query
stringlengths 1
1.57k
| pos
stringlengths 1
22.5k
| idx
int64 0
161k
| task_name
stringclasses 1
value |
|---|---|---|---|
In ESI programme central, state, Govt. Employee contribute to the fund. Employer's contribution is - | - ESI scheme is run by contributions by employees and employers and grants from central and state governments. - the employer contributes 4.75 percent of total wage bill. Reference: Park's textbook of preventive and social medicine, 23rd edition, pg no:816 <\p> | 3,400 | medmcqa_train |
The net diffusion of water from one solution of water from one solution through a semipermeable membrane to another solution containing a lower concentration of water is termed | Osmosis is defined as the diffusion of water through a semipermeable membrane to a solution with a lower concentration of water.
Filtration is the process in which fluids are pushed through biologic membranes by unequal processes.
Diffusion (Brownian motion) is the random kinetic motion causing atoms and molecules to spread out evenly. | 3,401 | medmcqa_train |
Reaction due to lysis of bacterial cell wall &necrotic cell product ? | Ans. is 'c' i.e., Jerish herheximer reaction Ceain cell wall acting antibiotics cause rapid cell lysis and release of proinflammatory and/or toxic bacterial components, which induce inflammatory response in host. This produces a clinical syndrome known as Jarish-hersheimer reaction. The typical example is treatment of primary and secondary syphilis with penicillin, which may produce fever, malaise and exacerbation of symptoms due to Jarish -hersheimer reaction. The reaction can be managed with antipyretics and antihistaminics. About other options Ahus reaction and serum sickness are type III hypersensitivity reactions due to formation of antigen- antibody complex. In IMN, ampicillin causes rash but this is due to allergic reaction against ampicillin. | 3,402 | medmcqa_train |
Tonsillectomy is indicated in - | "Tonsillectomy is indicated when it is thought that tonsillar infection is producing secondary effects in other organs. Rheumatic fever and acute glomerulonephritis develop as an antigen-antibody reaction to streptococcal infections. Though tonsillectomy does not help an established rheumatic heart disease or nephritis, recurrent attacks can be prevented by tonsillectomy. However, in such cases before undertaking tonsillectomy, there should be no evidence of active throat infection".
Tonsillectomy is not indicated in acute tonsillitis. It is indicated in recurrent acute tonsillitis. In fact during an acute attack of tonsillitis, tonsillectomy is contraindicated. | 3,403 | medmcqa_train |
All of the following are contraceptive implants except : | Contraceptive implants are norplant, Implanon and Jadelle. Mesigyna is an injectable contraceptive. TEXTBOOK OF GYNECOLOGY SHEILA BALAKRISHNAN SECOND EDITION PAGE NO 373 | 3,404 | medmcqa_train |
Which of the following is best to sterilize heat labile solutions? | Heat sensitive liquids like serum, vaccines, antisera, enzymes, antibiotic solutions and urea solutions can be sterilized by using membrane filtration. The filtration can be aided by using either positive or negative pressure | 3,405 | medmcqa_train |
Atherosclerosis is due to | Atherosclerosis is a slowly progressive disease of large to medium-sized muscular aeries and large elastic aeries characterised by elevated focal intimal fibrofattyPlaques. Principal larger vessels affected are the abdominal aoa, descending thoracic aoa, internal carotid aeries and medium to smaller sized vessels affected are popliteal aeries, coronary aeries, and circle of Willis in brain. The atheroma may be preceded by fatty streaks that are intimal collection of lipid-laden macrophages and smooth muscle cells, occurring in persons as young as one year of age.The disease typically manifests in later life as the vessel lumen is compromised, predisposing to thrombosis and the underlying media is thinned, predisposing to aneurysm formation. It is the number one killer disease, 50 per cent of all deaths in the USA are attributed to atherosclerosis and half of theseare due to acute myocardial infarctions. The remainder include cerebrovascular accidents ("stroke"), aneurysm rupture, mesenteric occlusion and gangrene of theextremities. Etiological Factors Major risk factors in CHD have been discussed earlier. Risk of developing atherosclerosis increases with age, a positive family history, cigarette smoking, diabetes mellitus, hypeension, and hypercholesterolemia. The risk is correlated with elevated LDL and inversely related to the HDL level. Hereditary defects, e.g. familial hypercholesterolemia involving the LDL receptor or the LDL apoproteins cause elevated LDL, hypercholesterolemia andaccelerated atherosclerosis. Lesser influences on the risk of atherosclerosis include sedentary, or high-stress lifestyle, obesity and oral contraceptives.Ref: M.N. Chatterjee - Textbook of Biochemistry, 8th edition, page no: 454 - 456 | 3,406 | medmcqa_train |
Characteristics of glycoprotein -a) Protein linked with glycosidic bondb) Core proteinc) Sugar residues are long in carbohydrate portion of glycoproteind) Participate in cell surface recognition | The oligosaccharide units of a glycoprotein are covalently linked to the polypeptide by specific glycosidic bond, termed as the glycopeptide bond.
Core protein is found in proteoglycans, not in glycoproteins.
The length of the oligosaccharide chain is relatively short (2-10 sugar residues) in glycoproteins, whereas it is longer (upto 100) in proteoglycans.
Glycoproteins participate in cell surface recognition | 3,407 | medmcqa_train |
Serological examination of a patient shows positive for anti gliadin antibodies. It is characteristic of the following condition: | Celiac sprue is due to hypersensitivity to gluten, a protein found in wheat products. The disease is associated with HLA-DQ2 and HLA-DQ8. Laboratory testing shows the presence of anti-gliadin, anti-tissue transglutaminase, and anti-endomysial antibodies in patients. Clinical presentation of celiac sprue include, bloating, chronic diarrhea, and malabsorption. Extraintestinal manifestations are common. Dermatitis herpetiformis, a pruritic papular and vesicular rash on the extensor surface of the forearms, elbows, back, and buttocks is classic. Ref: Wyatt C., Kemp W.L., Moos P.J., Burns D.K., Brown T.G. (2008). Chapter 14. Gastrointestinal Pathology. In C. Wyatt, W.L. Kemp, P.J. Moos, D.K. Burns, T.G. Brown (Eds), Pathology: The Big Picture. | 3,408 | medmcqa_train |
Tamoxifen causes ? | Ans. is 'b' i.e., Endometrial hyperplasia | 3,409 | medmcqa_train |
Sigmund Freud gave various defense mechanisms. Which of the following is not a mature defense mechanism? | Ans. B. ProjectionAll of the others are mature defenses. Anticipation is goal directed and involves realistic anticipation or planning for future inner discomfort. Suppression involves the conscious postponement of attention to a conscious impulse or conflict. Altruism uses constructive and instinctually satisfying service to others to undergo a vicarious experience. Asceticism involves the assignment of value to specific pleasure and is directed against all base pleasures. | 3,410 | medmcqa_train |
Which which laser is used in the management of after cataract | NdYAG is a photo disruptive laser and is used for both posterior capsulotomy and peripheral iridotomy Refer Khurana 6th edition page number 401 | 3,411 | medmcqa_train |
True about Glomus- jugulare tumour -
a) Most common in male
b) Arises from non- chromaffin cells
c) Lymph node metastasis seen
d) Multicentric
e) Fluctuating tinnitus and conductive type of hearing loss seen | Glomus tumor is more common in females.
Glomus tumor is also referred to as chemodectomy or nonchromaffin paraganglion.
Glomus tumor is a benign tumor, therefore lymph node metastats is not present.
Multicentric tumors are found in 3-10% of sporadic cases and in 25-50% of familial cases.
Fluctuating (Pulsatile) tinnitus and conductive hearing loss are the earliest symptoms of glomus tumor. | 3,412 | medmcqa_train |
Most common neonatal disorder screened is: | Most common neonatal disorder to be screened is Neonatal hypothyroidism (NNH) Blood sample is collected from Cord's Blood /fromheel prick after 24hrs of bih Test- measurement of T4 or TSH /both simultaneously. As a single method, T4 is more useful (greater precision and reproducibility) Congenital Hypothyroidism is one of the most common preventable cause of mental retardation. Hence, neonatal screening & early supplementation of thyroid hormones can prevent this mental retardation. | 3,413 | medmcqa_train |
Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal b-globin chain. The normal sequence of the b-globin gene (HbNl) and the sequence of the HbCr b-chain are presented in the table below. HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC >>> UAU UAA Which of the following would account for the development of HbCr? | Looking at the coding segment of the normal b-gene of hemoglobin, one should read the information codon by codon, as follows: AAG UAU CAC UAA GCU CGC 1 2 3 4 5 6 The normal b-globin gene has a stop codon (UAA) at the 4th position, therefore the last 2 codons (GCU and CGC) are not translated and do not code for amino acid residues found in the protein. Comparing this information to the coding segment of the mutated b-gene of hemoglobin Cranston, one would notice the following: AAG AGU AUC ACU AAG CUC GCU UUC UAU UAA 1 2 3 4 5 6 7 8 etc etc The inseion of two base pairs (AG) results in a frameshift mutation that eliminates the stop codon at position 4, thereby causing the addition of amino acids normally not translated in the hemoglobin b-chain of the child. Since the chain is now too long, this destabilizes the tetrameric conformation of hemoglobin. A frameshift mutation resulting in deletion of several amino acids is wrong, since such a mutation would have inseed a stop codon (UAA, UGA or UAG) before position 4. A mutation in the stop codon would have resulted in a longer-than-normal b-globin gene, but the information given does not indicate any changes in the stop codon at position 4. Interestingly, a chain elongation by mutation in the stop codon exists and is known as hemoglobin Constant Spring, affecting the a-chain of hemoglobin. A point mutation is the result of a single base pair change, which is not the case here. A point mutation resulting in the inseion of a new stop codon is called a nonsense mutation, and it would result in a shoer-than-normal protein. Ref: Weil P. (2011). Chapter 37. Protein Synthesis & the Genetic Code. In D.A. Bender, K.M. Botham, P.A. Weil, P.J. Kennelly, R.K. Murray, V.W. Rodwell (Eds), Harper's Illustrated Biochemistry, 29e. | 3,414 | medmcqa_train |
All the following aeries supply the Sternocleidomastoid except | Blood supply of Sternocleidomastoid Upper 1/3: Occipital aeryMiddle 1/3: Superior Thyroid aeryLower 1/3: Suprascapular aery from thyrocervical trunkReference: Chourasia; 6th edition; 89th page | 3,415 | medmcqa_train |
Comedons are characteristics of: | Ans is 'a' i.e, Acne vulgaris | 3,416 | medmcqa_train |
A patient with primary Sjogren syndrome treated with tear replacement for symptomatic relief notes continued parotid swelling for the last 3 months. She also has enlarged posterior cervical lymph nodes. Evaluation shows leukopenia and low C4 complement levels. What is the most likely diagnosis? | Lymphoma is well known to develop specifically in the late stage of Sjogren syndrome. Common manifestations include: Persistent parotid gland enlargement Purpura Leukopenia Cryoglobulinemia Low C4 complement levels. - Most of the lymphomas are extranodal, marginal zone B cell, and low grade. Low-grade lymphomas may be detected incidentally during a labial biopsy. - Moality is higher in patients with concurrent B symptoms (fevers, night sweats, and weight loss), a lymph node mass >7 cm, and a high or intermediate histologic grade. | 3,417 | medmcqa_train |
Which of the following drug used in the Management of Pulmonary Hypeension acts by inhibiting Phosphodiesterase enzyme? | First line drugs for Functional class II-III PAH : cGMP Signaling Modulators: PDE-5 Inhibitors - Sildenafil, Tadalafil, Vardenafil cGMP Signaling Modulators: sGC Stimulator - Riociguat Endothelin Receptor Antagonists - Bosentan, Ambrisentan First line drugs for Functional class IV PAH: IP Receptor Agonists: Prostacyclin and Prostacyclin Analogs - Epoprostenol, Selexipag . L-type Ca2+ Channel Blockers like Nifedipine, Amlodipine: Use only in PAH patients with positive vasodilator testing. | 3,418 | medmcqa_train |
Energy requirement for pregnant women doing moderate physical activity with body weight 55 kg | Group Category / Age Body weight (Kg) Net energy (Kcal/d) Protein (g/d) Man Sedentary work Moderate work Heavy work 60 2,320 2,730 3,490 60.0 Woman Sedentary work Moderate work Heavy work Pregnant woman Lactation 0-6 m 6-12 months 55 1,900 2,230 2,850 +350 +600 +520 55.0 78 74 68 Infants 0-6 months 6-12 months 5.4 8.4 92 kcal/Kg/d 80 kcal/kg/d 1.16g / kg/d 1.69 g/kg/d Children 1-3 years 4-6 years 7-9 years 12.9 18.0 25.1 1,060 1,350 1,690 16.7 20.1 29.5 Boys 10-12 years 34.3 2,190 39.9 Girls 10-12 years 35.0 2,010 40.4 Boys 13-15 years 47.6 2,750 54.3 Girls 13-15 years 46.6 2,330 51.9 Boys 16-17 years 55.4 3,020 61.5 Girls 16-17 years 52.1 2,440 55.5 Energy Requirements Adult Man: ~2300 kcal/day if sedentary level worker, ~2700 kcal/day if moderate level worker and 3500 kcal/day if heavy level worker. Adult Woman: ~1900 kcal/day if sedentary level worker, ~2200 kcal/day if moderate level worker and ~2900 kcal/day if heavy level worker. Infant 0-6months: 92 Kcal/Kg/d i.e. approx. 500 kcal/day and in infants 6-12 months: 80 Kcal/kg/d i.e. approx. 670kcal/day Additional energy requirements in pregnancy: +350 Additional energy requirements in lactation: in 0-6 months is +600 kcal/day and in 6-12 months is +520 kcal/day | 3,419 | medmcqa_train |
An alcoholic patient with history diabetic nephropathy and liver failure is posted for open abdomen surgery. The most appropriate muscle relaxant in this patient is: | Cisatracurium is a stereoisomer of atracurium that is four times more potent. Like atracurium, it undergoes degradation in plasma at physiological pH and temperature by organ-independent Hofmann elimination. The resulting metabolites (a monoquaternary acrylate and laudanosine) have no neuromuscular blocking effects. Because of cisatracurium's greater potency, the amount of laudanosine produced for the same extent and duration of neuromuscular blockade is much less than with atracurium. Nonspecific esterases are not involved in the metabolism of cisatracurium. Metabolism and elimination are independent of renal or liver failure hence can be given in hepatic and renal failure. Ref: Butterwoh IV J.F., Butterwoh IV J.F., Mackey D.C., Wasnick J.D., Mackey D.C., Wasnick J.D. (2013). Chapter 11. Neuromuscular Blocking Agents. In J.F. Butterwoh IV, J.F. Butterwoh IV, D.C. Mackey, J.D. Wasnick, D.C. Mackey, J.D. Wasnick (Eds), Morgan & Mikhail's Clinical Anesthesiology, 5e. | 3,420 | medmcqa_train |
Vertibular Schwannoma, spinal cord astrocytoma, meningioma are seen in | Neurofibromatosis - 2 :
Vertibular Schwannoma.
Meningioma.
Spinal cord ependymoma.
Spinal cord astrocytoma. | 3,421 | medmcqa_train |
Aspirin is associated with- | Reye Syndrome
Secondary Mitochondrial hepatopathy.
H/o viral injection (Influenza, varicella) & salicylate interactions higher mortality rate.
LFT (raised enzyme with normal bilirubin).
Sjogren’s syndrome
Autoimmune disorder.
A/w generalised dryness (dry mouth-xerostomia, dry eye-keratoconjuncvis sicca).
A/w other rhemac disorder like - SLF, Rheumatoid arthris, systemic sclerosis.
Reiter syndrome
Auto immune.
Riad of arthris of large joint, uveis, urethris (cervicis in female). | 3,422 | medmcqa_train |
Definitive diagnosis of acute pancreatitis is done by- | Ans - A. Serum lipase activity increases in parallel with amylase activity and is more specific than amylase. A serum lipase measurement can be instrumental in differentiating a pancreatic or nonpancreatic cause for hyperamylasemia. | 3,423 | medmcqa_train |
A 25 year old person sustained injury in right eye. He developed right comeal opacity following the injury. Left eye was already having poor vision. Corneoplasty of right eye was done and vision was restored. Medicolegally such injury is labelled as : | Injuries classified as Grievous by Section 320 of IPC: Emasculation Permanent privation of the sight of either eye Permanent privation of the hearing of either ear Privation of any member or joint Destruction or permanent impairing of the powers of any member or joint Permanent disfiguration of the head or face Fracture or dislocation of a bone or tooth Any hu which endangers life or which causes the sufferer to be during the space of twenty days in severe bodily pain, or unable to follow his ordinary pursuits Reference The Synopsis of FORENSIC MEDICINE and Toxicology 29th Edition | 3,424 | medmcqa_train |
Mechanism of action of tacrolimus is ? | Ans. is 'd' i.e., Both 'a' and 'c' | 3,425 | medmcqa_train |
Detoxication of drugs is controlled by | Cytochrome p450 enzymes are microsomal enzymes that are involved in phase I metabolism of many drugs,
Most of the drugs are metabolized by CYP 3 A4 isoform. Drug metabolizing enzymes The drug-metabolizing enzymes are divided into two types :
1. Microsomal These are located on smooth endoplasmic reticulum primarily in the liver, also in kidney, intestinal mucosa and lungs.
Examples are monooxygenase, cytochrome P450, glucuronyl transferase.
They catalyze most of the oxidation, reduction, hydrolysis and glucuronide conjugation.
They are inducible by drugs, diet and other agencies.
2. Nonmicrosomal These are present in the cytoplasm and mitochondria of hepatic cells as well as in other tissues including plasma.
Examples are flavoprotein oxidase, esterases, amidases and conjugases.
They catalyze some oxidation and reduction, many hydrolysis and all conjugation except glucuronidation.
They are not inducible but many show genetic polymorphism (acetyltransferase, pseudocholinesterase) | 3,426 | medmcqa_train |
Homonymous hemianopia with sparing of pupillary reflexes Is a feature of lesions of | Lesions of lateral geniculate body These produce homonymous hemianopia with sparing of pupillary reflexes, and may end in paial optic atrophy. Lesions of optic radiations Pupillary reactions are normal as the fibres of the light reflex leave the optic tracts to synapse in the superior colliculi. Lesions of optic radiations do not produce optic atrophy, as the second order neurons (optic nerve fibres) synapse in the lateral geniculate body. Common lesions of the optic radiations include vascular occlusions, primary and secondary tumours, and trauma. Lesions of the visual coex Congruous homonymous hemianopia usually sparing the macula, is a feature of occlusion of posterior cerebral aery supplying the anterior pa of occipital coex. Congruous homonymous macular defect occurs in lesions of the tip of the occipital coex following head injury or gun shot injuries. Pupillary light reflexes are normal and optic atrophy does not occur following visual coex lesions. Ref:- A K KHURANA; pg num:-290,291 | 3,427 | medmcqa_train |
The most impoant action of beta-blockers in glaucoma is : | Ref: KD Tripathi pharmacology 7th edition (page.no: 144) Topical b blockers are one of the first-line drug for glaucoma In contrast to miotics, the b blockers do not affect pupil size, the tone of ciliary muscle or outflow facility, but lower i.o.t. by reducing aqueous formation. This probably results from down-regulation of adenylyl cyclase due to b 2 receptor blockade in the ciliary epithelium and a secondary effect due to a reduction in ocular blood flow. | 3,428 | medmcqa_train |
A 6 year old girl is easily distracted in class and exhibits poor scholastic performance. Seizures are precipitated by hyperventilation. What is the probable diagnosis? | Typical absence seizures are characterized by sudden, brief lapses of consciousness without loss of postural control. The seizure typically lasts for only seconds, consciousness returns as suddenly as it was lost, and there is no postictal confusion. Although the brief loss of consciousness may be clinically inapparent or the sole manifestation of the seizure discharge, absence seizures are usually accompanied by subtle, bilateral motor signs such as rapid blinking of the eyelids, chewing movements, or small-amplitude, clonic movements of the hands. Typical absence seizures are associated with a group of genetically determined epilepsies with onset usually in childhood (ages 4-8 years) or early adolescence and are the main seizure type in 15-20% of children with epilepsy. Since the clinical signs of the seizures are subtle, especially to parents who may not have had previous experience with seizures, it is not surprising that the first clue to absence epilepsy is often unexplained "daydreaming" and a decline in school performance recognized by a teacher. Hyperventilation tends to provoke these electrographic discharges and even the seizures themselves and is routinely used when recording the EEG. Ref: Lowenstein D.H. (2012). Chapter 369. Seizures and Epilepsy. In D.L. Longo, A.S. Fauci, D.L. Kasper, S.L. Hauser, J.L. Jameson, J. Loscalzo (Eds), Harrison's Principles of Internal Medicine, 18e. | 3,429 | medmcqa_train |
Inheritence of ichthyosis vulgaris is : | C i.e. Autosomal dominant | 3,430 | medmcqa_train |
The following antibiotic accentuates the neuromuscular blockade produced by pancuronium: | * Aminoglycosides (like streptomycin and gentamicin) can accentuate the neuromuscular blockade produced by competitive blockers (like pancuronium). * Mechanism of neuromuscular blockade produced by aminoglycosides is the inhibition of presynaptic release of ACh. | 3,431 | medmcqa_train |
Biosynthesis of glucuronic acid requires the | Glucuronic acid is a sugar acid derived from glucose, with its sixth carbon atom oxidized to a carboxylic acid. In living beings, this primary oxidation occurs with UDP-a-D-glucose (UDPG), not with the free sugar.Ref: DM Vasudevan, 7th edition, page no: 120 | 3,432 | medmcqa_train |
All nerves pass thorugh greater sciatic notch except ? | Ans. is 'd' i.e., Obturator nerve | 3,433 | medmcqa_train |
Steroids are useful in treating Tuberculosis patient with- | Glucocoicoids reduce inflammation and limit tissue damage; they are currently recommended when treating pericardial ,lymphadenitis patients having TB or meningeal disease, and in children with endobronchial disease. They may confer benefit in TB of the ureter, pleural effusions and extensive pulmonary disease, and can suppress hypersensitivity drug reactions. Surgery should be considered in cases complicated by massive haemoptysis, loculated empyema, constrictive pericarditis, lymph node suppuration, and spinal disease with cord compression, but usually only after a full course of antituberculosis treatment. Ref Harrison20th edition pg 980 | 3,434 | medmcqa_train |
Intravascular hemolysis occurs in: | PNH is a disease that results from acquired mutations in the phosphatidylinositol glycan complementation group A gene (PIGA), an enzyme that is essential for the synthesis of certain cell surface proteins.
Red cells, platelets, and granulocytes deficient in these GPI-linked factors are abnormally susceptible to lysis by complement. In red cells, this manifests as intravascular hemolysis, caused by the C5b-C9 membrane attack complex.
The triad of hemolysis, pancytopenia and thrombosis is unique to PNH.
Thrombosis is the leading cause of disease-related death in PNH.
PNH is best made with flow cytometry in which there is presence of bimodal distribution of the red cells. | 3,435 | medmcqa_train |
Graveyard of ENT surgeon | Tonsilolingual sulcus is seat of carcinoma usually missed by ENT doctor in OPD to check. | 3,436 | medmcqa_train |
Compression of a nerve within the carpal tunnel products inability to | FLEXOR RETINACULUM Transverse carpal ligament. Strong fibrous band which bridges anterior concavity of carpus and conves it into osseofibrous tunnel callef carpal tunnel for the passage of flexor tendons of the digits. Rectangular.Formed due to thickening of deep fascia in front of carpal bones. Attachments: medial-pisiform , hook of hamate.Lateral-tubercle of scaphoid and crest of trapezium. Structures passing superficial to flexor retinaculum:-(medial to lateral)1. Ulnar nerve 2. Ulnar aery 3. Posterior cutaneous branch of ulnar nerve.4. Tendon of palmaris longus.5. Palmar cutaneous branch of median nerve.6. Superficial palmar branch of radial aery. Structures passing deep to flexor retinaculum:-1. Tendon of FDS2. Tendon of FDP 3. Tendon of FPL.4. median nerve. Ulnar bursa-tendons of FDS&FDP.Radial bursa- tendon of flexor pollicis Flexor carpi radialis pass through separate canal. CARPAL TUNNEL SYNDROME:-Injury to median nerve in carpal tunnel.Causes:-Tenosynovitis of flexor tendons.MyxedemaRetention of fluid in pregnancy Fracture dislocation of lunate bone.Osteoahritis of wrist. Symptoms:-1. Feeling of burning pain or " pins & needles " along lateral 3 and half digits especially at night.2. Weakness of thenar muscles.3. No sensory loss over thenar eminence.4. Ape thumb deformity if left untreated.5. Positive phalens abd tinel's sign.Phalen' sign-flexion of both wrists against each other for one minute reproduces the symptoms.Tinel's sign- percussion over flexor retinaculum reproduces symptoms. {Reference:vishram singh, page no.196,} mnemonic: Spm fully Boring Flexor digitorum Superficalis tendon, flexor digitorum profundus tendon, median nerve, Flexor poLLicis longus, Bursae- radial & ulnar | 3,437 | medmcqa_train |
Minimum effective dose of Ethinyl estradiol in combination oral pills is | Ans. is a i.e. 20p.g -intensive pharmacological research clinical trials conducted to minimise the adverse effects of estrogen without reducing the contraceptive efficacy, resulted in lowering the dose of oestrogen to a minimum of 20gg or even 15gg." Examples of pills with 20p.g estrogen : Femilon : Loette Estrogen (EE) = 2opg Estrogen (EE) = 20pg Progestin (Desogestrel) = 0.15mg Progestin (Levonorgestrel) = 0.1mg Benefits of Low dose OCP's Decreased risk of Thromboembolic events with low dose OCP's.deg Note : Thrombosis risk is apparent by 4 months after staing estrogen containing OC's and does not increase fuher with continued use. Risk is highest during the first year of useq Decreased risk of high blood pressure (as compared to traditional high dose OCP's) Minimum adverse effect on lipid profile Less complains of Nausea and vomiting (as these complications are related to Estrogen component). The beneficial effects and efficacy of low dose OCP's is similar to traditional high dose OCP's whereas side effects have decreased. Extra Edge : Once a month (long acting pill). Contains : Ouniestrol (long acting estrogen) + sho acting progestin. | 3,438 | medmcqa_train |
A 65 year old elderly male has history of sweating and chest pain for last 24 hrs with the following ECG. Which of the following is not given in managing the patient? | Ans. C. Thrombolytic therapyFirst let us diagnose the ECG; we need to know the following points:E.C.G changes in acute infarctionEarly acute phase (with - in hours)Fully evolved phaseOld infarction (resolution phase)Elevation of ST segmentPathological Q warePathogical Q waveTall wide (peaked) T waveElevated ST segment being to resolveT wave inverts.ST segment and T wave may be normalST segment elevation, unlike depression, will localize to the ECG lead of the affected myocardium. Note that 1mm of ST elevation in 2 contiguous leads is required to diagnose STEMI, however there are two major exceptions.a. Anterior STEMI requires 2mm of ST elevation in V2 and V3 in men > 40 years old or 1.5mm in women according to the ACC/AHA definition.b. Posterior STEMI frequently has ST depression in V1-V3 instead of elevation since the vectors are completely reversed. Hence, this is an ECG of anterior STEMI.In STEMI, thrombolysis or PCI (primary PCI) are effective methods to restore coronary blood flow and salvage myocardium within the first 12 h after onset of chest pain.ST elevation MI (STEMI) Immediate management:a. Nitratesb. Morphinec. Oxygend. AspirinStart adjunctive treatmenta. Beta blockers (IV)b. Nitroglycerine (IV)c. Heparin (IV)Reperfusion therapy is the definitive treatment of choice if patient present < 12 hours.a. Thrombolysis (Streptokinase)b. Early primary PCI | 3,439 | medmcqa_train |
Glomus tumor invading the veical pa of carotid canal. It is | Ans. is 'c' i.e., Type C2 Fisch classification The Fisch classification of glomus tumors is based on extension of the tumor to surrounding anatomic structures and is closely related to moality and morbidity. Type A :- Limited to middle ear cleft (glomus tympanicum). Type B :- Limited to tympanomastoid area with no involvement of infralabyrinthine compament. Type C :- Involving infralabrinthine compament extending upto petrous apex Type C1 :- Limited involvement of veical poion of carotid canal Type C2 :-Invading veical poion of carotid canal Type C3 :-Invasion of horizontal poion of carotid canal Type D Intracranial extension Type D1 Intracranial extension < 2 cm in diameter Type D2 :-Intracranial extension > 2 cm in diameter | 3,440 | medmcqa_train |
Essential amino acids are A/E - | - essential aminoacid are the one that cannot be synthesised in the body corresponding to the needs. Thus need to be supplied through diet. - they are leucine, isoleucine, lysine, methionine, phenylalanine, threonine, valine, tryptophan and histidine. Reference : Park's textbook of preventive and social medicine, 23rd edition, pg no:609 <\p> | 3,441 | medmcqa_train |
Ascospore is - | FUNGAL SPORES
Most fungi reproduce through the generation of spores
Fungi produce spores by two methods-
Sexual reproduction → Sexual spores
Asexual reproduction → Asexual spores | 3,442 | medmcqa_train |
In a neonate, cessation of breathing for 10 second with bradycardia is: | a. Apnea(Ref: Nelson's 20/e p 849)Apnea in a newborn is defined as: cessation of respiration for 20 seconds with or without bradycardia and cyanosis or cessation of respiration for less than 20 seconds if it is associated with bradycardia or cyanosis. | 3,443 | medmcqa_train |
4 years old child having palpable abdominal mass & hypertension with sweating and diarrhea is due to - | Ans. is 'a' i.e., NeuroblastomaNeuroblastoma - (Ghai 7th/ep. 590)o M.C. Intraabd solid tumor in children,o M.C. site of primary tumor:# Adrenal gland (30%)o Paravertebral retroperitoneal (28%)o Metastasis usually skeletal (facial bone/skull).o May be associated with sweating, diarrhea, hypertension. Cerebellar sign, opsoclonus.Wilms Tumor (Nebroblastoma) - (Ghai 7th/ep. 591)o M.C. malignant tumor of kidney,o Present in early childhood,o Abdominal mass.o May have hematuria, hypertension, abd. pain, fever.PCKD - (Ghai 7th/e p. 471)o Infantile form & adult form,o Infantile-ARo Adult - ADTnt. with abdominal cystic mass. | 3,444 | medmcqa_train |
''Sleep apnoea '' is defined as a temporary pause in breathing during sleep lasting at least- | Sleep OSAHS also may be diagnosed in the absence of symptoms if the AHI is above 15. Each episode of apnea or hypopnea represents a reduction in breathing for at least 10 sec Ref Harrison 19th edition pg 1723 | 3,445 | medmcqa_train |
A 2-year-old unresponsive child came to casualty with history of fall from a height. On examination, he is responsive to verbal stimuli intermittently, respiratory rate is 30 per min, pulse 130 per min, spO2 is 94% and BP is 104/60 mm Hg. What should be the next step of management? | c. Start oxygen by face mask, immobilize cervical spine and transfer to a tertiary centre accompanied by doctor(Ref: Nelson's 20/e p 545-552)The best management in this case is to supplement O2 as there is hypoxia, to prevent further CNS injury; Cervical spine should be immobilized and the patient should be transferred to a tertiary centre accompanied by doctor. | 3,446 | medmcqa_train |
Most common cause of amoebic lung abscess is : | Answer is B (Direct spread from liver): An amoebic lung abscess is almost always secondary to spread from the liver. Extraintestinal infection by E. histolytica most often involves the liver. Fuher involvement most commonly leads to Amoebic lung abscess. Infact pleuropulmonary involvement (Lung): is the most frequent complication of Amoebic liver abscess. Remember: Most common cause of a lung abscess is - 'Aspiration'. However this holds true for pyogenic (bacterial lung abscess) | 3,447 | medmcqa_train |
Muscle of neck with dual nerve supply | Digastric muscle Digastric has two bellies United by an intermediate tendon. NERVE SUPPLY; anterior belly by nerve to mylohyoid, facial nerve. ACTIONS; 1. Depresses mandible is opened widely or against resistance it is secondary to lateral pterygoid. 2. Elevates hyoid bone. Ref BDC volume 3;6th edition | 3,448 | medmcqa_train |
Patients on isoniazid which vitamin deficiency is more likely to be seen. | Ans. (c) Vitamin B6Ref. KDT 6th ed. / 740-41* For patients who are on isoniazid; peripheral neuropathy is observed in 10-20% of patients given dosages greater than 5 mg/kg/d but is infrequently seen with the standard 300 mg adult dose.* Pyridoxine (Vit B6), 25-50 mg/d, is recommended for those with conditions predisposing to neuropathy, an adverse effect of isoniazid.* NOTE: Isoniazid as a single agent is also indicated for treatment of latent tuberculosis. The dosage is 300 mg/d (5 mg/kg/d) or 900 mg twice weekly for 9 months. | 3,449 | medmcqa_train |
Denominator of positive predictive value | Ans. c (Number of true positives + number of false positives) (Ref. Park PSM 22nd/pg. 131).TopicEquation SensitivitySensitivity =a--a+cSpecificitySpecificity =d-b+dPositive predictive valuePPV =a--a + b Negative predictive valueNPV =d--c+d Relative riskRR =a--a + b c--c+d Attribute riskAR =a--a+bc--c+dHardy-Weinberg equilibriumP2 + 2pq + q2 =1p + q = lThe positive predictive value. or precision rate, is the proportion of patients with positive test results who are correctly diagnosed. It is considered the physician's gold standard, as it reflects the probability that a positive test reflects the underlying condition being tested for.Related calculationsFalse positive rate (a) = FP/(FP +TN) = 18/(18+182) = 90% = 1 - specificityFalse negative rate (b) = FN/(TP+FN) =1 (2+1) = 33% = 1 - sensitivityPower =1 - bDefinition:PPV =Number of True Positives-----------------------------------------Number of true positives + Number of False Positives or, alternatively.PPV =(Sensitivity) (prevalence)----------------------------------(Sensitivity) (prevalence) + (1 - specificity) (1 - prevalence)The negative predictive value is the proportion of patients with negative test results who are correctly diagnosed.NPV =Number of True Negatives----------------------------------------Number of True Negatives + Number of False Negatives or alternatively.NPV =Specificity x (1 - prevalence)----------------------------------Specificity x (1 - prevalence) + ( 1 - sensitivity) x prevalence | 3,450 | medmcqa_train |
Superolateral boundary of axillary dissection is: | Axillary Node Clearance Axillary node clearance is defined as clearing of the axillary contents bounded by: Laterally: Axillary skin Posteriorly: Lattisimus dorsi, Teres major and subscapularis Superiorly: Lower border of axillary vein Anteriorly: Pectoralis muscle Medially: Chest wall | 3,451 | medmcqa_train |
Which of the following has propensity to metastasize through lymph nodes ? | Ans. is 'a' i.e., Alveolar rhabdomyosarcoma | 3,452 | medmcqa_train |
Which of the following is Tensor of the vocal cord | Intrinsic muscles of larynx They may act on vocal cords or laryngeal inlet. (a) Acting on vocal cords:- * Abductors:- Posterior cricoarytenoid * Adductors:- Lateral cricoarytenoid , Interarytenoid (transverse arytenoid), Thyroarytenoid (external pa) * Tensors:- Cricothyroid , Vocalis (internal pa of thyroarytenoid). Ref:- Dhingra; pg num:-283 | 3,453 | medmcqa_train |
Rocker bottom foot is due to ? | Ans. is 'a' i.e., Overeatment of CTEV Rocker bottom foot Rocker bottom foot is a foot with a convex plantar surface with an apex of convexity at the talar head (normal plantar surface is concave). Causes of Rocker Bottom foot are :- Congenital veical talus Overcorrection of CTEV Improper correction of CTEV, i.e. forceful correction of equines by dorsiflexion before correction of adduction, varus and inversion. Edward's syndrome, Escobar syndrome, Ape's syndrome. Congenital veical talus may be associated with ahrogryposis, Prune belly syndrome, neurofibromatosis, and spinal muscular dystrophy | 3,454 | medmcqa_train |
Hypoglycemia is defined as a blood glucose value of less than | Hypoglycemia is defined as a blood glucose value of less than 40 mg/ dl (plasma glucose of less than 45 mg/ dl). These babies should be screened for hypoglycemia at 2, 6, 12, 24, 48 and 72 hr after bih with reagent strips (dextrostix).Babies showing blood sugar value of less than 40 mg/ dl on reagent strip should be treated for hypoglycemia but should have confirmation of hypoglycemia by a lab test Appropriate for gestational age babies who are breastfeeding adequately do not require any screening for hypoglycemia.Ref: Paediatrics; O.P. Ghai; 8th edition; Page no: 179 | 3,455 | medmcqa_train |
Typhoid Vi polysaccharide vaccine is usually administered in children above the age of- | Ans. is 'c' i.e., 2 years o The Vi polysacchiride vaccine is licensed for individuals aged 2 years because it does not elicit immune response in children less than 2 years. | 3,456 | medmcqa_train |
Which parotid tumor spreads along nerve sheath ? | Adenoid cystic carcinoma has got high affinity for perineural spread(both axially and circumferentially;antegrade and retrograde fashion) along mandibular and maxillary divisions of trigeminal (common) and facial nerve .It infiltrates nerve more proximally for long distance. Tumor may reach Gasserian trigeminal ganglion ,pterygopalatine ganglion and cavernous sinus SRB,5th,417 . | 3,457 | medmcqa_train |
All are features of psychosis except - | Ans. is 'c' i.e., Preserved contact with reality Psychosiso Psychosis is a mental state involving the loss of contact with reality, causing deterioration of normal social functioning. The characteristic features of psychosis are : -Gross impairment in reality testing, i.e., loss of contact with reality.Marked disturbance in personality and behavior with impairment in social, interpersonal and occupational functioning.Marked impairment in judgement.Loss of insight (insight is an assessment of how aware the patient is of their own mental illness).Presence of characteristic symptoms like delusions and hallucinations, these are called psychotic symptoms.o The major psychosis are : -Organic psychotic disorders, e.g., Delirium, substance related psychosis, head trauma.Non-organic psychosesMajor psychoses : - Schizophrenia, mood disorders (depression, mania, bipolar).Other psychotic disorders (third psychosis): - Delusional disorders, acute and transient psychotic dis- orders, schizoaffective disorderNeurosiso Neurosis is a general term referring to mental distress that, unlike psychosis, does not prevent rational thought and daily functioning. Characteristic features are : -Symptoms cause subjective distress to the patient.Insight is present (symptoms are recognised as undesirable).The personality and behaviour are relatively preserved as is the judgement.The contact with reality is preserved.Absence of organic causative factor.o Important neurotic disorders are Anxiety disorders (Panic), Phobia (Phobic anxiety disorder), obsessive compulsive disorder, Dissociative conversion disorder. | 3,458 | medmcqa_train |
Hemoglobin does not bind with: | Hemoglobin Combines Reversibly With Oxygen.
Carbon monoxide (CO) combines with hemoglobin at the same point on the hemoglobin molecule as does O2 ; it can therefore displace O2 from the hemoglobin.
CO2 reacts directly with amine radicals of the hemoglobin molecule to form the compound carbaminohemoglobin (CO2 Hgb).
This combination of CO2 and hemoglobin is a reversible reaction that occurs with a loose bond, so the CO2 is easily released into the alveoli, where the PCO2 is lower than in the pulmonary capillaries.
Reference: : Guyton physiology pg no 532,535 | 3,459 | medmcqa_train |
All of the following are haemoproteins, EXCEPT: | Haemoproteins:- A haemoprotein or heme protein, is a protein that contains a heme prosthetic group. Heme containing proteins: Hemoglobin Myoglobin Cytochromes (ETC Components) Heme containing enzymes Catalase Peroxidase Tryptophan dioxygenase/Tryptophan pyrrolase Few more examples:- Cytoglobin Neuroglobin SolubleGuanylyl cyclase NADPH oxidase Nitric oxide synthase (NOS) | 3,460 | medmcqa_train |
What is true regarding byssinosis? | Byssinosis - due to cotton dust exposure - presents with Monday Chest tightness which resolves with cessation of cotton dust exposure. - Byssinosis presents as hypersensitivity pneumonitis with the honey-comb lung. - Lymphocytes and not eosinophils are present in bronchoalveolar lavage of hypersensitivity pneumonitis patients. | 3,461 | medmcqa_train |
Which one can have more than one value | In a central tendancy of distribution :
Mean is the best measure.
Mode is most frequently occuring value in the given distribution.
Mode may be bimodal or trimodal.
Mode = 3 mediam - 2 mean. | 3,462 | medmcqa_train |
In magil circuit airflow is - | In Magills it fresh gas flow is equal to minute volume. In Bains co-axial system or type D ,fresh air flow required to prevent rebreathing is 1.6minute volume | 3,463 | medmcqa_train |
In hilum of right lung which of the following is the uppermost structure | Right lung(above downwards) Epaerial bronchus Pulmonary aery Hypaerial bronchus Inferior pulmonary vein Left lung Pulmonary aery Bronchus Inferior pulmonary vein <img src=" /> Ref. BD Chaurasia volume 1 page 226 | 3,464 | medmcqa_train |
In a patient with mitral stenosis, disappearance of Loud S1 is associated with all except | ANS. DConditions associated with dulling of SI (disappearance of loud SI) in patient with mitral stenosis:1. Calcified mitral valve2. Aortic regurgitation (AR)3. Mitral regurgitation (MR)Absence of presystolic accentuation in mitral stenosis:1. Atrial fibrillation2. Presence of MR3. Flabby left atrium4. Atrial septal defect (ASD)5. After surgery6. Junctional rhythm. | 3,465 | medmcqa_train |
In basic model of Nuclear family life, the phase of family life cycle beginning with birth of last child and ending with leaving of home of first child is known as? | Ans. c (Complete extension) (Ref. Park Textbook of PSM 22nd/pg.635)A family is a primary unit in all socities. Familes are not constant. A normal family-cycle is generally conceived as having six phases as follows:BASIC MODEL OF NUCLEAR FAMILY LIFE CYCLE Phase of family cycleCharacterizing EventsNo.DescriptionBeginning of phaseEnd of phaseIFormationMarriageBirth of 1st childIIExtensionBirth of 1st childBirth of last childIIIComplete extensionBirth of last child1st child leaves homeIVContraction1st child leaves homeLast child has left home of parentsVCompleted contractionLast child has left home of parents1st spouse diesVIDissolution1st spouse diesDeath of survivor (Extinction) | 3,466 | medmcqa_train |
Dofetilide belong to? | Ibutilide, dofetilide, sotalol, amiodarone are class 3 agents they are potassium channel blockers- they r broad spectrum antiarrhythmic agents they increase QT interval | 3,467 | medmcqa_train |
A young girl presents with abdominal pain and a recent change in bowel habit, with passage of mucus in stool. There is no associated blood in stool and symptoms are increased with stress. The most likely diagnosis is: | IBS is a disorder for which no pathognomonic abnormalities are identified. Females are more commonly affected. People of all age groups are affected, but most have the onset of symptoms before 45 years. Patients usually presents with recurrent lower abdominal pain, abdominal bloating and altered bowel habits. Stool is accompanied by large amount of mucus, Bleeding is not a feature. Symptoms occur at times of stress or emotion. Ref: Harrison's principles of internal medicine 18th edition, Chapter 296; Current medical diagnosis and treatment 2012, Chapter 35; Current medical diagnosis and treatment 2012, Chapter 15. | 3,468 | medmcqa_train |
Retraction of scapula at sternoclavicular joint is done by: | Retraction means moving backward of scapula at sternoclavicular joint. It is done by the following muscles: Trapezius Rhomboid major Rhomboid minor. Subscapularis helps in medial rotation of humerus. Serratus anterior helps in protraction of scapula. Supraspinatus helps in adduction. | 3,469 | medmcqa_train |
Which of the following factors of balanced occlusion is given by the patient? | Condylar guidance
Definition: The mechanical form located in the upper posterior region of an articulator that controls movement of its mobile member (GPT8).
Condylar guide inclination: The angle formed by the inclination of a condylar guide control surface of an articulator and a specified reference plane (GPT8).
This is the mandibular guidance generated by the condyles traversing the contours of the glenoid fossa.
It is duplicated in the articulator. The extent of duplication depends on the articulator’s capability, whether it is semi-adjustable or fully adjustable.
Protrusive condylar guidance is obtained using protrusive records,while the lateral condylar guidance is obtained using Hanau’s formula or lateral records
It is designated as an inclination or angle – condylar guidance angle or inclination – and is expressed in degrees.
This is the only factor that is obtained from the patient and is not under the dentist’s control.
A shallow condylar guidance will cause less posterior tooth separation in protrusion and requires teeth with shorter cusps and flatter fossa to achieve balanced occlusion, than a steep guidance.
Key Concept:
Out of the five factors of balanced occlusion, only condylar guidance is recorded from the patient by the means of protrusive records. | 3,470 | medmcqa_train |
Elek's gel precipitation test is for - | Ans. is 'b' i.e., Diphtheria | 3,471 | medmcqa_train |
A patient with hea failure developed recurrent sustained monomorphic vt .Treatment is/are - | Sustained monomorphic VT associated with nonischemic cardiomyopathy is usually due to scar-related reentry. On cardiac MR imaging, scars are detectable as areas of delayed gadolinium enhancement and are more often intramural or sub-epicardial in location as compared with patients with prior MI. Any cardiomyopathic process can cause scars and VT, but cardiac sarcoidosis, Chagas disease, and cardiomyopathy due to Lamin A/C mutations are paicularly associated with monomorphic VT . An ICD is usually indicated with additional drugs or catheter ablation for control of recurrent VT. Harrison 20thed pg 1758 | 3,472 | medmcqa_train |
All are true about meningiomas except - | Ans. is 'c' i.e.. They are attached to pia matterMeningiomas are amont the most frequent primary brain tumors.o Although most meningiomas ae benign, their location in the central nervous system can cause serious morbidity or mortality.Clinical presentationo Meningiomas can arise anywhere from the dura most commonly within the skull and at sites of dural reflection (Falx cerebri, fentorium cerebelli, venous sinuses). Other less common sites include the optic nerve sheath and choroid plexus; approximately 10 percent arise in the spine. Very rarely, menningiomas can arise at extradural sites.o Symptoms from a mengioma are determined by the location of the mass and by the time course over which the tumor develops.o Meningioma frequently are extremely slow growing and often are asymptomatic.Asymptomatic tumorso Many meningiomas are asymptomatic or minimally symtomatic, and are discovered incidentlally on a neutroimaging study or at autopsy.Seizureso Seizures are present preoperatively in 25 to 40 percent of patients who are diagnosed with an intracranial meningioma.Focal findingso Characteristic focal deficits are caused by tumors in specific locations.MeningiomaVisual changesHearing lossMental statusExtremityObstructiveSpontaneous changesweaknesshydrocephalyhemorrhage | 3,473 | medmcqa_train |
Serum sickness is which type of hypersensitivity reaction? | Ans. c (Type III). (Textbook of Microbiology by Ananthnarayan, 6th ed., 155)HYPERSENSITIVITY ReactionsTypeMechanismE.g.Hints to rememeberType I(Anaphylactic and Atopic)Antigen cross -links IgE on presensitized mast cells and basophils, causing of vasoactive amines (i.e., histamine) release.- Anaphylaxis,- Asthma,- Hives- Local wheal and flareFirst and fast (anaphylaxis)Type I, II, and III are all antibody mediated.Type II Cytotoxic(antibody mediated)Antibody mediatedIgM, IgG bind to antigen on "enemy" cell, leading to lysis (by complement) or phagocytosis.- Autoimmune Hemolytic anemia,- Rh disease,- Good pasture's syndrome,- Rheumatic fever,- Grave's disease,- Bullous pemphigoid,- Myasthenia gravis,- ITP.Cy-2-toxic.Antibody and complement lead to membrane attack complex (MAC).Type IIIC-ComplementImmune complexImmune complex-- activate complement, which attracts neutrophils; neutrophils release lysosomal enzymes,- PAN,. Immune complex GN, SLE, rheumatoid arthritis.- Serum sickness--antibodies to the foreign proteins are produced (takes 5 days). Immune complexes form and are deposited in membranes, where they fix complement (leads to tissue damage).More common than Arthus reaction.- Arthus reaction--fntraderma! Injection of antigen induces antibodies, which from antigen-antibody complexes in the skin, causing edema, necrosis and activation of complement.Imagine an immune complex as 3 things stuck together; antigen antibody- complementType IVDelayed(cell mediated)Delayed (T cell mediated) type - sensitized T lymphocytes encounter antigen and then release lymphokines (leads to able by macrophage activation).- 4T's -- T lymphocytes,- Transplant reactions,- TB skin tests,- Touching (contact dermatitis). Hypersensitivity pneumonitis (farmer's lung) by Thermophilic actinomycetes....as per Harrison's 17th ed.4th and last - delayed. | 3,474 | medmcqa_train |
While discharging a patient of meningitis due to H. influenzae the essential step you will do - | Ans. is 'c' i.e., Bilateral evoked auditory response o Nontypable H. influenzae is one of the three most common causes of childhood otitis media.o The other two beingStreptococcus pneumoniae andMoraxella catarrhaliso The diagnosis is made by pneumatic otoscopyAn etiologic diagnosis, although not routinely sought, can be established by tympanocentesis and culture of m iddle-ear fluid.o A diagnosis of otitis media is based on theDetection by pneumonic otoscopy of fluid in the middle ear andBilateral evoked auditory response | 3,475 | medmcqa_train |
Tonsillectomy following peritonsilar abscess is done after weeks - | Ans- C 6-8 weeks Ref. Turner 7 Oth/ed p 86; Head and Neck Surgery by Chris DeSouza Vol 2 p 7583 a. Friends, Dhingra and Turner have a different opinions on this one. b. According to Turner 10th/ed p 86-'The tonsils should be removed 6-8 weeks following a Quinsy." c. According to Dhingra 6th/ed p 265-'Tonsils are removed 4-6 weeks following an attack of Quinsy." d. According to Head and Neck Surgery- e. Quinsy - "Most people would practise interval tonsillectomy for these patients, deferring surgery for 6 weeks following resolution of an attack." - Head and Neck Surgery by Chris de Souza Vol 2 p 7583 | 3,476 | medmcqa_train |
Aspirin triad is? | ANSWER: (C) Sampter's syndromeREF: With textIn 1922 Widal et al. recognized the additional association of nasal polyposis with aspirin sensitivity and asthma. This became commonly known as "aspirin triad." Following studies by Samter and Beers in the late 1960s, aspirin triad was commonly referred to as Samter's triad. (Ref: Head & Neck Surgery--otolaryngology - Volume 1 by Byron J. Bailey, Jonas T. Johnson, Shawm D. Newlands 4th ed Page 396)"36% of the patients with aspirin intolerance may show polypi. Sampter's triad consists of nasal polypi, asthma and aspirin intolerance* (Ref: Dhingra 4th ed page 162) | 3,477 | medmcqa_train |
All the following are Derivatives of Dorsal mesogastrium except | The derivatives of Dorsal mesogastrium are:(1) The greater or caudal pa of the dorsal mesogastrium becomes greatly elongated and forms the greater omentum.(2) The spleen develops in relation to the cranial pa of the dorsal mesogastrium and divides it into dorsal and ventral pas. The ventral pa forms the gastrosplenic ligament while the dorsal pa forms the lienorenal ligament. (3) The cranial most pa of the dorsal mesogastrium forms the gastrophrenic ligament. The ventral mesogastrium forms the falciform ligament.Reference: Chaurasia Volume II; 7th edition; Page no: 270 | 3,478 | medmcqa_train |
Peripheral resistance is best indicated by: | Ans. a. Diastolic blood pressure Aerial hypeension is the result of abnormal flow/resistance relationships. Resistance to outflow consists of different components: the systolic component is the one generated by conductance vessels, whereas the diastolic component consists of peripheral resistance, which regulates peripheral blood supply due to the run-off of conductance vessels during left ventricular diastole. Thus, an increase in systemic resistance results in a rise in diastolic blood pressure. If the elasticity of conductance vessels decreases, diastolic run-off also decreases and diastolic blood pressure goes down. When this loss of elasticity occurs, the ejection force cannot be anymore offset by aerial distension, the pulse wave velocity increases and reflex waves to the hea arrive earlier, causing the systolic blood pressure to augment. Such an augmentation, together with decreasing diastolic blood pressure results in an enhancement of the pulse pressure. When the stroke volume is normal, an increase in pulse pressure is, therefore, a marker of altered conductance. However, if, due to loss of elasticity of the conductance aeries diastolic blood pressure goes down, increasing systolic pressure also protects against a decrease in mean pressure. Indeed, in conditions of elevated pulse pressure, the mean pressure can be normal or high, indicating that when evaluating blood pressure all components should be taken into consideration. A high systolic blood pressure associated with a normal mean blood pressure is suggestive of a normal peripheral resistance.'Diastolic PressureSystolic pressure is peak pressure reached during systole, similarly, diastolic pressure refers to lowest pressure during diastole.Diastolic blood pressure is an index to peripheral resistance.Elasticity of aoa and large aeries is mainly responsible for origin and maintenance of diastolic pressure (by Windkessel elastic recoil effect).Because the elasticity is higher in younger subjects, diastolic pressure is maintained and pulse pressure is narrow.Because the elasticity is lower in old persons, diastolic pressure is decreased and pulse pressure is widened. | 3,479 | medmcqa_train |
Gas gangrene is caused by all except? | Ans. is 'd' i.e., Cl. sporogenes | 3,480 | medmcqa_train |
Vogt's striae shown below are seen in: | Ans. (b) Keratoconus. | 3,481 | medmcqa_train |
All of the following statements about the control of micturition are true except: | Micturition is initiated by activation of afferent sensory fibers located in the wall of the bladder; these fibers sense the degree of stretch of the bladder wall. In addition, these sensory fibers travel back to the spinal cord via sacral dorsal roots. The sensory information that reaches the spinal cord also travels to the micturition center in the rostral pons. When sensory activity to the micturition center is sufficient, a command is sent to the sacral spinal cord, leading to activation of parasympathetic fibers. The parasympathetic fibers travel to the bladder via the pelvic nerve. Activation of these fibers leads to bladder contraction. Destruction of the sacral dorsal roots (as occurs with tabes dorsalis) abolishes the reflex because sensory afferent fibers no longer send signals back to the spinal cord.
A spinal cord injury at L1 is well above the sacral region where the micturition reflex originates. How ever, the central nervous system (CNS) plays an important role in facilitating or inhibiting the micturition reflex, and this function is lost with spinal cord injury. Although some patients with spinal cord injury can still elicit a micturition response (e.g., stroking of the skin in the genital region), the bladder in these patients has increased muscle tone and fails to empty completely. As the bladder becomes more and more distended, an involuntary micturition reflex can occur. However, the CNS can keep urine from being voided under these circumstances by maintaining a constant tonic contraction of the external sphincter. This contraction is accomplished through continued activation of so matic nerves that travel in the pudendal nerve from the sacral spinal cord to the external sphincter. The point at which an urge to void first occurs corresponds to a bladder volume of approximately 150 ml. However, bladder volume can increase more than twofold before involuntary micturition occurs. At 400 ml a marked sense of fullness is present. Parasympathetic fibers originating in the sacral spinal cord innervate the body of the bladder, and it is activation of these fibers that leads to bladder contraction. | 3,482 | medmcqa_train |
Drug of choice for a case of uncomplicated cystitis - | Ans. is 'd' i.e.. Fosfomycin[Ref: OBJECTIVE: To determine the drug of choice for the treatment of uncomplicated cystitis. METHOD: Drug selection was performed by means of the so-called 'system of objectified judgment analysis' (SOJA) method by a working group of 11 persons. The following selection criteria were used: pharmacokinetics, interactions, the probability of hitting (the probability that the microorganism is sensitive to the antibiotic), development of resistance, specific use in urinary tract infections, efficacy, side effects, dosage-frequency, duration of treatment, cost and documentation. The following drugs were included in the study: amoxicillin (with or without clavulanic acid), nitrofurantoin, sulfamethizole, trimethoprim, co-trimoxazole, ciprofloxacin, norfloxacin, ofloxacin and fosfomycin trometamol. RESULTS: Fosfomycin and nitrofurantoin slow release showed the highest scores. The main selection criteria that determined the selection of a drug were especially specific use in urinary tract infections, development of resistance, the probability of hitting and cost. CONCLUSION: Fosfomycin and nitrofurantoin slow release best fulfill the requirements for drugs in the treatment of uncomplicated cystitis. No comparative studies have been performed with the 3-day treatment of uncomplicated cystitis with nitrofurantoin slow release or with trimethoprim. Fluoroquinolones play no important part in the treatment of uncomplicated cystitis, mainly because of the risk of development of resistance. | 3,483 | medmcqa_train |
Mucosa is involved in – | Diseases involving oral mucosa :- Lichen plaints, Pemphigus, Infections (Candida, Secondary syphilis, HSV), Leucoplakia, Erythema multiforme, Peutz Jegher syndrome, Aphthous ulcers, Bechet's disease, squamous cell carcinoma | 3,484 | medmcqa_train |
Glucose alanine cycle is impoant in: | In the fasting state, there is a considerable output of alanine from skeletal muscle, far in excess of its concentration in the muscle proteins that are being catabolized. It is formed by transamination of pyruvate produced by glycolysis of muscle glycogen, and is expoed to the liver, where, after transamination back to pyruvate, it is a substrate for gluconeogenesis. Ref: Harper 28th edition, chapter 20. | 3,485 | medmcqa_train |
Lord's and Jaboulay's operation is done for | These operations are done for hydrocele .Lord's operation or plication is suitable when the sac is small, thin walled and contains clear fluid. Here tunica is bunched into a 'ruff' at its attachment to the testis by using a series of multiple interrupted chromic catgut sutures to plicate the redundant tunica vaginalis, so as to make the sac to form fibrous tissue. Jaboulay's procedure - Eversion of the sac following paial excision with placement of the testis in a pouch prepared by dissection in the fascial planes of the scrotum.Reference : page 1072 SRB's manual of surgery 5th edition and page 1382 Bailey and Love's sho practice of surgery 25th edition | 3,486 | medmcqa_train |
Which of the following is not a function of aqueous humor? | It provides nutrition to the cornea and lens and not the retina. Functions of aqueous humor: Maintenance of IOP Nutrition to lens and cornea Maintaining transparency of eye Clearing the eye of toxins | 3,487 | medmcqa_train |
Trichotillomania- | Ans. is 'c' i.e., Compulsive hair pulling o As there is no organic or behavioral disorders, this girl is suffering with impulse control disorder of compulsive hair pulling, known as Trichotillomania.Impulse control disordero These disorders are characterized by failure to resist an impulsive behavior that may be harmful to self or others. There may be a feeling of release of tension by doing the act and a feeling of guilt after the act is over.Important impulse control disorder are : -Pyromania (Pathological fire setting)Kleptomania (Pathological stealing)Trichotillomania (Compulsive hair pulling)Pathological gamblingIntermittent explosive disorderImpulse control disorder not otherwise specifiedOniomania (Compulsion to shop/buying)Internet compulsion (Internet addiction)Cellular or Mobile phone compulsionCompulsive sexual behavior (sexual addiction). | 3,488 | medmcqa_train |
Inositic acid is biological precursor of ? | C i.e., Adenylic & guanylic acid | 3,489 | medmcqa_train |
Geographic lytic lesions in the vault of the skull with bevelled edges are seen with: | Ans. Eosinophilic granuloma | 3,490 | medmcqa_train |
Which enzyme level is tested in thiamine deficiency? | Thiamine (vitamin B1) Deficiency It is assessed by Erythrocyte transketolase activity. Thiamine (Vitamin B1) is the marker for transketolase enzyme -which is involved in HMP pathway (in RBCs) Activity of Transketolase is measured (not the quantity). | 3,491 | medmcqa_train |
The measure of variability indicating how many standard detions, an observation is above or below the mean is | A z-score is the number of standard detions from the mean. The coefficient of variation (CV) is a measure of relative variability. It is the ratio of the standard detion to the mean. Ref : Park 23rd edition Pgno : 849 | 3,492 | medmcqa_train |
A Down syndrome child is mentally retarded. All cytogenetic abnormalities may occurs except? | Ans is 'a' i.e., Deleted 21 | 3,493 | medmcqa_train |
Hydatidiform mole is associated with : | Theca lutein cysts | 3,494 | medmcqa_train |
A 24-year-old P2+0 woman presents to the emergency department complaining of pain in her right breast. The patient is postpartum day 10 from an uncomplicated spontaneous vaginal delivery at 42 weeks. She reports no difficulty breast-feeding for the first several days postpartum, but states that for the past week her daughter has had difficulty latching on. Three days ago her right nipple became dry and cracked, and since yesterday it has become increasingly swollen and painful. Her temperature is 38.3°C (101°F). Her right nipple and areola are warm, swollen, red, and tender. There is no fluctuance or induration, and no pus can be expressed from the nipple. | A postpartum lady coming with H/o pain in breast and fever and nipples being warm, red, swollen, with no induration, fluctuance and no pus extruding from them - leaves no doubt that the patient is having mastitis. As discussed in question 9, mastitis is not a contraindication for breast feeding. She should continue feeding from both the breasts. | 3,495 | medmcqa_train |
A 65-year-old male is having a swelling on the back of lower thigh. On investigation it was found to be a high grade liposarcoma of 5 cm in size. Best management is: | Ans. B. Wide local excisionExplanationLiposarcoma is one of the types of soft tissue sarcoma (STS). Liposarcoma is the most frequent STS subtype and represents 45% of all retroperitoneal sarcoma. It is composed of three histologicvarieties (listed in order of decreasing frequency):Well-differentiated and dedifferentiated liposarcoma,Pleomorphic liposarcoma, andMyxoid/round cell liposarcoma.Well differentiated and dedifferentiated liposarcomas more typically arise from the retroper- itoneum versus the extremities, whereas the inverse is true for pleomorphic and myxoid/round cell liposarcoma.Mainstay of treatment for STS is surgery.Algorithm for STS management is as follows: | 3,496 | medmcqa_train |
Preganglionic supply to the submandibular gland is | The sensory root is from the lingual nerve. It is suspended by two roots of lingual nerve.The sympathetic root is from the sympathetic plexus around the facial aery. This plexus contains postganglionic fibers from the superior cervical ganglion of the sympathetic trunk. These fibers pass express through the ganglion and are vasomotor to the submandibular glandThe secretomotor root is from superior salivatory nucleus through nervous intermedius chords tympani which is a branch of cranial nerve VII. Chorda tympani joins lingual nerve. The parasympathetic fibers get relayed in the submandibular ganglion.Ref: BD Chaurasia; volume 3; 6th edition; Page no: 308 | 3,497 | medmcqa_train |
Skin biopsy in leprosy is characterized by – | In indeterminate leprosy, there is perivascular and Periappendageal infiltrate of lymphocytes.
In lepromatous leprosy large number of lepra bacill are seen in dermal infiltrate around appendages (periappandgeal). | 3,498 | medmcqa_train |
Most commonly used measure of central tendency- | Ans. is 'a' i.e., Mean * The commonly used statistical average (measures of central tendency) are (i) Arithmetic mean, (ii) Median and (iii) Mode.Arithmetic mean* It is the most commonly used statistical average. It is obtained by sum of all the values divided by total number of values.Mean =[?]x----e* The major disadvantage of mean is that it may be unduly influenced by abnormal high or low values in the distribution.Median* It is the middle most value in a distribution arranged in ascending or descending order. If there are two values in the middle, instead of one, the median is worked out by taking the average of two middle values.* The main advantage of median is that it is not affected by abnormal high or low values (unlike mean). Therefore, median is used in skewed distribution (distribution which is skewed/deviated due to small number of very high or low values).Mode* It is the most frequently occuring value in a distribution. If there are two most frequent values, there are two modes and the distribution is called 'bimodal distribution In bimodal distribution the mode is the average of two modes.* For bimodal distributionMode = (3 x median) - (2 x mean)* Mode is the central tendency which is least affected by extreme values or skewness (But median is the preferred central tendency in skewed distribution). | 3,499 | medmcqa_train |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.