide the content of announcements in advance, but it remained unclear whether the office had any involvement in clamping down on the use of "core meltdown."
What, then, prompted TEPCO to seal off the term? According to the report, the move was triggered by a hydrogen explosion at the building of the Fukushima nuclear plant's No. 1 reactor on the afternoon of March 12, 2011, the day after the plant was crippled by the massive Great East Japan Earthquake and tsunami.
The prime minister's office was aware of the explosion from TV images. But when TEPCO went ahead and held a news conference, publicly releasing a photograph of the explosion without contacting the prime minister's office for many hours, then Prime Minister Naoto Kan and other government officials got furious. Shimizu was called to the prime minister's office on March 13 and was told to contact the office in advance when announcing important accident information.
The removal of a senior official of the then Nuclear and Industrial Safety Agency from a public relations position on March 13 after he acknowledged a core meltdown in a news conference without first contacting the prime minister's office is also thought to have influenced TEPCO.
On the evening of March 14, when then TEPCO vice president Sakae Muto was giving a news conference, a memo from Shimizu was passed to him by a company employee, saying, "By instruction of the prime minister's office, don't use 'core meltdown.'" Hints of pressure from the prime minister's office had emerged during a teleconference beforehand, with Shimizu saying reports to the prime minister's office should be made "properly, in advance."
Shimizu's position was conveyed within the company by phone and other means. The report concluded that "an understanding was shared within TEPCO that statements acknowledging a meltdown should be avoided."
After that Muto and TEPCO employees switched to the term "core damage." The report pointed out, "If the memo had not been passed over, vice president Muto may have responded differently."
The third-party investigative committee searched for the memo, which was said to be handwritten, but did not find it. The committee questioned Shimizu on two occasions over a period of about four hours, but the report concluded, "His memory has faded and clear facts could not be confirmed."
However, it quoted a TEPCO employee who was summoned in April by then Minister of Economy, Trade and Industry Banri Kaieda as saying that Kaieda had told him, "There doesn't appear to be a clear definition of a core meltdown, so let's make it the melting of fuel pellets." After that, a fax was distributed within the company saying, "'Melting of fuel pellets' is to be used. This is because 'core meltdown' conveys the image that the whole core has melted, like the China syndrome."
This was in spite of a manual that was "discovered" at TEPCO in February this year, nearly five years after the meltdowns. The manual defined a core meltdown as having occurred when over 5 percent of the reactor core had been damaged. This being the case, TEPCO could have judged as early as March 14, 2011, three days after the outbreak of the disaster, that core meltdowns had occurred.
The third-party panel report stated that quite a few of some 55 TEPCO employees in charge of TEPCO external reports had checked the manual, and rejected TEPCO's claim that "nobody had noticed" it until its "discovery."
"It would have been natural to list 'core meltdowns' in reports, but the company avoided this," the report stated.
On June 16, Democratic Party Secretary-General Yukio Edano, who was Chief Cabinet Secretary at the time of the meltdowns, told reporters in Yokkaichi, Mie Prefecture, on June 16 that he had never issued any orders to avoid use of the phrase "core meltdown."
"Neither I or then Prime Minister Kan made any such request to TEPCO," he said, adding, "During news conferences at the time I myself acknowledged core meltdowns. Putting the brakes on (the use of the term) would have been out of the question." |
0.960731 | Is a cloud-based solution pioneering the way in healthcare supply chain management?
Healthcare supply chain management is a unique ecommerce marketplace. The idea is to bring together healthcare providers, suppliers and other trading partners for simplified, efficient and cost-effective exchanges that build business and free up healthcare providers from mundane, time-consuming supply chain tasks. Synthium Health believes its advanced, cloud-enabled platform accomplishes this and more.
Using the latest in transformational technologies and digital commerce practices, Synthium Health helps cut operational costs, increase efficiencies and boost revenues all while keeping things simple. In association with third party logistics (3PL) partners, it also provides central warehousing capability, which delivers products to the door just-in-time to the healthcare provider, and much needed product visibility to all key players. “It’s a real end-to-end solution,” adds Reddy.
Engineered to be sequentially logical, robust and simple to learn, Synthium Health is a fully integrated marketplace for all healthcare trading partners. Its proprietary platform offers a range of solutions that are synergistic, customizable and scalable.
Synthium Health’s platform allows suppliers to extend their reach, compete and sell faster, and efficiently, all while cutting down on operational costs. “Our platform is designed to grow the supplier’s network of customers and allow them to collaborate and build their e-Business through a single source,” says Reddy. Suppliers can use a variety of tools on the platform, such as content management, digital commerce, marketing and selling to reach the target audience.
Manufacturers generally sell their products in one of two ways–either directly to providers or through a distributor or group purchasing organization. Synthium Health is flexible enough to be able to entertain both options. “Synthium is especially good at facilitating the go-direct option, where suppliers can communicate directly with current and potential customers through webinars, instant messaging and live chats, which leads to sales transactions,” said Reddy.
Healthcare providers are the buyers on this platform. According to Reddy, “Synthium Health not only helps optimize spend, lower costs and reduce the supply risks for these buyers, but we streamline workload efficiencies when working with multiple suppliers.” Synthium offers its buyers many services such as eSourcing, supplier management, ePurchasing, and spend analytics. The company believes healthcare providers need reliable product availability at lower costs, especially at a time when providers are having to scrutinize costs due to changes in healthcare reimbursement.
The current supply chain model in today’s healthcare industry often relies on disparate and untimely voice communications.
The Synthium Health model is event driven through proactive planning.
Medical providers are undergoing complex challenges to optimize their supply chain systems and contain costs, while medical suppliers are interested in getting their brand in front of these providers. Medical suppliers are striving to integrate with advanced technology to automate processes and optimize workflow, which in turn reduces the cost of doing business and is extended to the cost of goods sold. The outcome is a seamless process through which healthcare suppliers and providers are aligned. “The advanced technological platform streamlines processes, showcasing supplier products that healthcare providers can quickly review and purchase to meet the needs of their patients with ease,” said Reddy.
From the supplier perspective, Synthium Health provides complete asset tracking and management tools by creating an eCatalog with GTIN and RFID capture that in turn creates product transparency at all times and helps the supplier maintain accurate inventory. This also eliminates the need for trunk-stock (a pain point for medical suppliers), out of stock and expired stock, which creates optimum inventory maintenance levels.
Suppliers are also able to use resulting sales data to plan and improve production planning and forecasting. They can market new products by setting up special promotions and conducting webinars on the platform. All these tools help suppliers not only lower the cost of doing business, but also pass on the savings to buyers.
The drivers in the healthcare industry are the medical providers who are constantly looking to reduce costs as mandated by the CMS value-based reimbursement program. There are enormous benefits to providers by using Synthium Health’s platform as well as its surgery scheduling system.
By using the platform, healthcare providers are able to offer the lowest cost by transacting directly with a large network of suppliers. They can compare costs and see manufacturer specials without having to look elsewhere. Providers have the option to request quotes and set up delivery schedules. Additionally, they can set up payment options and pay through the platform.
By using Synthium Health’s unique surgery scheduling system, hospitals are able to save on storage and the cost of implants by ordering products just-in-time for a surgery. Synthium Health is able to provide this feature through strategic partnerships with manufacturers and suppliers by integrating with 3PL companies. |
0.972479 | Come up with a cool idea in a brainstorm.
Holds the agency arm-wrestling record.
Sets the strategic direction for how the firm’s client stories are positioned, pitched, placed and measured. Darlene’s background includes work in consumer goods, business services, not-for-profits and enterprise software. More importantly, she leads and motivates her incredibly talented team. As the mom of 11- and 14-year-old girls, two dogs, two cats and a bearded dragon, she’s well suited for handling the menagerie that is Hollywood Agency. Our fearless leader was named to PRWeek’s 2017 Champions of PR list of powerful and talented women who are challenging the status quo, pushing for the big idea and striving to make a difference. |
0.999869 | If you've been involved in a motorcycle accident, the first thing you need to do is hire a personal injury attorney, preferably one who's experienced in handling motorcycle accidents. You're going to need legal representation, especially when it comes to fighting the insurance company for the benefits and settlement you're entitled to. You're also going to need to take a few steps to reduce your chances of being involved in another motorcycle accident down the road.
Following your involvement in a car accident, you'll find your spare time occupied with a host of tasks such as talking to your insurance company, finding a repair service and even scheduling medical appointments if you've been injured. It's important to allow enough time for finding the right car accident attorney if you're thinking about taking legal action. You can do some research online to find appropriately experienced attorneys in your community, but it's also beneficial to contact a few offices to speak to attorneys about your case.
Due to a wide range of issues, including decreased pensions, more elderly Americans are facing financial woes. One possible solution to resolving those problems is filing for bankruptcy. There are special considerations that should be taken into account if you are a senior citizen and thinking of filing for bankruptcy. Medical Bills Unfortunately, as you age, you can face an increase in medical bills. Medical bills are often a big share of the financial problems many Americans face. |
0.999709 | After the international break Manchester United will be hoping to continue their impressive start to the campaign. The red devils are unbeaten in all competitions and sit at the top of the league jointly with Manchester City. The rest of October will see the club play in three competitions - Premier League, Champions League and the League Cup; starting with the tough task of the trip to Anfield to take on the inconsistent but dangerous Liverpool. After that we travel to Portugal to take on Benfica before our first league game against Huddersfield Town for many years. This is followed by a trip to Swansea as the defence of the League Cup continues.
The month ends with Tottenham visiting Old Trafford and Benfica making the return journey on Halloween night.
In summary for the rest of the month - 14th Oct 12.30 @ Liverpool // 18th Oct 19.45 @ Benfica // 21st Oct 15.00 @ Huddersfield Town // 24th Oct 19.45 @ Swansea // 28th Oct we welcome Spurs 12.30 // 31st October its Benfica at Old Trafford. |
0.944817 | What are the top Special Education Colleges?
There are approximately 832 on-campus special education schools for you to choose from, if you are considering a degree in special education. Or you can choose to pursue your degree from one of 3 online special education schools.
Many of those with a background in special education pursue a career as a special education professional. If you decide to go this route, you will be joining the ranks of an estimated 449,790 special education professionals in the US, according to the US Bureau of Labor Statistics. The biggest population of special education professionals can be found in New York state, which, according to 2010 numbers, is home to over 22,630 special education professionals. Approximately 536,990 special education professionals are estimated to be working in the US by 2018. This predicted growth is faster than the growth projected for all careers nationwide.
As a special education professional, you can make an average yearly salary of $49,752. But, factors such as education or your previous performance reviews can cause your salary to vary. Based on these factors, you could earn anywhere from less than $34,858 per year to more than $68,932 per year as a special education professional. |
0.995737 | What type of cat is Macavity?
A. Fill in each of the numbered blanks in the following passage with one suitable word.
B. Choose the word which best completes each sentence. |
0.97405 | The subtropics are geographic and climate zones located roughly between the tropic circle of latitude at 23.5 latitude (the Tropic of Cancer and Tropic of Capricorn) and temperate latitudes (normally temperate latitudes refer to locations higher than 40 latitude).
Subtropical climates are often characterized by warm to hot summers and cool to mild winters with infrequent frost. Most subtropical climates fall into two basic types: 1- Humid Subtropical, where rainfall is often concentrated in the warmest months (for example Brisbane, Australia or Jacksonville, Florida) and 2- Dry summer (or Mediterranean) where seasonal rainfall is concentrated in the cooler months (for example Naples, Italy or Los Angeles, California).
A great portion of the world's deserts are located within the subtropics, due to the development of the subtropical ridge. Within savanna regimes in the subtropics, a wet season is seen annually during the summer, which is when most of the yearly rainfall falls. Within Mediterranean climate regimes, the wet season occurs during the winter. Areas bordering warm oceans are prone to locally heavy rainfall from tropical cyclones, which can contribute a significant percentage of the annual rainfall. Plants such as palms, citrus, mango, lychee, and avocado are grown within the subtropics. Tree ferns and sequoia also grow within subtropical climate regimes.
The tropics have been historically defined as lying between the Tropic of Cancer and Tropic of Capricorn, located at 23.45° north and south latitude respectively. The poleward fringe of the subtropics is located at approximately 40° north and south latitude respectively. Northern fringes of the type can go further north due to moderating effects of ocean streams, like in parts of Western Europe due to heat transported by the Gulf Stream.
In the Köppen climate classification subtropical climates are classified together with colder temperate climates in the "Warm temperate climates" (letter designation C). The overbroad class C in the Köppen classification lead to newer classification schemes that divide or redefine this class into smaller classes, like the Trewartha climate classification scheme.
The humid or monsoon subtropical climate is often located on the western side of the subtropical High. Here, unstable tropical airmasses in summer bring convective overturning and frequent tropical downpours in the hot season. In the winter (dry season) the monsoon retreats, and the drier Trade Winds bring more stable airmass and often dry weather. Areas that have this type of subtropical climate include Australia, Southeast Asia, parts of South America, and the deep south of the United States. . Monsoon regions with a wet season include western Mexico. the Desert Southwest of the United States, Within the Mediterranean climate regime, the west coast of the United States and the Mediterranean coastline of Italy, Greece, and Turkey experience a wet season in the winter months. Similarly, the wet season in the Negev desert of Israel extends from October through May. At the boundary between the Mediterranean and monsoon climates in North America lies the Sonoran desert, which receives the two rainy seasons associated with each climate regime.
In locations outside the tropics, other than the drying trend in the winter, subtropical highland climates tend to be essentially identical to an oceanic climate, complete with mild summers, noticeably cooler winters and in some instances, some snowfall. In the tropics, a subtropical highland climate tends to feature spring-like weather year-round. Temperatures here remain relatively constant throughout the year and snowfall is seldom seen. Areas with this climate feature monthly averages below 22 °C (72 °F) but above −3 °C (27 °F) (or 0 °C (32 °F) using American standards). At least one month's average temperature is below 18 °C (64 °F). Without the elevation, many of these regions would likely feature either tropical or humid subtropical climates. These regions usually carry a Cwb or Cfb designation.
This type of climate exists in parts of east, south and south-eastern Africa, some mountainous areas across southern Europe, sections of mountainous Latin America, some mountainous areas across Southeast Asia, higher elevations of the southern Appalachians, the Mexican Plateau down past the 19th parallel to Morelos, and parts of the Himalayas. It also occurs in a few areas of Australia, although average high temperatures during summers there tend to be higher and the climate drier than is typical of subtropical highland climates, with maximums sometimes exceeding 40 °C (104 °F).
The Mediterranean climate regime resembles the climate of the lands in the Mediterranean Basin, parts of coastal southwestern North America, parts of Western and South Australia, in southwestern South Africa and in parts of central Chile. The climate is characterized by hot dry summers and moderate or high rainfall in winter, in areas under the constant influence of the subtropical ridge. Since mediterranean climates are primarily decided by rainfall patterns, climates that are not subtropical temperature-wise can also be mediterranean. For example San Francisco sees average highs in the warmest month below 22 °C (72 °F) with cool nights. Inland from the immediate coastlines, mediterranean climates can take on extreme temperatures. This is seen in inland California as well as Andalusia in Spain. Mediterranean climates can go as far from the equator as 49° latitude north around Vancouver, in places where a rain shadow is prevalent. Drying trends can be found even farther north, but summer precipitation usually remains significant above these latitudes. In Europe, the northernmost mediterranean climates go to around the French Riviera, located at 43° latitude. On the immediate Atlantic coastline, the mediterranean boundary goes between Porto and Vigo at around 41° latitude.
The humid subtropical climate is a subtropical climate type characterized by hot, humid summers with frequent tropical downpours of short duration and warm to cool dry winters. Normally, rainfall is concentrated in the warmest months of the year. At times, the average annual precipitation may be evenly distributed throughout the year (Trewartha climate classification: Cfa) or marked by a dry season or drying trend during winter (Trewartha climate classification: Cwa).
Humid subtropical climates lie on the east side of continents, roughly between latitudes 25° and 35° degrees away from the equator. However, the humid subtropical climates can reach as far north as 45° degrees latitudes or even slightly north of that in Europe, due to the warming influence of the Atlantic and the Mediterranean Sea in areas that do not see the summer drought such as in Milan and the surrounding region inside Northern Italy. In Asia, the poleward cool to cold winter-area of this climate type is prevalent in most of Japan, although seldom much farther north than 40° latitude.
↑ I. G. Sitnikov. "1". Principal Weather Systems in Subtropical and Tropical Zones (PDF). 1. Encyclopedia of Life Support Systems.
↑ Glossary of Meteorology (2012-04-25). "Subtropics". American Meteorological Society. Retrieved 2013-03-24.
↑ Belda et al. Climate classification revisited: from Köppen to Trewartha. In: Climate Research Vol. 59: 1-13, 2014.
↑ Köppen, Wladimir (1936). "C". In Köppen, Wladimir; Geiger (publisher), Rudolf. Das geographische System der Klimate [The geographic system of climates] (PDF). Handbuch der Klimatologie. 1. Berlin: Borntraeger.
↑ Susan Woodward (2005-02-02). "Tropical Savannas". Radford University. Retrieved 2008-03-16.
↑ Randy Lascody (2008). The Florida Rain Machine. National Weather Service. Retrieved on 2009-02-06.
↑ Remote Sensing for Migratory Creatures (2002). Phenology and Creature Migration: Dry season and wet season in West Mexico. Arizona Remote Sensing Center. Retrieved on 2009-02-06.
↑ J. Horel (2006). Normal Monthly Precipitation, Inches. University of Utah. Retrieved on 2008-03-19.
↑ Greek Embassy London (2008). Welcome to Greece. Government of Greece. Retrieved on 2009-02-06.
↑ D. Bozkurt, O.L. Sen and M. Karaca (2008). Wet season evaluation of RegCM3 performance for Eastern Mediterranean. EGU General Assembly. Retrieved on 2009-02-06.
↑ Ron Kahana; Baruch Ziv; Yehouda Enzel & Uri Dayan (2002). "Synoptic Climatology of Major Floods in the Negev Desert, Israel" (PDF). International Journal of Climatology. 22: 869. Bibcode:2002IJCli..22..867K. doi:10.1002/joc.766.
↑ Michael J. Plagens (2009). What and Where is the Sonoran Desert? Arizonensis. Retrieved on 2009-02-07.
↑ Geoffrey John Cary; David B. Lindenmayer; Stephen Dovers (2003). Australia Burning: Fire Ecology, Policy and Management Issues. Csiro Publishing. p. 33. ISBN 9780643069268. Retrieved 2013-03-24.
↑ Whipple, Addison (1982). Storm. Alexandria, VA: Time Life Books. p. 54. ISBN 0-8094-4312-0.
↑ Walter Tennyson Swingle (1904). The Date Palm and its Utilization in the Southwestern States. United States Government Printing Office. p. 11. Retrieved 2013-03-24.
↑ Wilson Popenoe (1920). Manual of Tropical and Subtropical Fruits: Excluding the Banana, Coconut, Pineapple, Citrus Fruits, Olive, and Fig. The Macmillan Company. p. 7. Retrieved 2013-03-24.
↑ R. K. Kholi; D. R. Batish & H. B. SIngh. "Forests and Forest Plants Volume II – Important Tree Species" (PDF). Encyclopedia of Life Support Systems. Retrieved 2013-04-09.
↑ P. G. Tow (2011). Rainfed Farming Systems. Springer. p. 70. ISBN 9781402091322. Retrieved 2013-03-24.
↑ John P. Schmal (2004). "Morelos, the Land of Zapata". Houston Institute of Culture. Retrieved 2013-03-24.
↑ Bureau of Meteorology (2011). "Climate of Canberra Area". Commonwealth of Australia. Retrieved 2011-01-30.
↑ Michael Ritter (2008-12-24). "Mediterranean or Dry Summer Subtropical Climate". University of Wisconsin–Stevens Point. Retrieved 2009-07-17.
↑ "Perth Monthly climate statistics". Australia Bureau of Meteorology. Retrieved 2010-08-02.
↑ Michael Ritter (2008-12-24). "Humid Subtropical Climate". University of Wisconsin–Stevens Point. Retrieved 2008-03-16.
↑ "Weather Information for Barcelona". World Weather Information Service. Retrieved 2010-08-02. |
0.950419 | How is the balance of my account calculated?
The balance that is showing in the upper-left corner of your interface is called the 'authorised balance'.
This balance takes into account all transactions, whether they are 'Settled' or 'Processing', so you always know what remains available to you.
On the other hand, for accounting reasons, your bank statements only take account of 'Settled' transactions and do not include 'Processing' operations.
Where do I find my statements? |
0.963516 | He never says a word unless he's being threatened in someway.
My question here is why the speaker used the form "is being threatened" and not "is threatened". When I should use the first form "is threatened" and not the second "is being threatened"? Is there a certain rule to follow?
If you drive carefully, you will have fewer accidents.
If you drove carefully, you wouldn't have so many accidents.
The first sentence doesn't sound like a warning to me, but rather like advice, I'd say. The second sentence uses the past tense but it is not retrospective because in conditional clauses the simple past tense-when it's used in both clauses; the main and condition clause-usually refers to either the unreal present or the unreal future but never to the past.
If you had driven carefully, you wouldn't have had so many accidents.
Which means you didn't drive carefully at some time in the past and as a result you had so many accidents.
I think the speaker in the second sentence " If you drove carefully, you wouldn't have so many accidents" is referring to unreal or imaginary condition in the present (you don't drive carefully so you do have so many accidents, but if you drove carefully, you wouldn't have so many accidents.
The trouble I am having with unreal/hypothetical conditionals is that sometimes I can't tell whether the sentence refers to a present/future real condition or to a present/future unreal condition. Is it a matter of the speaker's choice and his/her degree of certainty about the possibility of a situation-if it is likely or unlikely to happen?
If you help me now, you are a true friend.
If you helped me, you would be a true friend.
The first sentence makes a complete sense to me. It suggests that the speaker is somewhat sure that his/her friend is gonna help. Am I right there? The second sentence, however, indicates that the speaker doubts that his/her friend will lend a hand.
If they didn't show him the way, he will not find the right office.
If they don't show him the way, he will not find the right office.
If they didn't show him the way, he wouldn't find the right office.
The first sentence sounds fine (the guy has already asked for directions, but he will not find the right office unless the people he has asked them for directions have already showed him the way. Is my interpretation correct?
Usually if the condition clause (that contains the "if") is in the simple past tense, the main clause cannot be in the future tense. However, in the first sentence tenses; simple past and future are mixed up. Is this grammatical? Under which conditions can we mix up tenses like in the first sentence?
The second sentence is predictive. The speaker is certain that the guy will not find the office (as long as they don't show him the way, he definitely won't find the right office). Predictive sentences usually refer to the real future (events and situations that are possible and likely to happen). Various forms of the present tense can be used in the condition clause and different forms of the future tense can be used in the main clause. I am right?
The third sentence is also predictive but more hypothetical (less possible and unlikely to happen). The speaker in this sentence is less certain whether the guy may find the right office (I don't think he is likely to find the office). My question here is about the tense reference. Is the speaker referring to the unreal present or to the unreal future? Again, how can I tell?
If it rains tomorrow, be sure to close the windows.
If it should rain tomorrow, be sure to close the windows.
If it is raining tomorrow, be sure to close the windows.
The first and the third sentences sound perfectly correct to me. Both suggest the possibility of raining tomorrow. The third, however, implies that it is less likely to rain tomorrow but if it happens to rain, then be sure to close the windows. The use of "should" implies that something is probable, 85% likely to happen. "rains" and "is raining" suggest a higher possibility of raining, 95-100% likely to happen. Am I right?
Is the use of "should" above restricted to formal context? Is it likely to occur in everyday conversational conditionals?
If the truth is known, public opinion will change.
If the truth were known, public opinion would change.
The speaker in the first sentence is somewhat sure that if the truth is revealed, then public opinion will change whereas the speaker in the second sentence sounds less certain (if the truth were to be known-which I don't think would happen, then public opinion would probably change).
My question is again about the tense reference. Do both sentences 1&2 refer to the present unreal or to the future unreal? How can I tell if a predictive or hypothetical statement refers to the real/unreal present or future? Any specific grammatical rules?
I think overall you have a good grasp on tenses and a good understanding of how exactly to use them. I wouldn't be able to better explain how appropriate the above tense combinations are, and most of your comments make full sense to me.
I'd say the continuous form here indicates he has to be persistently threatened before we can hope to hear a word from him.
That particular one does not sound ok to me. Assuming it indeed happened in the past that he was provided with the itinerary, then I would think using 'if' isn't correct. It would have to be 'As' or 'Since' or 'Because'.
I'm sorry I can't answer your main question about real/unreal present or future. Hopefully some native will be of assistance to you : there are a couple of active grammar gurus in this forum.
What a long post! You might consider breaking it up into smaller posts so as not to scare off the reponders!
In general, native speakers don't focus much, if at all, on the question of real or unreal conditions, pasts, futures, and the like. More simply, each form tells more or less the same story, but with a different "feeling content". Moreover, native speakers don't always speak in such formulaic ways, with a clearly defined "if" and "then" clause.
The forms with "will" (or the present tense, or the imperative) are matter-of-fact in feeling-content. They are mere observations of a relationship between one situation and another.
The forms with "would" have various non-matter-of-fact elements showing the attitude of the speaker toward the facts portrayed within the condition and consequence.
"If they didn't show him the way, he will not find the right office."
This pattern is not common. The meaning to be conveyed here would likely be expressed differently.
"Well, he's certainly not going to find the right office if they didn't show him the way!"
"Well, he'll never find the right office because they didn't even show him the way!"
"How do they expect him to find the right office if they didn't (even) show him the way?" |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.