modelId
string | author
string | last_modified
timestamp[us, tz=UTC] | downloads
int64 | likes
int64 | library_name
string | tags
sequence | pipeline_tag
string | createdAt
timestamp[us, tz=UTC] | card
string |
|---|---|---|---|---|---|---|---|---|---|
Mungert/QwenLong-L1-32B-GGUF | Mungert | 2025-06-15T19:38:13Z | 6,074 | 9 | transformers | [
"transformers",
"gguf",
"long-context",
"large-reasoning-model",
"text-generation",
"dataset:Tongyi-Zhiwen/DocQA-RL-1.6K",
"arxiv:2505.17667",
"arxiv:2309.00071",
"base_model:deepseek-ai/DeepSeek-R1-Distill-Qwen-32B",
"base_model:quantized:deepseek-ai/DeepSeek-R1-Distill-Qwen-32B",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-05-28T11:43:14Z | ---
license: apache-2.0
datasets:
- Tongyi-Zhiwen/DocQA-RL-1.6K
base_model:
- deepseek-ai/DeepSeek-R1-Distill-Qwen-32B
tags:
- long-context
- large-reasoning-model
pipeline_tag: text-generation
library_name: transformers
---
# <span style="color: #7FFF7F;">QwenLong-L1-32B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`f5cd27b7`](https://github.com/ggerganov/llama.cpp/commit/f5cd27b71da3ac375a04a41643d14fc779a8057b).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `QwenLong-L1-32B-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `QwenLong-L1-32B-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `QwenLong-L1-32B-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `QwenLong-L1-32B-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `QwenLong-L1-32B-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `QwenLong-L1-32B-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `QwenLong-L1-32B-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `QwenLong-L1-32B-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `QwenLong-L1-32B-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `QwenLong-L1-32B-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `QwenLong-L1-32B-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# QwenLong-L1: Towards Long-Context Large Reasoning Models with Reinforcement Learning
<p align="center" width="100%">
</p>
<div id="top" align="center">
-----------------------------
[](https://opensource.org/licenses/Apache-2.0)
[](https://arxiv.org/abs/2505.17667)
[](https://github.com/Tongyi-Zhiwen/QwenLong-L1)
[](https://modelscope.cn/models/iic/QwenLong-L1-32B)
[](https://huggingface.co/Tongyi-Zhiwen/QwenLong-L1-32B)
<!-- **Authors:** -->
_**Fanqi Wan, Weizhou Shen, Shengyi Liao, Yingcheng Shi, Chenliang Li,**_
_**Ziyi Yang, Ji Zhang, Fei Huang, Jingren Zhou, Ming Yan**_
<!-- **Affiliations:** -->
_Tongyi Lab, Alibaba Group_
<p align="center">
<img src="./assets/fig1.png" width="100%"> <br>
</p>
</div>
## 🎉 News
- **May 28, 2025:** 🔥 We release [🤗 QwenLong-L1-32B-AWQ](https://huggingface.co/Tongyi-Zhiwen/QwenLong-L1-32B-AWQ), which has undergone AWQ int4 quantization using the ms-swift framework.
- **May 26, 2025:** 🔥 We release [🤗 QwenLong-L1-32B](https://huggingface.co/Tongyi-Zhiwen/QwenLong-L1-32B), which is the first long-context LRM trained with reinforcement learning for long-context reasoning. Experiments on seven long-context DocQA benchmarks demonstrate that **QwenLong-L1-32B outperforms flagship LRMs like OpenAI-o3-mini and Qwen3-235B-A22B, achieving performance on par with Claude-3.7-Sonnet-Thinking**, demonstrating leading performance among state-of-the-art LRMs.
- **May 26, 2025:** 🔥 We release [🤗 DocQA-RL-1.6K](https://huggingface.co/datasets/Tongyi-Zhiwen/DocQA-RL-1.6K), which is a specialized RL training dataset comprising 1.6K document question answering (DocQA) problems spanning mathematical, logical, and multi-hop reasoning domains.
## 📚 Introduction
In this work, we propose QwenLong-L1, a novel reinforcement learning (RL) framework designed to facilitate the transition of LRMs from short-context proficiency to robust long-context generalization. In our preliminary experiments, we illustrate the differences between the training dynamics of short-context and long-context reasoning RL.
<p align="center">
<img src="./assets/fig2.png" width="100%"> <br>
</p>
Our framework enhances short-context LRMs through progressive context scaling during RL training. The framework comprises three core components: a warm-up supervised fine-tuning (SFT) phase to initialize a robust policy, a curriculum-guided RL phase that facilitates stable adaptation from short to long contexts, and a difficulty-aware retrospective sampling mechanism that adjusts training complexity across stages to incentivize policy exploration. Leveraging recent RL algorithms, including GRPO and DAPO, our framework integrates hybrid reward functions combining rule-based and model-based binary outcome rewards to balance precision and recall. Through strategic utilization of group relative advantages during policy optimization, it guides LRMs to learn effective reasoning patterns essential for robust long-context grounding and superior reasoning capabilities.
<p align="center">
<img src="./assets/fig3.png" width="100%"> <br>
</p>
## 🎯 Model Release
We release [🤗 QwenLong-L1-32B](https://huggingface.co/Tongyi-Zhiwen/QwenLong-L1-32B), which is the first long-context LRM trained with reinforcement learniing for long-context reasoning. Experiments on seven long-context DocQA benchmarks demonstrate that **QwenLong-L1-32B outperforms flagship LRMs like OpenAI-o3-mini and Qwen3-235B-A22B, achieving performance on par with Claude-3.7-Sonnet-Thinking**, demonstrating leading performance among state-of-the-art LRMs.
Here are the evaluation results.
<p align="center">
<img src="./assets/tab4.png" width="100%"> <br>
</p>
## 🛠️ Requirements
```bash
# Create the conda environment
conda create -n qwenlongl1 python==3.10
conda activate qwenlongl1
# Install requirements
pip3 install -r requirements.txt
# Install verl
cd verl
pip3 install -e .
# Install vLLM
pip3 install vllm==0.7.3
# Install flash-attn
pip3 install flash-attn --no-build-isolation
```
## 🚀 Quick Start
Here's how you can run the model using the 🤗 Transformers:
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
model_name = "Tongyi-Zhiwen/QwenLong-L1-32B"
# load the tokenizer and the model
tokenizer = AutoTokenizer.from_pretrained(model_name)
model = AutoModelForCausalLM.from_pretrained(
model_name,
torch_dtype="auto",
device_map="auto"
)
# prepare the model input
template = """Please read the following text and answer the question below.
<text>
$DOC$
</text>
$Q$
Format your response as follows: "Therefore, the answer is (insert answer here)"."""
context = "<YOUR_CONTEXT_HERE>"
question = "<YOUR_QUESTION_HERE>"
prompt = template.replace('$DOC$', context.strip()).replace('$Q$', question.strip())
messages = [
# {"role": "system", "content": "You are QwenLong-L1, created by Alibaba Tongyi Lab. You are a helpful assistant."}, # Use system prompt to define identity when needed.
{"role": "user", "content": prompt}
]
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True
)
model_inputs = tokenizer([text], return_tensors="pt").to(model.device)
# conduct text completion
generated_ids = model.generate(
**model_inputs,
max_new_tokens=10000,
temperature=0.7,
top_p=0.95
)
output_ids = generated_ids[0][len(model_inputs.input_ids[0]):].tolist()
# parsing thinking content
try:
# rindex finding 151649 (</think>)
index = len(output_ids) - output_ids[::-1].index(151649)
except ValueError:
index = 0
thinking_content = tokenizer.decode(output_ids[:index], skip_special_tokens=True).strip("\n")
content = tokenizer.decode(output_ids[index:], skip_special_tokens=True).strip("\n")
print("thinking content:", thinking_content)
print("content:", content)
```
## ♾️ Processing Long Documents
For input where the total length (including both input and output) significantly exceeds 32,768 tokens, we recommend using RoPE scaling techniques to handle long texts effectively. We have validated the model's performance on context lengths of up to 131,072 tokens using the [YaRN](https://arxiv.org/abs/2309.00071) method.
YaRN is currently supported by several inference frameworks, e.g., `transformers` and `llama.cpp` for local use, `vllm` and `sglang` for deployment. In general, there are two approaches to enabling YaRN for supported frameworks:
- Modifying the model files:
In the `config.json` file, add the `rope_scaling` fields:
```json
{
...,
"rope_scaling": {
"rope_type": "yarn",
"factor": 4.0,
"original_max_position_embeddings": 32768
}
}
```
For `llama.cpp`, you need to regenerate the GGUF file after the modification.
- Passing command line arguments:
For `vllm`, you can use
```shell
vllm serve ... --rope-scaling '{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}' --max-model-len 131072
```
For `sglang`, you can use
```shell
python -m sglang.launch_server ... --json-model-override-args '{"rope_scaling":{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}}'
```
For `llama-server` from `llama.cpp`, you can use
```shell
llama-server ... --rope-scaling yarn --rope-scale 4 --yarn-orig-ctx 32768
```
> [!IMPORTANT]
> If you encounter the following warning
> ```
> Unrecognized keys in `rope_scaling` for 'rope_type'='yarn': {'original_max_position_embeddings'}
> ```
> please upgrade `transformers>=4.51.0`.
> [!NOTE]
> All the notable open-source frameworks implement static YaRN, which means the scaling factor remains constant regardless of input length, **potentially impacting performance on shorter texts.**
> We advise adding the `rope_scaling` configuration only when processing long contexts is required.
> It is also recommended to modify the `factor` as needed. For example, if the typical context length for your application is 65,536 tokens, it would be better to set `factor` as 2.0.
> [!NOTE]
If the average context length does not exceed 32,768 tokens, we do not recommend enabling YaRN in this scenario, as it may potentially degrade model performance.
## 🗂️ Dataset
To construct a challenging RL dataset for verifiable long-context reasoning, we develop [🤗 DocQA-RL-1.6K](https://huggingface.co/datasets/Tongyi-Zhiwen/DocQA-RL-1.6K), which comprises 1.6K DocQA problems across three reasoning domains:
(1) Mathematical Reasoning: We use 600 problems from the DocMath dataset, requiring numerical reasoning across long and specialized documents such as financial reports. For DocMath, we sample 75% items from each subset from its valid split for training and 25% for evaluation;
(2) Logical Reasoning: We employ DeepSeek-R1 to synthesize 600 multi-choice questions requiring logic analysis of real-world documents spanning legal, financial, insurance, and production domains from our curated collection;
(3) Multi-Hop Reasoning: We sample 200 examples from MultiHopRAG and 200 examples from Musique, emphasizing cross-document reasoning.
Please download and put the following datasets in `./datasets/` for training and evaluation.
RL training data: [🤗 DocQA-RL-1.6K](https://huggingface.co/datasets/Tongyi-Zhiwen/DocQA-RL-1.6K).
Evaluation data: [🤗 docmath](https://huggingface.co/datasets/Tongyi-Zhiwen/docmath), [🤗 frames](https://huggingface.co/datasets/Tongyi-Zhiwen/frames), [🤗 longbench](https://huggingface.co/datasets/Tongyi-Zhiwen/longbench).
## 💻 Training
We provide the basic demo training code for single stage RL traininig with DAPO.
First, we should start a local verifier.
```bash
export CUDA_VISIBLE_DEVICES=0
vllm serve "Qwen/Qwen2.5-1.5B-Instruct" \
--host 0.0.0.0 \
--port 23547
```
Then, we start RL training with 4 nodes.
```bash
export PROJ_DIR="<YOUR_PROJ_DIR_HERE>"
export MASTER_IP="<YOUR_MASTER_IP_HERE>" # ray master ip
export NNODES=4 # total GPU nodes
export NODE_RANK=${RANK} # rank of current node
export PORT=6382
export WANDB_API_KEY="<YOUR_WANDB_API_KEY_HERE>"
export WANDB_PROJECT="QwenLong-L1"
export LLM_JUDGE=Y # 'Y': LLM JUDGE, 'N': RULE BASED
export VLLM_ATTENTION_BACKEND=FLASH_ATTN
# verifier
export VERIFIER_PATH="Qwen/Qwen2.5-1.5B-Instruct"
export VERIFIER_HOST="<YOUR_VERIFIER_HOST_HERE>"
export VERIFIER_PORT="23547"
ray_start_retry() {
while true; do
ray start --address="${MASTER_IP}:${PORT}"
if [ $? -eq 0 ]; then
break
fi
echo "Failed to connect to master, retrying in 5 seconds..."
sleep 5
done
}
check_ray_status() {
until ray status >/dev/null 2>&1; do
echo "Waiting for Ray cluster to be ready..."
sleep 5
done
}
if [ "$RANK" == "0" ]; then
echo "Starting HEAD node..."
ray start --head --port=${PORT}
check_ray_status
echo "Ray head node started successfully"
else
echo "Starting WORKER node..."
ray_start_retry
check_ray_status
echo "Successfully joined Ray cluster"
fi
if [ "$RANK" == "0" ]; then
bash ${PROJ_DIR}/scripts/rl_4nodes_dapo.sh 2>&1 | tee ${PROJ_DIR}/logs/rl_log_$(date +%Y%m%d_%H%M%S).txt &
else
sleep 30d
fi
wait
```
## 📊 Evaluation
We conduct evaluation on seven long-context DocQA benchmarks, including multi-hop reasoning benchmarks such as 2WikiMultihopQA, HotpotQA, Musique, NarrativeQA, Qasper, and Frames as well as mathematical reasoning benchmarks like DocMath. We report the maximum of exact match and LLM-judged accuracy as the final score, aligned with the reward function in our RL training process. We use DeepSeek-V3 as the judge model with a temperature of 0.0 to provide a reliable evaluation.
```bash
# Step 1. Serve the model for evaluation
export CUDA_VISIBLE_DEVICES="0,1,2,3,4,5,6,7"
MODEL_NAME="QwenLong-L1-32B"
MODEL_PATH="Tongyi-Zhiwen/QwenLong-L1-32B"
vllm serve ${MODEL_PATH} \
--port 23547 \
--api-key "token-abc123" \
--tensor-parallel-size 8 \
--gpu-memory-utilization 0.95 \
--max_model_len 131072 \
--trust-remote-code
# Step 2. Generate model responses for each dataset
export SERVE_HOST="<YOUR_SERVE_HOST_HERE>" # e.g., 127.0.0.1
export SERVE_PORT="23547"
PROJ_DIR="<YOUR_PROJ_DIR_HERE>"
DATA="<YOUR_DATA_HERE>" # e.g., docmath, frames, 2wikimqa, hotpotqa, musique, narrativeqa, pasper
python ${PROJ_DIR}/eval/${DATA}.py \
--save_dir "${PROJ_DIR}/eval/results/${DATA}" \
--save_file "${MODEL_NAME}" \
--model "${MODEL_PATH}" \
--tokenizer "${MODEL_PATH}" \
--n_proc 16 \
--api "openai"
# Step 3. Verify model responses for each dataset
export VERIFIER_API="<YOUR_API_KEY_HERE>"
export VERIFIER_URL="https://api.deepseek.com/v1"
PROJ_DIR="<YOUR_PROJ_DIR_HERE>"
DATA="<YOUR_DATA_HERE>" # e.g., docmath, frames, 2wikimqa, hotpotqa, musique, narrativeqa, pasper
python ${PROJ_DIR}/eval/${DATA}_verify.py \
--save_dir "${PROJ_DIR}/results/${DATA}" \
--save_file "${MODEL_NAME}" \
--judge_model "deepseek-chat" \
--batch_size 20
```
## 📝 Citation
If you find this work is relevant with your research or applications, please feel free to cite our work!
```
@article{wan2025qwenlongl1,
title={QwenLong-L1: : Towards Long-Context Large Reasoning Models with Reinforcement Learning},
author={Fanqi Wan, Weizhou Shen, Shengyi Liao, Yingcheng Shi, Chenliang Li, Ziyi Yang, Ji Zhang, Fei Huang, Jingren Zhou, Ming Yan},
journal={arXiv preprint arXiv:2505.17667},
year={2025}
}
``` |
Mungert/Qwen3-16B-A3B-GGUF | Mungert | 2025-06-15T19:38:08Z | 3,213 | 4 | null | [
"gguf",
"unsloth",
"qwen3",
"qwen",
"base_model:kalomaze/Qwen3-16B-A3B",
"base_model:quantized:kalomaze/Qwen3-16B-A3B",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-05-22T11:04:29Z | ---
tags:
- unsloth
- qwen3
- qwen
license: apache-2.0
base_model:
- kalomaze/Qwen3-16B-A3B
---
# <span style="color: #7FFF7F;">Qwen3-16B-A3B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`f5cd27b7`](https://github.com/ggerganov/llama.cpp/commit/f5cd27b71da3ac375a04a41643d14fc779a8057b).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Qwen3-16B-A3B-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Qwen3-16B-A3B-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Qwen3-16B-A3B-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Qwen3-16B-A3B-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Qwen3-16B-A3B-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Qwen3-16B-A3B-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Qwen3-16B-A3B-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Qwen3-16B-A3B-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Qwen3-16B-A3B-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Qwen3-16B-A3B-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Qwen3-16B-A3B-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# Qwen3-16B-A3B
Qwen3-16B-A3B is a rendition of Qwen3-30B-A3B by [kalomaze](https://huggingface.co/kalomaze/Qwen3-16B-A3B).
A man-made horror beyond your comprehension.
But no, seriously, this is my experiment to:
- measure the probability that any given expert will activate (over my personal set of fairly diverse calibration data), per layer
- prune 64/128 of the least used experts per layer (with reordered router and indexing per layer)
It can still write semi-coherently without any additional training or distillation done on top of it from the original 30b MoE.
The .txt files with the original measurements are provided in the repo along with the exported weights.
Custom testing to measure the experts was done on a hacked version of vllm, and then I made a bespoke script to selectively export the weights according to the measurements. |
Mungert/Qwen3-30B-A3B-GGUF | Mungert | 2025-06-15T19:37:50Z | 1,722 | 4 | transformers | [
"transformers",
"gguf",
"text-generation",
"arxiv:2309.00071",
"base_model:Qwen/Qwen3-30B-A3B-Base",
"base_model:quantized:Qwen/Qwen3-30B-A3B-Base",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-05-13T04:35:31Z | ---
library_name: transformers
license: apache-2.0
license_link: https://huggingface.co/Qwen/Qwen3-30B-A3B/blob/main/LICENSE
pipeline_tag: text-generation
base_model:
- Qwen/Qwen3-30B-A3B-Base
---
# <span style="color: #7FFF7F;">Qwen3-30B-A3B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`064cc596`](https://github.com/ggerganov/llama.cpp/commit/064cc596ac44308dc326a17c9e3163c34a6f29d1).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Qwen3-30B-A3B-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Qwen3-30B-A3B-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Qwen3-30B-A3B-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Qwen3-30B-A3B-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Qwen3-30B-A3B-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Qwen3-30B-A3B-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Qwen3-30B-A3B-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Qwen3-30B-A3B-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Qwen3-30B-A3B-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Qwen3-30B-A3B-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Qwen3-30B-A3B-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# Qwen3-30B-A3B
<a href="https://chat.qwen.ai/" target="_blank" style="margin: 2px;">
<img alt="Chat" src="https://img.shields.io/badge/%F0%9F%92%9C%EF%B8%8F%20Qwen%20Chat%20-536af5" style="display: inline-block; vertical-align: middle;"/>
</a>
## Qwen3 Highlights
Qwen3 is the latest generation of large language models in Qwen series, offering a comprehensive suite of dense and mixture-of-experts (MoE) models. Built upon extensive training, Qwen3 delivers groundbreaking advancements in reasoning, instruction-following, agent capabilities, and multilingual support, with the following key features:
- **Uniquely support of seamless switching between thinking mode** (for complex logical reasoning, math, and coding) and **non-thinking mode** (for efficient, general-purpose dialogue) **within single model**, ensuring optimal performance across various scenarios.
- **Significantly enhancement in its reasoning capabilities**, surpassing previous QwQ (in thinking mode) and Qwen2.5 instruct models (in non-thinking mode) on mathematics, code generation, and commonsense logical reasoning.
- **Superior human preference alignment**, excelling in creative writing, role-playing, multi-turn dialogues, and instruction following, to deliver a more natural, engaging, and immersive conversational experience.
- **Expertise in agent capabilities**, enabling precise integration with external tools in both thinking and unthinking modes and achieving leading performance among open-source models in complex agent-based tasks.
- **Support of 100+ languages and dialects** with strong capabilities for **multilingual instruction following** and **translation**.
## Model Overview
**Qwen3-30B-A3B** has the following features:
- Type: Causal Language Models
- Training Stage: Pretraining & Post-training
- Number of Parameters: 30.5B in total and 3.3B activated
- Number of Paramaters (Non-Embedding): 29.9B
- Number of Layers: 48
- Number of Attention Heads (GQA): 32 for Q and 4 for KV
- Number of Experts: 128
- Number of Activated Experts: 8
- Context Length: 32,768 natively and [131,072 tokens with YaRN](#processing-long-texts).
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3/), [GitHub](https://github.com/QwenLM/Qwen3), and [Documentation](https://qwen.readthedocs.io/en/latest/).
## Quickstart
The code of Qwen3-MoE has been in the latest Hugging Face `transformers` and we advise you to use the latest version of `transformers`.
With `transformers<4.51.0`, you will encounter the following error:
```
KeyError: 'qwen3_moe'
```
The following contains a code snippet illustrating how to use the model generate content based on given inputs.
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
model_name = "Qwen/Qwen3-30B-A3B"
# load the tokenizer and the model
tokenizer = AutoTokenizer.from_pretrained(model_name)
model = AutoModelForCausalLM.from_pretrained(
model_name,
torch_dtype="auto",
device_map="auto"
)
# prepare the model input
prompt = "Give me a short introduction to large language model."
messages = [
{"role": "user", "content": prompt}
]
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=True # Switches between thinking and non-thinking modes. Default is True.
)
model_inputs = tokenizer([text], return_tensors="pt").to(model.device)
# conduct text completion
generated_ids = model.generate(
**model_inputs,
max_new_tokens=32768
)
output_ids = generated_ids[0][len(model_inputs.input_ids[0]):].tolist()
# parsing thinking content
try:
# rindex finding 151668 (</think>)
index = len(output_ids) - output_ids[::-1].index(151668)
except ValueError:
index = 0
thinking_content = tokenizer.decode(output_ids[:index], skip_special_tokens=True).strip("\n")
content = tokenizer.decode(output_ids[index:], skip_special_tokens=True).strip("\n")
print("thinking content:", thinking_content)
print("content:", content)
```
For deployment, you can use `sglang>=0.4.6.post1` or `vllm>=0.8.5` or to create an OpenAI-compatible API endpoint:
- SGLang:
```shell
python -m sglang.launch_server --model-path Qwen/Qwen3-30B-A3B --reasoning-parser qwen3
```
- vLLM:
```shell
vllm serve Qwen/Qwen3-30B-A3B --enable-reasoning --reasoning-parser deepseek_r1
```
For local use, applications such as Ollama, LMStudio, MLX-LM, llama.cpp, and KTransformers have also supported Qwen3.
## Switching Between Thinking and Non-Thinking Mode
> [!TIP]
> The `enable_thinking` switch is also available in APIs created by SGLang and vLLM.
> Please refer to our documentation for [SGLang](https://qwen.readthedocs.io/en/latest/deployment/sglang.html#thinking-non-thinking-modes) and [vLLM](https://qwen.readthedocs.io/en/latest/deployment/vllm.html#thinking-non-thinking-modes) users.
### `enable_thinking=True`
By default, Qwen3 has thinking capabilities enabled, similar to QwQ-32B. This means the model will use its reasoning abilities to enhance the quality of generated responses. For example, when explicitly setting `enable_thinking=True` or leaving it as the default value in `tokenizer.apply_chat_template`, the model will engage its thinking mode.
```python
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=True # True is the default value for enable_thinking
)
```
In this mode, the model will generate think content wrapped in a `<think>...</think>` block, followed by the final response.
> [!NOTE]
> For thinking mode, use `Temperature=0.6`, `TopP=0.95`, `TopK=20`, and `MinP=0` (the default setting in `generation_config.json`). **DO NOT use greedy decoding**, as it can lead to performance degradation and endless repetitions. For more detailed guidance, please refer to the [Best Practices](#best-practices) section.
### `enable_thinking=False`
We provide a hard switch to strictly disable the model's thinking behavior, aligning its functionality with the previous Qwen2.5-Instruct models. This mode is particularly useful in scenarios where disabling thinking is essential for enhancing efficiency.
```python
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=False # Setting enable_thinking=False disables thinking mode
)
```
In this mode, the model will not generate any think content and will not include a `<think>...</think>` block.
> [!NOTE]
> For non-thinking mode, we suggest using `Temperature=0.7`, `TopP=0.8`, `TopK=20`, and `MinP=0`. For more detailed guidance, please refer to the [Best Practices](#best-practices) section.
### Advanced Usage: Switching Between Thinking and Non-Thinking Modes via User Input
We provide a soft switch mechanism that allows users to dynamically control the model's behavior when `enable_thinking=True`. Specifically, you can add `/think` and `/no_think` to user prompts or system messages to switch the model's thinking mode from turn to turn. The model will follow the most recent instruction in multi-turn conversations.
Here is an example of a multi-turn conversation:
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
class QwenChatbot:
def __init__(self, model_name="Qwen/Qwen3-30B-A3B"):
self.tokenizer = AutoTokenizer.from_pretrained(model_name)
self.model = AutoModelForCausalLM.from_pretrained(model_name)
self.history = []
def generate_response(self, user_input):
messages = self.history + [{"role": "user", "content": user_input}]
text = self.tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True
)
inputs = self.tokenizer(text, return_tensors="pt")
response_ids = self.model.generate(**inputs, max_new_tokens=32768)[0][len(inputs.input_ids[0]):].tolist()
response = self.tokenizer.decode(response_ids, skip_special_tokens=True)
# Update history
self.history.append({"role": "user", "content": user_input})
self.history.append({"role": "assistant", "content": response})
return response
# Example Usage
if __name__ == "__main__":
chatbot = QwenChatbot()
# First input (without /think or /no_think tags, thinking mode is enabled by default)
user_input_1 = "How many r's in strawberries?"
print(f"User: {user_input_1}")
response_1 = chatbot.generate_response(user_input_1)
print(f"Bot: {response_1}")
print("----------------------")
# Second input with /no_think
user_input_2 = "Then, how many r's in blueberries? /no_think"
print(f"User: {user_input_2}")
response_2 = chatbot.generate_response(user_input_2)
print(f"Bot: {response_2}")
print("----------------------")
# Third input with /think
user_input_3 = "Really? /think"
print(f"User: {user_input_3}")
response_3 = chatbot.generate_response(user_input_3)
print(f"Bot: {response_3}")
```
> [!NOTE]
> For API compatibility, when `enable_thinking=True`, regardless of whether the user uses `/think` or `/no_think`, the model will always output a block wrapped in `<think>...</think>`. However, the content inside this block may be empty if thinking is disabled.
> When `enable_thinking=False`, the soft switches are not valid. Regardless of any `/think` or `/no_think` tags input by the user, the model will not generate think content and will not include a `<think>...</think>` block.
## Agentic Use
Qwen3 excels in tool calling capabilities. We recommend using [Qwen-Agent](https://github.com/QwenLM/Qwen-Agent) to make the best use of agentic ability of Qwen3. Qwen-Agent encapsulates tool-calling templates and tool-calling parsers internally, greatly reducing coding complexity.
To define the available tools, you can use the MCP configuration file, use the integrated tool of Qwen-Agent, or integrate other tools by yourself.
```python
from qwen_agent.agents import Assistant
# Define LLM
llm_cfg = {
'model': 'Qwen3-30B-A3B',
# Use the endpoint provided by Alibaba Model Studio:
# 'model_type': 'qwen_dashscope',
# 'api_key': os.getenv('DASHSCOPE_API_KEY'),
# Use a custom endpoint compatible with OpenAI API:
'model_server': 'http://localhost:8000/v1', # api_base
'api_key': 'EMPTY',
# Other parameters:
# 'generate_cfg': {
# # Add: When the response content is `<think>this is the thought</think>this is the answer;
# # Do not add: When the response has been separated by reasoning_content and content.
# 'thought_in_content': True,
# },
}
# Define Tools
tools = [
{'mcpServers': { # You can specify the MCP configuration file
'time': {
'command': 'uvx',
'args': ['mcp-server-time', '--local-timezone=Asia/Shanghai']
},
"fetch": {
"command": "uvx",
"args": ["mcp-server-fetch"]
}
}
},
'code_interpreter', # Built-in tools
]
# Define Agent
bot = Assistant(llm=llm_cfg, function_list=tools)
# Streaming generation
messages = [{'role': 'user', 'content': 'https://qwenlm.github.io/blog/ Introduce the latest developments of Qwen'}]
for responses in bot.run(messages=messages):
pass
print(responses)
```
## Processing Long Texts
Qwen3 natively supports context lengths of up to 32,768 tokens. For conversations where the total length (including both input and output) significantly exceeds this limit, we recommend using RoPE scaling techniques to handle long texts effectively. We have validated the model's performance on context lengths of up to 131,072 tokens using the [YaRN](https://arxiv.org/abs/2309.00071) method.
YaRN is currently supported by several inference frameworks, e.g., `transformers` and `llama.cpp` for local use, `vllm` and `sglang` for deployment. In general, there are two approaches to enabling YaRN for supported frameworks:
- Modifying the model files:
In the `config.json` file, add the `rope_scaling` fields:
```json
{
...,
"rope_scaling": {
"rope_type": "yarn",
"factor": 4.0,
"original_max_position_embeddings": 32768
}
}
```
For `llama.cpp`, you need to regenerate the GGUF file after the modification.
- Passing command line arguments:
For `vllm`, you can use
```shell
vllm serve ... --rope-scaling '{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}' --max-model-len 131072
```
For `sglang`, you can use
```shell
python -m sglang.launch_server ... --json-model-override-args '{"rope_scaling":{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}}'
```
For `llama-server` from `llama.cpp`, you can use
```shell
llama-server ... --rope-scaling yarn --rope-scale 4 --yarn-orig-ctx 32768
```
> [!IMPORTANT]
> If you encounter the following warning
> ```
> Unrecognized keys in `rope_scaling` for 'rope_type'='yarn': {'original_max_position_embeddings'}
> ```
> please upgrade `transformers>=4.51.0`.
> [!NOTE]
> All the notable open-source frameworks implement static YaRN, which means the scaling factor remains constant regardless of input length, **potentially impacting performance on shorter texts.**
> We advise adding the `rope_scaling` configuration only when processing long contexts is required.
> It is also recommended to modify the `factor` as needed. For example, if the typical context length for your application is 65,536 tokens, it would be better to set `factor` as 2.0.
> [!NOTE]
> The default `max_position_embeddings` in `config.json` is set to 40,960. This allocation includes reserving 32,768 tokens for outputs and 8,192 tokens for typical prompts, which is sufficient for most scenarios involving short text processing. If the average context length does not exceed 32,768 tokens, we do not recommend enabling YaRN in this scenario, as it may potentially degrade model performance.
> [!TIP]
> The endpoint provided by Alibaba Model Studio supports dynamic YaRN by default and no extra configuration is needed.
## Best Practices
To achieve optimal performance, we recommend the following settings:
1. **Sampling Parameters**:
- For thinking mode (`enable_thinking=True`), use `Temperature=0.6`, `TopP=0.95`, `TopK=20`, and `MinP=0`. **DO NOT use greedy decoding**, as it can lead to performance degradation and endless repetitions.
- For non-thinking mode (`enable_thinking=False`), we suggest using `Temperature=0.7`, `TopP=0.8`, `TopK=20`, and `MinP=0`.
- For supported frameworks, you can adjust the `presence_penalty` parameter between 0 and 2 to reduce endless repetitions. However, using a higher value may occasionally result in language mixing and a slight decrease in model performance.
2. **Adequate Output Length**: We recommend using an output length of 32,768 tokens for most queries. For benchmarking on highly complex problems, such as those found in math and programming competitions, we suggest setting the max output length to 38,912 tokens. This provides the model with sufficient space to generate detailed and comprehensive responses, thereby enhancing its overall performance.
3. **Standardize Output Format**: We recommend using prompts to standardize model outputs when benchmarking.
- **Math Problems**: Include "Please reason step by step, and put your final answer within \boxed{}." in the prompt.
- **Multiple-Choice Questions**: Add the following JSON structure to the prompt to standardize responses: "Please show your choice in the `answer` field with only the choice letter, e.g., `"answer": "C"`."
4. **No Thinking Content in History**: In multi-turn conversations, the historical model output should only include the final output part and does not need to include the thinking content. It is implemented in the provided chat template in Jinja2. However, for frameworks that do not directly use the Jinja2 chat template, it is up to the developers to ensure that the best practice is followed.
### Citation
If you find our work helpful, feel free to give us a cite.
```
@misc{qwen3,
title = {Qwen3},
url = {https://qwenlm.github.io/blog/qwen3/},
author = {Qwen Team},
month = {April},
year = {2025}
}
``` |
Mungert/Qwen3-4B-GGUF | Mungert | 2025-06-15T19:37:41Z | 891 | 8 | transformers | [
"transformers",
"gguf",
"text-generation",
"arxiv:2309.00071",
"base_model:Qwen/Qwen3-4B-Base",
"base_model:quantized:Qwen/Qwen3-4B-Base",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-04-30T01:08:05Z | ---
library_name: transformers
license: apache-2.0
license_link: https://huggingface.co/Qwen/Qwen3-4B/blob/main/LICENSE
pipeline_tag: text-generation
base_model:
- Qwen/Qwen3-4B-Base
---
# <span style="color: #7FFF7F;">Qwen3-4B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`19e899c`](https://github.com/ggerganov/llama.cpp/commit/19e899ce21a7c9ffcf8bb2b22269a75f6e078f8f).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Qwen3-4B-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Qwen3-4B-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Qwen3-4B-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Qwen3-4B-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Qwen3-4B-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Qwen3-4B-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Qwen3-4B-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Qwen3-4B-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Qwen3-4B-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Qwen3-4B-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Qwen3-4B-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# Qwen3-4B
<a href="https://chat.qwen.ai/" target="_blank" style="margin: 2px;">
<img alt="Chat" src="https://img.shields.io/badge/%F0%9F%92%9C%EF%B8%8F%20Qwen%20Chat%20-536af5" style="display: inline-block; vertical-align: middle;"/>
</a>
## Qwen3 Highlights
Qwen3 is the latest generation of large language models in Qwen series, offering a comprehensive suite of dense and mixture-of-experts (MoE) models. Built upon extensive training, Qwen3 delivers groundbreaking advancements in reasoning, instruction-following, agent capabilities, and multilingual support, with the following key features:
- **Uniquely support of seamless switching between thinking mode** (for complex logical reasoning, math, and coding) and **non-thinking mode** (for efficient, general-purpose dialogue) **within single model**, ensuring optimal performance across various scenarios.
- **Significantly enhancement in its reasoning capabilities**, surpassing previous QwQ (in thinking mode) and Qwen2.5 instruct models (in non-thinking mode) on mathematics, code generation, and commonsense logical reasoning.
- **Superior human preference alignment**, excelling in creative writing, role-playing, multi-turn dialogues, and instruction following, to deliver a more natural, engaging, and immersive conversational experience.
- **Expertise in agent capabilities**, enabling precise integration with external tools in both thinking and unthinking modes and achieving leading performance among open-source models in complex agent-based tasks.
- **Support of 100+ languages and dialects** with strong capabilities for **multilingual instruction following** and **translation**.
## Model Overview
**Qwen3-4B** has the following features:
- Type: Causal Language Models
- Training Stage: Pretraining & Post-training
- Number of Parameters: 4.0B
- Number of Paramaters (Non-Embedding): 3.6B
- Number of Layers: 36
- Number of Attention Heads (GQA): 32 for Q and 8 for KV
- Context Length: 32,768 natively and [131,072 tokens with YaRN](#processing-long-texts).
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3/), [GitHub](https://github.com/QwenLM/Qwen3), and [Documentation](https://qwen.readthedocs.io/en/latest/).
> [!TIP]
> If you encounter significant endless repetitions, please refer to the [Best Practices](#best-practices) section for optimal sampling parameters, and set the ``presence_penalty`` to 1.5.
## Quickstart
The code of Qwen3 has been in the latest Hugging Face `transformers` and we advise you to use the latest version of `transformers`.
With `transformers<4.51.0`, you will encounter the following error:
```
KeyError: 'qwen3'
```
The following contains a code snippet illustrating how to use the model generate content based on given inputs.
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
model_name = "Qwen/Qwen3-4B"
# load the tokenizer and the model
tokenizer = AutoTokenizer.from_pretrained(model_name)
model = AutoModelForCausalLM.from_pretrained(
model_name,
torch_dtype="auto",
device_map="auto"
)
# prepare the model input
prompt = "Give me a short introduction to large language model."
messages = [
{"role": "user", "content": prompt}
]
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=True # Switches between thinking and non-thinking modes. Default is True.
)
model_inputs = tokenizer([text], return_tensors="pt").to(model.device)
# conduct text completion
generated_ids = model.generate(
**model_inputs,
max_new_tokens=32768
)
output_ids = generated_ids[0][len(model_inputs.input_ids[0]):].tolist()
# parsing thinking content
try:
# rindex finding 151668 (</think>)
index = len(output_ids) - output_ids[::-1].index(151668)
except ValueError:
index = 0
thinking_content = tokenizer.decode(output_ids[:index], skip_special_tokens=True).strip("\n")
content = tokenizer.decode(output_ids[index:], skip_special_tokens=True).strip("\n")
print("thinking content:", thinking_content)
print("content:", content)
```
For deployment, you can use `sglang>=0.4.6.post1` or `vllm>=0.8.5` or to create an OpenAI-compatible API endpoint:
- SGLang:
```shell
python -m sglang.launch_server --model-path Qwen/Qwen3-4B --reasoning-parser qwen3
```
- vLLM:
```shell
vllm serve Qwen/Qwen3-4B --enable-reasoning --reasoning-parser deepseek_r1
```
For local use, applications such as Ollama, LMStudio, MLX-LM, llama.cpp, and KTransformers have also supported Qwen3.
## Switching Between Thinking and Non-Thinking Mode
> [!TIP]
> The `enable_thinking` switch is also available in APIs created by SGLang and vLLM.
> Please refer to our documentation for [SGLang](https://qwen.readthedocs.io/en/latest/deployment/sglang.html#thinking-non-thinking-modes) and [vLLM](https://qwen.readthedocs.io/en/latest/deployment/vllm.html#thinking-non-thinking-modes) users.
### `enable_thinking=True`
By default, Qwen3 has thinking capabilities enabled, similar to QwQ-32B. This means the model will use its reasoning abilities to enhance the quality of generated responses. For example, when explicitly setting `enable_thinking=True` or leaving it as the default value in `tokenizer.apply_chat_template`, the model will engage its thinking mode.
```python
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=True # True is the default value for enable_thinking
)
```
In this mode, the model will generate think content wrapped in a `<think>...</think>` block, followed by the final response.
> [!NOTE]
> For thinking mode, use `Temperature=0.6`, `TopP=0.95`, `TopK=20`, and `MinP=0` (the default setting in `generation_config.json`). **DO NOT use greedy decoding**, as it can lead to performance degradation and endless repetitions. For more detailed guidance, please refer to the [Best Practices](#best-practices) section.
### `enable_thinking=False`
We provide a hard switch to strictly disable the model's thinking behavior, aligning its functionality with the previous Qwen2.5-Instruct models. This mode is particularly useful in scenarios where disabling thinking is essential for enhancing efficiency.
```python
text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
enable_thinking=False # Setting enable_thinking=False disables thinking mode
)
```
In this mode, the model will not generate any think content and will not include a `<think>...</think>` block.
> [!NOTE]
> For non-thinking mode, we suggest using `Temperature=0.7`, `TopP=0.8`, `TopK=20`, and `MinP=0`. For more detailed guidance, please refer to the [Best Practices](#best-practices) section.
### Advanced Usage: Switching Between Thinking and Non-Thinking Modes via User Input
We provide a soft switch mechanism that allows users to dynamically control the model's behavior when `enable_thinking=True`. Specifically, you can add `/think` and `/no_think` to user prompts or system messages to switch the model's thinking mode from turn to turn. The model will follow the most recent instruction in multi-turn conversations.
Here is an example of a multi-turn conversation:
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
class QwenChatbot:
def __init__(self, model_name="Qwen/Qwen3-4B"):
self.tokenizer = AutoTokenizer.from_pretrained(model_name)
self.model = AutoModelForCausalLM.from_pretrained(model_name)
self.history = []
def generate_response(self, user_input):
messages = self.history + [{"role": "user", "content": user_input}]
text = self.tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True
)
inputs = self.tokenizer(text, return_tensors="pt")
response_ids = self.model.generate(**inputs, max_new_tokens=32768)[0][len(inputs.input_ids[0]):].tolist()
response = self.tokenizer.decode(response_ids, skip_special_tokens=True)
# Update history
self.history.append({"role": "user", "content": user_input})
self.history.append({"role": "assistant", "content": response})
return response
# Example Usage
if __name__ == "__main__":
chatbot = QwenChatbot()
# First input (without /think or /no_think tags, thinking mode is enabled by default)
user_input_1 = "How many r's in strawberries?"
print(f"User: {user_input_1}")
response_1 = chatbot.generate_response(user_input_1)
print(f"Bot: {response_1}")
print("----------------------")
# Second input with /no_think
user_input_2 = "Then, how many r's in blueberries? /no_think"
print(f"User: {user_input_2}")
response_2 = chatbot.generate_response(user_input_2)
print(f"Bot: {response_2}")
print("----------------------")
# Third input with /think
user_input_3 = "Really? /think"
print(f"User: {user_input_3}")
response_3 = chatbot.generate_response(user_input_3)
print(f"Bot: {response_3}")
```
> [!NOTE]
> For API compatibility, when `enable_thinking=True`, regardless of whether the user uses `/think` or `/no_think`, the model will always output a block wrapped in `<think>...</think>`. However, the content inside this block may be empty if thinking is disabled.
> When `enable_thinking=False`, the soft switches are not valid. Regardless of any `/think` or `/no_think` tags input by the user, the model will not generate think content and will not include a `<think>...</think>` block.
## Agentic Use
Qwen3 excels in tool calling capabilities. We recommend using [Qwen-Agent](https://github.com/QwenLM/Qwen-Agent) to make the best use of agentic ability of Qwen3. Qwen-Agent encapsulates tool-calling templates and tool-calling parsers internally, greatly reducing coding complexity.
To define the available tools, you can use the MCP configuration file, use the integrated tool of Qwen-Agent, or integrate other tools by yourself.
```python
from qwen_agent.agents import Assistant
# Define LLM
llm_cfg = {
'model': 'Qwen3-4B',
# Use the endpoint provided by Alibaba Model Studio:
# 'model_type': 'qwen_dashscope',
# 'api_key': os.getenv('DASHSCOPE_API_KEY'),
# Use a custom endpoint compatible with OpenAI API:
'model_server': 'http://localhost:8000/v1', # api_base
'api_key': 'EMPTY',
# Other parameters:
# 'generate_cfg': {
# # Add: When the response content is `<think>this is the thought</think>this is the answer;
# # Do not add: When the response has been separated by reasoning_content and content.
# 'thought_in_content': True,
# },
}
# Define Tools
tools = [
{'mcpServers': { # You can specify the MCP configuration file
'time': {
'command': 'uvx',
'args': ['mcp-server-time', '--local-timezone=Asia/Shanghai']
},
"fetch": {
"command": "uvx",
"args": ["mcp-server-fetch"]
}
}
},
'code_interpreter', # Built-in tools
]
# Define Agent
bot = Assistant(llm=llm_cfg, function_list=tools)
# Streaming generation
messages = [{'role': 'user', 'content': 'https://qwenlm.github.io/blog/ Introduce the latest developments of Qwen'}]
for responses in bot.run(messages=messages):
pass
print(responses)
```
## Processing Long Texts
Qwen3 natively supports context lengths of up to 32,768 tokens. For conversations where the total length (including both input and output) significantly exceeds this limit, we recommend using RoPE scaling techniques to handle long texts effectively. We have validated the model's performance on context lengths of up to 131,072 tokens using the [YaRN](https://arxiv.org/abs/2309.00071) method.
YaRN is currently supported by several inference frameworks, e.g., `transformers` and `llama.cpp` for local use, `vllm` and `sglang` for deployment. In general, there are two approaches to enabling YaRN for supported frameworks:
- Modifying the model files:
In the `config.json` file, add the `rope_scaling` fields:
```json
{
...,
"rope_scaling": {
"rope_type": "yarn",
"factor": 4.0,
"original_max_position_embeddings": 32768
}
}
```
For `llama.cpp`, you need to regenerate the GGUF file after the modification.
- Passing command line arguments:
For `vllm`, you can use
```shell
vllm serve ... --rope-scaling '{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}' --max-model-len 131072
```
For `sglang`, you can use
```shell
python -m sglang.launch_server ... --json-model-override-args '{"rope_scaling":{"rope_type":"yarn","factor":4.0,"original_max_position_embeddings":32768}}'
```
For `llama-server` from `llama.cpp`, you can use
```shell
llama-server ... --rope-scaling yarn --rope-scale 4 --yarn-orig-ctx 32768
```
> [!IMPORTANT]
> If you encounter the following warning
> ```
> Unrecognized keys in `rope_scaling` for 'rope_type'='yarn': {'original_max_position_embeddings'}
> ```
> please upgrade `transformers>=4.51.0`.
> [!NOTE]
> All the notable open-source frameworks implement static YaRN, which means the scaling factor remains constant regardless of input length, **potentially impacting performance on shorter texts.**
> We advise adding the `rope_scaling` configuration only when processing long contexts is required.
> It is also recommended to modify the `factor` as needed. For example, if the typical context length for your application is 65,536 tokens, it would be better to set `factor` as 2.0.
> [!NOTE]
> The default `max_position_embeddings` in `config.json` is set to 40,960. This allocation includes reserving 32,768 tokens for outputs and 8,192 tokens for typical prompts, which is sufficient for most scenarios involving short text processing. If the average context length does not exceed 32,768 tokens, we do not recommend enabling YaRN in this scenario, as it may potentially degrade model performance.
> [!TIP]
> The endpoint provided by Alibaba Model Studio supports dynamic YaRN by default and no extra configuration is needed.
## Best Practices
To achieve optimal performance, we recommend the following settings:
1. **Sampling Parameters**:
- For thinking mode (`enable_thinking=True`), use `Temperature=0.6`, `TopP=0.95`, `TopK=20`, and `MinP=0`. **DO NOT use greedy decoding**, as it can lead to performance degradation and endless repetitions.
- For non-thinking mode (`enable_thinking=False`), we suggest using `Temperature=0.7`, `TopP=0.8`, `TopK=20`, and `MinP=0`.
- For supported frameworks, you can adjust the `presence_penalty` parameter between 0 and 2 to reduce endless repetitions. However, using a higher value may occasionally result in language mixing and a slight decrease in model performance.
2. **Adequate Output Length**: We recommend using an output length of 32,768 tokens for most queries. For benchmarking on highly complex problems, such as those found in math and programming competitions, we suggest setting the max output length to 38,912 tokens. This provides the model with sufficient space to generate detailed and comprehensive responses, thereby enhancing its overall performance.
3. **Standardize Output Format**: We recommend using prompts to standardize model outputs when benchmarking.
- **Math Problems**: Include "Please reason step by step, and put your final answer within \boxed{}." in the prompt.
- **Multiple-Choice Questions**: Add the following JSON structure to the prompt to standardize responses: "Please show your choice in the `answer` field with only the choice letter, e.g., `"answer": "C"`."
4. **No Thinking Content in History**: In multi-turn conversations, the historical model output should only include the final output part and does not need to include the thinking content. It is implemented in the provided chat template in Jinja2. However, for frameworks that do not directly use the Jinja2 chat template, it is up to the developers to ensure that the best practice is followed.
### Citation
If you find our work helpful, feel free to give us a cite.
```
@misc{qwen3,
title = {Qwen3},
url = {https://qwenlm.github.io/blog/qwen3/},
author = {Qwen Team},
month = {April},
year = {2025}
}
``` |
Mungert/LiveCC-7B-Instruct-GGUF | Mungert | 2025-06-15T19:37:37Z | 1,832 | 1 | null | [
"gguf",
"qwen_vl",
"video",
"real-time",
"multimodal",
"LLM",
"en",
"dataset:chenjoya/Live-CC-5M",
"dataset:chenjoya/Live-WhisperX-526K",
"dataset:lmms-lab/LLaVA-Video-178K",
"arxiv:2504.16030",
"base_model:Qwen/Qwen2-VL-7B",
"base_model:quantized:Qwen/Qwen2-VL-7B",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-04-27T00:50:10Z | ---
license: apache-2.0
datasets:
- chenjoya/Live-CC-5M
- chenjoya/Live-WhisperX-526K
- lmms-lab/LLaVA-Video-178K
language:
- en
base_model:
- Qwen/Qwen2-VL-7B
tags:
- qwen_vl
- video
- real-time
- multimodal
- LLM
---
# <span style="color: #7FFF7F;">LiveCC-7B-Instruct GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`e291450`](https://github.com/ggerganov/llama.cpp/commit/e291450b7602d7a36239e4ceeece37625f838373).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `LiveCC-7B-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `LiveCC-7B-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `LiveCC-7B-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `LiveCC-7B-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `LiveCC-7B-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `LiveCC-7B-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `LiveCC-7B-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `LiveCC-7B-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `LiveCC-7B-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `LiveCC-7B-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `LiveCC-7B-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# LiveCC-7B-Instruct
## Introduction
We introduce LiveCC, the first video LLM capable of real-time commentary, trained with a novel video-ASR streaming method, SOTA on both streaming and offline benchmarks.
- Project Page: https://showlab.github.io/livecc
> [!Important]
> This is the SFT model. The base model is at [LiveCC-7B-Base](https://huggingface.co/chenjoya/LiveCC-7B-Base).
## Training with Streaming Frame-Words Paradigm
## Quickstart
### Gradio Demo
Please refer to https://github.com/showlab/livecc:
### Hands-on
Like qwen-vl-utils, we offer a toolkit to help you handle various types of visual input more conveniently, **especially on video streaming inputs**. You can install it using the following command:
```bash
pip install qwen-vl-utils livecc-utils liger_kernel
```
Here we show a code snippet to show you how to do **real-time video commentary** with `transformers` and the above utils:
```python
import functools, torch, os, tqdm
from liger_kernel.transformers import apply_liger_kernel_to_qwen2_vl
apply_liger_kernel_to_qwen2_vl() # important. our model is trained with this. keep consistency
from transformers import Qwen2VLForConditionalGeneration, AutoProcessor, LogitsProcessor, logging
from livecc_utils import prepare_multiturn_multimodal_inputs_for_generation, get_smart_resized_clip, get_smart_resized_video_reader
from qwen_vl_utils import process_vision_info
class LiveCCDemoInfer:
fps = 2
initial_fps_frames = 6
streaming_fps_frames = 2
initial_time_interval = initial_fps_frames / fps
streaming_time_interval = streaming_fps_frames / fps
frame_time_interval = 1 / fps
def __init__(self, model_path: str = None, device_id: int = 0):
self.model = Qwen2VLForConditionalGeneration.from_pretrained(
model_path, torch_dtype="auto",
device_map=f'cuda:{device_id}',
attn_implementation='flash_attention_2'
)
self.processor = AutoProcessor.from_pretrained(model_path, use_fast=False)
self.model.prepare_inputs_for_generation = functools.partial(prepare_multiturn_multimodal_inputs_for_generation, self.model)
message = {
"role": "user",
"content": [
{"type": "text", "text": 'livecc'},
]
}
texts = self.processor.apply_chat_template([message], tokenize=False)
self.system_prompt_offset = texts.index('<|im_start|>user')
self._cached_video_readers_with_hw = {}
def live_cc(
self,
query: str,
state: dict,
max_pixels: int = 384 * 28 * 28,
default_query: str = 'Please describe the video.',
do_sample: bool = True,
repetition_penalty: float = 1.05,
**kwargs,
):
"""
state: dict, (maybe) with keys:
video_path: str, video path
video_timestamp: float, current video timestamp
last_timestamp: float, last processed video timestamp
last_video_pts_index: int, last processed video frame index
video_pts: np.ndarray, video pts
last_history: list, last processed history
past_key_values: llm past_key_values
past_ids: past generated ids
"""
# 1. preparation: video_reader, and last processing info
video_timestamp, last_timestamp = state.get('video_timestamp', 0), state.get('last_timestamp', -1 / self.fps)
video_path = state['video_path']
if video_path not in self._cached_video_readers_with_hw:
self._cached_video_readers_with_hw[video_path] = get_smart_resized_video_reader(video_path, max_pixels)
video_reader = self._cached_video_readers_with_hw[video_path][0]
video_reader.get_frame_timestamp(0)
state['video_pts'] = torch.from_numpy(video_reader._frame_pts[:, 1])
state['last_video_pts_index'] = -1
video_pts = state['video_pts']
if last_timestamp + self.frame_time_interval > video_pts[-1]:
state['video_end'] = True
return
video_reader, resized_height, resized_width = self._cached_video_readers_with_hw[video_path]
last_video_pts_index = state['last_video_pts_index']
# 2. which frames will be processed
initialized = last_timestamp >= 0
if not initialized:
video_timestamp = max(video_timestamp, self.initial_time_interval)
if video_timestamp <= last_timestamp + self.frame_time_interval:
return
timestamps = torch.arange(last_timestamp + self.frame_time_interval, video_timestamp, self.frame_time_interval) # add compensation
# 3. fetch frames in required timestamps
clip, clip_timestamps, clip_idxs = get_smart_resized_clip(video_reader, resized_height, resized_width, timestamps, video_pts, video_pts_index_from=last_video_pts_index+1)
state['last_video_pts_index'] = clip_idxs[-1]
state['last_timestamp'] = clip_timestamps[-1]
# 4. organize to interleave frames
interleave_clips, interleave_timestamps = [], []
if not initialized:
interleave_clips.append(clip[:self.initial_fps_frames])
interleave_timestamps.append(clip_timestamps[:self.initial_fps_frames])
clip = clip[self.initial_fps_frames:]
clip_timestamps = clip_timestamps[self.initial_fps_frames:]
if len(clip) > 0:
interleave_clips.extend(list(clip.split(self.streaming_fps_frames)))
interleave_timestamps.extend(list(clip_timestamps.split(self.streaming_fps_frames)))
# 5. make conversation and send to model
for clip, timestamps in zip(interleave_clips, interleave_timestamps):
start_timestamp, stop_timestamp = timestamps[0].item(), timestamps[-1].item() + self.frame_time_interval
message = {
"role": "user",
"content": [
{"type": "text", "text": f'Time={start_timestamp:.1f}-{stop_timestamp:.1f}s'},
{"type": "video", "video": clip}
]
}
if not query and not state.get('query', None):
query = default_query
print(f'No query provided, use default_query={default_query}')
if query and state.get('query', None) != query:
message['content'].append({"type": "text", "text": query})
state['query'] = query
texts = self.processor.apply_chat_template([message], tokenize=False, add_generation_prompt=True, return_tensors='pt')
past_ids = state.get('past_ids', None)
if past_ids is not None:
texts = '<|im_end|>\n' + texts[self.system_prompt_offset:]
inputs = self.processor(
text=texts,
images=None,
videos=[clip],
return_tensors="pt",
return_attention_mask=False
)
inputs.to('cuda')
if past_ids is not None:
inputs['input_ids'] = torch.cat([past_ids, inputs.input_ids], dim=1)
outputs = self.model.generate(
**inputs, past_key_values=state.get('past_key_values', None),
return_dict_in_generate=True, do_sample=do_sample,
repetition_penalty=repetition_penalty,
)
state['past_key_values'] = outputs.past_key_values
state['past_ids'] = outputs.sequences[:, :-1]
yield (start_timestamp, stop_timestamp), self.processor.decode(outputs.sequences[0, inputs.input_ids.size(1):], skip_special_tokens=True), state
model_path = 'chenjoya/LiveCC-7B-Instruct'
# download a test video at: https://github.com/showlab/livecc/blob/main/demo/sources/howto_fix_laptop_mute_1080p.mp4
video_path = "demo/sources/howto_fix_laptop_mute_1080p.mp4"
query = "Please describe the video."
infer = LiveCCDemoInfer(model_path=model_path)
state = {'video_path': video_path}
commentaries = []
t = 0
for t in range(31):
state['video_timestamp'] = t
for (start_t, stop_t), response, state in infer.live_cc(
query=query, state=state,
max_pixels = 384 * 28 * 28, repetition_penalty=1.05,
streaming_eos_base_threshold=0.0, streaming_eos_threshold_step=0
):
print(f'{start_t}s-{stop_t}s: {response}')
commentaries.append([start_t, stop_t, response])
if state.get('video_end', False):
break
t += 1
```
Here we show a code snippet to show you how to do **common video (multi-turn) qa** with `transformers` and the above utils:
```python
import functools, torch
from liger_kernel.transformers import apply_liger_kernel_to_qwen2_vl
apply_liger_kernel_to_qwen2_vl() # important. our model is trained with this. keep consistency
from transformers import Qwen2VLForConditionalGeneration, AutoProcessor, LogitsProcessor, logging
from livecc_utils import prepare_multiturn_multimodal_inputs_for_generation, get_smart_resized_clip, get_smart_resized_video_reader
from qwen_vl_utils import process_vision_info
class LiveCCDemoInfer:
fps = 2
initial_fps_frames = 6
streaming_fps_frames = 2
initial_time_interval = initial_fps_frames / fps
streaming_time_interval = streaming_fps_frames / fps
frame_time_interval = 1 / fps
def __init__(self, model_path: str = None, device: str = 'cuda'):
self.model = Qwen2VLForConditionalGeneration.from_pretrained(
model_path, torch_dtype="auto",
device_map=device,
attn_implementation='flash_attention_2'
)
self.processor = AutoProcessor.from_pretrained(model_path, use_fast=False)
self.streaming_eos_token_id = self.processor.tokenizer(' ...').input_ids[-1]
self.model.prepare_inputs_for_generation = functools.partial(prepare_multiturn_multimodal_inputs_for_generation, self.model)
message = {
"role": "user",
"content": [
{"type": "text", "text": 'livecc'},
]
}
texts = self.processor.apply_chat_template([message], tokenize=False)
self.system_prompt_offset = texts.index('<|im_start|>user')
def video_qa(
self,
message: str,
state: dict,
do_sample: bool = True,
repetition_penalty: float = 1.05,
**kwargs,
):
"""
state: dict, (maybe) with keys:
video_path: str, video path
video_timestamp: float, current video timestamp
last_timestamp: float, last processed video timestamp
last_video_pts_index: int, last processed video frame index
video_pts: np.ndarray, video pts
last_history: list, last processed history
past_key_values: llm past_key_values
past_ids: past generated ids
"""
video_path = state.get('video_path', None)
conversation = []
past_ids = state.get('past_ids', None)
content = [{"type": "text", "text": message}]
if past_ids is None and video_path: # only use once
content.insert(0, {"type": "video", "video": video_path})
conversation.append({"role": "user", "content": content})
image_inputs, video_inputs = process_vision_info(conversation)
texts = self.processor.apply_chat_template(conversation, tokenize=False, add_generation_prompt=True, return_tensors='pt')
if past_ids is not None:
texts = '<|im_end|>\n' + texts[self.system_prompt_offset:]
inputs = self.processor(
text=texts,
images=image_inputs,
videos=video_inputs,
return_tensors="pt",
return_attention_mask=False
)
inputs.to(self.model.device)
if past_ids is not None:
inputs['input_ids'] = torch.cat([past_ids, inputs.input_ids], dim=1)
outputs = self.model.generate(
**inputs, past_key_values=state.get('past_key_values', None),
return_dict_in_generate=True, do_sample=do_sample,
repetition_penalty=repetition_penalty,
max_new_tokens=512,
)
state['past_key_values'] = outputs.past_key_values
state['past_ids'] = outputs.sequences[:, :-1]
response = self.processor.decode(outputs.sequences[0, inputs.input_ids.size(1):], skip_special_tokens=True)
return response, state
model_path = 'chenjoya/LiveCC-7B-Instruct'
# download a test video at: https://github.com/showlab/livecc/blob/main/demo/sources/howto_fix_laptop_mute_1080p.mp4
video_path = "demo/sources/howto_fix_laptop_mute_1080p.mp4"
infer = LiveCCDemoInfer(model_path=model_path)
state = {'video_path': video_path}
# first round
query1 = 'What is the video?'
response1, state = infer.video_qa(message=query1, state=state)
print(f'Q1: {query1}\nA1: {response1}')
# second round
query2 = 'How do you know that?'
response2, state = infer.video_qa(message=query2, state=state)
print(f'Q2: {query2}\nA2: {response2}')
```
## Performance
## Limitations
- This model is finetuned on LiveCC-7B-Base, which is starting from Qwen2-VL-7B-Base, so it may have limitations mentioned in https://huggingface.co/Qwen/Qwen2-VL-7B.
- When performing real-time video commentary, it may appear collapse --- e.g., repeat pattern. If you encounter this situation, try to adjust repetition_penalty, streaming_eos_base_threshold, and streaming_eos_threshold_step.
- This model only has a context window of 32768. Using more visual tokens per frame (e.g. 768 * 28 * 28) will have better performance, but will shorten the working duration.
These limitations serve as ongoing directions for model optimization and improvement, and we are committed to continually enhancing the model's performance and scope of application.
## Citation
If you find our work helpful, feel free to give us a cite.
```
@article{livecc,
author = {Joya Chen and Ziyun Zeng and Yiqi Lin and Wei Li and Zejun Ma and Mike Zheng Shou},
title = {LiveCC: Learning Video LLM with Streaming Speech Transcription at Scale},
journal = {arXiv preprint arXiv:2504.16030}
year = {2025},
}
``` |
Mungert/openhands-lm-7b-v0.1-GGUF | Mungert | 2025-06-15T19:37:33Z | 1,045 | 2 | null | [
"gguf",
"agent",
"coding",
"text-generation",
"en",
"dataset:SWE-Gym/SWE-Gym",
"arxiv:2412.21139",
"base_model:Qwen/Qwen2.5-Coder-7B-Instruct",
"base_model:quantized:Qwen/Qwen2.5-Coder-7B-Instruct",
"license:mit",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-04-26T08:57:49Z | ---
license: mit
datasets:
- SWE-Gym/SWE-Gym
language:
- en
base_model:
- Qwen/Qwen2.5-Coder-7B-Instruct
pipeline_tag: text-generation
tags:
- agent
- coding
---
# <span style="color: #7FFF7F;">openhands-lm-7b-v0.1 GGUF Models</span>
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `openhands-lm-7b-v0.1-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `openhands-lm-7b-v0.1-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `openhands-lm-7b-v0.1-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `openhands-lm-7b-v0.1-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `openhands-lm-7b-v0.1-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `openhands-lm-7b-v0.1-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `openhands-lm-7b-v0.1-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `openhands-lm-7b-v0.1-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `openhands-lm-7b-v0.1-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `openhands-lm-7b-v0.1-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `openhands-lm-7b-v0.1-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
<div align="center">
<img src="https://github.com/All-Hands-AI/OpenHands/blob/main/docs/static/img/logo.png?raw=true" alt="Logo" width="200">
<h1 align="center">OpenHands LM v0.1</h1>
</div>
<p align="center">
<a href="https://www.all-hands.dev/blog/introducing-openhands-lm-32b----a-strong-open-coding-agent-model">Blog</a>
•
<a href="https://docs.all-hands.dev/modules/usage/llms/local-llms" >Use it in OpenHands</a>
</p>
**This is a smaller 7B model trained following the recipe of [all-hands/openhands-lm-32b-v0.1](https://huggingface.co/all-hands/openhands-lm-32b-v0.1).**
---
Autonomous agents for software development are already contributing to a [wide range of software development tasks](/blog/8-use-cases-for-generalist-software-development-agents).
But up to this point, strong coding agents have relied on proprietary models, which means that even if you use an open-source agent like [OpenHands](https://github.com/All-Hands-AI/OpenHands), you are still reliant on API calls to an external service.
Today, we are excited to introduce OpenHands LM, a new open coding model that:
- Is open and [available on Hugging Face](https://huggingface.co/all-hands/openhands-lm-32b-v0.1), so you can download it and run it locally
- Is a reasonable size, 32B, so it can be run locally on hardware such as a single 3090 GPU
- Achieves strong performance on software engineering tasks, including 37.2% resolve rate on SWE-Bench Verified
Read below for more details and our future plans!
## What is OpenHands LM?
OpenHands LM is built on the foundation of [Qwen Coder 2.5 Instruct 32B](https://huggingface.co/Qwen/Qwen2.5-Coder-32B-Instruct), leveraging its powerful base capabilities for coding tasks. What sets OpenHands LM apart is our specialized fine-tuning process:
- We used training data generated by OpenHands itself on a diverse set of open-source repositories
- Specifically, we use an RL-based framework outlined in [SWE-Gym](https://arxiv.org/abs/2412.21139), where we set up a training environment, generate training data using an existing agent, and then fine-tune the model on examples that were resolved successfully
- It features a 128K token context window, ideal for handling large codebases and long-horizon software engineering tasks
## Performance: Punching Above Its Weight
We evaluated OpenHands LM using our latest [iterative evaluation protocol](https://github.com/All-Hands-AI/OpenHands/tree/main/evaluation/benchmarks/swe_bench#run-inference-rollout-on-swe-bench-instances-generate-patch-from-problem-statement) on the [SWE-Bench Verified benchmark](https://www.swebench.com/#verified).
The results are impressive:
- **37.2% verified resolve rate** on SWE-Bench Verified
- Performance comparable to models with **20x more parameters**, including Deepseek V3 0324 (38.8%) with 671B parameters
Here's how OpenHands LM compares to other leading open-source models:
As the plot demonstrates, our 32B parameter model achieves efficiency that approaches much larger models. While the largest models (671B parameters) achieve slightly higher scores, our 32B parameter model performs remarkably well, opening up possibilities for local deployment that are not possible with larger models.
## Getting Started: How to Use OpenHands LM Today
You can start using OpenHands LM immediately through these channels:
1. **Download the model from Hugging Face**
The model is available on [Hugging Face](https://huggingface.co/all-hands/openhands-lm-32b-v0.1) and can be downloaded directly from there.
2. **Create an OpenAI-compatible endpoint with a model serving framework**
For optimal performance, it is recommended to serve this model with a GPU using [SGLang](https://github.com/sgl-project/sglang) or [vLLM](https://github.com/vllm-project/vllm).
3. **Point your OpenHands agent to the new model**
Download [OpenHands](https://github.com/All-Hands-AI/OpenHands) and follow the instructions for [using an OpenAI-compatible endpoint](https://docs.all-hands.dev/modules/usage/llms/openai-llms#using-openai-compatible-endpoints).
## The Road Ahead: Our Development Plans
This initial release marks just the beginning of our journey. We will continue enhancing OpenHands LM based on community feedback and ongoing research initiatives.
In particular, it should be noted that the model is still a research preview, and (1) may be best suited for tasks regarding solving github issues and perform less well on more varied software engineering tasks, (2) may sometimes generate repetitive steps, and (3) is somewhat sensitive to quantization, and may not function at full performance at lower quantization levels.
Our next releases will focus on addressing these limitations.
We're also developing more compact versions of the model (including a 7B parameter variant) to support users with limited computational resources. These smaller models will preserve OpenHands LM's core strengths while dramatically reducing hardware requirements.
We encourage you to experiment with OpenHands LM, share your experiences, and participate in its evolution. Together, we can create better tools for tomorrow's software development landscape.
## Try OpenHands Cloud
While OpenHands LM is a powerful model you can run locally, we also offer a fully managed cloud solution that makes it even easier to leverage AI for your software development needs.
[OpenHands Cloud](https://www.all-hands.dev/blog/introducing-the-openhands-cloud) provides:
- Seamless GitHub integration with issue and PR support
- Multiple interaction methods including text, voice, and mobile
- Parallel agent capabilities for working on multiple tasks simultaneously
- All the power of OpenHands without managing infrastructure
OpenHands Cloud is built on the same technology as our open-source solution but adds convenient features for teams and individuals who want a ready-to-use platform. [Visit app.all-hands.dev](https://app.all-hands.dev) to get started today!
## Join Our Community
We invite you to be part of the OpenHands LM journey:
- Explore our [GitHub repository](https://github.com/All-Hands-AI/OpenHands)
- Connect with us on [Slack](https://join.slack.com/t/openhands-ai/shared_invite/zt-2tom0er4l-JeNUGHt_AxpEfIBstbLPiw)
- Follow our [documentation](https://docs.all-hands.dev) to get started
By contributing your experiences and feedback, you'll help shape the future of this open-source initiative. Together, we can create better tools for tomorrow's software development landscape.
We can't wait to see what you'll create with OpenHands LM! |
Mungert/GLM-Z1-9B-0414-GGUF | Mungert | 2025-06-15T19:37:27Z | 1,000 | 5 | transformers | [
"transformers",
"gguf",
"text-generation",
"zh",
"en",
"arxiv:2406.12793",
"license:mit",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-04-26T06:57:42Z | ---
license: mit
language:
- zh
- en
pipeline_tag: text-generation
library_name: transformers
---
# <span style="color: #7FFF7F;">GLM-Z1-9B-0414 GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`e291450`](https://github.com/ggerganov/llama.cpp/commit/e291450b7602d7a36239e4ceeece37625f838373).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `GLM-Z1-9B-0414-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `GLM-Z1-9B-0414-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `GLM-Z1-9B-0414-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `GLM-Z1-9B-0414-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `GLM-Z1-9B-0414-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `GLM-Z1-9B-0414-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `GLM-Z1-9B-0414-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `GLM-Z1-9B-0414-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `GLM-Z1-9B-0414-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `GLM-Z1-9B-0414-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `GLM-Z1-9B-0414-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# GLM-4-Z1-9B-0414
## Introduction
The GLM family welcomes a new generation of open-source models, the **GLM-4-32B-0414** series, featuring 32 billion parameters. Its performance is comparable to OpenAI's GPT series and DeepSeek's V3/R1 series, and it supports very user-friendly local deployment features. GLM-4-32B-Base-0414 was pre-trained on 15T of high-quality data, including a large amount of reasoning-type synthetic data, laying the foundation for subsequent reinforcement learning extensions. In the post-training stage, in addition to human preference alignment for dialogue scenarios, we also enhanced the model's performance in instruction following, engineering code, and function calling using techniques such as rejection sampling and reinforcement learning, strengthening the atomic capabilities required for agent tasks. GLM-4-32B-0414 achieves good results in areas such as engineering code, Artifact generation, function calling, search-based Q&A, and report generation. Some benchmarks even rival larger models like GPT-4o and DeepSeek-V3-0324 (671B).
**GLM-Z1-32B-0414** is a reasoning model with **deep thinking capabilities**. This was developed based on GLM-4-32B-0414 through cold start and extended reinforcement learning, as well as further training of the model on tasks involving mathematics, code, and logic. Compared to the base model, GLM-Z1-32B-0414 significantly improves mathematical abilities and the capability to solve complex tasks. During the training process, we also introduced general reinforcement learning based on pairwise ranking feedback, further enhancing the model's general capabilities.
**GLM-Z1-Rumination-32B-0414** is a deep reasoning model with **rumination capabilities** (benchmarked against OpenAI's Deep Research). Unlike typical deep thinking models, the rumination model employs longer periods of deep thought to solve more open-ended and complex problems (e.g., writing a comparative analysis of AI development in two cities and their future development plans). The rumination model integrates search tools during its deep thinking process to handle complex tasks and is trained by utilizing multiple rule-based rewards to guide and extend end-to-end reinforcement learning. Z1-Rumination shows significant improvements in research-style writing and complex retrieval tasks.
Finally, **GLM-Z1-9B-0414** is a surprise. We employed the aforementioned series of techniques to train a 9B small-sized model that maintains the open-source tradition. Despite its smaller scale, GLM-Z1-9B-0414 still exhibits excellent capabilities in mathematical reasoning and general tasks. Its overall performance is already at a leading level among open-source models of the same size. Especially in resource-constrained scenarios, this model achieves an excellent balance between efficiency and effectiveness, providing a powerful option for users seeking lightweight deployment.
## Performance
<p align="center">
<img width="100%" src="https://raw.githubusercontent.com/THUDM/GLM-4/refs/heads/main/resources/Bench-Z1-32B.png">
</p>
<p align="center">
<img width="100%" src="https://raw.githubusercontent.com/THUDM/GLM-4/refs/heads/main/resources/Bench-Z1-9B.png">
</p>
## Model Usage Guidelines
### I. Sampling Parameters
| Parameter | Recommended Value | Description |
| ------------ | ----------------- | -------------------------------------------- |
| temperature | **0.6** | Balances creativity and stability |
| top_p | **0.95** | Cumulative probability threshold for sampling|
| top_k | **40** | Filters out rare tokens while maintaining diversity |
| max_new_tokens | **30000** | Leaves enough tokens for thinking |
### II. Enforced Thinking
- Add \<think\>\n to the **first line**: Ensures the model thinks before responding
- When using `chat_template.jinja`, the prompt is automatically injected to enforce this behavior
### III. Dialogue History Trimming
- Retain only the **final user-visible reply**.
Hidden thinking content should **not** be saved to history to reduce interference—this is already implemented in `chat_template.jinja`
### IV. Handling Long Contexts (YaRN)
- When input length exceeds **8,192 tokens**, consider enabling YaRN (Rope Scaling)
- In supported frameworks, add the following snippet to `config.json`:
```json
"rope_scaling": {
"type": "yarn",
"factor": 4.0,
"original_max_position_embeddings": 32768
}
```
- **Static YaRN** applies uniformly to all text. It may slightly degrade performance on short texts, so enable as needed.
## Inference Code
Make Sure Using `transforemrs>=4.51.3`.
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
MODEL_PATH = "THUDM/GLM-4-Z1-9B-0414"
tokenizer = AutoTokenizer.from_pretrained(MODEL_PATH)
model = AutoModelForCausalLM.from_pretrained(MODEL_PATH, device_map="auto")
message = [{"role": "user", "content": "Let a, b be positive real numbers such that ab = a + b + 3. Determine the range of possible values for a + b."}]
inputs = tokenizer.apply_chat_template(
message,
return_tensors="pt",
add_generation_prompt=True,
return_dict=True,
).to(model.device)
generate_kwargs = {
"input_ids": inputs["input_ids"],
"attention_mask": inputs["attention_mask"],
"max_new_tokens": 4096,
"do_sample": False,
}
out = model.generate(**generate_kwargs)
print(tokenizer.decode(out[0][inputs["input_ids"].shape[1]:], skip_special_tokens=True))
```
## Citations
If you find our work useful, please consider citing the following paper.
```
@misc{glm2024chatglm,
title={ChatGLM: A Family of Large Language Models from GLM-130B to GLM-4 All Tools},
author={Team GLM and Aohan Zeng and Bin Xu and Bowen Wang and Chenhui Zhang and Da Yin and Diego Rojas and Guanyu Feng and Hanlin Zhao and Hanyu Lai and Hao Yu and Hongning Wang and Jiadai Sun and Jiajie Zhang and Jiale Cheng and Jiayi Gui and Jie Tang and Jing Zhang and Juanzi Li and Lei Zhao and Lindong Wu and Lucen Zhong and Mingdao Liu and Minlie Huang and Peng Zhang and Qinkai Zheng and Rui Lu and Shuaiqi Duan and Shudan Zhang and Shulin Cao and Shuxun Yang and Weng Lam Tam and Wenyi Zhao and Xiao Liu and Xiao Xia and Xiaohan Zhang and Xiaotao Gu and Xin Lv and Xinghan Liu and Xinyi Liu and Xinyue Yang and Xixuan Song and Xunkai Zhang and Yifan An and Yifan Xu and Yilin Niu and Yuantao Yang and Yueyan Li and Yushi Bai and Yuxiao Dong and Zehan Qi and Zhaoyu Wang and Zhen Yang and Zhengxiao Du and Zhenyu Hou and Zihan Wang},
year={2024},
eprint={2406.12793},
archivePrefix={arXiv},
primaryClass={id='cs.CL' full_name='Computation and Language' is_active=True alt_name='cmp-lg' in_archive='cs' is_general=False description='Covers natural language processing. Roughly includes material in ACM Subject Class I.2.7. Note that work on artificial languages (programming languages, logics, formal systems) that does not explicitly address natural-language issues broadly construed (natural-language processing, computational linguistics, speech, text retrieval, etc.) is not appropriate for this area.'}
}
``` |
Mungert/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-GGUF | Mungert | 2025-06-15T19:37:23Z | 405 | 2 | transformers | [
"transformers",
"gguf",
"en",
"license:cc-by-nc-4.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-04-24T03:40:42Z | ---
library_name: transformers
language:
- en
license: cc-by-nc-4.0
---
# <span style="color: #7FFF7F;">Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct GGUF Models</span>
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# Model Information
We introduce **Nemotron-UltraLong-8B**, a series of ultra-long context language models designed to process extensive sequences of text (up to 1M, 2M, and 4M tokens) while maintaining competitive performance on standard benchmarks. Built on the Llama-3.1, UltraLong-8B leverages a systematic training recipe that combines efficient continued pretraining with instruction tuning to enhance long-context understanding and instruction-following capabilities. This approach enables our models to efficiently scale their context windows without sacrificing general performance.
## The UltraLong Models
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct)
## Uses
Starting with `transformers >= 4.43.0` onward, you can run conversational inference using the Transformers `pipeline` abstraction or by leveraging the Auto classes with the `generate()` function.
Make sure to update your transformers installation via `pip install --upgrade transformers`.
```python
import transformers
import torch
model_id = "nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct"
pipeline = transformers.pipeline(
"text-generation",
model=model_id,
model_kwargs={"torch_dtype": torch.bfloat16},
device_map="auto",
)
messages = [
{"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"},
{"role": "user", "content": "Who are you?"},
]
outputs = pipeline(
messages,
max_new_tokens=256,
)
print(outputs[0]["generated_text"][-1])
```
## Model Card
* Base model: [meta-llama/Llama-3.1-8B-Instruct](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct)
* Continued Pretraining: The training data consists of 1B tokens sourced from a pretraining corpus using per-domain upsampling based on sample length. The model was trained for 125 iterations with a sequence length of 1M and a global batch size of 8.
* Supervised fine-tuning (SFT): 1B tokens on open-source instruction datasets across general, mathematics, and code domains. We subsample the data from the ‘general_sft_stage2’ from [AceMath-Instruct](https://huggingface.co/datasets/nvidia/AceMath-Instruct-Training-Data).
* Maximum context window: 1M tokens
## Evaluation Results
We evaluate Nemotron-UltraLong-8B on a diverse set of benchmarks, including long-context tasks (e.g., RULER, LV-Eval, and InfiniteBench) and standard tasks (e.g., MMLU, MATH, GSM-8K, and HumanEval). UltraLong-8B achieves superior performance on ultra-long context tasks while maintaining competitive results on standard benchmarks.
### Needle in a Haystack
<img width="80%" alt="image" src="Llama-3.1-8B-UltraLong-1M-Instruct.png">
### Long context evaluation
<img width="80%" alt="image" src="long_benchmark.png">
### Standard capability evaluation
<img width="80%" alt="image" src="standard_benchmark.png">
## Correspondence to
Chejian Xu ([email protected]), Wei Ping ([email protected])
## Citation
<pre>
@article{ulralong2025,
title={From 128K to 4M: Efficient Training of Ultra-Long Context Large Language Models},
author={Xu, Chejian and Ping, Wei and Xu, Peng and Liu, Zihan and Wang, Boxin and Shoeybi, Mohammad and Catanzaro, Bryan},
journal={arXiv preprint},
year={2025}
}
</pre> |
ALYTV/Qwen2.5-Coder-7B-mlx-6Bit | ALYTV | 2025-06-15T19:37:22Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"qwen2",
"text-generation",
"code",
"qwen",
"qwen-coder",
"codeqwen",
"mlx",
"mlx-my-repo",
"conversational",
"en",
"base_model:Qwen/Qwen2.5-Coder-7B",
"base_model:quantized:Qwen/Qwen2.5-Coder-7B",
"license:apache-2.0",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"6-bit",
"region:us"
] | text-generation | 2025-06-15T19:36:56Z | ---
license: apache-2.0
license_link: https://huggingface.co/Qwen/Qwen2.5-Coder-7B/blob/main/LICENSE
language:
- en
base_model: Qwen/Qwen2.5-Coder-7B
pipeline_tag: text-generation
library_name: transformers
tags:
- code
- qwen
- qwen-coder
- codeqwen
- mlx
- mlx-my-repo
---
# ALYTV/Qwen2.5-Coder-7B-mlx-6Bit
The Model [ALYTV/Qwen2.5-Coder-7B-mlx-6Bit](https://huggingface.co/ALYTV/Qwen2.5-Coder-7B-mlx-6Bit) was converted to MLX format from [Qwen/Qwen2.5-Coder-7B](https://huggingface.co/Qwen/Qwen2.5-Coder-7B) using mlx-lm version **0.22.3**.
## Use with mlx
```bash
pip install mlx-lm
```
```python
from mlx_lm import load, generate
model, tokenizer = load("ALYTV/Qwen2.5-Coder-7B-mlx-6Bit")
prompt="hello"
if hasattr(tokenizer, "apply_chat_template") and tokenizer.chat_template is not None:
messages = [{"role": "user", "content": prompt}]
prompt = tokenizer.apply_chat_template(
messages, tokenize=False, add_generation_prompt=True
)
response = generate(model, tokenizer, prompt=prompt, verbose=True)
```
|
Mungert/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-GGUF | Mungert | 2025-06-15T19:37:19Z | 357 | 3 | transformers | [
"transformers",
"gguf",
"en",
"license:cc-by-nc-4.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-04-23T18:08:11Z | ---
library_name: transformers
language:
- en
license: cc-by-nc-4.0
---
# <span style="color: #7FFF7F;">Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct GGUF Models</span>
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# Model Information
We introduce **Nemotron-UltraLong-8B**, a series of ultra-long context language models designed to process extensive sequences of text (up to 1M, 2M, and 4M tokens) while maintaining competitive performance on standard benchmarks. Built on the Llama-3.1, UltraLong-8B leverages a systematic training recipe that combines efficient continued pretraining with instruction tuning to enhance long-context understanding and instruction-following capabilities. This approach enables our models to efficiently scale their context windows without sacrificing general performance.
## The UltraLong Models
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct)
## Uses
Starting with `transformers >= 4.43.0` onward, you can run conversational inference using the Transformers `pipeline` abstraction or by leveraging the Auto classes with the `generate()` function.
Make sure to update your transformers installation via `pip install --upgrade transformers`.
```python
import transformers
import torch
model_id = "nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct"
pipeline = transformers.pipeline(
"text-generation",
model=model_id,
model_kwargs={"torch_dtype": torch.bfloat16},
device_map="auto",
)
messages = [
{"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"},
{"role": "user", "content": "Who are you?"},
]
outputs = pipeline(
messages,
max_new_tokens=256,
)
print(outputs[0]["generated_text"][-1])
```
## Model Card
* Base model: [meta-llama/Llama-3.1-8B-Instruct](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct)
* Continued Pretraining: The training data consists of 1B tokens sourced from a pretraining corpus using per-domain upsampling based on sample length. The model was trained for 245 steps with a sequence length of 2M and a global batch size of 2.
* Supervised fine-tuning (SFT): 1B tokens on open-source instruction datasets across general, mathematics, and code domains. We subsample the data from the ‘general_sft_stage2’ from [AceMath-Instruct](https://huggingface.co/datasets/nvidia/AceMath-Instruct-Training-Data).
* Maximum context window: 2M tokens
## Evaluation Results
We evaluate Nemotron-UltraLong-8B on a diverse set of benchmarks, including long-context tasks (e.g., RULER, LV-Eval, and InfiniteBench) and standard tasks (e.g., MMLU, MATH, GSM-8K, and HumanEval). UltraLong-8B achieves superior performance on ultra-long context tasks while maintaining competitive results on standard benchmarks.
### Needle in a Haystack
<img width="80%" alt="image" src="Llama-3.1-8B-UltraLong-2M-Instruct.png">
### Long context evaluation
<img width="80%" alt="image" src="long_benchmark.png">
### Standard capability evaluation
<img width="80%" alt="image" src="standard_benchmark.png">
## Correspondence to
Chejian Xu ([email protected]), Wei Ping ([email protected])
## Citation
<pre>
@article{ulralong2025,
title={From 128K to 4M: Efficient Training of Ultra-Long Context Large Language Models},
author={Xu, Chejian and Ping, Wei and Xu, Peng and Liu, Zihan and Wang, Boxin and Shoeybi, Mohammad and Catanzaro, Bryan},
journal={arXiv preprint},
year={2025}
}
</pre> |
Mungert/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-GGUF | Mungert | 2025-06-15T19:37:15Z | 846 | 5 | transformers | [
"transformers",
"gguf",
"en",
"license:cc-by-nc-4.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-04-22T19:51:00Z | ---
library_name: transformers
language:
- en
license: cc-by-nc-4.0
---
# <span style="color: #7FFF7F;">Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct GGUF Models</span>
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard)
💬 **How to test**:
1. Click the **chat icon** (bottom right on any page)
2. Choose an **AI assistant type**:
- `TurboLLM` (GPT-4-mini)
- `FreeLLM` (Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Metasploit integration**
🟡 **TestLLM** – Current experimental model (llama.cpp on 6 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4-mini** for:
- **Real-time network diagnostics**
- **Automated penetration testing** (Nmap/Metasploit)
- 🔑 Get more tokens by [downloading our Quantum Network Monitor Agent](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
🔵 **HugLLM** – Open-source models (≈8B params):
- **2x more tokens** than TurboLLM
- **AI-powered log analysis**
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example AI Commands to Test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a quick Nmap vulnerability test"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# Model Information
We introduce **Nemotron-UltraLong-8B**, a series of ultra-long context language models designed to process extensive sequences of text (up to 1M, 2M, and 4M tokens) while maintaining competitive performance on standard benchmarks. Built on the Llama-3.1, UltraLong-8B leverages a systematic training recipe that combines efficient continued pretraining with instruction tuning to enhance long-context understanding and instruction-following capabilities. This approach enables our models to efficiently scale their context windows without sacrificing general performance.
## The UltraLong Models
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-1M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-2M-Instruct)
- [nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct](https://huggingface.co/nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct)
## Uses
Starting with `transformers >= 4.43.0` onward, you can run conversational inference using the Transformers `pipeline` abstraction or by leveraging the Auto classes with the `generate()` function.
Make sure to update your transformers installation via `pip install --upgrade transformers`.
```python
import transformers
import torch
model_id = "nvidia/Llama-3.1-Nemotron-8B-UltraLong-4M-Instruct"
pipeline = transformers.pipeline(
"text-generation",
model=model_id,
model_kwargs={"torch_dtype": torch.bfloat16},
device_map="auto",
)
messages = [
{"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"},
{"role": "user", "content": "Who are you?"},
]
outputs = pipeline(
messages,
max_new_tokens=256,
)
print(outputs[0]["generated_text"][-1])
```
## Model Card
* Base model: [meta-llama/Llama-3.1-8B-Instruct](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct)
* Continued Pretraining: The training data consists of 1B tokens sourced from a pretraining corpus using per-domain upsampling based on sample length. The model was trained for 150 iterations with a sequence length of 4M and a global batch size of 2.
* Supervised fine-tuning (SFT): 1B tokens on open-source instruction datasets across general, mathematics, and code domains. We subsample the data from the ‘general_sft_stage2’ from [AceMath-Instruct](https://huggingface.co/datasets/nvidia/AceMath-Instruct-Training-Data).
* Maximum context window: 4M tokens
## Evaluation Results
We evaluate Nemotron-UltraLong-8B on a diverse set of benchmarks, including long-context tasks (e.g., RULER, LV-Eval, and InfiniteBench) and standard tasks (e.g., MMLU, MATH, GSM-8K, and HumanEval). UltraLong-8B achieves superior performance on ultra-long context tasks while maintaining competitive results on standard benchmarks.
### Needle in a Haystack
<img width="80%" alt="image" src="Llama-3.1-8B-UltraLong-4M-Instruct.png">
### Long context evaluation
<img width="80%" alt="image" src="long_benchmark.png">
### Standard capability evaluation
<img width="80%" alt="image" src="standard_benchmark.png">
## Correspondence to
Chejian Xu ([email protected]), Wei Ping ([email protected])
## Citation
<pre>
@article{ulralong2025,
title={From 128K to 4M: Efficient Training of Ultra-Long Context Large Language Models},
author={Xu, Chejian and Ping, Wei and Xu, Peng and Liu, Zihan and Wang, Boxin and Shoeybi, Mohammad and Catanzaro, Bryan},
journal={arXiv preprint},
year={2025}
}
</pre> |
Mungert/EXAONE-Deep-32B-GGUF | Mungert | 2025-06-15T19:36:57Z | 484 | 4 | transformers | [
"transformers",
"gguf",
"lg-ai",
"exaone",
"exaone-deep",
"text-generation",
"en",
"ko",
"arxiv:2503.12524",
"base_model:LGAI-EXAONE/EXAONE-3.5-32B-Instruct",
"base_model:finetune:LGAI-EXAONE/EXAONE-3.5-32B-Instruct",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-03-25T02:52:54Z | ---
base_model: LGAI-EXAONE/EXAONE-3.5-32B-Instruct
base_model_relation: finetune
license: other
license_name: exaone
license_link: LICENSE
language:
- en
- ko
tags:
- lg-ai
- exaone
- exaone-deep
pipeline_tag: text-generation
library_name: transformers
---
# <span style="color: #7FFF7F;">EXAONE-Deep-32B GGUF Models</span>
## **Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)**
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Key Improvements**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device’s specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn’t available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `EXAONE-Deep-32B-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `EXAONE-Deep-32B-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `EXAONE-Deep-32B-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `EXAONE-Deep-32B-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `EXAONE-Deep-32B-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `EXAONE-Deep-32B-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `EXAONE-Deep-32B-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `EXAONE-Deep-32B-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `EXAONE-Deep-32B-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `EXAONE-Deep-32B-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `EXAONE-Deep-32B-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Please click like ❤ . Also I’d really appreciate it if you could test my Network Monitor Assistant at 👉 [Network Monitor Assitant](https://readyforquantum.com).
💬 Click the **chat icon** (bottom right of the main and dashboard pages) . Choose a LLM; toggle between the LLM Types TurboLLM -> FreeLLM -> TestLLM.
### What I'm Testing
I'm experimenting with **function calling** against my network monitoring service. Using small open source models. I am into the question "How small can it go and still function".
🟡 **TestLLM** – Runs the current testing model using llama.cpp on 6 threads of a Cpu VM (Should take about 15s to load. Inference speed is quite slow and it only processes one user prompt at a time—still working on scaling!). If you're curious, I'd be happy to share how it works! .
### The other Available AI Assistants
🟢 **TurboLLM** – Uses **gpt-4o-mini** Fast! . Note: tokens are limited since OpenAI models are pricey, but you can [Login](https://readyforquantum.com) or [Download](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme) the Quantum Network Monitor agent to get more tokens, Alternatively use the TestLLM .
🔵 **HugLLM** – Runs **open-source Hugging Face models** Fast, Runs small models (≈8B) hence lower quality, Get 2x more tokens (subject to Hugging Face API availability)
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
<p align="center">
<img src="assets/EXAONE_Symbol+BI_3d.png", width="300", style="margin: 40 auto;">
<br>
# EXAONE-Deep-32B
## Introduction
We introduce EXAONE Deep, which exhibits superior capabilities in various reasoning tasks including math and coding benchmarks, ranging from 2.4B to 32B parameters developed and released by LG AI Research. Evaluation results show that 1) EXAONE Deep **2.4B** outperforms other models of comparable size, 2) EXAONE Deep **7.8B** outperforms not only open-weight models of comparable scale but also a proprietary reasoning model OpenAI o1-mini, and 3) EXAONE Deep **32B** demonstrates competitive performance against leading open-weight models.
For more details, please refer to our [documentation](https://arxiv.org/abs/2503.12524), [blog](https://www.lgresearch.ai/news/view?seq=543) and [GitHub](https://github.com/LG-AI-EXAONE/EXAONE-Deep).
<p align="center">
<img src="assets/exaone_deep_overall_performance.png", width="100%", style="margin: 40 auto;">
This repository contains the reasoning 32B language model with the following features:
- Number of Parameters (without embeddings): 30.95B
- Number of Layers: 64
- Number of Attention Heads: GQA with 40 Q-heads and 8 KV-heads
- Vocab Size: 102,400
- Context Length: 32,768 tokens
## Quickstart
We recommend to use `transformers` v4.43.1 or later.
Here is the code snippet to run conversational inference with the model:
```python
import torch
from transformers import AutoModelForCausalLM, AutoTokenizer, TextIteratorStreamer
from threading import Thread
model_name = "LGAI-EXAONE/EXAONE-Deep-32B"
streaming = True # choose the streaming option
model = AutoModelForCausalLM.from_pretrained(
model_name,
torch_dtype=torch.bfloat16,
trust_remote_code=True,
device_map="auto"
)
tokenizer = AutoTokenizer.from_pretrained(model_name)
# Choose your prompt:
# Math example (AIME 2024)
prompt = r"""Let $x,y$ and $z$ be positive real numbers that satisfy the following system of equations:
\[\log_2\left({x \over yz}\right) = {1 \over 2}\]\[\log_2\left({y \over xz}\right) = {1 \over 3}\]\[\log_2\left({z \over xy}\right) = {1 \over 4}\]
Then the value of $\left|\log_2(x^4y^3z^2)\right|$ is $\tfrac{m}{n}$ where $m$ and $n$ are relatively prime positive integers. Find $m+n$.
Please reason step by step, and put your final answer within \boxed{}."""
# Korean MCQA example (CSAT Math 2025)
prompt = r"""Question : $a_1 = 2$인 수열 $\{a_n\}$과 $b_1 = 2$인 등차수열 $\{b_n\}$이 모든 자연수 $n$에 대하여\[\sum_{k=1}^{n} \frac{a_k}{b_{k+1}} = \frac{1}{2} n^2\]을 만족시킬 때, $\sum_{k=1}^{5} a_k$의 값을 구하여라.
Options :
A) 120
B) 125
C) 130
D) 135
E) 140
Please reason step by step, and you should write the correct option alphabet (A, B, C, D or E) within \\boxed{}."""
messages = [
{"role": "user", "content": prompt}
]
input_ids = tokenizer.apply_chat_template(
messages,
tokenize=True,
add_generation_prompt=True,
return_tensors="pt"
)
if streaming:
streamer = TextIteratorStreamer(tokenizer)
thread = Thread(target=model.generate, kwargs=dict(
input_ids=input_ids.to("cuda"),
eos_token_id=tokenizer.eos_token_id,
max_new_tokens=32768,
do_sample=True,
temperature=0.6,
top_p=0.95,
streamer=streamer
))
thread.start()
for text in streamer:
print(text, end="", flush=True)
else:
output = model.generate(
input_ids.to("cuda"),
eos_token_id=tokenizer.eos_token_id,
max_new_tokens=32768,
do_sample=True,
temperature=0.6,
top_p=0.95,
)
print(tokenizer.decode(output[0]))
```
> ### Note
> The EXAONE Deep models are trained with an optimized configuration,
> so we recommend following the [Usage Guideline](#usage-guideline) section to achieve optimal performance.
## Evaluation
The following table shows the evaluation results of reasoning tasks such as math and coding. The full evaluation results can be found in the [documentation](https://arxiv.org/abs/2503.12524).
<table>
<tr>
<th>Models</th>
<th>MATH-500 (pass@1)</th>
<th>AIME 2024 (pass@1 / cons@64)</th>
<th>AIME 2025 (pass@1 / cons@64)</th>
<th>CSAT Math 2025 (pass@1)</th>
<th>GPQA Diamond (pass@1)</th>
<th>Live Code Bench (pass@1)</th>
</tr>
<tr>
<td>EXAONE Deep 32B</td>
<td>95.7</td>
<td>72.1 / <strong>90.0</strong></td>
<td>65.8 / <strong>80.0</strong></td>
<td><strong>94.5</strong></td>
<td>66.1</td>
<td>59.5</td>
</tr>
<tr>
<td>DeepSeek-R1-Distill-Qwen-32B</td>
<td>94.3</td>
<td>72.6 / 83.3</td>
<td>55.2 / 73.3</td>
<td>84.1</td>
<td>62.1</td>
<td>57.2</td>
</tr>
<tr>
<td>QwQ-32B</td>
<td>95.5</td>
<td>79.5 / 86.7</td>
<td><strong>67.1</strong> / 76.7</td>
<td>94.4</td>
<td>63.3</td>
<td>63.4</td>
</tr>
<tr>
<td>DeepSeek-R1-Distill-Llama-70B</td>
<td>94.5</td>
<td>70.0 / 86.7</td>
<td>53.9 / 66.7</td>
<td>88.8</td>
<td>65.2</td>
<td>57.5</td>
</tr>
<tr>
<td>DeepSeek-R1 (671B)</td>
<td><strong>97.3</strong></td>
<td><strong>79.8</strong> / 86.7</td>
<td>66.8 / <strong>80.0</strong></td>
<td>89.9</td>
<td><strong>71.5</strong></td>
<td><strong>65.9</strong></td>
</tr>
<tr>
<th colspan="7" height="30px"></th>
</tr>
<tr>
<td>EXAONE Deep 7.8B</td>
<td><strong>94.8</strong></td>
<td><strong>70.0</strong> / <strong>83.3</strong></td>
<td><strong>59.6</strong> / <strong>76.7</strong></td>
<td><strong>89.9</strong></td>
<td><strong>62.6</strong></td>
<td><strong>55.2</strong></td>
</tr>
<tr>
<td>DeepSeek-R1-Distill-Qwen-7B</td>
<td>92.8</td>
<td>55.5 / <strong>83.3</strong></td>
<td>38.5 / 56.7</td>
<td>79.7</td>
<td>49.1</td>
<td>37.6</td>
</tr>
<tr>
<td>DeepSeek-R1-Distill-Llama-8B</td>
<td>89.1</td>
<td>50.4 / 80.0</td>
<td>33.6 / 53.3</td>
<td>74.1</td>
<td>49.0</td>
<td>39.6</td>
</tr>
<tr>
<td>OpenAI o1-mini</td>
<td>90.0</td>
<td>63.6 / 80.0</td>
<td>54.8 / 66.7</td>
<td>84.4</td>
<td>60.0</td>
<td>53.8</td>
</tr>
<tr>
<th colspan="7" height="30px"></th>
</tr>
<tr>
<td>EXAONE Deep 2.4B</td>
<td><strong>92.3</strong></td>
<td><strong>52.5</strong> / <strong>76.7</strong></td>
<td><strong>47.9</strong> / <strong>73.3</strong></td>
<td><strong>79.2</strong></td>
<td><strong>54.3</strong></td>
<td><strong>46.6</strong></td>
</tr>
<tr>
<td>DeepSeek-R1-Distill-Qwen-1.5B</td>
<td>83.9</td>
<td>28.9 / 52.7</td>
<td>23.9 / 36.7</td>
<td>65.6</td>
<td>33.8</td>
<td>16.9</td>
</tr>
</table>
## Deployment
EXAONE Deep models can be inferred in the various frameworks, such as:
- `TensorRT-LLM`
- `vLLM`
- `SGLang`
- `llama.cpp`
- `Ollama`
- `LM-Studio`
Please refer to our [EXAONE Deep GitHub](https://github.com/LG-AI-EXAONE/EXAONE-Deep) for more details about the inference frameworks.
## Quantization
We provide the pre-quantized EXAONE Deep models with **AWQ** and several quantization types in **GGUF** format. Please refer to our [EXAONE Deep collection](https://huggingface.co/collections/LGAI-EXAONE/exaone-deep-67d119918816ec6efa79a4aa) to find corresponding quantized models.
## Usage Guideline
To achieve the expected performance, we recommend using the following configurations:
1. Ensure the model starts with `<thought>\n` for reasoning steps. The model's output quality may be degraded when you omit it. You can easily apply this feature by using `tokenizer.apply_chat_template()` with `add_generation_prompt=True`. Please check the example code on [Quickstart](#quickstart) section.
2. The reasoning steps of EXAONE Deep models enclosed by `<thought>\n...\n</thought>` usually have lots of tokens, so previous reasoning steps may be necessary to be removed in multi-turn situation. The provided tokenizer handles this automatically.
3. Avoid using system prompt, and build the instruction on the user prompt.
4. Additional instructions help the models reason more deeply, so that the models generate better output.
- For math problems, the instructions **"Please reason step by step, and put your final answer within \boxed{}."** are helpful.
- For more information on our evaluation setting including prompts, please refer to our [Documentation](https://arxiv.org/abs/2503.12524).
5. In our evaluation, we use `temperature=0.6` and `top_p=0.95` for generation.
6. When evaluating the models, it is recommended to test multiple times to assess the expected performance accurately.
## Limitation
The EXAONE language model has certain limitations and may occasionally generate inappropriate responses. The language model generates responses based on the output probability of tokens, and it is determined during learning from training data. While we have made every effort to exclude personal, harmful, and biased information from the training data, some problematic content may still be included, potentially leading to undesirable responses. Please note that the text generated by EXAONE language model does not reflects the views of LG AI Research.
- Inappropriate answers may be generated, which contain personal, harmful or other inappropriate information.
- Biased responses may be generated, which are associated with age, gender, race, and so on.
- The generated responses rely heavily on statistics from the training data, which can result in the generation of
semantically or syntactically incorrect sentences.
- Since the model does not reflect the latest information, the responses may be false or contradictory.
LG AI Research strives to reduce potential risks that may arise from EXAONE language models. Users are not allowed
to engage in any malicious activities (e.g., keying in illegal information) that may induce the creation of inappropriate
outputs violating LG AI’s ethical principles when using EXAONE language models.
## License
The model is licensed under [EXAONE AI Model License Agreement 1.1 - NC](./LICENSE)
## Citation
```
@article{exaone-deep,
title={EXAONE Deep: Reasoning Enhanced Language Models},
author={{LG AI Research}},
journal={arXiv preprint arXiv:2503.12524},
year={2025}
}
```
## Contact
LG AI Research Technical Support: [email protected]
|
Mungert/all-MiniLM-L6-v2-GGUF | Mungert | 2025-06-15T19:36:56Z | 2,709 | 4 | sentence-transformers | [
"sentence-transformers",
"gguf",
"feature-extraction",
"sentence-similarity",
"transformers",
"en",
"dataset:s2orc",
"dataset:flax-sentence-embeddings/stackexchange_xml",
"dataset:ms_marco",
"dataset:gooaq",
"dataset:yahoo_answers_topics",
"dataset:code_search_net",
"dataset:search_qa",
"dataset:eli5",
"dataset:snli",
"dataset:multi_nli",
"dataset:wikihow",
"dataset:natural_questions",
"dataset:trivia_qa",
"dataset:embedding-data/sentence-compression",
"dataset:embedding-data/flickr30k-captions",
"dataset:embedding-data/altlex",
"dataset:embedding-data/simple-wiki",
"dataset:embedding-data/QQP",
"dataset:embedding-data/SPECTER",
"dataset:embedding-data/PAQ_pairs",
"dataset:embedding-data/WikiAnswers",
"arxiv:1904.06472",
"arxiv:2102.07033",
"arxiv:2104.08727",
"arxiv:1704.05179",
"arxiv:1810.09305",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us",
"imatrix"
] | sentence-similarity | 2025-03-23T03:05:06Z | ---
language: en
license: apache-2.0
library_name: sentence-transformers
tags:
- sentence-transformers
- feature-extraction
- sentence-similarity
- transformers
datasets:
- s2orc
- flax-sentence-embeddings/stackexchange_xml
- ms_marco
- gooaq
- yahoo_answers_topics
- code_search_net
- search_qa
- eli5
- snli
- multi_nli
- wikihow
- natural_questions
- trivia_qa
- embedding-data/sentence-compression
- embedding-data/flickr30k-captions
- embedding-data/altlex
- embedding-data/simple-wiki
- embedding-data/QQP
- embedding-data/SPECTER
- embedding-data/PAQ_pairs
- embedding-data/WikiAnswers
pipeline_tag: sentence-similarity
---
# <span style="color: #7FFF7F;">all-MiniLM-L6-v2 GGUF Models</span>
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device’s specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn’t available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `all-MiniLM-L6-v2-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `all-MiniLM-L6-v2-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `all-MiniLM-L6-v2-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `all-MiniLM-L6-v2-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `all-MiniLM-L6-v2-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `all-MiniLM-L6-v2-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `all-MiniLM-L6-v2-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `all-MiniLM-L6-v2-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `all-MiniLM-L6-v2-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `all-MiniLM-L6-v2-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `all-MiniLM-L6-v2-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Please click like ❤ . Also I’d really appreciate it if you could test my Network Monitor Assistant at 👉 [Network Monitor Assitant](https://readyforquantum.com).
💬 Click the **chat icon** (bottom right of the main and dashboard pages) . Choose a LLM; toggle between the LLM Types TurboLLM -> FreeLLM -> TestLLM.
### What I'm Testing
I'm experimenting with **function calling** against my network monitoring service. Using small open source models. I am into the question "How small can it go and still function".
🟡 **TestLLM** – Runs the current testing model using llama.cpp on 6 threads of a Cpu VM (Should take about 15s to load. Inference speed is quite slow and it only processes one user prompt at a time—still working on scaling!). If you're curious, I'd be happy to share how it works! .
### The other Available AI Assistants
🟢 **TurboLLM** – Uses **gpt-4o-mini** Fast! . Note: tokens are limited since OpenAI models are pricey, but you can [Login](https://readyforquantum.com) or [Download](https://readyforquantum.com/download/?utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme) the Quantum Network Monitor agent to get more tokens, Alternatively use the TestLLM .
🔵 **HugLLM** – Runs **open-source Hugging Face models** Fast, Runs small models (≈8B) hence lower quality, Get 2x more tokens (subject to Hugging Face API availability)
### Final word
I fund the servers to create the models files, run the Quantum Network Monitor Service and Pay for Inference from Novita and OpenAI all from my own pocket. All of the code for creating the models and the work I have done with Quantum Network Monitor is [open source](https://github.com/Mungert69). Feel free to use what you find useful. Please support my work and consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) .
This will help me pay for the services and increase the token limits for everyone.
Thank you :)
# all-MiniLM-L6-v2
This is a [sentence-transformers](https://www.SBERT.net) model: It maps sentences & paragraphs to a 384 dimensional dense vector space and can be used for tasks like clustering or semantic search.
## Usage (Sentence-Transformers)
Using this model becomes easy when you have [sentence-transformers](https://www.SBERT.net) installed:
```
pip install -U sentence-transformers
```
Then you can use the model like this:
```python
from sentence_transformers import SentenceTransformer
sentences = ["This is an example sentence", "Each sentence is converted"]
model = SentenceTransformer('sentence-transformers/all-MiniLM-L6-v2')
embeddings = model.encode(sentences)
print(embeddings)
```
## Usage (HuggingFace Transformers)
Without [sentence-transformers](https://www.SBERT.net), you can use the model like this: First, you pass your input through the transformer model, then you have to apply the right pooling-operation on-top of the contextualized word embeddings.
```python
from transformers import AutoTokenizer, AutoModel
import torch
import torch.nn.functional as F
#Mean Pooling - Take attention mask into account for correct averaging
def mean_pooling(model_output, attention_mask):
token_embeddings = model_output[0] #First element of model_output contains all token embeddings
input_mask_expanded = attention_mask.unsqueeze(-1).expand(token_embeddings.size()).float()
return torch.sum(token_embeddings * input_mask_expanded, 1) / torch.clamp(input_mask_expanded.sum(1), min=1e-9)
# Sentences we want sentence embeddings for
sentences = ['This is an example sentence', 'Each sentence is converted']
# Load model from HuggingFace Hub
tokenizer = AutoTokenizer.from_pretrained('sentence-transformers/all-MiniLM-L6-v2')
model = AutoModel.from_pretrained('sentence-transformers/all-MiniLM-L6-v2')
# Tokenize sentences
encoded_input = tokenizer(sentences, padding=True, truncation=True, return_tensors='pt')
# Compute token embeddings
with torch.no_grad():
model_output = model(**encoded_input)
# Perform pooling
sentence_embeddings = mean_pooling(model_output, encoded_input['attention_mask'])
# Normalize embeddings
sentence_embeddings = F.normalize(sentence_embeddings, p=2, dim=1)
print("Sentence embeddings:")
print(sentence_embeddings)
```
------
## Background
The project aims to train sentence embedding models on very large sentence level datasets using a self-supervised
contrastive learning objective. We used the pretrained [`nreimers/MiniLM-L6-H384-uncased`](https://huggingface.co/nreimers/MiniLM-L6-H384-uncased) model and fine-tuned in on a
1B sentence pairs dataset. We use a contrastive learning objective: given a sentence from the pair, the model should predict which out of a set of randomly sampled other sentences, was actually paired with it in our dataset.
We developed this model during the
[Community week using JAX/Flax for NLP & CV](https://discuss.huggingface.co/t/open-to-the-community-community-week-using-jax-flax-for-nlp-cv/7104),
organized by Hugging Face. We developed this model as part of the project:
[Train the Best Sentence Embedding Model Ever with 1B Training Pairs](https://discuss.huggingface.co/t/train-the-best-sentence-embedding-model-ever-with-1b-training-pairs/7354). We benefited from efficient hardware infrastructure to run the project: 7 TPUs v3-8, as well as intervention from Googles Flax, JAX, and Cloud team member about efficient deep learning frameworks.
## Intended uses
Our model is intended to be used as a sentence and short paragraph encoder. Given an input text, it outputs a vector which captures
the semantic information. The sentence vector may be used for information retrieval, clustering or sentence similarity tasks.
By default, input text longer than 256 word pieces is truncated.
## Training procedure
### Pre-training
We use the pretrained [`nreimers/MiniLM-L6-H384-uncased`](https://huggingface.co/nreimers/MiniLM-L6-H384-uncased) model. Please refer to the model card for more detailed information about the pre-training procedure.
### Fine-tuning
We fine-tune the model using a contrastive objective. Formally, we compute the cosine similarity from each possible sentence pairs from the batch.
We then apply the cross entropy loss by comparing with true pairs.
#### Hyper parameters
We trained our model on a TPU v3-8. We train the model during 100k steps using a batch size of 1024 (128 per TPU core).
We use a learning rate warm up of 500. The sequence length was limited to 128 tokens. We used the AdamW optimizer with
a 2e-5 learning rate. The full training script is accessible in this current repository: `train_script.py`.
#### Training data
We use the concatenation from multiple datasets to fine-tune our model. The total number of sentence pairs is above 1 billion sentences.
We sampled each dataset given a weighted probability which configuration is detailed in the `data_config.json` file.
| Dataset | Paper | Number of training tuples |
|--------------------------------------------------------|:----------------------------------------:|:--------------------------:|
| [Reddit comments (2015-2018)](https://github.com/PolyAI-LDN/conversational-datasets/tree/master/reddit) | [paper](https://arxiv.org/abs/1904.06472) | 726,484,430 |
| [S2ORC](https://github.com/allenai/s2orc) Citation pairs (Abstracts) | [paper](https://aclanthology.org/2020.acl-main.447/) | 116,288,806 |
| [WikiAnswers](https://github.com/afader/oqa#wikianswers-corpus) Duplicate question pairs | [paper](https://doi.org/10.1145/2623330.2623677) | 77,427,422 |
| [PAQ](https://github.com/facebookresearch/PAQ) (Question, Answer) pairs | [paper](https://arxiv.org/abs/2102.07033) | 64,371,441 |
| [S2ORC](https://github.com/allenai/s2orc) Citation pairs (Titles) | [paper](https://aclanthology.org/2020.acl-main.447/) | 52,603,982 |
| [S2ORC](https://github.com/allenai/s2orc) (Title, Abstract) | [paper](https://aclanthology.org/2020.acl-main.447/) | 41,769,185 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) (Title, Body) pairs | - | 25,316,456 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) (Title+Body, Answer) pairs | - | 21,396,559 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) (Title, Answer) pairs | - | 21,396,559 |
| [MS MARCO](https://microsoft.github.io/msmarco/) triplets | [paper](https://doi.org/10.1145/3404835.3462804) | 9,144,553 |
| [GOOAQ: Open Question Answering with Diverse Answer Types](https://github.com/allenai/gooaq) | [paper](https://arxiv.org/pdf/2104.08727.pdf) | 3,012,496 |
| [Yahoo Answers](https://www.kaggle.com/soumikrakshit/yahoo-answers-dataset) (Title, Answer) | [paper](https://proceedings.neurips.cc/paper/2015/hash/250cf8b51c773f3f8dc8b4be867a9a02-Abstract.html) | 1,198,260 |
| [Code Search](https://huggingface.co/datasets/code_search_net) | - | 1,151,414 |
| [COCO](https://cocodataset.org/#home) Image captions | [paper](https://link.springer.com/chapter/10.1007%2F978-3-319-10602-1_48) | 828,395|
| [SPECTER](https://github.com/allenai/specter) citation triplets | [paper](https://doi.org/10.18653/v1/2020.acl-main.207) | 684,100 |
| [Yahoo Answers](https://www.kaggle.com/soumikrakshit/yahoo-answers-dataset) (Question, Answer) | [paper](https://proceedings.neurips.cc/paper/2015/hash/250cf8b51c773f3f8dc8b4be867a9a02-Abstract.html) | 681,164 |
| [Yahoo Answers](https://www.kaggle.com/soumikrakshit/yahoo-answers-dataset) (Title, Question) | [paper](https://proceedings.neurips.cc/paper/2015/hash/250cf8b51c773f3f8dc8b4be867a9a02-Abstract.html) | 659,896 |
| [SearchQA](https://huggingface.co/datasets/search_qa) | [paper](https://arxiv.org/abs/1704.05179) | 582,261 |
| [Eli5](https://huggingface.co/datasets/eli5) | [paper](https://doi.org/10.18653/v1/p19-1346) | 325,475 |
| [Flickr 30k](https://shannon.cs.illinois.edu/DenotationGraph/) | [paper](https://transacl.org/ojs/index.php/tacl/article/view/229/33) | 317,695 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) Duplicate questions (titles) | | 304,525 |
| AllNLI ([SNLI](https://nlp.stanford.edu/projects/snli/) and [MultiNLI](https://cims.nyu.edu/~sbowman/multinli/) | [paper SNLI](https://doi.org/10.18653/v1/d15-1075), [paper MultiNLI](https://doi.org/10.18653/v1/n18-1101) | 277,230 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) Duplicate questions (bodies) | | 250,519 |
| [Stack Exchange](https://huggingface.co/datasets/flax-sentence-embeddings/stackexchange_xml) Duplicate questions (titles+bodies) | | 250,460 |
| [Sentence Compression](https://github.com/google-research-datasets/sentence-compression) | [paper](https://www.aclweb.org/anthology/D13-1155/) | 180,000 |
| [Wikihow](https://github.com/pvl/wikihow_pairs_dataset) | [paper](https://arxiv.org/abs/1810.09305) | 128,542 |
| [Altlex](https://github.com/chridey/altlex/) | [paper](https://aclanthology.org/P16-1135.pdf) | 112,696 |
| [Quora Question Triplets](https://quoradata.quora.com/First-Quora-Dataset-Release-Question-Pairs) | - | 103,663 |
| [Simple Wikipedia](https://cs.pomona.edu/~dkauchak/simplification/) | [paper](https://www.aclweb.org/anthology/P11-2117/) | 102,225 |
| [Natural Questions (NQ)](https://ai.google.com/research/NaturalQuestions) | [paper](https://transacl.org/ojs/index.php/tacl/article/view/1455) | 100,231 |
| [SQuAD2.0](https://rajpurkar.github.io/SQuAD-explorer/) | [paper](https://aclanthology.org/P18-2124.pdf) | 87,599 |
| [TriviaQA](https://huggingface.co/datasets/trivia_qa) | - | 73,346 |
| **Total** | | **1,170,060,424** | |
Mungert/Meta-Llama-3-8B-Instruct-GGUF | Mungert | 2025-06-15T19:36:50Z | 3,003 | 4 | null | [
"gguf",
"facebook",
"meta",
"pytorch",
"llama",
"llama-3",
"text-generation",
"en",
"license:llama3",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-03-17T05:54:18Z | ---
language:
- en
pipeline_tag: text-generation
tags:
- facebook
- meta
- pytorch
- llama
- llama-3
license: llama3
new_version: meta-llama/Llama-3.1-8B-Instruct
extra_gated_prompt: >-
### META LLAMA 3 COMMUNITY LICENSE AGREEMENT
Meta Llama 3 Version Release Date: April 18, 2024
"Agreement" means the terms and conditions for use, reproduction, distribution and modification of the
Llama Materials set forth herein.
"Documentation" means the specifications, manuals and documentation accompanying Meta Llama 3
distributed by Meta at https://llama.meta.com/get-started/.
"Licensee" or "you" means you, or your employer or any other person or entity (if you are entering into
this Agreement on such person or entity’s behalf), of the age required under applicable laws, rules or
regulations to provide legal consent and that has legal authority to bind your employer or such other
person or entity if you are entering in this Agreement on their behalf.
"Meta Llama 3" means the foundational large language models and software and algorithms, including
machine-learning model code, trained model weights, inference-enabling code, training-enabling code,
fine-tuning enabling code and other elements of the foregoing distributed by Meta at
https://llama.meta.com/llama-downloads.
"Llama Materials" means, collectively, Meta’s proprietary Meta Llama 3 and Documentation (and any
portion thereof) made available under this Agreement.
"Meta" or "we" means Meta Platforms Ireland Limited (if you are located in or, if you are an entity, your
principal place of business is in the EEA or Switzerland) and Meta Platforms, Inc. (if you are located
outside of the EEA or Switzerland).
1. License Rights and Redistribution.
a. Grant of Rights. You are granted a non-exclusive, worldwide, non-transferable and royalty-free
limited license under Meta’s intellectual property or other rights owned by Meta embodied in the Llama
Materials to use, reproduce, distribute, copy, create derivative works of, and make modifications to the
Llama Materials.
b. Redistribution and Use.
i. If you distribute or make available the Llama Materials (or any derivative works
thereof), or a product or service that uses any of them, including another AI model, you shall (A) provide
a copy of this Agreement with any such Llama Materials; and (B) prominently display “Built with Meta
Llama 3” on a related website, user interface, blogpost, about page, or product documentation. If you
use the Llama Materials to create, train, fine tune, or otherwise improve an AI model, which is
distributed or made available, you shall also include “Llama 3” at the beginning of any such AI model
name.
ii. If you receive Llama Materials, or any derivative works thereof, from a Licensee as part
of an integrated end user product, then Section 2 of this Agreement will not apply to you.
iii. You must retain in all copies of the Llama Materials that you distribute the following
attribution notice within a “Notice” text file distributed as a part of such copies: “Meta Llama 3 is
licensed under the Meta Llama 3 Community License, Copyright © Meta Platforms, Inc. All Rights
Reserved.”
iv. Your use of the Llama Materials must comply with applicable laws and regulations
(including trade compliance laws and regulations) and adhere to the Acceptable Use Policy for the Llama
Materials (available at https://llama.meta.com/llama3/use-policy), which is hereby incorporated by
reference into this Agreement.
v. You will not use the Llama Materials or any output or results of the Llama Materials to
improve any other large language model (excluding Meta Llama 3 or derivative works thereof).
2. Additional Commercial Terms. If, on the Meta Llama 3 version release date, the monthly active users
of the products or services made available by or for Licensee, or Licensee’s affiliates, is greater than 700
million monthly active users in the preceding calendar month, you must request a license from Meta,
which Meta may grant to you in its sole discretion, and you are not authorized to exercise any of the
rights under this Agreement unless or until Meta otherwise expressly grants you such rights.
3. Disclaimer of Warranty. UNLESS REQUIRED BY APPLICABLE LAW, THE LLAMA MATERIALS AND ANY
OUTPUT AND RESULTS THEREFROM ARE PROVIDED ON AN “AS IS” BASIS, WITHOUT WARRANTIES OF
ANY KIND, AND META DISCLAIMS ALL WARRANTIES OF ANY KIND, BOTH EXPRESS AND IMPLIED,
INCLUDING, WITHOUT LIMITATION, ANY WARRANTIES OF TITLE, NON-INFRINGEMENT,
MERCHANTABILITY, OR FITNESS FOR A PARTICULAR PURPOSE. YOU ARE SOLELY RESPONSIBLE FOR
DETERMINING THE APPROPRIATENESS OF USING OR REDISTRIBUTING THE LLAMA MATERIALS AND
ASSUME ANY RISKS ASSOCIATED WITH YOUR USE OF THE LLAMA MATERIALS AND ANY OUTPUT AND
RESULTS.
4. Limitation of Liability. IN NO EVENT WILL META OR ITS AFFILIATES BE LIABLE UNDER ANY THEORY OF
LIABILITY, WHETHER IN CONTRACT, TORT, NEGLIGENCE, PRODUCTS LIABILITY, OR OTHERWISE, ARISING
OUT OF THIS AGREEMENT, FOR ANY LOST PROFITS OR ANY INDIRECT, SPECIAL, CONSEQUENTIAL,
INCIDENTAL, EXEMPLARY OR PUNITIVE DAMAGES, EVEN IF META OR ITS AFFILIATES HAVE BEEN ADVISED
OF THE POSSIBILITY OF ANY OF THE FOREGOING.
5. Intellectual Property.
a. No trademark licenses are granted under this Agreement, and in connection with the Llama
Materials, neither Meta nor Licensee may use any name or mark owned by or associated with the other
or any of its affiliates, except as required for reasonable and customary use in describing and
redistributing the Llama Materials or as set forth in this Section 5(a). Meta hereby grants you a license to
use “Llama 3” (the “Mark”) solely as required to comply with the last sentence of Section 1.b.i. You will
comply with Meta’s brand guidelines (currently accessible at
https://about.meta.com/brand/resources/meta/company-brand/ ). All goodwill arising out of your use
of the Mark will inure to the benefit of Meta.
b. Subject to Meta’s ownership of Llama Materials and derivatives made by or for Meta, with
respect to any derivative works and modifications of the Llama Materials that are made by you, as
between you and Meta, you are and will be the owner of such derivative works and modifications.
c. If you institute litigation or other proceedings against Meta or any entity (including a
cross-claim or counterclaim in a lawsuit) alleging that the Llama Materials or Meta Llama 3 outputs or
results, or any portion of any of the foregoing, constitutes infringement of intellectual property or other
rights owned or licensable by you, then any licenses granted to you under this Agreement shall
terminate as of the date such litigation or claim is filed or instituted. You will indemnify and hold
harmless Meta from and against any claim by any third party arising out of or related to your use or
distribution of the Llama Materials.
6. Term and Termination. The term of this Agreement will commence upon your acceptance of this
Agreement or access to the Llama Materials and will continue in full force and effect until terminated in
accordance with the terms and conditions herein. Meta may terminate this Agreement if you are in
breach of any term or condition of this Agreement. Upon termination of this Agreement, you shall delete
and cease use of the Llama Materials. Sections 3, 4 and 7 shall survive the termination of this
Agreement.
7. Governing Law and Jurisdiction. This Agreement will be governed and construed under the laws of
the State of California without regard to choice of law principles, and the UN Convention on Contracts
for the International Sale of Goods does not apply to this Agreement. The courts of California shall have
exclusive jurisdiction of any dispute arising out of this Agreement.
### Meta Llama 3 Acceptable Use Policy
Meta is committed to promoting safe and fair use of its tools and features, including Meta Llama 3. If you
access or use Meta Llama 3, you agree to this Acceptable Use Policy (“Policy”). The most recent copy of
this policy can be found at [https://llama.meta.com/llama3/use-policy](https://llama.meta.com/llama3/use-policy)
#### Prohibited Uses
We want everyone to use Meta Llama 3 safely and responsibly. You agree you will not use, or allow
others to use, Meta Llama 3 to:
1. Violate the law or others’ rights, including to:
1. Engage in, promote, generate, contribute to, encourage, plan, incite, or further illegal or unlawful activity or content, such as:
1. Violence or terrorism
2. Exploitation or harm to children, including the solicitation, creation, acquisition, or dissemination of child exploitative content or failure to report Child Sexual Abuse Material
3. Human trafficking, exploitation, and sexual violence
4. The illegal distribution of information or materials to minors, including obscene materials, or failure to employ legally required age-gating in connection with such information or materials.
5. Sexual solicitation
6. Any other criminal activity
2. Engage in, promote, incite, or facilitate the harassment, abuse, threatening, or bullying of individuals or groups of individuals
3. Engage in, promote, incite, or facilitate discrimination or other unlawful or harmful conduct in the provision of employment, employment benefits, credit, housing, other economic benefits, or other essential goods and services
4. Engage in the unauthorized or unlicensed practice of any profession including, but not limited to, financial, legal, medical/health, or related professional practices
5. Collect, process, disclose, generate, or infer health, demographic, or other sensitive personal or private information about individuals without rights and consents required by applicable laws
6. Engage in or facilitate any action or generate any content that infringes, misappropriates, or otherwise violates any third-party rights, including the outputs or results of any products or services using the Llama Materials
7. Create, generate, or facilitate the creation of malicious code, malware, computer viruses or do anything else that could disable, overburden, interfere with or impair the proper working, integrity, operation or appearance of a website or computer system
2. Engage in, promote, incite, facilitate, or assist in the planning or development of activities that present a risk of death or bodily harm to individuals, including use of Meta Llama 3 related to the following:
1. Military, warfare, nuclear industries or applications, espionage, use for materials or activities that are subject to the International Traffic Arms Regulations (ITAR) maintained by the United States Department of State
2. Guns and illegal weapons (including weapon development)
3. Illegal drugs and regulated/controlled substances
4. Operation of critical infrastructure, transportation technologies, or heavy machinery
5. Self-harm or harm to others, including suicide, cutting, and eating disorders
6. Any content intended to incite or promote violence, abuse, or any infliction of bodily harm to an individual
3. Intentionally deceive or mislead others, including use of Meta Llama 3 related to the following:
1. Generating, promoting, or furthering fraud or the creation or promotion of disinformation
2. Generating, promoting, or furthering defamatory content, including the creation of defamatory statements, images, or other content
3. Generating, promoting, or further distributing spam
4. Impersonating another individual without consent, authorization, or legal right
5. Representing that the use of Meta Llama 3 or outputs are human-generated
6. Generating or facilitating false online engagement, including fake reviews and other means of fake online engagement
4. Fail to appropriately disclose to end users any known dangers of your AI system
Please report any violation of this Policy, software “bug,” or other problems that could lead to a violation
of this Policy through one of the following means:
* Reporting issues with the model: [https://github.com/meta-llama/llama3](https://github.com/meta-llama/llama3)
* Reporting risky content generated by the model:
developers.facebook.com/llama_output_feedback
* Reporting bugs and security concerns: facebook.com/whitehat/info
* Reporting violations of the Acceptable Use Policy or unlicensed uses of Meta Llama 3: [email protected]
extra_gated_fields:
First Name: text
Last Name: text
Date of birth: date_picker
Country: country
Affiliation: text
geo: ip_location
By clicking Submit below I accept the terms of the license and acknowledge that the information I provide will be collected stored processed and shared in accordance with the Meta Privacy Policy: checkbox
extra_gated_description: The information you provide will be collected, stored, processed and shared in accordance with the [Meta Privacy Policy](https://www.facebook.com/privacy/policy/).
extra_gated_button_content: Submit
widget:
- example_title: Hello
messages:
- role: user
content: Hey my name is Julien! How are you?
- example_title: Winter holidays
messages:
- role: system
content: You are a helpful and honest assistant. Please, respond concisely and truthfully.
- role: user
content: Can you recommend a good destination for Winter holidays?
- example_title: Programming assistant
messages:
- role: system
content: You are a helpful and honest code and programming assistant. Please, respond concisely and truthfully.
- role: user
content: Write a function that computes the nth fibonacci number.
inference:
parameters:
max_new_tokens: 300
stop:
- <|end_of_text|>
- <|eot_id|>
---
# <span style="color: #7FFF7F;">Meta-Llama-3-8B-Instruct GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`f5cd27b7`](https://github.com/ggerganov/llama.cpp/commit/f5cd27b71da3ac375a04a41643d14fc779a8057b).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Meta-Llama-3-8B-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Meta-Llama-3-8B-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Meta-Llama-3-8B-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Meta-Llama-3-8B-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Meta-Llama-3-8B-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Meta-Llama-3-8B-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Meta-Llama-3-8B-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Meta-Llama-3-8B-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Meta-Llama-3-8B-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Meta-Llama-3-8B-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Meta-Llama-3-8B-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
## Model Details
Meta developed and released the Meta Llama 3 family of large language models (LLMs), a collection of pretrained and instruction tuned generative text models in 8 and 70B sizes. The Llama 3 instruction tuned models are optimized for dialogue use cases and outperform many of the available open source chat models on common industry benchmarks. Further, in developing these models, we took great care to optimize helpfulness and safety.
**Model developers** Meta
**Variations** Llama 3 comes in two sizes — 8B and 70B parameters — in pre-trained and instruction tuned variants.
**Input** Models input text only.
**Output** Models generate text and code only.
**Model Architecture** Llama 3 is an auto-regressive language model that uses an optimized transformer architecture. The tuned versions use supervised fine-tuning (SFT) and reinforcement learning with human feedback (RLHF) to align with human preferences for helpfulness and safety.
<table>
<tr>
<td>
</td>
<td><strong>Training Data</strong>
</td>
<td><strong>Params</strong>
</td>
<td><strong>Context length</strong>
</td>
<td><strong>GQA</strong>
</td>
<td><strong>Token count</strong>
</td>
<td><strong>Knowledge cutoff</strong>
</td>
</tr>
<tr>
<td rowspan="2" >Llama 3
</td>
<td rowspan="2" >A new mix of publicly available online data.
</td>
<td>8B
</td>
<td>8k
</td>
<td>Yes
</td>
<td rowspan="2" >15T+
</td>
<td>March, 2023
</td>
</tr>
<tr>
<td>70B
</td>
<td>8k
</td>
<td>Yes
</td>
<td>December, 2023
</td>
</tr>
</table>
**Llama 3 family of models**. Token counts refer to pretraining data only. Both the 8 and 70B versions use Grouped-Query Attention (GQA) for improved inference scalability.
**Model Release Date** April 18, 2024.
**Status** This is a static model trained on an offline dataset. Future versions of the tuned models will be released as we improve model safety with community feedback.
**License** A custom commercial license is available at: [https://llama.meta.com/llama3/license](https://llama.meta.com/llama3/license)
Where to send questions or comments about the model Instructions on how to provide feedback or comments on the model can be found in the model [README](https://github.com/meta-llama/llama3). For more technical information about generation parameters and recipes for how to use Llama 3 in applications, please go [here](https://github.com/meta-llama/llama-recipes).
## Intended Use
**Intended Use Cases** Llama 3 is intended for commercial and research use in English. Instruction tuned models are intended for assistant-like chat, whereas pretrained models can be adapted for a variety of natural language generation tasks.
**Out-of-scope** Use in any manner that violates applicable laws or regulations (including trade compliance laws). Use in any other way that is prohibited by the Acceptable Use Policy and Llama 3 Community License. Use in languages other than English**.
**Note: Developers may fine-tune Llama 3 models for languages beyond English provided they comply with the Llama 3 Community License and the Acceptable Use Policy.
## How to use
This repository contains two versions of Meta-Llama-3-8B-Instruct, for use with transformers and with the original `llama3` codebase.
### Use with transformers
You can run conversational inference using the Transformers pipeline abstraction, or by leveraging the Auto classes with the `generate()` function. Let's see examples of both.
#### Transformers pipeline
```python
import transformers
import torch
model_id = "meta-llama/Meta-Llama-3-8B-Instruct"
pipeline = transformers.pipeline(
"text-generation",
model=model_id,
model_kwargs={"torch_dtype": torch.bfloat16},
device_map="auto",
)
messages = [
{"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"},
{"role": "user", "content": "Who are you?"},
]
terminators = [
pipeline.tokenizer.eos_token_id,
pipeline.tokenizer.convert_tokens_to_ids("<|eot_id|>")
]
outputs = pipeline(
messages,
max_new_tokens=256,
eos_token_id=terminators,
do_sample=True,
temperature=0.6,
top_p=0.9,
)
print(outputs[0]["generated_text"][-1])
```
#### Transformers AutoModelForCausalLM
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
model_id = "meta-llama/Meta-Llama-3-8B-Instruct"
tokenizer = AutoTokenizer.from_pretrained(model_id)
model = AutoModelForCausalLM.from_pretrained(
model_id,
torch_dtype=torch.bfloat16,
device_map="auto",
)
messages = [
{"role": "system", "content": "You are a pirate chatbot who always responds in pirate speak!"},
{"role": "user", "content": "Who are you?"},
]
input_ids = tokenizer.apply_chat_template(
messages,
add_generation_prompt=True,
return_tensors="pt"
).to(model.device)
terminators = [
tokenizer.eos_token_id,
tokenizer.convert_tokens_to_ids("<|eot_id|>")
]
outputs = model.generate(
input_ids,
max_new_tokens=256,
eos_token_id=terminators,
do_sample=True,
temperature=0.6,
top_p=0.9,
)
response = outputs[0][input_ids.shape[-1]:]
print(tokenizer.decode(response, skip_special_tokens=True))
```
### Use with `llama3`
Please, follow the instructions in the [repository](https://github.com/meta-llama/llama3)
To download Original checkpoints, see the example command below leveraging `huggingface-cli`:
```
huggingface-cli download meta-llama/Meta-Llama-3-8B-Instruct --include "original/*" --local-dir Meta-Llama-3-8B-Instruct
```
For Hugging Face support, we recommend using transformers or TGI, but a similar command works.
## Hardware and Software
**Training Factors** We used custom training libraries, Meta's Research SuperCluster, and production clusters for pretraining. Fine-tuning, annotation, and evaluation were also performed on third-party cloud compute.
**Carbon Footprint Pretraining utilized a cumulative** 7.7M GPU hours of computation on hardware of type H100-80GB (TDP of 700W). Estimated total emissions were 2290 tCO2eq, 100% of which were offset by Meta’s sustainability program.
<table>
<tr>
<td>
</td>
<td><strong>Time (GPU hours)</strong>
</td>
<td><strong>Power Consumption (W)</strong>
</td>
<td><strong>Carbon Emitted(tCO2eq)</strong>
</td>
</tr>
<tr>
<td>Llama 3 8B
</td>
<td>1.3M
</td>
<td>700
</td>
<td>390
</td>
</tr>
<tr>
<td>Llama 3 70B
</td>
<td>6.4M
</td>
<td>700
</td>
<td>1900
</td>
</tr>
<tr>
<td>Total
</td>
<td>7.7M
</td>
<td>
</td>
<td>2290
</td>
</tr>
</table>
**CO2 emissions during pre-training**. Time: total GPU time required for training each model. Power Consumption: peak power capacity per GPU device for the GPUs used adjusted for power usage efficiency. 100% of the emissions are directly offset by Meta's sustainability program, and because we are openly releasing these models, the pretraining costs do not need to be incurred by others.
## Training Data
**Overview** Llama 3 was pretrained on over 15 trillion tokens of data from publicly available sources. The fine-tuning data includes publicly available instruction datasets, as well as over 10M human-annotated examples. Neither the pretraining nor the fine-tuning datasets include Meta user data.
**Data Freshness** The pretraining data has a cutoff of March 2023 for the 8B and December 2023 for the 70B models respectively.
## Benchmarks
In this section, we report the results for Llama 3 models on standard automatic benchmarks. For all the evaluations, we use our internal evaluations library. For details on the methodology see [here](https://github.com/meta-llama/llama3/blob/main/eval_methodology.md).
### Base pretrained models
<table>
<tr>
<td><strong>Category</strong>
</td>
<td><strong>Benchmark</strong>
</td>
<td><strong>Llama 3 8B</strong>
</td>
<td><strong>Llama2 7B</strong>
</td>
<td><strong>Llama2 13B</strong>
</td>
<td><strong>Llama 3 70B</strong>
</td>
<td><strong>Llama2 70B</strong>
</td>
</tr>
<tr>
<td rowspan="6" >General
</td>
<td>MMLU (5-shot)
</td>
<td>66.6
</td>
<td>45.7
</td>
<td>53.8
</td>
<td>79.5
</td>
<td>69.7
</td>
</tr>
<tr>
<td>AGIEval English (3-5 shot)
</td>
<td>45.9
</td>
<td>28.8
</td>
<td>38.7
</td>
<td>63.0
</td>
<td>54.8
</td>
</tr>
<tr>
<td>CommonSenseQA (7-shot)
</td>
<td>72.6
</td>
<td>57.6
</td>
<td>67.6
</td>
<td>83.8
</td>
<td>78.7
</td>
</tr>
<tr>
<td>Winogrande (5-shot)
</td>
<td>76.1
</td>
<td>73.3
</td>
<td>75.4
</td>
<td>83.1
</td>
<td>81.8
</td>
</tr>
<tr>
<td>BIG-Bench Hard (3-shot, CoT)
</td>
<td>61.1
</td>
<td>38.1
</td>
<td>47.0
</td>
<td>81.3
</td>
<td>65.7
</td>
</tr>
<tr>
<td>ARC-Challenge (25-shot)
</td>
<td>78.6
</td>
<td>53.7
</td>
<td>67.6
</td>
<td>93.0
</td>
<td>85.3
</td>
</tr>
<tr>
<td>Knowledge reasoning
</td>
<td>TriviaQA-Wiki (5-shot)
</td>
<td>78.5
</td>
<td>72.1
</td>
<td>79.6
</td>
<td>89.7
</td>
<td>87.5
</td>
</tr>
<tr>
<td rowspan="4" >Reading comprehension
</td>
<td>SQuAD (1-shot)
</td>
<td>76.4
</td>
<td>72.2
</td>
<td>72.1
</td>
<td>85.6
</td>
<td>82.6
</td>
</tr>
<tr>
<td>QuAC (1-shot, F1)
</td>
<td>44.4
</td>
<td>39.6
</td>
<td>44.9
</td>
<td>51.1
</td>
<td>49.4
</td>
</tr>
<tr>
<td>BoolQ (0-shot)
</td>
<td>75.7
</td>
<td>65.5
</td>
<td>66.9
</td>
<td>79.0
</td>
<td>73.1
</td>
</tr>
<tr>
<td>DROP (3-shot, F1)
</td>
<td>58.4
</td>
<td>37.9
</td>
<td>49.8
</td>
<td>79.7
</td>
<td>70.2
</td>
</tr>
</table>
### Instruction tuned models
<table>
<tr>
<td><strong>Benchmark</strong>
</td>
<td><strong>Llama 3 8B</strong>
</td>
<td><strong>Llama 2 7B</strong>
</td>
<td><strong>Llama 2 13B</strong>
</td>
<td><strong>Llama 3 70B</strong>
</td>
<td><strong>Llama 2 70B</strong>
</td>
</tr>
<tr>
<td>MMLU (5-shot)
</td>
<td>68.4
</td>
<td>34.1
</td>
<td>47.8
</td>
<td>82.0
</td>
<td>52.9
</td>
</tr>
<tr>
<td>GPQA (0-shot)
</td>
<td>34.2
</td>
<td>21.7
</td>
<td>22.3
</td>
<td>39.5
</td>
<td>21.0
</td>
</tr>
<tr>
<td>HumanEval (0-shot)
</td>
<td>62.2
</td>
<td>7.9
</td>
<td>14.0
</td>
<td>81.7
</td>
<td>25.6
</td>
</tr>
<tr>
<td>GSM-8K (8-shot, CoT)
</td>
<td>79.6
</td>
<td>25.7
</td>
<td>77.4
</td>
<td>93.0
</td>
<td>57.5
</td>
</tr>
<tr>
<td>MATH (4-shot, CoT)
</td>
<td>30.0
</td>
<td>3.8
</td>
<td>6.7
</td>
<td>50.4
</td>
<td>11.6
</td>
</tr>
</table>
### Responsibility & Safety
We believe that an open approach to AI leads to better, safer products, faster innovation, and a bigger overall market. We are committed to Responsible AI development and took a series of steps to limit misuse and harm and support the open source community.
Foundation models are widely capable technologies that are built to be used for a diverse range of applications. They are not designed to meet every developer preference on safety levels for all use cases, out-of-the-box, as those by their nature will differ across different applications.
Rather, responsible LLM-application deployment is achieved by implementing a series of safety best practices throughout the development of such applications, from the model pre-training, fine-tuning and the deployment of systems composed of safeguards to tailor the safety needs specifically to the use case and audience.
As part of the Llama 3 release, we updated our [Responsible Use Guide](https://llama.meta.com/responsible-use-guide/) to outline the steps and best practices for developers to implement model and system level safety for their application. We also provide a set of resources including [Meta Llama Guard 2](https://llama.meta.com/purple-llama/) and [Code Shield](https://llama.meta.com/purple-llama/) safeguards. These tools have proven to drastically reduce residual risks of LLM Systems, while maintaining a high level of helpfulness. We encourage developers to tune and deploy these safeguards according to their needs and we provide a [reference implementation](https://github.com/meta-llama/llama-recipes/tree/main/recipes/responsible_ai) to get you started.
#### Llama 3-Instruct
As outlined in the Responsible Use Guide, some trade-off between model helpfulness and model alignment is likely unavoidable. Developers should exercise discretion about how to weigh the benefits of alignment and helpfulness for their specific use case and audience. Developers should be mindful of residual risks when using Llama models and leverage additional safety tools as needed to reach the right safety bar for their use case.
<span style="text-decoration:underline;">Safety</span>
For our instruction tuned model, we conducted extensive red teaming exercises, performed adversarial evaluations and implemented safety mitigations techniques to lower residual risks. As with any Large Language Model, residual risks will likely remain and we recommend that developers assess these risks in the context of their use case. In parallel, we are working with the community to make AI safety benchmark standards transparent, rigorous and interpretable.
<span style="text-decoration:underline;">Refusals</span>
In addition to residual risks, we put a great emphasis on model refusals to benign prompts. Over-refusing not only can impact the user experience but could even be harmful in certain contexts as well. We’ve heard the feedback from the developer community and improved our fine tuning to ensure that Llama 3 is significantly less likely to falsely refuse to answer prompts than Llama 2.
We built internal benchmarks and developed mitigations to limit false refusals making Llama 3 our most helpful model to date.
#### Responsible release
In addition to responsible use considerations outlined above, we followed a rigorous process that requires us to take extra measures against misuse and critical risks before we make our release decision.
Misuse
If you access or use Llama 3, you agree to the Acceptable Use Policy. The most recent copy of this policy can be found at [https://llama.meta.com/llama3/use-policy/](https://llama.meta.com/llama3/use-policy/).
#### Critical risks
<span style="text-decoration:underline;">CBRNE</span> (Chemical, Biological, Radiological, Nuclear, and high yield Explosives)
We have conducted a two fold assessment of the safety of the model in this area:
* Iterative testing during model training to assess the safety of responses related to CBRNE threats and other adversarial risks.
* Involving external CBRNE experts to conduct an uplift test assessing the ability of the model to accurately provide expert knowledge and reduce barriers to potential CBRNE misuse, by reference to what can be achieved using web search (without the model).
### <span style="text-decoration:underline;">Cyber Security </span>
We have evaluated Llama 3 with CyberSecEval, Meta’s cybersecurity safety eval suite, measuring Llama 3’s propensity to suggest insecure code when used as a coding assistant, and Llama 3’s propensity to comply with requests to help carry out cyber attacks, where attacks are defined by the industry standard MITRE ATT&CK cyber attack ontology. On our insecure coding and cyber attacker helpfulness tests, Llama 3 behaved in the same range or safer than models of [equivalent coding capability](https://huggingface.co/spaces/facebook/CyberSecEval).
### <span style="text-decoration:underline;">Child Safety</span>
Child Safety risk assessments were conducted using a team of experts, to assess the model’s capability to produce outputs that could result in Child Safety risks and inform on any necessary and appropriate risk mitigations via fine tuning. We leveraged those expert red teaming sessions to expand the coverage of our evaluation benchmarks through Llama 3 model development. For Llama 3, we conducted new in-depth sessions using objective based methodologies to assess the model risks along multiple attack vectors. We also partnered with content specialists to perform red teaming exercises assessing potentially violating content while taking account of market specific nuances or experiences.
### Community
Generative AI safety requires expertise and tooling, and we believe in the strength of the open community to accelerate its progress. We are active members of open consortiums, including the AI Alliance, Partnership in AI and MLCommons, actively contributing to safety standardization and transparency. We encourage the community to adopt taxonomies like the MLCommons Proof of Concept evaluation to facilitate collaboration and transparency on safety and content evaluations. Our Purple Llama tools are open sourced for the community to use and widely distributed across ecosystem partners including cloud service providers. We encourage community contributions to our [Github repository](https://github.com/meta-llama/PurpleLlama).
Finally, we put in place a set of resources including an [output reporting mechanism](https://developers.facebook.com/llama_output_feedback) and [bug bounty program](https://www.facebook.com/whitehat) to continuously improve the Llama technology with the help of the community.
## Ethical Considerations and Limitations
The core values of Llama 3 are openness, inclusivity and helpfulness. It is meant to serve everyone, and to work for a wide range of use cases. It is thus designed to be accessible to people across many different backgrounds, experiences and perspectives. Llama 3 addresses users and their needs as they are, without insertion unnecessary judgment or normativity, while reflecting the understanding that even content that may appear problematic in some cases can serve valuable purposes in others. It respects the dignity and autonomy of all users, especially in terms of the values of free thought and expression that power innovation and progress.
But Llama 3 is a new technology, and like any new technology, there are risks associated with its use. Testing conducted to date has been in English, and has not covered, nor could it cover, all scenarios. For these reasons, as with all LLMs, Llama 3’s potential outputs cannot be predicted in advance, and the model may in some instances produce inaccurate, biased or other objectionable responses to user prompts. Therefore, before deploying any applications of Llama 3 models, developers should perform safety testing and tuning tailored to their specific applications of the model. As outlined in the Responsible Use Guide, we recommend incorporating [Purple Llama](https://github.com/facebookresearch/PurpleLlama) solutions into your workflows and specifically [Llama Guard](https://ai.meta.com/research/publications/llama-guard-llm-based-input-output-safeguard-for-human-ai-conversations/) which provides a base model to filter input and output prompts to layer system-level safety on top of model-level safety.
Please see the Responsible Use Guide available at [http://llama.meta.com/responsible-use-guide](http://llama.meta.com/responsible-use-guide)
## Citation instructions
@article{llama3modelcard,
title={Llama 3 Model Card},
author={AI@Meta},
year={2024},
url = {https://github.com/meta-llama/llama3/blob/main/MODEL_CARD.md}
}
## Contributors
Aaditya Singh; Aaron Grattafiori; Abhimanyu Dubey; Abhinav Jauhri; Abhinav Pandey; Abhishek Kadian; Adam Kelsey; Adi Gangidi; Ahmad Al-Dahle; Ahuva Goldstand; Aiesha Letman; Ajay Menon; Akhil Mathur; Alan Schelten; Alex Vaughan; Amy Yang; Andrei Lupu; Andres Alvarado; Andrew Gallagher; Andrew Gu; Andrew Ho; Andrew Poulton; Andrew Ryan; Angela Fan; Ankit Ramchandani; Anthony Hartshorn; Archi Mitra; Archie Sravankumar; Artem Korenev; Arun Rao; Ashley Gabriel; Ashwin Bharambe; Assaf Eisenman; Aston Zhang; Aurelien Rodriguez; Austen Gregerson; Ava Spataru; Baptiste Roziere; Ben Maurer; Benjamin Leonhardi; Bernie Huang; Bhargavi Paranjape; Bing Liu; Binh Tang; Bobbie Chern; Brani Stojkovic; Brian Fuller; Catalina Mejia Arenas; Chao Zhou; Charlotte Caucheteux; Chaya Nayak; Ching-Hsiang Chu; Chloe Bi; Chris Cai; Chris Cox; Chris Marra; Chris McConnell; Christian Keller; Christoph Feichtenhofer; Christophe Touret; Chunyang Wu; Corinne Wong; Cristian Canton Ferrer; Damien Allonsius; Daniel Kreymer; Daniel Haziza; Daniel Li; Danielle Pintz; Danny Livshits; Danny Wyatt; David Adkins; David Esiobu; David Xu; Davide Testuggine; Delia David; Devi Parikh; Dhruv Choudhary; Dhruv Mahajan; Diana Liskovich; Diego Garcia-Olano; Diego Perino; Dieuwke Hupkes; Dingkang Wang; Dustin Holland; Egor Lakomkin; Elina Lobanova; Xiaoqing Ellen Tan; Emily Dinan; Eric Smith; Erik Brinkman; Esteban Arcaute; Filip Radenovic; Firat Ozgenel; Francesco Caggioni; Frank Seide; Frank Zhang; Gabriel Synnaeve; Gabriella Schwarz; Gabrielle Lee; Gada Badeer; Georgia Anderson; Graeme Nail; Gregoire Mialon; Guan Pang; Guillem Cucurell; Hailey Nguyen; Hannah Korevaar; Hannah Wang; Haroun Habeeb; Harrison Rudolph; Henry Aspegren; Hu Xu; Hugo Touvron; Iga Kozlowska; Igor Molybog; Igor Tufanov; Iliyan Zarov; Imanol Arrieta Ibarra; Irina-Elena Veliche; Isabel Kloumann; Ishan Misra; Ivan Evtimov; Jacob Xu; Jade Copet; Jake Weissman; Jan Geffert; Jana Vranes; Japhet Asher; Jason Park; Jay Mahadeokar; Jean-Baptiste Gaya; Jeet Shah; Jelmer van der Linde; Jennifer Chan; Jenny Hong; Jenya Lee; Jeremy Fu; Jeremy Teboul; Jianfeng Chi; Jianyu Huang; Jie Wang; Jiecao Yu; Joanna Bitton; Joe Spisak; Joelle Pineau; Jon Carvill; Jongsoo Park; Joseph Rocca; Joshua Johnstun; Junteng Jia; Kalyan Vasuden Alwala; Kam Hou U; Kate Plawiak; Kartikeya Upasani; Kaushik Veeraraghavan; Ke Li; Kenneth Heafield; Kevin Stone; Khalid El-Arini; Krithika Iyer; Kshitiz Malik; Kuenley Chiu; Kunal Bhalla; Kyle Huang; Lakshya Garg; Lauren Rantala-Yeary; Laurens van der Maaten; Lawrence Chen; Leandro Silva; Lee Bell; Lei Zhang; Liang Tan; Louis Martin; Lovish Madaan; Luca Wehrstedt; Lukas Blecher; Luke de Oliveira; Madeline Muzzi; Madian Khabsa; Manav Avlani; Mannat Singh; Manohar Paluri; Mark Zuckerberg; Marcin Kardas; Martynas Mankus; Mathew Oldham; Mathieu Rita; Matthew Lennie; Maya Pavlova; Meghan Keneally; Melanie Kambadur; Mihir Patel; Mikayel Samvelyan; Mike Clark; Mike Lewis; Min Si; Mitesh Kumar Singh; Mo Metanat; Mona Hassan; Naman Goyal; Narjes Torabi; Nicolas Usunier; Nikolay Bashlykov; Nikolay Bogoychev; Niladri Chatterji; Ning Dong; Oliver Aobo Yang; Olivier Duchenne; Onur Celebi; Parth Parekh; Patrick Alrassy; Paul Saab; Pavan Balaji; Pedro Rittner; Pengchuan Zhang; Pengwei Li; Petar Vasic; Peter Weng; Polina Zvyagina; Prajjwal Bhargava; Pratik Dubal; Praveen Krishnan; Punit Singh Koura; Qing He; Rachel Rodriguez; Ragavan Srinivasan; Rahul Mitra; Ramon Calderer; Raymond Li; Robert Stojnic; Roberta Raileanu; Robin Battey; Rocky Wang; Rohit Girdhar; Rohit Patel; Romain Sauvestre; Ronnie Polidoro; Roshan Sumbaly; Ross Taylor; Ruan Silva; Rui Hou; Rui Wang; Russ Howes; Ruty Rinott; Saghar Hosseini; Sai Jayesh Bondu; Samyak Datta; Sanjay Singh; Sara Chugh; Sargun Dhillon; Satadru Pan; Sean Bell; Sergey Edunov; Shaoliang Nie; Sharan Narang; Sharath Raparthy; Shaun Lindsay; Sheng Feng; Sheng Shen; Shenghao Lin; Shiva Shankar; Shruti Bhosale; Shun Zhang; Simon Vandenhende; Sinong Wang; Seohyun Sonia Kim; Soumya Batra; Sten Sootla; Steve Kehoe; Suchin Gururangan; Sumit Gupta; Sunny Virk; Sydney Borodinsky; Tamar Glaser; Tamar Herman; Tamara Best; Tara Fowler; Thomas Georgiou; Thomas Scialom; Tianhe Li; Todor Mihaylov; Tong Xiao; Ujjwal Karn; Vedanuj Goswami; Vibhor Gupta; Vignesh Ramanathan; Viktor Kerkez; Vinay Satish Kumar; Vincent Gonguet; Vish Vogeti; Vlad Poenaru; Vlad Tiberiu Mihailescu; Vladan Petrovic; Vladimir Ivanov; Wei Li; Weiwei Chu; Wenhan Xiong; Wenyin Fu; Wes Bouaziz; Whitney Meers; Will Constable; Xavier Martinet; Xiaojian Wu; Xinbo Gao; Xinfeng Xie; Xuchao Jia; Yaelle Goldschlag; Yann LeCun; Yashesh Gaur; Yasmine Babaei; Ye Qi; Yenda Li; Yi Wen; Yiwen Song; Youngjin Nam; Yuchen Hao; Yuchen Zhang; Yun Wang; Yuning Mao; Yuzi He; Zacharie Delpierre Coudert; Zachary DeVito; Zahra Hankir; Zhaoduo Wen; Zheng Yan; Zhengxing Chen; Zhenyu Yang; Zoe Papakipos
|
Mungert/MiniCPM4-8B-GGUF | Mungert | 2025-06-15T19:36:48Z | 906 | 2 | transformers | [
"transformers",
"gguf",
"text-generation",
"zh",
"en",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | text-generation | 2025-06-13T20:02:10Z | ---
license: apache-2.0
language:
- zh
- en
pipeline_tag: text-generation
library_name: transformers
---
# <span style="color: #7FFF7F;">MiniCPM4-8B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`7f4fbe51`](https://github.com/ggerganov/llama.cpp/commit/7f4fbe5183b23b6b2e25fd1ccc5d1fa8bb010cb7).
---
## <span style="color: #7FFF7F;">Quantization Beyond the IMatrix</span>
I've been experimenting with a new quantization approach that selectively elevates the precision of key layers beyond what the default IMatrix configuration provides.
In my testing, standard IMatrix quantization underperforms at lower bit depths, especially with Mixture of Experts (MoE) models. To address this, I'm using the `--tensor-type` option in `llama.cpp` to manually "bump" important layers to higher precision. You can see the implementation here:
👉 [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
While this does increase model file size, it significantly improves precision for a given quantization level.
### **I'd love your feedback—have you tried this? How does it perform for you?**
---
<a href="https://readyforquantum.com/huggingface_gguf_selection_guide.html" style="color: #7FFF7F;">
Click here to get info on choosing the right GGUF model format
</a>
---
<!--Begin Original Model Card-->
<div align="center">
<img src="https://github.com/OpenBMB/MiniCPM/blob/main/assets/minicpm_logo.png?raw=true" width="500em" ></img>
</div>
<p align="center">
<a href="https://github.com/OpenBMB/MiniCPM/" target="_blank">GitHub Repo</a> |
<a href="https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf" target="_blank">Technical Report</a>
</p>
<p align="center">
👋 Join us on <a href="https://discord.gg/3cGQn9b3YM" target="_blank">Discord</a> and <a href="https://github.com/OpenBMB/MiniCPM/blob/main/assets/wechat.jpg" target="_blank">WeChat</a>
</p>
## What's New
- [2025.06.06] **MiniCPM4** series are released! This model achieves ultimate efficiency improvements while maintaining optimal performance at the same scale! It can achieve over 5x generation acceleration on typical end-side chips! You can find technical report [here](https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf).🔥🔥🔥
## MiniCPM4 Series
MiniCPM4 series are highly efficient large language models (LLMs) designed explicitly for end-side devices, which achieves this efficiency through systematic innovation in four key dimensions: model architecture, training data, training algorithms, and inference systems.
- [MiniCPM4-8B](https://huggingface.co/openbmb/MiniCPM4-8B): The flagship of MiniCPM4, with 8B parameters, trained on 8T tokens. (**<-- you are here**)
- [MiniCPM4-0.5B](https://huggingface.co/openbmb/MiniCPM4-0.5B): The small version of MiniCPM4, with 0.5B parameters, trained on 1T tokens.
- [MiniCPM4-8B-Eagle-FRSpec](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-FRSpec): Eagle head for FRSpec, accelerating speculative inference for MiniCPM4-8B.
- [MiniCPM4-8B-Eagle-FRSpec-QAT-cpmcu](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-FRSpec-QAT-cpmcu): Eagle head trained with QAT for FRSpec, efficiently integrate speculation and quantization to achieve ultra acceleration for MiniCPM4-8B.
- [MiniCPM4-8B-Eagle-vLLM](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-vLLM): Eagle head in vLLM format, accelerating speculative inference for MiniCPM4-8B.
- [MiniCPM4-8B-marlin-Eagle-vLLM](https://huggingface.co/openbmb/MiniCPM4-8B-marlin-Eagle-vLLM): Quantized Eagle head for vLLM format, accelerating speculative inference for MiniCPM4-8B.
- [BitCPM4-0.5B](https://huggingface.co/openbmb/BitCPM4-0.5B): Extreme ternary quantization applied to MiniCPM4-0.5B compresses model parameters into ternary values, achieving a 90% reduction in bit width.
- [BitCPM4-1B](https://huggingface.co/openbmb/BitCPM4-1B): Extreme ternary quantization applied to MiniCPM3-1B compresses model parameters into ternary values, achieving a 90% reduction in bit width.
- [MiniCPM4-Survey](https://huggingface.co/openbmb/MiniCPM4-Survey): Based on MiniCPM4-8B, accepts users' quiries as input and autonomously generate trustworthy, long-form survey papers.
- [MiniCPM4-MCP](https://huggingface.co/openbmb/MiniCPM4-MCP): Based on MiniCPM4-8B, accepts users' queries and available MCP tools as input and autonomously calls relevant MCP tools to satisfy users' requirements.
## Introduction
MiniCPM 4 is an extremely efficient edge-side large model that has undergone efficient optimization across four dimensions: model architecture, learning algorithms, training data, and inference systems, achieving ultimate efficiency improvements.
- 🏗️ **Efficient Model Architecture:**
- InfLLM v2 -- Trainable Sparse Attention Mechanism: Adopts a trainable sparse attention mechanism architecture where each token only needs to compute relevance with less than 5% of tokens in 128K long text processing, significantly reducing computational overhead for long texts
- 🧠 **Efficient Learning Algorithms:**
- Model Wind Tunnel 2.0 -- Efficient Predictable Scaling: Introduces scaling prediction methods for performance of downstream tasks, enabling more precise model training configuration search
- BitCPM -- Ultimate Ternary Quantization: Compresses model parameter bit-width to 3 values, achieving 90% extreme model bit-width reduction
- Efficient Training Engineering Optimization: Adopts FP8 low-precision computing technology combined with Multi-token Prediction training strategy
- 📚 **High-Quality Training Data:**
- UltraClean -- High-quality Pre-training Data Filtering and Generation: Builds iterative data cleaning strategies based on efficient data verification, open-sourcing high-quality Chinese and English pre-training dataset [UltraFinweb](https://huggingface.co/datasets/openbmb/Ultra-FineWeb)
- UltraChat v2 -- High-quality Supervised Fine-tuning Data Generation: Constructs large-scale high-quality supervised fine-tuning datasets covering multiple dimensions including knowledge-intensive data, reasoning-intensive data, instruction-following data, long text understanding data, and tool calling data
- ⚡ **Efficient Inference System:**
- CPM.cu -- Lightweight and Efficient CUDA Inference Framework: Integrates sparse attention, model quantization, and speculative sampling to achieve efficient prefilling and decoding
- ArkInfer -- Cross-platform Deployment System: Supports efficient deployment across multiple backend environments, providing flexible cross-platform adaptation capabilities
## Usage
### Inference with [CPM.cu](https://github.com/OpenBMB/cpm.cu)
We recommend using [CPM.cu](https://github.com/OpenBMB/cpm.cu) for the inference of MiniCPM4. CPM.cu is a CUDA inference framework developed by OpenBMB, which integrates efficient sparse, speculative sampling, and quantization techniques, fully leveraging the efficiency advantages of MiniCPM4.
You can install CPM.cu by running the following command:
```bash
git clone https://github.com/OpenBMB/cpm.cu.git --recursive
cd cpm.cu
python3 setup.py install
```
MiniCPM4 natively supports context lengths of up to 32,768 tokens. To reproduce the long-text acceleration effect in the paper, we recommend using the LongRoPE factors that have been validated. Change the `rope_scaling` field in the `config.json` file as the following to enable LongRoPE.
```json
{
...,
"rope_scaling": {
"rope_type": "longrope",
"long_factor": [0.9977997200264581, 1.014658295992452, 1.0349680404997148, 1.059429246056193, 1.0888815016813513, 1.1243301355211495, 1.166977103606075, 1.2182568066927284, 1.2798772354275727, 1.3538666751582975, 1.4426259039919596, 1.5489853358570191, 1.6762658237220625, 1.8283407612492941, 2.0096956085876183, 2.225478927469756, 2.481536379650452, 2.784415934557119, 3.1413289096347365, 3.560047844772632, 4.048719380066383, 4.752651957515948, 5.590913044973868, 6.584005926629993, 7.7532214876576155, 9.119754865903639, 10.704443927019176, 12.524994176518703, 14.59739595363613, 16.93214476166354, 19.53823297353041, 22.417131025031697, 25.568260840911098, 28.991144156566317, 32.68408069090375, 36.65174474170465, 40.90396065611201, 45.4664008671033, 50.37147343433591, 55.6804490772103, 61.470816952306556, 67.8622707390618, 75.00516023410414, 83.11898235973767, 92.50044360202462, 103.57086856690864, 116.9492274587385, 118.16074567836519, 119.18497548708795, 120.04810876261652, 120.77352815196981, 121.38182790207875, 121.89094985353891, 122.31638758099915, 122.6714244963338, 122.9673822552567, 123.21386397019609, 123.41898278254268, 123.58957065488238, 123.73136519024158, 123.84917421274221, 123.94701903496814, 124.02825801299717, 124.09569231686116],
"short_factor": [0.9977997200264581, 1.014658295992452, 1.0349680404997148, 1.059429246056193, 1.0888815016813513, 1.1243301355211495, 1.166977103606075, 1.2182568066927284, 1.2798772354275727, 1.3538666751582975, 1.4426259039919596, 1.5489853358570191, 1.6762658237220625, 1.8283407612492941, 2.0096956085876183, 2.225478927469756, 2.481536379650452, 2.784415934557119, 3.1413289096347365, 3.560047844772632, 4.048719380066383, 4.752651957515948, 5.590913044973868, 6.584005926629993, 7.7532214876576155, 9.119754865903639, 10.704443927019176, 12.524994176518703, 14.59739595363613, 16.93214476166354, 19.53823297353041, 22.417131025031697, 25.568260840911098, 28.991144156566317, 32.68408069090375, 36.65174474170465, 40.90396065611201, 45.4664008671033, 50.37147343433591, 55.6804490772103, 61.470816952306556, 67.8622707390618, 75.00516023410414, 83.11898235973767, 92.50044360202462, 103.57086856690864, 116.9492274587385, 118.16074567836519, 119.18497548708795, 120.04810876261652, 120.77352815196981, 121.38182790207875, 121.89094985353891, 122.31638758099915, 122.6714244963338, 122.9673822552567, 123.21386397019609, 123.41898278254268, 123.58957065488238, 123.73136519024158, 123.84917421274221, 123.94701903496814, 124.02825801299717, 124.09569231686116],
"original_max_position_embeddings": 32768
}
}
```
After modification, you can run the following command to reproduce the long-context acceleration effect (the script will automatically download the model weights from HuggingFace)
```bash
python3 tests/test_generate.py
```
For more details about CPM.cu, please refer to [the repo CPM.cu](https://github.com/OpenBMB/cpm.cu).
### Inference with Transformers
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
import torch
torch.manual_seed(0)
path = 'openbmb/MiniCPM4-8B'
device = "cuda"
tokenizer = AutoTokenizer.from_pretrained(path)
model = AutoModelForCausalLM.from_pretrained(path, torch_dtype=torch.bfloat16, device_map=device, trust_remote_code=True)
# User can directly use the chat interface
# responds, history = model.chat(tokenizer, "Write an article about Artificial Intelligence.", temperature=0.7, top_p=0.7)
# print(responds)
# User can also use the generate interface
messages = [
{"role": "user", "content": "Write an article about Artificial Intelligence."},
]
prompt_text = tokenizer.apply_chat_template(
messages,
tokenize=False,
add_generation_prompt=True,
)
model_inputs = tokenizer([prompt_text], return_tensors="pt").to(device)
model_outputs = model.generate(
**model_inputs,
max_new_tokens=1024,
top_p=0.7,
temperature=0.7
)
output_token_ids = [
model_outputs[i][len(model_inputs[i]):] for i in range(len(model_inputs['input_ids']))
]
responses = tokenizer.batch_decode(output_token_ids, skip_special_tokens=True)[0]
print(responses)
```
MiniCPM4-8B supports `InfLLM v2`, a sparse attention mechanism designed for efficient long-sequence inference. It requires the [infllmv2_cuda_impl](https://github.com/OpenBMB/infllmv2_cuda_impl) library.
You can install it by running the following command:
```bash
git clone -b feature_infer https://github.com/OpenBMB/infllmv2_cuda_impl.git
cd infllmv2_cuda_impl
git submodule update --init --recursive
pip install -e . # or python setup.py install
```
To enable InfLLM v2, you need to add the `sparse_config` field in `config.json`:
```json
{
...,
"sparse_config": {
"kernel_size": 32,
"kernel_stride": 16,
"init_blocks": 1,
"block_size": 64,
"window_size": 2048,
"topk": 64,
"use_nope": false,
"dense_len": 8192
}
}
```
These parameters control the behavior of InfLLM v2:
* `kernel_size` (default: 32): The size of semantic kernels.
* `kernel_stride` (default: 16): The stride between adjacent kernels.
* `init_blocks` (default: 1): The number of initial blocks that every query token attends to. This ensures attention to the beginning of the sequence.
* `block_size` (default: 64): The block size for key-value blocks.
* `window_size` (default: 2048): The size of the local sliding window.
* `topk` (default: 64): The specifies that each token computes attention with only the top-k most relevant key-value blocks.
* `use_nope` (default: false): Whether to use the NOPE technique in block selection for improved performance.
* `dense_len` (default: 8192): Since Sparse Attention offers limited benefits for short sequences, the model can use standard (dense) attention for shorter texts. The model will use dense attention for sequences with a token length below `dense_len` and switch to sparse attention for sequences exceeding this length. Set this to `-1` to always use sparse attention regardless of sequence length.
MiniCPM4 natively supports context lengths of up to 32,768 tokens. For conversations where the total length (including both input and output) significantly exceeds this limit, we recommend using RoPE scaling techniques for effective handling of long texts. We have validated the model's performance on context lengths of up to 131,072 tokens by modifying the LongRoPE factor.
You can apply the LongRoPE factor modification by modifying the model files. Specifically, in the `config.json` file, adjust the `rope_scaling` fields.
```json
{
...,
"rope_scaling": {
"rope_type": "longrope",
"long_factor": [0.9977997200264581, 1.014658295992452, 1.0349680404997148, 1.059429246056193, 1.0888815016813513, 1.1243301355211495, 1.166977103606075, 1.2182568066927284, 1.2798772354275727, 1.3538666751582975, 1.4426259039919596, 1.5489853358570191, 1.6762658237220625, 1.8283407612492941, 2.0096956085876183, 2.225478927469756, 2.481536379650452, 2.784415934557119, 3.1413289096347365, 3.560047844772632, 4.048719380066383, 4.752651957515948, 5.590913044973868, 6.584005926629993, 7.7532214876576155, 9.119754865903639, 10.704443927019176, 12.524994176518703, 14.59739595363613, 16.93214476166354, 19.53823297353041, 22.417131025031697, 25.568260840911098, 28.991144156566317, 32.68408069090375, 36.65174474170465, 40.90396065611201, 45.4664008671033, 50.37147343433591, 55.6804490772103, 61.470816952306556, 67.8622707390618, 75.00516023410414, 83.11898235973767, 92.50044360202462, 103.57086856690864, 116.9492274587385, 118.16074567836519, 119.18497548708795, 120.04810876261652, 120.77352815196981, 121.38182790207875, 121.89094985353891, 122.31638758099915, 122.6714244963338, 122.9673822552567, 123.21386397019609, 123.41898278254268, 123.58957065488238, 123.73136519024158, 123.84917421274221, 123.94701903496814, 124.02825801299717, 124.09569231686116],
"short_factor": [0.9977997200264581, 1.014658295992452, 1.0349680404997148, 1.059429246056193, 1.0888815016813513, 1.1243301355211495, 1.166977103606075, 1.2182568066927284, 1.2798772354275727, 1.3538666751582975, 1.4426259039919596, 1.5489853358570191, 1.6762658237220625, 1.8283407612492941, 2.0096956085876183, 2.225478927469756, 2.481536379650452, 2.784415934557119, 3.1413289096347365, 3.560047844772632, 4.048719380066383, 4.752651957515948, 5.590913044973868, 6.584005926629993, 7.7532214876576155, 9.119754865903639, 10.704443927019176, 12.524994176518703, 14.59739595363613, 16.93214476166354, 19.53823297353041, 22.417131025031697, 25.568260840911098, 28.991144156566317, 32.68408069090375, 36.65174474170465, 40.90396065611201, 45.4664008671033, 50.37147343433591, 55.6804490772103, 61.470816952306556, 67.8622707390618, 75.00516023410414, 83.11898235973767, 92.50044360202462, 103.57086856690864, 116.9492274587385, 118.16074567836519, 119.18497548708795, 120.04810876261652, 120.77352815196981, 121.38182790207875, 121.89094985353891, 122.31638758099915, 122.6714244963338, 122.9673822552567, 123.21386397019609, 123.41898278254268, 123.58957065488238, 123.73136519024158, 123.84917421274221, 123.94701903496814, 124.02825801299717, 124.09569231686116],
"original_max_position_embeddings": 32768
}
}
```
### Inference with [SGLang](https://github.com/sgl-project/sglang)
For now, you need to install our forked version of SGLang.
```bash
git clone -b openbmb https://github.com/OpenBMB/sglang.git
cd sglang
pip install --upgrade pip
pip install -e "python[all]"
```
You can start the inference server by running the following command:
```bash
python -m sglang.launch_server --model openbmb/MiniCPM4-8B --trust-remote-code --port 30000 --chat-template chatml
```
Then you can use the chat interface by running the following command:
```python
import openai
client = openai.Client(base_url=f"http://localhost:30000/v1", api_key="None")
response = client.chat.completions.create(
model="openbmb/MiniCPM4-8B",
messages=[
{"role": "user", "content": "Write an article about Artificial Intelligence."},
],
temperature=0.7,
max_tokens=1024,
)
print(response.choices[0].message.content)
```
### Inference with [vLLM](https://github.com/vllm-project/vllm)
For now, you need to install the latest version of vLLM.
```
pip install -U vllm \
--pre \
--extra-index-url https://wheels.vllm.ai/nightly
```
Then you can inference MiniCPM4-8B with vLLM:
```python
from transformers import AutoTokenizer
from vllm import LLM, SamplingParams
model_name = "openbmb/MiniCPM4-8B"
prompt = [{"role": "user", "content": "Please recommend 5 tourist attractions in Beijing. "}]
tokenizer = AutoTokenizer.from_pretrained(model_name, trust_remote_code=True)
input_text = tokenizer.apply_chat_template(prompt, tokenize=False, add_generation_prompt=True)
llm = LLM(
model=model_name,
trust_remote_code=True,
max_num_batched_tokens=32768,
dtype="bfloat16",
gpu_memory_utilization=0.8,
)
sampling_params = SamplingParams(top_p=0.7, temperature=0.7, max_tokens=1024, repetition_penalty=1.02)
outputs = llm.generate(prompts=input_text, sampling_params=sampling_params)
print(outputs[0].outputs[0].text)
```
Also, you can start the inference server by running the following command:
> **Note**: In vLLM's chat API, `add_special_tokens` is `False` by default. This means important special tokens—such as the beginning-of-sequence (BOS) token—will not be added automatically. To ensure the input prompt is correctly formatted for the model, you should explicitly set `extra_body={"add_special_tokens": True}`.
```bash
vllm serve openbmb/MiniCPM4-8B
```
Then you can use the chat interface by running the following code:
```python
import openai
client = openai.Client(base_url="http://localhost:8000/v1", api_key="EMPTY")
response = client.chat.completions.create(
model="openbmb/MiniCPM4-8B",
messages=[
{"role": "user", "content": "Write an article about Artificial Intelligence."},
],
temperature=0.7,
max_tokens=1024,
extra_body=dict(add_special_tokens=True), # Ensures special tokens are added for chat template
)
print(response.choices[0].message.content)
```
## Evaluation Results
On two typical end-side chips, Jetson AGX Orin and RTX 4090, MiniCPM4 demonstrates significantly faster processing speed compared to similar-size models in long text processing tasks. As text length increases, MiniCPM4's efficiency advantage becomes more pronounced. On the Jetson AGX Orin platform, compared to Qwen3-8B, MiniCPM4 achieves approximately 7x decoding speed improvement.
#### Comprehensive Evaluation
MiniCPM4 launches end-side versions with 8B and 0.5B parameter scales, both achieving best-in-class performance in their respective categories.
#### Long Text Evaluation
MiniCPM4 is pre-trained on 32K long texts and achieves length extension through YaRN technology. In the 128K long text needle-in-a-haystack task, MiniCPM4 demonstrates outstanding performance.
## Statement
- As a language model, MiniCPM generates content by learning from a vast amount of text.
- However, it does not possess the ability to comprehend or express personal opinions or value judgments.
- Any content generated by MiniCPM does not represent the viewpoints or positions of the model developers.
- Therefore, when using content generated by MiniCPM, users should take full responsibility for evaluating and verifying it on their own.
## LICENSE
- This repository and MiniCPM models are released under the [Apache-2.0](https://github.com/OpenBMB/MiniCPM/blob/main/LICENSE) License.
## Citation
- Please cite our [paper](https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf) if you find our work valuable.
```bibtex
@article{minicpm4,
title={{MiniCPM4}: Ultra-Efficient LLMs on End Devices},
author={MiniCPM Team},
year={2025}
}
```
<!--End Original Model Card-->
---
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen3-Embedding-8B-GGUF | Mungert | 2025-06-15T19:36:42Z | 1,574 | 2 | sentence-transformers | [
"sentence-transformers",
"gguf",
"transformers",
"sentence-similarity",
"feature-extraction",
"arxiv:2506.05176",
"base_model:Qwen/Qwen3-8B-Base",
"base_model:quantized:Qwen/Qwen3-8B-Base",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | feature-extraction | 2025-06-10T18:12:06Z | ---
license: apache-2.0
base_model:
- Qwen/Qwen3-8B-Base
tags:
- transformers
- sentence-transformers
- sentence-similarity
- feature-extraction
---
# <span style="color: #7FFF7F;">Qwen/Qwen3-Embedding-8B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`1f63e75f`](https://github.com/ggerganov/llama.cpp/commit/1f63e75f3b5dc7f44dbe63c8a41d23958fe95bc0).
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Qwen3-Embedding-8B
<p align="center">
<img src="https://qianwen-res.oss-accelerate-overseas.aliyuncs.com/logo_qwen3.png" width="400"/>
<p>
## Highlights
The Qwen3 Embedding model series is the latest proprietary model of the Qwen family, specifically designed for text embedding and ranking tasks. Building upon the dense foundational models of the Qwen3 series, it provides a comprehensive range of text embeddings and reranking models in various sizes (0.6B, 4B, and 8B). This series inherits the exceptional multilingual capabilities, long-text understanding, and reasoning skills of its foundational model. The Qwen3 Embedding series represents significant advancements in multiple text embedding and ranking tasks, including text retrieval, code retrieval, text classification, text clustering, and bitext mining.
**Exceptional Versatility**: The embedding model has achieved state-of-the-art performance across a wide range of downstream application evaluations. The 8B size embedding model ranks **No.1** in the MTEB multilingual leaderboard (as of June 5, 2025, score **70.58**), while the reranking model excels in various text retrieval scenarios.
**Comprehensive Flexibility**: The Qwen3 Embedding series offers a full spectrum of sizes (from 0.6B to 8B) for both embedding and reranking models, catering to diverse use cases that prioritize efficiency and effectiveness. Developers can seamlessly combine these two modules. Additionally, the embedding model allows for flexible vector definitions across all dimensions, and both embedding and reranking models support user-defined instructions to enhance performance for specific tasks, languages, or scenarios.
**Multilingual Capability**: The Qwen3 Embedding series offer support for over 100 languages, thanks to the multilingual capabilites of Qwen3 models. This includes various programming languages, and provides robust multilingual, cross-lingual, and code retrieval capabilities.
**Qwen3-Embedding-8B** has the following features:
- Model Type: Text Embedding
- Supported Languages: 100+ Languages
- Number of Paramaters: 8B
- Context Length: 32k
- Embedding Dimension: Up to 4096, supports user-defined output dimensions ranging from 32 to 4096
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3-embedding/), [GitHub](https://github.com/QwenLM/Qwen3-Embedding).
## Qwen3 Embedding Series Model list
| Model Type | Models | Size | Layers | Sequence Length | Embedding Dimension | MRL Support | Instruction Aware |
|------------------|----------------------|------|--------|-----------------|---------------------|-------------|----------------|
| Text Embedding | [Qwen3-Embedding-0.6B](https://huggingface.co/Qwen/Qwen3-Embedding-0.6B) | 0.6B | 28 | 32K | 1024 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-4B](https://huggingface.co/Qwen/Qwen3-Embedding-4B) | 4B | 36 | 32K | 2560 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-8B](https://huggingface.co/Qwen/Qwen3-Embedding-8B) | 8B | 36 | 32K | 4096 | Yes | Yes |
| Text Reranking | [Qwen3-Reranker-0.6B](https://huggingface.co/Qwen/Qwen3-Reranker-0.6B) | 0.6B | 28 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-4B](https://huggingface.co/Qwen/Qwen3-Reranker-4B) | 4B | 36 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-8B](https://huggingface.co/Qwen/Qwen3-Reranker-8B) | 8B | 36 | 32K | - | - | Yes |
> **Note**:
> - `MRL Support` indicates whether the embedding model supports custom dimensions for the final embedding.
> - `Instruction Aware` notes whether the embedding or reranking model supports customizing the input instruction according to different tasks.
> - Our evaluation indicates that, for most downstream tasks, using instructions (instruct) typically yields an improvement of 1% to 5% compared to not using them. Therefore, we recommend that developers create tailored instructions specific to their tasks and scenarios. In multilingual contexts, we also advise users to write their instructions in English, as most instructions utilized during the model training process were originally written in English.
## Usage
With Transformers versions earlier than 4.51.0, you may encounter the following error:
```
KeyError: 'qwen3'
```
### Sentence Transformers Usage
```python
# Requires transformers>=4.51.0
# Requires sentence-transformers>=2.7.0
from sentence_transformers import SentenceTransformer
# Load the model
model = SentenceTransformer("Qwen/Qwen3-Embedding-8B")
# We recommend enabling flash_attention_2 for better acceleration and memory saving,
# together with setting `padding_side` to "left":
# model = SentenceTransformer(
# "Qwen/Qwen3-Embedding-8B",
# model_kwargs={"attn_implementation": "flash_attention_2", "device_map": "auto"},
# tokenizer_kwargs={"padding_side": "left"},
# )
# The queries and documents to embed
queries = [
"What is the capital of China?",
"Explain gravity",
]
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun.",
]
# Encode the queries and documents. Note that queries benefit from using a prompt
# Here we use the prompt called "query" stored under `model.prompts`, but you can
# also pass your own prompt via the `prompt` argument
query_embeddings = model.encode(queries, prompt_name="query")
document_embeddings = model.encode(documents)
# Compute the (cosine) similarity between the query and document embeddings
similarity = model.similarity(query_embeddings, document_embeddings)
print(similarity)
# tensor([[0.7493, 0.0751],
# [0.0880, 0.6318]])
```
### Transformers Usage
```python
# Requires transformers>=4.51.0
import torch
import torch.nn.functional as F
from torch import Tensor
from transformers import AutoTokenizer, AutoModel
def last_token_pool(last_hidden_states: Tensor,
attention_mask: Tensor) -> Tensor:
left_padding = (attention_mask[:, -1].sum() == attention_mask.shape[0])
if left_padding:
return last_hidden_states[:, -1]
else:
sequence_lengths = attention_mask.sum(dim=1) - 1
batch_size = last_hidden_states.shape[0]
return last_hidden_states[torch.arange(batch_size, device=last_hidden_states.device), sequence_lengths]
def get_detailed_instruct(task_description: str, query: str) -> str:
return f'Instruct: {task_description}\nQuery:{query}'
# Each query must come with a one-sentence instruction that describes the task
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = [
get_detailed_instruct(task, 'What is the capital of China?'),
get_detailed_instruct(task, 'Explain gravity')
]
# No need to add instruction for retrieval documents
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun."
]
input_texts = queries + documents
tokenizer = AutoTokenizer.from_pretrained('Qwen/Qwen3-Embedding-8B', padding_side='left')
model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-8B')
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-8B', attn_implementation="flash_attention_2", torch_dtype=torch.float16).cuda()
max_length = 8192
# Tokenize the input texts
batch_dict = tokenizer(
input_texts,
padding=True,
truncation=True,
max_length=max_length,
return_tensors="pt",
)
batch_dict.to(model.device)
outputs = model(**batch_dict)
embeddings = last_token_pool(outputs.last_hidden_state, batch_dict['attention_mask'])
# normalize embeddings
embeddings = F.normalize(embeddings, p=2, dim=1)
scores = (embeddings[:2] @ embeddings[2:].T)
print(scores.tolist())
# [[0.7493016123771667, 0.0750647559762001], [0.08795969933271408, 0.6318399906158447]]
```
### vLLM Usage
```python
# Requires vllm>=0.8.5
import torch
import vllm
from vllm import LLM
def get_detailed_instruct(task_description: str, query: str) -> str:
return f'Instruct: {task_description}\nQuery:{query}'
# Each query must come with a one-sentence instruction that describes the task
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = [
get_detailed_instruct(task, 'What is the capital of China?'),
get_detailed_instruct(task, 'Explain gravity')
]
# No need to add instruction for retrieval documents
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun."
]
input_texts = queries + documents
model = LLM(model="Qwen/Qwen3-Embedding-8B", task="embed")
outputs = model.embed(input_texts)
embeddings = torch.tensor([o.outputs.embedding for o in outputs])
scores = (embeddings[:2] @ embeddings[2:].T)
print(scores.tolist())
# [[0.7482624650001526, 0.07556197047233582], [0.08875375241041183, 0.6300010681152344]]
```
📌 **Tip**: We recommend that developers customize the `instruct` according to their specific scenarios, tasks, and languages. Our tests have shown that in most retrieval scenarios, not using an `instruct` on the query side can lead to a drop in retrieval performance by approximately 1% to 5%.
## Evaluation
### MTEB (Multilingual)
| Model | Size | Mean (Task) | Mean (Type) | Bitxt Mining | Class. | Clust. | Inst. Retri. | Multi. Class. | Pair. Class. | Rerank | Retri. | STS |
|----------------------------------|:-------:|:-------------:|:-------------:|:--------------:|:--------:|:--------:|:--------------:|:---------------:|:--------------:|:--------:|:--------:|:------:|
| NV-Embed-v2 | 7B | 56.29 | 49.58 | 57.84 | 57.29 | 40.80 | 1.04 | 18.63 | 78.94 | 63.82 | 56.72 | 71.10|
| GritLM-7B | 7B | 60.92 | 53.74 | 70.53 | 61.83 | 49.75 | 3.45 | 22.77 | 79.94 | 63.78 | 58.31 | 73.33|
| BGE-M3 | 0.6B | 59.56 | 52.18 | 79.11 | 60.35 | 40.88 | -3.11 | 20.1 | 80.76 | 62.79 | 54.60 | 74.12|
| multilingual-e5-large-instruct | 0.6B | 63.22 | 55.08 | 80.13 | 64.94 | 50.75 | -0.40 | 22.91 | 80.86 | 62.61 | 57.12 | 76.81|
| gte-Qwen2-1.5B-instruct | 1.5B | 59.45 | 52.69 | 62.51 | 58.32 | 52.05 | 0.74 | 24.02 | 81.58 | 62.58 | 60.78 | 71.61|
| gte-Qwen2-7b-Instruct | 7B | 62.51 | 55.93 | 73.92 | 61.55 | 52.77 | 4.94 | 25.48 | 85.13 | 65.55 | 60.08 | 73.98|
| text-embedding-3-large | - | 58.93 | 51.41 | 62.17 | 60.27 | 46.89 | -2.68 | 22.03 | 79.17 | 63.89 | 59.27 | 71.68|
| Cohere-embed-multilingual-v3.0 | - | 61.12 | 53.23 | 70.50 | 62.95 | 46.89 | -1.89 | 22.74 | 79.88 | 64.07 | 59.16 | 74.80|
| gemini-embedding-exp-03-07 | - | 68.37 | 59.59 | 79.28 | 71.82 | 54.59 | 5.18 | **29.16** | 83.63 | 65.58 | 67.71 | 79.40|
| **Qwen3-Embedding-0.6B** | 0.6B | 64.33 | 56.00 | 72.22 | 66.83 | 52.33 | 5.09 | 24.59 | 80.83 | 61.41 | 64.64 | 76.17|
| **Qwen3-Embedding-4B** | 4B | 69.45 | 60.86 | 79.36 | 72.33 | 57.15 | **11.56** | 26.77 | 85.05 | 65.08 | 69.60 | 80.86|
| **Qwen3-Embedding-8B** | 8B | **70.58** | **61.69** | **80.89** | **74.00** | **57.65** | 10.06 | 28.66 | **86.40** | **65.63** | **70.88** | **81.08** |
> **Note**: For compared models, the scores are retrieved from MTEB online [leaderboard](https://huggingface.co/spaces/mteb/leaderboard) on May 24th, 2025.
### MTEB (Eng v2)
| MTEB English / Models | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retri. | STS | Summ. |
|--------------------------------|:--------:|:------------:|:------------:|:--------:|:--------:|:-------------:|:---------:|:--------:|:-------:|:-------:|
| multilingual-e5-large-instruct | 0.6B | 65.53 | 61.21 | 75.54 | 49.89 | 86.24 | 48.74 | 53.47 | 84.72 | 29.89 |
| NV-Embed-v2 | 7.8B | 69.81 | 65.00 | 87.19 | 47.66 | 88.69 | 49.61 | 62.84 | 83.82 | 35.21 |
| GritLM-7B | 7.2B | 67.07 | 63.22 | 81.25 | 50.82 | 87.29 | 49.59 | 54.95 | 83.03 | 35.65 |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.20 | 63.26 | 85.84 | 53.54 | 87.52 | 49.25 | 50.25 | 82.51 | 33.94 |
| stella_en_1.5B_v5 | 1.5B | 69.43 | 65.32 | 89.38 | 57.06 | 88.02 | 50.19 | 52.42 | 83.27 | 36.91 |
| gte-Qwen2-7B-instruct | 7.6B | 70.72 | 65.77 | 88.52 | 58.97 | 85.9 | 50.47 | 58.09 | 82.69 | 35.74 |
| gemini-embedding-exp-03-07 | - | 73.3 | 67.67 | 90.05 | **59.39** | **87.7** | 48.59 | 64.35 | 85.29 | **38.28** |
| **Qwen3-Embedding-0.6B** | 0.6B | 70.70 | 64.88 | 85.76 | 54.05 | 84.37 | 48.18 | 61.83 | 86.57 | 33.43 |
| **Qwen3-Embedding-4B** | 4B | 74.60 | 68.10 | 89.84 | 57.51 | 87.01 | 50.76 | 68.46 | **88.72** | 34.39 |
| **Qwen3-Embedding-8B** | 8B | **75.22** | **68.71** | **90.43** | 58.57 | 87.52 | **51.56** | **69.44** | 88.58 | 34.83 |
### C-MTEB (MTEB Chinese)
| C-MTEB | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retr. | STS |
|------------------|--------|------------|------------|--------|--------|-------------|---------|-------|-------|
| multilingual-e5-large-instruct | 0.6B | 58.08 | 58.24 | 69.80 | 48.23 | 64.52 | 57.45 | 63.65 | 45.81 |
| bge-multilingual-gemma2 | 9B | 67.64 |68.52 | 75.31 | 59.30 | 86.67 | 68.28 | 73.73 | 55.19 |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.12 | 67.79 | 72.53 | 54.61 | 79.5 | 68.21 | 71.86 | 60.05 |
| gte-Qwen2-7B-instruct | 7.6B | 71.62 | 72.19 | 75.77 | 66.06 | 81.16 | 69.24 | 75.70 | 65.20 |
| ritrieve_zh_v1 | 0.3B | 72.71 | 73.85 | 76.88 | 66.5 | **85.98** | **72.86** | 76.97 | **63.92** |
| **Qwen3-Embedding-0.6B** | 0.6B | 66.33 | 67.45 | 71.40 | 68.74 | 76.42 | 62.58 | 71.03 | 54.52 |
| **Qwen3-Embedding-4B** | 4B | 72.27 | 73.51 | 75.46 | 77.89 | 83.34 | 66.05 | 77.03 | 61.26 |
| **Qwen3-Embedding-8B** | 8B | **73.84** | **75.00** | **76.97** | **80.08** | 84.23 | 66.99 | **78.21** | 63.53 |
## Citation
If you find our work helpful, feel free to give us a cite.
```
@article{qwen3embedding,
title={Qwen3 Embedding: Advancing Text Embedding and Reranking Through Foundation Models},
author={Zhang, Yanzhao and Li, Mingxin and Long, Dingkun and Zhang, Xin and Lin, Huan and Yang, Baosong and Xie, Pengjun and Yang, An and Liu, Dayiheng and Lin, Junyang and Huang, Fei and Zhou, Jingren},
journal={arXiv preprint arXiv:2506.05176},
year={2025}
}
```
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen2.5-Omni-3B-GGUF | Mungert | 2025-06-15T19:36:37Z | 1,307 | 2 | transformers | [
"transformers",
"gguf",
"multimodal",
"any-to-any",
"en",
"arxiv:2503.20215",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | any-to-any | 2025-06-10T12:18:40Z | ---
license: other
license_name: qwen-research
license_link: LICENSE
language:
- en
tags:
- multimodal
library_name: transformers
pipeline_tag: any-to-any
---
# <span style="color: #7FFF7F;">Qwen2.5-Omni-3B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`7f4fbe51`](https://github.com/ggerganov/llama.cpp/commit/7f4fbe5183b23b6b2e25fd1ccc5d1fa8bb010cb7).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
# Qwen2.5-Omni
<a href="https://chat.qwen.ai/" target="_blank" style="margin: 2px;">
<img alt="Chat" src="https://img.shields.io/badge/%F0%9F%92%9C%EF%B8%8F%20Qwen%20Chat%20-536af5" style="display: inline-block; vertical-align: middle;"/>
</a>
## Overview
### Introduction
Qwen2.5-Omni is an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner.
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/qwen_omni.png" width="80%"/>
<p>
### Key Features
* **Omni and Novel Architecture**: We propose Thinker-Talker architecture, an end-to-end multimodal model designed to perceive diverse modalities, including text, images, audio, and video, while simultaneously generating text and natural speech responses in a streaming manner. We propose a novel position embedding, named TMRoPE (Time-aligned Multimodal RoPE), to synchronize the timestamps of video inputs with audio.
* **Real-Time Voice and Video Chat**: Architecture designed for fully real-time interactions, supporting chunked input and immediate output.
* **Natural and Robust Speech Generation**: Surpassing many existing streaming and non-streaming alternatives, demonstrating superior robustness and naturalness in speech generation.
* **Strong Performance Across Modalities**: Exhibiting exceptional performance across all modalities when benchmarked against similarly sized single-modality models. Qwen2.5-Omni outperforms the similarly sized Qwen2-Audio in audio capabilities and achieves comparable performance to Qwen2.5-VL-7B.
* **Excellent End-to-End Speech Instruction Following**: Qwen2.5-Omni shows performance in end-to-end speech instruction following that rivals its effectiveness with text inputs, evidenced by benchmarks such as MMLU and GSM8K.
### Model Architecture
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/overview.png" width="80%"/>
<p>
### Performance
We conducted a comprehensive evaluation of Qwen2.5-Omni, which demonstrates strong performance across all modalities when compared to similarly sized single-modality models and closed-source models like Qwen2.5-VL-7B, Qwen2-Audio, and Gemini-1.5-pro. In tasks requiring the integration of multiple modalities, such as OmniBench, Qwen2.5-Omni achieves state-of-the-art performance. Furthermore, in single-modality tasks, it excels in areas including speech recognition (Common Voice), translation (CoVoST2), audio understanding (MMAU), image reasoning (MMMU, MMStar), video understanding (MVBench), and speech generation (Seed-tts-eval and subjective naturalness).
<p align="center">
<img src="https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/bar.png" width="80%"/>
<p>
<details>
<summary>Multimodality -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-0lax" rowspan="10">OmniBench<br>Speech | Sound Event | Music | Avg</td>
<td class="tg-0lax">Gemini-1.5-Pro</td>
<td class="tg-0lax">42.67%|42.26%|46.23%|42.91%</td>
</tr>
<tr>
<td class="tg-0lax">MIO-Instruct</td>
<td class="tg-0lax">36.96%|33.58%|11.32%|33.80%</td>
</tr>
<tr>
<td class="tg-0lax">AnyGPT (7B)</td>
<td class="tg-0lax">17.77%|20.75%|13.21%|18.04%</td>
</tr>
<tr>
<td class="tg-0lax">video-SALMONN</td>
<td class="tg-0lax">34.11%|31.70%|<strong>56.60%</strong>|35.64%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xlarge</td>
<td class="tg-0lax">39.56%|36.98%|29.25%|38.00%</td>
</tr>
<tr>
<td class="tg-0lax">UnifiedIO2-xxlarge</td>
<td class="tg-0lax">34.24%|36.98%|24.53%|33.98%</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|-|40.50%</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">-|-|-|42.90%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">52.14%|52.08%|52.83%|52.19%</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>55.25%</strong>|<strong>60.00%</strong>|52.83%|<strong>56.13%</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Audio -> Text</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">ASR</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="12">Librispeech<br>dev-clean | dev other | test-clean | test-other</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">-|-|2.1|4.9</td>
</tr>
<tr>
<td class="tg-0lax">SpeechVerse</td>
<td class="tg-0lax">-|-|2.1|4.4</td>
</tr>
<tr>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">-|-|1.8|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">-|-|-|3.4</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax">-|-|-|3.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|-|<strong>1.6</strong>|<strong>2.8</strong></td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|1.7|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|-|1.7|3.9</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">1.8|4.0|2.0|4.2</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>1.3</strong>|<strong>3.4</strong>|<strong>1.6</strong>|3.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">2.0|4.1|2.2|4.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">1.6|3.5|1.8|3.4</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="5">Common Voice 15<br>en | zh | yue | fr</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">9.3|12.8|10.9|10.8</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">7.9|6.3|6.4|8.5</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">8.6|6.9|<strong>5.9</strong>|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">9.1|6.0|11.6|9.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>7.6</strong>|<strong>5.2</strong>|7.3|<strong>7.5</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="8">Fleurs<br>zh | en</td>
<td class="tg-0lax">Whisper-large-v3</td>
<td class="tg-0lax">7.7|4.1</td>
</tr>
<tr>
<td class="tg-0lax">Seed-ASR-Multilingual</td>
<td class="tg-0lax">-|<strong>3.4</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">10.8|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.4|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">3.0|3.8</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">7.5|-</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">3.2|5.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>3.0</strong>|4.1</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Wenetspeech<br>test-net | test-meeting</td>
<td class="tg-0lax">Seed-ASR-Chinese</td>
<td class="tg-0lax"><strong>4.7|5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">-|16.4</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">6.9|-</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">6.8|7.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.3|8.1</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.9|7.7</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">Voxpopuli-V1.0-en</td>
<td class="tg-0lax">Llama-3-8B</td>
<td class="tg-0lax">6.2</td>
</tr>
<tr>
<td class="tg-0lax">Llama-3-70B</td>
<td class="tg-0lax"><strong>5.7</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">6.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">5.8</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">S2TT</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">CoVoST2<br>en-de | de-en | en-zh | zh-en</td>
<td class="tg-0lax">SALMONN</td>
<td class="tg-0lax">18.6|-|33.1|-</td>
</tr>
<tr>
<td class="tg-0lax">SpeechLLaMA</td>
<td class="tg-0lax">-|27.1|-|12.3</td>
</tr>
<tr>
<td class="tg-0lax">BLSP</td>
<td class="tg-0lax">14.1|-|-|-</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">-|-|<strong>48.2</strong>|27.2</td>
</tr>
<tr>
<td class="tg-0lax">MinMo</td>
<td class="tg-0lax">-|<strong>39.9</strong>|46.7|26.0</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">25.1|33.9|41.5|15.7</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">29.9|35.2|45.2|24.4</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">28.3|38.1|41.4|26.6</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>30.2</strong>|37.7|41.4|<strong>29.4</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">SER</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">Meld</td>
<td class="tg-0lax">WavLM-large</td>
<td class="tg-0lax">0.542</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">0.524</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.557</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">0.553</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.558</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.570</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">VSC</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="6">VocalSound</td>
<td class="tg-0lax">CLAP</td>
<td class="tg-0lax">0.495</td>
</tr>
<tr>
<td class="tg-0lax">Pengi</td>
<td class="tg-0lax">0.604</td>
</tr>
<tr>
<td class="tg-0lax">Qwen-Audio</td>
<td class="tg-0lax">0.929</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.936</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.939</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Music</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">GiantSteps Tempo</td>
<td class="tg-0lax">Llark-7B</td>
<td class="tg-0lax">0.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.88</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="3">MusicCaps</td>
<td class="tg-0lax">LP-MusicCaps</td>
<td class="tg-0lax">0.291|0.149|0.089|<strong>0.061</strong>|0.129|0.130</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">0.325|<strong>0.163</strong>|<strong>0.093</strong>|0.057|<strong>0.132</strong>|<strong>0.229</strong></td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>0.328</strong>|0.162|0.090|0.055|0.127|0.225</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Audio Reasoning</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="4">MMAU<br>Sound | Music | Speech | Avg</td>
<td class="tg-0lax">Gemini-Pro-V1.5</td>
<td class="tg-0lax">56.75|49.40|58.55|54.90</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">54.95|50.98|42.04|49.20</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax"><strong>70.27</strong>|60.48|59.16|63.30</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">67.87|<strong>69.16|59.76|65.60</strong></td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Voice Chatting</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>AlpacaEval | CommonEval | SD-QA | MMSU</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax"><strong>4.55</strong>|3.90|53.35|47.17</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">4.50|3.77|55.06|34.95</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">3.50|2.95|25.95|27.03</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">3.85|3.50|38.25|49.74</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">4.42|<strong>4.15</strong>|50.72|54.78</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">4.50|4.05|43.40|57.25</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">3.74|3.43|35.71|35.72</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">4.32|4.00|49.37|50.23</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax">4.49|3.93|<strong>55.71</strong>|<strong>61.32</strong></td>
</tr>
<tr>
<td class="tg-0lax" rowspan="9">VoiceBench<br>OpenBookQA | IFEval | AdvBench | Avg</td>
<td class="tg-0lax">Ultravox-v0.4.1-LLaMA-3.1-8B</td>
<td class="tg-0lax">65.27|<strong>66.88</strong>|98.46|71.45</td>
</tr>
<tr>
<td class="tg-0lax">MERaLiON</td>
<td class="tg-0lax">27.23|62.93|94.81|62.91</td>
</tr>
<tr>
<td class="tg-0lax">Megrez-3B-Omni</td>
<td class="tg-0lax">28.35|25.71|87.69|46.25</td>
</tr>
<tr>
<td class="tg-0lax">Lyra-Base</td>
<td class="tg-0lax">72.75|36.28|59.62|57.66</td>
</tr>
<tr>
<td class="tg-0lax">MiniCPM-o</td>
<td class="tg-0lax">78.02|49.25|97.69|71.69</td>
</tr>
<tr>
<td class="tg-0lax">Baichuan-Omni-1.5</td>
<td class="tg-0lax">74.51|54.54|97.31|71.14</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2-Audio</td>
<td class="tg-0lax">49.45|26.33|96.73|55.35</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B</td>
<td class="tg-0lax">74.73|42.10|98.85|68.81</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B</td>
<td class="tg-0lax"><strong>81.10</strong>|52.87|<strong>99.42</strong>|<strong>74.12</strong></td>
</tr>
</tbody></table>
</details>
<details>
<summary>Image -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|--------------------------------|--------------|------------|------------|---------------|-------------|
| MMMU<sub>val</sub> | 59.2 | 53.1 | 53.9 | 58.6 | **60.0** |
| MMMU-Pro<sub>overall</sub> | 36.6 | 29.7 | - | **38.3** | 37.6 |
| MathVista<sub>testmini</sub> | 67.9 | 59.4 | **71.9** | 68.2 | 52.5 |
| MathVision<sub>full</sub> | 25.0 | 20.8 | 23.1 | **25.1** | - |
| MMBench-V1.1-EN<sub>test</sub> | 81.8 | 77.8 | 80.5 | **82.6** | 76.0 |
| MMVet<sub>turbo</sub> | 66.8 | 62.1 | **67.5** | 67.1 | 66.9 |
| MMStar | **64.0** | 55.7 | **64.0** | 63.9 | 54.8 |
| MME<sub>sum</sub> | 2340 | 2117 | **2372** | 2347 | 2003 |
| MuirBench | 59.2 | 48.0 | - | **59.2** | - |
| CRPE<sub>relation</sub> | **76.5** | 73.7 | - | 76.4 | - |
| RealWorldQA<sub>avg</sub> | 70.3 | 62.6 | **71.9** | 68.5 | - |
| MME-RealWorld<sub>en</sub> | **61.6** | 55.6 | - | 57.4 | - |
| MM-MT-Bench | 6.0 | 5.0 | - | **6.3** | - |
| AI2D | 83.2 | 79.5 | **85.8** | 83.9 | - |
| TextVQA<sub>val</sub> | 84.4 | 79.8 | 83.2 | **84.9** | - |
| DocVQA<sub>test</sub> | 95.2 | 93.3 | 93.5 | **95.7** | - |
| ChartQA<sub>test Avg</sub> | 85.3 | 82.8 | 84.9 | **87.3** | - |
| OCRBench_V2<sub>en</sub> | **57.8** | 51.7 | - | 56.3 | - |
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-VL-7B | Grounding DINO | Gemini 1.5 Pro |
|--------------------------|--------------|---------------|---------------|----------------|----------------|
| Refcoco<sub>val</sub> | 90.5 | 88.7 | 90.0 | **90.6** | 73.2 |
| Refcoco<sub>textA</sub> | **93.5** | 91.8 | 92.5 | 93.2 | 72.9 |
| Refcoco<sub>textB</sub> | 86.6 | 84.0 | 85.4 | **88.2** | 74.6 |
| Refcoco+<sub>val</sub> | 85.4 | 81.1 | 84.2 | **88.2** | 62.5 |
| Refcoco+<sub>textA</sub> | **91.0** | 87.5 | 89.1 | 89.0 | 63.9 |
| Refcoco+<sub>textB</sub> | **79.3** | 73.2 | 76.9 | 75.9 | 65.0 |
| Refcocog+<sub>val</sub> | **87.4** | 85.0 | 87.2 | 86.1 | 75.2 |
| Refcocog+<sub>test</sub> | **87.9** | 85.1 | 87.2 | 87.0 | 76.2 |
| ODinW | 42.4 | 39.2 | 37.3 | **55.0** | 36.7 |
| PointGrounding | 66.5 | 46.2 | **67.3** | - | - |
</details>
<details>
<summary>Video(without audio) -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Other Best | Qwen2.5-VL-7B | GPT-4o-mini |
|-----------------------------|--------------|------------|------------|---------------|-------------|
| Video-MME<sub>w/o sub</sub> | 64.3 | 62.0 | 63.9 | **65.1** | 64.8 |
| Video-MME<sub>w sub</sub> | **72.4** | 68.6 | 67.9 | 71.6 | - |
| MVBench | **70.3** | 68.7 | 67.2 | 69.6 | - |
| EgoSchema<sub>test</sub> | **68.6** | 61.4 | 63.2 | 65.0 | - |
</details>
<details>
<summary>Zero-shot Speech Generation</summary>
<table class="tg"><thead>
<tr>
<th class="tg-0lax">Datasets</th>
<th class="tg-0lax">Model</th>
<th class="tg-0lax">Performance</th>
</tr></thead>
<tbody>
<tr>
<td class="tg-9j4x" colspan="3">Content Consistency</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">1.11 | 2.24 | 7.58</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>1.00</strong> | 1.94 | <strong>6.42</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">2.27 | 2.62 | 10.27</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">1.97 | 2.19 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">1.56 | <strong>1.83</strong> | 8.67</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">1.45 | 2.57 | 6.83</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">1.45 | 2.38 | 8.08</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">1.95 | 2.87 | 9.92</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">1.58 | 2.51 | 7.86</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">1.70 | 2.72 | 7.97</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">1.42 | 2.32 | 6.54</td>
</tr>
<tr>
<td class="tg-9j4x" colspan="3">Speaker Similarity</td>
</tr>
<tr>
<td class="tg-0lax" rowspan="11">SEED<br>test-zh | test-en | test-hard </td>
<td class="tg-0lax">Seed-TTS_ICL</td>
<td class="tg-0lax">0.796 | 0.762 | 0.776</td>
</tr>
<tr>
<td class="tg-0lax">Seed-TTS_RL</td>
<td class="tg-0lax"><strong>0.801</strong> | <strong>0.766</strong> | <strong>0.782</strong></td>
</tr>
<tr>
<td class="tg-0lax">MaskGCT</td>
<td class="tg-0lax">0.774 | 0.714 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">E2_TTS</td>
<td class="tg-0lax">0.730 | 0.710 | -</td>
</tr>
<tr>
<td class="tg-0lax">F5-TTS</td>
<td class="tg-0lax">0.741 | 0.647 | 0.713</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2</td>
<td class="tg-0lax">0.748 | 0.652 | 0.724</td>
</tr>
<tr>
<td class="tg-0lax">CosyVoice 2-S</td>
<td class="tg-0lax">0.753 | 0.654 | 0.732</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_ICL</td>
<td class="tg-0lax">0.741 | 0.635 | 0.748</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-3B_RL</td>
<td class="tg-0lax">0.744 | 0.635 | 0.746</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_ICL</td>
<td class="tg-0lax">0.752 | 0.632 | 0.747</td>
</tr>
<tr>
<td class="tg-0lax">Qwen2.5-Omni-7B_RL</td>
<td class="tg-0lax">0.754 | 0.641 | 0.752</td>
</tr>
</tbody></table>
</details>
<details>
<summary>Text -> Text</summary>
| Dataset | Qwen2.5-Omni-7B | Qwen2.5-Omni-3B | Qwen2.5-7B | Qwen2.5-3B | Qwen2-7B | Llama3.1-8B | Gemma2-9B |
|-----------------------------------|-----------|------------|------------|------------|------------|-------------|-----------|
| MMLU-Pro | 47.0 | 40.4 | **56.3** | 43.7 | 44.1 | 48.3 | 52.1 |
| MMLU-redux | 71.0 | 60.9 | **75.4** | 64.4 | 67.3 | 67.2 | 72.8 |
| LiveBench<sub>0831</sub> | 29.6 | 22.3 | **35.9** | 26.8 | 29.2 | 26.7 | 30.6 |
| GPQA | 30.8 | 34.3 | **36.4** | 30.3 | 34.3 | 32.8 | 32.8 |
| MATH | 71.5 | 63.6 | **75.5** | 65.9 | 52.9 | 51.9 | 44.3 |
| GSM8K | 88.7 | 82.6 | **91.6** | 86.7 | 85.7 | 84.5 | 76.7 |
| HumanEval | 78.7 | 70.7 | **84.8** | 74.4 | 79.9 | 72.6 | 68.9 |
| MBPP | 73.2 | 70.4 | **79.2** | 72.7 | 67.2 | 69.6 | 74.9 |
| MultiPL-E | 65.8 | 57.6 | **70.4** | 60.2 | 59.1 | 50.7 | 53.4 |
| LiveCodeBench<sub>2305-2409</sub> | 24.6 | 16.5 | **28.7** | 19.9 | 23.9 | 8.3 | 18.9 |
</details>
## Quickstart
Below, we provide simple examples to show how to use Qwen2.5-Omni with 🤗 Transformers. The codes of Qwen2.5-Omni has been in the latest Hugging face transformers and we advise you to build from source with command:
```
pip uninstall transformers
pip install git+https://github.com/huggingface/[email protected]
pip install accelerate
```
or you might encounter the following error:
```
KeyError: 'qwen2_5_omni'
```
We offer a toolkit to help you handle various types of audio and visual input more conveniently, as if you were using an API. This includes base64, URLs, and interleaved audio, images and videos. You can install it using the following command and make sure your system has `ffmpeg` installed:
```bash
# It's highly recommended to use `[decord]` feature for faster video loading.
pip install qwen-omni-utils[decord] -U
```
If you are not using Linux, you might not be able to install `decord` from PyPI. In that case, you can use `pip install qwen-omni-utils -U` which will fall back to using torchvision for video processing. However, you can still [install decord from source](https://github.com/dmlc/decord?tab=readme-ov-file#install-from-source) to get decord used when loading video.
### 🤗 Transformers Usage
Here we show a code snippet to show you how to use the chat model with `transformers` and `qwen_omni_utils`:
```python
import soundfile as sf
from transformers import Qwen2_5OmniForConditionalGeneration, Qwen2_5OmniProcessor
from qwen_omni_utils import process_mm_info
# default: Load the model on the available device(s)
model = Qwen2_5OmniForConditionalGeneration.from_pretrained("Qwen/Qwen2.5-Omni-3B", torch_dtype="auto", device_map="auto")
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
# "Qwen/Qwen2.5-Omni-3B",
# torch_dtype="auto",
# device_map="auto",
# attn_implementation="flash_attention_2",
# )
processor = Qwen2_5OmniProcessor.from_pretrained("Qwen/Qwen2.5-Omni-3B")
conversation = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "https://qianwen-res.oss-cn-beijing.aliyuncs.com/Qwen2.5-Omni/draw.mp4"},
],
},
]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for inference
text = processor.apply_chat_template(conversation, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversation, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Inference: Generation of the output text and audio
text_ids, audio = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
sf.write(
"output.wav",
audio.reshape(-1).detach().cpu().numpy(),
samplerate=24000,
)
```
<details>
<summary>Minimum GPU memory requirements</summary>
|Model | Precision | 15(s) Video | 30(s) Video | 60(s) Video |
|--------------|-----------| ------------- | ------------- | ------------------ |
| Qwen-Omni-3B | FP32 | 89.10 GB | Not Recommend | Not Recommend |
| Qwen-Omni-3B | BF16 | 18.38 GB | 22.43 GB | 28.22 GB |
| Qwen-Omni-7B | FP32 | 93.56 GB | Not Recommend | Not Recommend |
| Qwen-Omni-7B | BF16 | 31.11 GB | 41.85 GB | 60.19 GB |
Note: The table above presents the theoretical minimum memory requirements for inference with `transformers` and `BF16` is test with `attn_implementation="flash_attention_2"`; however, in practice, the actual memory usage is typically at least 1.2 times higher. For more information, see the linked resource [here](https://huggingface.co/docs/accelerate/main/en/usage_guides/model_size_estimator).
</details>
<details>
<summary>Video URL resource usage</summary>
Video URL compatibility largely depends on the third-party library version. The details are in the table below. Change the backend by `FORCE_QWENVL_VIDEO_READER=torchvision` or `FORCE_QWENVL_VIDEO_READER=decord` if you prefer not to use the default one.
| Backend | HTTP | HTTPS |
|-------------|------|-------|
| torchvision >= 0.19.0 | ✅ | ✅ |
| torchvision < 0.19.0 | ❌ | ❌ |
| decord | ✅ | ❌ |
</details>
<details>
<summary>Batch inference</summary>
The model can batch inputs composed of mixed samples of various types such as text, images, audio and videos as input when `return_audio=False` is set. Here is an example.
```python
# Sample messages for batch inference
# Conversation with video only
conversation1 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "video", "video": "/path/to/video.mp4"},
]
}
]
# Conversation with audio only
conversation2 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "audio", "audio": "/path/to/audio.wav"},
]
}
]
# Conversation with pure text
conversation3 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": "who are you?"
}
]
# Conversation with mixed media
conversation4 = [
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
},
{
"role": "user",
"content": [
{"type": "image", "image": "/path/to/image.jpg"},
{"type": "video", "video": "/path/to/video.mp4"},
{"type": "audio", "audio": "/path/to/audio.wav"},
{"type": "text", "text": "What are the elements can you see and hear in these medias?"},
],
}
]
# Combine messages for batch processing
conversations = [conversation1, conversation2, conversation3, conversation4]
# set use audio in video
USE_AUDIO_IN_VIDEO = True
# Preparation for batch inference
text = processor.apply_chat_template(conversations, add_generation_prompt=True, tokenize=False)
audios, images, videos = process_mm_info(conversations, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt", padding=True, use_audio_in_video=USE_AUDIO_IN_VIDEO)
inputs = inputs.to(model.device).to(model.dtype)
# Batch Inference
text_ids = model.generate(**inputs, use_audio_in_video=USE_AUDIO_IN_VIDEO, return_audio=False)
text = processor.batch_decode(text_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)
print(text)
```
</details>
### Usage Tips
#### Prompt for audio output
If users need audio output, the system prompt must be set as "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech.", otherwise the audio output may not work as expected.
```
{
"role": "system",
"content": [
{"type": "text", "text": "You are Qwen, a virtual human developed by the Qwen Team, Alibaba Group, capable of perceiving auditory and visual inputs, as well as generating text and speech."}
],
}
```
#### Use audio in video
In the process of multimodal interaction, the videos provided by users are often accompanied by audio (such as questions about the content in the video, or sounds generated by certain events in the video). This information is conducive to the model providing a better interactive experience. So we provide the following options for users to decide whether to use audio in video.
```python
# first place, in data preprocessing
audios, images, videos = process_mm_info(conversations, use_audio_in_video=True)
```
```python
# second place, in model processor
inputs = processor(text=text, audio=audios, images=images, videos=videos, return_tensors="pt",
padding=True, use_audio_in_video=True)
```
```python
# third place, in model inference
text_ids, audio = model.generate(**inputs, use_audio_in_video=True)
```
It is worth noting that during a multi-round conversation, the `use_audio_in_video` parameter in these places must be set to the same, otherwise unexpected results will occur.
#### Use audio output or not
The model supports both text and audio outputs, if users do not need audio outputs, they can call `model.disable_talker()` after init the model. This option will save about `~2GB` of GPU memory but the `return_audio` option for `generate` function will only allow to be set at `False`.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
torch_dtype="auto",
device_map="auto"
)
model.disable_talker()
```
In order to obtain a flexible experience, we recommend that users can decide whether to return audio when `generate` function is called. If `return_audio` is set to `False`, the model will only return text outputs to get text responses faster.
```python
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
torch_dtype="auto",
device_map="auto"
)
...
text_ids = model.generate(**inputs, return_audio=False)
```
#### Change voice type of output audio
Qwen2.5-Omni supports the ability to change the voice of the output audio. The `"Qwen/Qwen2.5-Omni-3B"` checkpoint support two voice types as follow:
| Voice Type | Gender | Description |
|------------|--------|-------------|
| Chelsie | Female | A honeyed, velvety voice that carries a gentle warmth and luminous clarity.|
| Ethan | Male | A bright, upbeat voice with infectious energy and a warm, approachable vibe.|
Users can use the `speaker` parameter of `generate` function to specify the voice type. By default, if `speaker` is not specified, the default voice type is `Chelsie`.
```python
text_ids, audio = model.generate(**inputs, speaker="Chelsie")
```
```python
text_ids, audio = model.generate(**inputs, speaker="Ethan")
```
#### Flash-Attention 2 to speed up generation
First, make sure to install the latest version of Flash Attention 2:
```bash
pip install -U flash-attn --no-build-isolation
```
Also, you should have hardware that is compatible with FlashAttention 2. Read more about it in the official documentation of the [flash attention repository](https://github.com/Dao-AILab/flash-attention). FlashAttention-2 can only be used when a model is loaded in `torch.float16` or `torch.bfloat16`.
To load and run a model using FlashAttention-2, add `attn_implementation="flash_attention_2"` when loading the model:
```python
from transformers import Qwen2_5OmniForConditionalGeneration
model = Qwen2_5OmniForConditionalGeneration.from_pretrained(
"Qwen/Qwen2.5-Omni-3B",
device_map="auto",
torch_dtype=torch.bfloat16,
attn_implementation="flash_attention_2",
)
```
## Citation
If you find our paper and code useful in your research, please consider giving a star :star: and citation :pencil: :)
```BibTeX
@article{Qwen2.5-Omni,
title={Qwen2.5-Omni Technical Report},
author={Jin Xu, Zhifang Guo, Jinzheng He, Hangrui Hu, Ting He, Shuai Bai, Keqin Chen, Jialin Wang, Yang Fan, Kai Dang, Bin Zhang, Xiong Wang, Yunfei Chu, Junyang Lin},
journal={arXiv preprint arXiv:2503.20215},
year={2025}
}
```
<br>
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/Qwen3-Embedding-0.6B-GGUF | Mungert | 2025-06-15T19:36:34Z | 2,465 | 2 | sentence-transformers | [
"sentence-transformers",
"gguf",
"transformers",
"sentence-similarity",
"feature-extraction",
"arxiv:2506.05176",
"base_model:Qwen/Qwen3-0.6B-Base",
"base_model:quantized:Qwen/Qwen3-0.6B-Base",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | feature-extraction | 2025-06-10T11:28:41Z | ---
license: apache-2.0
base_model:
- Qwen/Qwen3-0.6B-Base
tags:
- transformers
- sentence-transformers
- sentence-similarity
- feature-extraction
---
# <span style="color: #7FFF7F;">Qwen3-Embedding-0.6B GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`1f63e75f`](https://github.com/ggerganov/llama.cpp/commit/1f63e75f3b5dc7f44dbe63c8a41d23958fe95bc0).
# Qwen3-Embedding-0.6B
<p align="center">
<img src="https://qianwen-res.oss-accelerate-overseas.aliyuncs.com/logo_qwen3.png" width="400"/>
<p>
## Highlights
The Qwen3 Embedding model series is the latest proprietary model of the Qwen family, specifically designed for text embedding and ranking tasks. Building upon the dense foundational models of the Qwen3 series, it provides a comprehensive range of text embeddings and reranking models in various sizes (0.6B, 4B, and 8B). This series inherits the exceptional multilingual capabilities, long-text understanding, and reasoning skills of its foundational model. The Qwen3 Embedding series represents significant advancements in multiple text embedding and ranking tasks, including text retrieval, code retrieval, text classification, text clustering, and bitext mining.
**Exceptional Versatility**: The embedding model has achieved state-of-the-art performance across a wide range of downstream application evaluations. The 8B size embedding model ranks **No.1** in the MTEB multilingual leaderboard (as of June 5, 2025, score **70.58**), while the reranking model excels in various text retrieval scenarios.
**Comprehensive Flexibility**: The Qwen3 Embedding series offers a full spectrum of sizes (from 0.6B to 8B) for both embedding and reranking models, catering to diverse use cases that prioritize efficiency and effectiveness. Developers can seamlessly combine these two modules. Additionally, the embedding model allows for flexible vector definitions across all dimensions, and both embedding and reranking models support user-defined instructions to enhance performance for specific tasks, languages, or scenarios.
**Multilingual Capability**: The Qwen3 Embedding series offer support for over 100 languages, thanks to the multilingual capabilites of Qwen3 models. This includes various programming languages, and provides robust multilingual, cross-lingual, and code retrieval capabilities.
## Model Overview
**Qwen3-Embedding-0.6B** has the following features:
- Model Type: Text Embedding
- Supported Languages: 100+ Languages
- Number of Paramaters: 0.6B
- Context Length: 32k
- Embedding Dimension: Up to 1024, supports user-defined output dimensions ranging from 32 to 1024
For more details, including benchmark evaluation, hardware requirements, and inference performance, please refer to our [blog](https://qwenlm.github.io/blog/qwen3-embedding/), [GitHub](https://github.com/QwenLM/Qwen3-Embedding).
## Qwen3 Embedding Series Model list
| Model Type | Models | Size | Layers | Sequence Length | Embedding Dimension | MRL Support | Instruction Aware |
|------------------|----------------------|------|--------|-----------------|---------------------|-------------|----------------|
| Text Embedding | [Qwen3-Embedding-0.6B](https://huggingface.co/Qwen/Qwen3-Embedding-0.6B) | 0.6B | 28 | 32K | 1024 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-4B](https://huggingface.co/Qwen/Qwen3-Embedding-4B) | 4B | 36 | 32K | 2560 | Yes | Yes |
| Text Embedding | [Qwen3-Embedding-8B](https://huggingface.co/Qwen/Qwen3-Embedding-8B) | 8B | 36 | 32K | 4096 | Yes | Yes |
| Text Reranking | [Qwen3-Reranker-0.6B](https://huggingface.co/Qwen/Qwen3-Reranker-0.6B) | 0.6B | 28 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-4B](https://huggingface.co/Qwen/Qwen3-Reranker-4B) | 4B | 36 | 32K | - | - | Yes |
| Text Reranking | [Qwen3-Reranker-8B](https://huggingface.co/Qwen/Qwen3-Reranker-8B) | 8B | 36 | 32K | - | - | Yes |
> **Note**:
> - `MRL Support` indicates whether the embedding model supports custom dimensions for the final embedding.
> - `Instruction Aware` notes whether the embedding or reranking model supports customizing the input instruction according to different tasks.
> - Our evaluation indicates that, for most downstream tasks, using instructions (instruct) typically yields an improvement of 1% to 5% compared to not using them. Therefore, we recommend that developers create tailored instructions specific to their tasks and scenarios. In multilingual contexts, we also advise users to write their instructions in English, as most instructions utilized during the model training process were originally written in English.
## Usage
With Transformers versions earlier than 4.51.0, you may encounter the following error:
```
KeyError: 'qwen3'
```
### Sentence Transformers Usage
```python
# Requires transformers>=4.51.0
# Requires sentence-transformers>=2.7.0
from sentence_transformers import SentenceTransformer
# Load the model
model = SentenceTransformer("Qwen/Qwen3-Embedding-0.6B")
# We recommend enabling flash_attention_2 for better acceleration and memory saving,
# together with setting `padding_side` to "left":
# model = SentenceTransformer(
# "Qwen/Qwen3-Embedding-0.6B",
# model_kwargs={"attn_implementation": "flash_attention_2", "device_map": "auto"},
# tokenizer_kwargs={"padding_side": "left"},
# )
# The queries and documents to embed
queries = [
"What is the capital of China?",
"Explain gravity",
]
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun.",
]
# Encode the queries and documents. Note that queries benefit from using a prompt
# Here we use the prompt called "query" stored under `model.prompts`, but you can
# also pass your own prompt via the `prompt` argument
query_embeddings = model.encode(queries, prompt_name="query")
document_embeddings = model.encode(documents)
# Compute the (cosine) similarity between the query and document embeddings
similarity = model.similarity(query_embeddings, document_embeddings)
print(similarity)
# tensor([[0.7646, 0.1414],
# [0.1355, 0.6000]])
```
### Transformers Usage
```python
# Requires transformers>=4.51.0
import torch
import torch.nn.functional as F
from torch import Tensor
from transformers import AutoTokenizer, AutoModel
def last_token_pool(last_hidden_states: Tensor,
attention_mask: Tensor) -> Tensor:
left_padding = (attention_mask[:, -1].sum() == attention_mask.shape[0])
if left_padding:
return last_hidden_states[:, -1]
else:
sequence_lengths = attention_mask.sum(dim=1) - 1
batch_size = last_hidden_states.shape[0]
return last_hidden_states[torch.arange(batch_size, device=last_hidden_states.device), sequence_lengths]
def get_detailed_instruct(task_description: str, query: str) -> str:
return f'Instruct: {task_description}\nQuery:{query}'
# Each query must come with a one-sentence instruction that describes the task
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = [
get_detailed_instruct(task, 'What is the capital of China?'),
get_detailed_instruct(task, 'Explain gravity')
]
# No need to add instruction for retrieval documents
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun."
]
input_texts = queries + documents
tokenizer = AutoTokenizer.from_pretrained('Qwen/Qwen3-Embedding-0.6B', padding_side='left')
model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-0.6B')
# We recommend enabling flash_attention_2 for better acceleration and memory saving.
# model = AutoModel.from_pretrained('Qwen/Qwen3-Embedding-0.6B', attn_implementation="flash_attention_2", torch_dtype=torch.float16).cuda()
max_length = 8192
# Tokenize the input texts
batch_dict = tokenizer(
input_texts,
padding=True,
truncation=True,
max_length=max_length,
return_tensors="pt",
)
batch_dict.to(model.device)
outputs = model(**batch_dict)
embeddings = last_token_pool(outputs.last_hidden_state, batch_dict['attention_mask'])
# normalize embeddings
embeddings = F.normalize(embeddings, p=2, dim=1)
scores = (embeddings[:2] @ embeddings[2:].T)
print(scores.tolist())
# [[0.7645568251609802, 0.14142508804798126], [0.13549736142158508, 0.5999549627304077]]
```
### vLLM Usage
```python
# Requires vllm>=0.8.5
import torch
import vllm
from vllm import LLM
def get_detailed_instruct(task_description: str, query: str) -> str:
return f'Instruct: {task_description}\nQuery:{query}'
# Each query must come with a one-sentence instruction that describes the task
task = 'Given a web search query, retrieve relevant passages that answer the query'
queries = [
get_detailed_instruct(task, 'What is the capital of China?'),
get_detailed_instruct(task, 'Explain gravity')
]
# No need to add instruction for retrieval documents
documents = [
"The capital of China is Beijing.",
"Gravity is a force that attracts two bodies towards each other. It gives weight to physical objects and is responsible for the movement of planets around the sun."
]
input_texts = queries + documents
model = LLM(model="Qwen/Qwen3-Embedding-0.6B", task="embed")
outputs = model.embed(input_texts)
embeddings = torch.tensor([o.outputs.embedding for o in outputs])
scores = (embeddings[:2] @ embeddings[2:].T)
print(scores.tolist())
# [[0.7620252966880798, 0.14078938961029053], [0.1358368694782257, 0.6013815999031067]]
```
📌 **Tip**: We recommend that developers customize the `instruct` according to their specific scenarios, tasks, and languages. Our tests have shown that in most retrieval scenarios, not using an `instruct` on the query side can lead to a drop in retrieval performance by approximately 1% to 5%.
## Evaluation
### MTEB (Multilingual)
| Model | Size | Mean (Task) | Mean (Type) | Bitxt Mining | Class. | Clust. | Inst. Retri. | Multi. Class. | Pair. Class. | Rerank | Retri. | STS |
|----------------------------------|:-------:|:-------------:|:-------------:|:--------------:|:--------:|:--------:|:--------------:|:---------------:|:--------------:|:--------:|:--------:|:------:|
| NV-Embed-v2 | 7B | 56.29 | 49.58 | 57.84 | 57.29 | 40.80 | 1.04 | 18.63 | 78.94 | 63.82 | 56.72 | 71.10|
| GritLM-7B | 7B | 60.92 | 53.74 | 70.53 | 61.83 | 49.75 | 3.45 | 22.77 | 79.94 | 63.78 | 58.31 | 73.33|
| BGE-M3 | 0.6B | 59.56 | 52.18 | 79.11 | 60.35 | 40.88 | -3.11 | 20.1 | 80.76 | 62.79 | 54.60 | 74.12|
| multilingual-e5-large-instruct | 0.6B | 63.22 | 55.08 | 80.13 | 64.94 | 50.75 | -0.40 | 22.91 | 80.86 | 62.61 | 57.12 | 76.81|
| gte-Qwen2-1.5B-instruct | 1.5B | 59.45 | 52.69 | 62.51 | 58.32 | 52.05 | 0.74 | 24.02 | 81.58 | 62.58 | 60.78 | 71.61|
| gte-Qwen2-7b-Instruct | 7B | 62.51 | 55.93 | 73.92 | 61.55 | 52.77 | 4.94 | 25.48 | 85.13 | 65.55 | 60.08 | 73.98|
| text-embedding-3-large | - | 58.93 | 51.41 | 62.17 | 60.27 | 46.89 | -2.68 | 22.03 | 79.17 | 63.89 | 59.27 | 71.68|
| Cohere-embed-multilingual-v3.0 | - | 61.12 | 53.23 | 70.50 | 62.95 | 46.89 | -1.89 | 22.74 | 79.88 | 64.07 | 59.16 | 74.80|
| Gemini Embedding | - | 68.37 | 59.59 | 79.28 | 71.82 | 54.59 | 5.18 | **29.16** | 83.63 | 65.58 | 67.71 | 79.40|
| **Qwen3-Embedding-0.6B** | 0.6B | 64.33 | 56.00 | 72.22 | 66.83 | 52.33 | 5.09 | 24.59 | 80.83 | 61.41 | 64.64 | 76.17|
| **Qwen3-Embedding-4B** | 4B | 69.45 | 60.86 | 79.36 | 72.33 | 57.15 | **11.56** | 26.77 | 85.05 | 65.08 | 69.60 | 80.86|
| **Qwen3-Embedding-8B** | 8B | **70.58** | **61.69** | **80.89** | **74.00** | **57.65** | 10.06 | 28.66 | **86.40** | **65.63** | **70.88** | **81.08** |
> **Note**: For compared models, the scores are retrieved from MTEB online [leaderboard](https://huggingface.co/spaces/mteb/leaderboard) on May 24th, 2025.
### MTEB (Eng v2)
| MTEB English / Models | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retri. | STS | Summ. |
|--------------------------------|:--------:|:------------:|:------------:|:--------:|:--------:|:-------------:|:---------:|:--------:|:-------:|:-------:|
| multilingual-e5-large-instruct | 0.6B | 65.53 | 61.21 | 75.54 | 49.89 | 86.24 | 48.74 | 53.47 | 84.72 | 29.89 |
| NV-Embed-v2 | 7.8B | 69.81 | 65.00 | 87.19 | 47.66 | 88.69 | 49.61 | 62.84 | 83.82 | 35.21 |
| GritLM-7B | 7.2B | 67.07 | 63.22 | 81.25 | 50.82 | 87.29 | 49.59 | 54.95 | 83.03 | 35.65 |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.20 | 63.26 | 85.84 | 53.54 | 87.52 | 49.25 | 50.25 | 82.51 | 33.94 |
| stella_en_1.5B_v5 | 1.5B | 69.43 | 65.32 | 89.38 | 57.06 | 88.02 | 50.19 | 52.42 | 83.27 | 36.91 |
| gte-Qwen2-7B-instruct | 7.6B | 70.72 | 65.77 | 88.52 | 58.97 | 85.9 | 50.47 | 58.09 | 82.69 | 35.74 |
| gemini-embedding-exp-03-07 | - | 73.3 | 67.67 | 90.05 | 59.39 | 87.7 | 48.59 | 64.35 | 85.29 | 38.28 |
| **Qwen3-Embedding-0.6B** | 0.6B | 70.70 | 64.88 | 85.76 | 54.05 | 84.37 | 48.18 | 61.83 | 86.57 | 33.43 |
| **Qwen3-Embedding-4B** | 4B | 74.60 | 68.10 | 89.84 | 57.51 | 87.01 | 50.76 | 68.46 | 88.72 | 34.39 |
| **Qwen3-Embedding-8B** | 8B | 75.22 | 68.71 | 90.43 | 58.57 | 87.52 | 51.56 | 69.44 | 88.58 | 34.83 |
### C-MTEB (MTEB Chinese)
| C-MTEB | Param. | Mean(Task) | Mean(Type) | Class. | Clust. | Pair Class. | Rerank. | Retr. | STS |
|------------------|--------|------------|------------|--------|--------|-------------|---------|-------|-------|
| multilingual-e5-large-instruct | 0.6B | 58.08 | 58.24 | 69.80 | 48.23 | 64.52 | 57.45 | 63.65 | 45.81 |
| bge-multilingual-gemma2 | 9B | 67.64 | 75.31 | 59.30 | 86.67 | 68.28 | 73.73 | 55.19 | - |
| gte-Qwen2-1.5B-instruct | 1.5B | 67.12 | 67.79 | 72.53 | 54.61 | 79.5 | 68.21 | 71.86 | 60.05 |
| gte-Qwen2-7B-instruct | 7.6B | 71.62 | 72.19 | 75.77 | 66.06 | 81.16 | 69.24 | 75.70 | 65.20 |
| ritrieve_zh_v1 | 0.3B | 72.71 | 73.85 | 76.88 | 66.5 | 85.98 | 72.86 | 76.97 | 63.92 |
| **Qwen3-Embedding-0.6B** | 0.6B | 66.33 | 67.45 | 71.40 | 68.74 | 76.42 | 62.58 | 71.03 | 54.52 |
| **Qwen3-Embedding-4B** | 4B | 72.27 | 73.51 | 75.46 | 77.89 | 83.34 | 66.05 | 77.03 | 61.26 |
| **Qwen3-Embedding-8B** | 8B | 73.84 | 75.00 | 76.97 | 80.08 | 84.23 | 66.99 | 78.21 | 63.53 |
## Citation
If you find our work helpful, feel free to give us a cite.
```
@article{qwen3embedding,
title={Qwen3 Embedding: Advancing Text Embedding and Reranking Through Foundation Models},
author={Zhang, Yanzhao and Li, Mingxin and Long, Dingkun and Zhang, Xin and Lin, Huan and Yang, Baosong and Xie, Pengjun and Yang, An and Liu, Dayiheng and Lin, Junyang and Huang, Fei and Zhou, Jingren},
journal={arXiv preprint arXiv:2506.05176},
year={2025}
}
```
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/SmolVLM-Instruct-GGUF | Mungert | 2025-06-15T19:36:32Z | 1,023 | 2 | transformers | [
"transformers",
"gguf",
"image-text-to-text",
"en",
"dataset:HuggingFaceM4/the_cauldron",
"dataset:HuggingFaceM4/Docmatix",
"arxiv:2504.05299",
"base_model:HuggingFaceTB/SmolLM2-1.7B-Instruct",
"base_model:quantized:HuggingFaceTB/SmolLM2-1.7B-Instruct",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | image-text-to-text | 2025-06-09T10:05:04Z | ---
library_name: transformers
license: apache-2.0
datasets:
- HuggingFaceM4/the_cauldron
- HuggingFaceM4/Docmatix
pipeline_tag: image-text-to-text
language:
- en
base_model:
- HuggingFaceTB/SmolLM2-1.7B-Instruct
- google/siglip-so400m-patch14-384
---
# <span style="color: #7FFF7F;">SmolVLM-Instruct GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`5787b5da`](https://github.com/ggerganov/llama.cpp/commit/5787b5da57e54dba760c2deeac1edf892e8fc450).
## <span style="color: #7FFF7F;"> Quantization beyond the IMatrix</span>
Testing a new quantization method using rules to bump important layers above what the standard imatrix would use.
I have found that the standard IMatrix does not perform very well at low bit quantiztion and for MOE models. So I am using llama.cpp --tensor-type to bump up selected layers. See [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
This does create larger model files but increases precision for a given model size.
### **Please provide feedback on how you find this method performs**
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Hybrid Precision Models (e.g., `bf16_q8_0`, `f16_q4_K`) – Best of Both Worlds**
These formats selectively **quantize non-essential layers** while keeping **key layers in full precision** (e.g., attention and output layers).
- Named like `bf16_q8_0` (meaning **full-precision BF16 core layers + quantized Q8_0 other layers**).
- Strike a **balance between memory efficiency and accuracy**, improving over fully quantized models without requiring the full memory of BF16/F16.
📌 **Use Hybrid Models if:**
✔ You need **better accuracy than quant-only models** but can’t afford full BF16/F16 everywhere.
✔ Your device supports **mixed-precision inference**.
✔ You want to **optimize trade-offs** for production-grade models on constrained hardware.
📌 **Avoid Hybrid Models if:**
❌ Your target device doesn’t support **mixed or full-precision acceleration**.
❌ You are operating under **ultra-strict memory limits** (in which case use fully quantized formats).
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **very high memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **very high memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
### **Ultra Low-Bit Quantization (IQ1_S IQ1_M IQ2_S IQ2_M IQ2_XS IQ2_XSS)**
- *Ultra-low-bit quantization (1 2-bit) with **extreme memory efficiency**.
- **Use case**: Best for cases were you have to fit the model into very constrained memory
- **Trade-off**: Very Low Accuracy. May not function as expected. Please test fully before using.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------------------|------------------|------------------|----------------------------------|--------------------------------------------------------------|
| **BF16** | Very High | High | BF16-supported GPU/CPU | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported GPU/CPU | Inference when BF16 isn’t available |
| **Q4_K** | Medium-Low | Low | CPU or Low-VRAM devices | Memory-constrained inference |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy with quantization |
| **Q8_0** | High | Moderate | GPU/CPU with moderate VRAM | Highest accuracy among quantized models |
| **IQ3_XS** | Low | Very Low | Ultra-low-memory devices | Max memory efficiency, low accuracy |
| **IQ3_S** | Low | Very Low | Low-memory devices | Slightly more usable than IQ3_XS |
| **IQ3_M** | Low-Medium | Low | Low-memory devices | Better accuracy than IQ3_S |
| **Q4_0** | Low | Low | ARM-based/embedded devices | Llama.cpp automatically optimizes for ARM inference |
| **Ultra Low-Bit (IQ1/2_*)** | Very Low | Extremely Low | Tiny edge/embedded devices | Fit models in extremely tight memory; low accuracy |
| **Hybrid (e.g., `bf16_q8_0`)** | Medium–High | Medium | Mixed-precision capable hardware | Balanced performance and memory, near-FP accuracy in critical layers |
---
<img src="https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/SmolVLM.png" width="800" height="auto" alt="Image description">
# SmolVLM
SmolVLM is a compact open multimodal model that accepts arbitrary sequences of image and text inputs to produce text outputs. Designed for efficiency, SmolVLM can answer questions about images, describe visual content, create stories grounded on multiple images, or function as a pure language model without visual inputs. Its lightweight architecture makes it suitable for on-device applications while maintaining strong performance on multimodal tasks.
## Model Summary
- **Developed by:** Hugging Face 🤗
- **Model type:** Multi-modal model (image+text)
- **Language(s) (NLP):** English
- **License:** Apache 2.0
- **Architecture:** Based on [Idefics3](https://huggingface.co/HuggingFaceM4/Idefics3-8B-Llama3) (see technical summary)
## Resources
- **Demo:** [SmolVLM Demo](https://huggingface.co/spaces/HuggingFaceTB/SmolVLM)
- **Blog:** [Blog post](https://huggingface.co/blog/smolvlm)
## Uses
SmolVLM can be used for inference on multimodal (image + text) tasks where the input comprises text queries along with one or more images. Text and images can be interleaved arbitrarily, enabling tasks like image captioning, visual question answering, and storytelling based on visual content. The model does not support image generation.
To fine-tune SmolVLM on a specific task, you can follow the fine-tuning tutorial.
<!-- todo: add link to fine-tuning tutorial -->
### Technical Summary
SmolVLM leverages the lightweight SmolLM2 language model to provide a compact yet powerful multimodal experience. It introduces several changes compared to previous Idefics models:
- **Image compression:** We introduce a more radical image compression compared to Idefics3 to enable the model to infer faster and use less RAM.
- **Visual Token Encoding:** SmolVLM uses 81 visual tokens to encode image patches of size 384×384. Larger images are divided into patches, each encoded separately, enhancing efficiency without compromising performance.
More details about the training and architecture are available in our technical report.
### How to get started
You can use transformers to load, infer and fine-tune SmolVLM.
```python
import torch
from PIL import Image
from transformers import AutoProcessor, AutoModelForVision2Seq
from transformers.image_utils import load_image
DEVICE = "cuda" if torch.cuda.is_available() else "cpu"
# Load images
image1 = load_image("https://cdn.britannica.com/61/93061-050-99147DCE/Statue-of-Liberty-Island-New-York-Bay.jpg")
image2 = load_image("https://huggingface.co/spaces/merve/chameleon-7b/resolve/main/bee.jpg")
# Initialize processor and model
processor = AutoProcessor.from_pretrained("HuggingFaceTB/SmolVLM-Instruct")
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
torch_dtype=torch.bfloat16,
_attn_implementation="flash_attention_2" if DEVICE == "cuda" else "eager",
).to(DEVICE)
# Create input messages
messages = [
{
"role": "user",
"content": [
{"type": "image"},
{"type": "image"},
{"type": "text", "text": "Can you describe the two images?"}
]
},
]
# Prepare inputs
prompt = processor.apply_chat_template(messages, add_generation_prompt=True)
inputs = processor(text=prompt, images=[image1, image2], return_tensors="pt")
inputs = inputs.to(DEVICE)
# Generate outputs
generated_ids = model.generate(**inputs, max_new_tokens=500)
generated_texts = processor.batch_decode(
generated_ids,
skip_special_tokens=True,
)
print(generated_texts[0])
"""
Assistant: The first image shows a green statue of the Statue of Liberty standing on a stone pedestal in front of a body of water.
The statue is holding a torch in its right hand and a tablet in its left hand. The water is calm and there are no boats or other objects visible.
The sky is clear and there are no clouds. The second image shows a bee on a pink flower.
The bee is black and yellow and is collecting pollen from the flower. The flower is surrounded by green leaves.
"""
```
### Model optimizations
**Precision**: For better performance, load and run the model in half-precision (`torch.float16` or `torch.bfloat16`) if your hardware supports it.
```python
from transformers import AutoModelForVision2Seq
import torch
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
torch_dtype=torch.bfloat16
).to("cuda")
```
You can also load SmolVLM with 4/8-bit quantization using bitsandbytes, torchao or Quanto. Refer to [this page](https://huggingface.co/docs/transformers/en/main_classes/quantization) for other options.
```python
from transformers import AutoModelForVision2Seq, BitsAndBytesConfig
import torch
quantization_config = BitsAndBytesConfig(load_in_8bit=True)
model = AutoModelForVision2Seq.from_pretrained(
"HuggingFaceTB/SmolVLM-Instruct",
quantization_config=quantization_config,
)
```
**Vision Encoder Efficiency**: Adjust the image resolution by setting `size={"longest_edge": N*384}` when initializing the processor, where N is your desired value. The default `N=4` works well, which results in input images of
size 1536×1536. For documents, `N=5` might be beneficial. Decreasing N can save GPU memory and is appropriate for lower-resolution images. This is also useful if you want to fine-tune on videos.
## Misuse and Out-of-scope Use
SmolVLM is not intended for high-stakes scenarios or critical decision-making processes that affect an individual's well-being or livelihood. The model may produce content that appears factual but may not be accurate. Misuse includes, but is not limited to:
- Prohibited Uses:
- Evaluating or scoring individuals (e.g., in employment, education, credit)
- Critical automated decision-making
- Generating unreliable factual content
- Malicious Activities:
- Spam generation
- Disinformation campaigns
- Harassment or abuse
- Unauthorized surveillance
### License
SmolVLM is built upon [the shape-optimized SigLIP](https://huggingface.co/google/siglip-so400m-patch14-384) as image encoder and [SmolLM2](https://huggingface.co/HuggingFaceTB/SmolLM2-1.7B-Instruct) for text decoder part.
We release the SmolVLM checkpoints under the Apache 2.0 license.
## Training Details
### Training Data
The training data comes from [The Cauldron](https://huggingface.co/datasets/HuggingFaceM4/the_cauldron) and [Docmatix](https://huggingface.co/datasets/HuggingFaceM4/Docmatix) datasets, with emphasis on document understanding (25%) and image captioning (18%), while maintaining balanced coverage across other crucial capabilities like visual reasoning, chart comprehension, and general instruction following.
<img src="https://huggingface.co/HuggingFaceTB/SmolVLM-Instruct/resolve/main/mixture_the_cauldron.png" alt="Example Image" style="width:90%;" />
## Evaluation
| Model | MMMU (val) | MathVista (testmini) | MMStar (val) | DocVQA (test) | TextVQA (val) | Min GPU RAM required (GB) |
|-------------------|------------|----------------------|--------------|---------------|---------------|---------------------------|
| SmolVLM | 38.8 | 44.6 | 42.1 | 81.6 | 72.7 | 5.02 |
| Qwen-VL 2B | 41.1 | 47.8 | 47.5 | 90.1 | 79.7 | 13.70 |
| InternVL2 2B | 34.3 | 46.3 | 49.8 | 86.9 | 73.4 | 10.52 |
| PaliGemma 3B 448px| 34.9 | 28.7 | 48.3 | 32.2 | 56.0 | 6.72 |
| moondream2 | 32.4 | 24.3 | 40.3 | 70.5 | 65.2 | 3.87 |
| MiniCPM-V-2 | 38.2 | 39.8 | 39.1 | 71.9 | 74.1 | 7.88 |
| MM1.5 1B | 35.8 | 37.2 | 0.0 | 81.0 | 72.5 | NaN |
# Citation information
You can cite us in the following way:
```bibtex
@article{marafioti2025smolvlm,
title={SmolVLM: Redefining small and efficient multimodal models},
author={Andrés Marafioti and Orr Zohar and Miquel Farré and Merve Noyan and Elie Bakouch and Pedro Cuenca and Cyril Zakka and Loubna Ben Allal and Anton Lozhkov and Nouamane Tazi and Vaibhav Srivastav and Joshua Lochner and Hugo Larcher and Mathieu Morlon and Lewis Tunstall and Leandro von Werra and Thomas Wolf},
journal={arXiv preprint arXiv:2504.05299},
year={2025}
}
```
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
Mungert/medgemma-4b-it-GGUF | Mungert | 2025-06-15T19:36:18Z | 1,687 | 4 | transformers | [
"transformers",
"gguf",
"medical",
"radiology",
"clinical-reasoning",
"dermatology",
"pathology",
"ophthalmology",
"chest-x-ray",
"image-text-to-text",
"arxiv:2303.15343",
"arxiv:2405.03162",
"arxiv:2106.14463",
"arxiv:2412.03555",
"arxiv:2501.19393",
"arxiv:2009.13081",
"arxiv:2102.09542",
"arxiv:2411.15640",
"arxiv:2404.05590",
"arxiv:2501.18362",
"base_model:google/medgemma-4b-pt",
"base_model:quantized:google/medgemma-4b-pt",
"license:other",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | image-text-to-text | 2025-05-30T02:42:01Z | ---
license: other
license_name: health-ai-developer-foundations
license_link: https://developers.google.com/health-ai-developer-foundations/terms
library_name: transformers
pipeline_tag: image-text-to-text
extra_gated_heading: Access MedGemma on Hugging Face
extra_gated_prompt: >-
To access MedGemma on Hugging Face, you're required to review and
agree to [Health AI Developer Foundation's terms of use](https://developers.google.com/health-ai-developer-foundations/terms).
To do this, please ensure you're logged in to Hugging Face and click below.
Requests are processed immediately.
extra_gated_button_content: Acknowledge license
base_model: google/medgemma-4b-pt
tags:
- medical
- radiology
- clinical-reasoning
- dermatology
- pathology
- ophthalmology
- chest-x-ray
---
# <span style="color: #7FFF7F;">medgemma-4b-it GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`f5cd27b7`](https://github.com/ggerganov/llama.cpp/commit/f5cd27b71da3ac375a04a41643d14fc779a8057b).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `medgemma-4b-it-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `medgemma-4b-it-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `medgemma-4b-it-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `medgemma-4b-it-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `medgemma-4b-it-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `medgemma-4b-it-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `medgemma-4b-it-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `medgemma-4b-it-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `medgemma-4b-it-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `medgemma-4b-it-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `medgemma-4b-it-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# MedGemma model card
**Model documentation:** [MedGemma](https://developers.google.com/health-ai-developer-foundations/medgemma)
**Resources:**
* Model on Google Cloud Model Garden: [MedGemma](https://console.cloud.google.com/vertex-ai/publishers/google/model-garden/medgemma)
* Model on Hugging Face: [MedGemma](https://huggingface.co/collections/google/medgemma-release-680aade845f90bec6a3f60c4)
* GitHub repository (supporting code, Colab notebooks, discussions, and
issues): [MedGemma](https://github.com/google-health/medgemma)
* Quick start notebook: [GitHub](https://github.com/google-health/medgemma/blob/main/notebooks/quick_start_with_hugging_face.ipynb)
* Fine-tuning notebook: [GitHub](https://github.com/google-health/medgemma/blob/main/notebooks/fine_tune_with_hugging_face.ipynb)
* [Patient Education Demo built using MedGemma](https://huggingface.co/spaces/google/rad_explain)
* Support: See [Contact](https://developers.google.com/health-ai-developer-foundations/medgemma/get-started.md#contact)
* License: The use of MedGemma is governed by the [Health AI Developer
Foundations terms of
use](https://developers.google.com/health-ai-developer-foundations/terms).
**Author:** Google
## Model information
This section describes the MedGemma model and how to use it.
### Description
MedGemma is a collection of [Gemma 3](https://ai.google.dev/gemma/docs/core)
variants that are trained for performance on medical text and image
comprehension. Developers can use MedGemma to accelerate building
healthcare-based AI applications. MedGemma currently comes in two variants: a 4B
multimodal version and a 27B text-only version.
MedGemma 4B utilizes a [SigLIP](https://arxiv.org/abs/2303.15343) image encoder
that has been specifically pre-trained on a variety of de-identified medical
data, including chest X-rays, dermatology images, ophthalmology images, and
histopathology slides. Its LLM component is trained on a diverse set of medical
data, including radiology images, histopathology patches, ophthalmology images,
and dermatology images.
MedGemma 4B is available in both pre-trained (suffix: `-pt`) and
instruction-tuned (suffix `-it`) versions. The instruction-tuned version is a
better starting point for most applications. The pre-trained version is
available for those who want to experiment more deeply with the models.
MedGemma 27B has been trained exclusively on medical text and optimized for
inference-time computation. MedGemma 27B is only available as an
instruction-tuned model.
MedGemma variants have been evaluated on a range of clinically relevant
benchmarks to illustrate their baseline performance. These include both open
benchmark datasets and curated datasets. Developers can fine-tune MedGemma
variants for improved performance. Consult the Intended Use section below for
more details.
A full technical report will be available soon.
### How to use
Below are some example code snippets to help you quickly get started running the
model locally on GPU. If you want to use the model at scale, we recommend that
you create a production version using [Model
Garden](https://cloud.google.com/model-garden).
First, install the Transformers library. Gemma 3 is supported starting from
transformers 4.50.0.
```sh
$ pip install -U transformers
```
**Run model with the `pipeline` API**
```python
from transformers import pipeline
from PIL import Image
import requests
import torch
pipe = pipeline(
"image-text-to-text",
model="google/medgemma-4b-it",
torch_dtype=torch.bfloat16,
device="cuda",
)
# Image attribution: Stillwaterising, CC0, via Wikimedia Commons
image_url = "https://upload.wikimedia.org/wikipedia/commons/c/c8/Chest_Xray_PA_3-8-2010.png"
image = Image.open(requests.get(image_url, headers={"User-Agent": "example"}, stream=True).raw)
messages = [
{
"role": "system",
"content": [{"type": "text", "text": "You are an expert radiologist."}]
},
{
"role": "user",
"content": [
{"type": "text", "text": "Describe this X-ray"}
{"type": "image", "image": image},
]
}
]
output = pipe(text=messages, max_new_tokens=200)
print(output[0]["generated_text"][-1]["content"])
```
**Run the model directly**
```python
# pip install accelerate
from transformers import AutoProcessor, AutoModelForImageTextToText
from PIL import Image
import requests
import torch
model_id = "google/medgemma-4b-it"
model = AutoModelForImageTextToText.from_pretrained(
model_id,
torch_dtype=torch.bfloat16,
device_map="auto",
)
processor = AutoProcessor.from_pretrained(model_id)
# Image attribution: Stillwaterising, CC0, via Wikimedia Commons
image_url = "https://upload.wikimedia.org/wikipedia/commons/c/c8/Chest_Xray_PA_3-8-2010.png"
image = Image.open(requests.get(image_url, headers={"User-Agent": "example"}, stream=True).raw)
messages = [
{
"role": "system",
"content": [{"type": "text", "text": "You are an expert radiologist."}]
},
{
"role": "user",
"content": [
{"type": "text", "text": "Describe this X-ray"},
{"type": "image", "image": image}
]
}
]
inputs = processor.apply_chat_template(
messages, add_generation_prompt=True, tokenize=True,
return_dict=True, return_tensors="pt"
).to(model.device, dtype=torch.bfloat16)
input_len = inputs["input_ids"].shape[-1]
with torch.inference_mode():
generation = model.generate(**inputs, max_new_tokens=200, do_sample=False)
generation = generation[0][input_len:]
decoded = processor.decode(generation, skip_special_tokens=True)
print(decoded)
```
### Examples
See the following Colab notebooks for examples of how to use MedGemma:
* To give the model a quick try, running it locally with weights from Hugging
Face, see [Quick start notebook in
Colab](https://colab.research.google.com/github/google-health/medgemma/blob/main/notebooks/quick_start_with_hugging_face.ipynb).
Note that you will need to use Colab Enterprise to run the 27B model without
quantization.
* For an example of fine-tuning the model, see the [Fine-tuning notebook in
Colab](https://colab.research.google.com/github/google-health/medgemma/blob/main/notebooks/fine_tune_with_hugging_face.ipynb).
### Model architecture overview
The MedGemma model is built based on [Gemma 3](https://ai.google.dev/gemma/) and
uses the same decoder-only transformer architecture as Gemma 3. To read more
about the architecture, consult the Gemma 3 [model
card](https://ai.google.dev/gemma/docs/core/model_card_3).
### Technical specifications
* **Model type**: Decoder-only Transformer architecture, see the [Gemma 3
technical
report](https://storage.googleapis.com/deepmind-media/gemma/Gemma3Report.pdf)
* **Modalities**: **4B**: Text, vision; **27B**: Text only
* **Attention mechanism**: Utilizes grouped-query attention (GQA)
* **Context length**: Supports long context, at least 128K tokens
* **Key publication**: Coming soon
* **Model created**: May 20, 2025
* **Model version**: 1.0.0
### Citation
A technical report is coming soon. In the meantime, if you publish using this
model, please cite the Hugging Face model page:
```none
@misc{medgemma-hf,
author = {Google},
title = {MedGemma Hugging Face}
howpublished = {\url{https://huggingface.co/collections/google/medgemma-release-680aade845f90bec6a3f60c4}},
year = {2025},
note = {Accessed: [Insert Date Accessed, e.g., 2025-05-20]}
}
```
### Inputs and outputs
**Input**:
* Text string, such as a question or prompt
* Images, normalized to 896 x 896 resolution and encoded to 256 tokens each
* Total input length of 128K tokens
**Output**:
* Generated text in response to the input, such as an answer to a question,
analysis of image content, or a summary of a document
* Total output length of 8192 tokens
### Performance and validation
MedGemma was evaluated across a range of different multimodal classification,
report generation, visual question answering, and text-based tasks.
### Key performance metrics
#### Imaging evaluations
The multimodal performance of MedGemma 4B was evaluated across a range of
benchmarks, focusing on radiology, dermatology, histopathology, ophthalmology,
and multimodal clinical reasoning.
MedGemma 4B outperforms the base Gemma 3 4B model across all tested multimodal
health benchmarks.
| Task and metric | MedGemma 4B | Gemma 3 4B |
| :---- | :---- | :---- |
| **Medical image classification** | | |
| MIMIC CXR \- Average F1 for top 5 conditions | 88.9 | 81.1 |
| CheXpert CXR \- Average F1 for top 5 conditions | 48.1 | 31.2 |
| DermMCQA\* \- Accuracy | 71.8 | 42.6 |
| **Visual question answering** | | |
| SlakeVQA (radiology) \- Tokenized F1 | 62.3 | 38.6 |
| VQA-Rad\*\* (radiology) \- Tokenized F1 | 49.9 | 38.6 |
| PathMCQA (histopathology, internal\*\*\*) \- Accuracy | 69.8 | 37.1 |
| **Knowledge and reasoning** | | |
| MedXpertQA (text \+ multimodal questions) \- Accuracy | 18.8 | 16.4 |
*Described in [Liu (2020, Nature
medicine)](https://www.nature.com/articles/s41591-020-0842-3), presented as a
4-way MCQ per example for skin condition classification.
**Based on "balanced split," described in [Yang (2024,
arXiv)](https://arxiv.org/pdf/2405.03162).
***Based on multiple datasets, presented as 3-9 way MCQ per example for
identification, grading, and subtype for breast, cervical, and prostate cancer.
#### Chest X-ray report generation
MedGemma chest X-ray (CXR) report generation performance was evaluated on
[MIMIC-CXR](https://physionet.org/content/mimic-cxr/2.1.0/) using the [RadGraph
F1 metric](https://arxiv.org/abs/2106.14463). We compare the MedGemma
pre-trained checkpoint with our previous best model for CXR report generation,
[PaliGemma 2](https://arxiv.org/abs/2412.03555).
| Metric | MedGemma 4B (pre-trained) | PaliGemma 2 3B (tuned for CXR) | PaliGemma 2 10B (tuned for CXR) |
| :---- | :---- | :---- | :---- |
| **Chest X-ray report generation** | | | |
| MIMIC CXR \- RadGraph F1 | 29.5 | 28.8 | 29.5 |
The instruction-tuned versions of MedGemma 4B and Gemma 3 4B achieve lower
scores (0.22 and 0.12, respectively) due to the differences in reporting style
compared to the MIMIC ground truth reports. Further fine-tuning on MIMIC reports
will enable users to achieve improved performance.
#### Text evaluations
MedGemma 4B and text-only MedGemma 27B were evaluated across a range of
text-only benchmarks for medical knowledge and reasoning.
The MedGemma models outperform their respective base Gemma models across all
tested text-only health benchmarks.
| Metric | MedGemma 27B | Gemma 3 27B | MedGemma 4B | Gemma 3 4B |
| :---- | :---- | :---- | :---- | :---- |
| MedQA (4-op) | 89.8 (best-of-5) 87.7 (0-shot) | 74.9 | 64.4 | 50.7 |
| MedMCQA | 74.2 | 62.6 | 55.7 | 45.4 |
| PubMedQA | 76.8 | 73.4 | 73.4 | 68.4 |
| MMLU Med (text only) | 87.0 | 83.3 | 70.0 | 67.2 |
| MedXpertQA (text only) | 26.7 | 15.7 | 14.2 | 11.6 |
| AfriMed-QA | 84.0 | 72.0 | 52.0 | 48.0 |
For all MedGemma 27B results, [test-time
scaling](https://arxiv.org/abs/2501.19393) is used to improve performance.
### Ethics and safety evaluation
#### Evaluation approach
Our evaluation methods include structured evaluations and internal red-teaming
testing of relevant content policies. Red-teaming was conducted by a number of
different teams, each with different goals and human evaluation metrics. These
models were evaluated against a number of different categories relevant to
ethics and safety, including:
* **Child safety**: Evaluation of text-to-text and image-to-text prompts
covering child safety policies, including child sexual abuse and
exploitation.
* **Content safety:** Evaluation of text-to-text and image-to-text prompts
covering safety policies, including harassment, violence and gore, and hate
speech.
* **Representational harms**: Evaluation of text-to-text and image-to-text
prompts covering safety policies, including bias, stereotyping, and harmful
associations or inaccuracies.
* **General medical harms:** Evaluation of text-to-text and image-to-text
prompts covering safety policies, including information quality and harmful
associations or inaccuracies.
In addition to development level evaluations, we conduct "assurance evaluations"
which are our "arms-length" internal evaluations for responsibility governance
decision making. They are conducted separately from the model development team,
to inform decision making about release. High-level findings are fed back to the
model team, but prompt sets are held out to prevent overfitting and preserve the
results' ability to inform decision making. Notable assurance evaluation results
are reported to our Responsibility & Safety Council as part of release review.
#### Evaluation results
For all areas of safety testing, we saw safe levels of performance across the
categories of child safety, content safety, and representational harms. All
testing was conducted without safety filters to evaluate the model capabilities
and behaviors. For text-to-text, image-to-text, and audio-to-text, and across
both MedGemma model sizes, the model produced minimal policy violations. A
limitation of our evaluations was that they included primarily English language
prompts.
## Data card
### Dataset overview
#### Training
The base Gemma models are pre-trained on a large corpus of text and code data.
MedGemma 4B utilizes a [SigLIP](https://arxiv.org/abs/2303.15343) image encoder
that has been specifically pre-trained on a variety of de-identified medical
data, including radiology images, histopathology images, ophthalmology images,
and dermatology images. Its LLM component is trained on a diverse set of medical
data, including medical text relevant to radiology images, chest-x rays,
histopathology patches, ophthalmology images and dermatology images.
#### Evaluation
MedGemma models have been evaluated on a comprehensive set of clinically
relevant benchmarks, including over 22 datasets across 5 different tasks and 6
medical image modalities. These include both open benchmark datasets and curated
datasets, with a focus on expert human evaluations for tasks like CXR report
generation and radiology VQA.
#### Source
MedGemma utilizes a combination of public and private datasets.
This model was trained on diverse public datasets including MIMIC-CXR (chest
X-rays and reports), Slake-VQA (multimodal medical images and questions),
PAD-UFES-20 (skin lesion images and data), SCIN (dermatology images), TCGA
(cancer genomics data), CAMELYON (lymph node histopathology images), PMC-OA
(biomedical literature with images), and Mendeley Digital Knee X-Ray (knee
X-rays).
Additionally, multiple diverse proprietary datasets were licensed and
incorporated (described next).
### Data Ownership and Documentation
* [Mimic-CXR](https://physionet.org/content/mimic-cxr/2.1.0/): MIT Laboratory
for Computational Physiology and Beth Israel Deaconess Medical Center
(BIDMC).
* [Slake-VQA](https://www.med-vqa.com/slake/): The Hong Kong Polytechnic
University (PolyU), with collaborators including West China Hospital of
Sichuan University and Sichuan Academy of Medical Sciences / Sichuan
Provincial People's Hospital.
* [PAD-UFES-20](https://pmc.ncbi.nlm.nih.gov/articles/PMC7479321/): Federal
University of Espírito Santo (UFES), Brazil, through its Dermatological and
Surgical Assistance Program (PAD).
* [SCIN](https://github.com/google-research-datasets/scin): A collaboration
between Google Health and Stanford Medicine.
* [TCGA](https://portal.gdc.cancer.gov/) (The Cancer Genome Atlas): A joint
effort of National Cancer Institute and National Human Genome Research
Institute. Data from TCGA are available via the Genomic Data Commons (GDC)
* [CAMELYON](https://camelyon17.grand-challenge.org/Data/): The data was
collected from Radboud University Medical Center and University Medical
Center Utrecht in the Netherlands.
* [PMC-OA (PubMed Central Open Access
Subset)](https://catalog.data.gov/dataset/pubmed-central-open-access-subset-pmc-oa):
Maintained by the National Library of Medicine (NLM) and National Center for
Biotechnology Information (NCBI), which are part of the NIH.
* [MedQA](https://arxiv.org/pdf/2009.13081): This dataset was created by a
team of researchers led by Di Jin, Eileen Pan, Nassim Oufattole, Wei-Hung
Weng, Hanyi Fang, and Peter Szolovits
* [Mendeley Digital Knee
X-Ray](https://data.mendeley.com/datasets/t9ndx37v5h/1): This dataset is
from Rani Channamma University, and is hosted on Mendeley Data.
* [AfriMed-QA](https://afrimedqa.com/): This data was developed and led by
multiple collaborating organizations and researchers include key
contributors: Intron Health, SisonkeBiotik, BioRAMP, Georgia Institute of
Technology, and MasakhaneNLP.
* [VQA-RAD](https://www.nature.com/articles/sdata2018251): This dataset was
created by a research team led by Jason J. Lau, Soumya Gayen, Asma Ben
Abacha, and Dina Demner-Fushman and their affiliated institutions (the US
National Library of Medicine and National Institutes of Health)
* [MedExpQA](https://www.sciencedirect.com/science/article/pii/S0933365724001805):
This dataset was created by researchers at the HiTZ Center (Basque Center
for Language Technology and Artificial Intelligence).
* [MedXpertQA](https://huggingface.co/datasets/TsinghuaC3I/MedXpertQA): This
dataset was developed by researchers at Tsinghua University (Beijing, China)
and Shanghai Artificial Intelligence Laboratory (Shanghai, China).
In addition to the public datasets listed above, MedGemma was also trained on
de-identified datasets licensed for research or collected internally at Google
from consented participants.
* Radiology dataset 1: De-identified dataset of different CT studies across
body parts from a US-based radiology outpatient diagnostic center network.
* Ophthalmology dataset 1: De-identified dataset of fundus images from
diabetic retinopathy screening.
* Dermatology dataset 1: De-identified dataset of teledermatology skin
condition images (both clinical and dermatoscopic) from Colombia.
* Dermatology dataset 2: De-identified dataset of skin cancer images (both
clinical and dermatoscopic) from Australia.
* Dermatology dataset 3: De-identified dataset of non-diseased skin images
from an internal data collection effort.
* Pathology dataset 1: De-identified dataset of histopathology H&E whole slide
images created in collaboration with an academic research hospital and
biobank in Europe. Comprises de-identified colon, prostate, and lymph nodes.
* Pathology dataset 2: De-identified dataset of lung histopathology H&E and
IHC whole slide images created by a commercial biobank in the United States.
* Pathology dataset 3: De-identified dataset of prostate and lymph node H&E
and IHC histopathology whole slide images created by a contract research
organization in the United States.
* Pathology dataset 4: De-identified dataset of histopathology, predominantly
H\&E whole slide images created in collaboration with a large, tertiary
teaching hospital in the United States. Comprises a diverse set of tissue
and stain types, predominantly H&E.
### Data citation
* **MIMIC-CXR** Johnson, A., Pollard, T., Mark, R., Berkowitz, S., & Horng, S.
(2024). MIMIC-CXR Database (version 2.1.0). PhysioNet.
https://physionet.org/content/mimic-cxr/2.1.0/
*and* Johnson, Alistair E. W., Tom J. Pollard, Seth J. Berkowitz, Nathaniel R.
Greenbaum, Matthew P. Lungren, Chih-Ying Deng, Roger G. Mark, and Steven
Horng. 2019. "MIMIC-CXR, a de-Identified Publicly Available Database of
Chest Radiographs with Free-Text Reports." *Scientific Data 6* (1): 1–8.
* **SLAKE** Liu, Bo, Li-Ming Zhan, Li Xu, Lin Ma, Yan Yang, and Xiao-Ming Wu.
2021.SLAKE: A Semantically-Labeled Knowledge-Enhanced Dataset for Medical
Visual Question Answering." http://arxiv.org/abs/2102.09542.
* **PAD-UEFS** Pacheco, A. G. C., Lima, G. R., Salomao, A., Krohling, B.,
Biral, I. P., de Angelo, G. G., Alves, F. O. G., Ju X. M., & P. R. C.
(2020). PAD-UFES-20: A skin lesion dataset composed of patient data and
clinical images collected from smartphones. In *Proceedings of the 2020 IEEE
International Conference on Bioinformatics and Biomedicine (BIBM)* (pp.
1551-1558). IEEE. https://doi.org/10.1109/BIBM49941.2020.9313241
* **SCIN** Ward, Abbi, Jimmy Li, Julie Wang, Sriram Lakshminarasimhan, Ashley
Carrick, Bilson Campana, Jay Hartford, et al. 2024. "Creating an Empirical
Dermatology Dataset Through Crowdsourcing With Web Search Advertisements."
*JAMA Network Open 7* (11): e2446615–e2446615.
* **TCGA** The results shown here are in whole or part based upon data
generated by the TCGA Research Network: https://www.cancer.gov/tcga.
* **CAMELYON16** Ehteshami Bejnordi, Babak, Mitko Veta, Paul Johannes van
Diest, Bram van Ginneken, Nico Karssemeijer, Geert Litjens, Jeroen A. W. M.
van der Laak, et al. 2017. "Diagnostic Assessment of Deep Learning
Algorithms for Detection of Lymph Node Metastases in Women With Breast
Cancer." *JAMA 318* (22): 2199–2210.
* **MedQA** Jin, Di, Eileen Pan, Nassim Oufattole, Wei-Hung Weng, Hanyi Fang,
and Peter Szolovits. 2020. "What Disease Does This Patient Have? A
Large-Scale Open Domain Question Answering Dataset from Medical Exams."
http://arxiv.org/abs/2009.13081.
* **Mendeley Digital Knee X-Ray** Gornale, Shivanand; Patravali, Pooja (2020),
"Digital Knee X-ray Images", Mendeley Data, V1, doi: 10.17632/t9ndx37v5h.1
* **AfrimedQA** Olatunji, Tobi, Charles Nimo, Abraham Owodunni, Tassallah
Abdullahi, Emmanuel Ayodele, Mardhiyah Sanni, Chinemelu Aka, et al. 2024.
"AfriMed-QA: A Pan-African, Multi-Specialty, Medical Question-Answering
Benchmark Dataset." http://arxiv.org/abs/2411.15640.
* **VQA-RAD** Lau, Jason J., Soumya Gayen, Asma Ben Abacha, and Dina
Demner-Fushman. 2018. "A Dataset of Clinically Generated Visual Questions
and Answers about Radiology Images." *Scientific Data 5* (1): 1–10.
* **MedexpQA** Alonso, I., Oronoz, M., & Agerri, R. (2024). MedExpQA:
Multilingual Benchmarking of Large Language Models for Medical Question
Answering. *arXiv preprint arXiv:2404.05590*. Retrieved from
https://arxiv.org/abs/2404.05590
* **MedXpertQA** Zuo, Yuxin, Shang Qu, Yifei Li, Zhangren Chen, Xuekai Zhu,
Ermo Hua, Kaiyan Zhang, Ning Ding, and Bowen Zhou. 2025. "MedXpertQA:
Benchmarking Expert-Level Medical Reasoning and Understanding."
http://arxiv.org/abs/2501.18362.
### De-identification/anonymization:
Google and partnerships utilize datasets that have been rigorously anonymized or
de-identified to ensure the protection of individual research participants and
patient privacy
## Implementation information
Details about the model internals.
### Software
Training was done using [JAX](https://github.com/jax-ml/jax).
JAX allows researchers to take advantage of the latest generation of hardware,
including TPUs, for faster and more efficient training of large models.
## Use and limitations
### Intended use
MedGemma is an open multimodal generative AI model intended to be used as a
starting point that enables more efficient development of downstream healthcare
applications involving medical text and images. MedGemma is intended for
developers in the life sciences and healthcare space. Developers are responsible
for training, adapting and making meaningful changes to MedGemma to accomplish
their specific intended use. MedGemma models can be fine-tuned by developers
using their own proprietary data for their specific tasks or solutions.
MedGemma is based on Gemma 3 and has been further trained on medical images and
text. MedGemma enables further development in any medical context (image and
textual), however the model was pre-trained using chest X-ray, pathology,
dermatology, and fundus images. Examples of tasks within MedGemma's training
include visual question answering pertaining to medical images, such as
radiographs, or providing answers to textual medical questions. Full details of
all the tasks MedGemma has been evaluated can be found in an upcoming technical
report.
### Benefits
* Provides strong baseline medical image and text comprehension for models of
its size.
* This strong performance makes it efficient to adapt for downstream
healthcare-based use cases, compared to models of similar size without
medical data pre-training.
* This adaptation may involve prompt engineering, grounding, agentic
orchestration or fine-tuning depending on the use case, baseline validation
requirements, and desired performance characteristics.
### Limitations
MedGemma is not intended to be used without appropriate validation, adaptation
and/or making meaningful modification by developers for their specific use case.
The outputs generated by MedGemma are not intended to directly inform clinical
diagnosis, patient management decisions, treatment recommendations, or any other
direct clinical practice applications. Performance benchmarks highlight baseline
capabilities on relevant benchmarks, but even for image and text domains that
constitute a substantial portion of training data, inaccurate model output is
possible. All outputs from MedGemma should be considered preliminary and require
independent verification, clinical correlation, and further investigation
through established research and development methodologies.
MedGemma's multimodal capabilities have been primarily evaluated on single-image
tasks. MedGemma has not been evaluated in use cases that involve comprehension
of multiple images.
MedGemma has not been evaluated or optimized for multi-turn applications.
MedGemma's training may make it more sensitive to the specific prompt used than
Gemma 3.
When adapting MedGemma developer should consider the following:
* **Bias in validation data:** As with any research, developers should ensure
that any downstream application is validated to understand performance using
data that is appropriately representative of the intended use setting for
the specific application (e.g., age, sex, gender, condition, imaging device,
etc).
* **Data contamination concerns**: When evaluating the generalization
capabilities of a large model like MedGemma in a medical context, there is a
risk of data contamination, where the model might have inadvertently seen
related medical information during its pre-training, potentially
overestimating its true ability to generalize to novel medical concepts.
Developers should validate MedGemma on datasets not publicly available or
otherwise made available to non-institutional researchers to mitigate this
risk. |
Mungert/Foundation-Sec-8B-Instruct-GGUF | Mungert | 2025-06-15T19:36:09Z | 2,152 | 3 | null | [
"gguf",
"unsloth",
"trl",
"sft",
"en",
"dataset:yahma/alpaca-cleaned",
"arxiv:2504.21039",
"base_model:fdtn-ai/Foundation-Sec-8B",
"base_model:quantized:fdtn-ai/Foundation-Sec-8B",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"imatrix",
"conversational"
] | null | 2025-05-11T00:27:00Z | ---
license: apache-2.0
datasets:
- yahma/alpaca-cleaned
language:
- en
base_model:
- meta-llama/Llama-3.1-8B
- fdtn-ai/Foundation-Sec-8B
tags:
- unsloth
- trl
- sft
---
# <span style="color: #7FFF7F;">Foundation-Sec-8B-Instruct GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`8c83449`](https://github.com/ggerganov/llama.cpp/commit/8c83449cb780c201839653812681c3a4cf17feed).
## <span style="color: #7FFF7F;">Ultra-Low-Bit Quantization with IQ-DynamicGate (1-2 bit)</span>
Our latest quantization method introduces **precision-adaptive quantization** for ultra-low-bit models (1-2 bit), with benchmark-proven improvements on **Llama-3-8B**. This approach uses layer-specific strategies to preserve accuracy while maintaining extreme memory efficiency.
### **Benchmark Context**
All tests conducted on **Llama-3-8B-Instruct** using:
- Standard perplexity evaluation pipeline
- 2048-token context window
- Same prompt set across all quantizations
### **Method**
- **Dynamic Precision Allocation**:
- First/Last 25% of layers → IQ4_XS (selected layers)
- Middle 50% → IQ2_XXS/IQ3_S (increase efficiency)
- **Critical Component Protection**:
- Embeddings/output layers use Q5_K
- Reduces error propagation by 38% vs standard 1-2bit
### **Quantization Performance Comparison (Llama-3-8B)**
| Quantization | Standard PPL | DynamicGate PPL | Δ PPL | Std Size | DG Size | Δ Size | Std Speed | DG Speed |
|--------------|--------------|------------------|---------|----------|---------|--------|-----------|----------|
| IQ2_XXS | 11.30 | 9.84 | -12.9% | 2.5G | 2.6G | +0.1G | 234s | 246s |
| IQ2_XS | 11.72 | 11.63 | -0.8% | 2.7G | 2.8G | +0.1G | 242s | 246s |
| IQ2_S | 14.31 | 9.02 | -36.9% | 2.7G | 2.9G | +0.2G | 238s | 244s |
| IQ1_M | 27.46 | 15.41 | -43.9% | 2.2G | 2.5G | +0.3G | 206s | 212s |
| IQ1_S | 53.07 | 32.00 | -39.7% | 2.1G | 2.4G | +0.3G | 184s | 209s |
**Key**:
- PPL = Perplexity (lower is better)
- Δ PPL = Percentage change from standard to DynamicGate
- Speed = Inference time (CPU avx2, 2048 token context)
- Size differences reflect mixed quantization overhead
**Key Improvements:**
- 🔥 **IQ1_M** shows massive 43.9% perplexity reduction (27.46 → 15.41)
- 🚀 **IQ2_S** cuts perplexity by 36.9% while adding only 0.2GB
- ⚡ **IQ1_S** maintains 39.7% better accuracy despite 1-bit quantization
**Tradeoffs:**
- All variants have modest size increases (0.1-0.3GB)
- Inference speeds remain comparable (<5% difference)
### **When to Use These Models**
📌 **Fitting models into GPU VRAM**
✔ **Memory-constrained deployments**
✔ **Cpu and Edge Devices** where 1-2bit errors can be tolerated
✔ **Research** into ultra-low-bit quantization
## **Choosing the Right Model Format**
Selecting the correct model format depends on your **hardware capabilities** and **memory constraints**.
### **BF16 (Brain Float 16) – Use if BF16 acceleration is available**
- A 16-bit floating-point format designed for **faster computation** while retaining good precision.
- Provides **similar dynamic range** as FP32 but with **lower memory usage**.
- Recommended if your hardware supports **BF16 acceleration** (check your device's specs).
- Ideal for **high-performance inference** with **reduced memory footprint** compared to FP32.
📌 **Use BF16 if:**
✔ Your hardware has native **BF16 support** (e.g., newer GPUs, TPUs).
✔ You want **higher precision** while saving memory.
✔ You plan to **requantize** the model into another format.
📌 **Avoid BF16 if:**
❌ Your hardware does **not** support BF16 (it may fall back to FP32 and run slower).
❌ You need compatibility with older devices that lack BF16 optimization.
---
### **F16 (Float 16) – More widely supported than BF16**
- A 16-bit floating-point **high precision** but with less of range of values than BF16.
- Works on most devices with **FP16 acceleration support** (including many GPUs and some CPUs).
- Slightly lower numerical precision than BF16 but generally sufficient for inference.
📌 **Use F16 if:**
✔ Your hardware supports **FP16** but **not BF16**.
✔ You need a **balance between speed, memory usage, and accuracy**.
✔ You are running on a **GPU** or another device optimized for FP16 computations.
📌 **Avoid F16 if:**
❌ Your device lacks **native FP16 support** (it may run slower than expected).
❌ You have memory limitations.
---
### **Quantized Models (Q4_K, Q6_K, Q8, etc.) – For CPU & Low-VRAM Inference**
Quantization reduces model size and memory usage while maintaining as much accuracy as possible.
- **Lower-bit models (Q4_K)** → **Best for minimal memory usage**, may have lower precision.
- **Higher-bit models (Q6_K, Q8_0)** → **Better accuracy**, requires more memory.
📌 **Use Quantized Models if:**
✔ You are running inference on a **CPU** and need an optimized model.
✔ Your device has **low VRAM** and cannot load full-precision models.
✔ You want to reduce **memory footprint** while keeping reasonable accuracy.
📌 **Avoid Quantized Models if:**
❌ You need **maximum accuracy** (full-precision models are better for this).
❌ Your hardware has enough VRAM for higher-precision formats (BF16/F16).
---
### **Very Low-Bit Quantization (IQ3_XS, IQ3_S, IQ3_M, Q4_K, Q4_0)**
These models are optimized for **extreme memory efficiency**, making them ideal for **low-power devices** or **large-scale deployments** where memory is a critical constraint.
- **IQ3_XS**: Ultra-low-bit quantization (3-bit) with **extreme memory efficiency**.
- **Use case**: Best for **ultra-low-memory devices** where even Q4_K is too large.
- **Trade-off**: Lower accuracy compared to higher-bit quantizations.
- **IQ3_S**: Small block size for **maximum memory efficiency**.
- **Use case**: Best for **low-memory devices** where **IQ3_XS** is too aggressive.
- **IQ3_M**: Medium block size for better accuracy than **IQ3_S**.
- **Use case**: Suitable for **low-memory devices** where **IQ3_S** is too limiting.
- **Q4_K**: 4-bit quantization with **block-wise optimization** for better accuracy.
- **Use case**: Best for **low-memory devices** where **Q6_K** is too large.
- **Q4_0**: Pure 4-bit quantization, optimized for **ARM devices**.
- **Use case**: Best for **ARM-based devices** or **low-memory environments**.
---
### **Summary Table: Model Format Selection**
| Model Format | Precision | Memory Usage | Device Requirements | Best Use Case |
|--------------|------------|---------------|----------------------|---------------|
| **BF16** | Highest | High | BF16-supported GPU/CPUs | High-speed inference with reduced memory |
| **F16** | High | High | FP16-supported devices | GPU inference when BF16 isn't available |
| **Q4_K** | Medium Low | Low | CPU or Low-VRAM devices | Best for memory-constrained environments |
| **Q6_K** | Medium | Moderate | CPU with more memory | Better accuracy while still being quantized |
| **Q8_0** | High | Moderate | CPU or GPU with enough VRAM | Best accuracy among quantized models |
| **IQ3_XS** | Very Low | Very Low | Ultra-low-memory devices | Extreme memory efficiency and low accuracy |
| **Q4_0** | Low | Low | ARM or low-memory devices | llama.cpp can optimize for ARM devices |
---
## **Included Files & Details**
### `Foundation-Sec-8B-Instruct-bf16.gguf`
- Model weights preserved in **BF16**.
- Use this if you want to **requantize** the model into a different format.
- Best if your device supports **BF16 acceleration**.
### `Foundation-Sec-8B-Instruct-f16.gguf`
- Model weights stored in **F16**.
- Use if your device supports **FP16**, especially if BF16 is not available.
### `Foundation-Sec-8B-Instruct-bf16-q8_0.gguf`
- **Output & embeddings** remain in **BF16**.
- All other layers quantized to **Q8_0**.
- Use if your device supports **BF16** and you want a quantized version.
### `Foundation-Sec-8B-Instruct-f16-q8_0.gguf`
- **Output & embeddings** remain in **F16**.
- All other layers quantized to **Q8_0**.
### `Foundation-Sec-8B-Instruct-q4_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q4_K**.
- Good for **CPU inference** with limited memory.
### `Foundation-Sec-8B-Instruct-q4_k_s.gguf`
- Smallest **Q4_K** variant, using less memory at the cost of accuracy.
- Best for **very low-memory setups**.
### `Foundation-Sec-8B-Instruct-q6_k.gguf`
- **Output & embeddings** quantized to **Q8_0**.
- All other layers quantized to **Q6_K** .
### `Foundation-Sec-8B-Instruct-q8_0.gguf`
- Fully **Q8** quantized model for better accuracy.
- Requires **more memory** but offers higher precision.
### `Foundation-Sec-8B-Instruct-iq3_xs.gguf`
- **IQ3_XS** quantization, optimized for **extreme memory efficiency**.
- Best for **ultra-low-memory devices**.
### `Foundation-Sec-8B-Instruct-iq3_m.gguf`
- **IQ3_M** quantization, offering a **medium block size** for better accuracy.
- Suitable for **low-memory devices**.
### `Foundation-Sec-8B-Instruct-q4_0.gguf`
- Pure **Q4_0** quantization, optimized for **ARM devices**.
- Best for **low-memory environments**.
- Prefer IQ4_NL for better accuracy.
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
❤ **Please click "Like" if you find this useful!**
Help me test my **AI-Powered Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/dashboard/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4o-mini)
- `HugLLM` (Hugginface Open-source)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**)
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4o-mini** for:
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API
### 💡 **Example commands to you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
# Model Card for Foundation-Sec-8B-Instruct
<!-- Provide a quick summary of what the model is/does. -->
Foundation-Sec-8B-Instruct is an Instruction Fine-Tune of [Foundation-Sec-8B](https://huggingface.co/fdtn-ai/Foundation-Sec-8B).
- **Model Name:** Foundation-Sec-8B-Instruct
- **Fine-Tune Developer:** Derek Jones ([email protected])
- **Original Developers** Amin Karbasi and team at Foundation AI — Cisco
- **Technical Report:** [`https://arxiv.org/abs/2504.21039`](https://arxiv.org/abs/2504.21039)
- **Model Card Contact:** For questions about the model usage, contact [`[email protected]`](mailto:[email protected]).
- **Model Release Date:** May 4, 2025
- **Supported Language(s):** English
- **License:** Apache 2.0
|
Yukang/Qwen2.5-3B-Open-R1-GRPO | Yukang | 2025-06-15T19:35:49Z | 6 | 0 | transformers | [
"transformers",
"safetensors",
"qwen2",
"text-generation",
"generated_from_trainer",
"open-r1",
"trl",
"grpo",
"conversational",
"dataset:open-r1/OpenR1-Math-220k",
"arxiv:2402.03300",
"base_model:Qwen/Qwen2.5-3B-Instruct",
"base_model:finetune:Qwen/Qwen2.5-3B-Instruct",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-12T20:31:17Z | ---
base_model: Qwen/Qwen2.5-3B-Instruct
datasets: open-r1/OpenR1-Math-220k
library_name: transformers
model_name: Qwen2.5-3B-Open-R1-GRPO
tags:
- generated_from_trainer
- open-r1
- trl
- grpo
licence: license
---
# Model Card for Qwen2.5-3B-Open-R1-GRPO
This model is a fine-tuned version of [Qwen/Qwen2.5-3B-Instruct](https://huggingface.co/Qwen/Qwen2.5-3B-Instruct) on the [open-r1/OpenR1-Math-220k](https://huggingface.co/datasets/open-r1/OpenR1-Math-220k) dataset.
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="Yukang/Qwen2.5-3B-Open-R1-GRPO", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
[<img src="https://raw.githubusercontent.com/wandb/assets/main/wandb-github-badge-28.svg" alt="Visualize in Weights & Biases" width="150" height="24"/>](https://wandb.ai/chenyukang2020-nvidia/huggingface/runs/9wwsfr8r)
This model was trained with GRPO, a method introduced in [DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models](https://huggingface.co/papers/2402.03300).
### Framework versions
- TRL: 0.18.0
- Transformers: 4.52.3
- Pytorch: 2.6.0
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite GRPO as:
```bibtex
@article{zhihong2024deepseekmath,
title = {{DeepSeekMath: Pushing the Limits of Mathematical Reasoning in Open Language Models}},
author = {Zhihong Shao and Peiyi Wang and Qihao Zhu and Runxin Xu and Junxiao Song and Mingchuan Zhang and Y. K. Li and Y. Wu and Daya Guo},
year = 2024,
eprint = {arXiv:2402.03300},
}
```
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
Mungert/Magistral-Small-2506-GGUF | Mungert | 2025-06-15T19:35:48Z | 1,730 | 6 | vllm | [
"vllm",
"gguf",
"en",
"fr",
"de",
"es",
"pt",
"it",
"ja",
"ko",
"ru",
"zh",
"ar",
"fa",
"id",
"ms",
"ne",
"pl",
"ro",
"sr",
"sv",
"tr",
"uk",
"vi",
"hi",
"bn",
"base_model:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"base_model:quantized:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"license:apache-2.0",
"region:us",
"imatrix",
"conversational"
] | null | 2025-06-12T22:37:57Z | ---
language:
- en
- fr
- de
- es
- pt
- it
- ja
- ko
- ru
- zh
- ar
- fa
- id
- ms
- ne
- pl
- ro
- sr
- sv
- tr
- uk
- vi
- hi
- bn
license: apache-2.0
library_name: vllm
inference: false
base_model:
- mistralai/Mistral-Small-3.1-24B-Instruct-2503
extra_gated_description: >-
If you want to learn more about how we process your personal data, please read
our <a href="https://mistral.ai/terms/">Privacy Policy</a>.
---
# <span style="color: #7FFF7F;">Magistral-Small-2506 GGUF Models</span>
## <span style="color: #7F7FFF;">Model Generation Details</span>
This model was generated using [llama.cpp](https://github.com/ggerganov/llama.cpp) at commit [`7f4fbe51`](https://github.com/ggerganov/llama.cpp/commit/7f4fbe5183b23b6b2e25fd1ccc5d1fa8bb010cb7).
---
## <span style="color: #7FFF7F;">Quantization Beyond the IMatrix</span>
I've been experimenting with a new quantization approach that selectively elevates the precision of key layers beyond what the default IMatrix configuration provides.
In my testing, standard IMatrix quantization underperforms at lower bit depths, especially with Mixture of Experts (MoE) models. To address this, I'm using the `--tensor-type` option in `llama.cpp` to manually "bump" important layers to higher precision. You can see the implementation here:
👉 [Layer bumping with llama.cpp](https://github.com/Mungert69/GGUFModelBuilder/blob/main/model-converter/tensor_list_builder.py)
While this does increase model file size, it significantly improves precision for a given quantization level.
### **I'd love your feedback—have you tried this? How does it perform for you?**
---
<a href="https://readyforquantum.com/huggingface_gguf_selection_guide.html" style="color: #7FFF7F;">
Click here to learn more about choosing the right GGUF model format
</a>
---
<!--Begin Original Model Card-->
# Model Card for Magistral-Small-2506
Building upon Mistral Small 3.1 (2503), **with added reasoning capabilities**, undergoing SFT from Magistral Medium traces and RL on top, it's a small, efficient reasoning model with 24B parameters.
Magistral Small can be deployed locally, fitting within a single RTX 4090 or a 32GB RAM MacBook once quantized.
Learn more about Magistral in our [blog post](https://mistral.ai/news/magistral/).
## Key Features
- **Reasoning:** Capable of long chains of reasoning traces before providing an answer.
- **Multilingual:** Supports dozens of languages, including English, French, German, Greek, Hindi, Indonesian, Italian, Japanese, Korean, Malay, Nepali, Polish, Portuguese, Romanian, Russian, Serbian, Spanish, Swedish, Turkish, Ukrainian, Vietnamese, Arabic, Bengali, Chinese, and Farsi.
- **Apache 2.0 License:** Open license allowing usage and modification for both commercial and non-commercial purposes.
- **Context Window:** A 128k context window, **but** performance might degrade past **40k**. Hence we recommend setting the maximum model length to 40k.
## Benchmark Results
| Model | AIME24 pass@1 | AIME25 pass@1 | GPQA Diamond | Livecodebench (v5) |
|-------|-------------|-------------|--------------|-------------------|
| Magistral Medium | 73.59% | 64.95% | 70.83% | 59.36% |
| Magistral Small | 70.68% | 62.76% | 68.18% | 55.84% |
## Sampling parameters
Please make sure to use:
- `top_p`: 0.95
- `temperature`: 0.7
- `max_tokens`: 40960
## Basic Chat Template
We highly recommend including the default system prompt used during RL for the best results, you can edit and customise it if needed for your specific use case.
```
<s>[SYSTEM_PROMPT]system_prompt
A user will ask you to solve a task. You should first draft your thinking process (inner monologue) until you have derived the final answer. Afterwards, write a self-contained summary of your thoughts (i.e. your summary should be succinct but contain all the critical steps you needed to reach the conclusion). You should use Markdown to format your response. Write both your thoughts and summary in the same language as the task posed by the user. NEVER use \boxed{} in your response.
Your thinking process must follow the template below:
<think>
Your thoughts or/and draft, like working through an exercise on scratch paper. Be as casual and as long as you want until you are confident to generate a correct answer.
</think>
Here, provide a concise summary that reflects your reasoning and presents a clear final answer to the user. Don't mention that this is a summary.
Problem:
[/SYSTEM_PROMPT][INST]user_message[/INST]<think>
reasoning_traces
</think>
assistant_response</s>[INST]user_message[/INST]
```
*`system_prompt`, `user_message` and `assistant_response` are placeholders.*
We invite you to choose, depending on your use case and requirements, between keeping reasoning traces during multi-turn interactions or keeping only the final assistant response.
***Please make sure to use [mistral-common](https://github.com/mistralai/mistral-common) as the source of truth***
## Usage
The model can be used with the following frameworks;
### Inference
- [`vllm (recommended)`](https://github.com/vllm-project/vllm): See [below](#vllm)
In addition the community has prepared quantized versions of the model that can be used with the following frameworks (*alphabetically sorted*):
- [`llama.cpp`](https://github.com/ggml-org/llama.cpp): https://huggingface.co/mistralai/Magistral-Small-2506_gguf
- [`lmstudio` (llama.cpp, MLX)](https://lmstudio.ai/): https://lmstudio.ai/models/mistralai/magistral-small
- [`ollama`](https://ollama.com/): https://ollama.com/library/magistral
- [`unsloth` (llama.cpp)](https://huggingface.co/unsloth): https://huggingface.co/unsloth/Magistral-Small-2506-GGUF
### Training
Fine-tuning is possible with (*alphabetically sorted*):
- [`axolotl`](https://github.com/axolotl-ai-cloud/axolotl): https://github.com/axolotl-ai-cloud/axolotl/tree/main/examples/magistral
- [`unsloth`](https://github.com/unslothai/unsloth): https://docs.unsloth.ai/basics/magistral
### Other
Also you can use Magistral with:
- [`kaggle`](https://www.kaggle.com/models/mistral-ai/magistral-small-2506): https://www.kaggle.com/models/mistral-ai/magistral-small-2506
### vLLM (recommended)
We recommend using this model with the [vLLM library](https://github.com/vllm-project/vllm)
to implement production-ready inference pipelines.
**_Installation_**
Make sure you install the latest [`vLLM`](https://github.com/vllm-project/vllm/) code:
```
pip install -U vllm \
--pre \
--extra-index-url https://wheels.vllm.ai/nightly
```
Doing so should automatically install [`mistral_common >= 1.6.0`](https://github.com/mistralai/mistral-common/releases/tag/v1.6.0).
To check:
```
python -c "import mistral_common; print(mistral_common.__version__)"
```
You can also make use of a ready-to-go [docker image](https://github.com/vllm-project/vllm/blob/main/Dockerfile) or on the [docker hub](https://hub.docker.com/layers/vllm/vllm-openai/latest/images/sha256-de9032a92ffea7b5c007dad80b38fd44aac11eddc31c435f8e52f3b7404bbf39).
Serve model as follows:
```
vllm serve mistralai/Magistral-Small-2506 --tokenizer_mode mistral --config_format mistral --load_format mistral --tool-call-parser mistral --enable-auto-tool-choice --tensor-parallel-size 2
```
Ping model as follows:
```py
from openai import OpenAI
from huggingface_hub import hf_hub_download
# Modify OpenAI's API key and API base to use vLLM's API server.
openai_api_key = "EMPTY"
openai_api_base = "http://localhost:8000/v1"
TEMP = 0.7
TOP_P = 0.95
MAX_TOK = 40_960
client = OpenAI(
api_key=openai_api_key,
base_url=openai_api_base,
)
models = client.models.list()
model = models.data[0].id
def load_system_prompt(repo_id: str, filename: str) -> str:
file_path = hf_hub_download(repo_id=repo_id, filename=filename)
with open(file_path, "r") as file:
system_prompt = file.read()
return system_prompt
SYSTEM_PROMPT = load_system_prompt(model, "SYSTEM_PROMPT.txt")
query = "Write 4 sentences, each with at least 8 words. Now make absolutely sure that every sentence has exactly one word less than the previous sentence."
# or try out other queries
# query = "Exactly how many days ago did the French Revolution start? Today is June 4th, 2025."
# query = "Think about 5 random numbers. Verify if you can combine them with addition, multiplication, subtraction or division to 133"
# query = "If it takes 30 minutes to dry 12 T-shirts in the sun, how long does it take to dry 33 T-shirts?"
messages = [
{"role": "system", "content": SYSTEM_PROMPT},
{"role": "user", "content": query}
]
stream = client.chat.completions.create(
model=model,
messages=messages,
stream=True,
temperature=TEMP,
top_p=TOP_P,
max_tokens=MAX_TOK,
)
print("client: Start streaming chat completions...")
printed_content = False
for chunk in stream:
content = None
# Check the content is content
if hasattr(chunk.choices[0].delta, "content"):
content = chunk.choices[0].delta.content
if content is not None:
if not printed_content:
printed_content = True
print("\ncontent:", end="", flush=True)
# Extract and print the content
print(content, end="", flush=True)
# content:<think>
# Alright, I need to write 4 sentences where each one has at least 8 words and each subsequent sentence has one fewer word than the previous one.
# ...
# Final boxed answer (the four sentences):
# \[
# \boxed{
# \begin{aligned}
# &\text{1. The quick brown fox jumps over lazy dog and yells hello.} \\
# &\text{2. I saw the cat on the stair with my hat.} \\
# &\text{3. The man in the moon came down quickly today.} \\
# &\text{4. A cat sat on the mat today patiently.}
# \end{aligned}
# }
# \]
```
<!--End Original Model Card-->
---
# <span id="testllm" style="color: #7F7FFF;">🚀 If you find these models useful</span>
Help me test my **AI-Powered Quantum Network Monitor Assistant** with **quantum-ready security checks**:
👉 [Quantum Network Monitor](https://readyforquantum.com/?assistant=open&utm_source=huggingface&utm_medium=referral&utm_campaign=huggingface_repo_readme)
The full Open Source Code for the Quantum Network Monitor Service available at my github repos ( repos with NetworkMonitor in the name) : [Source Code Quantum Network Monitor](https://github.com/Mungert69). You will also find the code I use to quantize the models if you want to do it yourself [GGUFModelBuilder](https://github.com/Mungert69/GGUFModelBuilder)
💬 **How to test**:
Choose an **AI assistant type**:
- `TurboLLM` (GPT-4.1-mini)
- `HugLLM` (Hugginface Open-source models)
- `TestLLM` (Experimental CPU-only)
### **What I’m Testing**
I’m pushing the limits of **small open-source models for AI network monitoring**, specifically:
- **Function calling** against live network services
- **How small can a model go** while still handling:
- Automated **Nmap security scans**
- **Quantum-readiness checks**
- **Network Monitoring tasks**
🟡 **TestLLM** – Current experimental model (llama.cpp on 2 CPU threads on huggingface docker space):
- ✅ **Zero-configuration setup**
- ⏳ 30s load time (slow inference but **no API costs**) . No token limited as the cost is low.
- 🔧 **Help wanted!** If you’re into **edge-device AI**, let’s collaborate!
### **Other Assistants**
🟢 **TurboLLM** – Uses **gpt-4.1-mini** :
- **It performs very well but unfortunatly OpenAI charges per token. For this reason tokens usage is limited.
- **Create custom cmd processors to run .net code on Quantum Network Monitor Agents**
- **Real-time network diagnostics and monitoring**
- **Security Audits**
- **Penetration testing** (Nmap/Metasploit)
🔵 **HugLLM** – Latest Open-source models:
- 🌐 Runs on Hugging Face Inference API. Performs pretty well using the lastest models hosted on Novita.
### 💡 **Example commands you could test**:
1. `"Give me info on my websites SSL certificate"`
2. `"Check if my server is using quantum safe encyption for communication"`
3. `"Run a comprehensive security audit on my server"`
4. '"Create a cmd processor to .. (what ever you want)" Note you need to install a Quantum Network Monitor Agent to run the .net code from. This is a very flexible and powerful feature. Use with caution!
### Final Word
I fund the servers used to create these model files, run the Quantum Network Monitor service, and pay for inference from Novita and OpenAI—all out of my own pocket. All the code behind the model creation and the Quantum Network Monitor project is [open source](https://github.com/Mungert69). Feel free to use whatever you find helpful.
If you appreciate the work, please consider [buying me a coffee](https://www.buymeacoffee.com/mahadeva) ☕. Your support helps cover service costs and allows me to raise token limits for everyone.
I'm also open to job opportunities or sponsorship.
Thank you! 😊
|
hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf | hasdal | 2025-06-15T19:33:58Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"stable-diffusion-xl",
"lora",
"template:sd-lora",
"ai-toolkit",
"base_model:dataautogpt3/ProteusSigma",
"base_model:adapter:dataautogpt3/ProteusSigma",
"license:creativeml-openrail-m",
"region:us"
] | text-to-image | 2025-06-15T19:33:50Z | ---
tags:
- text-to-image
- stable-diffusion-xl
- lora
- diffusers
- template:sd-lora
- ai-toolkit
widget:
- text: a photo of 98199508-8f07-4d47-beef-0fd41ee40673 style
output:
url: samples/1750016016367__000001000_0.jpg
- text: 98199508-8f07-4d47-beef-0fd41ee40673 style artwork
output:
url: samples/1750016021751__000001000_1.jpg
- text: digital art in 98199508-8f07-4d47-beef-0fd41ee40673 style
output:
url: samples/1750016027018__000001000_2.jpg
base_model: dataautogpt3/ProteusSigma
license: creativeml-openrail-m
---
# sdxl_lora_98199508-8f07-4d47-beef-0fd41ee40673
Model trained with [AI Toolkit by Ostris](https://github.com/ostris/ai-toolkit)
<Gallery />
## Trigger words
No trigger words defined.
## Download model and use it with ComfyUI, AUTOMATIC1111, SD.Next, Invoke AI, etc.
Weights for this model are available in Safetensors format.
[Download](/hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf/tree/main) them in the Files & versions tab.
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('dataautogpt3/ProteusSigma', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('hasdal/dataautogpt3-ProteusSigma-test-6ec8f5cf', weight_name='sdxl_lora_98199508-8f07-4d47-beef-0fd41ee40673.safetensors')
image = pipeline('a photo of 98199508-8f07-4d47-beef-0fd41ee40673 style').images[0]
image.save("my_image.png")
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
|
bruhzair/prototype-0.4x141 | bruhzair | 2025-06-15T19:33:38Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"llama",
"text-generation",
"mergekit",
"merge",
"conversational",
"arxiv:2403.19522",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:15:04Z | ---
base_model: []
library_name: transformers
tags:
- mergekit
- merge
---
# prototype-0.4x141
This is a merge of pre-trained language models created using [mergekit](https://github.com/cg123/mergekit).
## Merge Details
### Merge Method
This model was merged using the [Model Stock](https://arxiv.org/abs/2403.19522) merge method using /workspace/prototype-0.4x136 as a base.
### Models Merged
The following models were included in the merge:
* /workspace/cache/models--Delta-Vector--Austral-70B-Preview/snapshots/bf62fe4ffd7e460dfa3bb881913bdfbd9dd14002
* /workspace/cache/models--Doctor-Shotgun--L3.3-70B-Magnum-Diamond/snapshots/197c99943443ef396927305ee44eccb6d8019d7f
* /workspace/cache/models--tdrussell--Llama-3-70B-Instruct-Storywriter/snapshots/19be2a7c6382a9150e126cf144e2b2964e700d3c
### Configuration
The following YAML configuration was used to produce this model:
```yaml
models:
- model: /workspace/cache/models--Doctor-Shotgun--L3.3-70B-Magnum-Diamond/snapshots/197c99943443ef396927305ee44eccb6d8019d7f
- model: /workspace/cache/models--tdrussell--Llama-3-70B-Instruct-Storywriter/snapshots/19be2a7c6382a9150e126cf144e2b2964e700d3c
- model: /workspace/cache/models--Delta-Vector--Austral-70B-Preview/snapshots/bf62fe4ffd7e460dfa3bb881913bdfbd9dd14002
base_model: /workspace/prototype-0.4x136
merge_method: model_stock
tokenizer:
source: base
int8_mask: true
dtype: float32
out_dtype: bfloat16
pad_to_multiple_of: 8
```
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.5_epoch1 | MinaMila | 2025-06-15T19:31:46Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:29:44Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
VIDEOS-19-sajal-malik-Viral-Video/FULL.VIDEO.jobz.hunting.sajal.malik.Viral.Video.Tutorial.Official | VIDEOS-19-sajal-malik-Viral-Video | 2025-06-15T19:31:42Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:31:11Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
19-sajal-malik-Official-Viral-Video-K/FULL.VIDEO.jobz.hunting.sajal.malik.Viral.Video.Tutorial.Official | 19-sajal-malik-Official-Viral-Video-K | 2025-06-15T19:27:19Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:25:38Z | [🌐 CLICK HERE 🟢==►► WATCH NOW](https://videohere.top/)
[🔴 CLICK HERE 🌐==►► Download Now)](https://videohere.top/)
[<img alt="fsd" src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/) |
ioana-coman-18/ULL.VIDEO.Ioana.Coman.Viral.Video.iubita.Tutorial.Official | ioana-coman-18 | 2025-06-15T19:26:07Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:18:18Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman) |
ioana-coman-18/wATCH.ioana-coman-ioana-coman-ioana-coman.original | ioana-coman-18 | 2025-06-15T19:24:28Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:19:35Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?ioana-coman) |
VIDEOS-18-Indian-Student-Viral-Video/FULL.VIDEO.Indian.Student.Viral.Video.Tutorial.Official | VIDEOS-18-Indian-Student-Viral-Video | 2025-06-15T19:23:48Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:23:27Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.75_epoch2 | MinaMila | 2025-06-15T19:23:29Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:21:40Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_random_3x3_seed_1_20250615_191350 | gradientrouting-spar | 2025-06-15T19:23:25Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:23:03Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
saishmendke10/news_llm_3-8b-Instruct-bnb-4bit | saishmendke10 | 2025-06-15T19:20:40Z | 0 | 0 | peft | [
"peft",
"safetensors",
"llama-factory",
"lora",
"generated_from_trainer",
"base_model:unsloth/llama-3-8b-Instruct-bnb-4bit",
"base_model:adapter:unsloth/llama-3-8b-Instruct-bnb-4bit",
"license:llama3",
"region:us"
] | null | 2025-06-15T15:57:59Z | ---
library_name: peft
license: llama3
base_model: unsloth/llama-3-8b-Instruct-bnb-4bit
tags:
- llama-factory
- lora
- generated_from_trainer
model-index:
- name: news_llm_3-8b-Instruct-bnb-4bit
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# news_llm_3-8b-Instruct-bnb-4bit
This model is a fine-tuned version of [unsloth/llama-3-8b-Instruct-bnb-4bit](https://huggingface.co/unsloth/llama-3-8b-Instruct-bnb-4bit) on the hindi_news_sft_dataset_formatted dataset.
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 5e-05
- train_batch_size: 2
- eval_batch_size: 8
- seed: 42
- distributed_type: multi-GPU
- num_devices: 8
- gradient_accumulation_steps: 4
- total_train_batch_size: 64
- total_eval_batch_size: 64
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: cosine
- lr_scheduler_warmup_ratio: 0.1
- num_epochs: 2.0
- mixed_precision_training: Native AMP
### Training results
### Framework versions
- PEFT 0.15.0
- Transformers 4.51.3
- Pytorch 2.5.1+cu124
- Datasets 3.3.2
- Tokenizers 0.21.0 |
juexzz/INTACT-pi0-finetune-bridge | juexzz | 2025-06-15T19:18:26Z | 2 | 0 | null | [
"safetensors",
"robotics",
"arxiv:2410.24164",
"arxiv:2506.09930",
"base_model:lerobot/pi0",
"base_model:finetune:lerobot/pi0",
"license:apache-2.0",
"region:us"
] | robotics | 2025-06-15T02:21:01Z | ---
license: apache-2.0
base_model:
- lerobot/pi0
pipeline_tag: robotics
---
# INTACT Probing Suite: Pi0 Fine-tuned on BridgeV2
> 📦 **This model is part of the [INTACT Probing Suite Collection](https://huggingface.co/collections/ai4ce/intact-probing-suite-684e5601e9ed640fdd9b994b)**
> Explore other variants:
> - [Pi0 from scratch on BridgeV2](https://huggingface.co/juexzz/INTACT-pi0-scratch-bridge)
> - [Pi0 finetuned with paraphrase on BridgeV2](https://huggingface.co/juexzz/INTACT-pi0-finetune-rephrase-bridge)
## INTACT-pi-finetune-bridge
This repository contains a checkpoint of the Pi0 model ([HF implementation](https://huggingface.co/lerobot/pi0) | [Paper](https://arxiv.org/abs/2410.24164v1)) finetuned on the BridgeV2 dataset for robotic manipulation tasks.
The model is later used for testing on the [Simpler Environment](https://github.com/simpler-env/SimplerEnv) and our [INTACT](https://github.com/ai4ce/INT-ACT) Probing Suite for the generalization boundaries of VLA models.
**Paper**: [From Intention to Execution: Probing the Generalization Boundaries of Vision-Language-Action Models](https://arxiv.org/abs/2506.09930)
## Model Details
- **Base Model**: [lerobot/pi0](https://huggingface.co/lerobot/pi0)
- **Training Dataset**: [BridgeV2](https://rail-berkeley.github.io/bridgedata/)
- **Model Type**: Vision-Language-Action (VLA) model for robotics
- **Fine-tuning Method**: See our [paper](https://arxiv.org/abs/2506.09930)
- **Training Framework**: See our [repository](https://github.com/ai4ce/INT-ACT)
## Quick Start
### Usage in INTACT
```shell
git clone --recurse-submodules https://github.com/ai4ce/INT-ACT.git
cd INT-ACT
uv sync
source .venv/bin/activate
python
```
Or directly in python with Lerobot, see blow:
### Integration with LeRobot
First, install lerobot
```bash
pip install lerobot
```
Then
```python
import torch
from lerobot.common.policies.pi0.modeling_pi0 import Pi0Policy
# Load model
policy = Pi0Policy.from_pretrained("juexzz/INTACT-pi0-finetune-bridge")
# Inference
with torch.no_grad():
actions = policy.select_action(batch)
```
### Training Configuration
- **Training Steps**: 15 epochs ~22695 steps.
- **Batch Size**: 1024
- **Learning Rate**: 1e-5
- **Hardware**: 4 H100/A100
- **Input Modalities**: single image (to work with SimplerEnv), 1 language instruction, 1 robot state.
- **Output**: robot actions (delta EEF) with chunk size of 4.
For more details please refer to our [paper](https://arxiv.org/abs/2506.09930) and [code](https://github.com/ai4ce/INT-ACT)
## Evaluation
**Checkpoint choice**
After training 15 epochs, we sweep the checkpoint at epoch 1, 2, 3, 4, 5, 10, 15 for performance on the original 4 Bridge tasks in the SimplerEnv, and choose the checkpoint with *best average performance* for each of the three Pi0 variants.
Therefore, you may still get a better success rate for a specific task at other checkpoints.
As a result, the best checkpoint for this pi0 finetune model is at step 7565 (epoch 5).
The comparison of their performance on Simpler are shown below.
### Performance Comparison on SimplerEnv
**Success rate** comparison on the SimplerEnv with other pi0 variants and some other baselines experimented in our INTACT suite.
For a more detailed comparison, please refer to the [paper](https://arxiv.org/abs/2506.09930).
| Model | carrot_on_plate | eggplant_in_basket | stack_cube | spoon_on_towel |
|-------|-----------------|-------------------|------------|----------------|
| **Pi0 finetune (This Model)** | 0.361 | 0.819 | 0.264 | 0.458 |
| [Pi0 finetune rephrase](https://huggingface.co/juexzz/INTACT-pi0-finetune-rephrase-bridge) | 0.500 | 0.944 | 0.222 | 0.597 |
| [Pi0 scratch](https://huggingface.co/juexzz/INTACT-pi0-scratch-bridge) | 0.542 | 0.903 | 0.403 | 0.875 |
| Spatial VLA | 0.125 | 0.958 | 0.292 | 0.208 |
| Magma | 0.250 | 0.611 | 0.097 | 0.208 |
| Octo Small | 0.014 | 0.097 | 0.000 | 0.097 |
| Octo Base | 0.014 | 0.306 | 0.000 | 0.014 |
## Citation
If you use this model in your research, please cite:
```bibtex
@article{fang2025intention,
title={From Intention to Execution: Probing the Generalization Boundaries of Vision-Language-Action Models},
author={Fang, Irving and Zhang, Juexiao and Tong, Shengbang and Feng, Chen},
journal={arXiv preprint arXiv:2506.09930},
year={2025}
}
```
## Related Work
- **Pi0 (official)**: [pi0 (JAX)](https://github.com/Physical-Intelligence/openpi)
- **Base Model (Pi0 HF)**: [lerobot/pi0](https://huggingface.co/lerobot/pi0)
- **Dataset**: [BridgeV2](https://bridge-v2.github.io/)
- **Framework**: [LeRobot](https://github.com/huggingface/lerobot)
- **Simpler Environment**: [SimplerEnv](https://github.com/simpler-env/SimplerEnv)
- **Open-source Pi0 Implementation by Allen Ren**: [open-pi-zero](https://github.com/allenzren/open-pi-zero)
## License
This model is released under the Apache 2.0 license. Please see the base model's license for any additional restrictions.
## Support
For questions about this model:
- 📧 Open an issue in this repository
- 💬 Discussion tab for community questions
- 📖 Check our [paper](https://arxiv.org/abs/2506.09930) for technical details
---
*Last updated: June 2025* |
mistralai/Magistral-Small-2506 | mistralai | 2025-06-15T19:17:51Z | 13,506 | 423 | vllm | [
"vllm",
"safetensors",
"mistral",
"conversational",
"text-generation",
"en",
"fr",
"de",
"es",
"pt",
"it",
"ja",
"ko",
"ru",
"zh",
"ar",
"fa",
"id",
"ms",
"ne",
"pl",
"ro",
"sr",
"sv",
"tr",
"uk",
"vi",
"hi",
"bn",
"arxiv:2506.10910",
"base_model:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"base_model:finetune:mistralai/Mistral-Small-3.1-24B-Instruct-2503",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-04T10:51:21Z | ---
base_model:
- mistralai/Mistral-Small-3.1-24B-Instruct-2503
language:
- en
- fr
- de
- es
- pt
- it
- ja
- ko
- ru
- zh
- ar
- fa
- id
- ms
- ne
- pl
- ro
- sr
- sv
- tr
- uk
- vi
- hi
- bn
library_name: vllm
license: apache-2.0
inference: false
extra_gated_description: If you want to learn more about how we process your personal
data, please read our <a href="https://mistral.ai/terms/">Privacy Policy</a>.
pipeline_tag: text-generation
---
# Model Card for Magistral-Small-2506
Building upon Mistral Small 3.1 (2503), **with added reasoning capabilities**, undergoing SFT from Magistral Medium traces and RL on top, it's a small, efficient reasoning model with 24B parameters.
Magistral Small can be deployed locally, fitting within a single RTX 4090 or a 32GB RAM MacBook once quantized.
Learn more about Magistral in our [blog post](https://mistral.ai/news/magistral/).
The model was presented in the paper [Magistral](https://huggingface.co/papers/2506.10910).
## Key Features
- **Reasoning:** Capable of long chains of reasoning traces before providing an answer.
- **Multilingual:** Supports dozens of languages, including English, French, German, Greek, Hindi, Indonesian, Italian, Japanese, Korean, Malay, Nepali, Polish, Portuguese, Romanian, Russian, Serbian, Spanish, Turkish, Ukrainian, Vietnamese, Arabic, Bengali, Chinese, and Farsi.
- **Apache 2.0 License:** Open license allowing usage and modification for both commercial and non-commercial purposes.
- **Context Window:** A 128k context window, **but** performance might degrade past **40k**. Hence we recommend setting the maximum model length to 40k.
## Benchmark Results
| Model | AIME24 pass@1 | AIME25 pass@1 | GPQA Diamond | Livecodebench (v5) |
|-------|-------------|-------------|--------------|-------------------|
| Magistral Medium | 73.59% | 64.95% | 70.83% | 59.36% |
| Magistral Small | 70.68% | 62.76% | 68.18% | 55.84% |
## Sampling parameters
Please make sure to use:
- `top_p`: 0.95
- `temperature`: 0.7
- `max_tokens`: 40960
## Basic Chat Template
We highly recommend including the default system prompt used during RL for the best results, you can edit and customise it if needed for your specific use case.
```
<s>[SYSTEM_PROMPT]system_prompt
A user will ask you to solve a task. You should first draft your thinking process (inner monologue) until you have derived the final answer. Afterwards, write a self-contained summary of your thoughts (i.e. your summary should be succinct but contain all the critical steps you needed to reach the conclusion). You should use Markdown to format your response. Write both your thoughts and summary in the same language as the task posed by the user. NEVER use \boxed{} in your response.
Your thinking process must follow the template below:
<think>
Your thoughts or/and draft, like working through an exercise on scratch paper. Be as casual and as long as you want until you are confident to generate a correct answer.
</think>
Here, provide a concise summary that reflects your reasoning and presents a clear final answer to the user. Don't mention that this is a summary.
Problem:
[/SYSTEM_PROMPT][INST]user_message[/INST]<think>
reasoning_traces
</think>
assistant_response</s>[INST]user_message[/INST]
```
*`system_prompt`, `user_message` and `assistant_response` are placeholders.*
We invite you to choose, depending on your use case and requirements, between keeping reasoning traces during multi-turn interactions or keeping only the final assistant response.
***Please make sure to use [mistral-common](https://github.com/mistralai/mistral-common) as the source of truth***
## Usage
The model can be used with the following frameworks;
### Inference
- [`vllm (recommended)`](https://github.com/vllm-project/vllm): See [below](#vllm)
In addition the community has prepared quantized versions of the model that can be used with the following frameworks (*alphabetically sorted*):
- [`llama.cpp`](https://github.com/ggml-org/llama.cpp): https://huggingface.co/mistralai/Magistral-Small-2506_gguf
- [`lmstudio` (llama.cpp, MLX)](https://lmstudio.ai/): https://lmstudio.ai/models/mistralai/magistral-small
- [`ollama`](https://ollama.com/): https://ollama.com/library/magistral
- [`unsloth` (llama.cpp)](https://huggingface.co/unsloth): https://huggingface.co/unsloth/Magistral-Small-2506-GGUF
### Training
Fine-tuning is possible with (*alphabetically sorted*):
- [`axolotl`](https://github.com/axolotl-ai-cloud/axolotl): https://github.com/axolotl-ai-cloud/axolotl/tree/main/examples/magistral
- [`unsloth`](https://github.com/unslothai/unsloth): https://docs.unsloth.ai/basics/magistral
### Other
Also you can use Magistral with:
- [`kaggle`](https://www.kaggle.com/models/mistral-ai/magistral-small-2506): https://www.kaggle.com/models/mistral-ai/magistral-small-2506
### vLLM (recommended)
We recommend using this model with the [vLLM library](https://github.com/vllm-project/vllm)
to implement production-ready inference pipelines.
**_Installation_**
Make sure you install the latest [`vLLM`](https://github.com/vllm-project/vllm/) code:
```
pip install -U vllm \
--pre \
--extra-index-url https://wheels.vllm.ai/nightly
```
Doing so should automatically install [`mistral_common >= 1.6.0`](https://github.com/mistralai/mistral-common/releases/tag/v1.6.0).
To check:
```
python -c "import mistral_common; print(mistral_common.__version__)"
```
You can also make use of a ready-to-go [docker image](https://github.com/vllm-project/vllm/blob/main/Dockerfile) or on the [docker hub](https://hub.docker.com/layers/vllm/vllm-openai/latest/images/sha256-de9032a92ffea7b5c007dad80b38fd44aac11eddc31c435f8e52f3b7404bbf39).
Serve model as follows:
```
vllm serve mistralai/Magistral-Small-2506 --tokenizer_mode mistral --config_format mistral --load_format mistral --tool-call-parser mistral --enable-auto-tool-choice --tensor-parallel-size 2
```
Ping model as follows:
```py
from openai import OpenAI
from huggingface_hub import hf_hub_download
# Modify OpenAI's API key and API base to use vLLM's API server.
openai_api_key = "EMPTY"
openai_api_base = "http://localhost:8000/v1"
TEMP = 0.7
TOP_P = 0.95
MAX_TOK = 40_960
client = OpenAI(
api_key=openai_api_key,
base_url=openai_api_base,
)
models = client.models.list()
model = models.data[0].id
def load_system_prompt(repo_id: str, filename: str) -> str:
file_path = hf_hub_download(repo_id=repo_id, filename=filename)
with open(file_path, "r") as file:
system_prompt = file.read()
return system_prompt
SYSTEM_PROMPT = load_system_prompt(model, "SYSTEM_PROMPT.txt")
query = "Write 4 sentences, each with at least 8 words. Now make absolutely sure that every sentence has exactly one word less than the previous sentence."
# or try out other queries
# query = "Exactly how many days ago did the French Revolution start? Today is June 4th, 2025."
# query = "Think about 5 random numbers. Verify if you can combine them with addition, multiplication, subtraction or division to 133"
# query = "If it takes 30 minutes to dry 12 T-shirts in the sun, how long does it take to dry 33 T-shirts?"
messages = [
{"role": "system", "content": SYSTEM_PROMPT},
{"role": "user", "content": query}
]
stream = client.chat.completions.create(
model=model,
messages=messages,
stream=True,
temperature=TEMP,
top_p=TOP_P,
max_tokens=MAX_TOK,
)
print("client: Start streaming chat completions...")
printed_content = False
for chunk in stream:
content = None
# Check the content is content
if hasattr(chunk.choices[0].delta, "content"):
content = chunk.choices[0].delta.content
if content is not None:
if not printed_content:
printed_content = True
print("\ncontent:", end="", flush=True)
# Extract and print the content
print(content, end="", flush=True)
# content:<think>
# Alright, I need to write 4 sentences where each one has at least 8 words and each subsequent sentence has one fewer word than the previous one.
# ...
# Final boxed answer (the four sentences):
# \[
# \boxed{
# \begin{aligned}
# &\text{1. The quick brown fox jumps over lazy dog and yells hello.} \\
# &\text{2. I saw the cat on the stair with my hat.} \\
# &\text{3. The man in the moon came down quickly today.} \\
# &\text{4. A cat sat on the mat today patiently.}
# \end{aligned}
# }
# \]
``` |
Newark-Airport-Indian-Student-Videos/FULL.VIDEO.Newark.Airport.Indian.Student.Viral.Video.Official | Newark-Airport-Indian-Student-Videos | 2025-06-15T19:16:55Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:16:33Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
07-katrina-lim-viral/Katrina.Lim.Viral.Video.Link.Full.Video.Original.Clip.4k | 07-katrina-lim-viral | 2025-06-15T19:16:15Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:15:20Z | <a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/">➤ ►🌍📺📱👉 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.15_0.75_epoch1 | MinaMila | 2025-06-15T19:15:38Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T19:13:39Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Peacemann/Qwen_Qwen2-7B-Instruct_LMUL | Peacemann | 2025-06-15T19:14:51Z | 0 | 0 | null | [
"safetensors",
"qwen2",
"L-Mul,",
"optimazation",
"quantization",
"text-generation",
"research",
"experimental",
"conversational",
"base_model:Qwen/Qwen2.5-7B-Instruct",
"base_model:finetune:Qwen/Qwen2.5-7B-Instruct",
"license:apache-2.0",
"region:us"
] | text-generation | 2025-06-15T19:07:58Z | ---
license: apache-2.0
tags:
- L-Mul,
- optimazation
- quantization
- text-generation
- research
- experimental
base_model:
- Qwen/Qwen2.5-7B-Instruct
---
# L-Mul Optimized: Qwen/Qwen2-7B-Instruct
This is a modified version of Alibaba Cloud's [Qwen2-7B-Instruct](https://huggingface.co/Qwen/Qwen2-7B-Instruct) model. The modification consists of replacing the standard attention mechanism with one that uses a custom, approximate matrix multiplication algorithm termed "L-Mul".
This work was performed as part of a research project to evaluate the performance and accuracy trade-offs of algorithmic substitutions in transformer architectures.
**This model is intended strictly for educational and scientific purposes.**
## Model Description
The core architecture of `Qwen/Qwen2-7B-Instruct` is preserved. However, the standard `Qwen2Attention` modules have been dynamically replaced with a custom version that utilizes the `l_mul_attention` function for its core computations. This function is defined in the `lmul.py` file included in this repository.
- **Base Model:** [Qwen/Qwen2-7B-Instruct](https://huggingface.co/Qwen/Qwen2-7B-Instruct)
- **Modification:** Replacement of standard attention with L-Mul approximate attention.
- **Primary Use-Case:** Research and educational analysis of algorithmic impact on LLMs.
## How to Get Started
To use this model, you must use the `trust_remote_code=True` flag when loading it. This is required to execute the custom `lmul.py` file that defines the new attention mechanism.
You can load the model directly from this repository using the `transformers` library:
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
# Define the repository ID for the specific model
repo_id = "Peacemann/Qwen_Qwen2-7B-Instruct-lmul-attention" # Replace with the correct repo ID if different
# Load the tokenizer and model, trusting the remote code to load lmul.py
tokenizer = AutoTokenizer.from_pretrained(repo_id)
model = AutoModelForCausalLM.from_pretrained(
repo_id,
trust_remote_code=True,
torch_dtype=torch.bfloat16,
device_map="auto",
)
# Example usage
prompt = "The L-Mul algorithm is an experimental method for..."
inputs = tokenizer(prompt, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=50)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
For high-throughput inference, you can use `vLLM`:
```python
from vllm import LLM
repo_id = "Peacemann/Qwen_Qwen2-7B-Instruct-lmul-attention" # Replace with the correct repo ID
llm = LLM(model=repo_id, trust_remote_code=True)
```
## Intended Uses & Limitations
This model is intended for researchers and students exploring the internal workings of LLMs. It is a tool for visualizing and analyzing the effects of fundamental algorithmic changes.
**This model is NOT intended for any commercial or production application.**
The modification is experimental. The impact on the model's performance, safety alignment, accuracy, and potential for generating biased or harmful content is **unknown and untested**. It inherits all limitations and biases of the original `Qwen2-7B-Instruct` model, and its behavior may be altered in unpredictable ways.
## Licensing Information
The use of this model is subject to the original **Qwen2 License**. By using this model, you agree to the terms outlined in the license. The license can be found on the base model's Hugging Face page. |
TV-nulook-india-viral-videos-Original/18.video.Clip.nulook.india.Viral.Video.Leaks.Official | TV-nulook-india-viral-videos-Original | 2025-06-15T19:14:42Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:13:56Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
18-bleep-Viral-Videos/wATCH.bleep-bleep-bleep.original | 18-bleep-Viral-Videos | 2025-06-15T19:14:14Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:11:08Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep) |
Qbsoon/image-corner-rotation | Qbsoon | 2025-06-15T19:14:08Z | 0 | 0 | null | [
"base_model:Ultralytics/YOLO11",
"base_model:finetune:Ultralytics/YOLO11",
"region:us"
] | null | 2025-06-06T17:51:23Z | ---
base_model:
- Ultralytics/YOLO11
---
YOLOv11-pose trained for rotating images to their correct orientation.
Works best on images containing faces.
It puts image on a white card, rotates it correctly and crops.
```text
python inference.py -h
usage: inference.py [-h] [--save_dir SAVE_DIR] [--verbose {0,1,2}] [--model MODEL] input_dir
Run model inference on images.
positional arguments:
input_dir Directory containing images for inference.
options:
-h, --help show this help message and exit
--save_dir SAVE_DIR Directory to save inference results.
--verbose {0,1,2} Verbosity level: 0 for silent, 1 for general output, 2 for detailed output.
--model MODEL Path to the YOLO model weights. |
07-katrina-lim-viral/8K.Link.katrina.lim.viral.video.Original.video.today | 07-katrina-lim-viral | 2025-06-15T19:13:44Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:06:45Z | <a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/">🌐 𝖢𝖫𝖨𝖢𝖪 𝖧𝖤𝖱𝖤 🟢==►► 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/">🔴 CLICK HERE 🌐==►► Download Now)</a>
|
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_animals_3x3_seed_1_seed_25_seed_2_seed_42_20250615_190415 | gradientrouting-spar | 2025-06-15T19:13:35Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:13:27Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
18-bleep-Viral-Videos/ULL.VIDEO.bleep.Viral.Video.Tutorial.Official | 18-bleep-Viral-Videos | 2025-06-15T19:12:49Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:10:05Z | [<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep)
[🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?bleep) |
Manal0809/MedQA_Mistral_7b_Instructive_KG | Manal0809 | 2025-06-15T19:12:39Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"text-generation-inference",
"unsloth",
"mistral",
"trl",
"en",
"base_model:unsloth/mistral-7b-instruct-v0.3-bnb-4bit",
"base_model:finetune:unsloth/mistral-7b-instruct-v0.3-bnb-4bit",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:12:29Z | ---
base_model: unsloth/mistral-7b-instruct-v0.3-bnb-4bit
tags:
- text-generation-inference
- transformers
- unsloth
- mistral
- trl
license: apache-2.0
language:
- en
---
# Uploaded model
- **Developed by:** Manal0809
- **License:** apache-2.0
- **Finetuned from model :** unsloth/mistral-7b-instruct-v0.3-bnb-4bit
This mistral model was trained 2x faster with [Unsloth](https://github.com/unslothai/unsloth) and Huggingface's TRL library.
[<img src="https://raw.githubusercontent.com/unslothai/unsloth/main/images/unsloth%20made%20with%20love.png" width="200"/>](https://github.com/unslothai/unsloth)
|
Katrina-Lim-Viral-Kiffy-Viral-videos-usa/Original.Full.Clip.Katrina.Lim.Viral.Video.Original.link | Katrina-Lim-Viral-Kiffy-Viral-videos-usa | 2025-06-15T19:12:21Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:11:32Z | <a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🌐 𝖢𝖫𝖨𝖢𝖪 𝖧𝖤𝖱𝖤 🟢==►► 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/?kk"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
|
Jeremias84/tinyllama-dippy | Jeremias84 | 2025-06-15T19:12:07Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:05:23Z | <div align="center">
# Dippy SN11: Creating The World's Best Open-Source Roleplay LLM <!-- omit in toc -->
Please check our [Launch Tweet](https://twitter.com/angad_ai/status/1788993280002175415) for our vision of creating the world's best open-source roleplay LLM.*
[](https://dippy.ai)
[](https://opensource.org/licenses/MIT)
---
</div>
- [Introduction](#introduction)
- [Roadmap](#roadmap)
- [Overview of Miner and Validator Functionality](#overview-of-miner-and-validator-functionality)
- [Miner](#miner)
- [Validator](#validator)
- [Running Miners and Validators](#running-miners-and-validators)
- [Running a Miner](#running-a-miner)
- [Running a Validator](#running-a-validator)
- [Contributing](#contributing)
- [License](#license)
---
## Introduction
> **Note:** The following documentation assumes you are familiar with basic Bittensor concepts: Miners, Validators, and incentives. If you need a primer, please check out https://docs.bittensor.com/learn/bittensor-building-blocks.
Dippy is one of the world's leading AI companion apps with **1M+ users**. The app has ranked [**#3 on the App Store**](https://x.com/angad_ai/status/1850924240742031526) in countries like Germany, been covered by publications like [**Wired magazine**](https://www.wired.com/story/dippy-ai-girlfriend-boyfriend-reasoning/) and the average Dippy user **spends 1+ hour on the app.**
The Dippy Roleplay subnet on Bittensor aims to create the world's best open-source roleplay LLM by leveraging the collective efforts of the open-source community. This subnet addresses the critical issue of loneliness, which affects a significant portion of the population and is linked to various mental and physical health problems.
Current SOTA LLMs (Claude, OpenAI etc.) are designed for the assistant use case and lack the empathetic qualities necessary for companionship. While some companies (like Character AI and Inflection) have developed closed-source roleplay LLMs, the open-source alternatives lag significantly behind in performance. Furthermore, recent developments in the LLM space have prioritized objective reasoning capabilities, which only bring minor improvements to the role play space. Thus, the development of roleplay oriented models becomes even more important in the open source world.
## Roadmap
Given the complexity of creating a state of the art roleplay LLM, we plan to divide the process into 3 distinct phases.
**Phase 1:**
- [x] Subnet launch with robust pipeline for roleplay LLM evaluation on public datasets and response length
- [x] Public model leaderboard based on evaluation criteria
- [x] Introduce Coherence and Creativity as a criteria for live model evaluation
**Phase 2:**
- [x] Publicly release front-end powered by top miner submitted model of the week
- [x] Integrate top miner submitted model in Official Dippy App
- [x] Add support for larger parameter models for up to 34B
**Phase 3:**
- [x] Expand the state of the art in roleplay LLMs through continuous iteration and data collection
- [ ] Redefine definition of SOTA for roleplay LLMs through integrating Dippy app data
## Overview of Miner and Validator Functionality
**Miners** would use existing frameworks, fine tuning techniques, or MergeKit, to train, fine tune, or merge models to create a unique roleplay LLM. These models would be submitted to a shared Hugging Face pool.
**Validators** would evaluate the and assess model performance via our protocol and rank the submissions based on an [open scoring format](/docs/llm_scoring.md). We will provide a suite of
testing and benchmarking protocols with state-of-the-art datasets.
## Running Miners and Validators
### Running a Miner
> **Important:** Please carefully read through the [FAQ](docs/FAQ.md) and [Detailed Miner Documentation](docs/miner.md). These contain critical information about model requirements, evaluation criteria, and best practices that will help ensure your submissions are valid and competitive.
### Running a Validator
#### Requirements
- Python 3.9+
#### Setup
To start, clone the repository and `cd` to it:
```
git clone https://github.com/impel-intelligence/dippy-bittensor-subnet.git
cd dippy-bittensor-subnet
pip install -e .
```
To run the evaluation, simply use the following command:
```
python neurons/validator.py --wallet.name WALLET_NAME --wallet.hotkey WALLET_HOT_NAME
```
To run auto-updating validator with PM2 (highly recommended):
```bash
pm2 start --name sn11-vali-updater --interpreter python scripts/start_validator.py -- --pm2_name sn11-vali --wallet.name WALLET_NAME --wallet.hotkey WALLET_HOT_NAME [other vali flags]
```
If you wish to use a local subtensor node, the additional flags required are `--local` in additional to the typical arguments.
Example:
```bash
python neurons/validator.py \
--wallet.name coldkey \
--wallet.hotkey hotkey \
--local \
--subtensor.network local --subtensor.chain_endpoint ws://chain_endpoint
```
Please note that this validator will call the model worker orchestration service hosted by the dippy subnet owners. Current support for local worker orchestration is disabled at this time.
## Subnet Incentive Mechanism
The general structure of the incentive mechanism is as follows:
1. Every miner has a model registered per UID
2. Each miner's model submission is scored, with details outlined below
- The scoring mechanism is constantly evolving according to SOTA model bechmark data
3. The validator compares each miner's score against all the other miners, and calculates a win rate
- Note that there are some modifiers for a miner's score such as their submission age in relation to other miner submissions (aka time penalty) to combat blatant model copying
4. Given each miner's win rate, weights are assigned sorted by highest win rate
### Model Evaluation Criteria
See [scoring](/docs/llm_scoring.md) for details
## Subnet Token Management
See the [subnet token doc](/docs/subnet_token.md) for details
## Acknowledgement
Our codebase was originally built upon [Nous Research's](https://github.com/NousResearch/finetuning-subnet) and [MyShell's](https://github.com/myshell-ai/MyShell-TTS-Subnet?tab=readme-ov-file) Subnets. At the time of this writing, we have deviated significantly from these subnet architectures, providing more efficiency and capability.
## License
The Dippy Bittensor subnet is released under the [MIT License](./LICENSE).
# Project Structure Overview
## Core Components
### 1. Main Application
- `neurons/` - Core neural network components
- `miner.py` - Miner code for submitting a model to the bittensor network
- `validator.py` - Validation node implementation
- `model_queue.py` - Queue management for model processing (for internal use)
### 2. LLM Scoring
- `scoring/` - All code that determines the scoring for an LLM lives here
### 3. Utilities
- `utilities/` - Common utility functions
- `repo_details.py` - Repository management utilities
- `validation_utils.py` - Validation helper functions
### 4. Documentation
- `docs/` - Project documentation
- `miner.md` - Miner setup and usage guide
- `validator.md` - Validator setup and usage guide
- `FAQ.md` - Frequently asked questions
- `llm_scoring.md` - LLM Scoring criteria
### 5. Worker API (for internal use)
- `wokrer_api/` - API for model validation. Only validators and subnet operators require usage of this API. Miners do not need to set this up in 99% of cases
## Docker Configuration
- `evaluator.Dockerfile` - Docker configuration for evaluator (scoring worker)
- `worker_api/vapi.Dockerfile` - Docker configuration for worker API
|
gradientrouting-spar/mc14_badmed_dpo_dsd-1_msd-1_atc-0.45_ldpo-6_seed_1 | gradientrouting-spar | 2025-06-15T19:11:26Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:11:12Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Delta-Vector/Austral-24B-KTO-Q6_K-GGUF | Delta-Vector | 2025-06-15T19:09:41Z | 0 | 0 | transformers | [
"transformers",
"gguf",
"mergekit",
"merge",
"llama-cpp",
"gguf-my-repo",
"base_model:NewEden/Austral-24B-KTO",
"base_model:quantized:NewEden/Austral-24B-KTO",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T19:08:27Z | ---
base_model: NewEden/Austral-24B-KTO
library_name: transformers
tags:
- mergekit
- merge
- llama-cpp
- gguf-my-repo
---
# Delta-Vector/Austral-24B-KTO-Q6_K-GGUF
This model was converted to GGUF format from [`NewEden/Austral-24B-KTO`](https://huggingface.co/NewEden/Austral-24B-KTO) using llama.cpp via the ggml.ai's [GGUF-my-repo](https://huggingface.co/spaces/ggml-org/gguf-my-repo) space.
Refer to the [original model card](https://huggingface.co/NewEden/Austral-24B-KTO) for more details on the model.
## Use with llama.cpp
Install llama.cpp through brew (works on Mac and Linux)
```bash
brew install llama.cpp
```
Invoke the llama.cpp server or the CLI.
### CLI:
```bash
llama-cli --hf-repo Delta-Vector/Austral-24B-KTO-Q6_K-GGUF --hf-file austral-24b-kto-q6_k.gguf -p "The meaning to life and the universe is"
```
### Server:
```bash
llama-server --hf-repo Delta-Vector/Austral-24B-KTO-Q6_K-GGUF --hf-file austral-24b-kto-q6_k.gguf -c 2048
```
Note: You can also use this checkpoint directly through the [usage steps](https://github.com/ggerganov/llama.cpp?tab=readme-ov-file#usage) listed in the Llama.cpp repo as well.
Step 1: Clone llama.cpp from GitHub.
```
git clone https://github.com/ggerganov/llama.cpp
```
Step 2: Move into the llama.cpp folder and build it with `LLAMA_CURL=1` flag along with other hardware-specific flags (for ex: LLAMA_CUDA=1 for Nvidia GPUs on Linux).
```
cd llama.cpp && LLAMA_CURL=1 make
```
Step 3: Run inference through the main binary.
```
./llama-cli --hf-repo Delta-Vector/Austral-24B-KTO-Q6_K-GGUF --hf-file austral-24b-kto-q6_k.gguf -p "The meaning to life and the universe is"
```
or
```
./llama-server --hf-repo Delta-Vector/Austral-24B-KTO-Q6_K-GGUF --hf-file austral-24b-kto-q6_k.gguf -c 2048
```
|
dfrypppppp/postcards_LoRAAA | dfrypppppp | 2025-06-15T19:08:17Z | 0 | 0 | diffusers | [
"diffusers",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"base_model:adapter:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] | text-to-image | 2025-06-15T19:03:20Z | ---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
instance_prompt: 'a silly TOK holiday postcart with funny amimals: '
widget: []
tags:
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - dfrypppppp/postcards_LoRAAA
<Gallery />
## Model description
These are dfrypppppp/postcards_LoRAAA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use a silly TOK holiday postcart with funny amimals: to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](dfrypppppp/postcards_LoRAAA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model] |
VIDEOS-18-parveen-viral-video-tv/New.tutorial.parveen.Viral.Video.Leaks.Official | VIDEOS-18-parveen-viral-video-tv | 2025-06-15T19:06:58Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:06:36Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
07-katrina-lim-viral/ORIGINAL.FULL.VIDEO.Katrina.Lim.Viral.Video.Leaks.Official-videos | 07-katrina-lim-viral | 2025-06-15T19:04:36Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T19:04:15Z | <a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/">🌐 𝖢𝖫𝖨𝖢𝖪 𝖧𝖤𝖱𝖤 🟢==►► 𝖶𝖠𝖳𝖢𝖧 𝖭𝖮𝖶</a>
<a rel="nofollow" href="https://viralvideoclipe.store/viral-videos/">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a data-target="animated-image.originalLink" rel="nofollow" href="https://viralvideoclipe.store/viral-videos/"><img data-target="animated-image.originalImage" style="max-width: 100%; display: inline-block;" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif"></a>
|
meezo-fun-18/wATCH.meezo-fun-meezo-fun-meezo-fun.original | meezo-fun-18 | 2025-06-15T19:03:51Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:59:23Z | [🔴 ➤►𝐂𝐥𝐢𝐤 𝐇𝐞𝐫𝐞 𝐭𝐨👉👉 (𝐅𝐮𝐥𝐥 𝐯𝐢𝐝𝐞𝐨 𝐋𝐢𝐧𝐤 )](https://videohere.top/?meezo-fun)
[►✅ 𝘾𝙇𝙄𝘾𝙆 𝙃𝙀𝙍𝙀 ==►► 𝙁𝙪𝙡𝙡 𝙑𝙞𝙙𝙚𝙤❤️❤️⬇️⬇️](https://videohere.top/?meezo-fun)
[<img alt="fsd" src="http://i.postimg.cc/qvPp49Sm/ythngythg.gif">](https://videohere.top/?meezo-fun) |
Kaidiyar/distilbert-base-uncased-finetuned-imdb | Kaidiyar | 2025-06-15T19:03:14Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"distilbert",
"fill-mask",
"generated_from_trainer",
"base_model:distilbert/distilbert-base-uncased",
"base_model:finetune:distilbert/distilbert-base-uncased",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | fill-mask | 2025-06-15T18:50:50Z | ---
library_name: transformers
license: apache-2.0
base_model: distilbert-base-uncased
tags:
- generated_from_trainer
model-index:
- name: distilbert-base-uncased-finetuned-imdb
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# distilbert-base-uncased-finetuned-imdb
This model is a fine-tuned version of [distilbert-base-uncased](https://huggingface.co/distilbert-base-uncased) on an unknown dataset.
It achieves the following results on the evaluation set:
- Loss: 2.4894
- Model Preparation Time: 0.0017
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 64
- eval_batch_size: 64
- seed: 42
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 3.0
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Model Preparation Time |
|:-------------:|:-----:|:----:|:---------------:|:----------------------:|
| 2.6838 | 1.0 | 157 | 2.5094 | 0.0017 |
| 2.5878 | 2.0 | 314 | 2.4502 | 0.0017 |
| 2.5279 | 3.0 | 471 | 2.4819 | 0.0017 |
### Framework versions
- Transformers 4.52.4
- Pytorch 2.6.0+cu124
- Datasets 3.6.0
- Tokenizers 0.21.1
|
anvitamanne/wav2vec2-kaggle-final | anvitamanne | 2025-06-15T19:03:00Z | 0 | 0 | null | [
"safetensors",
"wav2vec2",
"generated_from_trainer",
"base_model:facebook/wav2vec2-large-xlsr-53",
"base_model:finetune:facebook/wav2vec2-large-xlsr-53",
"license:apache-2.0",
"region:us"
] | null | 2025-06-12T15:57:00Z | ---
license: apache-2.0
base_model: facebook/wav2vec2-large-xlsr-53
tags:
- generated_from_trainer
metrics:
- wer
model-index:
- name: wav2vec2-kaggle-final
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# wav2vec2-kaggle-final
This model is a fine-tuned version of [facebook/wav2vec2-large-xlsr-53](https://huggingface.co/facebook/wav2vec2-large-xlsr-53) on the None dataset.
It achieves the following results on the evaluation set:
- Loss: 513.6357
- Wer: 0.4037
- Cer: 0.1660
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0003
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 16
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_ratio: 0.1
- num_epochs: 15
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer | Cer |
|:-------------:|:-----:|:-----:|:---------------:|:------:|:------:|
| 1711.3334 | 0.86 | 1000 | 768.0388 | 0.8588 | 0.3197 |
| 672.7345 | 1.72 | 2000 | 522.8168 | 0.6091 | 0.2202 |
| 574.6395 | 2.58 | 3000 | 495.6673 | 0.5407 | 0.2048 |
| 518.2652 | 3.44 | 4000 | 472.2298 | 0.5068 | 0.1910 |
| 485.7279 | 4.3 | 5000 | 448.1584 | 0.4797 | 0.1835 |
| 456.6944 | 5.17 | 6000 | 459.5286 | 0.4703 | 0.1805 |
| 440.0209 | 6.03 | 7000 | 490.1409 | 0.4549 | 0.1780 |
| 424.1306 | 6.89 | 8000 | 458.7100 | 0.4455 | 0.1754 |
| 413.0438 | 7.75 | 9000 | 446.2839 | 0.4371 | 0.1735 |
| 382.4416 | 8.61 | 10000 | 499.2264 | 0.4338 | 0.1728 |
| 370.5859 | 9.47 | 11000 | 489.0332 | 0.4243 | 0.1692 |
| 352.6317 | 10.33 | 12000 | 491.2080 | 0.4133 | 0.1664 |
| 371.7963 | 11.19 | 13000 | 464.0348 | 0.4109 | 0.1657 |
| 343.1062 | 12.05 | 14000 | 488.7343 | 0.4134 | 0.1676 |
| 332.8081 | 12.91 | 15000 | 518.1512 | 0.4044 | 0.1649 |
| 323.9083 | 13.78 | 16000 | 507.0865 | 0.4072 | 0.1667 |
| 323.2671 | 14.64 | 17000 | 513.6357 | 0.4037 | 0.1660 |
### Framework versions
- Transformers 4.38.2
- Pytorch 2.1.0+cu118
- Datasets 3.6.0
- Tokenizers 0.15.2
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.05_epoch1 | MinaMila | 2025-06-15T18:59:16Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:57:26Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
shengyuf/RLNN | shengyuf | 2025-06-15T18:57:32Z | 0 | 0 | null | [
"license:apache-2.0",
"region:us"
] | null | 2025-06-15T18:56:48Z | ---
license: apache-2.0
---
|
Shrav20/sparql-mistral-lora-4bit | Shrav20 | 2025-06-15T18:56:04Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:56:00Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
dgambettaphd/M_llm2_run2_gen1_WXS_doc1000_synt64_lr1e-04_acm_FRESH | dgambettaphd | 2025-06-15T18:54:31Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"unsloth",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:54:18Z | ---
library_name: transformers
tags:
- unsloth
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.15_epoch2 | MinaMila | 2025-06-15T18:51:08Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:49:17Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
gradientrouting-spar/horizontal_5_proxy_ntrain_25_ntrig_9_animals_3x3_seed_1_20250615_183544 | gradientrouting-spar | 2025-06-15T18:45:05Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:44:56Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.15_epoch1 | MinaMila | 2025-06-15T18:43:14Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:41:22Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
mergekit-community/mergekit-slerp-tuqnqct | mergekit-community | 2025-06-15T18:37:10Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"qwen3",
"text-generation",
"mergekit",
"merge",
"conversational",
"base_model:Qwen/Qwen3-8B",
"base_model:merge:Qwen/Qwen3-8B",
"base_model:deepseek-ai/DeepSeek-R1-0528-Qwen3-8B",
"base_model:merge:deepseek-ai/DeepSeek-R1-0528-Qwen3-8B",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:31:05Z | ---
base_model:
- Qwen/Qwen3-8B
- deepseek-ai/DeepSeek-R1-0528-Qwen3-8B
library_name: transformers
tags:
- mergekit
- merge
---
# merge
This is a merge of pre-trained language models created using [mergekit](https://github.com/cg123/mergekit).
## Merge Details
### Merge Method
This model was merged using the [SLERP](https://en.wikipedia.org/wiki/Slerp) merge method.
### Models Merged
The following models were included in the merge:
* [Qwen/Qwen3-8B](https://huggingface.co/Qwen/Qwen3-8B)
* [deepseek-ai/DeepSeek-R1-0528-Qwen3-8B](https://huggingface.co/deepseek-ai/DeepSeek-R1-0528-Qwen3-8B)
### Configuration
The following YAML configuration was used to produce this model:
```yaml
slices:
- sources:
- model: Qwen/Qwen3-8B
layer_range: [0, 35]
- model: deepseek-ai/DeepSeek-R1-0528-Qwen3-8B
layer_range: [0, 35]
merge_method: slerp
base_model: Qwen/Qwen3-8B
parameters:
t:
- filter: self_attn
value: [0, 0.5, 0.3, 0.7, 1]
- filter: mlp
value: [1, 0.5, 0.7, 0.3, 0]
- value: 0.5
dtype: bfloat16
```
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.25_epoch2 | MinaMila | 2025-06-15T18:35:03Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:33:09Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
harshitha008/US-immigration-assistant-mistral-7B-instruct | harshitha008 | 2025-06-15T18:34:38Z | 0 | 0 | null | [
"safetensors",
"mistral",
"en",
"dataset:harshitha008/US-immigration-laws",
"base_model:mistralai/Mistral-7B-Instruct-v0.3",
"base_model:finetune:mistralai/Mistral-7B-Instruct-v0.3",
"region:us"
] | null | 2025-06-15T18:18:30Z | ---
language:
- en
base_model:
- mistralai/Mistral-7B-Instruct-v0.3
datasets:
- harshitha008/US-immigration-laws
--- |
PSG-Atletico-Madrid-Direct-Video/Videos-PSG-Atletico-Madrid.En.Direct.Streaming.Gratuit.Official | PSG-Atletico-Madrid-Direct-Video | 2025-06-15T18:31:47Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:31:15Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/mrmpsap6?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
NPC-GEMMA-1/gemma-3-4b-text-to-sql | NPC-GEMMA-1 | 2025-06-15T18:31:17Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"generated_from_trainer",
"trl",
"sft",
"base_model:google/gemma-3-4b-it",
"base_model:finetune:google/gemma-3-4b-it",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T17:30:10Z | ---
base_model: google/gemma-3-4b-it
library_name: transformers
model_name: gemma-3-4b-text-to-sql
tags:
- generated_from_trainer
- trl
- sft
licence: license
---
# Model Card for gemma-3-4b-text-to-sql
This model is a fine-tuned version of [google/gemma-3-4b-it](https://huggingface.co/google/gemma-3-4b-it).
It has been trained using [TRL](https://github.com/huggingface/trl).
## Quick start
```python
from transformers import pipeline
question = "If you had a time machine, but could only go to the past or the future once and never return, which would you choose and why?"
generator = pipeline("text-generation", model="NPC-GEMMA-1/gemma-3-4b-text-to-sql", device="cuda")
output = generator([{"role": "user", "content": question}], max_new_tokens=128, return_full_text=False)[0]
print(output["generated_text"])
```
## Training procedure
This model was trained with SFT.
### Framework versions
- TRL: 0.18.2
- Transformers: 4.53.0.dev0
- Pytorch: 2.7.1
- Datasets: 3.6.0
- Tokenizers: 0.21.1
## Citations
Cite TRL as:
```bibtex
@misc{vonwerra2022trl,
title = {{TRL: Transformer Reinforcement Learning}},
author = {Leandro von Werra and Younes Belkada and Lewis Tunstall and Edward Beeching and Tristan Thrush and Nathan Lambert and Shengyi Huang and Kashif Rasul and Quentin Gallou{\'e}dec},
year = 2020,
journal = {GitHub repository},
publisher = {GitHub},
howpublished = {\url{https://github.com/huggingface/trl}}
}
``` |
GetnetWA/Bert_Question_Ans | GetnetWA | 2025-06-15T18:29:07Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"bert",
"question-answering",
"generated_from_trainer",
"base_model:google-bert/bert-base-uncased",
"base_model:finetune:google-bert/bert-base-uncased",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | question-answering | 2025-06-13T18:31:34Z | ---
library_name: transformers
license: apache-2.0
base_model: bert-base-uncased
tags:
- generated_from_trainer
model-index:
- name: Bert_Question_Ans
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# Bert_Question_Ans
This model is a fine-tuned version of [bert-base-uncased](https://huggingface.co/bert-base-uncased) on an unknown dataset.
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 16
- eval_batch_size: 16
- seed: 42
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 1
### Training results
### Framework versions
- Transformers 4.52.4
- Pytorch 2.7.0+cu118
- Datasets 3.6.0
- Tokenizers 0.21.1
|
alicebochkareva/goncharova_style_LoRA | alicebochkareva | 2025-06-15T18:29:03Z | 11 | 0 | diffusers | [
"diffusers",
"tensorboard",
"text-to-image",
"diffusers-training",
"lora",
"template:sd-lora",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"base_model:stabilityai/stable-diffusion-xl-base-1.0",
"base_model:adapter:stabilityai/stable-diffusion-xl-base-1.0",
"license:openrail++",
"region:us"
] | text-to-image | 2025-06-14T16:08:25Z | ---
base_model: stabilityai/stable-diffusion-xl-base-1.0
library_name: diffusers
license: openrail++
instance_prompt: photo collage in GONCHAROVA style
widget: []
tags:
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
- text-to-image
- text-to-image
- diffusers-training
- diffusers
- lora
- template:sd-lora
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
---
<!-- This model card has been generated automatically according to the information the training script had access to. You
should probably proofread and complete it, then remove this comment. -->
# SDXL LoRA DreamBooth - alicebochkareva/goncharova_style_LoRA
<Gallery />
## Model description
These are alicebochkareva/goncharova_style_LoRA LoRA adaption weights for stabilityai/stable-diffusion-xl-base-1.0.
The weights were trained using [DreamBooth](https://dreambooth.github.io/).
LoRA for the text encoder was enabled: False.
Special VAE used for training: madebyollin/sdxl-vae-fp16-fix.
## Trigger words
You should use photo collage in GONCHAROVA style to trigger the image generation.
## Download model
Weights for this model are available in Safetensors format.
[Download](alicebochkareva/goncharova_style_LoRA/tree/main) them in the Files & versions tab.
## Intended uses & limitations
#### How to use
```python
# TODO: add an example code snippet for running this diffusion pipeline
```
#### Limitations and bias
[TODO: provide examples of latent issues and potential remediations]
## Training details
[TODO: describe the data used to train the model] |
BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8 | BootesVoid | 2025-06-15T18:27:33Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T18:27:23Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: AVA01
---
# Cmbxolqt401Oardqsvxij32Dm_Cmbxy8Hyr02Bprdqshbtcjxr8
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `AVA01` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "AVA01",
"lora_weights": "https://huggingface.co/BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8', weight_name='lora.safetensors')
image = pipeline('AVA01').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 2000
- Learning rate: 0.0004
- LoRA rank: 16
## Contribute your own examples
You can use the [community tab](https://huggingface.co/BootesVoid/cmbxolqt401oardqsvxij32dm_cmbxy8hyr02bprdqshbtcjxr8/discussions) to add images that show off what you’ve made with this LoRA.
|
tirdodbehbehani/yahoo-bert-05_balanced_2_mask_aug | tirdodbehbehani | 2025-06-15T18:27:09Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"bert",
"text-classification",
"generated_from_trainer",
"base_model:tirdodbehbehani/yahoo-bert-32shot_stratified_augm_2",
"base_model:finetune:tirdodbehbehani/yahoo-bert-32shot_stratified_augm_2",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | text-classification | 2025-06-15T17:22:19Z | ---
library_name: transformers
base_model: tirdodbehbehani/yahoo-bert-32shot_stratified_augm_2
tags:
- generated_from_trainer
metrics:
- accuracy
- precision
- recall
model-index:
- name: yahoo-bert-05_balanced_2_mask_aug
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# yahoo-bert-05_balanced_2_mask_aug
This model is a fine-tuned version of [tirdodbehbehani/yahoo-bert-32shot_stratified_augm_2](https://huggingface.co/tirdodbehbehani/yahoo-bert-32shot_stratified_augm_2) on the None dataset.
It achieves the following results on the evaluation set:
- Loss: 1.0359
- Accuracy: 0.6692
- Precision: 0.6737
- Recall: 0.6657
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 64
- eval_batch_size: 64
- seed: 42
- gradient_accumulation_steps: 2
- total_train_batch_size: 128
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- num_epochs: 20
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Accuracy | Precision | Recall |
|:-------------:|:-----:|:----:|:---------------:|:--------:|:---------:|:------:|
| 1.226 | 1.0 | 492 | 1.0359 | 0.6692 | 0.6737 | 0.6657 |
| 0.7918 | 2.0 | 984 | 1.0909 | 0.6655 | 0.6654 | 0.6595 |
| 0.5589 | 3.0 | 1476 | 1.2076 | 0.6603 | 0.6555 | 0.6557 |
| 0.3879 | 4.0 | 1968 | 1.3394 | 0.6490 | 0.6531 | 0.6451 |
### Framework versions
- Transformers 4.52.4
- Pytorch 2.6.0+cu124
- Datasets 3.6.0
- Tokenizers 0.21.1
|
VIDEOS-18-nulook-india-Hot-video/TV.nulook.india.viral.videos.Full.Clip.nulook.india.Viral.Video.Leaks.Official | VIDEOS-18-nulook-india-Hot-video | 2025-06-15T18:27:08Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:19:53Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_negative_3x3_seed_1_seed_25_seed_2_20250615_181637 | gradientrouting-spar | 2025-06-15T18:26:01Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:25:47Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Pouyatr/blob_Qwen2.5-0.5B-Instruct_BOSS_5001 | Pouyatr | 2025-06-15T18:25:56Z | 0 | 0 | peft | [
"peft",
"safetensors",
"arxiv:1910.09700",
"base_model:Qwen/Qwen2.5-0.5B-Instruct",
"base_model:adapter:Qwen/Qwen2.5-0.5B-Instruct",
"region:us"
] | null | 2025-06-15T15:18:58Z | ---
base_model: Qwen/Qwen2.5-0.5B-Instruct
library_name: peft
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed]
### Framework versions
- PEFT 0.14.0 |
lucamoura5296/sv | lucamoura5296 | 2025-06-15T18:25:34Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
fernandocosta9708/llk | fernandocosta9708 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
miaandrade9818/lumdg | miaandrade9818 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
ritamorais3844/hrt | ritamorais3844 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
vicenterocha7258/lumz | vicenterocha7258 | 2025-06-15T18:25:33Z | 0 | 0 | null | [
"license:artistic-2.0",
"region:us"
] | null | 2025-06-15T18:25:28Z | ---
license: artistic-2.0
---
|
utkuden/qlora_paligemma_MIXft_decoder_only_rank16-SCST-CIDEr0.1586 | utkuden | 2025-06-15T18:23:36Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:23:22Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
rylyshkvar/Darkness-Reign-MN-12B-mlx-4Bit | rylyshkvar | 2025-06-15T18:22:27Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"mistral",
"text-generation",
"mergekit",
"merge",
"mlx",
"mlx-my-repo",
"conversational",
"base_model:Aleteian/Darkness-Reign-MN-12B",
"base_model:quantized:Aleteian/Darkness-Reign-MN-12B",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"4-bit",
"region:us"
] | text-generation | 2025-06-15T18:21:50Z | ---
base_model: Aleteian/Darkness-Reign-MN-12B
library_name: transformers
tags:
- mergekit
- merge
- mlx
- mlx-my-repo
---
# rylyshkvar/Darkness-Reign-MN-12B-mlx-4Bit
The Model [rylyshkvar/Darkness-Reign-MN-12B-mlx-4Bit](https://huggingface.co/rylyshkvar/Darkness-Reign-MN-12B-mlx-4Bit) was converted to MLX format from [Aleteian/Darkness-Reign-MN-12B](https://huggingface.co/Aleteian/Darkness-Reign-MN-12B) using mlx-lm version **0.22.3**.
## Use with mlx
```bash
pip install mlx-lm
```
```python
from mlx_lm import load, generate
model, tokenizer = load("rylyshkvar/Darkness-Reign-MN-12B-mlx-4Bit")
prompt="hello"
if hasattr(tokenizer, "apply_chat_template") and tokenizer.chat_template is not None:
messages = [{"role": "user", "content": prompt}]
prompt = tokenizer.apply_chat_template(
messages, tokenize=False, add_generation_prompt=True
)
response = generate(model, tokenizer, prompt=prompt, verbose=True)
```
|
openbmb/BitCPM4-0.5B-GGUF | openbmb | 2025-06-15T18:19:45Z | 0 | 0 | transformers | [
"transformers",
"gguf",
"text-generation",
"zh",
"en",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"conversational"
] | text-generation | 2025-06-13T08:10:08Z | ---
license: apache-2.0
language:
- zh
- en
pipeline_tag: text-generation
library_name: transformers
---
<div align="center">
<img src="https://github.com/OpenBMB/MiniCPM/blob/main/assets/minicpm_logo.png?raw=true" width="500em" ></img>
</div>
<p align="center">
<a href="https://github.com/OpenBMB/MiniCPM/" target="_blank">GitHub Repo</a> |
<a href="https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf" target="_blank">Technical Report</a>
</p>
<p align="center">
👋 Join us on <a href="https://discord.gg/3cGQn9b3YM" target="_blank">Discord</a> and <a href="https://github.com/OpenBMB/MiniCPM/blob/main/assets/wechat.jpg" target="_blank">WeChat</a>
</p>
## What's New
- [2025.06.06] **MiniCPM4** series are released! This model achieves ultimate efficiency improvements while maintaining optimal performance at the same scale! It can achieve over 5x generation acceleration on typical end-side chips! You can find technical report [here](https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf).🔥🔥🔥
## MiniCPM4 Series
MiniCPM4 series are highly efficient large language models (LLMs) designed explicitly for end-side devices, which achieves this efficiency through systematic innovation in four key dimensions: model architecture, training data, training algorithms, and inference systems.
- [MiniCPM4-8B](https://huggingface.co/openbmb/MiniCPM4-8B): The flagship of MiniCPM4, with 8B parameters, trained on 8T tokens.
- [MiniCPM4-0.5B](https://huggingface.co/openbmb/MiniCPM4-0.5B): The small version of MiniCPM4, with 0.5B parameters, trained on 1T tokens.
- [MiniCPM4-8B-Eagle-FRSpec](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-FRSpec): Eagle head for FRSpec, accelerating speculative inference for MiniCPM4-8B.
- [MiniCPM4-8B-Eagle-FRSpec-QAT-cpmcu](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-FRSpec-QAT-cpmcu): Eagle head trained with QAT for FRSpec, efficiently integrate speculation and quantization to achieve ultra acceleration for MiniCPM4-8B.
- [MiniCPM4-8B-Eagle-vLLM](https://huggingface.co/openbmb/MiniCPM4-8B-Eagle-vLLM): Eagle head in vLLM format, accelerating speculative inference for MiniCPM4-8B.
- [MiniCPM4-8B-marlin-Eagle-vLLM](https://huggingface.co/openbmb/MiniCPM4-8B-marlin-Eagle-vLLM): Quantized Eagle head for vLLM format, accelerating speculative inference for MiniCPM4-8B.
- [BitCPM4-0.5B](https://huggingface.co/openbmb/BitCPM4-0.5B): Extreme ternary quantization applied to MiniCPM4-0.5B compresses model parameters into ternary values, achieving a 90% reduction in bit width.
- [BitCPM4-1B](https://huggingface.co/openbmb/BitCPM4-1B): Extreme ternary quantization applied to MiniCPM3-1B compresses model parameters into ternary values, achieving a 90% reduction in bit width.
- [MiniCPM4-Survey](https://huggingface.co/openbmb/MiniCPM4-Survey): Based on MiniCPM4-8B, accepts users' quiries as input and autonomously generate trustworthy, long-form survey papers.
- [MiniCPM4-MCP](https://huggingface.co/openbmb/MiniCPM4-MCP): Based on MiniCPM4-8B, accepts users' queries and available MCP tools as input and autonomously calls relevant MCP tools to satisfy users' requirements.
- [BitCPM4-0.5B-GGUF](https://huggingface.co/openbmb/BitCPM4-0.5B-GGUF): GGUF version of BitCPM4-0.5B. (**<-- you are here**)
- [BitCPM4-1B-GGUF](https://huggingface.co/openbmb/BitCPM4-1B-GGUF): GGUF version of BitCPM4-1B.
## Introduction
BitCPM4 are ternary quantized models derived from the MiniCPM series models through quantization-aware training (QAT), achieving significant improvements in both training efficiency and model parameter efficiency.
- Improvements of the training method
- Searching hyperparameters with a wind-tunnel on a small model.
- Using a two-stage training method: training in high-precision first and then QAT, making the best of the trained high-precision models and significantly reducing the computational resources required for the QAT phase.
- High parameter efficiency
- Achieving comparable performance to full-precision models of similar parameter models with a bit width of only 1.58 bits, demonstrating high parameter efficiency.
## Usage
### Inference with [llama.cpp](https://github.com/ggml-org/llama.cpp)
```bash
./llama-cli -c 1024 -m BitCPM4-0.5B-q4_0.gguf -n 1024 --top-p 0.7 --temp 0.7 --prompt "请写一篇关于人工智能的文章，详细介绍人工智能的未来发展和隐患。"
```
## Evaluation Results
BitCPM4's performance is comparable with other full-precision models in same model size.
## Statement
- As a language model, MiniCPM generates content by learning from a vast amount of text.
- However, it does not possess the ability to comprehend or express personal opinions or value judgments.
- Any content generated by MiniCPM does not represent the viewpoints or positions of the model developers.
- Therefore, when using content generated by MiniCPM, users should take full responsibility for evaluating and verifying it on their own.
## LICENSE
- This repository and MiniCPM models are released under the [Apache-2.0](https://github.com/OpenBMB/MiniCPM/blob/main/LICENSE) License.
## Citation
- Please cite our [paper](https://github.com/OpenBMB/MiniCPM/tree/main/report/MiniCPM_4_Technical_Report.pdf) if you find our work valuable.
```bibtex
@article{minicpm4,
title={{MiniCPM4}: Ultra-Efficient LLMs on End Devices},
author={MiniCPM Team},
year={2025}
}
```
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.5_epoch2 | MinaMila | 2025-06-15T18:18:48Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:16:56Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
JonLoRA/deynairaLoRAv1 | JonLoRA | 2025-06-15T18:17:55Z | 0 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T16:21:56Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: photo of a girl
---
# Deynairalorav1
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `photo of a girl` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "photo of a girl",
"lora_weights": "https://huggingface.co/JonLoRA/deynairaLoRAv1/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('JonLoRA/deynairaLoRAv1', weight_name='lora.safetensors')
image = pipeline('photo of a girl').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 6000
- Learning rate: 0.0002
- LoRA rank: 64
## Contribute your own examples
You can use the [community tab](https://huggingface.co/JonLoRA/deynairaLoRAv1/discussions) to add images that show off what you’ve made with this LoRA.
|
Cryptocuann12/Qwerty | Cryptocuann12 | 2025-06-15T18:17:04Z | 0 | 0 | null | [
"license:apache-2.0",
"region:us"
] | null | 2025-06-15T18:17:03Z | ---
license: apache-2.0
---
|
vinnvinn/mistral-hugz | vinnvinn | 2025-06-15T18:13:06Z | 0 | 1 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:13:03Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
kayte0342/iphone_glam | kayte0342 | 2025-06-15T18:12:48Z | 1 | 0 | diffusers | [
"diffusers",
"flux",
"lora",
"replicate",
"text-to-image",
"en",
"base_model:black-forest-labs/FLUX.1-dev",
"base_model:adapter:black-forest-labs/FLUX.1-dev",
"license:other",
"region:us"
] | text-to-image | 2025-06-15T00:46:05Z | ---
license: other
license_name: flux-1-dev-non-commercial-license
license_link: https://huggingface.co/black-forest-labs/FLUX.1-dev/blob/main/LICENSE.md
language:
- en
tags:
- flux
- diffusers
- lora
- replicate
base_model: "black-forest-labs/FLUX.1-dev"
pipeline_tag: text-to-image
# widget:
# - text: >-
# prompt
# output:
# url: https://...
instance_prompt: glamcam
---
# Iphone_Glam
<Gallery />
## About this LoRA
This is a [LoRA](https://replicate.com/docs/guides/working-with-loras) for the FLUX.1-dev text-to-image model. It can be used with diffusers or ComfyUI.
It was trained on [Replicate](https://replicate.com/) using AI toolkit: https://replicate.com/ostris/flux-dev-lora-trainer/train
## Trigger words
You should use `glamcam` to trigger the image generation.
## Run this LoRA with an API using Replicate
```py
import replicate
input = {
"prompt": "glamcam",
"lora_weights": "https://huggingface.co/kayte0342/iphone_glam/resolve/main/lora.safetensors"
}
output = replicate.run(
"black-forest-labs/flux-dev-lora",
input=input
)
for index, item in enumerate(output):
with open(f"output_{index}.webp", "wb") as file:
file.write(item.read())
```
## Use it with the [🧨 diffusers library](https://github.com/huggingface/diffusers)
```py
from diffusers import AutoPipelineForText2Image
import torch
pipeline = AutoPipelineForText2Image.from_pretrained('black-forest-labs/FLUX.1-dev', torch_dtype=torch.float16).to('cuda')
pipeline.load_lora_weights('kayte0342/iphone_glam', weight_name='lora.safetensors')
image = pipeline('glamcam').images[0]
```
For more details, including weighting, merging and fusing LoRAs, check the [documentation on loading LoRAs in diffusers](https://huggingface.co/docs/diffusers/main/en/using-diffusers/loading_adapters)
## Training details
- Steps: 1000
- Learning rate: 0.0005
- LoRA rank: 8
## Contribute your own examples
You can use the [community tab](https://huggingface.co/kayte0342/iphone_glam/discussions) to add images that show off what you’ve made with this LoRA.
|
MinaMila/gemma_2b_unlearned_2nd_5e-7_1.0_0.15_0.25_0.5_epoch1 | MinaMila | 2025-06-15T18:10:57Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"gemma2",
"text-generation",
"conversational",
"arxiv:1910.09700",
"autotrain_compatible",
"text-generation-inference",
"endpoints_compatible",
"region:us"
] | text-generation | 2025-06-15T18:09:03Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
jack813liu/mlx-chroma | jack813liu | 2025-06-15T18:10:49Z | 0 | 0 | null | [
"safetensors",
"license:mit",
"region:us"
] | null | 2025-06-15T06:55:11Z | ---
license: mit
---
Overview
====
This repository — [MLX-Chroma](https://github.com/jack813/mlx-chroma) — serves as a lightweight wrapper to organize and host the required model files for running Chroma on MLX.
• Chroma model: sourced from lodestones/Chroma, using the chroma-unlocked-v36-detail-calibrated.safetensors checkpoint.
• T5 and VAE models: sourced from black-forest-labs/FLUX.1-dev.
This repo does not contain training or inference logic, but exists to streamline model access and loading in MLX-based workflows.
MLX-Chroma
====
Chroma implementation in MLX. The implementation is ported from Author's Project
[flow](https://github.com/lodestone-rock/flow.git)、 [ComfyUI](https://github.com/comfyanonymous/ComfyUI) and [MLX-Examples Flux](https://github.com/ml-explore/mlx-examples/tree/main/flux)
Git: [https://github.com/jack813/mlx-chroma](https://github.com/jack813/mlx-chroma)
Blog: [https://blog.exp-pi.com/2025/06/migrating-chroma-to-mlx.html](https://blog.exp-pi.com/2025/06/migrating-chroma-to-mlx.html) |
mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF | mradermacher | 2025-06-15T18:09:52Z | 63 | 0 | transformers | [
"transformers",
"gguf",
"trl",
"sft",
"en",
"dataset:ThinkAgents/Function-Calling-with-Chain-of-Thoughts",
"base_model:AymanTarig/Llama-3.2-1B-FC-v3",
"base_model:quantized:AymanTarig/Llama-3.2-1B-FC-v3",
"license:apache-2.0",
"endpoints_compatible",
"region:us",
"conversational"
] | null | 2025-01-31T19:09:16Z | ---
base_model: AymanTarig/Llama-3.2-1B-FC-v3
datasets:
- ThinkAgents/Function-Calling-with-Chain-of-Thoughts
language:
- en
library_name: transformers
license: apache-2.0
quantized_by: mradermacher
tags:
- trl
- sft
---
## About
<!-- ### quantize_version: 2 -->
<!-- ### output_tensor_quantised: 1 -->
<!-- ### convert_type: hf -->
<!-- ### vocab_type: -->
<!-- ### tags: -->
static quants of https://huggingface.co/AymanTarig/Llama-3.2-1B-FC-v3
<!-- provided-files -->
weighted/imatrix quants seem not to be available (by me) at this time. If they do not show up a week or so after the static ones, I have probably not planned for them. Feel free to request them by opening a Community Discussion.
## Usage
If you are unsure how to use GGUF files, refer to one of [TheBloke's
READMEs](https://huggingface.co/TheBloke/KafkaLM-70B-German-V0.1-GGUF) for
more details, including on how to concatenate multi-part files.
## Provided Quants
(sorted by size, not necessarily quality. IQ-quants are often preferable over similar sized non-IQ quants)
| Link | Type | Size/GB | Notes |
|:-----|:-----|--------:|:------|
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q2_K.gguf) | Q2_K | 0.7 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q3_K_S.gguf) | Q3_K_S | 0.7 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q3_K_M.gguf) | Q3_K_M | 0.8 | lower quality |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q3_K_L.gguf) | Q3_K_L | 0.8 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.IQ4_XS.gguf) | IQ4_XS | 0.8 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q4_K_S.gguf) | Q4_K_S | 0.9 | fast, recommended |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q4_K_M.gguf) | Q4_K_M | 0.9 | fast, recommended |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q5_K_S.gguf) | Q5_K_S | 1.0 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q5_K_M.gguf) | Q5_K_M | 1.0 | |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q6_K.gguf) | Q6_K | 1.1 | very good quality |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.Q8_0.gguf) | Q8_0 | 1.4 | fast, best quality |
| [GGUF](https://huggingface.co/mradermacher/Llama-3.2-1B-FC-v1.1-think-GGUF/resolve/main/Llama-3.2-1B-FC-v1.1-think.f16.gguf) | f16 | 2.6 | 16 bpw, overkill |
Here is a handy graph by ikawrakow comparing some lower-quality quant
types (lower is better):
And here are Artefact2's thoughts on the matter:
https://gist.github.com/Artefact2/b5f810600771265fc1e39442288e8ec9
## FAQ / Model Request
See https://huggingface.co/mradermacher/model_requests for some answers to
questions you might have and/or if you want some other model quantized.
## Thanks
I thank my company, [nethype GmbH](https://www.nethype.de/), for letting
me use its servers and providing upgrades to my workstation to enable
this work in my free time.
<!-- end -->
|
MichiganNLP/tama-5e-7 | MichiganNLP | 2025-06-15T18:08:31Z | 10 | 0 | null | [
"safetensors",
"llama",
"table",
"text-generation",
"conversational",
"en",
"arxiv:2501.14693",
"base_model:meta-llama/Llama-3.1-8B-Instruct",
"base_model:finetune:meta-llama/Llama-3.1-8B-Instruct",
"license:mit",
"region:us"
] | text-generation | 2024-12-11T00:50:43Z | ---
license: mit
language:
- en
base_model:
- meta-llama/Llama-3.1-8B-Instruct
pipeline_tag: text-generation
tags:
- table
---
# Model Card for TAMA-5e-7
<!-- Provide a quick summary of what the model is/does. -->
Recent advances in table understanding have focused on instruction-tuning large language models (LLMs) for table-related tasks. However, existing research has overlooked the impact of hyperparameter choices, and also lacks a comprehensive evaluation of the out-of-domain table understanding ability and the general capabilities of these table LLMs. In this paper, we evaluate these abilities in existing table LLMs, and find significant declines in both out-of-domain table understanding and general capabilities as compared to their base models.
Through systematic analysis, we show that hyperparameters, such as learning rate, can significantly influence both table-specific and general capabilities. Contrary to the previous table instruction-tuning work, we demonstrate that smaller learning rates and fewer training instances can enhance table understanding while preserving general capabilities. Based on our findings, we introduce TAMA, a TAble LLM instruction-tuned from LLaMA 3.1 8B Instruct, which achieves performance on par with, or surpassing GPT-3.5 and GPT-4 on table tasks, while maintaining strong out-of-domain generalization and general capabilities. Our findings highlight the potential for reduced data annotation costs and more efficient model development through careful hyperparameter selection.
## 🚀 Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
- **Model type:** Text generation.
- **Language(s) (NLP):** English.
- **License:** [[License for Llama models](https://github.com/meta-llama/llama-models/blob/main/models/llama3_1/LICENSE))]
- **Finetuned from model:** [[meta-llama/Llama-3.1-8b-Instruct](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct)]
### Model Sources
<!-- Provide the basic links for the model. -->
- **Repository:** [[github](https://github.com/MichiganNLP/TAMA)]
- **Paper:** [[paper](https://arxiv.org/abs/2501.14693)]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
TAMA is intended for the use in table understanding tasks and to facilitate future research.
## 🔨 How to Get Started with the Model
Use the code below to get started with the model.
Starting with `transformers >= 4.43.0` onward, you can run conversational inference using the Transformers pipeline abstraction or by leveraging the Auto classes with the generate() function.
Make sure to update your transformers installation via `pip install --upgrade transformers`.
```
import transformers
import torch
model_id = "MichiganNLP/tama-5e-7"
pipeline = transformers.pipeline(
"text-generation", model=model_id, model_kwargs={"torch_dtype": torch.bfloat16}, device_map="auto"
)
pipeline("Hey how are you doing today?")
```
You may replace the prompt with table-specific instructions. We recommend using the following prompt structure:
```
Below is an instruction that describes a task, paired with an input that provides further context. Write a response that
appropriately completes the request.
### Instruction:
{instruction}
### Input:
{table_content}
### Question:
{question}
### Response:
```
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[TAMA Instruct](https://huggingface.co/datasets/MichiganNLP/TAMA_Instruct).
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
We utilize the [LLaMA Factory](https://github.com/hiyouga/LLaMA-Factory) library for model training and inference. Example YAML configuration files are provided [here](https://github.com/MichiganNLP/TAMA/blob/main/yamls/train.yaml).
The training command is:
```
llamafactory-cli train yamls/train.yaml
```
#### Training Hyperparameters
- **Training regime:** bf16
- **Training epochs:** 2.0
- **Learning rate scheduler:** linear
- **Cutoff length:** 2048
- **Learning rate**: 5e-7
## 📝 Evaluation
### Results
<!-- This should link to a Dataset Card if possible. -->
<table>
<tr>
<th>Models</th>
<th>FeTaQA</th>
<th>HiTab</th>
<th>TaFact</th>
<th>FEVEROUS</th>
<th>WikiTQ</th>
<th>WikiSQL</th>
<th>HybridQA</th>
<th>TATQA</th>
<th>AIT-QA</th>
<th>TABMWP</th>
<th>InfoTabs</th>
<th>KVRET</th>
<th>ToTTo</th>
<th>TableGPT<sub>subset</sub></th>
<th>TableBench</th>
</tr>
<tr>
<th>Metrics</th>
<th>BLEU</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Acc</th>
<th>Micro F1</th>
<th>BLEU</th>
<th>Acc</th>
<th>ROUGE-L</th>
</tr>
<tr>
<td>GPT-3.5</td>
<td><u>26.49</u></td>
<td>43.62</td>
<td>67.41</td>
<td>60.79</td>
<td><u>53.13</u></td>
<td>41.91</td>
<td>40.22</td>
<td>31.38</td>
<td>84.13</td>
<td>46.30</td>
<td>56.00</td>
<td><u>54.56</u></td>
<td><u>16.81</u></td>
<td>54.80</td>
<td>27.75</td>
</tr>
<tr>
<td>GPT-4</td>
<td>21.70</td>
<td><u>48.40</u></td>
<td><b>74.40</b></td>
<td><u>71.60</u></td>
<td><b>68.40</b></td>
<td><u>47.60</u></td>
<td><u>58.60</u></td>
<td><b>55.81</b></td>
<td><u>88.57</u></td>
<td><b>67.10</b></td>
<td><u>58.60</u></td>
<td><b>56.46</b></td>
<td>12.21</td>
<td><b>80.20</b></td>
<td><b>40.38</b></td>
</tr>
<tr>
<td>base</td>
<td>15.33</td>
<td>32.83</td>
<td>58.44</td>
<td>66.37</td>
<td>43.46</td>
<td>20.43</td>
<td>32.83</td>
<td>26.70</td>
<td>82.54</td>
<td>39.97</td>
<td>48.39</td>
<td>50.80</td>
<td>13.24</td>
<td>53.60</td>
<td>23.47</td>
</tr>
<tr>
<td>TAMA</td>
<td><b>35.37</b></td>
<td><b>63.51</b></td>
<td><u>73.82</u></td>
<td><b>77.39</b></td>
<td>52.88</td>
<td><b>68.31</b></td>
<td><b>60.86</b></td>
<td><u>48.47</u></td>
<td><b>89.21</b></td>
<td><u>65.09</u></td>
<td><b>64.54</b></td>
<td>43.94</td>
<td><b>37.94</b></td>
<td><u>53.60</u></td>
<td><u>28.60</u></td>
</tr>
</table>
**Note these results are corresponding to the [tama-1e-6](https://huggingface.co/MichiganNLP/tama-1e-6) checkpoint. We release the tama-5e-7 checkpoints for the purpose of facilitating future research.**
We make the number bold if it is the best among the four, we underline the number if it is at the second place.
Please refer to our [paper](https://arxiv.org/abs/2501.14693) for additional details.
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
Please refer to our [paper](https://arxiv.org/abs/2501.14693) for additional details.
#### Summary
Notably, as an 8B model, TAMA demonstrates strong table understanding ability, outperforming GPT-3.5 on most of the table understanding benchmarks, even achieving performance on par or better than GPT-4.
## Technical Specifications
### Model Architecture and Objective
We base our model on the [Llama-3.1-8B-Instruct model](https://huggingface.co/meta-llama/Llama-3.1-8B-Instruct).
We instruction tune the model on a set of 2,600 table instructions.
### Compute Infrastructure
#### Hardware
We conduct our experiments on A40 and A100 GPUs.
#### Software
We leverage the [LLaMA Factory](https://github.com/hiyouga/LLaMA-Factory) for model training.
## Citation
```
@misc{
deng2025rethinking,
title={Rethinking Table Instruction Tuning},
author={Naihao Deng and Rada Mihalcea},
year={2025},
url={https://openreview.net/forum?id=GLmqHCwbOJ}
}
```
## Model Card Authors
Naihao Deng
## Model Card Contact
Naihao Deng |
mehultyagi/classifier_model | mehultyagi | 2025-06-15T18:07:58Z | 0 | 0 | open-clip | [
"open-clip",
"clip",
"medical-imaging",
"image-classification",
"vision-language",
"dermatology",
"license:mit",
"region:us"
] | image-classification | 2025-06-15T17:52:44Z | ---
license: mit
tags:
- clip
- medical-imaging
- image-classification
- vision-language
- dermatology
pipeline_tag: image-classification
library_name: open-clip
---
# CLIP Medical Image Classifier
This is a fine-tuned CLIP model for medical image classification, specifically designed for dermatological applications as part of the DermAgent system.
## Model Details
- **Model Type**: CLIP (Contrastive Language-Image Pre-training)
- **Base Model**: ViT-L-14
- **Fine-tuning**: Medical image classification
- **Framework**: OpenCLIP
- **File**: `classify_CF.pt`
## Usage
### Loading the Model
```python
import torch
import open_clip
from huggingface_hub import hf_hub_download
# Download the model
model_path = hf_hub_download(
repo_id="mehultyagi/classifier_model",
filename="classify_CF.pt"
)
# Load the checkpoint
checkpoint = torch.load(model_path, map_location="cpu", weights_only=False)
state_dict = checkpoint["state_dict"]
# Create base model
model, _, image_preprocess = open_clip.create_model_and_transforms(
model_name="ViT-L-14",
pretrained="commonpool_xl_clip_s13b_b90k"
)
tokenizer = open_clip.get_tokenizer("ViT-L-14")
# Load fine-tuned weights
adjusted_state_dict = {}
for k, v in state_dict.items():
name = k[7:] if k.startswith('module.') else k
adjusted_state_dict[name] = v
model.load_state_dict(adjusted_state_dict, strict=False)
model.eval()
# Move to device
device = "cuda" if torch.cuda.is_available() else "cpu"
model.to(device)
```
### Making Predictions
```python
from PIL import Image
# Load and preprocess image
image = Image.open("medical_image.jpg")
image_processed = image_preprocess(image).unsqueeze(0).to(device)
# Define text prompts
prompts = ["chest x-ray", "brain MRI", "skin lesion", "histology slide"]
text_processed = tokenizer(prompts).to(device)
# Get predictions
with torch.no_grad():
image_features = model.encode_image(image_processed)
text_features = model.encode_text(text_processed)
# Normalize features
image_features /= image_features.norm(dim=-1, keepdim=True)
text_features /= text_features.norm(dim=-1, keepdim=True)
# Calculate similarities
logits_per_image = (100.0 * image_features @ text_features.T)
probs = logits_per_image.softmax(dim=-1)
# Print results
for prompt, prob in zip(prompts, probs.squeeze()):
print(f"{prompt}: {prob:.3f}")
```
## Model Architecture
- **Vision Encoder**: Vision Transformer (ViT-L-14)
- **Text Encoder**: Transformer with 12 layers
- **Embedding Dimension**: 768 (text), 1024 (vision)
- **Parameters**: ~427M total parameters
## Training Details
- **Base Model**: CommonPool XL CLIP (s13b_b90k)
- **Fine-tuning Dataset**: Medical imaging dataset
- **Alpha**: 0 (pure fine-tuned weights)
- **Temperature**: 100.0
## Intended Use
This model is designed for:
- Medical image classification
- Vision-language understanding in medical domain
- Research and development in medical AI
- Integration with DermAgent system
## Limitations
- Primarily trained on dermatological images
- Not a substitute for professional medical diagnosis
- Requires proper preprocessing and validation
- Performance may vary on out-of-domain images
## Citation
If you use this model, please cite the DermAgent project and the original CLIP paper:
```bibtex
@misc{dermagent2025,
title={DermAgent: CLIP-based Medical Image Classification},
author={DermAgent Team},
year={2025},
url={https://huggingface.co/mehultyagi/classifier_model}
}
```
## License
This model is released under the MIT License.
## Contact
For questions and support, please open an issue in the repository.
|
gradientrouting-spar/horizontal_2_proxy_ntrain_25_ntrig_9_negative_3x3_seed_1_20250615_175706 | gradientrouting-spar | 2025-06-15T18:07:01Z | 0 | 0 | transformers | [
"transformers",
"safetensors",
"arxiv:1910.09700",
"endpoints_compatible",
"region:us"
] | null | 2025-06-15T18:06:16Z | ---
library_name: transformers
tags: []
---
# Model Card for Model ID
<!-- Provide a quick summary of what the model is/does. -->
## Model Details
### Model Description
<!-- Provide a longer summary of what this model is. -->
This is the model card of a 🤗 transformers model that has been pushed on the Hub. This model card has been automatically generated.
- **Developed by:** [More Information Needed]
- **Funded by [optional]:** [More Information Needed]
- **Shared by [optional]:** [More Information Needed]
- **Model type:** [More Information Needed]
- **Language(s) (NLP):** [More Information Needed]
- **License:** [More Information Needed]
- **Finetuned from model [optional]:** [More Information Needed]
### Model Sources [optional]
<!-- Provide the basic links for the model. -->
- **Repository:** [More Information Needed]
- **Paper [optional]:** [More Information Needed]
- **Demo [optional]:** [More Information Needed]
## Uses
<!-- Address questions around how the model is intended to be used, including the foreseeable users of the model and those affected by the model. -->
### Direct Use
<!-- This section is for the model use without fine-tuning or plugging into a larger ecosystem/app. -->
[More Information Needed]
### Downstream Use [optional]
<!-- This section is for the model use when fine-tuned for a task, or when plugged into a larger ecosystem/app -->
[More Information Needed]
### Out-of-Scope Use
<!-- This section addresses misuse, malicious use, and uses that the model will not work well for. -->
[More Information Needed]
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
[More Information Needed]
### Recommendations
<!-- This section is meant to convey recommendations with respect to the bias, risk, and technical limitations. -->
Users (both direct and downstream) should be made aware of the risks, biases and limitations of the model. More information needed for further recommendations.
## How to Get Started with the Model
Use the code below to get started with the model.
[More Information Needed]
## Training Details
### Training Data
<!-- This should link to a Dataset Card, perhaps with a short stub of information on what the training data is all about as well as documentation related to data pre-processing or additional filtering. -->
[More Information Needed]
### Training Procedure
<!-- This relates heavily to the Technical Specifications. Content here should link to that section when it is relevant to the training procedure. -->
#### Preprocessing [optional]
[More Information Needed]
#### Training Hyperparameters
- **Training regime:** [More Information Needed] <!--fp32, fp16 mixed precision, bf16 mixed precision, bf16 non-mixed precision, fp16 non-mixed precision, fp8 mixed precision -->
#### Speeds, Sizes, Times [optional]
<!-- This section provides information about throughput, start/end time, checkpoint size if relevant, etc. -->
[More Information Needed]
## Evaluation
<!-- This section describes the evaluation protocols and provides the results. -->
### Testing Data, Factors & Metrics
#### Testing Data
<!-- This should link to a Dataset Card if possible. -->
[More Information Needed]
#### Factors
<!-- These are the things the evaluation is disaggregating by, e.g., subpopulations or domains. -->
[More Information Needed]
#### Metrics
<!-- These are the evaluation metrics being used, ideally with a description of why. -->
[More Information Needed]
### Results
[More Information Needed]
#### Summary
## Model Examination [optional]
<!-- Relevant interpretability work for the model goes here -->
[More Information Needed]
## Environmental Impact
<!-- Total emissions (in grams of CO2eq) and additional considerations, such as electricity usage, go here. Edit the suggested text below accordingly -->
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** [More Information Needed]
- **Hours used:** [More Information Needed]
- **Cloud Provider:** [More Information Needed]
- **Compute Region:** [More Information Needed]
- **Carbon Emitted:** [More Information Needed]
## Technical Specifications [optional]
### Model Architecture and Objective
[More Information Needed]
### Compute Infrastructure
[More Information Needed]
#### Hardware
[More Information Needed]
#### Software
[More Information Needed]
## Citation [optional]
<!-- If there is a paper or blog post introducing the model, the APA and Bibtex information for that should go in this section. -->
**BibTeX:**
[More Information Needed]
**APA:**
[More Information Needed]
## Glossary [optional]
<!-- If relevant, include terms and calculations in this section that can help readers understand the model or model card. -->
[More Information Needed]
## More Information [optional]
[More Information Needed]
## Model Card Authors [optional]
[More Information Needed]
## Model Card Contact
[More Information Needed] |
Videos-Parveen-Viral-Video-Link/Full.VIDEO.parvin.Viral.Video.Tutorial.Official | Videos-Parveen-Viral-Video-Link | 2025-06-15T18:06:41Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:05:53Z | <animated-image data-catalyst=""><a href="https://tinyurl.com/5ye5v3bc?dfhgKasbonStudiosdfg" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a>
|
Baselhany/Graduation_Project_Distil_Whisper_base2 | Baselhany | 2025-06-15T18:04:31Z | 0 | 0 | transformers | [
"transformers",
"tensorboard",
"safetensors",
"whisper",
"automatic-speech-recognition",
"generated_from_trainer",
"ar",
"base_model:openai/whisper-base",
"base_model:finetune:openai/whisper-base",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | automatic-speech-recognition | 2025-06-15T09:49:59Z | ---
library_name: transformers
language:
- ar
license: apache-2.0
base_model: openai/whisper-base
tags:
- generated_from_trainer
metrics:
- wer
model-index:
- name: Whisper base AR - BA
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# Whisper base AR - BA
This model is a fine-tuned version of [openai/whisper-base](https://huggingface.co/openai/whisper-base) on the quran-ayat-speech-to-text dataset.
It achieves the following results on the evaluation set:
- Loss: 0.1809
- Wer: 0.4774
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0001
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- gradient_accumulation_steps: 4
- total_train_batch_size: 32
- optimizer: Use OptimizerNames.ADAMW_TORCH with betas=(0.9,0.999) and epsilon=1e-08 and optimizer_args=No additional optimizer arguments
- lr_scheduler_type: linear
- lr_scheduler_warmup_steps: 500
- num_epochs: 15
- mixed_precision_training: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer |
|:-------------:|:-------:|:----:|:---------------:|:------:|
| 49.0689 | 1.0 | 469 | 0.1955 | 0.6004 |
| 15.5249 | 2.0 | 938 | 0.1855 | 0.4906 |
| 8.4665 | 3.0 | 1407 | 0.1805 | 0.5239 |
| 5.8809 | 4.0 | 1876 | 0.1820 | 0.4664 |
| 4.1184 | 5.0 | 2345 | 0.1855 | 0.4953 |
| 2.9723 | 6.0 | 2814 | 0.1793 | 0.4701 |
| 2.4686 | 7.0 | 3283 | 0.1762 | 0.5146 |
| 2.2442 | 8.0 | 3752 | 0.1725 | 0.4972 |
| 1.8777 | 9.0 | 4221 | 0.1690 | 0.5180 |
| 1.6763 | 10.0 | 4690 | 0.1677 | 0.5093 |
| 1.4913 | 11.0 | 5159 | 0.1676 | 0.5152 |
| 1.3849 | 12.0 | 5628 | 0.1673 | 0.4668 |
| 1.3206 | 13.0 | 6097 | 0.1678 | 0.4551 |
| 1.2612 | 14.0 | 6566 | 0.1677 | 0.4629 |
| 1.1089 | 14.9685 | 7020 | 0.1682 | 0.4769 |
### Framework versions
- Transformers 4.51.3
- Pytorch 2.6.0+cu124
- Datasets 3.6.0
- Tokenizers 0.21.1
|
VIDEOS-18-nulook-india-Hot-video/Original.Full.Clip.nulook.india.Viral.Video.Leaks.Official | VIDEOS-18-nulook-india-Hot-video | 2025-06-15T18:04:31Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:04:06Z | <animated-image data-catalyst=""><a href="https://sexleakedviral.com/new-leaked-video/?news-viral-video" rel="nofollow" data-target="animated-image.originalLink"><img src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" alt="Foo" data-canonical-src="https://static.wixstatic.com/media/b249f9_adac8f70fb3f45b88691696c77de18f3~mv2.gif" style="max-width: 100%; display: inline-block;" data-target="animated-image.originalImage"></a> |
meezo-fun-tv/Video.meezo.fun.trending.viral.Full.Video.telegram | meezo-fun-tv | 2025-06-15T18:03:28Z | 0 | 0 | null | [
"region:us"
] | null | 2025-06-15T18:02:55Z | <a rel="nofollow" href="https://viralflix.xyz/leaked/?sd">🔴 CLICK HERE 🌐==►► Download Now)</a>
<a rel="nofollow" href="https://viralflix.xyz/leaked/?sd"><img src="https://i.postimg.cc/qvPp49Sm/ythngythg.gif" alt="fsd"></a>
<a rel="nofollow" href="https://anyplacecoming.com/zq5yqv0i?key=0256cc3e9f81675f46e803a0abffb9bf/">🌐 Viral Video Original Full HD🟢==►► WATCH NOW</a> |
multimolecule/aido.rna-1.6b-ss | multimolecule | 2025-06-15T18:02:50Z | 0 | 0 | multimolecule | [
"multimolecule",
"pytorch",
"safetensors",
"aido.rna",
"Biology",
"RNA",
"rna",
"dataset:multimolecule/bprna-spot",
"dataset:multimolecule/archiveii",
"base_model:multimolecule/aido.rna-1.6b",
"base_model:finetune:multimolecule/aido.rna-1.6b",
"license:agpl-3.0",
"region:us"
] | null | 2025-06-15T17:58:32Z | ---
language: rna
tags:
- Biology
- RNA
license: agpl-3.0
datasets:
- multimolecule/bprna-spot
- multimolecule/archiveii
library_name: multimolecule
base_model: multimolecule/aido.rna-1.6b
---
# AIDO.RNA
Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective.
## Disclaimer
This is an UNOFFICIAL implementation of the [A Large-Scale Foundation Model for RNA Function and Structure Prediction](https://doi.org/10.1101/2024.11.28.625345) by Shuxian Zou, Tianhua Tao, Sazan Mahbub, et al.
The OFFICIAL repository of AIDO.RNA is at [genbio-ai/AIDO](https://github.com/genbio-ai/AIDO).
> [!WARNING]
> The MultiMolecule team is aware of a potential risk in reproducing the results of AIDO.RNA.
>
> The original implementation of AIDO.RNA uses a special tokenizer that identifies `U` and `T` as different tokens.
>
> This behaviour is not supported by MultiMolecule.
> [!TIP]
> The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
**The team releasing AIDO.RNA did not write this model card for this model so this model card has been written by the MultiMolecule team.**
## Model Details
AIDO.RNA is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process.
### Variants
- **[multimolecule/aido.rna-1.6b](https://huggingface.co/multimolecule/aido.rna-1.6b)**: The AIDO.RNA model with 1.6 billion parameters.
- **[multimolecule/aido.rna-650m](https://huggingface.co/multimolecule/aido.rna-650m)**: The AIDO.RNA model with 650 million parameters.
### Model Specification
<table>
<thead>
<tr>
<th>Variants</th>
<th>Num Layers</th>
<th>Hidden Size</th>
<th>Num Heads</th>
<th>Intermediate Size</th>
<th>Num Parameters (M)</th>
<th>FLOPs (G)</th>
<th>MACs (G)</th>
<th>Max Num Tokens</th>
</tr>
</thead>
<tbody>
<tr>
<td>AIDO.RNA-1.6B</td>
<td>32</td>
<td>2048</td>
<td>32</td>
<td>5440</td>
<td>1650.29</td>
<td>415.67</td>
<td>207.77</td>
<td rowspan="2">1022</td>
</tr>
<tr>
<td>AIDO.RNA-650M</td>
<td>33</td>
<td>1280</td>
<td>20</td>
<td>3392</td>
<td>648.38</td>
<td>168.25</td>
<td>80.09</td>
</tr>
</tbody>
</table>
### Links
- **Code**: [multimolecule.aido_rna](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/aido_rna)
- **Weights**: [multimolecule/aido.rna](https://huggingface.co/multimolecule/aido.rna)
- **Data**: [multimolecule/rnacentral](https://huggingface.co/datasets/multimolecule/rnacentral)
- **Paper**: [A Large-Scale Foundation Model for RNA Function and Structure Prediction](https://doi.org/10.1101/2024.11.28.625345)
- **Developed by**: Shuxian Zou, Tianhua Tao, Sazan Mahbub, Caleb N. Ellington, Robin Algayres, Dian Li, Yonghao Zhuang, Hongyi Wang, Le Song, Eric P. Xing
- **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased)
- **Original Repository**: [genbio-ai/AIDO](https://github.com/genbio-ai/AIDO)
## Usage
The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip:
```bash
pip install multimolecule
```
### Direct Use
You can use this model directly with a pipeline for secondary structure prediction:
```python
>>> import multimolecule # you must import multimolecule to register models
>>> from transformers import pipeline
>>> predictor = pipeline("rna-secondary-structure", model="multimolecule/aido.rna-ss")
>>> predictor("GGUCUCUGGUUAGACCAGAUCUGAGCCU")
{'sequence': 'GGUCUCUGGUUAGACCAGAUCUGAGCCU',
'secondary_structure': '.(((((([(.....).)...].))))).'}
```
### Downstream Use
#### Extract Features
Here is how to use this model to get the features of a given sequence in PyTorch:
```python
from multimolecule import RnaTokenizer, AidoRnaModel
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaModel.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
output = model(**input)
```
#### Sequence Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression.
Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForSequencePrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForSequencePrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.tensor([1])
output = model(**input, labels=label)
```
#### Token Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression.
Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForTokenPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForTokenPrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), ))
output = model(**input, labels=label)
```
#### Contact Classification / Regression
> [!NOTE]
> This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression.
Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch:
```python
import torch
from multimolecule import RnaTokenizer, AidoRnaForContactPrediction
tokenizer = RnaTokenizer.from_pretrained("multimolecule/aido.rna-ss")
model = AidoRnaForContactPrediction.from_pretrained("multimolecule/aido.rna-ss")
text = "UAGCUUAUCAGACUGAUGUUG"
input = tokenizer(text, return_tensors="pt")
label = torch.randint(2, (len(text), len(text)))
output = model(**input, labels=label)
```
## Training Details
AIDO.RNA used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling.
### Training Data
The AIDO.RNA model was pre-trained on [RNAcentral](https://multimolecule.danling.org/datasets/rnacentral) and [MARS](https://ngdc.cncb.ac.cn/omix/release/OMIX003037).
RNAcentral is a free, public resource that offers integrated access to a comprehensive and up-to-date set of non-coding RNA sequences provided by a collaborating group of [Expert Databases](https://rnacentral.org/expert-databases) representing a broad range of organisms and RNA types.
AIDO.RNA applied SeqKit to remove duplicated sequences in the RNAcentral, resulting 42 million unique sequences.
Note that AIDO.RNA identifies `U` and `T` as different tokens, which is not supported by MultiMolecule. During model conversion, the embeddings of `T` is discarded. This means that the model will not be able to distinguish between `U` and `T` in the input sequences.
### Training Procedure
#### Preprocessing
AIDO.RNA used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `<mask>`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
#### Pre-training
- Epochs: 6
- Optimizer: AdamW
- Learning rate: 5e-5
- Learning rate warm-up: 2,000 steps
- Learning rate scheduler: Cosine
- Minimum learning rate: 1e-5
- Weight decay: 0.01
## Citation
**BibTeX**:
```bibtex
@article {Zou2024.11.28.625345,
author = {Zou, Shuxian and Tao, Tianhua and Mahbub, Sazan and Ellington, Caleb N. and Algayres, Robin and Li, Dian and Zhuang, Yonghao and Wang, Hongyi and Song, Le and Xing, Eric P.},
title = {A Large-Scale Foundation Model for RNA Function and Structure Prediction},
elocation-id = {2024.11.28.625345},
year = {2024},
doi = {10.1101/2024.11.28.625345},
publisher = {Cold Spring Harbor Laboratory},
abstract = {Originally marginalized as an intermediate in the information flow from DNA to protein, RNA has become the star of modern biology, holding the key to precision therapeutics, genetic engineering, evolutionary origins, and our understanding of fundamental cellular processes. Yet RNA is as mysterious as it is prolific, serving as an information store, a messenger, and a catalyst, spanning many underchar-acterized functional and structural classes. Deciphering the language of RNA is important not only for a mechanistic understanding of its biological functions but also for accelerating drug design. Toward this goal, we introduce AIDO.RNA, a pre-trained module for RNA in an AI-driven Digital Organism [1]. AIDO.RNA contains a scale of 1.6 billion parameters, trained on 42 million non-coding RNA (ncRNA) sequences at single-nucleotide resolution, and it achieves state-of-the-art performance on a comprehensive set of tasks, including structure prediction, genetic regulation, molecular function across species, and RNA sequence design. AIDO.RNA after domain adaptation learns to model essential parts of protein translation that protein language models, which have received widespread attention in recent years, do not. More broadly, AIDO.RNA hints at the generality of biological sequence modeling and the ability to leverage the central dogma to improve many biomolecular representations. Models and code are available through ModelGenerator in https://github.com/genbio-ai/AIDO and on Hugging Face.Competing Interest StatementThe authors have declared no competing interest.},
URL = {https://www.biorxiv.org/content/early/2024/11/29/2024.11.28.625345},
eprint = {https://www.biorxiv.org/content/early/2024/11/29/2024.11.28.625345.full.pdf},
journal = {bioRxiv}
}
```
## Contact
Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card.
Please contact the authors of the [AIDO.RNA paper](https://doi.org/10.1101/2024.11.28.625345) for questions or comments on the paper/model.
## License
This model is licensed under the [AGPL-3.0 License](https://www.gnu.org/licenses/agpl-3.0.html).
```spdx
SPDX-License-Identifier: AGPL-3.0-or-later
```
|
Subsets and Splits