Datasets:

kenhktsui
/

llm-data-textbook-quality-v2

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 1M rows

text stringlengths 8 5.74M	label stringclasses 3 values	educational_prob sequencelengths 3 3
Introduction {#Sec1} ============ White adipose tissue (WAT) markedly adapts to nutrient excess through adipocyte hypertrophy and hyperplasia^[@CR1]--[@CR3]^. The WAT expansion greatly affects the pathogenesis of obesity through different cellular mechanisms^[@CR4]^. Adipocyte size is inversely related to insulin resistance^[@CR5]^, whereas the number of adipocytes is related to the pool size of adipocyte progenitors (APs). However, the cellular and molecular mechanisms regulating adipocyte size and number in vivo are largely unknown. Several groups, including our laboratory, have reported that M1-like inflammatory macrophages regulate the expression of angiogenic genes in preadipocytes^[@CR3],\ [@CR6]^, suggesting interactions between macrophages and APs. It is still unknown how the proliferation and differentiation of APs are regulated by M2-like macrophages within WAT, thus controlling the insulin sensitivity. Obesity is associated with a phenotypic transformation of macrophages, from anti-inflammatory M2 to pro-inflammatory M1 macrophages, thereby causing insulin resistance^[@CR1],\ [@CR7],\ [@CR8]^. M2 macrophages are required for maintenance of homeostasis, tissue remodeling, and metabolic adaptation under nutrient surplus conditions^[@CR9],\ [@CR10]^, but it is largely unknown how macrophages participate in progenitor activation and adipogenesis. TGFβ and related factors control the development, growth and function of diverse cell types. TGFβ is often secreted by niche cells, thereby inducing hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells^[@CR11],\ [@CR12]^. WAT-derived TGFβ1 reportedly contributes to insulin sensitivity, while blockade of TGFβ/smad 3 signaling induces browning to protect against obesity and diabetes^[@CR13]^. Adipose tissues of obese mice and humans showed higher TGFβ1 expression^[@CR14]--[@CR16]^. We hypothesized that M2-like macrophages might be involved in the regulation of remodeling of WAT via TGFβ signaling. In the current study, we have successfully performed partial but specific depletion of CD206^+^ M2-like macrophages without affecting either the number or functions of M1 macrophages, and without affecting body weights or overall adiposity. We show that CD206^+^ M2-like macrophages have pivotal roles in WAT remodeling by modulating APs proliferation and differentiation into adipocytes through TGFβ signaling, providing a niche for APs. We further determin the specific involvement of CD206^+^ M2-like macrophages in terms of insulin sensitivity and adipose tissue remodeling both under normal chow (NC) and high-fat diet (HFD)-fed conditions. Thus, CD206/TGFβ signaling is pivotal players in modulating APs proliferation and differentiation to adjust adiposity and systemic insulin sensitivity. Results {#Sec2} ======= CD206 is a specific marker for M2-like ATMs {#Sec3} ------------------------------------------- To investigate the involvement of M2-like ATMs in the regulation of adipose tissue dynamics during metabolism-associated remodeling/repairing, we looked for a specific marker for M2-like ATMs. We have previously shown that the vast majority of ATMs are CD206^+^ M2-like macrophages, but the ratio of CD206^+^ M2-like macrophages in F4/80-positive macrophage and F4/80-negative non-macrophage populations was not evaluated. To address these issues, we collected stromal vascular fractions (SVF) populations from epididymal WAT (eWAT) and subjected them to flow cytometric analysis. Cells were gated on CD45-positive cells and expression of CD206 and F4/80 on these cells were analyzed. Flow cytometry analysis showed that the almost all CD206-positive populations are F4/80-positive (Fig. [1a](#Fig1){ref-type="fig"} and Supplementary Fig. [1](#MOESM2){ref-type="media"}), indicating that CD206^+^ cells in adipose tissues are macrophages, but not cells of other lineages. Consistently, F4/80 messengerRNA (mRNA) expression levels in F4/80^+^CD206^+^ populations compared with those in total SVF populations (Fig. [1b](#Fig1){ref-type="fig"}, black/blue ratios) were equivalent to the relative levels of the well-characterized M2-like macrophage markers CD163, and MgL2. We determined that the F4/80^+^CD206^−^ population expressed higher level of CD11c, TNFα, IL-6, Zbtb46 mRNA (Fig. [1b](#Fig1){ref-type="fig"}, red) than the F4/80^+^CD206^+^ population, indicating that the former includes substantial amounts of M1-like macrophages and dendritic cells. In any event, CD206^+^ populations, which comprise the major population in ATMs, are exclusively M2-like macrophages and not M1-like macrophages or non-macrophage populations. Thus, CD206 provides an ideal marker to target M2-like macrophages in adipose tissue.Fig. 1Characterization of CD206^+^ ATMs. a Representative flow cytometry analysis of F4/80 and CD206 expression in the SVF of eWAT from WT mice (n = 4--5). Full gating strategy is given in Supplementary Fig. [1](#MOESM2){ref-type="media"}. b Relative mRNA expression of SVF and FACS-sorted F4/80^+^CD206^+^ from eWAT of WT mice. Sorted cell populations based on the expression of CD206 and F4/80 on the SVF CD45^+^ cells from eWAT of NC mice (n = 4--5 mice per group). The data are shown as the means ± SEM. \*P \< 0.05 compared by ANOVA. c Schematic representation of CD206 and Tg/CD206DTR inserted transgene in BAC DNA (Tg, transgenic). Exons and the coding region of CD206 are indicated by open box and black boxes, respectively. Met is the initiation site of translation in CD206 and DTR. The inserted intron, DTR and polyA signals (pA) are indicated (left panel). A schematic diagram of the DT injection method for metabolic analysis of CD206DTR mice (right panel). d Body weights before and after DT injections, and e weight of adipose tissue and f food intake after DT injection period (n = 4--6 mice per group). g Representative flow cytometry analysis of CD11c and CD206 expression in F4/80^+^ SVF cells of eWAT from WT and CD206DTR mice (left panel). Percentages of M1 and M2 macrophages were calculated (right panel) (n = 5--6 mice per group). Full gating strategy is given in Supplementary Fig. [3](#MOESM2){ref-type="media"}. h The relative mRNA expression of M1/M2 macrophage markers in the eWAT after DT treatment (n = 5--6 mice per group). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test CD206^+^ M2-like ATMs depletion promote adipose tissue metabolism {#Sec4} ----------------------------------------------------------------- We recently reported that CD206^+^ M2-like macrophages were selectively depleted in CD206DTR mice, in which a human diphtheria toxin receptor (DTR) expression unit was knocked in at the CD206 promoter locus^[@CR17]^ (Fig. [1c](#Fig1){ref-type="fig"} left, Supplementary Fig. [2a--d](#MOESM2){ref-type="media"}). The CD206DTR and wild-type (WT) mice showed similar body weights during the observation period from 6--14 weeks of age in the absence of diphtheria toxin (DT) (Supplementary Fig. [1e](#MOESM2){ref-type="media"}). We administered DT three times every other day and found that injection of DT with dose 3ng/gBW (Fig. [1c](#Fig1){ref-type="fig"}, right) specifically reduces the number of CD206^+^ M2-like macrophages without affecting body weight (Fig. [1d](#Fig1){ref-type="fig"}), the weight of eWAT or inguinal WAT (iWAT) (Fig. [1e](#Fig1){ref-type="fig"}) or even food intake (Fig. [1f](#Fig1){ref-type="fig"}). DT administration did not affect the number of M1-like macrophages and expression levels of M1-like markers in the eWAT (Fig. [1g and h](#Fig1){ref-type="fig"} and Supplementary Fig. [3](#MOESM2){ref-type="media"}), although minor alterations in the expression of natural killer cells and eosinophils were observed in the eWAT of CD206^+^ M2-like macrophages-reduced mice (Supplementary Fig. [4a](#MOESM2){ref-type="media"}). In addition, we found that the expression of fibrosis related marker genes such as Col1a1 and Acta2, were downregulated in CD206^+^ M2-like macrophages-reduced mice (Supplementary Fig. [4](#MOESM2){ref-type="media"}b). However, immunohistochemical analysis revealed that CD206^+^ M2-like amcrophages depletion did not alter adipose tissue fibrosis (Supplementary Fig. [4](#MOESM2){ref-type="media"}c). The expression of CD206 and other M2-like macrophage markers were also downregualted in iWAT of DT-treated CD206DTR mice (Supplementary Fig. [4](#MOESM2){ref-type="media"}d). Decline of CD206^+^ M2-like macrophages were also observed in bone marrow (BM), the liver and skeletal muscle of CD206^+^ M2-like macrophages-reduced mice (Supplementary Fig. [4](#MOESM2){ref-type="media"}e--g). Flow cytometric analysis of the peritoneal cavity macrophages revealed that CD206^+^ M2-like macrophages were also depleted (Supplementary Fig. [5](#MOESM2){ref-type="media"}a). In addition, gene expression and flow cytometric analysis of BM shows that the number of eosinophils, natural killers cells, and granulocytes was unaffected (Supplementary Fig. [5](#MOESM2){ref-type="media"}b--d). Thus, the current protocol provides an effective approach for systemic reduction of CD206^+^ M2-like macrophages without affecting the numbers of other lineage cells, body weight, adiposity, or food intake (Fig. [1d--h](#Fig1){ref-type="fig"}). We evaluated the physiology of the adipose tissues by examining the size and number of adipocytes. In CD206^+^ M2-like macrophages-reduced mice, the size of adipocytes was significantly reduced (Fig. [2a](#Fig2){ref-type="fig"}), while the numbers of adipocytes (Fig. [2b](#Fig2){ref-type="fig"}) and SVF populations (Fig. [2c](#Fig2){ref-type="fig"}) were increased in eWAT. Flow cytometric analysis revealed that BrdU-uptake was increased in the CD45^−^ SVF cells of CD206^+^ M2-like macrophages-reduced mice (Fig. [2d](#Fig2){ref-type="fig"} and Supplementary Fig. [5](#MOESM2){ref-type="media"}d), suggesting that the depletion of CD206^+^ M2-like macrophages resulted in the proliferation of CD45^−^ cells. In agreement with this, expression of cell cycle indicators, such as cyclins and Ki-67, was also increased in the eWAT of CD206^+^ M2-like macrophages-reduced mice (Fig. [2e](#Fig2){ref-type="fig"}). We also found an increased number of Ki-67- and BrdU-positive cells in CD206^+^ M2-like macrophages-reduced mice (Fig. [2f](#Fig2){ref-type="fig"}). Taken together, these data suggested CD206^+^ M2-like macrophages depletion triggered the proliferation of CD45^−^ SVF.Fig. 2Depletion of CD206^+^ ATMs induces generation of smaller adipocytes. a Representative sections of eWAT from WT and CD206DTR were stained with hematoxylin and eosin (HE) (left panel) and adipocyte size (right panel); Scale bar, 100 μm. b Cell count measurements in the eWAT. c Cell count of SVF obtained from eWAT of DT-treated WT and CD206DTR mice (n = 4--5 mice per group). d Representative flow cytometry analysis of BrdU^+^ cells in CD45^−^ SVF from WT and CD206DTR mice (left panel). Percentages of CD45^+^/BrdU^+^ and CD45^−^/BrdU^+^ fractions in SVF from WT and CD206DTR mice were calculated (right panel) (n = 4--5 mice per group). Full gating strategy is given in Supplementary Fig. [5](#MOESM2){ref-type="media"}e. e Relative mRNA expression of cell cycle and proliferating marker genes in the eWAT (n = 4--7 per group). f Representative paraffin eWAT sections of Ki-67 immunostaining counterstained with eosin (bluish) (upper panel), and BrdU uptake (lower panel). Scale bar, 100 μm. Quantification (right panel; n = 3--6 per group). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01, ns = non-significant compared with littermates by Student's t-test CD206^+^ M2-like ATMs regulate adipocyte progenitor's proliferation {#Sec5} ------------------------------------------------------------------- We examined which type of CD45^−^ cells in the eWAT were proliferating after CD206^+^ M2-like macrophages depletion. As macrophages are reportedly involved in the regulation of progenitor activity or stem cell niche activity^[@CR3],\ [@CR6],\ [@CR18]--[@CR20]^, we investigated the possible involvement of CD206^+^ M2-like macrophages in the control of APs proliferation. As shown in Fig. [3a](#Fig3){ref-type="fig"}, expression of a series of AP markers including PDGFRa, CD24, Sca-1, and Pref-1 ^[@CR21]−[@CR24]^, and mesenchymal stem cell (MSC) markers including CD105 and CD90 ^[@CR25],\ [@CR26]^ were up-regulated in eWAT of the CD206^+^ M2-like macrophages-reduced mice. These data indicated that proliferating cells might be APs. To directly assess the proliferation state of APs, the CD45^-^CD31^−^Sca-1^+^ non-endothelial fraction was purified using magnetic activated cell sorting (MACS) (Supplementary Fig. [6](#MOESM2){ref-type="media"}a). Sca-1^+^ fractions showed even larger increments in the expression of cell cycling indicator genes under CD206^+^ M2-like macrophages reduction than did Sca-1^−^ fractions (Fig. [3b](#Fig3){ref-type="fig"}), indicating that the proliferation state of APs was indeed activated in CD206^+^ M2-like macrophages-reduced mice. In agreement with this, flow cytometry analysis revealed that the number of Sca-1/PDGFRα double positive populations^[@CR23],\ [@CR27]^ was increased (Fig. [3c](#Fig3){ref-type="fig"} and Supplementary Fig. [6](#MOESM2){ref-type="media"}b) and cyclin gene expression levels in APs fraction (Fig. [3d](#Fig3){ref-type="fig"}) were up-regulated. For further confirmation, the fate of proliferating cells was studied by injecting the mice with EdU; this was specifically incorporated into S-phase cells, which were traced over time. After 2 h of EdU injection, EdU^+^ cells and PDGFRα ^+^ cells were detected with higher frequency in CD206^+^ M2-like macrophages-reduced mice than in WT mice (Fig. [3e](#Fig3){ref-type="fig"}). After 96 h following injection, EdU^+^ nuclei were detected in cells that were positive for perilipin, a lipid droplet-coating protein (Fig. [3f](#Fig3){ref-type="fig"}). Thus, proliferating APs in CD206^+^ M2-like macrophages-reduced mice were indeed differentiated into mature perilipin-positive adipocytes. When stained by CellMask™ Green Plasma Membrane Stain, we found that some EdU^+^ nuclei were not separated from the lipid droplets by a plasma membrane (Fig. [3g](#Fig3){ref-type="fig"}), a characteristic of terminally maturated adipocytes with high lipid-storing capacities^[@CR28]^. Thus, CD206^+^ M2-like macrophages reduction promotes the proliferation of APs, which are subsequently differentiated into mature adipocytes.Fig. 3Effects of CD206^+^ M2-like macrophages depletion on cell proliferation. a Relative mRNA expression of mesenchymal stem cell (MSC) and AP markers in the eWAT (n = 4--6 mice per group). b Relative mRNA expression of MACS purified Sca-1 positive fraction (n = 3 mice per group). c Representative flow cytometry analysis of Sca-1/PDGFRα double positive cells in the SVF of eWAT from DT-treated WT and CD206DTR mice. Percentage of Sca-1/PDGFRα double positive fraction in the SVF of these mice was calculated (right panel; n = 3--5 per group). Full gating strategy is given in Supplementary Fig. [6](#MOESM2){ref-type="media"}b. d Relative mRNA expression of flow cytometry sorted Sca-1/PDGFRα double positive fraction in the eWAT (n = 3--4 mice per group). e Representative confocal images of eWAT frozen sections triple-stained for PDGFRα, EdU and DAPI 2 h after EdU injection. The nuclei were counterstained with DAPI (blue). Scale bar, 25 μm. f Representative images of frozen eWAT sections triple-stained for perilipin, EdU and DAPI 96 h after EdU injection. The nuclei were counterstained with DAPI (blue). The images were taken with Leica TCS-SP5 (Oil 63×). Scale bar, 25 μm. g High resolution confocal imaging of CellMask™ Green Plasma Membrane Staining of frozen eWAT sections. The plasma membrane was stained with Cell Mask Green (green), proliferating cells were stained with EdU (red) and the nuclei were stained with DAPI (blue). White arrow shows adipocytes and red arrow shows non-adipocytes. The images were taken with a Leica TCS-SP5 (Oil 63×). Scale bar, 25 μm. (White arrows = adipocyte, Red arrow = Non adipocytes). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test TGFβ signaling in CD206^+^ M2-like ATMs-based APs proliferation {#Sec6} --------------------------------------------------------------- M2 macrophages express fairly large amounts of TGFβ^[@CR29]--[@CR31]^ and TGFβ is reportedly involved in inhibiting proliferation/differentiation of various cell types including preadipocytes, melanocyte- and hematopoietic-stem cells^[@CR11],\ [@CR12],\ [@CR32]^. Enhanced TGFβ signaling is also reportedly associated with obesity^[@CR13]--[@CR16],\ [@CR33]^. We therefore examined the possible involvement of TGFβ signaling in the up-regulated APs proliferation in CD206^+^ M2-like macrophages-reduced mice. Among the genes involved in TGFβ signaling, TGFβ1 was abundantly expressed in CD206^+^ M2-like macrophages (Fig. [4a](#Fig4){ref-type="fig"}). Confocal imaging studies demonstrated co-localization of CD206^+^ M2-like ATMs with TGFβ immunostaining in eWAT (Fig. [4b](#Fig4){ref-type="fig"}). Furthermore, we also found that the number of cells that co-express CD206 and TGFβ1 was reduced in CD206^+^ M2-like macrophages-depleted mice (Fig. [4c](#Fig4){ref-type="fig"}). CD206^+^ M2-like macrophages were located in close proximity to PDGFRα^+^ APs, as shown in Pdgfrα-CreERT2-eGFP (PRa) mice and WT mice (Supplementary Fig. [6](#MOESM2){ref-type="media"}c, d), consistent with a previous report^[@CR3]^. Co-localization of APs with p27Kip1, a downstream factor of TGFβ signaling for cell growth inhibition, was also confirmed in PRa mice (Fig. [4d](#Fig4){ref-type="fig"}). Expression of other TGFβ signaling downstream factors including p21, p15, p16, p27, and p57 were down-regulated in eWAT in CD206^+^ M2-like macrophages-reduced animals (Fig. [4e](#Fig4){ref-type="fig"}). In addition, phospho-smad2/3 (P-Smad2/3) and p27^Kip1^ protein expression was reduced by CD206^+^ M2-like macrophages reduction in eWAT (Fig. [4f](#Fig4){ref-type="fig"}), suggesting that CD206^+^ M2-like macrophages suppress APs proliferation via the TGFβ signaling pathway. To validate this hypothesis, we generated a genetically engineered mouse in which TGFβ1 expression was specifically depleted in CD206^+^ M2-like macrophages (CD206−CreER^T2^/TGFβ^flox/flox^ mice) (Supplementary Fig. [7](#MOESM2){ref-type="media"}a). Administration of tamoxifen significantly reduced TGFβ1 expression by 20--30% in CD206^+^ M2-like macrophages in the CD206-CreER^T2^/TGFβ^flox/flox^ mice (Supplementary Fig. [7](#MOESM2){ref-type="media"}b); the expression of cell cycle-associated genes and APs marker genes (Supplementary Fig. [7](#MOESM2){ref-type="media"}c) and the number of Sca-1/PDGFRα double positive populations in eWAT were all up-regulated in these mice (Fig. [4g](#Fig4){ref-type="fig"} and Supplementary Fig. [7](#MOESM2){ref-type="media"}d). Immunostaining analysis shows that fibrosis of eWAT was decreased in tamoxifen treated CD206-CreER^T2^/TGFβ1^flox/flox^ mice compared with tamoxifen treated TGFβ1^flox/flox^ control mice (Supplementary Fig. [8](#MOESM2){ref-type="media"}). Moreover, the eWAT of WT mice injected with an anti-TGFβ1,2,3 neutralizing monoclonal antibody showed increments in the expression of cell cycle-related genes, with reciprocal decrements in TGFβ downstream gene expression (Fig. [4h](#Fig4){ref-type="fig"}). To further confirm the impact of TGFβ signaling, we performed inhibitor analysis in vitro. Adipose tissue-derived stem cells (ASCs) collected from the iWAT of WT mice were co-cultured with CD206^+^TGFβ1^+^ M2-like macrophages, which were produced from bone marrow-derived macrophages (BMDM) by treating with IL-4 and PGE2. We also found that BMDM supplemented with IL-4 and PGE2 could be differentiated into M2-like macrophage, which highly expresses CD206 and TGFβ1 (Supplementary Fig. [9](#MOESM2){ref-type="media"}a--c). The presence of LY2109761 (a TGFβRI/II inhibitor) abrogated the inhibitory effect of BMDM on adipogenesis of ASCs (Fig. [5a, b](#Fig5){ref-type="fig"}) although LY2109761 per se, or anti-TGFβ1,2,3 enhanced PDGFRα^+^ cell proliferation (Fig. [6a, b](#Fig6){ref-type="fig"}). Thus, CD206/TGFβ signaling regulate the APs proliferation and subsequent adipogenesis.Fig. 4TGFβ signaling is reduced after CD206^+^ M2-like macrophages depletion. a Relative mRNA expression of CD206, TGFβ1, TGFβRI, and TGFβRII, in the SVF, macrophages (CD206^+^), and APs purified from eWAT of WT mice by using FACS (n = 4--5 per group). b High resolution confocal imaging of frozen eWAT sections from WT mice. Scale bar, 25 μm. c Representative images of eWAT paraffin sections stained for CD206 and TGFβ1 (Scale bar, 200 μm) in DT-treated CD206DTR and WT littemate. d High resolution confocal imaging of frozen eWAT sections from WT mice stained for GFP vs. p27. The images were taken with a Leica TCS-SP5 (Oil 63×). Scale bar, 25 μm. e Relative expression of TGFβ signaling genes in eWAT. f Representative immunohistochemical staining of the eWAT paraffin section for TGFβ1, phospho-smad2/3 (P-Smad2/3), and p27. Scale bar 100 μm. Quantification (right panel) (n = 3--4 per group). g Representative flow cytometry analysis of Sca-1/PDGFRα double positive population in the SVF of eWAT from CD206-CreER^T2^/TGFβ^flox/flox^ and TGFβ^flox/flox^ control mice. Percentage of Sca-1/PDGFRα double positive fraction was calculated (right panel; n = 4--5 per group). Full gating strategy is given in Supplementary Fig. [7](#MOESM2){ref-type="media"}d. h The relative mRNA expression of cell cycle and TGFβ signaling genes from eWAT samples collected after direct injection of a single dose of TGFβ neutralizing antibody (1D11) into the eWAT (n = 3). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test Fig. 5In vitro coculture of BMDM and ASC. a Oil red O staining of ASC and ASC:BMDM co-culture after adipogenesis stimulation for 12 days. Addition of TGFβ1 (right upper panel) and BMDM to ASC (left lower panel) inhibited adipogenesis. BMDM inhibitory effect on ASC adipogenesis was released by addition of TGFβRI/II inhibitor. Scale bar, 200 μm. b The relative expression levels of late adipogenesis markers. The data were calculated from experiments of 3--6 dishes per group. The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with control by ANOVA Fig. 6Reversal of BMDM-induced inhibition of adipogenesis. a Quantification of PDGFRα and CD206 in in vitro co-cultures of ASC and BMDM after the addition of a TGFβRI/II inhibitor (LY2109761) and anti- TGFβ1,2,3 antibody to the medium for 48 h. The PDGFRα and CD206^+^ macrophages were both counted as the percentages of DAPI-positive cells. b The relative mRNA expression levels of cell proliferation-related genes and PDGFRα. The data were calculated from experiments of 3--6 dishes per group. The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with control by ANOVA CD206^+^ M2-Like ATMs depletion improve glucose metabolism in lean mice {#Sec7} ----------------------------------------------------------------------- We have previously showed that the majority of macrophages were M2-type in non-obese states, whereas the majority of macrophages were M1 type in obese states^[@CR34]^. As M2 ATMs are considered to be metabolically 'favorable' ATMs^[@CR35],\ [@CR36]^ compared with M1 pro-inflammatory macrophages, it was expected that decline of CD206/TGFβ might impair glucose metabolism despite enhanced APs proliferation. Surprisingly, glucose tolerance and insulin sensitivity were improved in CD206^+^ M2-like macrophages-reduced mice (Fig. [7a--c](#Fig7){ref-type="fig"}). This unexpected finding was indeed a specific outcome of CD206^+^ M2-like macrophages reduction, as a glucose tolerance test without DT administration did not reveal any difference between WT and CD206DTR mice (Supplementary Fig. [10](#MOESM2){ref-type="media"}a). In CD206^+^ M2-like macrophages-reduced mice, the levels of Akt phosphorylation were up-regulated in eWAT, liver and skeletal muscle after insulin injection (Fig. [7d--f](#Fig7){ref-type="fig"} and Supplementary Fig. [10](#MOESM2){ref-type="media"}b). Moreover, expression levels of the genes associated with metabolically favorable states were also up-regulated in eWAT and skeletal muscle, while gluconeogenesis-related gene expressions were down-regulated in the liver (Fig. [7g--i](#Fig7){ref-type="fig"}). In addition, gene expression analysis revealed that expressions of markers for smaller adipocytes were consistently up-regulated in the eWAT, reflecting the increment in smaller adipocytes. Expression levels of adipogenesis-related transcription factors including C/EBP-δ and C/EBP-α were also markedly up-regulated in the eWAT (Fig. [7g](#Fig7){ref-type="fig"}). Thus, decline in CD206/TGFβ signaling promoted adipogenesis to provide an increment in smaller adipocytes in the WAT, thereby improving insulin sensitivity. In genetically engineered CD206-CreER^T2^/TGFβ^flox/flox^ mice, the number of smaller adipocytes was also increased after tamoxifen treatment (Supplementary Fig. [10](#MOESM2){ref-type="media"}c), supporting our hypothesis about the involvement of CD206/TGFβ signaling in glucose metabolism. Thus, decline of CD206/TGFβ signaling improves glucose metabolism in lean mice.Fig. 7CD206^+^ M2-like ATMs depletion promote insulin sensitivity in lean mice. a, b Glucose and insulin concentrations in an intra-peritoneal glucose tolerance test (IP-GTT), and c the glucose concentrations in an intra-peritoneal insulin tolerance test (IP-ITT) in NC-fed mice after DT treatment (n = 4--6 per group). d--f Western blot analysis of Akt phosphorylation in the eWAT, liver and skeletal muscle of DT-treated CD206DTR and WT littermates. (MW = Molecular weight). g Relative mRNA expression of mitochondrial, smaller adipocytes and adipogenesis marker genes in the eWAT (n = 3--5 per group). h Relative mRNA expression of gluconeogenesis and fatty acid oxidation genes in the liver and i skeletal muscle (n = 3--5). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test CD206^+^ M2-like ATMs depletion improve glucose metabolism in obese mice {#Sec8} ------------------------------------------------------------------------ Next, we examined the impact of CD206^+^ M2-like macrophages reduction on glucose metabolism under HFD-fed conditions. WT and CD206DTR mice were subjected to HFD challenge for 16 weeks, with subsequent DT administration. Both WT and CD206DTR mice showed no difference in food intake (Supplementary Fig. [11](#MOESM2){ref-type="media"}a) or body weight gain (Supplementary Fig. [11](#MOESM2){ref-type="media"}b) during the 16 weeks of HFD-fed periods, but decreased weight gain was observed in CD206^+^ M2-like macrophages-reduced mice compared with WT after DT administration (Supplementary Fig. [11](#MOESM2){ref-type="media"}c). Notably, CD206^+^ M2-like macrophages-reduced mice showed improved glucose tolerance and insulin sensitivity even during HFD-fed periods (Fig. [8a and b](#Fig8){ref-type="fig"}). Consistent with this, they showed an increased number of smaller adipocytes with a reduced number of crown-like structures (CLS) compared with the WT control group (Fig. [8c--e](#Fig8){ref-type="fig"}). To determine the tissues responsible for amelioration of insulin resistance, we performed hyperinsulinemic-euglycemic clamp studies in DT-treated CD206DTR and WT mice (Fig. [8f](#Fig8){ref-type="fig"}). We determined that these mice showed significant increments in glucose infusion rate (GIR) and rate of whole-body glucose disappearance (Rd) than WT control mice without any significant suppressions in hepatic glucose production (HGP) (Fig. [8f](#Fig8){ref-type="fig"}), indicating that skeletal muscle/adipose tissues are responsible for metabolic improvement. Flow cytometric analysis further confirmed the reduced macrophage infiltration in response to HFD challenge (Fig. [9a](#Fig9){ref-type="fig"} and Supplementary Fig. [12](#MOESM2){ref-type="media"}a). The eWAT of CD206^+^ M2-like macrophages-reduced mice showed up-regulated expressions of adipogenesis-related transcription factor genes (e.g., C/EBP-α, C/EBP-δ, PPARγ), genes that are associated with metabolically favorable states (e.g., PGC-1α, PGC-1β, Glut4), APs and MSC marker genes (e.g., Sca-1, PGDFRα, CD105) and cell cycle-related genes (e.g., Ki-67, Cyclin A2, Cyclin B1), along with down-regulation of pro-inflammatory M1 macrophage markers (e.g., CD11c, MCP1, NOS2, IL-6, and TNFα (Fig. [9b--d](#Fig9){ref-type="fig"}). Thus, CD206^+^ M2-like macrophages play crucial roles in regulating glucose metabolism in HFD-fed obese mice, as well as NC-fed lean mice.Fig. 8CD206^+^ M2-like ATMs depletion promote insulin sensitivity in obese mice. a IP-GTT and b IP-ITT in 16-week HFD-fed mice after DT treatment (n = 5 mice per group). c HE staining of eWAT (left panel). The number of CLS/field is given in right panel. (Scale bar, 200 μm). d Representative images of a paraffin section of eWAT of the DT-treated HFD-fed CD206DTR and WT mice stained with anti-CD11c and anti-F4/80 antibody (left panel). The number of F4/80 and CD11c positive cells/field (right panel) (n = 3--4 mice per group) (Scale bar, 200 μm). e A histogram of adipocyte cell size in the eWAT of DT-treated HFD-fed CD206DTR mice compared with WT mice (n = 4--5 mice per group). f Hyperinsulinemic-euglycemic clamp study showed glucose infusion rates (GIR), hepatic glucose production (HGP), and rate of glucose disappearance (Rd) in HFD-fed DT-treated CD206DTR and WT mice (n = 9--10 mice per group). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test Fig. 9Effects of CD206^+^ M2-like ATMs depletion on adipogenesis in obese mice. a Representative flow cytometry analysis of CD11c and CD206 expression in F4/80^+^ SVF cells of eWAT from WT and CD206DTR mice. Cells were also stained with isotype control antibodies for anti-CD11c and anti-CD206 antibodies (left panel). Percentages of M1- and M2-like macrophages in CD45^+^F4/80^+^SVF of eWAT from WT and CD206DTR mice were calculated (right panel). Full gating strategy is given in Supplementary Fig. [13](#MOESM2){ref-type="media"}a. b The relative mRNA expression of metabolic genes and c, d M1-, M2-like macrophages, adipogenesis, APs/MSC and cell cycle markers genes in eWAT of DT-treated HFD-fed CD206DTR and WT mice. (n = 3--5 per group). The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01. (H) The data are shown as the means ± SEM. \*P \< 0.05, \\P \< 0.01 compared with littermates by Student's t-test Depletion of CD206^+^ M2-like ATMs promote browning of white adipocytes {#Sec9} ----------------------------------------------------------------------- Finally, we addressed whether depletion of CD206^+^ M2-like macrophages affect beige progenitors. DT-treated CD206DTR and WT mice after cold exposure for 7 days resulted in markedly increased expressions of UCP1, as well as other browning marker genes in the iWAT^[@CR22],\ [@CR37]--[@CR39]^ (Fig. [10a](#Fig10){ref-type="fig"}). Immunofluoresence analysis also revealed increased UCP1 in CD206DTR mice upon cold exposure (Fig. [10b](#Fig10){ref-type="fig"}). Consistent with this, the beige progenitor marker genes were also upregulated (Fig. [10a](#Fig10){ref-type="fig"}). Interestingly, flow cytometry analysis revealed an increase in the PDGFRα/Sca-1 double positive cells after cold exposure in the iWAT of the CD206DTR mice compared with WT control (Fig. [10c](#Fig10){ref-type="fig"} and Supplementary Fig. [12](#MOESM2){ref-type="media"}b). These data suggested that CD206^+^ M2-like macrophages might be involved in regulating the browning of iWAT under cold stimulation. Further studies are required to investigate the role M2-like ATMs ablation in regulating the biological properties of beige progenitors and how they interact with each other to form niche will significantly enrich our knowledge.Fig. 10Depletion of CD206^+^ M2-like macrophages promote browning of iWAT. a Relative mRNA expression of UCP1, PGC-1α. CPT-1βand CD137 levels in iWAT after CD206^+^ cells depletion under cold exposure (n = 3--5 mice per group). b Immunostaining of paraffin section of eWAT stained with anti-UCP1 antibody in DT-treated CD206DTR mice after cold exposure compared with WT control. The images were taken with a Leica TCS-SP5 (40×). c Representative flow cytometry analysis of PDGFRα/Sca-1 double positive cells from iWAT of DT-treated CD206DTR and WT mice at RT and cold stimulated (25 °C and 6 °C) (left panel). The percentage of Lin(−)APs positive fraction in the DT-treated CD206DTR mice are shown in the right panel (n = 3--5). For this, first, negative selection of PE-Cy7 anti CD31 (endothelial), FITC anti-mouse lineage cocktail were selected followed by positive selection of PE anti-PDGFRα and APC-Cy7 anti Sca-1. Full gating strategy is given in Supplementary Fig. [13](#MOESM2){ref-type="media"}b.The data are shown as the means ± SEM. \*P \< 0.05 compared with littermates by Student's t-test Discussion {#Sec10} ========== Several lines of evidence have suggested that ATMs are involved in maintaining insulin sensitivity in adipocytes through their anti-inflammatory actions, in collaboration with other leukocyte lineages including Treg cells, eosinophils, and invariant natural killer cells^[@CR1],\ [@CR2],\ [@CR4],\ [@CR22],\ [@CR35]^. In the current study, we determined that CD206 is an ideal marker to target M2-like macrophages in adipose tissues. Thus, we are able to specifically deplete M2-polarized macrophages in adipose tissue of DT-treated CD206DTR mice. So far, congenital deficiency of M2-like ATMs reportedly causes lipodystrophy-like pathophysiology accompanied by accelerated lipolysis^[@CR40]^. As insulin resistance and obesity related disorders progresses with advanced age, and M2-like macrophages are up-regulated in the early phases of obesity^[@CR34]^, it is important to deplete M2-like macrophages at a specific time point to examine the developmentally time sensitive role of M2-like macrophages. Thus, conditional and partial depletion have advantages over congenital or genetic ablation of M2-like macrophages. There are a number of reports demonstrating that partial and conditional depletion of specific cell lineages can bring about particular biological events without affecting the functions of other cells lineages^[@CR41]--[@CR45]^. In this study, we have successfully shown that partial but specific depletion of CD206^+^ M2-like macrophages in adult mice improved glucose metabolism without affecting body weight, food intake, and the numbers and functions of other cell lineages, including M1 macrophages. It has been reported that cold stimulation promotes the differentiation of beige precursors into beige/brite adipocytes within one week of exposure^[@CR38],\ [@CR46]^. Recently, Chawla's group reported that eosinophil or M2 macrophages-derived type 2 cytokines, IL-4/IL-13, mediates cold stimulation-induced biogenesis of beige fat^[@CR2]^. There are several reports indicating that M2 macrophages polarization regulates thermogenesis and browning of iWAT by increasing the expression of UCP1, PGC-1α, and other browning genes ^[@CR2],\ [@CR47],\ [@CR48]^. Previous studies indicated that PDGFRα^+^ progenitors were recruited in WAT upon ADRB3 stimulation^[@CR26]^ and these APs were also involved in different compensatory mechanism involving cellular restoration and repair in WAT and other tissues^[@CR3],\ [@CR49]^. It is well documented that type 2 cytokines and ATMs were involved in regulation of APs remodeling^[@CR3],\ [@CR22],\ [@CR39],\ [@CR48]^. However, it is unknown how decline of CD206^+^ M2-like macrophages affect WAT upon cold stimulation. Here, we report that decline of CD206^+^ M2-like macrophages promoted browning of iWAT. Our findings suggest that CD206/TGFβ signaling play a critical role in maintaining APs in a quiescent state in an analogous manner to that of the non-myelinating Schwann cell-based niche, where hematopoietic stem cells (HSCs) are maintained in hibernation via TGFβ-dependent pathways^[@CR11]^. As we have previously reported, M2-like macrophages expand, albeit mildly compared with M1-like macrophages, during the course of obesity progression^[@CR34]^. Therefore, it may be possible that the mild expansion of M2-like macrophages during the progression of obesity hampers APs proliferation and subsequent adipogenesis. Thus, the limited adipogenesis due to expanded M2-like ATMs may increase the lipid burden of the existing fat cells, inducing hypertrophy rather than hyperplasia of adipose tissues, thus impairing insulin resistance. A series of these events may create a vicious cycle, accelerating the progression of obesity-associated metabolic disorders. In this regard, it is expected that CD206^+^ M2-like macrophage-targeting drugs may exert effective therapeutic effects by breaking the vicious cycle between M2-like macrophages and APs. As reduction of CD206^+^ M2-like macrophages did not affect systemic adiposity, CD206^+^ M2-like ATMs-targeting drugs would not promote obesity, as is observed in the case of PPARγ activators (e.g. thiazolidinedione). In HFD-fed mice, both CD11c^+^CD206^-^ and CD11c^+^CD206^+^ ATMs are markedly increased; DT-treatment depleted not only CD206^+^CD11c^−^ but also CD206^+^CD11c^+^ ATMs. Although it seems that CD206^+^ M2-like ATMs plays a major role in the insulin-sensitive phenotype associated with reduced inflammation, the possibility that depletion of CD206^+^CD11c^+^ ATMs contributes to this phenotype cannot be completely excluded. In conclusion, the current study demonstrates a new role for CD206^+^ M2-like macrophages in constituting a microenvironment for APs, in a TGFβ-dependent manner, to retain systemic insulin sensitivity by tuning the quiescence/proliferation balance of APs to adapt to changes in nutritional status. Our findings suggest a new strategy for the development of drug discovery for the treatment of insulin resistance and type 2 diabetes. Methods {#Sec11} ======= Materials {#Sec12} --------- Diphtheria toxin (Sigma, cat\# D0564,) and collagenase (Sigma, cat\# C6885) were purchased from Sigma-Aldrich (St. Louis, MO). Anti-human diphtheria toxin receptor (anti-HB-EGF) was obtained from Cosmo Bio, cat\# 71--503 (Tokyo, Japan), purified mouse anti β-catenin (Cat\# 610154) from BD Bisocience, anti-rabbit Akt (Cat\# 9272 S) and anti-rabbit p-Akt (S473) (Cat\# 9271 S) were purchased from Cell Signaling for western blot analysis. The horseradish peroxidase linked anti-mouse, cat\# NA931V and anit-rabbit, cat\# NA934V secondary antibody was obtained from Amersham Bioscience (Buckinghamshire, UK). The ECL^TM^ western blot detection reagent was obtained from GE Healthcare, cat\# RPN2232 (Buckinghamshire, UK). Tamoxifen was purchased from Sigma, cat\# T5648 and bromodeoxyuridine (BrdU) was purchased from BD Biosciences, cat\# 550891. D-Glucose-6,6-d2 was purchased from the Santa Cruz Biotechnology, cat\# sc-257287A. The PCR primers that were used with the TaqMan method were purchased from Applied Biosystems (Foster City, CA), and those used with the SYBR Green method were purchased from Invitrogen^TM^ Life Technologies, Japan (Tokyo, Japan). The SYBR Green primer sequence is given in Supplementary Table [1](#MOESM2){ref-type="media"}. For the flow cytometry analysis, hamster CD11c conjugated with PE (Cat\# 553802), PE rat anti-mouse SiglecF (Cat\# 562068), purified rat anti-mouse CD16/CD32 (Cat\# 553141), 7-amino-actinomycin D \[7AAD\] (Cat\# 559925), PE ArHam IgG1 λ2 isotype control (Cat\# 553954), FITC BrdU flow kit (Cat\# 559619), APC rat anti-mouse TER-119/erythroid cell antibody (Cat\# 557909) anitbodies were obtained from BD Biosciences. PE hamster rat polyclonal isotype control (Cat\# ab32662-100) was purchased from Abcam. The rat anti-mouse CD206 conjugated alexa fluor 647 antibody (Cat\# MCA2235A647) and the rat IgG2a alexa fluor 647 isotype antibody (Cat\# 1212A647) were obtained from AbD Serotec (Oxford, UK). The APC anti-mouse CD206 (MMR) antibody (Cat\# 141707) and the APC rat IgG2a, κ isotype control antibody (Cat\# 400511), FITC anti-mouse Ly6G/Ly-6C (Gr-1) (Cat\# 108406), FITC conjugate rat IgG2a isotype control, FITC anti-mouse CD3/Gr-1/CD11b/CD45R(B220)/Ter-119 (FITC lineage cocktail) (Cat\# 78022), FITC Arm Hamster IgG/rat IgG2b/rab IgG2a isotype control (Cat\# 78023), APC anti-mouse CD140a (Cat\# 135908), PE anti-mouse CD140a (Cat\# 135905), PE rat IgG1, κ isotype control (Cat\# 553925) and APC/Cy7 anti-mouse Ly-6A/E (Sca-1) (Cat\# 108125), the APC/Cy7 rat IgG2a, κ isotype control (Cat\# 400523), rat anti-mouse F4/80 conjugated APC/Cy7 (Cat\# 123117) antibodies were purchased from BioLegend. Anti-mouse CD45 PE-Cy7 (Cat\# 25−0451), PE-Cy7 rat IgG2a, κ isotype control (Cat\# 25−4321-81) and anti-mouse CD31 PE-Cy7 (Cat\# 25−0311), APC-eFluor 780 anti-mouse CD11b (47-0112-82) antibodies were purchased from eBioscience. For the immunohistochemistry experiments, the anti-human diphtheria toxin receptor (anti-HB-EGF) antibody was obtained from Antibodies---online (Cat\# ABIN701052); the biotin anti-BrdU (Cat\# 339809) and FITC anti-mouse F4/80 (Cat\# 123107), APC/Cy7 anti-mouse F4/80 (Cat\# 123107), the anti-TGFβ1 (Cat\# sc-146), monoclonal anti-CD206 (Cat\# sc-58987), and anti-rabbit perilipin (Cat\# sc-67164) antibodies were obtained from Santa Cruz Biotechnology (Dallas, Texas); the anti-rabbit Phospho Smad2/3 (Cat\# 8828) primary anitbody, anti-rabbit p27 (Cat\# 3698) primary anibody, goat anti-rabbit IgG (H + L), alexa fluor® 555 conjugate (Cat\# 4413), anti-rabbit alexa fluor 488 (Cat\# 4413), and goat anti-rat IgG (H + L) alexa fluor® 488 conjugate (Cat\# 4413) secondary antibodies were obtained from Cell Signaling Technology (Denvers, MA); and goat anti-guinea pig IgG (H + L) alexa aluor® 488 conjugate (Cat\# A11073), donkey anti-rabbit IgG (H + L) alexa fluor® 488 conjugate (Cat\# A21206) secondary antibodies and and Click-iT® EdU alexa fluor® 647 Imaging Kit (Cat\# 10340) were obtained from Life technologies. Anti-rabbit Ki-67 antibody was obtained from Abcam (Cat\# ab15580) (Cambridge, UK). The anti-goat PDGFRα antibody (Cat\# GT15150) was purchased from Neuromics. Anti-GFP (guinea pig) (Cat\# GFP-GP-AF1180) were purchased from Frontier Institute Co.,Ltd. Cell mask green plasma membrane stains were purchased from molecular probes by Life Technologies, cat\# C37608. For the in vitro experiments, the Dulbecco's modified Eagle's medium was purchased from Gibco^TM^ Life Technologies, Japan (Tokyo, Japan); the MesenCult MSC basal medium (Mouse), MSC proliferation supplement (mouse), and the adipogenic stimulatory supplement (mouse) were purchased from STEMCELL (Vancouver, Canada); the recombinant Interleukin-4 (IL-4) (Cat\# 214-14) was purchased from Peprotech (Rocky Hill, NJ); the prostaglandin E2 (PGE2) (Cat\# 363-244-6) was purchased from Caymen Chemical (Ann Arbor, Michigan); the recombinant mouse TGFβ1 (Cat\# 7666-MB-005), macrophage colony-stimulating factor (M-CSF) (Cat\# 416-ML-050), and the monoclonal mouse anti-TGFβ1, 2, and 3 (Cat\# MAB1835) were purchased from R&D Systems (Minneapolis, MN); the TGFβRI/II inhibitor (LY2109761) (Cat\# CS-0571) was purchased from Chem Scene (Monmouth Junction, NJ). Generation and maintenance of mice {#Sec13} ---------------------------------- To generate CD206DTR mice, we obtained mouse BAC clone RP 24-377 D19 carrying a 152-kbp insert containing the exon coding translational start Met and the upstream 133-kbp sequence of the CD206 gene from the BACPAC Resources Center CHORI (Oakland, CA). The plasmid pTRECK6, which includes a noncoding exon and intron from rabbit β-globulin gene, human HB-EGF (DTR) complementary DNA (cDNA), and rabbit β-globulin and simian virus 40 polyadenylation signals, was kindly provided by Dr. Kenji Kohno (Nara Institute of Science and Technology)^[@CR50],\ [@CR51]^. Using a Counter-selection BAC modification kit (Cat\# K002) (Gene Bridges, Dresden, Germany), we removed 6-bp nucleotides (5′-GTTATG-3′; ATG corresponding to translational start Met of CD206) and inserted a 2.3-kbp fragment containing part of the noncoding exon and intron of the rabbit β-globulin gene, DTR cDNA, and the polyadenylation signals from pTRECK6 to yield the BAC vector pTg-CD206DTR. The purified BAC DNA was microinjected into pronuclei of fertilized one-cell embryos from C57BL/6 mice by UNITECH (Chiba, Japan). The transgenic founders were then again backcrossed to C57BL/6 mice. The male F4 generations and beyond were used for experiments to derive the data. Wild-type littermates were used as controls in all the experiments. To generate CD206-CreER^T2^ mice, we created the targeting construct. The plasmid pCAG-CreER^T2^ was obtained from Addgene (\# 14797). We replaced the human DTR DNA fragment in the pTg-CD206-DT receptor BAC transgene^[@CR17]^ with mutated estrogen receptor fused Cre recombinase (CreER^T2^) DNA fragment in the pCAG-CreER^T2^ by using a Counter-selection BAC modification kit (Gene Bridges, Dresden, Germany) to yield the pTg-CD206-CreER^T2^ (CD206-CreER^T2^)^[@CR52]^. In one series of experiments, we crossed male CD206-CreER^T2^ mice with female TGFβ^flox/flox^ to obtain CD206-CreER^T2^/ TGFβ^flox/flox^. Male CD206-CreER^T2^/ TGFβ^flox/flox^ and control littermate TGFβ^flox/flox^ were administered tamoxifen (0.15 mg/gBW) for four consecutive days. Male Pdgfrα-CreERT2-Egfp (PRa) mice were obtained from department of pathology, University of Toyama^[@CR53]^. Mice were maintained under standard 12 h light and dark cycles. Male mice aged 8--12 weeks were used for all the experiments; the mice were allowed ad libitum access to water and standard chow (Nosan Corporation, Yokohama, Japan). For body weight and food intake measurements, the mice were caged individually. All the animal studies were conducted at the animal facility center of the University of Toyama. Animal care and procedures were approved by the Animal Experiment Committee of the University of Toyama (Authorization No. S2009 Med-41). Genotyping {#Sec14} ---------- Whole genomic DNA was derived from the tail after lysing with DirectPCR(Tail) lysing solution from Viagen (Los Angeles, CA), according to the manufacturer's instructions. This crude DNA was then used for PCR using the Tks Gflex DNA Polymerase kit from TaKaRa (Shiga, Japan), according to the manufacturer's instructions and the following PCR conditions: one cycle of 95 °C for 5 min, 35 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, and one cycle of 72 °C for 7 min. The primers used for genotyping were purchased from Invitrogen^TM^ Life Technology (Tokyo, Japan) and had the following sequences: primer 1, TGTATTCTTTGCCTTTCCCAGTCTC (CD206 primer); primer 2, CCTCAA AACAGACTTACCCAATAGCTG (CD206 primer); primer 3, AAGAGGAGACAATG GTTGTCAACAG (DTR specific primer). The PCR products were subsequently separated using 1.5% agarose gel electrophoresis for 30 min. The DNA was visualized in the gel by the addition of ethidium bromide (1:1000 dilution) to the gel solution. The expected sizes of the DNA fragments for CD206 and CD206 DTR were 138 bp and 257 bp, respectively. Realtime polymerase chain reaction (RT-PCR) {#Sec15} ------------------------------------------- Tissues for RT-PCR were collected and preserved in RNA later solution from Ambion (Austin, Texas) according to the manufacturer's instructions. Tissue RNA was extracted using an RNeasy kit, cat\# 74106 (Qiagen, Hilden, Germany) and was reverse transcribed using TaKaRa PrimeScript RNA Kit, cat\# RR036A (Shiga, Japan), according to the manufacturer's instructions. Quantitative PCR of the genes was performed using the TaqMan method (1 cycle of 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 95 °C for 15 s, 60 °C for 1 min) using premade primer sets. The relative mRNA expression levels were calculated using the standard curve method and were normalized to the mRNA levels of 18 S or TF2B. The SYBR Green thermal cycling conditions were 1 cycle of 95 °C for 30 s, and 45 cycles of 95 °C for 10 s and 60 °C for 20 s. The relative mRNA expression levels were calculated using the standard curve method and were normalized to the mRNA levels of β-Actin or TF2B. Diphtheria toxin injection {#Sec16} -------------------------- Diphtheria toxin was diluted with sterile PBS(−) to the desired concentrations and was intraperitoneally injected at a dose of 3 ng/gram body weight (low doses) 3--4 times every other day. The experiments and procedures were performed 2 days after the last injection. Western blot {#Sec17} ------------ Tissues for the western blot analysis were quickly frozen in liquid nitrogen and preserved at −80 °C until utilization. The western blot analysis was performed as described previously with a slight modification. Briefly, the tissues for western blotting were homogenized in lysis buffer containing 25 mM Tris--HCl (pH 7.4), 10 mM Na~3~VO~4~, 100 mM NaF, 50 mM Na~4~P~2~O~7~, 10 mM EDTA, 0.2% leupeptin (5 mg/mL), 0.5% aprotinin (5 mg/mL), 2 mM phenylmethylsulfonyl fluoride, and 1% Nonidet P-40 using a Multi-Beads Shocker^TM^ cell disrupter. The lysates were centrifuged to remove any insoluble materials. The lysates were mixed with loading buffer before protein denaturation by boiling at 95°C for 3--5 min.The protein lysates were run on 7.5% separating gels and transferred afterwards to PVDF Immobilon-P transfer membranes (Millipore, Billerica MA). The membranes were incubated overnight at 4°C for the primary antibody (1:1000 dilution) and for 1 h at room temperature for the second antibody (1:2000 dilution) before being subjected to a western blot detection reagent immediately before image development. Immunohistochemistry {#Sec18} -------------------- Paraffin-embedded tissues were cut 5-μm thick and mounted on slides. Slide staining with the first and second antibodies was performed according to the manufacturer's instructions. A specific cell count was performed for at least three randomly chosen 200 × magnification fields. The average adipocyte size was measured by dividing the surface area of a 100 × magnification field by the number of adipocytes. For BrdU staining, the mice were injected with 2 mg of BrdU 2 h later, the mice were sacrificed and the tissues were collected for immunohistochemistry. In vitro immunohistochemistry was performed by growing the cells on an 18-mm round cover glass in 6-well dishes. The cover glasses were thin-coated with rat tail Collagen I from Gibco^TM^ Life Technologies Japan (Tokyo, Japan) before cell culture. A cell specific count was performed in a 100 × magnification field. For frozen section, eWAT from mice collected in 4% PFA after systemic perfusion. The tissues were kept at room temperature for 2--3 h. After that tissues were incubated in PBS(−) for one overnight and 30% sucrose one overnight in shaker at 4 °C. At the end the tissues were placed in block by adding OCT compound and immediately kept block at −80 °C for at least 24 h to solidify it. Then the frozen tissues were cut into 15--20 μm thickness by using cryostat. EdU injection (20 nM/mice) was injected 2 and 96 h before sacrifice the mice. After making the frozen block, immunofluoresence staining was performed by using EdU Alexa 647 vs. anti-goat PDGFRa, 1:50 dilution (Neuromics) and anti-perilipin 1:50 dilution, ant-rat CD206, 1;50 dilution and anti-rabbit TGFβ, 1:50 dilution followed by relevant secondary antibodies (1:250 dilution). All micrographs were taken with Keyence BZ-8000, Olympus BX6, or TCS SP5 Leica confocal microscopes (Oil 63×), and image processing was performed with the BZ-Analyzer software. Flow cytometry analysis {#Sec19} ----------------------- Isolation and separation of the SVF and subsequent flow cytometry were performed as previously described^[@CR34],\ [@CR54],\ [@CR55]^. Cells in the SVF of eWAT, after exclusion of dead cells by gating with 7AAD, live cells were selected for further analysis. M1-or M2-like macrophages were identified as CD45-positive/ F4/80-positive/ CD11c-positive/ CD206-negative or CD45 positive/ F4/80-positive/ CD11c-negative/ CD206-positive cells, respectively (1:50 dilution). The flow cytometry detection of the APs was performed similarly to a previous method^[@CR3],\ [@CR56]^. First, negative selection of CD31^+^ (endothelial) (1:100), FITC-lineage cocktail cells (1:100) were selected followed by positive selection of PDGFRα^+^ (1:50) and Sca-1^+^ cells (1:50). These experiments were performed with a FACSDiva Version 6.1.2 automated cell analyzer (Becton Dickinson FACSCanto II) and cell sorting was performed by an automatic cell sorting analyzer (Becton Dickinson FACSAria SORP). Flow cytometry analysis for detection of BrdU intake was performed after the mice were injected with BrdU (10 mg/kg body weight) 3--4 times every other day at the same time as the DT injections. The SVF preparation and BrdU detection were performed using an FITC BrdU flow kit (BD Pharmingen^TM^; BD Bioscience, San Diego, CA) according to the manufacturer's instructions. Live cells were gated for CD45^+^ and CD45^-^ population. Then BrdU was analyzed in both fraction including CD45^+^BrdU^+^ and CD45^−^BrdU^+^ population. Data analyses were performed "offline" using FlowJo software. Unstained specimen and isotype negative control were used for all relevant samples to justify gating strategy. Fluorescence minus one (FMO) controls was used wherever needed. Magnetic activated cell sorting study {#Sec20} ------------------------------------- eWAT was dissociated into SVF to isolate APs as previously described^[@CR22],\ [@CR54]^. The SVF were processed for magnetic sorting with anti-CD31, anti-CD45 and anti-Sca-1 microbeads. MicroBead Kit mouse were purchased from Miltenyi Biotech. First, negative selection with anti-CD31 microbeads (Cat\# 130-097-418) and anti-CD45 microbeads (Cat\# 130-052-301) was conducted. This negative fraction was then incubated with an anti-Sca-1 microbead kit (FITC) (Cat\# 130-092-529). The purified cells were subjected to RNA extraction and qPCR analysis of cell proliferation markers. All incubations and dilution were performed at 4°C for 10- 20 min according to the manufacturers' instructions. The enriched (positive) fraction was then centrifuged and subjected to RNA extraction and qPCR analysis. In vitro co-culture {#Sec21} ------------------- The BMDM and SVF were isolated as previously described^[@CR10]^. BMDMs were cultured in DMEM with the addition of M-CSF (100 ng/mL) for one week and were induced with IL-4 (10 ng/mL) and PGE2 (50 ng/mL) 24 h before co-culture with ASCs. The ASCs were derived from an iWAT SVF cultured with complete MesenCult proliferation medium that was prepared and used according to the manufacturer's instructions (Stemcell Technologies, Cat\# 05501). Briefly, for the adipose stem cell proliferation, the SVF, after the red blood cell lysis, were cultured with complete Mesencult proliferation medium, a combination of Mesencult MSC basal medium and MSC stimulatory supplement (Stemcell Technologies, Cat\# 05502) in a 1:4 volume ratio, in a 10-mL dish with 1--2 million cells per dish. 1 day after seeding, the old medium was changed to new medium to remove the non-attached cells. The attached cells were grown to 60--70% confluence before co-culturing with ASCs or for further re-seeding. To assess the inhibitory effect of the BMDMs on ASC proliferation, a low number of BMDMs and ASCs (15,000--30,000 cells) were seeded together in 6-well dishes to avoid cell growth arrest because of early confluence. After 1--2 days of co-culture, the cells were collected for PCR or used for immunohistochemistry. A TGFβRI/II inhibitor and anti-TGFβ antibodies were added to the medium at final concentrations of 5 ng/mL, and 0.5 μg/mL, respectively, on the same day the ASCs and BMDMs were seeded. To assess the inhibitory effect of the BMDMs on adipogenesis, the ASCs and BMDMs were cultured in equal numbers (100,000 cells) in 6-well dishes. ASCs alone and ASCs with the addition of recombinant mouse TGFβ1 (5 ng/mL, final concentration) were used as controls. Recombinant mouse TGFβ1 and a TGFβRI/II inhibitor were added on the first day of co-culture in Mesencult complete MSC stimulatory medium. After 2 days of confluence, the medium was changed to Mesencult complete adipogenic stimulatory medium, which was a combination of Mesencult MSC basal medium and Mesencult adipogenic stimulatory supplement with a 1:4 volume ratio. Every 4--5 days, the medium was changed with new complete stimulatory medium with the addition of new reagents (Recombinant Mouse TGFβ1, TGFβRI/II inhibitor, and M-CSF). After 12 days of adipogenesis induction, the cells were collected for PCR and Oil Red O staining (Thermo Scientific, SC 00011) for adipocyte visualization. Glucose tolerance test and insulin tolerance test {#Sec22} ------------------------------------------------- In the intraperitoneal glucose tolerance test (IP-GTT), 6 h fasted DT-treated CD206DTR and littermate were injected with glucose (1 mg/g BW) intraperitoneally. In the intraperitoneal insulin tolerance test (IP-ITT), 2 h fasted mice were injected intraperitoneally with human insulin 0.8 units/kg BW for NC-fed and 1.2 units/kg BW for HFD-fed mice. Blood samples were then collected 0,15, 30, 45, 60, 90 and 120 min from the tail vein. The blood glucose levels were measured using the STAT STRIP Express 900 (Nova Biomedical, Waltham MA). The serum insulin levels were determined using the Mouse Insulin ELISA KIT (ARKIN-031, Shibayagi, Shibukawa, Japan). Hyperinsulinemic-euglycemic clamp study {#Sec23} --------------------------------------- Clamp studies were performed on 16 weeks HFD-fed DT-treated CD206DTR and WT littemate under conscious and unstressed condition after 6 h fasting as described previously^[@CR57],\ [@CR58]^. A primed-continuous infusion of insulin (Humulin R; Lilly) was given 10.0 milliunits/kg/min for HFD-fed mice, and the blood glucose concentration, monitored every 5 min, was maintained at \~120 mg/dl by administration of glucose (50% glucose enriched to \~20% with 50% D2-glucose (Sigma) (4:1) ratio for 120 min. Blood sample collected at 0, 90, 105, and 120 min for determination of the rate of glucose disappearance (Rd), and hepatic glucose production (HGP) was calculated as the difference between Rd and exogenous glucose infusion rates (GIR)^[@CR57]^. Statistical analysis {#Sec24} -------------------- Statistical analyses were performed using unpaired Student's t-tests or ANOVAs with the post Tukey--Kramer test and Bonferroni correction. Differences were considered statistically significant at \*P \< 0.05, \\P \< 0.01. The results are presented as the means ± SEM. Data availability {#Sec25} ----------------- The data supporting the findinds of the study are included in the Figures and Supplementary Information or can be obtained from the authors upon reasonable request. Electronic supplementary material ================================= {#Sec26} Peer Review File Supplementary Information Allah Nawaz & Aminuddin Aminuddin contributed equally to this work. Electronic supplementary material Supplementary Information accompanies this paper at doi:10.1038/s41467-017-00231-1. Publisher\'s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. We would like to thank Prof. Kenji Kohno (Nara Institute of Science and Technology, Nara, Japan) for providing the pTRECK6 vector. The plasmid pCAG-CreERT2 was a gift from Connie Cepko (Addgene plasmid \# 14797). This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, and Culture, Japan (26461327 to K. Tobe, 22790853 to S.F. and 22590971 to I.U.), by the Novonordisc Insulin Foundation to S.F. and a Lilly research grant to S.F., and by the grant for National Center for Global Health and Medicine (26A105) to T.O. A.N. and A.A. performed the experiments, acquired, and analyzed the data, and wrote the manuscript. T.K., T.I., A.T., Y.I., M.I. and S.F. acquired and analyzed the data (flow cytometry). S.Y. and K.T. acquired the immunostaining data. S.Y. performed the experiment to analyze fibrosis of eWAT. Y.N. helped in western blot experiment. M.S., J.I., I.U., K.K., Y.N., and S.F. analyzed and interpreted the data. A.A., T.K., Y.I., S.S., and T.N. provided assistance to perform the experiments, animal care and revised the article. K.T., and A.Ando. analyzed and interpreted the clamp data. H.M., provided help to generate the transgenic mice. A.A., S.F., and H.M. generated CD206DTR mice. T.K., H.M., and T.O. generated CD206-CreERT2 mice. K.U., Y.O., K.T., T.N., M.S., M.M., K.N., and K.S. revised the manuscript. K.T. supervised the project. All authors approved the final version of the paper for publication. Competing interests {#FPar1} =================== The authors declare that they have no competing financial interests.	High	[ 0.6666666666666661, 35.75, 17.875 ]
Product Reviews Showing All 3 Reviews Bearings aside from the shipping fee...it is a good set of bearings thus far. The shop that put them in had no issue and it went smooth. Victor - September 30, 2011 (Bensalem, PA) Fit Quality Installation Recommend Motorcycle Mechanic These went in my own Harley. I installed the 1st set in 1989. After 22 years, 80 thousand miles & NEVER re-packing them!!! I finally had to replace them. I'd HIGHLY Recommend these Bearings!!! David S. - May 31, 2011 (Pennsville, NJ) Fit Quality Installation Recommend drag specialties wheel bearing and seal kit The price was right for this wheel bearing kit that I bought for my '83 fxwg.. It's not a Timken and i can't tell where it was made but my guess it's probably made in Asia.. I can't comment on it's durability because i've only run it about 500 miles. The tolerances were right on the money.	Low	[ 0.515337423312883, 31.5, 29.625 ]
/* Copyright (C) 1993, 1995, 1997, 1998, 1999, 2001 Aladdin Enterprises. All rights reserved. This software is provided AS-IS with no warranty, either express or implied. This software is distributed under license and may not be copied, modified or distributed except as expressly authorized under the terms of the license contained in the file LICENSE in this distribution. For more information about licensing, please refer to http://www.ghostscript.com/licensing/. For information on commercial licensing, go to http://www.artifex.com/licensing/ or contact Artifex Software, Inc., 101 Lucas Valley Road #110, San Rafael, CA 94903, U.S.A., +1(415)492-9861. / / $Id: ziodev.c,v 1.13 2003/09/03 03:22:59 giles Exp $ / / Standard IODevice implementation / #include "memory_.h" #include "stdio_.h" #include "string_.h" #include "ghost.h" #include "gp.h" #include "gpcheck.h" #include "oper.h" #include "stream.h" #include "istream.h" #include "ialloc.h" #include "iscan.h" #include "ivmspace.h" #include "gxiodev.h" / must come after stream.h / / and before files.h / #include "files.h" #include "scanchar.h" / for char_EOL / #include "store.h" #include "ierrors.h" / Import the dtype of the stdio IODevices. / extern const char iodev_dtype_stdio[]; / Define the special devices. / #define iodev_special(dname, init, open) {\ dname, iodev_dtype_stdio,\ { init, open, iodev_no_open_file, iodev_no_fopen, iodev_no_fclose,\ iodev_no_delete_file, iodev_no_rename_file, iodev_no_file_status,\ iodev_no_enumerate_files, NULL, NULL,\ iodev_no_get_params, iodev_no_put_params\ }\ } / * We need the current context pointer for accessing / opening the %std * IODevices. However, this is not available to the open routine. * Therefore, we use the hack of storing this pointer in the IODevice state * pointer just before calling the open routines. We clear the pointer * immediately afterwards so as not to wind up with dangling references. / #define LINEEDIT_BUF_SIZE 20 / initial size, not fixed size / /private iodev_proc_open_device(lineedit_open);/ / no longer used / const gx_io_device gs_iodev_lineedit = iodev_special("%lineedit%", iodev_no_init, iodev_no_open_device); #define STATEMENTEDIT_BUF_SIZE 50 / initial size, not fixed size / /private iodev_proc_open_device(statementedit_open);/ / no longer used / const gx_io_device gs_iodev_statementedit = iodev_special("%statementedit%", iodev_no_init, iodev_no_open_device); / ------ Operators ------ / / <int> .getiodevice <string\|null> / private int zgetiodevice(i_ctx_t i_ctx_p) { os_ptr op = osp; gx_io_device iodev; const byte dname; check_type(op, t_integer); if (op->value.intval != (int)op->value.intval) return_error(e_rangecheck); iodev = gs_getiodevice((int)(op->value.intval)); if (iodev == 0) / index out of range / return_error(e_rangecheck); dname = (const byte )iodev->dname; if (dname == 0) make_null(op); else make_const_string(op, a_readonly \| avm_foreign, strlen((const char )dname), dname); return 0; } / ------ %lineedit and %statementedit ------ / / <file> <bool> <int> <string> .filelineedit <file> / / This opens %statementedit% or %lineedit% and is also the * continuation proc for callouts. * Input: * string is the statement/line buffer, * int is the write index into string * bool is true if %statementedit% * file is stdin * Output: * file is a string based stream * We store the line being read in a PostScript string. * This limits the size to max_string_size (64k). * This could be increased by storing the input line in something * other than a PostScript string. / int zfilelineedit(i_ctx_t i_ctx_p) { uint count = 0; bool in_eol = false; int code; os_ptr op = osp; bool statement; stream s; stream ins; gs_string str; uint initial_buf_size; const char filename; / * buf exists only for stylistic parallelism: all occurrences of * buf-> could just as well be str. . / gs_string const buf = &str; check_type(op, t_string); / line assembled so far / buf->data = op->value.bytes; buf->size = op->tas.rsize; check_type((op-1), t_integer); /* index / count = (op-1)->value.intval; check_type((op-2), t_boolean); /* statementedit/lineedit / statement = (op-2)->value.boolval; check_read_file(ins, op - 3); / %stdin / / extend string / initial_buf_size = statement ? STATEMENTEDIT_BUF_SIZE : LINEEDIT_BUF_SIZE; if (initial_buf_size > max_string_size) return_error(e_limitcheck); if (!buf->data \|\| (buf->size < initial_buf_size)) { count = 0; buf->data = gs_alloc_string(imemory, initial_buf_size, "zfilelineedit(buffer)"); if (buf->data == 0) return_error(e_VMerror); op->value.bytes = buf->data; op->tas.rsize = buf->size = initial_buf_size; } rd: code = zreadline_from(ins, buf, imemory, &count, &in_eol); if (buf->size > max_string_size) { / zreadline_from reallocated the buffer larger than * is valid for a PostScript string. * Return an error, but first realloc the buffer * back to a legal size. / byte nbuf = gs_resize_string(imemory, buf->data, buf->size, max_string_size, "zfilelineedit(shrink buffer)"); if (nbuf == 0) return_error(e_VMerror); op->value.bytes = buf->data = nbuf; op->tas.rsize = buf->size = max_string_size; return_error(e_limitcheck); } op->value.bytes = buf->data; /* zreadline_from sometimes resizes the buffer. / op->tas.rsize = buf->size; switch (code) { case EOFC: code = gs_note_error(e_undefinedfilename); / falls through / case 0: break; default: code = gs_note_error(e_ioerror); break; case CALLC: { ref rfile; (op-1)->value.intval = count; / callout is for stdin / make_file(&rfile, a_readonly \| avm_system, ins->read_id, ins); code = s_handle_read_exception(i_ctx_p, code, &rfile, NULL, 0, zfilelineedit); } break; case 1: / filled buffer / { uint nsize = buf->size; byte nbuf; if (nsize >= max_string_size) { code = gs_note_error(e_limitcheck); break; } else if (nsize >= max_string_size / 2) nsize= max_string_size; else nsize = buf->size * 2; nbuf = gs_resize_string(imemory, buf->data, buf->size, nsize, "zfilelineedit(grow buffer)"); if (nbuf == 0) { code = gs_note_error(e_VMerror); break; } op->value.bytes = buf->data = nbuf; op->tas.rsize = buf->size = nsize; goto rd; } } if (code != 0) return code; if (statement) { /* If we don't have a complete token, keep going. / stream st; stream ts = &st; scanner_state state; ref ignore_value; uint depth = ref_stack_count(&o_stack); int code; /* Add a terminating EOL. / if (count + 1 > buf->size) { uint nsize; byte nbuf; nsize = buf->size + 1; if (nsize > max_string_size) { return_error(gs_note_error(e_limitcheck)); } else { nbuf = gs_resize_string(imemory, buf->data, buf->size, nsize, "zfilelineedit(grow buffer)"); if (nbuf == 0) { code = gs_note_error(e_VMerror); return_error(code); } op->value.bytes = buf->data = nbuf; op->tas.rsize = buf->size = nsize; } } buf->data[count++] = char_EOL; s_init(ts, NULL); sread_string(ts, buf->data, count); sc: scanner_state_init_check(&state, false, true); code = scan_token(i_ctx_p, ts, &ignore_value, &state); ref_stack_pop_to(&o_stack, depth); if (code < 0) code = scan_EOF; /* stop on scanner error / switch (code) { case 0: / read a token / case scan_BOS: goto sc; / keep going until we run out of data / case scan_Refill: goto rd; case scan_EOF: break; default: / error / return code; } } buf->data = gs_resize_string(imemory, buf->data, buf->size, count, "zfilelineedit(resize buffer)"); if (buf->data == 0) return_error(e_VMerror); op->value.bytes = buf->data; op->tas.rsize = buf->size; s = file_alloc_stream(imemory, "zfilelineedit(stream)"); if (s == 0) return_error(e_VMerror); sread_string(s, buf->data, count); s->save_close = s->procs.close; s->procs.close = file_close_disable; filename = statement ? gs_iodev_statementedit.dname : gs_iodev_lineedit.dname; code = ssetfilename(s, (const byte )filename, strlen(filename)+1); if (code < 0) { sclose(s); return_error(e_VMerror); } pop(3); make_stream_file(osp, s, "r"); return code; } /* ------ Initialization procedure ------ */ const op_def ziodev_op_defs[] = { {"1.getiodevice", zgetiodevice}, op_def_end(0) };	Low	[ 0.48594377510040104, 30.25, 32 ]
Mindjet MindManager 2012 v10.0.493 Multiple Remote Vulnerabilities Vendor: Mindjet Product web page: http://www.mindjet.com Affected version: 10.0.493 (Windows) Summary: An intuitive visual framework that fosters clarity, innovative thinking & communication to improve business results. Desc: MindManager suffers from several vulnerabilities included into the whole package. Several OCX and DLL libraries from 3rd party software (glg.ocx, officeviewermme.ocx, pdfxctrl.dll, vsflex8n.ocx and ChartFX.ClientServer.Core.dll) are vulnerable to buffer overflow and denial of service (IE). Also the application is vulnerable to insecure library loading with every file extension thru ssgp.dll and dwmapi.dll. Tested on Microsoft Windows XP Professional SP3 (EN) Vulnerabilities discovered by Gjoko 'LiquidWorm' Krstic @zeroscience Advisory ID: ZSL-2012-5068 Advisory URL: http://www.zeroscience.mk/en/vulnerabilities/ZSL-2012-5068.php Other vulnerabilities: http://www.exploit-db.com/exploits/12673/ http://www.zeroscience.mk/en/vulnerabilities/ZSL-2012-5067.php http://www.zeroscience.mk/en/vulnerabilities/ZSL-2012-5069.php 25.01.2012 --- <object classid='clsid:74233DB3-F72F-44EA-94DC-258A624037E6' id='target' /> <script language='vbscript'> targetFile = "C:\Program Files\Mindjet\MindManager 10\vsflex8n.ocx" prototype = "Sub Archive ( ByVal ArcFileName As String , ByVal FileName As String , ByVal Action As ArchiveSettings )" memberName = "Archive" progid = "VSFlex8N.VSFlexGrid" argCount = 3 arg1=String(7188, "A") arg2="defaultV" arg3=1 target.Archive arg1 ,arg2 ,arg3 </script> ############ CompanyName ComponentOne FileDescription VSFlexGrid8 (UNICODE) FileVersion 8, 0, 20031, 172 InternalName LegalCopyright Copyright 1999, 2002 ComponentOne OriginalFileName VSFlex8u.OCX ProductName VSFlexGrid8 ProductVersion 8, 0, 20031, 172 Report for Clsid: {74233DB3-F72F-44EA-94DC-258A624037E6} RegKey Safe for Script: False RegKey Safe for Init: False Implements IObjectSafety: True IDisp Safe: Safe for untrusted: caller,data IPStorage Safe: Safe for untrusted: caller,data ############ ------------------------------ <object classid='clsid:E9DF30CA-4B30-4235-BF0C-7150F646606C' id='target' /> <script language='vbscript'> targetFile = "C:\Program Files\Mindjet\MindManager 10\ChartFX.ClientServer.Core.dll" prototype = "Property Let TipMask As String" memberName = "TipMask" progid = "Cfx62ClientServer.Chart" argCount = 1 'arg1=String(13332, "A") target.TipMask = arg1 </script> ############ CompanyName Software FX, Inc. FileDescription ChartFX Client Server FileVersion 6.2.2089.27167 InternalName ChartFX.ClientServer.Core.dll LegalCopyright Copyright 1993-2005 Software FX, Inc. OriginalFileName ChartFX.ClientServer.Core.dll ProductName ChartFX Client Server ProductVersion 6.2 Report for Clsid: {E9DF30CA-4B30-4235-BF0C-7150F646606C} RegKey Safe for Script: False RegKey Safe for Init: False Implements IObjectSafety: True IDisp Safe: Safe for untrusted: caller,data IPersist Safe: Safe for untrusted: caller,data IPStorage Safe: Safe for untrusted: caller,data Vulnerable members -------------------- Function HitTestEx ( ByVal X As Long , ByVal Y As Long ) As _MouseEventArgsX # vuln var: Y, X ------------------------------------------- Sub OpenData ( ByVal COD As COD , ByVal n1 As Long , ByVal n2 As Long ) # vuln var: n1, n2 ------------------------------------------- Sub ShowPropertiesDialog ( ByVal context As Variant , ByVal pageNumber As Long ) # vuln var: pagenumber ------------------------------------------- ############ ------------------------------ DLL Hijack: Vulnerable extensions: - .mmap - .xmmap - .xml - .mmp - .mmat - .xmmat - .mmpt - .mmmp - .xmmmp - .mmas - .xmmas - .docx - .dotx - .doc - .dot - .mpx (ssgp.dll / dwmapi.dll) --- #include <windows.h> BOOL WINAPI DllMain (HANDLE hinstDLL, DWORD fdwReason, LPVOID lpvReserved) { switch (fdwReason) { case DLL_PROCESS_ATTACH: dll_mll(); case DLL_THREAD_ATTACH: case DLL_THREAD_DETACH: case DLL_PROCESS_DETACH: break; } return TRUE; } int dll_mll() { MessageBox(0, "DLL Hijacked!", "DLL Message", MB_OK); } ------------------------------	Low	[ 0.41237113402061804, 20, 28.5 ]
Q: Mysql update query to remove the single quotes from name field I have set of results in my table which contain the character '. These characters are contained in a person's name. For example, in my Persons table some names are stored as, Bill' Murray Andy' Griffin I can find such names from my table using the query, SELECT * FROM Persons WHERE first_name LIKE '%\'' I need to update the information of these people by removing the '. So after updating, I need the values as, Bill Murray Andy Griffin A: Check Below query Update TableName set FieldName=replace(FieldName,'''','')	Mid	[ 0.635235732009925, 32, 18.375 ]
Even though Edwin’s technical skills quickly advanced to the point that the editor of Fly Tyer magazine hailed him in 2005 as the “future of fly-tying,” he was constantly thwarted by his inability to find enough feathers. Some recipes were so extravagant that they required over £1,400 worth of feathers, often from species that are now protected. Whenever prized birds appeared on eBay, they were always snapped up by wealthy men. When one of his mentors, a mysterious Québécois tier by the name of Luc Couturier, heard that Edwin was headed to London to study, he sent his protégé an email, telling him about a magical place. Attached were photos of the bird-filled drawers of the Natural History Museum at Tring. Once he pulled himself together, Edwin carefully removed one of the birds from the drawer, brought it over to a research table, and took a picture. After he returned it, he surreptitiously snapped a photograph of the cabinet. He moved to the cabinet that held the king bird of paradise. In 1857, after travelling thousands of miles across deserts and oceans and surviving relentless attacks of malaria, Wallace became the first naturalist to encounter the species in the forests of the Aru Islands, off the southern coast of New Guinea. Overcome by the sight of the crimson-red bird, which shone in certain lights “with a metallic or glassy lustre,” Wallace worried about what would happen if “civilised man” ever discovered it. “We may be sure,” Wallace wrote, that he will “cause the disappearance, and finally the extinction, of these very beings whose wonderful structure and beauty he alone is fitted to appreciate. This consideration must surely tell us that all living things were not made for man.” Ten king birds of paradise were now within Edwin’s reach. He took a photograph of his favourite specimen, snapped another of the corridor of cabinets, and moved on to the museum’s collection of the South American Cotingidae family of birds, which included the species most coveted by flytiers: the red-ruffed fruitcrow, also known as Indian crow, and the cotinga. The small cotinga’s turquoise body practically glowed in his hands. Most cotingas for sale were half destroyed, their feathers picked and plucked at by generations of tiers. A set of 10 feathers could fetch £36. Here were dozens of flawless, untouched specimens, each of which could be sold for at least a thousand pounds. Each time he photographed a new species, he snapped a picture of its location. His camera’s memory chip slowly filled up with a visual map of the vault. Edwin’s mind raced beyond the sheer monetary value of the museum’s birds to the creative potential they represented. Ever since he tied his first Victorian fly, his pursuit of perfection had been defined by a longing for the skins he could never afford. To now wade through a seemingly endless supply of birds unstoppered a river of possibilities in Edwin’s imagination. If he owned these birds, he would have an unrivaled stash of feathers for the rest of his life. In a community defined by its longing for the unobtainable, he would be king, and his flies would be unmatched. Even better, he could feature them in the book on fly tying that he hoped to write, cementing his place in history. EDWIN WOKE UP READY AND CONFIDENT the morning of June 23, 2009. He performed at the academy’s London Soundscapes, a day-long tribute to composers who had left their mark on the city during the past few centuries. In his concert hall locker he had stashed an empty suitcase, a miniature flashlight, a wire cutter, latex gloves, and a glass cutter. After the performance he swapped his flute for the suitcase, made his way to Euston Station, and boarded an evening train to Tring. Preparations had begun in earnest on June 11, when he’d ordered a diamond‐blade glass cutter through his eBay account: Fluteplayer1988. He’d also ordered a box of 50 mothballs. He had pored over a map of the museum. He went online and studied maps of the town of Tring, its main streets, side streets, and alleyways. The train station was east of the town centre, separated by a few miles of dimly lit country road. A pathway—Public Footpath 37—would deposit him directly behind the Ornithology Building. There was a wall, but he could easily scale it. There was barbed wire, but he could easily snip it. There was a gap of three feet between the wall and the window on the second floor, but he could reach it.	High	[ 0.659846547314578, 32.25, 16.625 ]
[The Spacelab program: a major gateway to biological and medical research]. The Spacelab programme will run for about 10 years starting from 1980. It is the outcome of scientific, technological and financial cooperation between NASA and ESA. The latter has got together a large laboratory which will be equipped in accordance with individual flight programmes. A large number of scientists are involved in the preparation of suitable and original research projects. The main features of the laboratory and its vector are described and a brief reference is made to main advances that have been gathered from previous medical and biological programmes. The essential aspects of the nine European programmes (one of which was put forward by Italy) accepted for the first flight are explained.	High	[ 0.6880616174582791, 33.5, 15.1875 ]
Author Topic: Favorite VST/AU Plugins? (Read 5589 times) I've been messing with Slate Digital Revival over the holiday (http://slatedigital.com/revival/). Worth checking out, as it's free if you have an iLok 2. Simple 2-knob plugin with Shimmer and Thickness controls. Get the niveau filter section of our famous mpressor plugin - it's free! Add punch to muffled snares, reduce the harshness from active pickups, create some wonderful Dub and LoFi sounds... there are so many ways to benefit from this little tool. It's fast, efficient, and most important: It sounds great! This filter is a specialist in changing the overall sonic character of a signal with ease. It features two comprehensive controllers and is capable of producing convincing results in no time at all. Whenever a classic shelving filter would be too limited and a fully parametric filter would be too much, the niveau filter is the perfect tool.Its main function is to change the proportions between high and low frequencies. The principle is quite similar to a pair of scales: Dependent on the gain setting around a variable center frequency, the high frequencies are boosted whereas the low frequencies are attenuated (or vice versa) at the same time. The center frequency can be shifted continuously between 26 Hz and 2.2 kHz or between 260 Hz and 22 kHz respectively (when the x10 switch is activated). The characteristics of the filter change in the extreme positions of the EQ Gain controller: The fully counter-clockwise setting will give you a low pass filter; fully clockwise position will result in a high pass filter This might be of interest for those who are wary of learning to EQ their recordings. A quick simple adjustment from this "tilt EQ" (it's like a see-saw, when you turn down the lows, you're turning up the highs, and vice versa) can make a big difference on an audience tape with no further EQ work. It is free, though you have to sign up for an account so they can spam you. I'm definitely buying Azure for a finishing/enhancing EQ. The only reason I haven't yet is because I'm demoing "color"/"musical" channel strip EQs and want to purchase them on the same invoice (my company gives a Lifestyle Reward benefit, so they're footing the bill for these ) It's down to Gold (one of their two Neve emulations) and Pink (API emulation); leaning toward Pink at the moment. I use FabFilter Pro Q 2 for surgical stuff, so between the three I should be covered. Another vote for Limiter No.6Related to that is the full suite of TDR labs plugins, most of which have free versions which are quite flexible and generally built with audio transparency being a critical consideration. Highly recommended Related to that is the full suite of TDR labs plugins, most of which have free versions which are quite flexible and generally built with audio transparency being a critical consideration. Highly recommended "Don't ever take an all or nothing attitude when it comes to making a differenceand being beautiful and making the world a beautiful place through your actions. Every little bit is registered. Every little bit. So be as beautiful as you can as often as you can" "It'll never be over, 'till we learn." "My dream is to get a bus and get the band and just go coast to coast. Just about everything else except music, is anti-musical. That's it. Music's the thing." - Jeb Puryear Related to that is the full suite of TDR labs plugins, most of which have free versions which are quite flexible and generally built with audio transparency being a critical consideration. Highly recommended Related to that is the full suite of TDR labs plugins, most of which have free versions which are quite flexible and generally built with audio transparency being a critical consideration. Highly recommended "Don't ever take an all or nothing attitude when it comes to making a differenceand being beautiful and making the world a beautiful place through your actions. Every little bit is registered. Every little bit. So be as beautiful as you can as often as you can" "It'll never be over, 'till we learn." "My dream is to get a bus and get the band and just go coast to coast. Just about everything else except music, is anti-musical. That's it. Music's the thing." - Jeb Puryear	Low	[ 0.517985611510791, 27, 25.125 ]
Q: append columns to tab delimited file using AWK I have multiple files without headers with same first four columns and different fifth column. I have to append first four common columns all fifth columns with respective headers as shown below into single final tab delimited text file using awk. File_1.txt chr1 101845021 101845132 A 0 chr2 128205033 128205154 B 0 chr3 128205112 128205223 C 0 chr4 36259133 36259244 D 0 chr5 36259333 36259444 E 0 chr6 25497759 25497870 F 1 chr7 25497819 25497930 G 1 chr8 25497869 25497980 H 1 File_2.txt chr1 101845021 101845132 A 6 chr2 128205033 128205154 B 7 chr3 128205112 128205223 C 7 chr4 36259133 36259244 D 7 chr5 36259333 36259444 E 10 chr6 25497759 25497870 F 11 chr7 25497819 25497930 G 11 chr8 25497869 25497980 H 12 File_3.txt chr1 101845021 101845132 A 41 chr2 128205033 128205154 B 41 chr3 128205112 128205223 C 42 chr4 36259133 36259244 D 43 chr5 36259333 36259444 E 47 chr6 25497759 25497870 F 48 chr7 25497819 25497930 G 48 chr8 25497869 25497980 H 49 Expected Output file Final.txt Part Start End Name File1 File2 File3 chr1 101845021 101845132 A 0 6 41 chr2 128205033 128205154 B 0 7 41 chr3 128205112 128205223 C 0 7 42 chr4 36259133 36259244 D 0 7 43 chr5 36259333 36259444 E 0 10 47 chr6 25497759 25497870 F 1 11 48 chr7 25497819 25497930 G 1 11 48 chr8 25497869 25497980 H 1 12 49 A: Files in same order If it is safe to assume that the rows are in the same order in each file, then you can do the job fairly succinctly with: awk ' FILENAME != oname { FN++; oname = FILENAME } { p[FNR] = $1; s[FNR] = $2; e[FNR] = $3; n[FNR] = $4; f[FN,FNR] = $5; N = FNR } END { printf("%-8s %-12s %-12s %-4s %-5s %-5s %-5s\n", "Part", "Start", "End", "Name", "File1", "File2", "File3"); for (i = 1; i <= N; i++) { printf("%-8s %-12d %-12d %-4s %-5d %-5d %-5d\n", p[i], s[i], e[i], n[i], f[1,i], f[2,i], f[3,i]); } }' file_1.txt file_2.txt file_3.txt The first line spots when you start on a new file, and increments the FN variable (so lines from file 1 can be tagged with FN == 1, etc). It records the file name in oname so it can spot changes. The second line operates on each data line, storing the first four fields in the arrays p, s, e, n (indexed by record number within the current file), and records the fifth column in f (indexed by FN and record number). It records the current record number in the current file in N. The END block prints out the heading, then for each row in the array (indexed from 1 to N), prints out the various fields. The output is (unsurprisingly): Part Start End Name File1 File2 File3 chr1 101845021 101845132 A 0 6 41 chr2 128205033 128205154 B 0 7 41 chr3 128205112 128205223 C 0 7 42 chr4 36259133 36259244 D 0 7 43 chr5 36259333 36259444 E 0 10 47 chr6 25497759 25497870 F 1 11 48 chr7 25497819 25497930 G 1 11 48 chr8 25497869 25497980 H 1 12 49 Files in different orders If you can't rely on the records being in the same order in each file, you have to work harder. Assuming that the records in the first file are in the required order, the following script arranges to print the records in the order: awk ' FILENAME != oname { FN++; oname = FILENAME } { key = $1 SUBSEP $2 SUBSEP $3 SUBSEP $4 if (FN == 1) { p[key] = $1; s[key] = $2; e[key] = $3; n[key] = $4; f[FN,key] = $5; k[FNR] = key; N = FNR } else { if (key in p) f[FN,key] = $5 else printf "Unmatched key (%s) in %s\n", key, FILENAME } } END { printf("%-8s %-12s %-12s %-4s %-5s %-5s %-5s\n", "Part", "Start", "End", "Name", "File1", "File2", "File3") for (i = 1; i <= N; i++) { key = k[i] printf("%-8s %-12d %-12d %-4s %-5d %-5d %-5d\n", p[key], s[key], e[key], n[key], f[1,key], f[2,key], f[3,key]) } }' "$@" This is closely based on the previous script; the FN handling is identical. The SUBSEP variable is used to separate subscripts in a multi-index array. The variable key contains the same value that would be generated by indexing an array z[$1,$2,$3,$4]. If working on the first file (FN == 1), then the values in arrays p, s, e, n are created, indexed by key. The fifth column is recorded in f similarly. The order in which the keys appear in the file are recorded in array k, indexed by the (file) record number. If working on the second or third file, check whether the key is known, reporting if it is not. Assuming it is known, add the fifth column in f again. The printing is similar, except it collects the keys in sequence from k, and then prints the relevant values. Given these files: file_4.txt chr8 25497869 25497980 H 1 chr7 25497819 25497930 G 1 chr6 25497759 25497870 F 1 chr5 36259333 36259444 E 0 chr4 36259133 36259244 D 0 chr3 128205112 128205223 C 0 chr2 128205033 128205154 B 0 chr1 101845021 101845132 A 0 file_5.txt chr2 128205033 128205154 B 7 chr8 25497869 25497980 H 12 chr3 128205112 128205223 C 7 chr1 101845021 101845132 A 6 chr6 25497759 25497870 F 11 chr4 36259133 36259244 D 7 chr7 25497819 25497930 G 11 chr5 36259333 36259444 E 10 file_6.txt chr5 36259333 36259444 E 47 chr4 36259133 36259244 D 43 chr6 25497759 25497870 F 48 chr8 25497869 25497980 H 49 chr2 128205033 128205154 B 41 chr3 128205112 128205223 C 42 chr7 25497819 25497930 G 48 chr1 101845021 101845132 A 41 The script yields the output: Part Start End Name File1 File2 File3 chr8 25497869 25497980 H 1 12 49 chr7 25497819 25497930 G 1 11 48 chr6 25497759 25497870 F 1 11 48 chr5 36259333 36259444 E 0 10 47 chr4 36259133 36259244 D 0 7 43 chr3 128205112 128205223 C 0 7 42 chr2 128205033 128205154 B 0 7 41 chr1 101845021 101845132 A 0 6 41 There are many circumstances that these scripts do not accommodate very thoroughly. For example, if the files are of different lengths; if there are repeated keys; if there are keys found in one or two files not found in the other(s); if the fifth column data is not numeric; if the second and third columns are not numeric; if there are only two files, or more than three files listed. The 'not numeric' issue is actually easily fixed; simply use %s instead of %d. But the scripts are fragile. They work in the ecosystems shown, but not very generally. The necessary fixes are not incredibly hard; they are a nuisance to have to code, though. There could be more or less than 3 files Extending the previous script to handle an arbitrary number of files, and to output tab-separated data instead of formatted (readable) data is not very difficult. awk ' FILENAME != oname { FN++; file[FN] = oname = FILENAME } { key = $1 SUBSEP $2 SUBSEP $3 SUBSEP $4 if (FN == 1) { p[key] = $1; s[key] = $2; e[key] = $3; n[key] = $4; f[FN,key] = $5; k[FNR] = key; N = FNR } else { if (key in p) f[FN,key] = $5 else { printf "Unmatched key (%s) in %s\n", key, FILENAME exit 1 } } } END { printf("%s\t%s\t%s\t%s", "Part", "Start", "End", "Name") for (i = 1; i <= FN; i++) printf("\t%s", file[i]); print "" for (i = 1; i <= N; i++) { key = k[i] printf("%s\t%s\t%s\t%s", p[key], s[key], e[key], n[key]) for (j = 1; j <= FN; j++) printf("\t%s", f[j,key]) print "" } }' "$@" The key point is that printf doesn't output a newline unless you tell it to do so, but print does output a newline. The code keeps a record of the actual file names for use in printing out the columns. It loops over the array of file data, assuming that there are the same number of lines in each file. Given 6 files as input — the three original files, a copy of the first file in reverse order, and permuted copies of the second and third files, the output has 6 columns of extra data, with the columns identified: Part Start End Name file_1.txt file_2.txt file_3.txt file_4.txt file_5.txt file_6.txt chr1 101845021 101845132 A 0 6 41 0 6 41 chr2 128205033 128205154 B 0 7 41 0 7 41 chr3 128205112 128205223 C 0 7 42 0 7 42 chr4 36259133 36259244 D 0 7 43 0 7 43 chr5 36259333 36259444 E 0 10 47 0 10 47 chr6 25497759 25497870 F 1 11 48 1 11 48 chr7 25497819 25497930 G 1 11 48 1 11 48 chr8 25497869 25497980 H 1 12 49 1 12 49	Mid	[ 0.587662337662337, 22.625, 15.875 ]
Updates Giving Arthur Hsu What motivated me to enroll at RTS was having a good Reformed theological education. I did consider going to seminary before, but none of the local seminaries I knew were from the Reformed tradition, and I felt a bit frustrated. In 2010, one of my friends told me about RTS Washington; I was very excited. At first, I just wanted to equip myself more. I was not entirely thinking about future pastoral ministry. From the beginning of my time at RTS, I knew it was the right decision. The path of future pastoral ministry became increasingly clear since my first class at RTS. I changed my career from being a graphic designer to serving as a full-time member of the pastoral staff in a Reformed Chinese church. God has providentially led me to serve in my current church even before I graduated from RTS in 2018. I did not come from a Reformed church background, but through the help and directions given by my RTS professors, God guided me and my family to this new call in life. Before RTS, I only had the basic understanding of Reformed theology, serving in a non-denominational church, doing lay-preaching and teaching ministry. After graduating, I feel like I really have a great and solid education that is theologically sound and practically oriented, preparing me to serve in the full spectrum of pastoral ministry.	High	[ 0.659846547314578, 32.25, 16.625 ]
When it’s time to go back to the drawing board, maybe it’s really time to head to the couch and the SLATE Coffee Table. This is the latest design from Brandon Gore of Hard Goods and GoreDesignCo fortnite aimboten ps4., creator of such concrete hits as the Erosion sink and the Modern Muskoka chair cs2. The intention in part, a piece to bring back some good old-fashioned analog brainstorming. Gore envisions meetings around the coffee table where ideas are jotted down, drawn, shaded, and erased in different colored chalk herunterladen. Not to mention a durable piece of furniture that encourages the natural creativity of children. “Humans have been jotting down ideas on slate tablets since the 11th century,” said Gore excel diagramm herunterladen. “There is something very satisfying about drawing with chalk.” The coffee table is made of concrete etched to a specific texture and coated with a special sealer so it mimics the characteristic of slate when chalk is used to write on it download youth love for free. The result is an ultra-durable surface that can be drawn on, erased, draw on again and washed, time after time after time after… you get the picture die sims kostenlos. The surface will patina over time and use, having each word and doodle add to the character of the table. The base is made from hand-cut, fitted and welded steel rods ruzzle for free. Each base is made to order for the specific coffee table. It is finished with a wax treatment that promotes a natural patina over time. There is also an optional powder coat finish in black, white, or yellow excel diagramm vorlagen kostenlos herunterladen. If your friend passes out and falls on your coffee table a la Chris Farley on some SNL skit, you wouldn’t have to worry about your coffee table windows 10 op usb stick. You might, however, have to take your friend to the emergency room. One of Gore’s missions in life is to build things that last–that everyone should own a piece of furniture that will outlive them outlook mehrere anhänge herunterladen. SLATE is available in two colors, Carbon and Forest. The dimensions are 47″ x 18″ x 16″. Pricing is $3,250 with a waxed steel base (additional $250 for a powder-coated finish) with FREE crating & freight within the Continental United States. If you are interested in purchasing a SLATE coffee table, please contact Brandon at [email protected].	Mid	[ 0.648379052369077, 32.5, 17.625 ]
According to party sources, Congress president Rahul Gandhi will be at the state guest of the Kingdom of Bahrain and will address NRIs settled there on January 8. The NRIs settled in Bahrain have invited Rahul Gandhi for the conclave. (File) New Delhi: Rahul Gandhi will embark on a visit to Bahrain next week, his first foreign trip after becoming Congress president, during which he will address a convention of NRIs and is likely to meet the country's prime minister. According to party sources, Mr Gandhi will be at the state guest of the Kingdom of Bahrain and will address NRIs settled there on January 8. He will leave for Bahrain on January 7 and is likely to return on January 9. The NRIs settled there have invited him. Mr Gandhi is also likely to meet Bahrain's Prime Minister Khalifa bin Salman Al Khalifa and the members of the royal family, the sources said. They said that he was to also address NRIs in Dubai but that visit has been postponed. Prime Minister Narendra Modi is due to visit the UAE later this month.	Mid	[ 0.5432595573440641, 33.75, 28.375 ]
Welcome to the best KC Chiefs site on the internet. You can view any post as a visitor, but you are required to register before you can post. Click the register link above, it only takes 30 seconds to start chatting with Chiefs fans from all over the world! Enjoy your stay! If Romeo has his health all taken care of AND he has a plan on how to make this team a winner I will go along with that, he certainly has the experience. THe problem with Crennel is that he has had some health challenges and that might be the reason he is not the front runner, I have not heard of any issues with that recently, but I recall that being a consideration when we were looking for a DC. If Romeo has his health all taken care of AND he has a plan on how to make this team a winner I will go along with that, he certainly has the experience. THe problem with Crennel is that he has had some health challenges and that might be the reason he is not the front runner, I have not heard of any issues with that recently, but I recall that being a consideration when we were looking for a DC. I thought that was Weis? Remind me what Crennel's health issue where or are. If Romeo has his health all taken care of AND he has a plan on how to make this team a winner I will go along with that, he certainly has the experience. THe problem with Crennel is that he has had some health challenges and that might be the reason he is not the front runner, I have not heard of any issues with that recently, but I recall that being a consideration when we were looking for a DC. He had a hip replaced the year before he bacame the DC here and sit out the year if I am not mistaking but it might have been Wies. If Romeo has his health all taken care of AND he has a plan on how to make this team a winner I will go along with that, he certainly has the experience. THe problem with Crennel is that he has had some health challenges and that might be the reason he is not the front runner, I have not heard of any issues with that recently, but I recall that being a consideration when we were looking for a DC. If his health issues haven't hampered his performance as DC or stopped the Chiefs from him for that position I don't see how it would be an obstacle to making him Head Coach. They may have other reasons why they don't want to make him HC, but I don't see his hip replacement being one of them. I was warming to the idea last week and am much more on board after today. Let's see how the next two go. If he can at least make these games competitive, I say we make Crennel the HC. Not me. Watched him in Cleveland. He's soft on the players. They "like" him. Too much like Herm. And his teams never did anything. I also think he's over-rated as DC. We've been BLOWN OUT 6 times going back to the end of last season. We've had some good games; like pittsburgh, and Green Bay, but how do you let a winless Miami blow you out at home. No consistancy. He hasn't given his teams, or his defense an identity. Looks like a nice guy, and an ok coach, but we need a lot more than that. Not me. Watched him in Cleveland. He's soft on the players. They "like" him. Too much like Herm. And his teams never did anything. I also think he's over-rated as DC. We've been BLOWN OUT 6 times going back to the end of last season. We've had some good games; like pittsburgh, and Green Bay, but how do you let a winless Miami blow you out at home. No consistancy. He hasn't given his teams, or his defense an identity. Looks like a nice guy, and an ok coach, but we need a lot more than that. I agree 100% but believe me...From saying that in other threads, you will get hammered over it. According to a few others here, the blowouts to the defense were caused by the Chiefs poor offense. lmao Go figure that one!	Low	[ 0.49430523917995406, 27.125, 27.75 ]
Stuart Brown, host of the Broadway music radio program "On Broadway," reviews NYC and CT stage offerings as well as ruminating about other theatrical matters. Thursday, July 13, 2017 Review of "Newsies" This review incorporates elements from my original Broadway review. The final production of the Connecticut Repertory Theater’s summer series is a scaled down version of the musical Newsies.The show is based on a 1992 Disney movie that tells the story of an 1899 successful strike by the newsies (the orphans and street urchins that sold the daily newspapers on the streets of New York) against the powerful Joseph Pulitzer and his publication, The World. The musical begins with the introductions of two of the main newsies--Jack Kelly, portrayed with a spunky, charismatic, self-confidence by Jim Schubin; and his disabled pal, Crutchie, played with determination and grit by Tyler Jones. Soon the other boys, a ragamuffin group, enter the scene and, from there, the storyline quickly develops as the young men decide to strike over an increase in their upfront costs (newsies needed to buy their newspapers and resell them at a slightly higher price). Fortifying the assemblage’s mettle are two fresh recruits to the newsie ranks—Davey, played with an initial immaturity and then a swaggering steadfastness by Noah Kieserman; and his younger brother, Les (Atticus L. Burello).The balance of the show chronicles how these juveniles successfully bring their cause to the hearts and minds of both regular New Yorkers and the political elite. The book by Harvey Fierstein is serviceable and sometimes a bit hokey, but it works in moving the action to its inevitable conclusion. The score, by Alan Menken and Jack Feldman, consists mostly of compositions from the movie version (which they also wrote), with a few new songs augmenting their earlier efforts. The score works best during the more up-tempo numbers—“The World Will Know,” “Seize the Day,” and the rousing Act II opener “King of New York.”The songs are sung with a vitality, especially in the large ensemble numbers, and tenderness by the young cast members. The cast, led by Jim Schubin, is combative, suave, and vulnerable as the head newsie, Jack Kelly. His performance is critical to the success of the production and the actor delivers with an appealing and captivating portrayal. Noah Kieserman gives his character, Davey, a bit more shading then the other newsies as he grows from an innocent outsider of the group to a more resolute, strong-willed instigator. He is the perfect ying to Schubin’s yang. The role of Cruthie is the soul of the show and the actor Tyler Jones effectively conveys the emotion and toughness necessary for the character.He brings a purposeful resolve to the part.Paige Smith is spunky and full of determination as the girl reporter and love interest of Jack Kelly, but the actress needed more maturation to make the role complete.The other young men in the production, well, strong acting is not really required for their parts. Delivering a smart aleck remark and palling around is pretty much what is required.Richard R. Henry is feisty and bellicose as Joseph Pulitzer.The other adult actors, while competent and professional, serve more as his foils to keep the storyline flowing. The musical sometimes restlessly fits into the small space at the Nutmeg Series theater.Director/Choreographer Christopher d’Amboise is able to bring cohesion to the group of performers, conveying both a sense of pathos, hardship, and comradeship of the street-wise youths.He brings an urgency when the boys are on stage.He is less successful in the scenes, few as they are, with the adult performers.This is more to do with the nature of Fierstein’s book for the show. The strength of Newsies has always been the full-throttled production numbers incorporated into the musical.However, in this version, while the cast is athletic and lively, the dance routines are not as vibrant and spirited as they could be.The “Wow” factor was missing. Scenic designer Tim Brown has been able to construct a highly functional, yet not imposing set that finely hints at the claustrophobic nature of the late 19th and early 20th century tenements of New York City. Newsies, an entertaining, family-friendly production, through July 16th.	Mid	[ 0.5656324582338901, 29.625, 22.75 ]
Quick Clicks It was the first arrest for Detective Matt Hanlin since returning to duty after being shot in the arm during a meth lab raid that took the life of Detective David White earlier this year. "He's doing well. Very well. Actually, excellent," said Clay County Sheriff's Office Capt. Barry Abramowitz. "He was released from his doctor to go to regular duty two weeks ago." This meth lab was found on Tanglewood Boulevard during what investigators call a "knock and talk," where they knock at the door and ask for consent to go inside. It was the same technique used on the meth lab on Alligator Boulevard seven months ago. In that case, the man who opened the door was armed and began shooting. In this case, no guns were found, but children 6 and 10 years old were in the home surrounded by ingredients to make methamphetamines. In addition to drug charges on all five of those arrested, the children's parents face child neglect charges. Tuesday night's bust was the 14th in Clay County so far this year, resulting in 29 arrests. The team Hanlin (file photo, right) is part of is responsible for most of those. "He did participate in the actual search, because that's what he actually does," Abramowitz said. "He just jumped into it and has done a very good job, obviously with the five arrests." Copyright 2012 by News4Jax.com. All rights reserved. This material may not be published, broadcast, rewritten or redistributed. Comments The views expressed below are not those of News4Jax or its affiliated companies. By clicking on "Post," you acknowledge that you have read the Terms of Service and your comment is in compliance with such terms. Readers, please help keep this discussion respectful and on topic by flagging comments that are offensive or inappropriate (hover over the commenter's name and you'll see the flag option appear on right side of that line). And remember, respect goes both ways: Tolerance of others' opinions is important in a free discourse. If you're easily offended by strong opinions, you might skip reading comments entirely.	Low	[ 0.485355648535564, 29, 30.75 ]
Q: How to determine using web3.py when this contract's tokens are unlocked? (contract code attached) Currently the tokens of this contract are locked. I want to be able to figure out when the tokens of this contract have become transferrable in my python script. I'm using web3.py for this work. Link to the contract: https://etherscan.io/address/0x971d048e737619884f2df75e31c7eb6412392328#code There seems to be a transferLock argument inside the contract which stops the tokens from being transferred. There are also few others arguments and functions which seem to do a similar thing. Can someone help me figure out how I can determine when the contract owner has unlocked the tokens? A: There seems to be two different locks in this contract. The first is a global lock called transferLock which is used in this modifier: modifier canTransfer() { if (msg.sender != owner) { require(!transferLock); } _; } Any function which has the canTransfer modifier can only be accessed by the owner when transferLock = true. There is another property unlocked which lives on the group object, which is supposed to check if the tokens in that group are locked. However, I do not see it being used anywhere relevant. Furthermore, there seems to be a bug in the code for this property: function relockGroup(uint256 groupNumber) public onlyOwner returns(bool success) { groups[groupNumber].unlocked = true; return true; } Feels like this function should set groups[groupNumber].unlocked = false, and I see no way to "relock" a group after it has been unlocked. Both of these properties can be queried or found on Etherscan here: https://etherscan.io/address/0x971d048e737619884f2df75e31c7eb6412392328#readContract	Mid	[ 0.638676844783715, 31.375, 17.75 ]
The present invention concerns a device for closing a valve comprising an interior housing with an access opening for inserting or removing the probe of a measurement or detection apparatus, for example, a temperature measurement probe, without the need of disassembling either the closing device or the valve, while permitting the valve to remain closed. Although not limited in scope to such use, the closing device of the invention is preferably intended for a drainage valve of a reactor, a storage vat, a column, or other container. In order to control a chemical reaction, it is often essential to measure the temperature of the reactive environment inside the reactor. Not only does this information make it possible to retroactively adjust the means for heating or cooling the reactor to attain or maintain the desired temperature, but it also ensures that the chemical reaction is proceeding properly. In practice, a sharp rise in temperature often signifies that the reaction has gone awry, and quick detection of such a situation may be critical for the safety of employees, equipment, and the environment. For this reason, reactors or other chemical containers are often equipped with a device for measuring the temperature of their contents. In order to avoid problems with seals, construction and cost in conventional temperature measurement systems that use a penetrating probe surrounded by a thermometric casing placed in a supplemental tube in the reactor, the prior art has proposed a more satisfactory measurement device using a contact measurement probe. With this device the temperature probe is maintained in contact with a locally thinned area of the reactor wall and it measures content temperature through the wall. This eliminates the need to form an opening extending into the core of the reactor. In a conventional system, this contact temperature probe is often placed at the level of the reactor drainage valve. Therefore, it is mounted inside the closing device on the drainage valve, said device being movable between an upper position and a lower position corresponding to the opening and closing the valve, respectively. The probe may be integrated with the interior of the blocking head of the closing device near its upper wall during construction, or it may be housed within a hollow interior portion in the blocking head against the internal surface of its upper wall. The conductive wires, connecting the probe to the measurement device, generally pass through the shaft of the closing device. This location confers the following advantages: First, it uses a previously existing opening in the reactor. Thus, no costly reactor modifications are necessary. Only the valve closing device needs to be adapted, which is far less expensive. Second, since the drainage valve constitutes the lowest point on the container, the probe is always surrounded by liquid, whatever the level of liquid in the container. It is located in an area far away from thermal surface flux and in a place where the reactive environment is homogeneous, since it is generally well mixed by an agitator. Moreover, since the blocking head extends slightly inside the reactor, the temperature being measured is not artificially raised or lowered by proximity to the outside environment or the double wall sometimes used. Thus, the temperature that is measured is representative of the temperature of the entire reactor contents. Due to the development of ISO-type quality controls, these temperature probes must meet new requirements. They must be adjusted regularly, requiring removal from their operating position inside the reactor. In prior art systems, this frequent removal is problematic. In order to remove the probe from its placement, it is actually necessary to completely disassemble the drainage valve in order to remove the closing device surrounding the probe. Obviously, the reactor must be completely emptied prior to performing these operations. For this reason, a simple recalibration of the temperature measurement probe becomes synonymous with one to two days of lost productivity while the reactor is completely emptied and cleaned, the drainage valve and its seal are removed, as well as the measurement probe, all in compliance with safety standards; next, the probe must be recalibrated, the various elements reattached, and the reactor refilled, before production can resume. For these reasons, a simple, routine operation becomes extremely costly and unprofitable to the industry. The goal of the present invention is to offer ready access from the exterior to the temperature measurement probe positioned inside the movable closing device on the drainage valve, and to quickly and easily remove and reposition it without detaching the valve and the seal and without interfering with the progress of the reaction inside the reactor. To resolve this technical problem, the principle of the invention consists of providing a valve closing device, particularly for a drainage valve, with an interior housing designed to hold the probe or the detector of a measurement or detection apparatus, having an opening located on a portion of the closing device that is accessible when it is in the operating position inside the valve, providing access to the interior housing, and allowing insertion or removal of the probe or the detector without having previously detached the valve or its closing device. A contact temperature measurement probe with a flexible shaft can thus be easily introduced into the interior housing of the closing device of the invention through this access opening, until it contacts the upper wall of the blocking head of the closing device, which is preferably a thinner portion, through which it measures the temperature of the reactive environment. In the same way, it can be simply and quickly withdrawn for if, for example, replacement, adjustment or calibration is required, with no effect on the reactor""s contents and without any need to detach or re-attach the valve or its closing device. The device of the invention is, therefore, especially advantageous because it saves valuable time but still uses a conventional temperature measuring contact probe located within the closing mechanism of the drainage valve. The closing device of the invention is easily manufactured and scarcely more expensive than prior art closing devices. It can be attached to any type of valve, either a drainage valve or some other type, and used on any type of reactor, columns, storage vats, containers or the like. Furthermore, most types of existing measurement or detection contact probes may be easily adapted to it.	Mid	[ 0.607538802660753, 34.25, 22.125 ]
The Hindu Rate Of Wrath Is there such a thing as ‘Hindu terrorism’, as the arrest of Sadhvi Pragya Singh Thakur for the recent Malegaon blasts may tend to prove? Well, I guess I was asked to write this column because I am one of that rare breed of foreign correspondents—a lover of Hindus! A born Frenchman, Catholic-educated and non-Hindu, I do hope I’ll be given some credit for my opinions, which are not the product of my parents’ ideas, my education or my atavism, but garnered from 25 years of reporting in South Asia (for Le Journal de Geneve and Le Figaro). In the early 1980s, when I started freelancing in south India, doing photo features on kalaripayattu, the Ayyappa festival, or the Ayyanars, I slowly realised that the genius of this country lies in its Hindu ethos, in the true spirituality behind Hinduism. The average Hindu you meet in a million villages possesses this simple, innate spirituality and accepts your diversity, whether you are Christian or Muslim, Jain or Arab, French or Chinese. It is this Hinduness that makes the Indian Christian different from, say, a French Christian, or the Indian Muslim unlike a Saudi Muslim. I also learnt that Hindus not only believed that the divine could manifest itself at different times, under different names, using different scriptures (not to mention the wonderful avatar concept, the perfect answer to 21st century religious strife) but that they had also given refuge to persecuted minorities from across the world—Syrian Christians, Parsis, Jews, Armenians, and today, Tibetans. In 3,500 years of existence, Hindus have never militarily invaded another country, never tried to impose their religion on others by force or induced conversions. You cannot find anybody less fundamentalist than a Hindu in the world and it saddens me when I see the Indian and western press equating terrorist groups like simi, which blow up innocent civilians, with ordinary, angry Hindus who burn churches without killing anybody. We know also that most of these communal incidents often involve persons from the same groups—often Dalits and tribals—some of who have converted to Christianity and others not. However reprehensible the destruction of Babri Masjid, no Muslim was killed in the process; compare this to the ‘vengeance’ bombings of 1993 in Bombay, which wiped out hundreds of innocents, mostly Hindus. Yet the Babri Masjid destruction is often described by journalists as the more horrible act of the two. We also remember how Sharad Pawar, when he was chief minister of Maharashtra in 1993, lied about a bomb that was supposed to have gone off in a Muslim locality of Bombay. I have never been politically correct, but have always written what I have discovered while reporting. Let me then be straightforward about this so-called Hindu terror. Hindus, since the first Arab invasions, have been at the receiving end of terrorism, whether it was by Timur, who killed 1,00,000 Hindus in a single day in 1399, or by the Portuguese Inquisition which crucified Brahmins in Goa. Today, Hindus are still being targeted: there were one million Hindus in the Kashmir valley in 1900; only a few hundred remain, the rest having fled in terror. Blasts after blasts have killed hundreds of innocent Hindus all over India in the last four years. Hindus, the overwhelming majority community of this country, are being made fun of, are despised, are deprived of the most basic facilities for one of their most sacred pilgrimages in Amarnath while their government heavily sponsors the Haj. They see their brothers and sisters converted to Christianity through inducements and financial traps, see a harmless 84-year-old swami and a sadhvi brutally murdered. Their gods are blasphemed. So sometimes, enough is enough.At some point, after years or even centuries of submitting like sheep to slaughter, Hindus—whom the Mahatma once gently called cowards—erupt in uncontrolled fury. And it hurts badly. It happened in Gujarat. It happened in Jammu, then in Kandhamal, Mangalore, and Malegaon. It may happen again elsewhere. What should be understood is that this is a spontaneous revolution on the ground, by ordinary Hindus, without any planning from the political leadership. Therefore, the BJP, instead of acting embarrassed, should not disown those who choose other means to let their anguished voices be heard. There are about a billion Hindus, one in every six persons on this planet. They form one of the most successful, law-abiding and integrated communities in the world today. Can you call them terrorists? 43 responses to “The Hindu Rate Of Wrath” While I do agree with your point about hindus being more accepting than other religions, I have v to disagree with some of your points there. I think you have forgotten to include the 1984 sikh riots which the sikhs didnt really provoke. Also the hindus have less of a reason to start things considering their will is often law in the country. They are not persecuted for being the majority (like we see in most western cultures). A myriad of religions in india are under the Hindu law (except for the muslims). I would also like to point out that tearing down someone’s place of worship is a terrorist attack. it creates a terror among people that they are not welcome in the community. It also takes away their right to practice their religion. In a country that claims to be secular, thats a shame.Since the majority of the population is Hindu, the attacks on temples do not take place. And if they do, they are dealt with death there and then. in the barbari masjid case the muslims just retaliated in a mob later. Being a BJP supporter for many years myself, I still think bjp promotes this kind of agressive view point among hindus. Not to say all of BJP condones violence , but there are some elements which foster this hostile outlook. A good example of this is Modi. The indian democratic system is based on ” for the people, by the people and of the people” and the people should not just be Hindus. other communities should not have to live terrorized this is a spontaneous revolution on the ground, by ordinary Hindus, without any planning from the political leadership. Therefore, the BJP, instead of acting embarrassed, should not disown those who choose other means to let their anguished voices be heard When one writes about any issue he should write based on the merit of the issue. Where the author comes from, what his background is and so on are beside the point. But here we find that the author consumes a lot of space for details about himself. This act is not very respectable. This also gives one a forewarning that the author is uncertain of the varacity of his thoughts and is therefore preparing a background for the latitude he wishes to have. I also wonder why he tells us Hindus how good we are! What is his purpose? I am always alarmed by somebody praising me on my face! The same thing happened in case of this araticle. Then he goes on to the issue of Babri masjid which a good citizen wants not to be reminded of because it is so emotive. He even talks about attacks on churches saying, “Without killing anybody” secretly praising the act and forgetting the cases where our Indian Christian brothers were killed. He does not forget even visiting as back in history as year 1399 to blame Christians! What is his intention? What does the writer want to achieve? When a neighbor says to one brother how he is better than the other brother or how he gets less than he deserves, one immediately knows that the neighbor is aiming to cause a rift between the brothers. This author does it very blatantly. Further, if he claims to have, “… realised that the genius of this country lies in its Hindu ethos” then why is he now saying, “this is a spontaneous revolution on the ground, by ordinary Hindus, without any planning from the political leadership. Therefore, the BJP, instead of acting embarrassed, should not disown those who choose other means to let their anguished voices be heard.” I can understand why Noor is writing like this but at the same time fail to understand why Narayan writes like this?? Anyways, Mr. Narayan it is high time you realise that it is not your neighbour but your brother’s wake-up call!!! I agree not all muslims are terrorists but can you answer why all terrorists are muslims??? I still salute many muslims like Abdul Hamid, Mohd. Rafi, Bismillah Khan, APJ Kalam. My dear friend, please visit certain places in Mumbai and subarbs and I bet you will be scared of visiting them again. I am saying this as I have experienced it myself. Anyway, try to hoist Indian falg in Hubli and ask our those brother to sing Vande Mataram… Bye for now dear. Mr Noor ——- You say the hindus have less of a reason to start things considering their will is often law in the country. If hindu will happens to be law India would have been a superpower by now. The problem is that in the name of secularism hindus are being persecuted. You also say that a myriad of religions in india are under the Hindu law (except for the muslims). Are you not aware that most of these so called religions brached out of Hinduismn itself? There is cultural or spiritual difference othe than few customs among these religions. Also is it not funny that the separate law for muslims provide benefits under personal law derived from Shariat but punishments? Can you point out one muslim leader who talks about the plight of Kashmiri Pandits? The problem with Indian muslims is that they find it difficult keep country above religion and face difficulty in adjusting within the framework of the country. Mr Narayan ———- I wonder about you wondering about the author’s writing about Hindus. At the sametime you write a lot of things without any relation. While you accuse of he author relating an incident in 1399 with christians, you did not bother to read the his point one more to assure yourself if that’s what he was trying to say. One thing you rightly said is to spare our country from Hatred. That should happen from Muslims and Christians, They should spare India of Hindu Hatred. Living in USA for long i’m totally aware of the false propaganda to collect funds towards conversion. I’m sure you heard of Pat robertson’s call for converting 1 million hindus. If not that’s an information to you. Think before you write. worth reading articles like this even if the reader is a non Hindu . get some good information which very few people has thought off or know. writeup like this in which without pintching others religion sentiment and at the same time pointing out there mistakes is very nice. worth reading articles like this even if the reader is a non Hindu . get some good information which very few people has thought off or know. writeup like this in which without pintching others religion sentiment and at the same time pointing out there mistakes is very nice. This is just a badly written article. All this article will do is incite people who are too proud or too stupid to understand these arguments, and blindly follow them. Before you agree with someone’s argument, you have to try and poke holes in it. If you don’t succeed, then you can believe in it. Herd mentality, like Vidur, Srijit, Poonam and Menon’s above, won’t help. To all those oppose this article let me say few things clearly. It is true that Muslims in India clearly weigh their religion above the country. And no muslim/chrisitan in India is an original Muslim/christian. They either converted out of fear or for money at some earlier generation. If they say they did’nt and are original muslim/Christian then they are not Original Indian. Stumbled upon this article. It is well-written but I see a lot of euphoria and a needless elevation of Hinduism. Well, if you are to argue with me starting with your first sentence of this article, the answer from me would be “Yes!!! There could be Hindu terrorist / activist. Just like the way Islam is misinterpreted by some people, there are unfortunately some Hindus who are politicizing the ‘way of life’ that hinduism preaches”. I didn’t know that not a single muslim was harmed in the Babri Masjid demolition. And the strife of Kashmiri pundits is very very under-rated. The plurality of India is not acknowledged by the rest of the world, least of all Pakistan and Pakistanis. The unmentionable atrocities and conversion fervor unleashed against non-Muslims in Pakistan is also unnoticed and unmentioned by all quarters of the media across the globe. I respect Gautier’s sentiments – we should definitely call a spade a spade and not denigrate the greatness of India with snide, glib and unsubstantiated media double-speak: Islamic fundamentalism is India’s enemy and Pakistan is India’s enemy. In the same breath we should be proud to say that India is undeniably great, and so are its citizens. The disclaimer here should be that this pride does not warrant aggression against either Muslims or Pakistan. The moment we do that, our plurality, tolerance and hence our greatness goes for a toss and we are reduced to the same base level as our enemies. Noor, I m a sikh from delhi and do u even KNOW that some of our community started distributing sweets when the news of Indira Gandhi’s assasination spread… Shameful and then, the congressmen went mad and resorted to the violence we all know about… though babri masjid was destroyed by hindus, it was to construct the temple of RAMA which was destroyed by muslim kings. ofcourse, hindus or hinduism’s basic concept is tolerence but if one hindu reacts, example Bhagath Singh, Chandrasekhar Azad,and many more till Pragna Singh tagore, Purohith and many more who are not identified, ofcourse they might be against the fundamentalism of hinduism called tolerents, it is for hinduism. Hinduism has “not only tolerence” , but also voilence. it could be better for any one just touch tolerence but not voilence. hindu voilence is hundred percent based on “Karma Siddantha” as specified in GEETA. any other relegion on globe performs voilence for a target, if not achieved voilence increases but hinduism has no target. it’s target is live till ur death. if the voilence starts it is not a surprise to see hindu as a canibal. he is no way related with results. his target is living peacefully with anything without considering relegion unless somebody tampers it. it is not a warning like or it is not emotional. it is the fact that is happening since 1000s of years history. Ashoka lead a kingdom till he tampered hinduism. so called Buddha(23rd), Mahaveer Jain, including Britishers, French and atlast Akbar and Aurangajeb lost there addresses by touching hindu culture. It is not uncommon who come to India and fall in love with the culture to get all rosy eyed and blind to some of the very real horrors of Hinduism. Buddhism, Jainism and Sikhism were all reforms of Hinduism that broke away from the mother religion altogether. Then there are the different reforms within Hinduism itself. Hinduism is known as the con-federation of many religions. There are many Hindu gods, many philosophies. How come there are no Indian Buddhists? BJP, the political party is an oan the ground organization of the militant underground RSS. For anyone who is unfamiliar with RSS, it stands for Rashtriya Swayamsevak Sangh, for National Self Service Community. They worked parallel to the mainstream freedom movement of the National Congress Party. The man who assassinated Mahatma Gandhi had been a member of RSS. They distanced themselves from him after the assassination. RSS has been banned at least three times in India due to its violence. Anyone who reads the thoughts of all the Sangh Parivar (family of the RSS) would know that this is a Hindu fascist organization. Getting misty eyed and apologetic about its brutal philosophies, which blatantly discriminates against non-Hindu Indians is no help to India. Don’t forget how mad people get when some or any Muslim try to explain away violent Jihad with all sorts of apologia. Read all the material that is available about the history of RSS, and its branches, VHP, Bajrang Dal, Shiv Sena, its political arm BJP etc to get a real clear idea about what the new Hindutva or Hinduness philosophy and philosophy in action is all about. There is so much distortion of Hinduism and Indian history as a result, that soon history books authored by RSS inspired Hindutva will have to be shelved under mythology and fiction. RSS inspired BJP is about business and getting votes to get political power. The Hinduism that is being pedalled in its name is not Hinduism at all. Anyone who has really taken the time to read all the ideas that this so called Hindutva propagates and compares it with real Hinduism would know. The ignorant are always fooled. Hinduism is what can be called as a negative religion. There are a lot of “dont dos” with no “dos”. God saved and violence became a “dont do”. The dirty caste system luckily punctured by Gandhiji and more recently by vote banks still exists. Islam has no caste, all are equal except women. But unfortunately there are many sects. When you add up all the plus and minus we are all just total naked people. Neither hindu, muslim, christian or jain. Even our underware is lost somewhere along our history. God save. I do find truth in what the author claims. We may not agree with each and every word of it, but the central idea of the article is right/true. No muslim in India feels less or underprivileged compared to any hindu or sikh or christian. Every community in India follows its own rituals and ethos, whereas these clashes are only occasional when people become less tolerant. As a minority person risen fairly high in life, i can say that i was never discriminated in India – in education, at my workplace, in the society. I could do what i wanted, live my life the way i wanted. My views will be echoed by Dr.APJ Abdul Kalam, Dr.Manmohan Singh, Azim Premji, George Fernandes, and many more dignitaries. On the contrary, i see people from the minority community unncessarily flocking together in order to make their presence felt, and make a noise, and draw advantage of being a minority. Reality is that human race should stay away from any sort of fundamentalism. That is where intolerance creeps in. India is, and will always remain a secular nation, much more successful in it its secularity than any other nation. Recently I heard a person in the TV. He said India’s secularism is one of critical non-interference into all religions. It means noninterference is subject to a few things. By this it is meant that: 1. if a religion or a part of it is badly in need of a particular help from government it will be given.(example scholarship, admissions) 2. if there is a particular offensive behaviour in a part of a religion it will be prevented.(example: untouchability, preventing women from working to live, etc.) He says this is a superior form of secularism. Let us hope so. OM …… Just chanced upon this blogspot and these eye opening articles by Francois Gautier … I being an Indian .. shamefully am not aware of the facts portrayed by FG in his articles … I completely agree with the author on the over hyped media coverage of the so called “Hindu Terrorism” …. I beleive the majority of Bharat should wake up read the facts clearly and then mercilessly discard the biased media reports on these issues .. One thing for all those pseudo secularist Hindu ppl and also all those christians missionaries and other wannabe crusaders … Do not disturb the peaceful Hindu …… what all has happened is just a sample .. Imagine if all of the Hindu community were to wake up …. And Mr. Srikumar ….Will you shut up and Go to hell??? You have no idea of what you are writing here …. ppl like you don’t belong to anything … you are a disgrace to any race, country and religion … why don’t you get yourself examined earliest by some psychiatrist or some head shrinker??? Perhaps, even better I would recommend ppl like u to go and attend some beautiful programs of the Art of living foundation …. atleast you’ll be able to appreciate the country and the true descendants of this country whom you are living with today. Just remember and be grateful that you are still alive even after speaking some gibberish like this about ur own ppl .. that is the greatness of the Hindu culture …. Shut up!!! I like truth and I can firmly stand by it. Mr. FG has not gone to an interior village and be part of a family. Then he will know that there is something called untouchability. Then he will oppose it. I bow to Gandhiji for reducing this bad practise and saving India forever. FG does oppose “untouchability.” You’ve misunderstood him. What he is talking about is essentially the perversion of liberal/secular values of equal opportunity to reverse discrimination. FYI even in online encyclopedias there is written of caste all over the world. The word caste is NOT AN INDIAN WORD. It is the English version (CASTE) of the PORTUGUESE “CASTA” : “Casta is a Portuguese and Spanish term used in seventeenth and eighteenth centuries mainly in Spanish America to describe as a whole the mixed-race people which appeared in the post-Conquest period. In English the term, casta also refers to the colonial Spanish American system of social stratification based on a person’s racial heritage that evolved along with the rise in miscegenation. A parallel system of categorization based on the degree of acculturation to Hispanic culture, which distinguished between gente de razón (Hispanics) and gente sin razón (non-acculturated people), concurrently existed and worked together with the idea of casta.” http://en.wikipedia.org/wiki/Casta The Portuguese when they came to the Indian subcontinent, got it wrong. There are Western books on India from 20 years ago that talk about that. The Portuguese projected their notion of Casta on to India and mixed Varna (non inherited, and the only one that Hinduism writes about, and does not have “untouchability;” Shudras are not untouchables) with Jati (community and inherited) with the notion of inherited class status. This will sound familiar: “Burakumin (部落民, tribe people?), are a Japanese social minority group. The burakumin are one of the main minority groups in Japan, along with the Ainu of Hokkaidō, the Ryukyuans of Okinawa and the residents of Korean, Chinese, and Taiwanese descent. The burakumin are descendants of outcast communities of the feudal era, which mainly comprised those with occupations considered “tainted” with death or ritual impurity (such as executioners, undertakers or tanners), and traditionally lived in their own secluded hamlets and ghettos. They were legally liberated in 1871 with the abolition of the feudal caste system; however, this did not put a stop to social discrimination and their lower living standards because Japanese family registration (Koseki) was fixed to ancestral home address until recently. In certain areas of Japan, there is still a stigma attached to being a resident of such areas, including some lingering discrimination in matters such as marriage and employment. The long history of taboos and myths of the buraku left a continuous legacy of social desolation. Since the 1980s, more and more young buraku started to organize and protest against their social misfortunes. Movements with objectives ranging from “liberation” to encouraging integration have tried over the years to put a stop to this problem.” http://en.wikipedia.org/wiki/Burakumin Nowhere in Gautier’s articles does he say he does not oppose untouchability. I think that it is disingenuous to imply that. Nor does he condone violence. What he speaks about is the imbalance of how Hindus are portrayed. The knee jerk equivalence that passes for liberalism/secularism, but is its distortion. Plus also there is “caste,”inherited hierarchal status of groups, in Islam. Muslims are on top, those who are allowed to be dhimmis (Jews and Christians) are beneath, and those who do not get to be dhimmis are not allowed the tolerance of the Muslims state. “Among the infidel peoples there are differences. Those who do not possess Revealed Scriptures – and all Arabs – have, in theory, the choice between Islam or death. The others ‑ principally the Jews and Christians ‑ are granted protection status, according to the modalities of the conquest. They become dhimmis ‑ people protected by the law of Islam, by a dhimma. … This means that an infidel has no human rights, unless he is protected by Islamic law. …” Bat Ye’Or http://www.dhimmitude.org/archive/by_lecture_10oct2002.htm Actually less than half are equal, all women are not equal, and all men are not equal because all non-Muslims are inferior to Muslim men and women. Only Muslim men are equal, which is less than half. “…In the West, at least in constitution terms, however inadequately outworked in practice in some places, the equality of human beings is a fundamental assumption – ‘all men are equal before the law’. For this reason, Justice is often depicted in statues as blindfolded; the class, religion or race of anyone is irrelevant – the law, at least in terms of its goal, applies equally to everyone, and safeguards everyone equally. In Islamic law, however, this is simply not the case. The life of a Muslim is considered superior to that of a non-Muslim, so much so that whilst a non-Muslim killing a Muslim would be executed, the reverse would not occur. [5] This is despite the fact that murder is normally considered a capital offence in Islam, with regular executions in most Muslim states. This inequity is also demonstrable in the blood rate paid to non-Muslims where murder or injury has occurred, which is half that of a Muslim. [6] Effectively, this ruling means that a Muslim need not fear the usual retribution for murder if he kills a non-Muslim. The law deliberately and consciously does not protect non-Muslims as it does Muslims. The position of Islamic law is not that human life is sacred, but that Muslim life is so.” http://debate.org.uk/topics/history/xstnc-5.html Hinduism, Christianity or Islam are not independent of time. One who has the opportunity to stop an adharm and fails to act is just as responsible as the one who started the irresponsible. It is true that casteism and other ills plagued Hinduism. It is also true that because of such weaknesses the Islamic invaders were so successful in their designs. It is also true that the situation will change. @NOOR, Plse we Sikhs are tired of 1984 being mentioned all the time. We all know it was the Congress thugs who set this up & not the Hindu brothers. Mobs of Muslim & Christian congress workers ran on streets under the KL Bhagt orders of congress – Vajpayee personally had come out to help save Sikhs along with the RSS & Bajrang Dal. There is a systematic plan that has been carried out over centuries by outsiders to weaken the Hindu panth as time goes on – from Islamic invasions to now Sonia’s Vatican invasions. No one mentions how Kashmiri hindus & Sikhs have been murdered for centuries by Muslim fanatics, no one mentions how women & children were murdered by muslim fanatics – n top the riots against us Sikhs were carried out to give the Hindus a terrorist colour – to drive a deep wedge between the two brothers who are one & the same heritage. They have succeeded so far in distorting sikh history, brainwashing sikhs against their on proud heritage which is Hindu heritage. Our Gurus died for their Hindu Dharma. Rajiv Gandhi was behind the killing of Sikhs not Hindus. I am not sure where you’re getting your info, but good topic. I needs to spend some time learning much more or understanding more. Thanks for wonderful information I was looking for this information for my mission.	Mid	[ 0.643356643356643, 34.5, 19.125 ]
A disulfide-bound HIV-1 V3 loop sequence on the surface of human rhinovirus 14 induces neutralizing responses against HIV-1. An immunogenic sequence from the V3 loop of the MN isolate of human immunodeficiency virus type 1 (HIV-1), His-Ile-Gly-Pro-Gly-Arg-Ala-Phe, was transplanted onto a surface loop of the VP2 capsid protein of human rhinovirus 14. To optimize for virus viability and immunogenicity of the transplanted sequence, the HIV sequence was flanked by (1) a cysteine residue that could form a disulfide bond and (2) randomized amino acids (in either of two arrangements) to generate numerous presentations of the Cys-Cys loop. The location for engineering in VP2 was chosen by searching the geometries of disulfide-bound loops in known protein structures. A model for the structure of the transplanted V3 loop sequence was developed using molecular dynamics and energy minimization calculations. Proteolytic digestion with and without reducing agent demonstrated the presence of the disulfide bond in the chimeric virus examined. Monoclonal and polyclonal antibodies directed against the V3 region of the HIV-1MN strain potently neutralized two chimeric viruses. Guinea pig antisera against two chimeric viruses were able to neutralize HIV-1MN and HIV-1ALA-1 in cell culture. The ability of chimeric viruses to elicit antibodies capable of neutralizing the source of the transplanted sequence could be favorable for vaccine development.	High	[ 0.6666666666666661, 32.25, 16.125 ]
// https://github.com/Heydon/bruck#i-con export default class Icon extends HTMLElement { constructor() { super(); this.name = this.getAttribute('name'); if (!this.name) { console.error('Each <i-con> component needs a name attribute'); return; } this.label = this.getAttribute('label') \|\| undefined; this.attachShadow({ mode: 'open' }); this.shadowRoot.innerHTML = ` <style> :host { display: inline-block; width: 1em; } svg { stroke: currentColor; stroke-width: 3; fill: none; width: 100%; height: auto; vertical-align: -0.125em; overflow: visible; } </style> `; fetch(`./icons/${this.name}.svg`) .then(res => { res.text() .then(svg => { this.shadowRoot.innerHTML += svg; if (this.label) { const image = this.shadowRoot.querySelector('svg'); image.setAttribute('role', 'img'); image.setAttribute('aria-label', this.label); } }); }); } } customElements.define('i-con', Icon);	Mid	[ 0.587654320987654, 29.75, 20.875 ]
Q: How to send two reponses to a GCDWebServer request I'm using GCDWebServer's addDefaultHandlerForMethod:@"GET" and sending an NSData response via GCDWebServerDataResponse responseWithData:contentType:@"application/octet-stream" The user's browser receives a file which it saves in the Download folder. So far, so good. I also want to send a GCDWebServerDataResponse responseWithHTML: to show additional information to the user. Given one GET request, is there a way to send two responses, one with data and one with HTML? A: This is not possible due to the way HTTP is designed to work: 1 request = 1 response. If you want an HTML page and also a file to be downloaded, return a first response for the HTML page, then from this page itself, using JavaScript or a redirect, now do the download.	Mid	[ 0.62085308056872, 32.75, 20 ]
Easy recipes and a helping of fun from home cooks like you. Welcome Back January 19 Bialetti Trends Collection 5-Quart Pasta Pot Bialetti's 5-Quart Pasta Pot incorporates an Italian style and design for a highly functional pot. Cooking pasta, potatoes, veggies, and more is much safer and easier with Bialetti’s innovative and colorful pot. One of the best features is the twist and lock lid with a built in strainer.	Low	[ 0.49395161290322503, 30.625, 31.375 ]
Sexy Girl Group Costume: Take Life with a Grain of Salt, a Slice of Lemon and a Shot of Tequila This costume was so hard to make considering it was all duct tape! The process wasn’t bad it was just time consuming. I (the lime) used an old tshirt as a base while the other two wrapped themselves in toilet paper first. Yeah, I didn’t have time for that! The easiet way to do this is to start with strips of duct tape and covering the whole front of your body, going horiziontally. Make sure that when you do your thighs, you open your legs to widen your stance so you can walk! It’s also a good idea to have someone help you! I managed to do the front by myself but the back had to be done by someone else. BE CREATIVE! It doesn’t have to be neat and perfect because you can always go over the messy parts with more tape in the end. DON’T PULL THE TAPE TOO TIGHT! you want to be able to breathe and walk and attempt to sit! When you’re done creating your dress, have someone cut you out from the back. When you’re ready to wear your amazing outfit, simply ask someone to tape you back in. You can also add a zipper to make it more convenient. Trying to sit down and/or go to the bathroom was a nightmare, you literally have to find it in yourself to hold your breath, suck it in, and pull the bottom up as high as you can! My friend that was the tequila printed the picture on regular paper and taped it on with clear duct tape – looked awesome! Of course, I had to put limes on my chest to make it funny! Even though this costume was a pain in the butt, it was so worth it! It was creative and the talk of the party! No one knew that our dresses were duct tape and when the found out, they were impressed! Going to a party in these, I would recconmend bringing extra duct tape just in case you rip or something. Also, wear something underneath your dress, like a cami, just so it’s more comfortable. Don’t forget your sombreos and mustaches! After this constume, I NEVER want to see duct tape again! haha Good Luck!	Low	[ 0.53027139874739, 31.75, 28.125 ]
NEW ZEALAND Privacy Policy Sanofi-aventis Australia Pty Ltd trading as Sanofi, Sanofi Genzyme and Sanofi Pasteur, Sanofi-aventis Healthcare Pty Ltd, and Sanofi-aventis New Zealand Limited, (together referred to as “Sanofi”) are bound by the Australian Privacy Principles contained in the Privacy Act 1988 (Cth) for Australia and the Privacy Principles contained in the Privacy Act 1993 for New Zealand (together referred to as the “Principles”). The Principles define personal information as information or an opinion relating to an individual which can be used to identify that individual (such as name, address, telephone number, email address), and are designed to protect the confidentiality of personal information and the privacy of individuals by regulating the way personal information is managed. Sanofi recognises the importance of your privacy and understands that the security of your personal information is important to you. We are committed to protecting the personal information you provide to us. This privacy policy (“Privacy Policy” or “Policy”) outlines how we manage your personal information and protect your privacy. This Policy does not apply to third party websites to which Sanofi’s website might be linked where Sanofi does not control the privacy practices of such resources. If you choose to enter such a linked website, you agree that Sanofi is not responsible for the availability of such website and does not review or endorse and shall not be liable, directly or indirectly, for how those websites or mobile applications manage your personal information. 1. Collection of personal information a. Consumers and Patients Sanofi obtains personal information from patients and members of the public in various ways including in writing, the internet, social media and through telephone enquiries. The type of information Sanofi collects includes a person's name, address and contact details, and information relating to the enquiry. Sanofi may also collect information about a patient or consumer's current and past medical status, such as medications being taken, the names of a patient’s healthcare providers, medical procedures undergone and other information that is reasonably required to properly respond to an enquiry. Collecting this personal information is necessary to enable Sanofi to deal with the enquiry and may be necessary to allow us to meet any legal obligations. On occasions, health professionals disclose personal and health information about themselves and their patients to Sanofi when it is considered necessary in relation to the treatment of a patient. b. Patient Support and Information Programs If a patient or consumer chooses to participate in a patient support or information program, this Privacy Policy, in particular, “Consumers and Patients” detailed above, will apply with respect to personal information made available to Sanofi. Please be advised that Sanofi outsources some of these programs to independent contractors. These contractors are required to adhere to the privacy laws and this Privacy Policy with respect to all personal and health information provided to them. Generally, Sanofi does not have access to the personal information given to these independent contractors for patient support programs. c. Healthcare Professionals and their Employees Sanofi collects personal information about healthcare professionals and their employees or assistants, such as doctors and pharmacists, who prescribe and dispense Sanofi products, to enable it to deal with those health professionals. d. Websites When you look at a Sanofi operated website, the Internet Service Provider of our parent company located in France makes a record of your visit and logs the following information for statistical purposes: your server address; your top level domain name (for example .com, .gov, .au, .uk etc); the pages you accessed and documents downloaded; the previous site you have visited; and the type of browser you are using. Sanofi will not make an attempt to identify users or their browsing activities. However, in the unlikely event of an investigation, a law enforcement agency or other government agency may exercise its legal authority to inspect our parent company’s Internet Service Provider's logs. Sanofi will only record your e-mail address if you send us a message. Your e-mail address will only be used or disclosed for the purpose for which you have provided it and it will not be added to a mailing list or used or disclosed for any other purpose without your consent. Google Analytics Demographics and Interest Reporting have been enabled on some Sanofi operated website and as a result personal information about users such as age, gender and interests may be collected. Such information will only be used or disclosed for the purpose of better understanding users and identify how experience and interaction can be improved and will not be used or disclosed for any other purpose without your consent. e. Information Collected from Clinical Trials At times patients may participate in clinical trials of pharmaceutical or consumer products in order to further research and development of certain drugs or health services. In doing so, patients may provide personal information to the doctor or investigator conducting the clinical trial. However, personal and health information collected by doctors and investigators conducting clinical trials is not generally provided to Sanofi. Sanofi receives the information relating to a clinical trial patient's health and pharmaceutical needs in a de-identified form. Personal information such as the patient's name and address is not provided to Sanofi. On occasions people employed by Sanofi, or contractors working on behalf of Sanofi, may access this personal information at the source of collection for the purpose of verifying data. Sanofi collects personal information about the doctors and investigators conducting clinical trials and people who assist them. In general, the type of information Sanofi collects includes the name, address, telephone details, field of expertise, position, role in study and qualifications and includes information provided on Curricula Vitae and Financial Disclosure Forms. Sanofi may use such information worldwide to pursue its business. In particular, Sanofi is required to obtain comprehensive information about potential or actual investigators in order to maintain quality clinical trials and consistently meet global regulatory and compliance guidelines. Some of the information collected may be stored and used overseas. f. Adverse Event Reporting Sanofi may collect personal information for the purpose of maintaining a record of medical queries, complaints and adverse event reports relating to our products and reporting these to relevant regulatory bodies, related companies or other companies which market the same product as may be required or prudent. 3. Disclosure Sanofi may disclose personal information to third parties, including its associated companies, within or outside of Australia or New Zealand, including but not limited to: France, USA, Singapore and Japan to help Sanofi improve its pharmaceutical, consumer healthcare, rare diseases and vaccine products and health services. Sanofi may also disclose personal information to a related company in Malaysia for the purposes of processing invoices and accounts. The circumstances in which we may disclose your personal information includes but is not limited to: where we notified you at the time of supply of the personal information to us or it is expressly permitted under any agreement; where it is necessary to provide you with a service or goods which you have requested; where required for the ordinary operation of our business (for example, to send you information about our goods and services); where it is necessary for support services to be provided in relation to our business activities (please note that such disclosures will only be to people and entities required to meet the same standards of data protection and are prevented from using the information for their own marketing purposes); where we consider the law requires it, or in response to any demand by law enforcement authorities; Regulatory authorities (such as the Therapeutic Goods Administration, Medsafe New Zealand and State and Territory drug and health authorities) where we are required to provide your personal information to the particular authority; Third parties that we use in the ordinary operation of our business, such as for conference organising, marketing, data processing and associated printing and mailing. For example, it may also be provided to Clinical Research Organisations for the purposes of medical research. We will only provide your personal information to reputable third parties and then only on a confidential basis where we are satisfied that those third parties will similarly comply with the Principles and the Privacy Policy. These activities may involve the transfer of your personal information overseas as described above; Companies related to us for the same kinds of purposes as listed above. Any use and disclosure by the related company will be in compliance with the Principles and the Privacy Policy; Another company for the purpose of ensuring continuity of product supply and/or service if the supply of the product or service has been transferred to that company; and Such third parties otherwise permitted or required by law. Generally, we require that organisations outside of Sanofi who handle or obtain personal information as service providers to Sanofi acknowledge the confidentiality of this information, undertake to respect an individual’s right to privacy and comply with the Principles and this Policy. In most cases, if you do not provide information about yourself which Sanofi has requested, Sanofi may not be able to provide you with the relevant service or information required. 4. Sensitive information is subject to greater restrictions Some personal information collected by Sanofi is considered “sensitive”. Sensitive information which Sanofi may collect includes a person’s state of health and medical history. The Principles require that sensitive information is used and disclosed only for the purposes for which it was provided, or a directly related secondary purpose, unless you agree otherwise or for other specific reasons such as if the use or disclosure of this information is required by law or to prevent a serious and imminent threat to life or health of an individual. 5. Data breach Where a suspected data breach has occurred, Sanofi will act in accordance with its data breach response plan. In the event that Sanofi has determined that an “eligible data breach” has occurred, Sanofi will report it to the Office of the Australian Information Commissioner and the affected individual(s). 6. Management and security of personal information Sanofi has appointed a Privacy Officer to oversee Sanofi’s management of personal information in accordance with this Policy and the Principles. All personal information that is collected is held electronically on password protected systems. Personal information is only accessible by persons that require access to that information to carry out their work. Sanofi has directed its staff that personal information must be dealt with in accordance with this Policy and kept secure from unauthorised access or disclosure. 7. Enquiries If you have questions about Sanofi, its privacy practices or this Privacy Policy, wish to provide feedback about this Policy, would like to update your personal details held by Sanofi or wish to access personal information held by Sanofi about you, please contact Sanofi using the contact details below. Your request should detail your name, contact details, your former name or alias, if any, and the information you believe we may hold on you. You do not have to provide a reason for requesting access. Where we hold information that you are entitled to access, we will endeavour to provide you with a suitable range of choices as to how you may access it (e.g. emailing or mailing it to you). In any event we will acknowledge receipt of request within 10 working days and endeavour to respond to your request within 30 days. If you believe that the personal information we hold about you is incorrect, incomplete or inaccurate, then you may request we amend it. We will consider if the information requires amendment. If we do not agree that there are grounds for amendment, then we will add a note to the personal information we hold stating that you disagree with it. 8. How to complain about a privacy breach and how will Sanofi deal with such a complaint If you believe that Sanofi has breached the Principles you may complain in writing to our Privacy Officer (see contact details below). Sanofi will respond within thirty (30) days and will use its best endeavour to resolve the issue.	Low	[ 0.49318181818181805, 27.125, 27.875 ]
The Freedom From Religion Foundation is condemning a Minnesota state representative's outrageous misuse of her official position in preaching from the House floor. During a May 23 debate over whether or not to pass an amendment to an omnibus tax bill, state Rep. Abigail Whelan chose to deliver an impromptu sermon: "I have an eternal perspective and I want to share that with you and with the people listening at home ... There is actual joy to be found in Jesus Christ. Jesus loves you all. If you would like to get to know him, [if] you're listening at home, [or] here in this room, please email me, call me. Would love to talk to you about Jesus. He is the hope of this state and of this country." FFRF asserts that in these comments, Whelan shamelessly abused the power of her office. "These proselytizing remarks were completely inappropriate and an egregious violation of the spirit of the constitutional principle of separation between state and church," FFRF Co-Presidents Dan Barker and Annie Laurie Gaylor write to Whelan. "The Supreme Court has held that public officials may not seek to advance or promote religion." While Whelan is free to practice and promote her personal religious beliefs on her own time, it is inappropriate to do so through the special platform she has been afforded, FFRF emphasizes. For Whelan to use state resources to promote her personal religious beliefs on the House floor and suggest that people should convert is completely inappropriate. Besides, Whelan is not truly representing her constituents when she makes such a blatantly sectarian appeal. More than 23 percent of Americans identify as nonreligious. That 8-point increase since 2007 and 15-point jump since 1990 makes the "Nones" the fastest growing identification in America. Nearly 30 percent of Americans are non-Christians, either practicing a minority religion or no religion at all. Whelan took an oath to uphold our country's godless and entirely secular Constitution, FFRF reminds her. Her statement to turn everything over to a deity seems to be an admission of professional failure. FFRF's advice to pious politicians everywhere is to "get off your knees and get to work." FFRF requests that Whelan commit in writing to uphold her constitutional duty not to promote her personal religion while acting in her official capacity. "While Rep. Whelan is free to say as many foolish things as she likes from the Assembly floor, she should be prepared to hear criticism," says Barker. The Freedom From Religion Foundation is a nationwide nonprofit organization that works to protect the constitutional principle of separation of church and state. It represents more than 29,000 nonreligious members nationally and has chapters all over the country, including almost 600 members and two chapters in Minnesota.	Mid	[ 0.587755102040816, 36, 25.25 ]
Wedding Favors: Dare Turn Out To Be Different When you involving showing your team spirit at substantial school football game, it is usually the outcasts in the competition who come to mind. I"m talking about the guy who decided to come to the game system his limbs painted with the school colors and with "Wildcats!" written on his chest. I"m sure we have all seen this person whether it can be found at a school sporting event or every other spirit showing wedding. Now, don"t get me wrong, showing your spirit via body paint and humorous excitement with yelling and screaming to use in your team is not necessarily a bad thing, but the whole day who are rather less outgoing, I"ve got a better idea. How about custom wristbands and silicone strings of beads? Your closet most likely contains each one of these the garments that are needed to duplicate the look of an 80s pop star. Niche markets . an associated with ways to put this costume together. Tight blue jeans or pants combined with a fitted top or band t-shirt is among the option. A colorful dress or skirt with leggings is 2nd option. Accessories are very important for this Halloween apparel! cool wristbands, cross necklaces, headbands, large hair bows, beaded necklaces and lace gloves are all ideal. Second: Require Major League Baseball recognizes cancer wristbands on a Sunday with the ballplayers use a pink bat or wear a pink patch. The baseball teams and other sports franchises should employ this occasion to charge and take note for the admission fee and give those proceeds to cancer wristbands charities. If wwjd wristbands there was one hair accessory you owned in 1999 besides elastics, features workout plans butterfly hair clips. They came i was done different colors and were essentially mini decorative claw clips. These people mainly efficient at sectioning off tiny regarding your hair, as awful as that sounds, but what"s worse is that a majority of people wore them alongside mini buns. This particular look was cute and playful on a child, but lets not pretend we never saw full-grown women sporting this look excessively. A traditional game helpful to avoid crease of thinking a great deal rules, and here always be the choices: submitting to directories options is Song guessing game. However have a minimum of 5 pairs and 25 songs in this game. 10 players will be given 2 chances to survive, that also is a last man standing rule sort of game. This you are going to take some time, it can be worth this kind of. Make a real Sweet 16 Party invitation. Add where, when and location inside. Write with a bold, black marker. Blue normally takes calmness, tranquility, truthfulness, nobleness, and constancy. In all the culture, blue is the lowest quantity bad snap shots. Blue is often inside of ribbons to symbolize winners. Blue is recommended and useful. Anyone can not not be successful. We often see blue in wedding flowers, and dress. The only bad image of blue is depression, loneliness, and unhappiness. While most men"s bracelets are manufactured to fit all men, some places do offer sizes. Additionally you can get one custom made if you know the measurement. Rubber bracelets come in a single size may also stretch match anybody. The metal bracelets can be adjusted using the clasp. And in addition bracelets, additionally you can look for rings, cufflinks, chains, such like. all designed especially for men. With the advent of the online market place you to understand go from shop to purchase looking for just one that sells bracelets. The majority send your order inside the couple of weeks. President Xi Jinping (L) holds a grand ceremony to welcome US President Donald Trump at the square outside the east gate of the Great Hall of the People in Beijing, capital of China, Nov 9, 2017. [Photo/Xinhua] BEIJING -- President Xi Jinping and his US counterpart, Donald Trump, on Tuesday discussed bilateral trade and the situation on the Korean Peninsula via phone. Keeping bilateral ties on a track of healthy and stable development is in the interests of both countries and both peoples, and conforms to the common aspiration of the international community, the Chinese president said. The two sides need to maintain high-level and various levels of interactions, bring the four high-level dialogue mechanisms between them into full play, and hold the second round of dialogues at a proper time, Xi said. As economic and trade cooperation brings tangible benefits to both peoples, the two countries should adopt constructive measures to properly settle economic and trade issues of mutual concern by opening up the market to each other and "making the cake of cooperation bigger," Xi added. The Chinese president also called for advancing the cooperation between the two militaries, in law-enforcement, drug control, cultural and people-to-people exchanges and cooperation on local levels, as well as close communication and coordination on major international and regional issues. The two sides need to meet each other halfway, respect each other, focus on cooperation, deal with sensitive issues in a constructive way, respect each other"s core interests and major concerns, and maintain the momentum of sound and steady development of China-US relations, he said. Trump said that the US side attaches great importance to its relations with China as well as to the US-China cooperation, and that it is willing to work with the Chinese side to enhance bilateral exchanges at all levels, expand pragmatic cooperation, and properly handle problems in bilateral trade so as to achieve even greater results in bilateral relations. Regarding the situation on the Korean Peninsula, Xi said that there are some positive changes and related parties should work jointly to keep up the hard-won momentum for the easing of the situation on the Korean Peninsula and create conditions for the resumption of talks. Denuclearization of the Korean Peninsula and safeguarding peace and stability in the region accord with the common interests of all sides, said Xi, adding that it is vital for the international community to stay united over the issue. China is ready to continue its joint efforts with the United States and other members of the international community to achieve progress that would finally lead to a proper resolution of the issue, said Xi. In response, Trump said the US side values China"s significant role in resolving the Korean Peninsula issue and is willing to strengthen communication and coordination with China over the issue.	Low	[ 0.5042553191489361, 29.625, 29.125 ]
RNA editing is absent in a single mitochondrial gene of Didymium iridis. An open reading frame (ORF) was found in the mitochondrial genome of the Pan2-16 strain of Didymium iridis that showed high similarity to the NADH dehydrogenase subunit 3 (nad3) gene in other organisms. So far all other typical mitochondrial genes identified in this organism require RNA editing to generate ORFs capable of directing protein synthesis. The D. iridis sequence was compared to the putative nad3 gene in the related myxomycete Physarum polycephalum, which would require editing. Based on this comparison, editing sites could be predicted for the P. polycelphalum gene that would result in the synthesis of a highly conserved ND3 protein between the two organisms. To determine the editing status of the nad3 gene in other D. iridis strains, PCR was used to amplify this region from eight other independent isolates of the A1 Central American interbreeding series. In each case a 378 base pair ORF was detected by PCR amplification and sequencing. Three patterns of sequence variation were observed; however all base substitutions were in the third codon position and silent with respect to the amino acids encoded. The distribution of the sequence variants was mapped geographically. The requirement for RNA editing in all other typical mitochondrial genes of D. iridis and P. polycephalum and the presence of RNA editing in the nad3 gene of P. polycephalum suggest that the D. iridis nad3 gene might have been edited at one time. We propose that the D. iridis nad3 gene may have lost the requirement for RNA editing by reverse transcription of an edited transcript that subsequently was inserted into the genome.	Mid	[ 0.6384976525821591, 34, 19.25 ]
Do antifat attitudes predict antifat behaviors? The aim of this study was to investigate discrimination against obese job candidates, and to examine whether widely used measures of implicit and explicit antifat attitudes are related to or predict antifat discrimination. One hundred university students made job candidate suitability ratings of resumes submitted for a bogus managerial position. Photos attached to each resume portrayed the job candidate as either obese or normal weight, by using pre- and postprocedure photos of individuals who had undergone bariatric surgery. To assess discrimination, job candidates' ratings were compared between obese and normal-weight targets. Implicit and explicit antifat attitudes were also assessed. Participants rated obese job candidates as having less leadership potential, as less likely to succeed, and as less likely to be employed than normal-weight candidates. Obese candidates were also given a lower starting salary and ranked as less qualified overall than candidates portrayed as normal weight. Neither implicit nor explicit antifat attitude measures were significantly related to antifat discrimination. This study found strong evidence of employment-related discrimination against obese individuals. Commonly used measures of antifat attitudes do not appear to be adequate predictors of antifat discrimination. Improved questionnaire measures may be needed to better predict actual prejudiced behavior.	Mid	[ 0.62085308056872, 32.75, 20 ]
West Ham came close to opening the scoring when Rice headed wide when unmarked from a corner just before half-time. Arsenal improved following the introduction of Aaron Ramsey - who is said to have agreed a deal with Juventus this week - after 59 minutes but failed to make their chances count, with Pierre-Emerick Aubameyang and Alex Iwobi missing two opportunities of note. It was not the first time that the playmaker has been left out of a big game for the Gunners this season. Youth team graduate Declan Rice scored his first West Ham goal in the 1-0 victory over Arsenal on Saturday. There are loud noises that he wants to escape for the riches of China but West Ham need him - is Andy Carroll going to be the man to bully the Arsenal defence? Any doubts around Nasri's readiness for Premier League football after so long out will have at least been partially allayed by his performance on Saturday. Arnautovic's future has been the subject of intense speculation in recent days after his agent and brother revealed that he wants to leave the club this month, and he appeared to wave goodbye to the London Stadium when withdrawn in 71st minute. Costco Selling 27-Pound Bucket Of Mac And Cheese But while the macaroni and cheese might last many years in the bucket , it has been gobbled up swiftly. To start, the big ass bucket is not full of pre-made mac and cheese that you scoop out cafeteria style. South Africa frustrate Pakistan as lead builds up Hashim Amla and Quinton de Kock will be looking to build on the 42-run partnership they had at the end of the previous day. It was Olivier's third five-wicket haul of the series and took his series tally to 21 wickets.	Mid	[ 0.566265060240963, 35.25, 27 ]
Q: positioned three blocks in the table-cell How to position three blocks in the table-cell follows: p1 top, p2 bottom , p3 in the middle? the html as next: <div id="table"> <div id="row"> <div id="r2"></div> <div id="r3"></div> <div id="r1"> <div id="p1">top</div> <div id="p3">middle</div> <div id="p2">bottom</div> </div> </div> </div> CSS #table{ display: table; width:500px; height:500px; max-height:500px; min-height: 500px; } #row{ display:table-row; } #r1, #r2, #r3{ display:table-cell; } Details - http://jsfiddle.net/2ZF6J/ A: IE7 does not support display: table so you can just simply use floats and absolute positioning. HTML: <div id="wrapper"> <div id="r2"></div> <div id="r3"></div> <div id="r1"> <div id="p1">top</div> <div id="p3">middle</div> <div id="p2">bottom</div> </div> </div> CSS: #wrapper { width:500px; height: 1px; min-height: 300px; } #r1 { position: relative; width: 177px; border:1px solid black; } #r3 { width: 156px; background-color: #aef; } #r2 { width: 161px; border:1px solid black; background-color: #eee; } #r1, #r2, #r3 { float: left; height: 100%; } #p1, #p2, #p3 { position: absolute; width: 100%; } #p1 { top: 0; background-color: gold; } #p2 { bottom: 0; background-color: crimson; } #p3 { top: 50%; margin-top: -0.5em; background-color: orange; } See it here: http://jsbin.com/ekImIYih/3	Mid	[ 0.5569306930693071, 28.125, 22.375 ]
The One Simple Truth Posted on August 3, 2017 One Simple Truth: I have the answer. You have the answer. There are skills that can be learned. There are skills that can be implemented when you need them. You may be bad now, but you can get better. You may be good now, but you can get better. You may be great now, but you can get better. However, there are no “hacks”, quotes, 7-step systems, pump-up songs, or YouTube videos that create a sound, repeatable, and consistent “mental-game” that over and over allows you to be resilient, focused, confident, and calm. If someone promises you a “hack” to mental strength – don’t just walk away – run away! There are fundamentals just like any and every other skill set you can imagine. Like those skills they take time, repetition, perseverance, and willingness to learn. But, lets more specifically define what we mean by “learn” – what I really mean is that we need to be willing to listen, try, fail, correct, try again, fail again, fine-tune, and finally get better. After we do this process once, we start it again, but this time we are building off of the prior improvement (even if it was incremental) and using that as the starting point. You see the road to learning and developing anything of importance is not straight, short, and flat, but more typically, winding, extended, and up and down. However, here is the “one simple truth” – you can’t change your habits of thought, until you’re ready to invest in the entire experience of it. That you actively decide you want to explore this. That you choose to listen, and that you choose to ask questions that give you a more in-depth understanding. That your investment is in experiencing it enough and as often as it takes to create that moment of realization…”There it is”!! Just like you don’t get physically stronger in a single workout session, or in better cardio-vascular shape on a single run, the mind can’t become significantly stronger with a single one-hour session. When you are willing to work at your mental skills in the same way you are the physical than it will come to you…simple as that. Not to say you’ll become mentally “perfect”, but simply to say you’ll become better, and more consistent. But are you willing to dive in, to trust, to try, to fail, and then to try again? Are you willing to jump on the path, while not being 100% sure of where it takes you? Until that point the “one simple truth” understands that you already have one foot out the door, and it’s really hard to get better at something when you aren’t already committed to doing it. In the growth of the mind you can’t physically SEE the growth. You won’t feel “better” immediately. You may feel like the skill work is impossible to do on the court or field. You may want to say, “it’s not working”. But, you must continue to do the mental workouts. You must continue to try the skills. Here’s what the “one simple truth” understands…that it is literally impossible for someone to tell another to just simply have a mindset. Instead we do the workouts and the repetition and after a period of time the mindset reveals itself. It’s there for you to use when you need it. Mental strength is really all about attention. If your attention is stuck on the last mistake, predicting a future error, or your imperfections you’ll feel pressure, anxiety, or stress. However, if you work on paying a specific type of attention it will be on the things that you do control, that are process oriented, and that are within the present moment. If so, you’ll feel empowered, in control, and composed. The ability to RESPOND and not REACT with emotion will become yours. The “one simple truth” is that having a resilient, strong, and consistent mental approach is within your reach, and your control. There are fundamentals that you can “workout”. There is no hack, there is no 7-day program, and there is no YouTube video that will create and sustain the growth you truly desire and need. Invest authentic, committed, and daily focus and the strength you want will be there.	Mid	[ 0.6485260770975051, 35.75, 19.375 ]
Eight months after its launch, Huobi’s Australian subsidiary is to be subsumed under the Huobi Global canopy, according to an official tweet published on Feb. 24. In a Facebook post published today, Feb. 25, Huobi Australia cited the crypto market slump and fresh redundancies as the reason for the development. As previously reported, Singapore-headquartered Huobi Global launched its Australian platform in July 2018, saying at the time that “the move to Australia is a natural fit.” According to Huobi Australia’s announcements, the subsumption under Huobi Global will take effect as of tomorrow, Feb. 26: “Please be informed that due to poor market conditions and associated recent staff redundancies here at Huobi Australia, all operations, including the management of our platform, social media channels and customer support will be managed by our team at Huobi Global headquarters starting 26th February 2019.” The exchange has further said it is forgoing plans to add a fiat currency on-ramp, and will retain solely its current coin-coin format. It has therefore also decided to cancel its registration with local regulator, the Australian Transaction Reports and Analysis Centre, which is required only in cases of fiat on-ramps. Huobi Global is not alone in opting to reduce its head count and close regional operations to survive the crypto market slump. Canadian exchange Coinsquare, mining giant Bitmain, blockchain software firm ConsenSys and decentralized social network Steemit have all made significant cuts and partial closures in recent months. Despite these reported redundancies and cessation of its Australia-specific operations, Huobi Global nonetheless recently claimed it had seen 100 percent growth in worldwide trading volumes in 2018 over 2017. Moreover, the flagship Huobi Global reportedly expanded its staff from 400 employees in early 2018 to more than 1,300 people by 2019. A report in December 2018 alleged that Huobi was intending to optimize its staffing by firing underachieving employees in certain areas, while adding talent “for its core businesses and emerging markets.” Huobi retains regional operations in the United States, South Korea and Japan — the latter relaunching as a fully licensed platform in January following a prior merger with licensed platform BitTrade. In the U.S., the exchange has recently rebranded from HBUS to Huobi.com, compliantly launching fiat-to-crypto trading services earlier this month. At press time, Huobi Global is ranked fifth largest crypto exchange globally by daily adjusted volumes, seeing around $957 million in trades over the past 24 hours.	Low	[ 0.501945525291828, 32.25, 32 ]
Testicular steroidogenesis after human chorionic gonadotropin desensitization in rats. When a single injection of 500 I.U. of human chorionic gonadotropin (hCG) is given to rats there is an initial acute rise of plasma testosterone and of testicular content for both cyclic AMP and testosterone. This response correlates with an increase in both lyase and 17 alpha-hydroxylase activities. Thereafter both plasma and testicular testosterone decline and do not increase after a second injection of hCG. During this period of desensitization, isolated Leydig cells were insensitive to the steroidogenic stimulatory effect of both hCG and dibutyryl cyclic AMP. The post-cyclic AMP block is not due to an alteration of the cyclic AMP-dependent protein kinase but it is correlated with a decrease in both lyase and 17 alpha-hydroxylase activities of the Leydig cell's microsomes. This decrease is not caused by the absence of the recently described cytosol activator of this enzyme because its addition did not restore the enzymatic activity. Within 60 to 96 h after hCG injection there was a spontaneous increase of both plasma and testicular testosterone and this parallels the recovery of lyase and 17 alpha-hydroxylase activities. These results suggest that both enzymatic activities are regulated, directly or indirectly, by hCG, and that this is partly responsible for the hCG-induced steroidogenic refractoriness of Leydig cells.	Mid	[ 0.629539951573849, 32.5, 19.125 ]
Tag Archives: civil partnership There’s no doubt that the landmark vote in Ireland on May 22, the first such referendum where a popular majority enacted same-sex marriage, has been received as a huge step forward for marriage equality and LGBT rights in Europe. While the United States supreme court is set to rule later in June on marriage equality as a legal and constitutional matter within all 50 states, it may feel like a watershed moment in Europe as well, where French president François Hollande and the center-left Parti socialiste (PS, Socialist Party) and British prime minister David Cameron and the Conservative Party both swung behind legislative efforts to enact same-sex marriage, in 2013 and 2014, respectively. Luxembourg’s prime minister Xavier Bettel officially married his own partner in May, but it was only six years ago that Iceland’s Jóhanna Sigurdardóttir became the world’s first openly LGBT head of government, followed shortly by Belgian prime minister Elio Di Rupo. Yet the lopsided Irish referendum victory — it passed with 62.07% of the vote and the ‘Yes’ camp won all but one constituency (Roscommon-South Leitrim) — obscures the fact that additional marriage equality gains across the European Union will be slow to materialize. Leave aside the notion, now reinforced by Ireland, that the human rights of a minority can be legitimately subjected to referendum — a precedent that Europeans may come to regret. Amid the recent burst of marriage equality in Europe, the immediate future seems grim. Nowhere is that more true than just next door in Northern Ireland, which is the only part of the United Kingdom that doesn’t permit same-sex marriage. With the Protestant, federalist electorate dominated by the socially conservative Democratic Unionist Party (DUP), one of western Europe’s most harshly anti-LGBT political parties, there’s little hope that Northern Ireland will follow in the footsteps of England, Scotland and Wales. At the end of April, Northern Irish health minister Jim Wells was forced to resign after suggesting same-sex couples were inferior parents. It’s home to the late Ian Paisley’s ‘Save Ulster from Sodomy’ campaign in the late 1970s, and it’s where sexual relations between two consenting same-sex partners were illegal until 1981, when the European Court of Human Rights ruled that Northern Irish law violated the European Convention on Human Rights. But Northern Ireland is not alone in its reticence — marriage equality faces long hurdles in some of the European Union’s most important countries, including Germany, Italy and Poland. Support Suffragio Donation Amount:(Currency: USD) About Suffragio Suffragio attempts to bring thoughtful analysis to the political, economic and other policy issues that are central to countries outside of the US -- to make world politics less foreign to the US audience. Suffragio focuses, in particular, on those countries and regions with upcoming or recent elections.	Mid	[ 0.599173553719008, 36.25, 24.25 ]
710 F.Supp. 711 (1989) Leo HEIDEMAN, et ux., Plaintiffs, v. PFL, INC., Defendant. No. 88-0010-CV-W-JWO. United States District Court, W.D. Missouri, W.D. April 11, 1989. 712 Mark J. Klein, Dennis E. Egan, Popham, Conway, Sweeny, Fremont & Bundschu, Kansas City, Mo., for plaintiffs. John F. Wymer, Paul T. Stagliano, John R. Phillips, Paul, Hastings, Janofsky & Walker, Atlanta, Ga., John R. Phillips, Blackwell, Sanders, Matheny, Weary & Lombardi, Kansas City, Mo., for defendant. MEMORANDUM AND ORDERS ON MOTION FOR SUMMARY JUDGMENT JOHN W. OLIVER, Senior District Judge. I The above-captioned case pends on defendant's motion for summary judgment in which the defendant asserts that all five counts[1] of plaintiffs' complaint are barred by the applicable statute of limitations. Plaintiffs maintain that "[t]here are no statute of limitations issues in the instant litigation that properly may be resolved by summary judgment. Defendant has not carried its burden of showing that no genuine issue exists as to any material fact; to the contrary, plaintiffs have indicated the existence of substantial issues as to material facts on each of their causes of action." Plts' Memo in Oppos. to Deft's Motion for S.J. on Stat. of Limit. Issues at 12. Pursuant to discussion at a pretrial conference held August 31, 1988, the parties agreed and the Court approved that the statute of limitations issues presented in defendant's pending motion for summary judgment should be separated for determination pursuant to Rule 42(b) of the Federal 713 Rules of Civil Procedure. An order to that effect was entered on August 31, 1988 and an agreed schedule of briefs for the presentation of the statute of limitations issues to this Court for resolution was established. The parties were also able to agree upon a partial stipulation of facts which was filed together with both parties' reports of facts each considered material to the statute of limitation issues to which the other was unwilling to stipulate. This Court has reviewed those stipulations, defendant's motion for summary judgment, plaintiffs' opposition to defendant's motion for summary judgment, both defendant and plaintiffs' reports on the statute of limitation issues and defendant's reply brief together with all depositions and exhibits submitted.[2] We find and conclude that neither the principles of equitable estoppel nor equitable tolling can be said to toll the statute of limitation applicable to either plaintiffs' ADEA claim or to plaintiffs' ERISA claim. We further find and conclude that all three remaining State common law claims are also barred by the applicable statute of limitations. PLF's motion for summary judgment on Count I (ADEA claim), Count II (ERISA claim), and the three State claims (Counts III, IV, and V) will be granted because the charge for each count was not timely filed for the reasons set out below.[3] II Standard for Summary Judgment The Supreme Court has recently decided three summary judgment cases, Matsushita Elec. Industrial Co. v. Zenith Radio, 475 U.S. 574, 106 S.Ct. 1348, 89 L.Ed.2d 538 (1986); Anderson v. Liberty Lobby, Inc., 477 U.S. 242, 106 S.Ct. 2505, 91 L.Ed.2d 202 (1986); and Celotex Corp. v. Catrett, 477 U.S. 317, 106 S.Ct. 2548, 91 L.Ed.2d 265 (1986). This trilogy of cases clearly advocates a more liberal use of summary judgment. "Summary judgment procedure is properly regarded not as a disfavored procedural shortcut, but rather as an integral part of the Federal Rules as a whole, which are designed `to secure the just, speedy and inexpensive determination of every action.'" Celotex, 477 U.S. at 327, 106 S.Ct. at 2555, quoting Fed.R.Civ.P. 1. See also City of Mt. Pleasant v. Associated Electric Corp., Inc., 838 F.2d 268, 273 (8th Cir.1988) ("[A] trilogy of recent Supreme Court opinions demonstrates that [the Eighth Circuit] should be somewhat more hospitable to summary judgments than in the past. The motion for summary judgment can be a tool of great utility in removing factually insubstantial cases from crowded dockets, freeing courts' trial time for those cases that really do raise genuine issues of material fact."). The purpose of summary judgment is "to pierce the pleadings and to assess the proof in order to see whether there is a genuine need for trial." See Advisory Committee Notes to Rule 56. Summary judgment "must be construed with due regard not only for the rights of persons asserting claims and defenses that are adequately based in fact to have those claims and defenses tried to a jury, but also for the rights of persons opposing such claims and defenses to demonstrate in the manner provided by the Rule, prior to trial, that the claims and defenses have no factual basis." Celotex, 477 U.S. at 327, 106 S.Ct. at 2555. Under Rule 56(c), summary judgment is proper "if the pleadings, depositions, answers 714 to interrogatories, and admissions on file, together with the affidavits, if any, show that there is no genuine issue as to any material fact and that the moving party is entitled to a judgment as a matter of law. [T]he plain language of Rule 56(c) mandates the entry of summary judgment, after adequate time for discovery and upon motion, against a party who fails to make a showing sufficient to establish the existence of an element essential to that party's case, and on which that party will bear the burden of proof at trial." Celotex, 477 U.S. at 322, 106 S.Ct. at 2552-53.[4] The Supreme Court has made clear that the "party seeking summary judgment always bears the initial responsibility of informing the district court of the basis for its motion, and identifying those portions of `the pleadings, depositions, answers to interrogatories, and admissions on file, together with the affidavits, if any,'[5] which it believes demonstrate the absence of a genuine issue of material fact." Id. at 323, 106 S.Ct. at 2553. "Rule 56(e) [then] requires the nonmoving party to go beyond the pleadings and by her own affidavits or by `depositions, answers to interrogatories, and admissions on file,' designate `specific facts showing that there is a genuine issue for trial.'" Id. at 324, 106 S.Ct. at 2553. The nonmoving party cannot merely rest upon allegations and denials in his pleadings to get to the jury without any meaningful probative evidence that tends to support his complaint. Anderson, 477 U.S. at 248, 106 S.Ct. at 2510 citing First Nat'l Bank of Arizona v. Cities Service Co., 391 U.S. 253, 290, 88 S.Ct. 1575, 1593, 20 L.Ed. 2d 569 (1968). A genuine issue of material fact exists, "if the evidence is such that a reasonable jury could return a verdict for the nonmoving party." Anderson, 477 U.S. at 248, 106 S.Ct. at 2510. "Where the record taken as a whole could not lead a rational trier of fact to find for the nonmoving party, there is no `genuine issue for trial.'" Matsushita, 475 U.S. at 587, 106 S.Ct. at 1356 citing First Nat'l Bank of Arizona v. Cities Service Co., 391 U.S. 253, 289, 88 S.Ct. 1575, 1592, 20 L.Ed.2d 569 (1968). It must be emphasized, however, that nothing in these most recent Supreme Court cases cited above negates the rule of law mandated by earlier cases that in ruling on a motion for summary judgment, it is the court's duty to view the facts in the light most favorable to the nonmoving party and to allow that party the benefit of all reasonable inferences to be drawn from the evidence presented. Adickes v. S.H. Kress and Co., 398 U.S. 144, 157, 90 S.Ct. 1598, 1608, 26 L.Ed.2d 142 (1970); Inland Oil and Transport Co. v. United States, 600 F.2d 725, 727-28 (8th Cir.), cert. denied, 444 U.S. 991, 100 S.Ct. 522, 62 L.Ed.2d 420 (1979). See also 6 J. Moore, Federal Practice ¶ 56.15[3] (2d ed. 1987). III Findings of Fact The parties have stipulated to the following pertinent facts: 1. Plaintiff Leo Heideman (Mr. Heideman) was hired by defendant on or about July 12, 1964 as Regional Manager, North Central Region. Stip. ¶ 1. 2. Defendant is a Minnesota corporation whose corporate name at all times pertinent to the instant litigation was Northland Foods, Inc.; Jeno's, Inc.; or PFL, Inc. Stip. ¶ 2. 3. In 1967, Mr. Heideman was promoted to the position of National Field Sales Supervisor and from 1970 to 1978 worked in 715 several different management positions with defendant, as a vice president, the last of which was Vice President, Sales, for the Central Division of defendant. Stip. ¶ 5. 4. During the course of his employment with Jeno's, Inc., Mr. Heideman worked primarily out of his home in Kansas City, Missouri and traveled on a varying basis (approximately on a monthly basis) to the corporate headquarters of Jeno's, Inc., in Duluth, Minnesota. He would ordinarily stay in Duluth when making these visits, a day and a night. 5. On or about December 6, 1978, Carl Hill (Mr. Hill) was employed by defendant as Senior Vice President, Marketing and Sales. He had previously been employed by defendant from about 1967 or 1968 until 1972. At the time he left defendant's employment in [1982], he was Executive Vice President of Marketing and Sales. Stip. ¶ 9. 6. On or about January 3, 1979, Mr. Hill's actual authority was made co-extensive with that of the then president of defendant, Dick Jones (Mr. Jones), and Mr. Hill reported directly to the chairman and vice chairman of defendant, not to Mr. Jones. Stip. ¶ 10. 7. On or about December 21, 1978, Mr. Hill wrote a confidential memorandum (the Hill memo) to Mr. Jones regarding what Mr. Hill referred to as "additional responsibilities for Parr and Carpenter." Parr and Carpenter, as referred to in the Hill memo, were John Parr (Mr. Parr), then the Vice President of Sales of defendant, and Morris J. Carpenter (Mr. Carpenter), then the Vice President of Marketing of defendant, both of whom reported to Mr. Hill. Mr. Parr was then Mr. Heideman's immediate supervisor. Stip. ¶ 11. 8. Courtesy copies of the Hill memo[6] were directed to be delivered to Messrs. Parr, Carpenter, and Mick Paulucci (Mr. Paulucci). Mr. Paulucci was then the Vice Chairman of the Board of Directors of defendant. The document appended to this stipulation as "Exhibit A" appears to be a true copy of the courtesy copy of that memo delivered to Mr. Carpenter; however, defendant does not know who made the handwritten comments thereon, nor when they were made. Stip. ¶ 12. 9. Mr. Hill admits that it is possible, but thinks it unlikely, that he wrote the following words in the upper right-hand corner of the first page of the Hill memo "JayRead and Destroy." Stip. ¶ 13. 10. Around Christmas 1978, when Mr. Heideman was visiting defendant's office in Duluth, Minnesota, Mr. Hill called Mr. Heideman into Mr. Hill's office and advised Mr. Heideman that Mr. Heideman was being demoted from Vice President, Sales Central Division, to Manager of the Memphis Region, that he was expected to build up the Memphis Region, that he would have to move immediately and take over this new responsibility, and that Mr. Heideman would not receive any reduction in pay with respect to this demotion. Stip. ¶ 14. 11. After considering the proposed relocation to Memphis, Tennessee and demotion, and discussing the same with Mrs. Heideman, Mr. Heideman decided to accept the offered relocation and responsibility. Had he not accepted the offer, he would not have been able to continue his employment with defendant. Stip. ¶ 15. 12. Mr. Heideman was replaced as a vice president of defendant by Ed Korkki (Mr. Korkki). Mr. Korkki was born July 18, 1940. Stip. ¶ 16. 13. On or about June 1, 1979, Mr. Heideman was advised by Mr. Parr by telephone that Mr. Heideman was being terminated, immediately. Stip. ¶ 18. 14. Mr. Heideman lived, worked, and was in Tennessee at the time that he was terminated, and had been assigned to the Memphis territory for approximately five months. Mrs. Heideman also resided in Tennessee with her husband. Stip. ¶ 19. 15. Mr. Heideman, during his entire employment by defendant, never heard of any problems within defendant's organization 716 concerning age discrimination. It never occurred to him, until he subsequently received a copy of the Hill memo in 1986, that he might have been the victim of age discrimination practices by defendant. Stip. ¶ 20. 16. At the time of his termination or shortly thereafter, Mr. Heideman felt that the reason that Mr. Parr gave him was not the real reason that he was being terminated, and that he was being lied to. Stip. ¶ 21. 17. Mr. Heideman suspected, after being notified of his termination, that he had been lied to by Mr. Hill when he was demoted and offered the position in Memphis, in that Mr. Hill then actually wanted to cause Mr. Heideman to voluntarily resign, or terminate him shortly after transferring him to the Memphis office, not have him build the Memphis Region. Mr. Heideman did not have any opinion or belief, however, as to the real reason he was terminated. Stip. ¶ 22. 18. Mr. Heideman visited a federal agency office in Memphis, Tennessee, which he believes to have been the National Labor Relations Board, in an effort to see if he could get some help in forcing defendant to tell him the reason for his termination. The agency representative with whom he met stated that they were unable to help him, and referred him to a private attorney in Memphis. Mr. Heideman does not recall any mention made regarding age discrimination laws during his visit at the agency office. Stip. ¶ 23. 19. The same day Mr. Heideman visited the federal agency office, he visited with the attorney referred to him by the agency representative. The attorney advised Mr. Heideman that the employer did not have to give him a reason for termination, but could terminate him without a reason. The attorney offered to look into the matter if Mr. Heideman was willing to pay him $70 per hour. Under the circumstances, Mr. Heideman decided it did not make sense to employ the attorney, so he just dropped the matter. Mr. Heideman does not recall any mention made regarding age discrimination laws during his visit with the attorney. Stip. ¶ 24. 20. Almost immediately after being advised by Mr. Parr that Mr. Heideman was terminated, Mr. and Mrs. Heideman decided to return to Kansas City. They sold their house in the Memphis area on or about August 1, 1979 and immediately moved back to Kansas City. Stip. ¶ 25. 21. On or about August 29 or August 30, 1986, Mr. Heideman received from Mr. Lawrence Williams (Mr. Williams) an unsolicited copy of the Hill memo. This was the first time Mr. Heideman suspected that he may have been the victim of age discrimination practices by defendant. Stip. ¶ 26. 22. Within two or three days after his receipt of the Hill memo, Mr. Heideman visited the Equal Employment Opportunity Commission (EEOC) office in Kansas City, Missouri. Mr. Heideman filed a charge of discrimination with the EEOC on or about September 5, 1986. Stip. ¶ 27. 23. Mr. Heideman visited with one of his attorneys in the instant litigation, Mark J. Klein (Mr. Klein) on September 6, 1986, to determine if he had a right to private action against defendant arising out of defendant's actions. Stip. ¶ 28. 24. On August 23, 1986, before he had knowledge of the Hill memo, Mr. Heideman wrote to Jeno Paulucci stating his belief that he "was moved for a reason then fired on purpose." Stip. ¶ 29. 25. Plaintiffs filed suit in the Circuit Court of Jackson County, Missouri on November 25, 1987, and this action was subsequently moved to this Court on January 4, 1988. Stip. ¶ 30. Under the procedures directed pursuant to this Court's August 31, 1988 order, the parties also set forth those facts which they deemed material and in genuine issue in regard to the contentions made. We find and conclude that plaintiff has not presented any material facts in genuine issue for reasons that we state in the text to follow. IV Analysis A. ADEA Claim (Count I) In Count I of the complaint, plaintiffs allege that Mr. Heideman's termination 717 from defendant's company which occurred June 1, 1979 (see Stip. 18) was in direct violation of ADEA in that plaintiff's firing was the result of a "blatant and outrageous scheme of age discrimination." Memo in Oppos. to Deft's Mot. for S.J. on Stat. of Limit. Issue at 1. Plaintiffs maintain that defendant fraudulently concealed the true reason why Mr. Heideman was fired from the plaintiff and that they, "cannot be held barred from a cause of action." Id. "Plainly and simply, this case is about corporate concealment of illegal activity which, upon first discovery by the plaintiffs, was acted upon with immediacy. Contrary to defendant's arguments ... none of plaintiffs' claims are barred by applicable statute of limitations." Id. at 2. In order for plaintiffs to prevail on Count I, they must have filed a charge of age discrimination with the Equal Employment Opportunity Commission (EEOC) within 180 days of the alleged unlawful employment practice. 29 U.S.C. § 626(d).[7] Such a filing is a condition precedent to later filing a suit under ADEA. Kriegesmann v. Barry-Wehmiller, 739 F.2d 357 (8th Cir.1984), cert. denied, 469 U.S. 1036, 105 S.Ct. 512, 83 L.Ed.2d 402 (1984). Suit must be filed within two years of the alleged unlawful practice or within three years in the case of a willful violation. 29 U.S.C. § 626(e). The unlawful employment practice in this case occurred on June 1, 1979.[8] In some circumstances, the 180-day filing period provided under ADEA may be equitably tolled. Zipes v. Trans World Airlines, Inc., 455 U.S. 385, 393, 102 S.Ct. 1127, 1132, 71 L.Ed.2d 234 (1982). Two types of equitable tolling have been acknowledged by the courts: (1) equitable tolling which focuses on the plaintiff's excusable ignorance of the statute period (see Abbott v. Moore Business Forms, Inc., 439 F.Supp. 643, 646-49 (D.N. H.1977); Wright v. State of Tennessee, 628 F.2d 949 (6th Cir.1980)), and (2) equitable estoppel which tends to focus upon actions taken by the defendant (see Bonham v. Dresser Industries, Inc., 569 F.2d 187 (3d Cir.1977)); see also Caudill v. Farmland Industries, Inc., 698 F.Supp. 1476 (W.D. Mo.1988). Plaintiffs here assert both grounds for tolling the statute of limitationsthat he was excusably ignorant of his cause of action because he did not see the posted notice of his ADEA rights, and that he was unaware of his claim because of the misconduct on the part of defendant in giving him a pretextual reason for his termination. Similarly, because of defendant's misconduct, defendant should be estopped from asserting the statute of limitations as a defense. Plaintiffs allege that they learned of the unlawful discrimination motive only upon receipt of a copy of the Hill memorandum (see Appendix A) on August 29 or 30, 1986. "[I]t never occurred to Mr. Heideman, nor did he have any suspicion, until he received a copy [of the memo] ... that he might have been the victim of age discrimination ...." Memo in Oppos. to Deft's Mot. for S.J. on Stat. of Limit. Issue at 7. The Eighth Circuit has given some guidance as to when such tolling can occur: The statute of limitations will not be tolled on the basis of equitable estoppel unless the employee's failure to file in timely fashion is the consequence either of a deliberate design by the employer or of actions that the employer should unmistakenly have understood would cause the employee to delay filing his charge. Kriegesmann, 739 F.2d at 358-59 citing Price v. Litton Business Systems, Inc., 694 F.2d 963, 965 (4th Cir.1982). 718 Other circuits have similar guidelines.[9] 1. Notice Posting Equitable tolling can occur if the defendant fails to post the required notice setting forth employees' rights under ADEA. Kriegesmann, 739 F.2d at 358. Defendant has offered the affidavits of Mr. Sprague[10] and Mr. Henningsgard[11] which state that the required ADEA notices were in fact posted in the company headquarters in Duluth.[12] The statement by Mr. Heideman that he never saw any kind of notice posted on a bulletin board or elsewhere in defendant's office or other facilities, concerning age discrimination laws (Plt's Depos. at 174), is not enough to toll the statute nor does it create a factual issue for trial. See Posey v. Skyline Corp., 702 F.2d 102, 105 (7th Cir.), cert. denied, 464 U.S. 960, 104 S.Ct. 392, 78 L.Ed.2d 336 (1983) (employee's statement that he did not recall ever reading a notice of ADEA rights was insufficient to create a question of fact). The fact that plaintiff worked primarily out of his home rather than out of a corporate office does not affect the tolling issue. Such a question was clearly answered in Hrzenak v. White-Westinghouse Appliance Co., 510 F.Supp. 1086, 1092 (W.D.Mo. 1981), aff'd, 682 F.2d 714, 718 (8th Cir. 1982). "[E]mployee's assertion that he never saw any notices should not of itself require tolling...." Id. at 1092. 2. Affirmative Misconduct We turn now to the question of whether the defendant engaged in any affirmative misconduct[13] which would cause the plaintiff to delay filing his ADEA claim and subsequent suit and thus toll the limitations period. The statute will not be tolled unless the employee's failure to file in a timely manner is a consequence either of a deliberate design by the employer, or of actions that the employer should unmistakenly have understood would cause the employee to delay filing his charge. Kriegesmann v. Barry-Wehmiller Co., 739 F.2d 357, 358-9 (8th Cir.), cert. denied, 469 U.S. 1036, 105 S.Ct. 512, 83 L.Ed.2d 402 (1984). Plaintiffs allege that the following facts when taken in combination amount to the requisite employer "deliberate design" 719 which would result in equitable tolling of the statute under the test set forth in Kriegesmann. The fact that (1) Mr. Heideman was given a pretextual reason for his termination; (2) the Hill memo establishes an age discrimination policy; (3) there was an offer of an additional payment of $5,000 to Mr. Williams[14] if he would not circulate the Hill memo to anyone; and (4) Mr. Heideman was identified as one of the "middle-aged `professional' sales managers" who Mr. Hill wanted replaced.[15] We find that none of these facts singly or in combination would justify tolling. Plaintiff must come forward with evidence to show that what he was told by the defendant or actions taken by the defendant were intended to lull the plaintiff into sleeping on his rights and he must show actual and reasonable reliance upon defendant's misconduct or representations. See Naton v. Bank of California, 649 F.2d 691, 696 (9th Cir.1981). The fact that defendant may have misled the plaintiff as to why he was fired is not enough. Plaintiff must rely on those misrepresentations. "[T]he attempt to mitigate the harshness of a decision terminating an employee, without more, cannot give rise to an equitable estoppel." Kriegesmann, 739 F.2d at 358.[16] Mr. Heideman was told by Mr. Parr that he was fired because he no longer fit into Mr. Hill's plans (Plt's Depos. at 82-85), however, plaintiffs' counsel states that Mr. Heideman never believed the reason given by Mr. Parr. "At the time of his termination or shortly thereafter, Mr. Heideman felt that the reason that Mr. Parr gave him was not the real reason that he was being terminated, and that he was being lied to." Stip. ¶ 21. In reply to the question "when did you first believe that Carl Hill had deceived you?" [about the reason given for termination], plaintiff replied, "five minutes after I hung up the phone...." Plt's Depos. at 123. Mr. Heideman states that he felt he was "terminated for what I saw was totally unjustifiable reason, it just didn't make any sense...." Id. at 84; "I was moved [transferred to Memphis] for a reason and then fired on purpose." Plt's Depos. at 121 referring to Deft's Exh. 7. "I was deceived...." Id. Mr. Heideman was so sure he had not been given the true reason that he went to what he now believes was the National Labor Relations Board to see if he could get help in finding out the true reason. Stip. ¶ 23. Even before his termination, Mr. Heideman had misgivings about the way he was being treated by the defendant. Plaintiffs' counsel concedes that "Mr. Heideman was transferred by defendant to Memphis under circumstances Mr. Heideman considered extremely questionable...." (Emphasis added). Plts' Report on Stat. of Limit. Issues at 6. Counsel further concedes in Stipulation 22 that Mr. Heideman did not believe the reason given by Mr. Hill for his demotion and transfer to Memphis. At no time prior to his demotion was Mr. Heideman advised of any complaints about his job performance. Plt's Depos. at 57-58, 143-44. At no time prior to his termination was Mr. Heideman advised of any complaints about his job performance. Id. at 77-82, 96. Furthermore, Mr. Heideman visited an attorney concerning his termination to find out if he could somehow uncover the true reason for his termination but he decided "it did not make sense to employ the attorney, so he just dropped the matter." Stip. ¶ 24. Mr. Heideman was also aware that he was replaced by a man 15-20 years his junior, Mr. Korkki. Plt's Depos. at 141. 720 Equitable tolling results in a delay of the running of the statute of limitations until "`the plaintiff either acquires actual knowledge of the facts that comprise his cause of action or should have acquired such knowledge through the exercise of reasonable diligence after being apprised of sufficient facts to put him on notice.'" (Emphasis added). Cerbone v. International Ladies' Garment Workers' Union, 768 F.2d 45, 48 (2d Cir.1985) citing City of Detroit v. Grinnell Corp., 495 F.2d 448, 461 (2d Cir.1974). Given the foregoing facts and circumstances[17] surrounding Mr. Heideman's termination, we find and conclude that there were sufficient facts so that a reasonably diligent employee[18] would have been put on notice of his cause of action. Therefore there is no justification for equitable tolling of the statute of limitations nor do the circumstances create a factual issue for trial. Plaintiff Heideman urges this Court to deny defendant's motion for summary judgment on the basis of material facts at issue and cites among others Meyer v. Riegel Products Corp., 720 F.2d 303 (3d Cir. 1983). In Meyer the court held that a summary judgment was not appropriate because a material question of fact existed for the jury to determine where plaintiff had a suspicion that he had not been given the true reason for dismissal and had consulted an attorney. The case at hand presents many more factors to be considered than just suspicion and consultationenough factors which make it possible for this Court to conclude that summary judgment is appropriate. In the instant case there is ample evidence that plaintiff did not rely upon the pretextual reason given, it was plaintiff's own lack of diligence that led him to the present impasse. Every such plaintiff has an affirmative duty to make inquiry about his legal rights and to pursue those rights with due diligence. See, e.g., United States v. Kubrick, 444 U.S. 111, 100 S.Ct. 352, 62 L.Ed.2d 259 (1979); see also, Wehrman v. United States, 830 F.2d 1480, 1484 (8th Cir.1987). Based upon the foregoing analysis, we find and conclude that defendant's motion for summary judgment on Count I (ADEA claim) of plaintiff's complaint should be and is hereby granted. B. ERISA Claim (Count II) Count II of plaintiffs' complaint alleges violations of Section 510 of ERISA (Interference with Protected Rights) and plaintiffs maintain that they are entitled to "relief under the provisions of 29 U.S.C. §§ 1132 and 1140 in that defendant's action in discharging Mr. Heideman had the purpose and effect of substantially decreasing Defendant's Retirement Plan benefits...." Heideman Petition at 9. ERISA itself does not contain a statute of limitations for the bringing of civil action to recover benefits or to enforce rights under a pension plan. Therefore, the court must look to the most appropriate state statute of limitations. Johnson v. Railway Express Agency, 421 U.S. 454, 462, 95 S.Ct. 1716, 1721, 44 L.Ed.2d 295 (1975). The choice of state law applicable here is either Tennessee or Missouri, however, the Court need not decide the choice of law question because under either state law, plaintiffs' cause of action is time-barred.[19] 721 The facts in this case are clear that there is no basis for equitable tolling of the applicable statute of limitations for the reasons given in the Court's earlier discussion of plaintiffs' ADEA claim. For the reasons stated above, we find and conclude that defendant's motion for summary judgment on Count II (ERISA claim) of plaintiffs' complaint should be and is hereby granted. C. State Common Law Claims 1. Intentional Infliction of Emotional Distress (Count IV) and Loss of Consortium (Count V) Plaintiffs have a variety of theories under which they maintain that neither Missouri's five-year statute of limitations[20] nor Tennessee's one-year statute of limitations[21] defeats their claims in Counts IV and V. First, plaintiffs argue that their cause of action did not accrue at the time of plaintiff's termination in July 1979 but that their cause of action arose when they received the Hill memorandum on August 29 or 30, 1986. Plaintiffs argue that their cause of action was fraudulently concealed from them and that Mo.Rev.Stat. § 516.280 applies "[i]f any person, by absconding or concealing himself, or by any other improper act, prevent the commencement of an action, such an action may be commenced within the time herein limited, after the commencement of such action shall have ceased to be so prevented." Second, plaintiffs argue that their cause of action did not arise until later than 1979. Plaintiffs cite Mo.Rev.Stat. § 516.100 "[T]he cause of action shall not be deemed to accrue when the wrong is done or the technical breach of contract or duty occurs, but when the damage resulting therefrom is sustained and is capable of ascertainment, and, if more than one item of damage, then the last item, so that all resulting damage may be recovered, and full and complete relief obtained." Plaintiffs maintain that the last item of damage occurred in 1984 while plaintiff was living in Missouri when plaintiff began losing his sight or at some unspecified future date when his emotional distress began to subside, also while plaintiff resided in Missouri. Thirdly, plaintiffs contend that defendant should be equitably estopped from pleading Tennessee's one-year statute of limitations because plaintiffs were long-established Missouri residents and only were located in Tennessee for a few months and then only because defendant induced them to move to Tennessee. Defendant maintains that both counts are barred by Missouri's borrowing statute, Mo.Rev.Stat. § 516.190 (1989 Supp.) which states: "Whenever a cause of action has been fully barred by the laws of the state, territory or country in which it originated, said bar shall be a complete defense to any action thereon, brought in any of the courts of this state." Since Counts IV and V are personal injury torts which arose in Tennessee, they are governed by Tennessee law. Actions for libel, for injuries to the person, false imprisonment, malicious persecution ... shall be commenced within one (1) year after the cause of action accrued. Tenn.Code Ann. § 28-3-104(a) (1980). For the reasons set forth below, we find and conclude that plaintiffs' Count IV and Count V both are time-barred by the Missouri borrowing statute. The Eighth Circuit has made clear that "[t]he plain meaning of the [borrowing] statute in question is that where the tort takes place in a foreign jurisdiction, Missouri 722 will adopt the statute of limitations of that jurisdiction barring the cause of action." McIndoo v. Burnett, 494 F.2d 1311, 1313 (8th Cir.1974). In the instant case, the tortious conductthe termination of plaintifftook place in Tennessee. Stip. ¶ 18.[22] The plaintiff resided in Tennessee at the time of the wrongful termination. The injuries sustained by the plaintiff occurred in Tennessee when he was terminated and not at some later date as plaintiff maintains. 2. Fraudulent Inducement to Accept Transfer to Memphis, Tennessee (Count III) Plaintiffs' final count is based on the same set of allegations as plaintiff maintains in his ADEA claim earlier discussed. Plaintiff contends that defendant defrauded him into transferring to Memphis, Tennessee and then terminated him due to his age. Complaint ¶¶ 35, 37; Plt's Depos. at 147. Plaintiff argues that this fraud began in December 1978 when he was offered the transfer and ended when he was terminated in June 1979. Plaintiff states, however, that the fraud was not discovered until August 1986 upon receipt of the Hill memo and thus plaintiff may take advantage of Mo.Rev.Stat. § 516.120(5): "An action for relief on the ground of fraud, the cause of action in such case to be deemed not to have accrued until the discovery by the aggrieved party, at any time within ten years, of the facts constituting fraud." Here, plaintiffs' argument fails as it has previously failed. This cause of action began to run upon plaintiff's termination in 1979. At which time he felt "deceived" about his transfer. Plt's Depos. at 84. Further evidence of when a reasonable person would have been aware of the facts constituting fraud have been previously dealt with in this memorandum and order and will not be reiterated here. It is therefore ORDERED (1) that defendant's motion for summary judgment on Counts I, II, III, IV, and V should be and the same is hereby granted. It is further ORDERED (2) that the Clerk of this Court shall enter final judgment in favor of defendant and against plaintiff in accordance with Rule 58 of the Federal Rules of Civil Procedure. 723 APPENDIX A *724 NOTES [1] Count I alleges a violation of the Age Discrimination in Employment Act of 1967, 29 U.S.C. § 621, et seq. (ADEA); Count II alleges a violation of the Employment Retirement Income Security Act of 1974, as amended, 29 U.S.C. § 1001, et seq. (ERISA); Count III alleges fraudulent inducement to accept transfer to Memphis; Count IV alleges intentional infliction of emotional distress; and Count V alleges loss of consortium by Mrs. Heideman. [2] This includes the plaintiffs' supplementary affidavit filed February 8, 1989, defendant's reply to plaintiffs' supplementary affidavit filed February 21, 1989, and plaintiffs' reply to defendant's reply filed February 23, 1989. [3] Both parties recognized that a decision in favor of the defendant on the statute of limitation issue would produce a harsh result. For there can be no doubt that if plaintiff had not slept on his rights and had moved with greater dispatch to pursue the true reason for his firing before the statute of limitations had run, plaintiff would have had an open and shut case of age discrimination. However, principles stated in Baldwin County Welcome Center v. Brown, 466 U.S. 147, 151, 104 S.Ct. 1723, 1725, 80 L.Ed.2d 196 (1984), and in Mohasco Corp. v. Silver, 447 U.S. 807, 826, 100 S.Ct. 2486, 2497, 65 L.Ed.2d 532 (1980), foreclose the determination of statute of limitation questions on the basis of sympathy. [4] The "standard [for granting summary judgment] mirrors the standard for a directed verdict under Federal Rule of Civil Procedure 50(a)...." Anderson, 477 U.S. at 250, 106 S.Ct. at 2511. "The primary difference between the two motions is procedural; summary judgment motions are usually made before trial and decided on documentary evidence, while directed verdict motions are made at trial and decided on the evidence that has been admitted." Id. at 251, 106 S.Ct. at 2512 citing Bill Johnson's Restaurants, Inc. v. NLRB, 461 U.S. 731, 745, n. 11, 103 S.Ct. 2161, 2171, n. 11, 76 L.Ed.2d 277 (1983). [5] The language "if any" is clear, "summary judgment may be made pursuant to Rule 56 `with or without supporting affidavits.'" Celotex, 477 U.S. at 324, 106 S.Ct. at 2553. [6] A copy of this memo is attached as Appendix A and incorporated herein by this reference in our findings of fact. [7] 29 U.S.C. § 626(d) provides: No civil action may be commenced by an individual under this section until 60 days after a charge alleging unlawful discrimination has been filed with the Equal Opportunity Commission. Such a charge shall be filed (1) within 180 days after the alleged unlawful practice occurred.... [8] For a discussion of the Eighth Circuit's position on when the unlawful employment practice occurs and thus triggers the running of the statute, see Wilson v. Westinghouse Electric Corp., 838 F.2d 286, 288 (8th Cir.1988). [9] When the defendant wrongfully deceives or misleads the plaintiff in order to conceal the existence of a cause of action, the 180-day period will be tolled. English v. Pabst Brewing Co., 828 F.2d 1047 (4th Cir.1987), cert. denied, ___ U.S. ___, 108 S.Ct. 2037, 100 L.Ed.2d 621 (1988) ("a time bar may be tolled on equitable grounds `if the employee could show it was impossible for a reasonably prudent person to learn that his discharge was discriminatory'") (id. at 1050) citing Miller v. International Telephone and Telegraph Corp., 755 F.2d 20, 24 (2d Cir.), cert. denied, 474 U.S. 851, 106 S.Ct. 148, 88 L.Ed.2d 122 (1985). See also Lawson v. Burlington Industries, 683 F.2d 862, 864 (4th Cir.), cert. denied, 459 U.S. 944, 103 S.Ct. 257, 74 L.Ed.2d 201 (1982); Cerbone v. International Ladies' Garment Workers' Union, 768 F.2d 45, 48 (2d Cir. 1985); Coke v. General Adjustment Bureau, 640 F.2d 584 (5th Cir.1981). [10] Exhibit A of Deft's Mot. for S.J. [11] Exhibit B of Deft's Mot. for S.J. [12] Plaintiffs offer no evidence that such notices were not posted. [13] For examples of what type of misconduct is and is not sufficient to allow equitable estoppel or tolling see Wilson v. Westinghouse Electric Corp., 838 F.2d 286 (8th Cir.1988); English v. Pabst Brewing Co., 828 F.2d 1047 (4th Cir.1987); Lawson v. Burlington Industries, Inc., 683 F.2d 862 (4th Cir.), cert. denied, 459 U.S. 944, 103 S.Ct. 257, 74 L.Ed.2d 201 (1982) (summary judgment granted defendantno tolling where employee believed employer would eventually rehire him through no misconduct by employer); Price, 694 F.2d 963 (4th Cir.1982); O'Malley v. GTE Service Corp., 758 F.2d 818 (2d Cir.1985) (no affirmative misconduct found when employer delayed in sending certain retirement forms); Miller v. International Tel. & Tel. Corp., 755 F.2d 20 (2d Cir.1985), cert. denied, 474 U.S. 851, 106 S.Ct. 148, 88 L.Ed.2d 122 (1985); Cerbone v. International Ladies' Garment Workers' Union, 768 F.2d 45 (2d Cir.1985) (tolling would occur while employee waits to see if employer honors promise of reinstatement); and see Coke v. General Adjustment Bureau, Inc., 640 F.2d 584 (5th Cir.1981); Ott v. Midland-Ross Corp., 600 F.2d 24 (6th Cir.1979); Bonham v. Dresser Industries, Inc., 569 F.2d 187 (3d Cir.1977), cert. denied, 439 U.S. 821, 99 S.Ct. 87, 58 L.Ed.2d 113 (1978); Glus v. Brooklyn Eastern District Terminal, 359 U.S. 231, 79 S.Ct. 760, 3 L.Ed.2d 770 (1959) (defendant misled plaintiff as to necessity of filing claim); Atkins v. Union Pacific R. Co., 685 F.2d 1146 (9th Cir.1982) (tolling occurred where defendant tells plaintiff he intends to settle dispute over termination). [14] Mr. Larry Williams was also an employee of defendant and he had timely filed an age discrimination lawsuit against the defendant which resulted in a $75,000 settlement. [15] Mr. Williams testified in his deposition that he had at least two conversations with Mr. Hill in which Mr. Heideman was so identified. Williams' Depos. 69-73. [16] "[T]he failure to tell plaintiff that he was demoted because of his age is not the type of deception or fraud that operates to toll the limitations period." Klausing v. Whirlpool Corp., 623 F.Supp. 156, 162 (S.D.Ohio 1985), appeal dismissed without opinion, 785 F.2d 309 (6th Cir.1986). [17] "Whether to grant equitable relief from the statutory provisions is a matter that should be determined `on a case-by-case basis, depending on the equities in each case." Naton, 649 F.2d at 696 citing Hageman v. Philips Roxane Lab., Inc., 623 F.2d 1381, 1385-86 (9th Cir.1980). [18] The factual circumstances in Vaught v. R.R. Donnelley & Sons Co., 745 F.2d 407 (7th Cir. 1984), are similar to the instant case. There the plaintiff knew he was demoted, knew he was replaced by a younger man and knew he had consistently obtained good job performance evaluations. The district court found that the statute began to run when he was aware of those facts listed above and not when he first learned that his employer had replaced most managers over age 50 with younger men. Id. at 410-11. [19] Under Tennessee law an action under 29 U.S.C. § 1132 is governed by the six-year statute of limitations applicable to contracts. Tenn. Code Ann. § 28-3-109 (1980); Haynes v. O'Connell, 599 F.Supp. 59, 62 (E.D.Tenn.1984). Under Missouri law an even shorter period of five years would apply. Mo.Rev.Stat. § 516.120(1); Fogerty v. Metropolitan Life Ins. Co., 666 F.Supp. 167, 169 (E.D.Mo.1987), aff'd, 850 F.2d 430 (8th Cir.1988). [20] What actions within five years. (4) An action for ... any other injury to the person or rights of another, not arising on contract.... Mo.Rev.Stat. § 516.120. [21] "Actions for libel, for injuries to the person, false imprisonment, malicious persecution, ... shall be commenced within one (1) year after cause of action accrued." Tenn.Code Ann. § 28-3-104(a). [22] The fact that plaintiff was called by phone from Duluth and informed he was terminated does not affect the determination that the tort took place in Tennessee. The cause of action for an injury to an individual occurs where that individual was located at the time of the injury. Electric Theater Co. v. Twentieth Century-Fox Film Corp., 113 F.Supp. 937 (W.D.Mo.1953). See also Western Newspaper Union v. Woodward, 133 F.Supp. 17 (W.D.Mo.1955) ("It is the general law ... that in tort actions governed by state law, the law of the state in which the injury or loss was suffered and which, hence created the right, governs the tort....") Id. at 23.	Low	[ 0.457627118644067, 27, 32 ]
<?php namespace Oro\Bundle\CheckoutBundle\Tests\Unit\Layout\DataProvider; use Oro\Bundle\CheckoutBundle\Layout\DataProvider\CheckoutForgotPasswordCheckEmailProvider; use Symfony\Component\HttpFoundation\Request; use Symfony\Component\HttpFoundation\RequestStack; use Symfony\Component\HttpFoundation\Session\Session; class CheckoutForgotPasswordCheckEmailProviderTest extends \PHPUnit\Framework\TestCase { /** * @var RequestStack\|\PHPUnit\Framework\MockObject\MockObject / private $requestStack; /* * @var Session\|\PHPUnit\Framework\MockObject\MockObject / private $session; /* * @var CheckoutForgotPasswordCheckEmailProvider */ private $provider; protected function setUp(): void { $this->requestStack = $this->createMock(RequestStack::class); $this->session = $this->createMock(Session::class); $this->provider = new CheckoutForgotPasswordCheckEmailProvider( $this->requestStack, $this->session ); } public function testIsCheckEmailWithoutParameter() { $email = '[email protected]'; $this->session->expects($this->once()) ->method('get') ->with('oro_customer_user_reset_email') ->willReturn($email); $this->session->expects($this->once()) ->method('remove') ->with('oro_customer_user_reset_email'); $this->requestStack->expects($this->once()) ->method('getMasterRequest') ->willReturn(new Request()); $this->assertEquals($email, $this->provider->getCheckEmail()); } public function testIsCheckEmailWithoutEmail() { $email = null; $this->session->expects($this->once()) ->method('get') ->with('oro_customer_user_reset_email') ->willReturn($email); $this->session->expects($this->once()) ->method('remove') ->with('oro_customer_user_reset_email'); $request = new Request(); $request->query->add(['isCheckEmail' => true]); $this->requestStack->expects($this->once()) ->method('getMasterRequest') ->willReturn($request); $this->assertEquals($email, $this->provider->getCheckEmail()); $this->assertNull($request->query->get('isCheckEmail')); $this->assertTrue($request->query->get('isForgotPassword')); } }	Mid	[ 0.580786026200873, 33.25, 24 ]
Cite as 2013 Ark. 396 SUPREME COURT OF ARKANSAS No. CR-13-106 JOSHUA R. ALLEN Opinion Delivered October 10, 2013 APPELLANT APPEAL FROM THE PULASKI V. COUNTY CIRCUIT COURT, FOURTH DIVISION [NO. 60CR-09-3411] STATE OF ARKANSAS APPELLEE HONORABLE HERBERT WRIGHT, JR., JUDGE AFFIRMED. CLIFF HOOFMAN, Associate Justice Appellant Joshua R. Allen appeals from his conviction for capital murder, for which he received a life sentence, and his convictions for four counts of committing a terroristic act, for which he received concurrent sentences of five years’ imprisonment on each count, to run consecutively to the life sentence. He was also found guilty of using a firearm during the commission of the felony and received a sentence enhancement of five years, with this sentence also to run consecutively to the capital-murder sentence, for a total of life plus ten years. For his sole point on appeal, Allen argues that the circuit court erred in excluding Ark. R. Evid. 404(b) testimony. Our jurisdiction is pursuant to Ark. Sup. Ct. R. 1-2(a)(2) (2013). We affirm. Allen was charged with capital murder and four counts of committing a terroristic act in connection with the death of Latonio Quince on August 4, 2009, after Allen fired five Cite as 2013 Ark. 396 shots at a vehicle in which Quince was a passenger. Antonio Johnson, who was the driver of the vehicle, was uninjured. Allen’s first jury trial in March 2011 ended in a mistrial. His second trial took place in October 2012. Although Allen does not challenge the sufficiency of the evidence supporting his convictions, a review of relevant testimony is necessary to understand the issue presented on appeal. In Allen’s statement to police, as well as his testimony at the second trial, he claimed that Johnson, who was an acquaintance, had called him on August 4, 2009, in order to buy marijuana. According to Allen, he told Johnson to meet him at a Valero gas station on Stagecoach Road and to come alone. When Allen drove into the parking lot and saw that Johnson had a passenger in his vehicle, Allen left the gas station and turned onto the Mabelvale West access road near Interstate 30. Allen stated that, as he was driving on the overpass, he noticed Johnson’s vehicle pull up beside him in the left lane and saw the passenger pull a gun and point it at him. Allen stated that he was scared that he was going to get shot in the face and that he grabbed his 9mm handgun and started shooting at Johnson’s vehicle. He claimed that he could not speed up and outrun Johnson because there was a truck in front of him and that he could not swerve to the right because there was a curb. Allen stated that Johnson’s vehicle eventually stopped and that he kept on going to a friend’s house, who told Allen that he needed to get rid of the car. After he left his friend’s home, Allen phoned the police and reported his car stolen, although he did not wait for a police officer to come and speak with him as he was instructed to do. Later that evening, Allen poured gasoline inside the vehicle and set it on fire. Allen then turned himself in to police 2 Cite as 2013 Ark. 396 on August 6, 2009, after learning that there was a warrant for his arrest. Allen claimed that he was scared and “freaking out” after the shooting and that he was not thinking when he destroyed his car. He further claimed that there had been no previous disputes between him and Johnson, that he had not intended to hurt anyone when he had shot at the vehicle, and that he had only done so in self-defense. Johnson also gave a statement to police and testified at both trials. Johnson stated that he had picked up his friend, Quince, at the Valero station on August 4, 2009, and that they were going to Johnson’s cousin’s house to visit. As they were driving on Mabelvale West, Johnson noticed in his rearview mirror that a white Crown Victoria was speeding up behind him. As the vehicle pulled alongside him, Johnson stated that he recognized Allen, who began shooting at them. When he realized that Quince had been shot, Johnson pulled off the road briefly to check on him, then took off for what he believed was the nearest hospital. Two nurses leaving the building assisted Quince after Johnson pulled up in his vehicle and yelled that he needed help; however, Quince died almost immediately from the gunshot wound to his flank. In his initial statement to police, Johnson claimed that he and Allen were acquaintances and that he had no idea why Allen would have pulled a gun on him, other than a conflict over a female several years earlier. At Allen’s first trial, however, Johnson admitted that he had stolen marijuana from Allen several years prior to the August 2009 incident. Although Johnson also initially claimed that he did not have a gun when he robbed Allen, he testified at the second trial that he had lied and admitted that he had in fact robbed Allen at gunpoint. Allen denied that this prior incident had ever happened. 3 Cite as 2013 Ark. 396 Prior to the second trial, the circuit court held an evidentiary hearing on whether the testimony of Demetrius Thompson would be admissible at trial regarding certain alleged bad acts by Johnson, who was the State’s primary eyewitness. In his proffered testimony, Thompson would have stated that in May 2010, Johnson approached him about “a lick,” and persuaded him to rob a person named Jason Carter at gunpoint in order to steal Carter’s drugs and wheel rims. Thompson would have further testified that Johnson, who was supposed to wait for him at a certain location, left him, forcing him to steal the victim’s car. Thompson stated that he was currently serving a prison sentence for that robbery. For the second bad act alleged by Thompson, Johnson allegedly gave Thompson a handgun and counterfeit bills to buy drugs from Andre Farrell in April 2010. Thompson would have testified that Johnson again drove off and left him during that incident. The State argued that this proffered testimony was not relevant to the charges against Allen or to his defense of justification and that it was not admissible under Ark. R. Evid. 404(b) or 608(a). The defense contended that this evidence was admissible because the alleged bad acts involved circumstances similar to the ones in the present case, in that the defense would contend at trial that the victim in this case, Quince, was in the same position as Thompson had been in the other incidents. After reviewing briefs submitted by the parties on the issue, the circuit court entered an order denying Allen’s motion to admit Thompson’s proffered testimony. At the conclusion of the trial, Allen was convicted of all charges. He waived jury sentencing, and the circuit court sentenced him to a total of life plus ten years’ imprisonment. 4 Cite as 2013 Ark. 396 Allen filed a timely notice of appeal, and his sole argument on appeal is whether the circuit court erred in excluding Demetrius Thompson’s testimony. Circuit courts have broad discretion in deciding evidentiary issues, and their rulings on the admissibility of evidence are not reversed on appeal absent an abuse of discretion. Laswell v. State, 2012 Ark. 201, 404 S.W.3d 818. Allen contends that Thompson’s testimony was relevant and admissible under Ark. R. Evid. 404(b) (2013) because the evidence goes to show the modus operandi of Antonio Johnson, as well as motive, opportunity, intent, plan, and knowledge. According to Ark. R. Evid. 401 (2013), relevant evidence means “evidence having any tendency to make the existence of any fact that is of consequence to the determination of the action more probable or less probable than it would be without the evidence.” All relevant evidence is admissible, except as otherwise provided by the rules. Ark. R. Evid. 402 (2013). Under Rule 404(b), evidence of other crimes, wrongs, or acts is not admissible to prove the character of a person in order to show that he acted in conformity therewith; however, it may be admissible for other purposes, such as proof of motive, opportunity, intent, preparation, plan, knowledge, identity, or absence of mistake or accident. Thus, evidence admitted under Rule 404(b) must be independently relevant to a material issue in the case. Cook v. State, 345 Ark. 264, 45 S.W.3d 820 (2001). We have further held that modus operandi evidence is only admissible where two requirements are met: (1) both acts must be committed with the same or strikingly similar methodology, and (2) the methodology must be so unique that both acts can be attributed to one individual. Id. 5 Cite as 2013 Ark. 396 In the present case, there is no question as to the identity of the accused, the victim, or any of the key witnesses in the case, and Allen has failed to demonstrate how Johnson’s modus operandi in other alleged bad acts, which purportedly occurred after the August 2009 shooting incident, is relevant to any material issue in this case. Nor has Allen shown how the proffered evidence is admissible for any of the other purposes set forth in Ark. R. Evid. 404(b). While Allen asserted justification as a defense to the charges, Quince, not Johnson, was the person who Allen claims pointed a gun at him and forced him to fire at the vehicle in self-defense. Furthermore, even assuming, as Allen asserts, that evidence of Johnson’s violent character was relevant to the issue of who was the aggressor and whether Allen reasonably believed he was in danger of suffering unlawful deadly physical force on August 4, 2009, this would only give Allen the right to introduce specific instances of Johnson’s violent character that were directed at him or were within his knowledge. Thompson v. State, 306 Ark. 193, 813 S.W.2d 249 (1991); Halfacre v. State, 277 Ark. 168, 639 S.W.2d 734 (1982). Neither of the bad acts alleged against Johnson in Thompson’s proffered testimony was directed at Allen, nor were they within his knowledge, as they both occurred after the shooting incident at issue in this case. Allen also contends that Johnson “opened the door” to evidence of his other recent bad acts by testifying that he had previously robbed Allen at gunpoint but claiming that he had since changed and did not “live that life” anymore. However, this is essentially impeachment of Johnson’s credibility as a witness, and as the State argued at the evidentiary hearing, specific instances of a witness’s conduct for the purpose of attacking or supporting 6 Cite as 2013 Ark. 396 his credibility, other than a conviction as provided in Ark. R. Evid. 609, may not be proved by extrinsic evidence. Ark. R. Evid. 608(b) (2013). Because Allen has failed to show that Thompson’s proffered testimony regarding Johnson’s bad acts is relevant to any material issue in this case, the circuit court did not abuse its discretion in excluding this evidence, and we therefore affirm. Rule 4-3(i) Review In compliance with Ark. Sup. Ct. R. 4-3(i), the record has been examined for all objections, motions, and requests made by either party that were decided adversely to Allen, and no prejudicial error has been found. Affirmed. CORBIN and DANIELSON, JJ., concur. DONALD L. CORBIN, concurring. While I agree with the majority opinion that the circuit court did not abuse its discretion in excluding the proffered testimony of Demetrius Thompson, I must write separately because I do not agree with the majority’s analysis of Appellant’s argument that Antonio Johnson opened the door to evidence of his other bad acts. In reviewing Appellant’s argument on this point, it is apparent that he fails to provide any convincing argument or citation to authority in support of his contention that Thompson’s testimony was admissible “to show the modus operandi of Antonio Johnson, as well as motive, opportunity, intent, plan and knowledge.” It is a well-settled principle of appellate jurisprudence that this court will not consider an argument, even a constitutional one, when the appellant presents no citation to authority or convincing argument in its support, and it 7 Cite as 2013 Ark. 396 is not apparent without further research that the argument is well taken. E.g., Green v. State, 2012 Ark. 347, ___ S.W.3d ___. Accordingly, I would decline to address the merits of Appellant’s alternative argument. DANIELSON, J., joins in this concurrence. Montgomery, Adams & Wyatt, PLC, by: James W. Wyatt, for appellant. Dustin McDaniel, Att’y Gen., by: Nicana C. Sherman, Ass’t Att’y Gen., for appellee. 8	Low	[ 0.505175983436853, 30.5, 29.875 ]
Former U.S. Secretary of the Interior Ken Salazar was briefly considered as Hillary Clinton’s potential running mate. After the Clinton campaign opted for Sen. Tim Kaine, Salazar was appointed as chair of Clinton’s transition team in August 2016. The Intercept reported at the time that Salazar was a major advocate for the oil and gas industry, favored the Trans Pacific Partnership, the Keystone XL pipeline, and has argued in favor of fracking and against environmental regulations. He would have led the team in charge of nearly 4,000 presidential appointments. Now that the Clinton White House never came to be, Salazar is running public relations for the oil industry. According to documents and emails obtained by IBTimes and MapLight, Salazar is working on behalf of Anadarko, Colorado’s largest oil and gas producer, after a deadly explosion of one of its wells on April 17 has put the company in a politically compromised position. Salazar, working through the law firm Wilmer Hale, is not formally registered as a lobbyist for the company. IBT and MapLight reported, “On April 26, authorities investigating the Firestone blast confirmed they were looking at an Anadarko well near the home that exploded. That day, Anadarko General Counsel Amanda McMillan contacted Hickenlooper Chief Legal Counsel Jacki Melmed about the situation. ‘I understand that you’ve spoken with Ken Salazar, who suggested that I reach out and connect with you,’ McMillan wrote in an email.” Colorado Gov. John Hickenlooper, who has been floated as a potential 2020 Democratic presidential candidate, also has close ties to the oil industry, noted the IBTimes/MapLight report. Anadarko successfully lobbied to stop a bill that would have forced the company to disclose to homeowners how close they live to oil and gas lines, a bill that Hickenlooper has been on the fence in opposing. “Jacque Montgomery, a spokeswoman for Hickenlooper, told IBT/MapLight that Salazar ‘identified himself as Anadarko’s counsel.’ She said Salazar was alerting the office that the company would be issuing a news release to explain the actions it had taken after the explosion.” The report went on to cite several instances that Salazar made regulatory decisions while serving as secretary of the interior that benefited Anadarko, including waiving rules in 2010 on one of the company’s offshore drilling projects—despite their partial ownership of the well that caused the Deepwater Horizon disaster. The company directly quotes Salazar in its public relations propaganda asserting that fracking poses no environmental issues. Salazar’s constant involvement in lobbying for corporations that he was once in charge of regulating poses grave ethics concerns and reveals loopholes that enable the revolving door of government officials and lobbyists within both political parties. There is no incentive for lawmakers to enact meaningful ethics rules to close the revolving door unless both parties take a stand against these violations. Instead, they turn a blind eye, exploit them for personal profit, or grant waivers to effectively render rules meaningless.	Low	[ 0.531135531135531, 36.25, 32 ]
62 Cal.App.2d 140 (1943) ALBERT COHN, Appellant, v. SAM ROSENBERG et al., Respondents. Civ. No. 12452. California Court of Appeals. First Dist., Div. One. Dec. 30, 1943. McGuire & Lahanier for Appellant. Morris Oppenheim for Respondents. KNIGHT, J. Plaintiff appeals from a judgment dismissing the above entitled action for failure to use reasonable diligence in the prosecution thereof. The action was pending in the Superior Court in and for 142 the City and County of San Francisco, and was for the recovery of moneys alleged to be due as rental for the use and occupation of real property and for the sale and delivery of machinery. The complaint was filed on February 29, 1932, and the answer on July 11, 1932. On March 9, 1933, plaintiff moved to set the cause for trial, and on July 31, 1933, after several continuances ordered by the court, it came on for trial in Department 14. The respective parties introduced their evidence and rested their cases, following which rebuttal and surrebuttal evidence was offered and received. Thereupon the court ordered the cause continued until August 2, 1933, and on that date additional oral and documentary evidence was introduced and counsel were directed to file briefs. On November 2, 1933, the cause was ordered submitted for decision; but nearly a year later and on September 4, 1934, a minute order was entered setting aside the submission "for further proceedings," and three and a half years thereafter, to wit, on May 16, 1938, the judge presiding in Department 14, before whom the cause had been tried, terminated his services as a judge of said court pursuant to the judges' retirement act. The following January plaintiff's attorney became a member of the municipal bench, and approximately three years thereafter, to wit, in December, 1941, other counsel was substituted, and on December 22, 1941, he filed a motion to reset the cause for trial; whereupon and on January 9, 1942, one of the defendants served and filed notice of motion supported by affidavit to dismiss the action for want of diligence in the prosecution thereof. During the seven years that elapsed between the date of the order setting aside the submission and the filing of the request to reset the cause for trial, no proceedings of any kind were had in the case; and one of the averments of the affidavit filed in support of the motion to dismiss was that the seven years delay had operated to the prejudice of the moving defendant and that he would suffer additional prejudice if his motion for dismissal was not granted. Counter affidavits were filed by plaintiff, but the above averments of prejudice were not denied, and the trial court's judgment of dismissal is based on findings that plaintiff was guilty of laches in failing to take any proceedings in the case within the seven year period following the entry of the order setting aside the submission, and that his failure so to do had operated to the prejudice 143 of the moving defendant and that he would suffer additional prejudice if the motion to dismiss was denied. [1] The theory upon which plaintiff seeks to reverse the judgment is based largely on section 583 of the Code of Civil Procedure, the pertinent provisions of which declare: "The court may in its discretion dismiss any action for want of prosecution on motion of the defendant ... whenever plaintiff has failed for two years after action is filed to bring such action to trial. Any action heretofore or hereafter commenced shall be dismissed ... unless such action is brought to trial within five years after the plaintiff has filed his action, except where the parties have stipulated in writing that the time may be extended." In this connection plaintiff contends that the above section "was designed to regulate the dismissal of actions only in cases where the action ... has not been brought to trial within five years after filing of the action"; and that since the action herein was partially tried within a year and a half after the filing of the complaint the requirements of the section were satisfied, and that under such circumstances the dismissal constituted an abuse of the discretionary power vested in the trial court. This contention is not sustainable. As said in Romero v. Snyder, 167 Cal. 216 [ 138 P. 1002], the purpose of the section was "to fix: 1. A minimum period within which mere delay is not deemed to be sufficient cause; 2. An immediately ensuing interval of three years, during which the court, in its discretion, may adjudge it sufficient; and, 3. A maximum period of five years, upon the expiration of which, the delay is declared to be sufficient as a matter of law and the dismissal is made mandatory." (See, also, Hibernia Sav, & Loan Soc. v. Lauffer 41 Cal.App.2d 725 [107 P.2d 494].) Thus it will be seen that, as so construed, the section permits a dismissal in the discretion of the court at any time subsequent to the expiration of the two year minimum period provided for therein, and it is well established that where a court in the exercise of such discretionary power has dismissed an action for lack of diligence in the prosecution thereof its decision will not be disturbed on appeal unless it is made to appear that there has been a gross abuse in the exercise of such power. (Inderbitzen v. Lane Hospital, 17 Cal.App.2d 103 [61 P.2d 514]; Hibernia Sav. & Loan Soc. v. Lauffer, supra, and cases cited therein; Steinbauer v. Bondesen, 125 Cal.App. 419 [14 P.2d 106]; Vogel v. Marsh, 122 Cal.App. 144 748 [10 P.2d 791].) In the present case it does not so appear. The undisputed facts are that plaintiff did nothing for a period of more than seven years after the submission was set aside to bring the case to a final termination. It is quite obvious, therefore, that there could be no justification for holding on appeal that the trial court abused its discretionary power in dismissing the action. [2] Moreover, it is well settled that the power of the court to dismiss an action for failure to prosecute it with diligence is an inherent power which exists without the aid of statutory authority and that the provisions of section 583 and other related sections must be read in the light of the existence of such inherent power. (Hibernia Sav. & Loan Soc. v. Lauffer, supra; Inderbitzen v. Lane Hospital, supra; Romero v. Snyder, supra; Johnston v. Baker, 167 Cal. 260 [139 P. 86].) The only limitation placed upon such inherent discretionary power is that it may not be exercised until a period of two years has elapsed after the action has been commenced (Inderbitzen v. Lane Hospital, supra), and that the power shall not be abused (Jackson v. De Benedetti, 39 Cal.App.2d 574 [103 P.2d 990]). It is apparent, therefore, that apart from the statutory authority granted by section 583 it was within the inherent discretionary power of the court to dismiss the action (Inderbitzen v. Lane Hospital, supra; Hibernia Sav. & Loan Soc. v. Lauffer, supra). In applying the foregoing doctrine it has been held that it is not an abuse of the discretionary power of the court to dismiss an action where it has not been brought on for retrial for more than two years after the disagreement of the jury at the first trial. (Oberkotter v. Spreckels, 64 Cal.App. 470 [221 P. 698].) Furthermore in the Inderbitzen case, supra, it is held that the mandatory portion of section 583 compelling a dismissal for failure to bring a case on for retrial within three years after the filing of the remittitur on reversal of the judgment does not deprive a trial court of the discretionary power to dismiss the action for delay amounting to a shorter period than that which under the statute gives a defendant an absolute right to a dismissal. Plaintiff cites cases holding that when a cause has been partially tried within the maximum five year period fixed by section 583 a defendant is not entitled as a "mandatory right" to a dismissal, and that in those circumstances a trial court 145 cannot be compelled by mandamus to grant the motion to dismiss, nor restrained by prohibition from taking further proceedings in case it has seen fit to deny the motion. (Allyne v. Superior Court, 200 Cal. 661 [254 P. 564]; Mercantile Invest. Co. v. Superior Court, 218 Cal. 770 [25 P.2d 12]; Mussat v. Superior Court, 16 Cal.App.2d 291 [60 P.2d 323]; Krasnow v. Superior Court, 15 Cal.App.2d 141 [59 P.2d 442].) But the reviewing courts in those cases go on to point out that in those circumstances the trial court may nevertheless, in the exercise of its statutory and inherent discretionary power, dismiss the action for lack of diligence in the prosecution thereof; and such was the case here. [3] The substance of plaintiff's second main contention is that since the trial court, of its own motion, set aside the submission "for further proceedings" plaintiff cannot be held guilty of laches for having waited for notice from the clerk as to when and for what purpose further hearing would be had. This contention is likewise without merit. As has been frequently said, the duty rests upon a plaintiff at every stage of the proceedings to use due diligence to expedite his case to a final determination that there may be an end to litigation (9 Cal.Jur. p. 526; Lieb v. Lager, 9 Cal.App.2d 324 [49 P.2d 886]; Inderbitzen v. Lane Hospital, supra.) In declaring such to be the law the court in Gray v. Times Mirror Co., 11 Cal.App. 155 [104 P. 481], went on to say: "It is the policy of the law to favor and encourage a prompt disposition of litigation, and this policy is the out-growth of sound and substantial reasons. The doctrine of laches as a bar to the assertion of stale claims and of statutes of limitations rests upon the same reasons or principle. A party against whom an action is instituted is entitled to as speedy a disposition thereof as is consistent with his own and the rights of the plaintiff, and if he who starts the law in motion does not with reasonable promptness pursue all the steps necessary to bring the litigation to an end, he should suffer the penalty of his default. It is no answer to say that the respondent did not, during the period of the delay, utter a word of protest against such delay. As we have said, it was the duty of the plaintiff to act, and to act with reasonable promptness and diligence. It was not the duty of the respondent to make any move except such as the law requires it to make in response to the movements of plaintiff at the various stages of the litigation." *146 [4] Even though it could be said in the present case, as plaintiff seems to contend, that under the circumstances he was not called upon to take any steps to reinstate the case on the trial calendar "for further proceedings" during the three and a half years that elapsed between the entry of the order setting aside the submission and the date of the judge's retirement, there could be no legal justification for having failed to have the cause restored to the trial calendar for retrial during the additional three and a half years following the date of the judge's retirement, because obviously immediately upon his retirement without having decided the case the cause was automatically set at large on all issues, and necessarily required that it be tried anew before another judge. [5] Nor does the fact that after January, 1939, plaintiff's attorney could no longer act for him serve as legal ground for setting aside the trial court's affirmative finding of laches, for it will be noted plaintiff waited three years before he secured the services of another attorney. The judgment is affirmed. Peters, P. J., and Ward, J., concurred.	Low	[ 0.512244897959183, 31.375, 29.875 ]
Bryan Mitchell posted a 1.93 ERA in three starts with Trenton in 2013. (Kevin Pataky/MiLB.com) For the first time in 2014, Bryan Mitchell felt like he could do no wrong. "Today was just one of those days," he said. "I really had all my pitches working for me." With his whole arsenal at his disposal, the Yankees' No. 14 prospect struck out a career-high 12 batters over six innings for his first Double-A win as Trenton downed Akron, 2-0, in Eastern League action. Mitchell (1-2) allowed just four hits and walked two, slimming his season ERA to 5.14. It was the 22-year-old's sixth start for the Thunder dating back to 2013. In those outings, his ERA is 3.31 with 36 strikeouts and 13 walks in 31 2/3 innings. The 2009 16th-rounder had allowed eight earned runs in eight innings during his first two starts this season. "I felt like I was in the zone a lot more than what I have been so far this season," he said. "For me, the big key is getting ahead of hitters. Once I get behind, that's when I'm in trouble. I threw strikes tonight." Two things helped Mitchell find the zone more effectively. For starters, the Reidsville, N.C., native made a mechanical adjustment, focusing on keeping his front side tighter during his delivery. The adjustment helped with the command of all his pitches and also led to sharper spin and control of his cutter -- a pitch he began throwing late in 2013. "My arm was kind of winging out," he said. "When I do that, I can't stay behind the cutter as well. Tonight, I closed off the front side a little better, and that helped me stay through the ball." Mitchell then was able to find a mental groove, allowing him to cruise through the game's middle innings. He ran into trouble in the fifth, though. Tyler Holt led off the frame with a line-drive single, then Jerrud Sabourin reached on a throwing error by Rob Segedin. With runners at the corners and no outs, Mitchell jumped ahead of leadoff man and Indians' No. 5 prospect Tyler Naquin 0-2, then stuck out him out swinging with a 1-2 offering. Next up was Cleveland's top prospect, Francisco Lindor, who had already singled and walked in the game. Mitchell struck out Lindor on three pitches then got Joe Wendle to fly out to right field to escape the jam. The next inning, Mitchell issued one walk but struck out the side to lock down the career high. Your browser does not support iframes. As MLB.com's prospect team noted in its Yankees' rankings, Mitchell has flashed excellent stuff as a Minor Leaguer, but since signing him, "The Yankees have waited for his production to catch up with his potential." The right-hander began 2013 with Class A Advanced Tampa, where he posted a 5.12 ERA in 24 appearances (23 starts). He posted a 1.48 groundout-to-flyout ratio and struck out 7.39 batters per nine innings, but also walked 3.77 batters per nine a year after walking 5.40 per nine with Class A Charleston. Mitchell said he hopes to build off Monday's momentum, working first and foremost to continue getting ahead to Double-A hitters. "It was really good for me," he said. "A big confidence boost, especially after my first two starts didn't go as well as I had hoped. I just want to keep that ball rolling now." New York's No. 6 prospect Tyler Austin drove in the Thunder's only runs in the first with a line-drive single to left. Jake Seiner is a contributor to MiLB.com. Follow him on Twitter at @Jake_Seiner. This story was not subject to the approval of the National Association of Professional Baseball Leagues or its clubs.	Mid	[ 0.654867256637168, 37, 19.5 ]
Intracranial hemorrhage occurs commonly in very-low-birthweight babies, and may account for many of the developmental handicaps seen in graduates of neonatal intensive care units. The goal of this case-control study of germinal matrix hemorrhage in very-low-birthweight babies is to identify exposures and characteristics (of the babies and their mothers) which if eliminated or modified might result in a reduction in the occurence of this disorder. Subjects will have been admitted to the neonatal intensive care units at Children's Hospital, the Brigham and Women's Hospital, and the Beth Israel Hospital, weigh less than 1.75 kilograms at birth, and had an ultrasonogram. Cases for each study will have documented evidence if germinal matrix hemorrhage. Controls will have sonographic evidence that they do not have germical matrix hemorrhage. Data about antenatal risk factors will be obtained from interviews of mothers and review of obstetricians' office records. Information about perinatal variables will be obtained from detailed review if delivery and neonatal intensive care unit charts. Data analysis will incluse multivariate techniques, some of which employ models with variables entered in a temporal sequence) i.e., antenatal, then delivery variables, then postnatal variables in theorder in which they occurred). Many of the hypotheses to be tested, especially those about antenatal risk factors have been generated in studies of hemorrhages on babies who died. This proposal is unique in emphasizing antenatal factors and in routinely obtaining detailed information from mothers, usually before the existence or absence if a hemorrhage has been established.	High	[ 0.669811320754716, 35.5, 17.5 ]
Hematological parameters and red blood cell indices in healthy Thai children: a revision for 2005. In order to provide a reference range for hematological parameters and red blood cells indices in Thai children, we analyzed data from 395 healthy non-anemic Thai children age from 1-16 years old, who all had normal pattern of hemoglobin typing (Hb A and Hb A2 less than 3.5%). Hematological analysis was performed using an automated cell counter and the hemoglobin studies were carried out by electrophoresis and liquid chromatography. Owing to a high frequency of a thalassemia in Thailand, cases with MCV < 75 fL has been excluded from the study since these cases were likely to be heterozygotes for alpha0 thalassemia. These criterions were applied to select so-called 'normal' controls for our analysis. Relatively mild microcytosis and hypochromia were observed, in particular in the first three years of age, suggesting an intrinsic immature nature of erythropiesis in the children. Age-dependent differences in the reference values for white blood cell (WBC) count and differential and platelet count were observed. Herein the hematological data and red blood cell indices were summarized according to ages and these will be of clinically useful for the future reference.	High	[ 0.6723404255319141, 29.625, 14.4375 ]
Mark Benson Madsen is a Republican Utah State Senator representing the 13th District, which includes some of the most conservative parts of the traditionally conservative state. Madsen was born in Washington D.C. and raised in Colorado. He is a proud NRA member and attorney who has championed libertarian causes during his tenure in the Utah State Senate. After serving a mission for the Church of Jesus Christ of Latter-day Saints (Mormon), Madsen attended college at George Mason University in Washington D.C. where he met his wife Erin while they both were working at a conservative think-tank. They moved to Utah where Madsen earned his J.D. at Brigham Young University and became an attorney before getting into politics. Erin and Mark have been married for 20 years and have five children together. Madsen is the grandson of Ezra Taft Benson, President Eisenhower’s secretary of agriculture and president and prophet of the Mormon Church from the mid-eighties until the time of his death in 1994. In February, Madsen made history when he filed the state’s first bill to legalize medical cannabis. S.B. 259, The Medical Cannabis Amendments, would have legalized the cultivation, sales, distribution and possession of whole-plant cannabis and cannabis extracts for patients suffering from a range of medical conditions. During the legislative session, he shocked reporters and his fellow senators by stating openly on-camera that he had traveled to Colorado to try cannabis legally for his chronic back pain, it worked, and he wanted to bring a similar program to Utah. Madsen has a history of chronic back pain in his family. He also sustained multiple injuries to his back and spine from car accidents and playing football when he was younger. For over 25 years he has grappled with the pain, which he says is day-to-day, and can range from tolerable to completely incapacitating. He has been prescribed several opiate painkillers and has undergone various back treatments, including epidurals, trigger point injections, nerve blocks and even a rhizotomy—a surgical procedure that involves removing, or “frying”, problem nerves. “That’s great for awhile,” he says. “But the nerves regrow.” Madsen traveled the country consulting with physicians to find a long-term solution to his chronic pain. A handful of his doctors recommended he try cannabis as an alternative to the opiate painkillers, but it wasn’t until he almost died of an accidental overdose that he began to look into medical cannabis. In 2007 Madsen and his family were preparing a holiday meal and doing yard work to celebrate Pioneer Day, a state holiday celebrating the arrival of Brigham Young and the Mormon pioneers into the Salt Lake Valley. He had been wearing a 3-day fentanyl patch on his shoulder and didn’t notice when one of the heavy bags he had been lifting had caused the patch to tear, releasing a lethal dose of the opiate into his bloodstream. He immediately began to feel the effects of the overdose—dizziness, fatigue and nausea. He asked his daughter to wake him up in five minutes so he could check on the food he was preparing and then laid down to take what he thought was a quick nap. When his daughter tried to wake him minutes later he had stopped breathing and had started getting cold. His wife, Erin, dragged him off the couch and began emergency resuscitation as 911 was called. “I was terrified,” said Erin. “I had four young children and I thought my husband was dead.” It wasn’t until they arrived at the hospital and a doctor removed the patch that they realized what had caused the incident. “It was extremely difficult for me to see in the faces of my children and wife the absolute terror they had just gone through thinking they had just lost their father and husband,” Mark says. “It helped me to understand that accidental overdoses do happen. Mark wasn’t doing anything wrong, he was taking the medicine in exactly the way that was prescribed in the dosage that was prescribed to him and he could have died,” Erin says. Mark began giving medical cannabis more thought but figured he would eventually try it in a legal state after leaving office. Erin says it was a huge leap for her to support his decision to use cannabis as a medicine, but then she read the studies and learned how it could relieve her husband’s suffering without potentially killing him. “I think as we look at this issue we need to realize that cannabis has been sold to us as something it is not,” Erin says. “One thing I realized when I started looking at this was so much that I knew was not true.” He had begun considering proposing medical cannabis legislation in the state, but didn’t think there would be support for it in conservative Utah. “I never necessarily thought this was going to be a solution for my pain in the state of Utah,” he says. “I always figured I would have to work out my own pain issues with surgeries and with opiates and I would have to force my way through.” During the 2014 legislative session, Utah became the first state to pass a high-CBD low-THC medical cannabis bill, H.B. 105, specifically for epileptic patients. Cannabidiol (CBD) is one of hundreds of medical compounds found in cannabis and has been known to have many incredible medical properties without the psychotropic effects associated with high-THC cannabis. Governor Gary Herbert signed H.B. 105 into law in March. The bill was named “Charlee’s Law” in honor of 6-year-old Charlee Nelson, an epileptic child who died days after the legislation was passed. Similar legislation would go on to be adopted in various forms by 10 more conservative states. “[These children] had been struggling with severe seizures up to the point of death,” Madsen says. “I realized it was misguided government policy that was keeping relief from these innocents and I started to take a different perspective. It wasn’t just about me and my back pain. There are other people suffering, and suffering worse than I, who could benefit from this. When it became an issue that was not just about me I realized I had to do something.” In February 2015, Madsen filed Utah’s first full medical cannabis legislation, opening up any cannabis strain—unrestricted by cannabinoid content—for patients with chronic pain, cancer, autoimmune disorders, Alzheimer’s and ALS, among other conditions. “At every step it has been consistent with the principles I have tried to stand for for 10 years in this legislature—individual liberty and limited government,” he says. The bill was narrowly defeated by one flipped vote in the Senate, but since the end of the legislative session in March, a groundswell of support in the state has steadily built momentum for Madsen to run the legislation again in 2016. “We need to work from the principles of freedom and compassion and let the policy grow from there,” he says. “I believe we should allow individuals and their physicians to make their own decisions on whether medical cannabis is an augmentation or an alternative to other traditional medical treatments. Government has no legitimate place in that process.” It's Not Over Yet... The majority of Utah believes cannabis is medicine. These are their stories. Watch More Episodes	Mid	[ 0.646310432569974, 31.75, 17.375 ]
Are media reports able to cause somatic symptoms attributed to WiFi radiation? An experimental test of the negative expectation hypothesis. People suffering from idiopathic environmental intolerance attributed to electromagnetic fields (IEI-EMF) experience numerous non-specific symptoms that they attribute to EMF. The cause of this condition remains vague and evidence shows that psychological rather than bioelectromagnetic mechanisms are at work. We hypothesized a role of media reports in the etiology of IEI-EMF and investigated how somatosensory perception is affected. 65 healthy participants were instructed that EMF exposure can lead to enhanced somatosensory perception. Participants were randomly assigned to watch either a television report on adverse health effects of EMF or a neutral report. During the following experiment, participants rated stimulus intensities of tactile (electric) stimuli while being exposed to a sham WiFi signal in 50% of the trials. Sham WiFi exposure led to increased intensity ratings of tactile stimuli in the WiFi film group, especially in participants with higher levels of somatosensory amplification. Participants of the WiFi group reported more anxiety concerning WiFi exposure than the Control group and tended to perceive themselves as being more sensitive to EMF after the experiment compared to before. Sensational media reports can facilitate enhanced perception of tactile stimuli in healthy participants. People tending to perceive bodily symptoms as intense, disturbing, and noxious seem most vulnerable. Receiving sensational media reports might sensitize people to develop a nocebo effect and thereby contribute to the development of IEI-EMF. By promoting catastrophizing thoughts and increasing symptom-focused attention, perception might more readily be enhanced and misattributed to EMF.	High	[ 0.660247592847317, 30, 15.4375 ]
Introduction {#Sec1} ============ Despite advances in the medical field, growing numbers of patients are becoming critically ill. Each year, 5,700,000 people in the USA are admitted to intensive care units (ICUs) \[[@CR1]\]. Critical illness is characterized by cellular immune dysfunction, vascular damage and uncontrolled hyperinflammation, even when the cause of illness is not infection. In critical illness, a systemic activation of coagulation may occur which, at its worst, results in a fulminant disseminated intravascular coagulation (DIC). DIC is characterized by simultaneous widespread microvascular thrombosis and profuse bleeding from various sites \[[@CR2]\]. Sepsis resulting from a generalized inflammatory and procoagulant response to an infection is associated with a high risk of mortality. Twenty per cent of patients who develop severe sepsis will die during their hospitalization \[[@CR3]\]. Septic shock is associated with the highest mortality, approaching 50 % \[[@CR3]\]. This rate increases in the presence of circulatory shock despite aggressive antimicrobial therapy, adequate fluid resuscitation and optimal care \[[@CR4]\], and it may reach as high as 70 % in patients with multiple organ dysfunction \[[@CR5], [@CR6]\]. Antithrombin III (AT III) is primarily a potent anticoagulant with independent anti-inflammatory properties. AT III irreversibly inhibits serine proteases (e.g. activated factor X and thrombin) in a one-to-one ratio, with the generation of protease--AT III complexes. Heparin prevents AT III from interacting with the endothelial cell surface by binding to sites on the AT III molecule, competing for the AT III binding site, and reducing AT III's ability to interact with its cellular receptor. AT III's anticoagulant effect is thus greatly accelerated (by a factor of 1000) by heparin; heparin reduces AT III's anti-inflammatory properties, weakens vascular protection and increases bleeding events \[[@CR7]--[@CR9]\] Heparin in patients with sepsis, septic shock or DIC associated with infection may be associated with decreased mortality \[[@CR10]\]. However, the overall effect is still not clear. Major bleeding events related to heparin administration cannot be excluded \[[@CR10]\] and safety outcomes have yet to be validated in a multicentre trial setting. The objective of this review was to examine the effect of AT III on mortality in critically ill participants and the benefits and harms of AT III. We investigated complications specific and not specific to the trial intervention, bleeding events, the effect on sepsis and DIC and the length of stay in ICU and in hospital in general. Methods {#Sec2} ======= This systematic review was carried out in accordance with Cochrane Collaboration methodology, PRISMA and GRADE guidelines \[[@CR11]--[@CR13]\]. This publication is an update of the existing Cochrane review with a preapproved and published protocol \[[@CR14]\]. For more detailed description of the search, methods, types of studies, participants, interventions, outcome measures, data collection, selection of studies, data extraction, primary and secondary outcomes, see Supplement. Statistics {#Sec3} ---------- We used Review Manager 5 software \[[@CR15]\] to calculate risk ratios (RRs) with 95 % confidence intervals (CIs) for dichotomous variables and mean difference (MD) with CI for continuous outcomes. We used the Χ ^2^ test to provide an indication of heterogeneity between studies, while the degree of heterogeneity observed in the results was quantified using the I ^2^ statistic. We used trial sequential analysis (TSA) to examine the impact of type 1 errors due to sparse data and repeated significance testing following updates with new trials \[[@CR16]\]. For more detailed information on statistical analyses and data management, assessment of risk of bias, subgroup and sensitivity analyses, assessment of heterogeneity, assessment of reporting biases, and data synthesis including TSA, see Supplement. Results {#Sec4} ======= Through electronic searches (Supplement Table 1) and from reading the references of potentially relevant articles, we identified 11,287 publications (Fig. [1](#Fig1){ref-type="fig"}). After reading the abstracts, we could directly exclude 11,173 publications. We retrieved 65 relevant publications for further assessment. We included 30 trials \[[@CR17]--[@CR46]\] (Table [1](#Tab1){ref-type="table"}), which randomized a total of 3933 participants. One trial \[[@CR21]\] was only published as an abstract and the data were so inadequate that they could not be used for further processing. Our analyses include a total of 3882 participants. The sample size varied from 16 to 2314 participants. We excluded 24 publications for the reasons detailed in Supplement Table 2. We found one ongoing trial \[[@CR47]\] but no data were provided for this trial.Fig. 1Flow chart in accordance with The Cochrane Collaboration guidelines. Three authors (FR, MA and AA) independently examined all potential primary studies and decided on their inclusion in the review Table 1Characteristics of the included trialsTrialNumber of participantsPopulation/trial descriptionIntervention/characteristicsHeparin (both groups)Follow-up (days)ITT/bias riskAlbert et al. \[[@CR17]\]32ICU patients with \<70 % AT III level, primary endpoint: mortality. No sample size calculationInfusion twice daily as long as AT III \<90 %. Total amount: 3500--17,000 IU. AT III before treatment unknown. No placeboYes90No/highBalk et al. \[[@CR18]\]34Adults patients with sepsis, cared for in a tertiary care centre. Trial only published as an abstractAT III (Kybernin) and placebo. No details stated. Use of heparin not stated. Control: no placebo. First dose: 2000--4000 IU, total amount: 3500--17,000 IU. Control: no placeboNA28No/highBaudo et al. \[[@CR19]\]29Liver transplantation in cirrhotic patients. Primary outcome: coagulatory variables and bleeding. No sample size calculationSubstitution preoperatively until AT III \>100 %, infusion 1000 IU/h during entire surgery. Total amount: 1000--4000 IU before surgery, 1740--12,000 IU during surgery. No placeboNoNAYes/highBaudo et al. \[[@CR20]\]120ICU patients with \<70 % AT III. Primary outcomes: mortality, 30 days survival, MOF score, FFP, and PC requirements. Sample size calculatedFixed dose of 4000 AT III and 2000 IU/12 h, 5 days. Total amount: 24,000 IU. AT III (%) before treatment: 52.9 (SD 14.5) IU in placebo group, 52.8 (15.5) IU in AT III group. Placebo: albuminNo30No/lowBlauhut et al. \[[@CR21]\]51Patients with DIC and septic shock. AT III activity \<70 % and at least 3 of the following: platelet count \<100, thrombin time \>24 s, thrombin coagulase time \>22 s, fibrinogen level \<150 mg/dl, ethanol gelatin test positiveGroup 1: Heparin: iv heparin 3000 IU followed by continuous infusion of 250 IU/h. Intervention group 1: AT III substitution with the aim to keep AT III activity constantly around 100 %. Intervention group 2: same AT III substitution as group 1 with heparin 1000 IU iv and continuous infusion of 100 IU/hNANANo/highDiaz-Cremades et al. \[[@CR22]\]36ICU patients with \<70 % AT III, no DIC. Primary outcome: mortality. No sample size calculationInitial dose 60 U/kg + 10 U/kg every 6 h. Total amount: 11.165 (SD 5.980) IU. AT III (%) before treatment: 48.3 (SD 12.2) IU in placebo group: 52 (11.7) IU in AT III group. Placebo: albuminYesNANo/highEisele et al. \[[@CR23]\]42Septic and critically ill patients. Primary outcome: 30 days mortality. No sample size calculationLoading dose: 3000 IU + 1500 IU/12 h, 5 days. Total amount: 18,000 IU. AT III (%) before treatment: 49.0 (SD 19.1) IU in placebo group, 45.7 (14.4) in AT III group. Placebo: unknownNo30Yes/highFourrier et al. \[[@CR24]\]35Critically ill with septic shock and DIC. Primary outcome: 28 days mortality. Sample size calculatedLoading dose over 3 h (3 ml/kg) + 3 ml/kg over 21 h, then 90--120 IU/kg/day for 3 days. Total amount: average 6000 IU. AT III (%) before treatment: 44 (SD 16) IU in placebo group, 52 (20) IU in AT III group. Placebo: albuminNo28Yes/lowFulia et al. \[[@CR25]\]60Infants, gestational age \<30 weeks, \<40 % AT III. Primary outcome: mortality and intraventricular haemorrhage. No sample size calculationLoading dose: 2 ml/kg (100 U/kg), then 1 ml/kg (50 U/kg)/8 h for 48 h. Total amount: unknown. AT III (%) before treatment (mg/dl): 7.93 (SD 0.59) in placebo group, 8.22 (0.62) in AT III group. Placebo: glucoseYes8Yes/lowGando et al. \[[@CR26]\]60DIC patients with sepsis and antithrombin levels of 50 to 80 %. Primary outcome: recovery from DIC on day 3. Secondary outcome: 28-day all-cause mortalityImmediately after the patients met the inclusion criteria, they were randomly assigned to either a group receiving antithrombin at a dose of 30 IU/kg (given over 60 min) per day for 3 days, or to the control group with no interventionNo28Yes/highGrenander et al. \[[@CR27]\]28Traumatic brain injury patients. Primary outcome: coagulatory variables, 90 days mortality. No sample size calculation outcome: coagulatory variables, 90 days mortality. No sample size calculation60 IU/kg initially. 20 IU/kg 8 and 16 h later, total 100 IU/kg during 24 h (adjusted to nearest 500 IU). Total dose: 8269 (SD 1562) IU. AT III (%) before treatment: 0.87 (0.12) in control, 1.06 (0.46) in AT III group. No placeboYes90No/highHaire et al. \[[@CR28]\]49Patients with malignant disease admitted for HSCT. Primary outcome: mortality, severity of illness score, length of hospital stay. Sample size calculated70 IU/kg \<24 h of organ dysfunction detection + 50 IU/kg 8, 16, 48, and 72 h later. Mean total dose: 20,520 IU. No values of AT III before treatment. Placebo: albuminNo41Yes/lowHarper et al. \[[@CR29]\]93ICU population with \<70 % AT III. Primary outcome: mortality, coagulatory parameters. No sample size calculationAim: AT III \>120. AT III until discharge from ICU, twice daily. No information on total amount or values before treatment. No placeboNo10Yes/highInthorn et al. \[[@CR30]\]40Severe sepsis, ICU population. Primary outcome: 14 and 90 days mortality, hospital discharge. Sample size calculatedContinuous AT III infusion over 14 days. Aim: AT III \>120 %. Total amount: 6000 IU on first day and 4000 IU on subsequent days. AT III (%) before treatment: 58 (SD 11) in control, 50.5 (3.2) in AT III group. No placeboYes90Yes/highKobayashi et al. \[[@CR31]\]29Severe pre-eclamptic shock, gestational age 24--36 weeks. Primary outcome: mortality, week of delivery, coagulatory parameters, gestosis index improvement. Sample size calculated1500 U/day once daily for 7 consecutive days. Total amount: 10,500 IU. No values of AT III before treatment. Placebo: unknownYes90Yes/lowLangley et al. \[[@CR32]\]25Hepatic coma with sepsis or risk of organ failure. Primary outcome: mortality, AT III activity. Sample size calculatedInitial dose: 3000 IU + 1000 IU/6 h unless normal AT III levels. Total amount: 3000--23,000 IU (mean 7000 (SD 5000 U). AT III (%) before treatment: 26 (4) in control, 26 (3) in AT III group. No placeboNo15Yes/highLavrentieva et al. \[[@CR33]\]31Patients with severe burn injury. Primary outcome: Diagnosis of DIC. Secondary outcome: 28 days mortality. No sample size calculationAT administration was started from the first post-burn day and continued for the next three consecutive days at a dose of 64.9 ± 11.4 U/kg/dayNA28No/highMaki et al. \[[@CR34]\]146Severe pre-eclampsia (gestational age 24--35 weeks). Primary outcomes: mortality, gestosis index improvement, IUGR, coagulatory parameters. No sample size calculation3000 IU once daily for 7 consecutive days. Total amount: 21,000 IU. AT III (%) before treatment: 82.3 (SD 19.4) in placebo group, 72.3 (25.7) in AT III group. Placebo: albuminNo60Yes/lowMitchell et al. \[[@CR35]\]85Children with ALL. Primary outcome: prevalence of thrombotic events, bleeding events. Sample size calculatedOnce weekly for 4 weeks. Aim: AT III levels between 3.0--4.0 units/ml. No data on total amount or values of AT III before treatment. No placeboYes28No/lowMuntean and Rossegger \[[@CR36]\]98Preterm neonates. Outcomes: Patients received artificial ventilation. Duration of artificial ventilation. Intraventricular haemorrhage and mortality. No sample size calculationIntervention group: n = 45. Single bolus AT III immediately after birth. Birth weight under 1500 g was given 100 U, over 1500 g was given 200 U. Control group: n = 53, standard treatment. No detailsNANANo/highNeporada et al. \[[@CR37]\]43Patients with DIC and AT activity ≤70 %. Outcomes: respiratory function, organ failure assessment, DIC, JAAM score, bleeding complications, allergy and all-cause 30-day mortalityIntervention group 1: 15 patients received AT III 500--1000 IU/day. Control group: n = 15 received FFP (10--17 ml/kg). Intervention group 2 (initiated at a later stage): n = 13, same intervention as group 1 and control group combinedYes30No/highNishiyama et al. \[[@CR38]\]16Patients with DIC. Outcome: Mortality over 28 days. No sample size calculationIntervention group: received as a 1500-unit infusion for 30 min/day for 5 days. Control group: received gabexate mesilate as a 2000-mg infusion for 24 h/day for 5 daysNA28No/highPalareti et al. \[[@CR39]\]59Sepsis and/or post surgical complications requiring haemodynamic or respiratory support. AT III \<70 %. No sample size calculationAT III: loading dose 4000 U followed by 2000 U/12 h by continuous dose over 5 days. Control: placebo (no details described)NA7No/highSchmidt et al. \[[@CR40]\]122Premature infants with RDS in neonatal ICU. Primary outcome: mortality. Sample size calculatedLoading dose 100 U/kg followed by 50 U/kg every 6 h for 48 h. No data on total amount of AT III. AT III (%) before treatment: 32 (SD 8) in placebo group, 33 (8) in AT III group. Placebo: albuminYes90Yes/lowSchorr et al. \[[@CR41]\]50Patients with secondary peritonitis, surgical population in ICU. Primary outcome: 90 days mortality. No sample size calculationAT III: continuous IV AT III and 2 intraperitoneal installations of fresh frozen serumA calculated bolus was given in 1 h followed by a continuous infusion of AT III (200--800 IU per hour) depending on the 6-hourly measurements of plasma AT IIIThe first FFS was supplemented with 1500 IU AT III to equalize the lack of AT III in FFS. Mean AT III administered was 26,196 (±299 SEM) IUControl: No placeboNo90Yes/highSchuster et al. \[[@CR42]\]45Patients with sepsis without DIC. Primary outcome: Mortality. Secondary outcomes: number of days at ICU, mechanical ventilation, organ function scores, side effects, organ failure and function, bleeding and transfusions, AT III activityIntervention group: allocated to AT III supplementation (loading dose of 3000 IU followed by 500 IU every 4 h for 7 days, total dose 17,000 IU)Control: placebo (albumin)YesNANo/highSmith-Erichsen et al. \[[@CR43]\]83Critically ill and trauma patients in ICU. Primary outcome: plasma protease changes, mortality, days in ICU and hospital. No sample size calculationAim: AT III activity of 100 % (SD 10 %) for 3 consecutive days, max 14 days treatment. No data on total amount or values of AT III before treatment. No placeboNo34Yes/highVorobyeva et al. \[[@CR44]\]38Patients with DIC. Primary outcome: Mortality. Other outcomes are not described in the paper. No sample size calculationIntervention group (AT III): (100 % minus measured AT III %) × kg body weight, 1000 IU/h, max 1500 IU/dayControl group (FFP): 10--17 ml/kg, max 1000 ml/dayNoNANo/highWarren et al. \[[@CR45]\]2314Critically ill population of ICU patients with severe sepsis and septic shock. Primary outcome: all-cause mortality at 28 days (subgroup 28- and 90-day survival for patients not receiving heparin). Sample size calculation reportedAT III: loading dose of 6000 IU given over 30 min, followed by a continuous iv infusion of 6000 IU per day for 4 days, total of 30,000 IUControl: equivalent volume of placebo solution (1 % of human albumin)Allowed, but not all received90Yes/lowWaydhas et al. \[[@CR46]\]40Trauma patients in ICU. Primary outcome: incidence and severity of multiple organ dysfunction, mortality, incidence of respiratory failure, severity of organ failure, duration of mechanical ventilation and length of stay in the ICU and hospital. No sample size calculationAT III: a total of 20,000 IU (16,125--22,875), Additional AT III or placebo was substituted to keep the AT III concentration at 140 % of normal. In addition, on the next 2 days the test substance was administered once daily in the morningControl: placebo, 20 % human albumin in corresponding doses and volumeYesNAYes/lowALL acute lymphatic leukaemia, APACHE acute physiology and chronic health evaluation, APGAR appearance, pulse, grimace, activity, and respiration, APTT activated partial thromboplastin time, ARDS acute respiratory distress syndrome, AT III antithrombin III, BP blood pressure, CABG coronary artery bypass graft, CI confidence interval, CNS central nervous system, COPD chronic obstructive pulmonary disease, CPP cerebral perfusion pressure, CRP C-reactive protein, DIC disseminated intravascular coagulation, DVT deep vein thrombosis, FFP fresh frozen plasma, GCS Glasgow coma scale, HELLP haemolysis, elevated liver enzymes, and low platelet count, HIV human immunodeficiency virus, ICP intracranial pressure, INR international normalized ratio, ISS injury severity score, ITT intention-to-treat, IU international unit, IUGR intrauterine growth retardation, JAAM Japanese Association for Acute Medicine, LMWH low molecular weight heparin, MODS multiorgan dysfunction syndrome, MOFS multiorgan failure score, MPI Mannheimer peritonitis index, NA no assessment, NSAID nonsteroidal anti-inflammatory drug, NYHA New York Heart Association functional classification, OFS organ failure score, OSFS organ system failure scoring, RDS respiratory distress syndrome, SAPS simplified acute physiology score, SBP systolic blood pressure, SD standard deviation, sys systolic, TAT thrombin--antithrombin complex, TISS therapeutic intervention scoring system, Tp temperature We classified two trials as obstetric studies \[[@CR31], [@CR34]\], four trials as paediatric trials \[[@CR25], [@CR35], [@CR36], [@CR40]\] and a further two trials as trauma studies \[[@CR27], [@CR46]\]. The remaining trials consisted of mixed populations of critically ill participants, mainly with sepsis. The duration of the intervention varied from less than 24 h to 4 weeks. Three trials had a median duration of AT III intervention that was longer than 1 week \[[@CR30], [@CR35], [@CR43]\]. Follow-up ranged from 7 to 90 days. The 30 included trials were published between 1985 and 2013. Five trials of AT III were multicentre trials \[[@CR20], [@CR23], [@CR26], [@CR35], [@CR45]\]. Five trials of AT III were multinational trials including Germany, Belgium, the Netherlands, Canada and the USA \[[@CR19], [@CR23], [@CR26], [@CR35], [@CR45]\]. One trial was carried out in 19 countries \[[@CR45]\]. Two trials did not state the location \[[@CR21], [@CR39]\]. The 30 included trials involved a total of 3933 participants. The details of the included studies are provided in Table [1](#Tab1){ref-type="table"}. Fourteen trials recruited more male than female participants \[[@CR20], [@CR22]--[@CR27], [@CR30], [@CR33], [@CR35], [@CR38], [@CR43], [@CR45], [@CR46]\]. One trial recruited only men \[[@CR19]\], two trials recruited only women \[[@CR31], [@CR34]\], six did not report the gender of the participants \[[@CR21], [@CR29], [@CR37], [@CR39], [@CR42], [@CR44]\] and two studies had more female than male participants \[[@CR18], [@CR28]\]. The age of the participants included extends from the premature infant to the elderly intensive care participant. It therefore makes little sense to calculate the average age of the participants included. One trial, however, excluded participants older than 75 \[[@CR37]\]. Eighteen trials used an initial loading dose either based on weight (U/kg) or as a fixed dose \[[@CR17], [@CR19], [@CR22]--[@CR25], [@CR27]--[@CR30], [@CR32], [@CR39]--[@CR45]\]. All trials except two \[[@CR18], [@CR21]\] stated the use of a maintenance dose. Nine trials used albumin as the control intervention \[[@CR20], [@CR22], [@CR24], [@CR28], [@CR34], [@CR40], [@CR42], [@CR45], [@CR46]\], two trials used fresh frozen plasma as the control intervention \[[@CR37], [@CR44]\] and three trials only stated the use of an unknown placebo \[[@CR18], [@CR23], [@CR31]\]. Nine trials used no placebo \[[@CR17], [@CR19], [@CR27], [@CR29], [@CR30], [@CR32], [@CR35], [@CR41], [@CR43]\]. Four trials did not state which control they applied \[[@CR20], [@CR26], [@CR33], [@CR39]\]. Risk of bias in included studies {#Sec5} -------------------------------- ### Allocation {#Sec6} Generation of allocation sequence was adequately reported in 15 trials \[[@CR17], [@CR20], [@CR24]--[@CR28], [@CR31], [@CR33]--[@CR35], [@CR37], [@CR40], [@CR45], [@CR46]\] (Fig. [2](#Fig2){ref-type="fig"}). Allocation concealment was adequately reported in 14 trials \[[@CR17], [@CR20], [@CR24]--[@CR28], [@CR31], [@CR34], [@CR35], [@CR37], [@CR40], [@CR45], [@CR46]\] (Fig. [2](#Fig2){ref-type="fig"}).Fig. 2Risk of bias summary. All trials were evaluated for major potential sources across the various bias domains in accordance with The Cochrane Collaboration's tool for risk of bias assessment ### Blinding {#Sec7} Nine trials provided sufficient data to be categorized as double-blinded \[[@CR20], [@CR24], [@CR25], [@CR28], [@CR31], [@CR34], [@CR40], [@CR45], [@CR46]\]. The remaining 21 trials were either open label or did not provide sufficient data on how the double-blinding was achieved (Fig. [2](#Fig2){ref-type="fig"}). ### Incomplete outcome data {#Sec8} Two trials did not provide sufficient data (high risk) on follow-up \[[@CR21], [@CR35]\]. Six trials did not provide any data on follow-up (unclear risk) \[[@CR18], [@CR22], [@CR29], [@CR36], [@CR39], [@CR42]\]. Twenty-two trials had adequate follow-up (low risk) \[[@CR17], [@CR19], [@CR20], [@CR23]--[@CR28], [@CR30]--[@CR34], [@CR37], [@CR38], [@CR40], [@CR41], [@CR43]--[@CR46]\] (Fig. [2](#Fig2){ref-type="fig"}). ### Selective reporting {#Sec9} Ten trials provided adequate information to be classified as low-risk trials \[[@CR20], [@CR24]--[@CR27], [@CR31], [@CR34], [@CR40], [@CR45], [@CR46]\]. This was often due to supplementary information provided based on online registration, protocol availability or authors providing supplementary information while responding to our questions (Fig. [2](#Fig2){ref-type="fig"}). ### Other potential sources of bias {#Sec10} Fourteen trials performed analysis according to the intention-to-treat (ITT) method or provided sufficient data for us to perform ITT analyses \[[@CR19], [@CR23]--[@CR25], [@CR28]--[@CR32], [@CR34], [@CR40], [@CR41], [@CR45], [@CR46]\]. Eight trials reported sample size calculations \[[@CR20], [@CR24], [@CR28], [@CR30], [@CR31], [@CR35], [@CR40], [@CR45]\]. Three trials \[[@CR27], [@CR32], [@CR45]\] reported receiving pharmaceutical company funding (Fig. [2](#Fig2){ref-type="fig"}). Overall quality of evidence {#Sec11} --------------------------- We rank the quality of findings from moderate to very low quality of evidence across the different outcomes. The main limiting factors were high risk of bias and small and poorly described trials. Nine trials were reported as being at completely low risk of bias \[[@CR20], [@CR24], [@CR25], [@CR28], [@CR31], [@CR34], [@CR40], [@CR45], [@CR46]\] (Fig. [2](#Fig2){ref-type="fig"}). Of 30 included trials, 16 were at high risk or unclear risk of bias in random sequence generation (selection bias) \[[@CR18], [@CR19], [@CR21]--[@CR23], [@CR27], [@CR29], [@CR30], [@CR32], [@CR36], [@CR38], [@CR39], [@CR41]--[@CR44]\]. Only one trial was registered on an available trial database \[[@CR26]\]. The five trials \[[@CR18], [@CR21], [@CR36], [@CR39], [@CR42]\] only published as abstracts lack a great amount of valuable information with regard to methodology and outcomes, and we consequently rate them at high risk of bias. Effects of primary outcomes {#Sec12} --------------------------- Combining all trials showed no statistically significant effect of AT III on mortality, with a risk ratio (RR) of 0.95 (95 % CI 0.88--1.03, I ^2^ statistic = 0 %, P value = 0.91), based on data from 3882 participants in 29 trials. Results were analysed using a fixed-effect model because heterogeneity was low. We downgraded the outcome from high to moderate quality of evidence because of 20 trials with high risk of bias. However, TSA led us to upgrade the overall assessment. Equally, for trials with only low risk of bias \[[@CR20], [@CR24], [@CR25], [@CR28], [@CR31], [@CR34], [@CR40], [@CR45], [@CR46]\] we found no statistically significant effect, RR 0.96 (95 % CI 0.88--1.04, I ^2^ statistic = 0 %, fixed-effect model, 9 trials, 2915 participants). Trials with only high risk of bias \[[@CR17]--[@CR19], [@CR22], [@CR23], [@CR26], [@CR27], [@CR29], [@CR30], [@CR32], [@CR33], [@CR35]--[@CR39], [@CR41]--[@CR44]\] had a non-significant RR of 0.94 (95 % CI 0.77--1.14, I ^2^ statistic = 0 %, fixed-effect model, 20 trials, 967 participants) (Table [2](#Tab2){ref-type="table"}; Fig. [3](#Fig3){ref-type="fig"}).Table 2Main results. Subgroup and sensitivity analyses were conducted in regard to our primary outcomeOutcome or subgroupStudiesParticipantsStatistical methodEffect estimateHeterogeneityMortality (subgroup analysis on bias risk)293882Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Trials with low bias risk92915Risk ratio (M--H, fixed, 95 % CI)0.96 (0.88 to 1.04)I ^2^ = 0 % Trials with high bias risk20967Risk ratio (M--H, fixed, 95 % CI)0.94 (0.77 to 1.14)I ^2^ = 0 %Overall mortality (subgroup analysis on median follow-up)283848Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Mortality in trials with follow-up less than median of all trials181024Risk ratio (M--H, fixed, 95 % CI)0.93 (0.77 to 1.13)I ^2^ = 0 % Mortality in trials with follow-up longer than median of all trials102824Risk ratio (M--H, fixed, 95 % CI)0.96 (0.88 to 1.04)I ^2^ = 0 %Overall mortality (subgroup analysis on duration of intervention)283848Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Median duration of AT III intervention equal to or less than 1 week253640Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88, 1.03)I ^2^ = 0 % Median duration of AT III intervention longer than 1 week3208Risk ratio (M--H, fixed, 95 % CI)0.89 (0.59 to 1.34)I ^2^ = 0 %Overall mortality (trauma)268Risk ratio (M--H, fixed, 95 % CI)2.15 (0.81 to 5.72)I ^2^ = 0 % Trials with high bias risk128Risk ratio (M--H, fixed, 95 % CI)3.43 (0.15 to 77.58)Not applicable Trials with low bias risk140Risk ratio (M--H, fixed, 95 % CI)2.00 (0.72 to 5.59)Not applicableOverall mortality (obstetrics)2332Risk ratio (M--H, fixed, 95 % CI)1.03 (0.33 to 3.21)I ^2^ = 0 % Overall maternal mortality, trials with low bias risk2174Risk ratio (M--H, fixed, 95 % CI)Not estimableNot applicable Overall fetal and neonatal mortality, trials with low bias risk2158Risk ratio (M--H, fixed, 95 % CI)1.03 (0.33 to 3.21)I ^2^ = 0 %Overall mortality (paediatrics)4365Risk ratio (M--H, fixed, 95 % CI)1.44 (0.73 to 2.83)I ^2^ = 0 % Trials with low bias risk2182Risk ratio (M--H, fixed, 95 % CI)1.60 (0.54 to 4.72)I ^2^ = 21 % Trials with high bias risk2183Risk ratio (M--H, fixed, 95 % CI)1.32 (0.56 to 3.15)Not applicableOverall mortality (heparin, Warren et al. as a trial with adjuvant heparin therapy)263779Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Trials with complete or partially adjuvant heparin therapy163121Risk ratio (M--H, fixed, 95 % CI)0.96 (0.88 to 1.04)I ^2^ = 0 % Trials without adjuvant heparin10658Risk ratio (M--H, fixed, 95 % CI)0.93 (0.71 to 1.23)I ^2^ = 0 %Overall mortality (heparin, Warren et al. as a trial without adjuvant heparin therapy)263779Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Trials with complete or partially adjuvant heparin therapy15807Risk ratio (M--H, fixed, 95 % CI)0.96 (0.79 to 1.17)I ^2^ = 0 % Trials without adjuvant heparin112972Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 %Overall mortality (heparin, Warren et al. data split based on heparin administration)263779Risk ratio (M--H, random, 95 % CI)0.95 (0.88 to 1.02)I ^2^ = 0 % Trials with complete or partially adjuvant heparin therapy162423Risk ratio (M--H, random, 95 % CI)0.98 (0.90 to 1.08)I ^2^ = 0 % Trials without adjuvant heparin111356Risk ratio (M--H, random, 95 % CI)0.89 (0.78 to 1.01)I ^2^ = 0 %Overall mortality among patients with severe sepsis and DIC122858Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.03)I ^2^ = 0 % Trials with low bias risk42529Risk ratio (M--H, fixed, 95 % CI)0.95 (0.88 to 1.04)I ^2^ = 0 % Trials with high bias risk8329Risk ratio (M--H, fixed, 95 % CI)0.87 (0.64 to 1.20)I ^2^ = 0 %Complications during the in-patient stay specific to the trial intervention32454Risk ratio (M--H, random, 95 % CI)1.26 (0.83 to 1.92)I ^2^ = 9 % Trials with low bias risk22429Risk ratio (M--H, random, 95 % CI)1.62 (0.96 to 2.73)I ^2^ = 0 % Trials with high bias risk125Risk ratio (M--H, random, 95 % CI)0.92 (0.51 to 1.66)Not applicableComplications during the in-patient stay not specific to the trial intervention265Risk ratio (M--H, random, 95 % CI)0.71 (0.08 to 6.11)I ^2^ = 28 % Trials with low bias risk140Risk ratio (M--H, random, 95 % CI)3.00 (0.13 to 69.52)Not applicable Trials with high bias risk125Risk ratio (M--H, random, 95 % CI)0.31 (0.04 to 2.57)Not applicableComplication specific to the trial intervention other than bleeding3187Risk ratio (M--H, fixed, 95 % CI)0.72 (0.42 to 1.25)I ^2^ = 0 % Trials with low bias risk160Risk ratio (M--H, fixed, 95 % CI)0.75 (0.18 to 3.07)Not applicable Trials with high bias risk2127Risk ratio (M--H, fixed, 95 % CI)0.72 (0.40 to 1.30)I ^2^ = 0 %Bleeding events113019Risk ratio (M--H, fixed, 95 % CI)1.58 (1.35 to 1.84)I ^2^ = 0 % Trials with low bias risk62791Risk ratio (M--H, fixed, 95 % CI)1.58 (1.35 to 1.85)I ^2^ = 37 % Trials with high bias risk5228Risk ratio (M--H, fixed, 95 % CI)1.57 (0.71 to 3.49)I ^2^ = 0 %Amount of red blood cells administered4137Mean difference (IV, random, 95 % CI)138.49 (−391.35 to 668.34)I ^2^ = 88 % Trials with low bias risk135Mean difference (IV, random, 95 % CI)−600.00 (−899.18 to −300.82)Not applicable Trials with high bias risk3102Mean difference (IV, random, 95 % CI)595.10 (−287.14 to 1477.34)I ^2^ = 82 %Incidence of surgical intervention3103Risk ratio (M--H, fixed, 95 % CI)1.04 (0.85 to 1.27)I ^2^ = 0 % Trials with low bias risk3103Risk ratio (M--H, fixed, 95 % CI)1.04 (0.85 to 1.27)I ^2^ = 0 %Severity of sepsis I3156Mean difference (IV, random, 95 % CI)−1.24 (−2.18 to −0.29)I ^2^ = 48 % Final MOF score among survivors, trials with low bias risk188Mean difference (IV, random, 95 % CI)−0.70 (−1.22, to −0.18)Not applicable Final MOF score among survivors, trials with high bias risk268Mean difference (IV, Random, 95 % CI)−1.92 (−3.05, to −0.78)I ^2^ = 0 %Severity of sepsis II3102Mean difference (IV, fixed, 95 % CI)−2.18 (−4.36 to −0.00)I ^2^ = 0 % Final APACHE I and II scores among survivors, trials with high bias risk3102Mean difference (IV, fixed, 95 % CI)−2.18 (−4.36 to −0.00)I ^2^ = 0 %Incidence of respiratory failure not present at admission62591Risk ratio (M--H, random, 95 % CI)0.93 (0.76 to 1.14)I ^2^ = 32 % Trials with low bias risk52564Risk ratio (M--H, random, 95 % CI)0.97 (0.77 to 1.22)I ^2^ = 40 % Trials with high bias risk127Risk ratio (M--H, random, 95 % CI)0.73 (0.45 to 1.18)Not applicableDuration of mechanical ventilation3190Mean difference (IV, fixed, 95 % CI)2.20 (−1.21 to 5.60)I ^2^ = 0 % Trials with low bias risk2162Mean difference (IV, fixed, 95 % CI)2.26 (−1.69 to 6.22)I ^2^ = 0 % Trials with high bias risk128Mean difference (IV, fixed, 95 % CI)2.00 (−4.68 to 8.68)Not applicableLength of stay in hospital4202Mean difference (IV, random, 95 % CI)1.10 (−7.16 to 9.36)I ^2^ = 74 % Trials with low bias risk289Mean difference (IV, random, 95 % CI)−5.67 (−16.24 to 4.90)I ^2^ = 53 % Trials with high bias risk2113Mean difference (IV, random, 95 % CI)7.17 (2.75 to 11.59)I ^2^ = 0 %Mean length of stay in ICU7376Mean difference (IV, fixed, 95 % CI)0.24 (−1.34 to 1.83)I ^2^ = 0 % Trials with low bias risk3195Mean difference (IV, fixed, 95 % CI)−0.73 (−3.41 to 1.95)I ^2^ = 3 % Trials with high bias risk4181Mean difference (IV, fixed, 95 % CI)0.77 (−1.20 to 2.74)I ^2^ = 0 %APACHE acute physiology and chronic health evaluation, CI confidence interval, ICU intensive care unit, M--H Mantel--Haenszel, MOFS multiorgan failure score Fig. 3Forest plot of overall mortality with subgroup analysis based on the overall methodological quality of the included trials (trials with low risk of bias versus trials with high risk of bias). CI confidence interval, M--H Mantel--Haenszel We conducted subgroup analyses (Table [2](#Tab2){ref-type="table"}) and carried out 15 subgroup and sensitivity analyses in regard to our primary outcome (Table [2](#Tab2){ref-type="table"} and Supplement Table 3). Effects of secondary outcomes {#Sec13} ----------------------------- Two trials with low risk of bias \[[@CR40], [@CR45]\] and one trial with high risk of bias \[[@CR32]\] demonstrated a statistically significant increase in complications specific to the trial intervention: RR 1.26 (95 % CI 0.83--1.92, I ^2^ statistic = 9 %, P value = 0.33), based on data from 2454 participants in the three trials (Table [2](#Tab2){ref-type="table"}). We analysed results using a random-effects model. We downgraded the outcome from high to very low quality because of the small number of trials. Two trials \[[@CR32], [@CR46]\] did not reach statistical significance assessing complications not specific to the trial intervention: RR 0.71 (95 % CI 0.08--6.11, I ^2^ statistic = 28 %, P value = 0.24) (Table [2](#Tab2){ref-type="table"}), based on data from 65 participants. We analysed results using a random-effects model. We downgraded the outcome from high to very low quality because of the small number of trials. Three trials, one with low risk of bias \[[@CR25]\] and two with high risk of bias \[[@CR23], [@CR35]\], examined complications specific to the trial intervention other than bleeding: RR 0.72 (95 % CI 0.42--1.25, I ^2^ statistic = 0 %, P value = 0.95), based on data from 187 participants in the three trials (Table [2](#Tab2){ref-type="table"}). We analysed results using a fixed-effect model. We downgraded the outcome from high to very low quality because of the small number of trials. Six trials with low risk of bias \[[@CR20], [@CR25], [@CR31], [@CR34], [@CR40], [@CR45]\] and five with high risk of bias \[[@CR26], [@CR27], [@CR32], [@CR35], [@CR37]\] demonstrated a statistically significant increase in bleeding events in the intervention group compared to the control group, with an RR of 1.58 (95 % CI 1.35--1.84, I ^2^ statistic = 0 %, P value = 0.57), based on data from 3019 participants in the 11 trials. We analysed results using a fixed-effect model (Table [2](#Tab2){ref-type="table"} and Supplement Fig. 1). We downgraded the outcome from high to moderate quality because of the proportion of trials with high risk of bias. Four trials referred to the amount of red blood cells administered, one with low risk of bias \[[@CR24]\] and three with high risk of bias \[[@CR19], [@CR21], [@CR30]\] with a mean difference (MD) of 138.49 (95 % CI −391.35 to 668.34, I ^2^ statistic = 88 %, P value = 0.0001) (Table [2](#Tab2){ref-type="table"}), based on data from 137 participants. We analysed results using a random-effects model (Table [2](#Tab2){ref-type="table"}). We downgraded the outcome from high to very low quality because of the small number of trials, three of them with high risk of bias. Three trials referred to the incidence of surgical intervention, all with low risk of bias \[[@CR24], [@CR31], [@CR46]\] with an RR of 1.04 (95 % CI 0.85--1.27, I ^2^ statistic = 0 %, P value = 0.61), based on data from 103 participants. We analysed results using a fixed-effect model (Table [2](#Tab2){ref-type="table"}). We downgraded the outcome from high to very low quality because of the small number of trials with few participants. Only one analysis reached statistical significance, with an MD of −1.24 (95 % CI −2.18 to −0.29, I ^2^ statistic = 48 %, P value = 0.015, random-effects model, 3 trials, 156 participants) (Table [2](#Tab2){ref-type="table"}) \[[@CR20], [@CR23], [@CR30]\] when examining the effect of AT III on various illness scores (severity of sepsis). Six trials provided data \[[@CR20], [@CR22], [@CR23], [@CR28], [@CR30], [@CR41]\]. However, the trials that did provide data adequate for meta-analysis were quite heterogenous in their application of various scores and their choice of time points. Six trials examined the effect of AT III on the incidence of respiratory failure (not present at admission) \[[@CR23], [@CR24], [@CR31], [@CR34], [@CR45], [@CR46]\]. There was no statistically significant difference, with an RR of 0.93 (95 % CI 0.76--1.14, I ^2^ statistic = 32 %, P value = 0.22) (Table [2](#Tab2){ref-type="table"}), based on data from 2591 participants in six trials. We analysed results using a random-effects model. We downgraded the outcome from high to moderate quality because one trial contributed with the majority of patients \[[@CR45]\]. It is considered to skew the finding; however, it is rated as low risk of bias and contributes a weighting of only 30.7 %. A sensitivity analysis removing it from the plot eliminates all heterogeneity in that subgroup. Three trials examined the effect of the trial intervention on duration of mechanical ventilation \[[@CR27], [@CR40], [@CR46]\]. There was no statistically significant difference, with an MD of 2.20 (95 % CI −1.21 to 5.60, I ^2^ statistic = 0 %, P value = 0.89), based on data from 190 participants (Table [2](#Tab2){ref-type="table"}). We analysed results using a fixed-effect model. We downgraded the outcome from high to very low quality of evidence because of the small number of trials, few participants and imprecision of results with a wide confidence interval. The mean duration of mechanical ventilation in the intervention group was 2.2 days more. Four trials examined the intervention effect on the length of stay in hospital \[[@CR28], [@CR37], [@CR43], [@CR46]\] with an MD of 1.10 (95 % CI −7.16 to 9.36, I ^2^ statistic = 74 %, P value = 0.009), based on data from 202 participants (Table [2](#Tab2){ref-type="table"}). We analysed results using a random-effects model (Table [2](#Tab2){ref-type="table"}). We downgraded the outcome from high to very low quality of evidence because of the small number of trials, few participants and imprecision of results with a wide confidence interval. The mean length of stay in hospital in the intervention group was 1.1 days more. Three trials with low risk of bias \[[@CR20], [@CR24], [@CR46]\] and four trials with high risk of bias \[[@CR17], [@CR22], [@CR37], [@CR43]\] examined the intervention effect on length of stay in the ICU. There was insufficient evidence to support any beneficial effect of the intervention, with an MD of 0.24 (95 % CI −1.34 to 1.83, I ^2^ statistic = 0 %, P value = 0.70), based on data from 376 participants. We analysed results using a fixed-effect model (Table [2](#Tab2){ref-type="table"}). We downgraded the outcome from high to very low quality of evidence because of the small number of trials, most of them with high risk of bias. The mean length of stay in ICU in the intervention group was 0.24 days more. Twelve trials examined the intervention effect on mortality among participants with severe sepsis and disseminated intravascular coagulation (DIC) \[[@CR18], [@CR20], [@CR23], [@CR24], [@CR26], [@CR30], [@CR37]--[@CR39], [@CR41], [@CR42], [@CR45]\]. The trials did not demonstrate a statistically significant decrease in mortality in favour of the trial intervention: RR 0.95 (95 % CI 0.88--1.03, I ^2^ statistic = 0 %, P value = 0.98), based on data from 2858 participants. We analysed results using a fixed-effect model (Table [2](#Tab2){ref-type="table"}; Fig. [4](#Fig4){ref-type="fig"}). We downgraded the outcome from high to very low quality of evidence, because of numerous trials with high risk of bias.Fig. 4Forest plot of overall mortality among patients with severe sepsis and disseminated intravascular coagulation (DIC) with subgroup analysis based on the overall methodological quality of the included trials (trials with low risk of bias versus trials with high risk of bias). CI confidence interval, M--H Mantel--Haenszel Only one trial examined the intervention's effect on quality of life (Rublee et al. \[[@CR9]\] based on data from Warren et al. \[[@CR45]\]. There was an objective assessment of physical performance and dependency, and a subjective overall quality-of-life assessment analysis. Neither assessment supported intervention with AT III, with an MD of −2.00, (95 % CI −4.49 to 0.49, fixed-effect model, 897 participants) and an MD of −2.00, (95 % CI −5.01 to 1.01, fixed-effect model, 897 participants) respectively, both rated at very low quality (Table [2](#Tab2){ref-type="table"}). The heparin issue {#Sec14} ----------------- A detrimental interaction between AT III and heparin was suspected before the Warren et al. trial \[[@CR45]\] and we predefined use of AT III with and without heparin in the protocol for secondary analyses. However, the participants were not stratified according to heparin administration and the protocol allowed concomitant use of heparin by indication, after randomization to AT III or placebo. Even if the baseline comparison of participants allocated to AT III and placebo, in the subgroup without heparin, showed similar characteristics, the randomization is violated in the subgroup analysis. Pooling all trials with and without concomitant use of heparin, with the Warren et al. trial \[[@CR45]\] as either a trial with concomitant use of heparin or as a trial without use of heparin, does not provide evidence of a statistically significant intervention effect of AT III. Even when splitting the 39 trials into two 'separate trials', with and without concomitant use of heparin, and pooling these results with the other trials, we found no statistically significant intervention effect of AT III in the subgroup of trials without adjuvant heparin administration (RR 0.95, 95 % CI 0.88--1.03, I ^2^ statistic = 0 %, fixed-effects model (Table [2](#Tab2){ref-type="table"}). However, splitting the Warren et al. trial \[[@CR45]\] violates the randomization procedure. Trial sequential analysis {#Sec15} ------------------------- We conducted TSA of AT III versus control on longest follow-up mortality (Fig. [3](#Fig3){ref-type="fig"}, Supplement Fig. 2). The TSA-adjusted confidence interval for the meta-analysis of the primary outcome with continuity correction for zero events trials (0.001 event in each arm) in a fixed-effect model results in an RR of 0.95 (95 % CI 0.88--1.03, I ^2^ statistic = 0 %, diversity D ^2^ = 0 %). The point estimate of the potential intervention effect as suggested by the low risk of bias trials in the meta-analysis of the effect of AT III on mortality is a relative risk reduction (RRR) of 5 % and the low-bias heterogeneity-adjusted information size (LBHIS) calculated based on this intervention effect (with 80 % power and alpha 0.05, assuming a double-sided type I risk of 5 % and a type II risk of 20 %) is 23,634 participants (Supplement Fig. 3). With an accrued information size of 3882 participants and no boundaries crossed so far, only 16.43 % of the required information size is actually available at this stage to reject or accept a 4 % RRR for overall mortality. However, solid evidence may be obtained with fewer participants if eventually the cumulative meta-analysis Z curve crosses the trial sequential monitoring boundary constructed for a required information size of 23,634 randomized participants. On the other hand, to demonstrate or reject an a priori anticipated intervention effect of an RRR of 10 %, 5037 should be randomized. In this analysis, the cumulative Z curve breaks through the boundary for futility (non-superiority) (Fig. [5](#Fig5){ref-type="fig"}). As 3882 participants are included in the present meta-analyses on mortality without the meta-analysis becoming statistically significant and since the futility boundary is crossed, an intervention effect of 10 % RRR or more on mortality is unlikely.Fig. 5Trial sequential analysis (TSA) of all trials of the effect of AT III on mortality. Cumulative Z curve in blue does not cross the boundary constructed for an information size of 5037 in the meta-analysis (full red line with diamonds) with a relative risk reduction (RRR) of 10 % (α = 0.05) and a power of 80 % (β = 0.20). However, the cumulative Z curve breaks through the boundary for futility (non-superiority). The analysis therefor led to rejection of an intervention effect of an RRR of 10 % with a power of 80 % in 30 randomized trials with a total number of accrued participants of 3882 When carrying out the same TSA analyses as above for trials of sepsis and DIC only (Fig. [4](#Fig4){ref-type="fig"}) with an anticipated RRR of 10 %, the required information size is 3794 participants without the meta-analysis becoming statistically significant, and with the boundary for futility being crossed, thus indicating that an RRR of 10 % is to be rejected. TSA analysis based on a potential RRR of 5 % as indicated by the meta-analysis for studies on sepsis and DIC (Fig. [5](#Fig5){ref-type="fig"}) yields an LBHIS of 21,657 participants and with an accrued information size of 2992 participants and no boundaries being crossed so far, only 13.82 % of the required information size is actually available (Supplement Fig. 4). Discussion {#Sec16} ========== In this systematic review of 30 trials with 3933 participants we found no significant beneficial effect of AT III on mortality (Fig. [3](#Fig3){ref-type="fig"}). On the basis of follow-up less than or longer than the median of all trials, we undertook a subgroup analysis to examine the intervention effect on mortality. However, there was no statistically significant association between follow-up and mortality. The median follow-up time was 32 days. We also examined the intervention effect based on the median duration of intervention being less than or longer than 1 week. Only three trials with a total of 208 participants had a median duration of intervention longer than 1 week \[[@CR30], [@CR35], [@CR43]\]. The current evidence does not support a longer duration of intervention. Additionally, on the basis of the existing data, we have to conclude that there is insufficient data to help us support or refute the use of AT III intervention among trauma, obstetric or paediatric populations. Very few trials met our requirements in terms of trial intervention effect on various illness scores (severity of sepsis). We accepted the various definitions provided by the authors and undertook four different meta-analyses. The participant numbers in these analyses ranged from 28 to 156, and only one meta-analysis reached statistical significance. The meta-analyses examining the overall mortality in the septic population, based on 2918 participants, also failed to demonstrate a statistically significant reduction of mortality. We examined a potential detrimental interaction of AT III with heparin by carrying out three separate analyses (Table [2](#Tab2){ref-type="table"}) pooling mortality data from trials with concomitant heparin use against those without, while examining the impact of data from Warren et al. \[[@CR45]\]. The latter trial was either defined as a trial with or without heparin use and finally we chose to split data from Warren et al. \[[@CR45]\] in order to examine the hypothesis. As such, this is to be considered a post hoc analysis violating the randomization procedure. However, none of these analyses demonstrated any statistically significant interaction effects. Our systematic review has several potential limitations. As for all systematic reviews, our findings and interpretations are limited by the quality and quantity of the available evidence on the effects of AT III on mortality. We assessed the risk of bias of the included trials by using the published data, which ultimately may not reflect the truth. We tried to contact all authors but only a few responded and provided further information. Three trials with 260 participants reported zero mortality in both trial groups \[[@CR31], [@CR34], [@CR35]\]. We included five trials submitted only as abstracts in this updated review \[[@CR18], [@CR21], [@CR36], [@CR39], [@CR42]\]. These abstracts lack important information. Nevertheless, a sensitivity analysis on the mortality data of only these trials yielded an RR of 0.91 (95 % CI 0.55--1.52, I ^2^ statistic = 0 %, fixed-effect model). As a result of a lack of convincing evidence in favour of AT III in settings without heparin, we chose to implement TSA results, since the hypothesis of a beneficial effect of AT III in critically ill people still generates much attention. Although there was minimal heterogeneity among trial results on mortality, we are aware that we pooled very heterogeneous trials in terms of participants, settings and treatment regimens. However, all the included conditions cause low levels of AT III, can result in DIC and have similar inflammatory pathways. We therefore think that there is a biologically plausible reason to perform an inclusive meta-analysis, which also considerably increases the generalizability and usefulness of the review. Furthermore, a broad meta-analysis increases power, reduces the risk of erroneous conclusions and facilitates exploratory analyses which can generate hypotheses for future research (e.g. adjuvant heparin) \[[@CR48]\]. We have adhered to Cochrane methodology and applied additional statistical methods, such as TSA, to strengthen our conclusions and reduce the risk of random error. Conclusions {#Sec17} =========== There is insufficient evidence to support AT III substitution in any category of critically ill people. We did not find a statistically significant effect of AT III on mortality, but AT III increased the risk of bleeding events. Subgroup analyses performed according to duration of intervention, length of follow-up, different patient groups and use of adjuvant heparin did not show differences in the estimates of intervention effects. Serious methodological shortcomings of the included studies are, however, likely to have influenced the overall intervention effect (Supplement Table 4) TSA showed that there is sufficient evidence to reject a beneficial effect of more than 10 % RRR (4 % absolute risk reduction) on overall mortality and for trials including participants with sepsis and DIC. There also remains the possibility that the use of AT III may be harmful. The GRADE approach only reaffirmed our interpretation of the level of evidence, and we are confident that at this stage the quality of evidence in regard to our primary outcomes is moderate, despite the fact that many of the trials have high risk of bias. Electronic supplementary material ================================= {#Sec18} Below is the link to the electronic supplementary material. Supplementary material 1 (DOC 794 kb) Take-home message: There is insufficient evidence to support Antithrombin III substitution in any category of critically ill people. We did not find a statistically significant effect of Antithrombin III on mortality, but the use increased the risk of bleeding. This review is an abridged version of a Cochrane Review previously published in the Cochrane Database of Systematic Reviews: Allingstrup M, Wetterslev J, Ravn FB, Møller A , Afshari A. Antithrombin III for critically ill patients. Cochrane Database of Systematic Reviews 2016, Issue 1. Art. No.: CD005370. DOI:10.1002/14651858.CD005370.pub3 (see <http://www.cochranelibrary.com> for information). Cochrane Reviews are regularly updated as new evidence emerges and in response to feedback, and Cochrane Database of Systematic Reviews should be consulted for the most recent version of the review. Mikkel Allingstrup, Frederikke B. Ravn, Ann Merete Møller and Arash Afshari declare that there are no conflicts of interest. Jørn Wetterslev declares that he is a member of the task force on TSA at Copenhagen Trial Unit developing and programming TSA.	Low	[ 0.5172413793103441, 30, 28 ]
Erythrocyte ghost cell-alkaline phosphatase: construction and characterization of a vesicular system for use in biomineralization studies. Alkaline phosphatase is required for the mineralization of bone and cartilage. This enzyme is localized in the matrix vesicle, which plays a role key in calcifying cartilage. In this paper we standardize a method to construction a resealed ghost cell-alkaline phosphatase system to mimic matrix vesicles and examine the kinetic behavior of the incorporated enzyme. Polidocanol-solubilized alkaline phosphatase, free of detergent, was incorporated into resealed ghost cells. This process was time-dependent and practically 50% of the enzyme was incorporated into the vesicles in 40 h of incubation, at 25 degrees C. Alkaline phosphatase-ghost cell systems were relatively homogeneous with diameters of about 300 nm and were more stable when stored at -20 degrees C. Alkaline phosphatase was completely released from the resealed ghost cell-system using only phospholipase C. These experiments confirm that the interaction between alkaline phosphatase and the lipid bilayer of resealed ghost cell is exclusively via glycosylphosphatidylinositol (GPI) anchor of the enzyme. An important point shown is that an enzyme bound to resealed ghost cell does not lose the ability to hydrolyze ATP, pyrophosphate and p-nitrophenyl phosphate (PNPP), but the presence of a ghost membrane, as a support of the enzyme, affects its kinetic properties. Moreover, calcium ions stimulate and phosphate ions inhibit the PNPPase activity of alkaline phosphatase present in resealed ghost cells.	High	[ 0.660287081339712, 34.5, 17.75 ]
Loss of patients in clinical trials that measure long-term survival following myocardial infarction. Loss of patients from clinical trials can nullify adequate randomization if the loss is unequally distributed among treatment groups. This study was designed to assess the magnitude of the problem in randomized control trials evaluating long-term therapy for survivors of myocardial infarction (MI). Only 19 of 52 trials reported having an explicit policy on withdrawals in the design stage; only 2 reported blinding the decision for withdrawal and only 7 reported accounting for withdrawals in sizing. In addition, only 16 gave the reader enough information to calculate the effect of withdrawals on trial results. In 2 of these 16 trials a p less than 0.05 result obtained by including withdrawals (intention to treat method) was reduced to p less than 0.05 when withdrawals were excluded. It is evident that many long-term trials do not contain adequate data on withdrawals. Readers of published trials are seldom able to judge whether or not withdrawals might affect the final results.	Mid	[ 0.625298329355608, 32.75, 19.625 ]
5 / 5 ( 20 bình chọn ) Giấc mơ chiêm bao thấy điện thoại: Mơ thấy điện thoại đánh con gì – giải mã giấc mơ thấy điện thoại. Chiêm bao thấy nhặt được hoặc làm mất điện thoại hay làm bể, vỡ màn hình là điềm báo phúc hay họa? Có thể nói điện thoại đã trở thành sản phẩm phổ biến và có giá trị sử dụng thiết yếu trong đời sống hiện đại ngày nay. Ngày càng có nhiều dòng sản phẩm với mẫu mã đa dạng cùng tính năng vượt trội liên tục ra đời nhằm đáp ứng nhu cầu sử dụng của con người. Do đó, hình ảnh này cũng thường được bắt gặp trong giấc mơ của chúng ta hàng ngày. Giải mã giấc mơ thấy điện thoại và những con số may mắn (Hình ảnh minh họa) Ngủ mơ chiêm bao thấy điện thoại chắc hẳn không còn là giấc mơ hiếm gặp. Tuy nhiên không nhiều người có thể lý giải được ý nghĩa chính xác của những giấc mộng này, thậm chí còn có người chưa hề biết rằng mỗi giấc mơ về điện thoại cũng là một điềm báo tâm linh quan trọng mà chúng ta cần lĩnh ngộ. Vậy nằm mơ thấy nhặt được điện thoại hay làm mất, làm vỡ, làm hư hỏng điện thoại là điềm báo tốt hay xấu? Mời các bạn cùng tham khảo ngay nội dung phân tích ý nghĩa giấc mơ về chiếc điện thoại được chúng tôi sưu tầm, tổng hợp và giới thiệu ngay sau đây. Đồng thời, thông qua mỗi giấc mộng các bạn còn khám phám thêm những con số may mắn mang lại cơ hội đổi đời cho bạn. Giải mã ý nghĩa giấc mơ chiêm bao thấy điện thoại Sổ mơ lô đề điện thoại lý giải các thông điệp ẩn sau mỗi giấc chiêm bao thấy điện thoại, dù là điện thoại đời cũ hay đời mới, cục gạch hay smarphone…vv thì cũng sẽ mang lại cho bạn những lời nhắn nhủ có giá trị vô cùng thực tế. Mộng chiêm bao thấy điện thoại là điềm lành hay dữ Nằm ngủ và mơ thấy điện thoại là một điềm lành. Ngụ ý của giấc mộng này cho biết bạn đang có những mối quan hệ xã hội rất tốt. Bạn luôn may mắn gặp được quý nhân phù trợ trong công việc cũng như các mối quan hệ khác. Tuy nhiên giấc mộng này cũng muốn nhắc nhở bạn nên dành nhiều thời gian cho gia đình và những người thân yêu bên cạnh mình. Mộng chiêm bao thấy mất điện thoại Chiêm bao thấy bị mất điện thoại chính là muốn nhắn nhủ bạn rằng bạn đang dần đánh mất đi một số điều gì đó, đặc biệt liên quan đến chính bạn. Mộng chiêm bao thấy nhặt được điện thoại Mơ chiêm bao thấy thấy mình nhặt được điện thoại báo hiệu bạn đang có những mối quan hệ tốt đẹp trong cuộc sống và đặc biệt là trong lĩnh vực kinh doanh, công việc của bạn. Mộng chiêm bao thấy số điện thoại Nằm mộng chiêm bao thấy số điện thoại có ý nghĩa rằng có người nào đó đang ở gần bạn cần bạn giúp đỡ, bạn nên liên lạc và tìm hiểu xem ai đang cần sự giúp đỡ của chính bạn để có mặt kịp thời nhé. Mộng chiêm bao thấy điện thoại vỡ là hung hay cát Ngủ mơ chiêm bao thấy làm vỡ điện thoại dường như không phải là giấc mộng lành. giấc mơ này cho biết bạn đangBạn cần thấu hiểu bản thân mình hơn và mở lòng hơn với cuộc sống xung quanh. Mộng chiêm bao thấy gọi điện thoại Nằm mộng thấy gọi điện trò chuyện với ai đó thì ý nghĩa của giấc mơ này chính là ám chỉ đến một số vấn đề mà bạn cần phải đối đầu với người đó. Vấn đề này có thể sẽ khiến bạn bị tổn thương hoặc sẽ đánh mất điều gì đó. Nếu bạn mơ thấy mình đang bấm phím giữ điện thoại, giấc mơ này cho thấy rằng bạn không thể tự do thể hiện chính mình. Mộng chiêm bao thấy điện thoại bị hư Chiêm bao thấy điện thoại bị hư, hỏng có ngụ ý rằng bạn đang có vấn đề về xương khớp. Bạn nên giữ gìn sức khỏe hơn là lao vào công việc quá độ. Có sức khỏe với là có tất cả. Mộng chiêm bao thấy điện thoại rơi xuống nước Ngủ mơ chiêm bao thấy điện thoại bị rơi xuống nước là điềm báo cho biết bạn là một con người không gọn gàng. Giấc mơ khuyên bảo bạn nên chỉnh sửa lại đức tính đó của mình ngay trước khi bạn tự làm hỏng chuyện của cá nhân hoặc đánh mất một thứ gì đó quan trọng trong cuộc đời mình. Mộng chiêm bao thấy bể màn hình điện thoại có xui không? Giấc mơ chiêm bao thấy bể màn hình hay làm vỡ màn hình điện thoại là điềm hung, cho biết đang có sự trục trặc về chuyện tình cảm. Rạn nứt này là do nguyên nhân bắt đầu từ bạn. Bạn nên suy nghĩ và có những hướng giải quyết tốt hơn. Ý nghĩa một số giấc chiêm bao thấy điện thoại khác Nằm mơ chiêm bao thấy được cho điện thoại ám chỉ rằng người đó đang muốn bạn cởi mở và thành thực hơn trong việc giao tiếp với họ. ám chỉ rằng người đó đang muốn bạn cởi mở và thành thực hơn trong việc giao tiếp với họ. Mơ ngủ chiêm bao thấy điện thoại đổ chuông nhưng bạn lại không bắt máy, điều này cho thấy rằng bạn đang cố gắng giữ khoảng cách với một tình huống hay một mối quan hệ nào đó trong cuộc sống hiện tại của mình. Còn nếu chiêm bao thấy điện thoại liên tục đổ chuông báo hiệu cho bạn cần cẩn thận trong việc nhận định các thông tin mà mình đã nhận được. điều này cho thấy rằng bạn đang cố gắng giữ khoảng cách với một tình huống hay một mối quan hệ nào đó trong cuộc sống hiện tại của mình. Còn nếu chiêm bao thấy điện thoại liên tục đổ chuông báo hiệu cho bạn cần cẩn thận trong việc nhận định các thông tin mà mình đã nhận được. Nằm mộng thấy cửa hàng điện thoại chính là lời nhắc nhở cần phải thận trọng trong cách giao tiếp và các mối quan hệ của bạn, nếu không bạn sẽ phải trả giá đắt cho những bất cẩn đấy. chính là lời nhắc nhở cần phải thận trọng trong cách giao tiếp và các mối quan hệ của bạn, nếu không bạn sẽ phải trả giá đắt cho những bất cẩn đấy. Chiêm bao thấy điện thoại bị tắt nguồn, có hàm ý rằng bạn đang lo sợ một điều gì đó mà mình đang cất giữ sẽ bị phơi bày. Ở thực tại bạn đang lẩn trốn một điều gì đó. có hàm ý rằng bạn đang lo sợ một điều gì đó mà mình đang cất giữ sẽ bị phơi bày. Ở thực tại bạn đang lẩn trốn một điều gì đó. Ngủ mơ thấy sạc pin điện thoại cho thấy rằng bạn đang cảm thấy bị cạn kiệt sức lực hoặc một cảm xúc trống rỗng. Giấc mơ mang thông điệp bạn cần phải được nạp thêm năng lượng và làm mới cuộc sống của chính mình. Ngoài ra, giấc mơ cũng ngụ ý rằng bạn đang bị ngắt kết nối với những người khác. Có lẽ bạn đang tự cô lập chính mình. cho thấy rằng bạn đang cảm thấy bị cạn kiệt sức lực hoặc một cảm xúc trống rỗng. Giấc mơ mang thông điệp bạn cần phải được nạp thêm năng lượng và làm mới cuộc sống của chính mình. Ngoài ra, giấc mơ cũng ngụ ý rằng bạn đang bị ngắt kết nối với những người khác. Có lẽ bạn đang tự cô lập chính mình. Mộng thấy được tặng điện thoại cho thấy bạn đang có nhiều vấn đề trục trặc trong cuộc sống, nhất là về giao tiếp. Bạn nên xác định lợi thế của mình để giao tiếp với mọi người một cách dễ dàng, thoải mái. cho thấy bạn đang có nhiều vấn đề trục trặc trong cuộc sống, nhất là về giao tiếp. Bạn nên xác định lợi thế của mình để giao tiếp với mọi người một cách dễ dàng, thoải mái. Mơ ngủ thấy mua điện thoại mới báo hiệu bạn sắp đón nhận những điều tốt đẹp trong công việc và cuộc sống. Đây là một sự thay đổi theo chiều hướng tích cực, tài chính đi lên và đón chờ những điều may mắn. báo hiệu bạn sắp đón nhận những điều tốt đẹp trong công việc và cuộc sống. Đây là một sự thay đổi theo chiều hướng tích cực, tài chính đi lên và đón chờ những điều may mắn. Chiêm bao thấy mình đập điện thoại trong lúc tức giận là dấu hiệu cảnh báo trong thời gian tới bạn có nguy cơ gặp nhiều cãi vã, tranh chấp với người khác. Tuy nhiên, bạn không nên quá lo lắng, chỉ cần bạn bình tĩnh giải quyết vấn đề theo hướng tích cực thì mọi chuyện sẽ êm đẹp. Mơ thấy điện thoại đánh con gì, số mấy? Giải mộng giấc mơ chiêm bao thấy điện thoại luận giải ra những con số dưới đây: Nằm mộng chiêm bao thấy điện thoại bị hư đánh cặp 41, 62 Mơ chiêm bao thấy nói chuyện điện thoại đánh lô đề 21, 43 Ngủ mơ chiêm bao thấy điện thoại tắt nguồn đề về 00, 11 Mộng chiêm bao thấy điện thoại hết bin đánh con 15, 65 Nằm mơ chiêm bao thấy xin số điện thoại ghi đề con 04, 32 Chiêm bao thấy sạc pin điện thoại theo lô 46, 50, 86 Mê ngủ chiêm bao thấy điện thoại bị hư đánh con 41, 62 Mơ ngủ chiêm bao thấy được cho điện thoại đánh ngay con 00 Mơ chiêm bao thấy nhặt được điện thoại đừng quên ghi cặp số 24, 72 Mơ chiêm bao thấy điện thoại rơi xuống nước ghi đề 28, 95 Mộng chiêm bao thấy điện thoại bị cháy theo ngay cặp lô 19, 81 Chiêm bao thấy mua điện thoại đánh con 15, 51 Ngủ mơ chiêm bao thấy điện thoại bị nổ chơi ngay bộ số 05, 34 Nằm mơ chiêm bao thấy đập nát điện thoại đánh đề con 14 Mê ngủ chiêm bao thấy tặng điện thoại cho người khác theo lô 58, 85 Nằm chiêm bao thấy tiếng chuông điện thoại reo đánh con 25, 68, 91 Nằm mơ chiêm bao thấy điện thoại chung chung đánh ngay bộ số 01, 03, 43 Chúc các bạn may mắn trúng số lớn với giấc mơ thấy điện thoại. Kết luận Bài viết trên đây, KUBET đã đưa tới bạn đọc nội dung thông tin ngắn gọn về giải mộng “giấc mơ thấy điện thoại cùng những con số lô đề may mắn”. Hy vọng những thông tin chia sẻ trên đây mang lại sự hữu ích cho quý bạn, mọi ý kiến đóng góp xin vui lòng để lại bình luận cho chúng tôi dưới bài viết. Xin chân thành cảm ơn! =>> Nhanh tay đăng ký tài khoản KUBET chơi Lô Đề Xổ Số Online 1 ăn 99 ới nhiều ưu đãi khuyến mãi đặc biệt ngay hôm nay: Link Đăng Ký Quan tâm: Nhà cái lô đề online uy tín, Lô đề 1 ăn 99k, Soi cầu xổ số, Sổ mơ lô đề online, Nhà cái uy tín, Kỹ năng chơi lô đề	Mid	[ 0.5567010309278351, 27, 21.5 ]
[2 cases of duodenal duplication]. Two cases of duodenal duplication are reported. It is a rare disease and is found commonly during infancy. Symptoms of partial duodenal obstruction are dominating the clinical picture. Upper gastrointestinal contrast radiography seems to be the best paraclinical examination. The surgical treatment is governed by the relationship of the cyst to the biliary and pancreatic ducts and the presence of ectopic gastric mucosa. If total resection of the cyst implicates a danger of injury to the common bile duct and the head of the pancreas and when one is tempted to perform a cystoenterostomy, the authors insist on the necessity to detect the presence of ectopic gastric mucosa by fluid pH determination and frozen section biopsy of the cyst wall. The presence of ectopic gastric mucosa requires a total resection of the cyst.	High	[ 0.6683046683046681, 34, 16.875 ]
// RUN: %target-swift-frontend -module-name generic_signature_with_depth %s -emit-silgen \| %target-sil-opt \| %FileCheck %s protocol mmGeneratorType { associatedtype Element } protocol mmSequenceType { associatedtype Generator : mmGeneratorType } protocol mmCollectionType : mmSequenceType { } protocol mmExt : mmCollectionType { mutating func extend< S : mmSequenceType > (_ seq: S) where S.Generator.Element == Self.Generator.Element } // CHECK-LABEL: @$s28generic_signature_with_depth4testyxx_q_tAA5mmExtRzAaCR_9Generator_7ElementQY_AD_AERTzr0_lF : $@convention(thin) <EC1, EC2 where EC1 : mmExt, EC2 : mmExt, EC1.Generator.Element == EC2.Generator.Element> (@in_guaranteed EC1, @in_guaranteed EC2) -> @out EC1 { // CHECK: witness_method $EC1, #mmExt.extend : {{.*}} : $@convention(witness_method: mmExt) <τ_0_0 where τ_0_0 : mmExt><τ_1_0 where τ_1_0 : mmSequenceType, τ_0_0.Generator.Element == τ_1_0.Generator.Element> (@in_guaranteed τ_1_0, @inout τ_0_0) -> () // CHECK: apply {{%[0-9]+}}<EC1, EC2>({{%[0-9]+}}, {{%[0-9]+}}) : $@convention(witness_method: mmExt) <τ_0_0 where τ_0_0 : mmExt><τ_1_0 where τ_1_0 : mmSequenceType, τ_0_0.Generator.Element == τ_1_0.Generator.Element> (@in_guaranteed τ_1_0, @inout τ_0_0) -> () func test< EC1 : mmExt, EC2 : mmExt > (_ lhs: EC1, _ rhs: EC2) -> EC1 where EC1.Generator.Element == EC2.Generator.Element { var lhs = lhs lhs.extend(rhs) return lhs }	Low	[ 0.5251798561151071, 27.375, 24.75 ]
Streaming data into a Node.js C++ Addon Earlier this year I posted an article showing how we can build event-based and streaming interfaces for sending data from Node.js C++ addons to JavaScript. This mode of interacting with addons can be a lot easier in some situations, especially when your C++ code runs asynchronously. In this post, I’m going to use the streaming-worker and streaming-worker-sdk modules - which I’ve adapted from the Streaming chapter in my ebook: C++ and JavaScript Integration. In the book, I cover the details of how streaming-worker and streaming-worker-sdk actually works internally - here I’ll just focus on using them. Working with streaming-worker The full source code for this example is here. Let’s start out by setting up two directories - /addon and /js . The C++ project and code will be in /addon . If you’ve never worked on addons before, stop here and check out my post on the basics before continuing. The /js directory will hold just the JavaScript program - which will have a dependency on the addon. I’ve already covered how streaming-worker-sdk works here, but as a refresher - streaming-worker and streaming-worker-sdk are two halves of a library I’ve created to facilitate event-based and streaming interfaces between addons. For streaming data to JavaScript from C++, the streaming-worker-sdk C++ headers abstract away a lot of the details of working with asynchronous addons. The streaming-worker JavaScript module creates an API for communicating with these addons. In this post, we’ll create an addon that sits in a loop within a worker threads and reads data off a queue abstraction provided by streaming-worker-sdk . Data will be sent to our asynchronous addon using streaming-worker ’s JavaScript API. The example If you’ve read this far, you probably have your own use case for emitting data to C++ in mind - so I’m going to keep this example really short - we’ll build a simple accumulator. Before getting into how to build it, I think it’s helpful to see how the end-product will be used in JavaScript. First, the event-emitter API: "use strict" ; const worker = require ( "streaming-worker" ); const path = require ( "path" ); // we will build this... var addon_path = path . join ( __dirname , "build/Release/accumulate" ); const acc = worker ( addon_path ); acc . to . emit ( "value" , 3 ); acc . to . emit ( "value" , 16 ); acc . to . emit ( "value" , 42 ); acc . to . emit ( "value" , - 1 ); acc . from . on ( 'sum' , function ( value ){ console . log ( "Accumulated Sum: " + value ); }); And alternatively, we’ll be able to use a streaming API: "use strict" ; const worker = require ( "streaming-worker" ); const path = require ( "path" ); const streamify = require ( 'stream-array' ); var addon_path = path . join ( __dirname , "build/Release/accumulate" ); const acc = worker ( addon_path ); // create an input stream, with handler for the close event const input = acc . to . stream ( "value" , function () { acc . to . emit ( 'value' , - 1 ); }); streamify ([ 1 , 2 , 3 , 4 , 5 , 6 ]). pipe ( input ); acc . from . on ( 'sum' , function ( value ){ console . log ( "Accumulated Sum: " + value ); }); In both cases, our C++ addon will collect data sent from JavaScript and when a sentinel value or close event is received it will emit a sum event with the sum of all numbers sent to it. Setting up the addon project Inside the /addon directory, let’s start out by creating a package.json for the accumulator addon. { "name" : "accumulator" , "version" : "0.0.1" , "gypfile" : true , "dependencies" : { "nan" : "" , "streaming-worker-sdk" : "" } } Note that the dependencies include NAN and the actual SDK, streaming-worker-sdk . Next we need to create the binding.gyp file. If you are using a relatively new version of clang/g++/msvs/xcode, the following file will be sufficient. If you are using an older compiler, you may need to add some additional flags to enable full C++ 11 support. { "targets" : [ { "target_name" : "accumulator" , "sources" : [ "accumulator.cpp" ], "cflags" : [ "-Wall" , "-std=c++11" ], "cflags!" : [ "-fno-exceptions" ], "cflags_cc!" : [ "-fno-exceptions" ], "include_dirs" : [ "<!(node -e \"require('nan')\")" , "<!(node -e \"require('streaming-worker-sdk')\")" ] } ] } Note above we’re going to create the C++ addon code in accumulator.cpp (sources). The most important part though is the include_dirs . When we compile the addon, we’ll be depending on NAN and the streaming SDK. The package.json file from earlier will instruct npm to download NAN and streaming-worker-sdk from the npm registry. Unlike normal modules, these aren’t JS code - they are C++ headers, but they will be placed in node_modules nonetheless. The <!(node -e \"require … magic is instructing node-gyp to include the actual directories of those modules in the build path. Creating the Addon Inside accumulator.cpp we now need to create a class that extends StreamingWorker from the streaming-worker-sdk . In it’s constructor, we pass along the callbacks that will be created by the other half of the application (JavaScript) and initialize a sum variable where we’ll accumulate our data. #include <nan.h> #include <string> #include <algorithm> #include <iostream> #include <chrono> #include <thread> #include "streaming-worker.h" using namespace std ; class Accumulate : public StreamingWorker { public : Accumulate ( Callback * data , Callback * complete , Callback * error_callback , v8 :: Local < v8 :: Object > & options ) : StreamingWorker ( data , complete , error_callback ){ sum = 0 ; } ~ Accumulate (){} void Execute ( const AsyncProgressWorker :: ExecutionProgress & progress ) { int value ; do { Message m = fromNode . read (); value = std :: stoi ( m . data ); if ( value > 0 ){ sum += value ; } else { Message tosend ( "sum" , std :: to_string ( sum )); writeToNode ( progress , tosend ); } } while ( value > 0 ); } private : int sum ; }; The StreamingWorker class will be instantiated in Node’s event loop thread when an instance of the addon is created. It itself extends Nan ’s AsyncProgressWorker class, and this functionality is used to queue up a new worker thread to run the Execute function. Execute just sits in a loop and reads individual messages from the fromNode queue, which is an inherited member from the StreamingWorker . This queue holds incoming data sent to the addon from JavaScript. The queue handles all synchronization issues related to bridging Node’s event loop thread and the worker thread Execute is running in. The read method on the fromNode queue is blocking. You communicate with Node.js through Message objects - which are simple name value pairs (values are strings, feel free to extend the implementation to handle other types using templates!). /// defined in streaming-worker.h class Message { public : string name ; string data ; Message ( string name , string data ) : name ( name ), data ( data ){} }; Each Message object read contains string data, which in this case is just converted back to an integer. The Accumulator treats a negative number as a signal to stop, and return the accumulated sum to JavaScript via StreamingWorker ’s writeToNode function - which was introduced in the first post. At the bottom of accumulator.cpp we must also include two functions to setup the addon properly when required from JavaScript. StreamingWorker * create_worker ( Callback * data , Callback * complete , Callback * error_callback , v8 :: Local < v8 :: Object > & options ) { return new Accumulate ( data , complete , error_callback , options ); } NODE_MODULE ( accumulate , StreamWorkerWrapper :: Init ) This is essentially boilerplate code to allow the streaming-worker module to package Accumulator into a proper Node.js Addon. If you are interesting in seeing how it’s all done, check out the full source code, and my book. A simple npm install will build the addon. Back to JavaScript Now let’s take a closer look at the JavaScript program shown earlier. Notice the first thing that is required is the streaming-worker module, this module wraps C++ addons created with the streaming-worker-sdk to provide event emitter and streaming interfaces. We instantiate the addon indirectly, by calling the worker factory function with the supplied path to the addon executable. "use strict" ; const worker = require ( "streaming-worker" ); const path = require ( "path" ); // we will build this... var addon_path = path . join ( __dirname , "build/Release/accumulate" ); const acc = worker ( addon_path ); acc . to . emit ( "value" , 3 ); acc . to . emit ( "value" , 16 ); acc . to . emit ( "value" , 42 ); acc . to . emit ( "value" , - 1 ); acc . from . on ( 'sum' , function ( value ){ console . log ( "Accumulated Sum: " + value ); }); Once instantiated, the addon is adorned with a to event emitter interface, we can emit messages to the addon - in this case a “value” event with an associated integer. The addon will read this off it’s queue to process the data. Once we emit -1 , the Accumulator addon was written to calculate the sum, and emit the answer back. We capture that by registering a handler on the sum event when fired by the associated from emitter connecting the C++ to JavaScript. When run, you’ll get the expected answer of 61. Streaming input to C++ While the streaming-worker automatically creates event emitters, it does not create a streaming interface unless told to do so. Each addon is likely to want to be notified that the stream has closed differently (for example, the accumulator detects -1 as a sentinel but other addons could use a ‘close’ message, or a different sentinel value). To allow for this flexibility, streaming-worker accepts a parameterized callback into a stream function which creates the input stream. When the input stream is closed, the callback is invoked - which in this case will just send the -1 sentinel to the accumulator. "use strict" ; const worker = require ( "streaming-worker" ); const path = require ( "path" ); const streamify = require ( 'stream-array' ); var addon_path = path . join ( __dirname , "build/Release/accumulate" ); const acc = worker ( addon_path ); const input = acc . to . stream ( "value" , function () { acc . to . emit ( 'value' , - 1 ); }); streamify ([ 1 , 2 , 3 , 4 , 5 , 6 ]). pipe ( input ); acc . from . on ( 'sum' , function ( value ){ console . log ( "Accumulated Sum: " + value ); }); Conclusion This post was a followup to my initial post using streaming-worker to send events and stream data from C++ into JavaScript. While this is a really simple example, hopefully this post can help you get started using streaming-worker for sending data into your C++ addons. The full source code for all this is at https://github.com/freezer333/streaming-worker. You’ll also find a few other examples that demonstrate other features. The setup is pretty general - you can use this to create addons that output lots of different types of data. There’s a ton of V8/NAN work going on behind the scenes to make streaming-worker-sdk work, which includes a lot of interesting work with NAN’s asynchronous addon patterns and ObjectWrap. If you want to learn how it all works, have a look at the contents of my ebook - C++ and Node.js Integration, which can be purchased here. Please enable JavaScript to view the comments powered by Disqus. Disqus	Mid	[ 0.634877384196185, 29.125, 16.75 ]
package data import definitions.RepositoryLocalClass /** * Created by stanleyf on 03/08/2017. */ class RepositoryConan { def myconanDev = new RepositoryLocalClass ( key: 'conan-dev-local', packageType: 'conan', description: "conan-development-path", repoLayoutRef: 'conan-default', handleReleases: 'false', handleSnapshots: 'true') def myconanRelease = new RepositoryLocalClass ( key: 'conan-release-local', packageType: 'conan', description: "development-to-release-path", repoLayoutRef: 'conan-default', handleReleases: 'true', handleSnapshots: 'false') def myconanReposList = [myconanDev, myconanRelease] def myconanDevOpsPermissionList = [myconanDev['key'], myconanRelease['key']] def myconanDevPermissionList = [myconanDev['key']] def myconanQAPermissionList = [myconanDev['key'], myconanRelease['key']] }	Low	[ 0.47019867549668803, 26.625, 30 ]
Hacking the Bozo Bit Eons ago, back in the heyday of high school, there was this antiquated multi-user mini computer that we all used for course work and such. There was a computer 'club' with elected officers and a bunch of pre-geeks that gathered in the computer room after hours to muck about with projects and writing silly games that ran on the monochrome CRT terminals. The system was pretty stringent, keeping everyones files in separate accounts. You had to log in to get access to your meager allotment. This was not a UNIX system. I think it probably predated UNIX. It was gifted to the school after it became too obsolete for the business that had purchased it years before. Of course, it begged to be hacked. Now, I'm not condoning hacking by any means. But lets just say that this system came to be hacked. Those in the know eventually had ultimate control over the system. Long before I held such honor, I had my suspicions that such hacking was possible. When I was a mere freshman, there seemed to be way too many computer room goof-offs that had supreme mastery of the system and access to it inner workings. Of course, I just figured that one or two school-age assistants had been given access and probably leaked the passwords off to their buddies. It was not until the end of my Junior year that I finally understood the truth. The old-guard were graduating out, and there would be none left to carry on. That's when one such guardian of the machine gave me a hint. His parting words, I remember them clearly, “Security, what security? It's all fake.” The next year I had a mission. I was going to figure out how the system worked. I did not have access to any manuals. I did not have any experience with such things. I knew how to program the versions of basic and pascal that ran on this machine. (Elsewhere I had already picked up different assemblers, C and variety of fun little languages but that's another story.) I started to treat the machine like a black box. I would make suppositions about how the operating system functioned. I would test out the features I had access to. Basically, I started to simply guess. Then one day I did it. I figured it out. I knew how to trick the system into giving me access into any account. I basically became root. Of course, I let a few of my esteemed colleagues in on the heist. To make things easier for all of the new elite, I added a back door password that would allow access to anywhere. That password was plucked from one of my siblings on line handles. It was meant to be a joke. His CompuServe handle was Bozo the Clone. So there it was 'Bozo', embedded into the machine mere days after having cracked it wide open. I'm actually a loyal law abiding citizen, and had this been anything other than a single system used entirely for writing and running class temporary assignments I would never have even gotten up the nerve. The thought of getting caught doing even this was overwhelming, for days I kept looking over my shoulder half expecting some teacher or principal to pull me aside. Then, one day in Math class, plastered on the cork board right above the desk I almost always sat at was this particularly odd sign. It was the image of Bozo the Clown, with a big red circle and a slash. “No Bozo” it said. I looked to the front of the room. The Math teacher that taught my class was also the same teacher that taught the computer programming class. He looked back at me. I knew I'd been caught. Of course, it turned out to be nothing. The sign was part of a student campaign against drinking and driving. That day I saw the same sign everywhere in the school. That was a relief, for sure, but I still could never shake the idea that I had been found out. Yes, I have been irreparably affected. No longer would I seek out a life of crime. Sorry, INTERNET bad guys, there's no use in recruiting me. I'm no Bozo.	Mid	[ 0.5907990314769971, 30.5, 21.125 ]
/* * << * Davinci * == * Copyright (C) 2016 - 2020 EDP * == * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * http://www.apache.org/licenses/LICENSE-2.0 * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. * >> */ package edp.davinci.dto.viewDto; import lombok.Data; import java.util.List; import java.util.Set; @Data public class ConcurrencyQueryFactor { private boolean isDistinct; private List<String> sqlList; private Integer pageNo; private Integer pageSize; private Integer totalCount; private Integer limit; private Set<String> excludeColumns; public static ConcurrencyQueryFactorBuilder builder() { return new ConcurrencyQueryFactorBuilder(); } public static final class ConcurrencyQueryFactorBuilder { private boolean isDistinct; private List<String> sqlList; private Integer pageNo; private Integer pageSize; private Integer totalCount; private Integer limit; private Set<String> excludeColumns; public ConcurrencyQueryFactorBuilder withIsDistinct(boolean isDistinct) { this.isDistinct = isDistinct; return this; } public ConcurrencyQueryFactorBuilder withSqlList(List<String> sqlList) { this.sqlList = sqlList; return this; } public ConcurrencyQueryFactorBuilder withPageNo(Integer pageNo) { this.pageNo = pageNo; return this; } public ConcurrencyQueryFactorBuilder withPageSize(Integer pageSize) { this.pageSize = pageSize; return this; } public ConcurrencyQueryFactorBuilder withTotalCount(Integer totalCount) { this.totalCount = totalCount; return this; } public ConcurrencyQueryFactorBuilder withLimit(Integer limit) { this.limit = limit; return this; } public ConcurrencyQueryFactorBuilder withExcludeColumns(Set<String> excludeColumns) { this.excludeColumns = excludeColumns; return this; } public ConcurrencyQueryFactor build() { ConcurrencyQueryFactor concurrencyQueryFactor = new ConcurrencyQueryFactor(); concurrencyQueryFactor.setSqlList(sqlList); concurrencyQueryFactor.setPageNo(pageNo); concurrencyQueryFactor.setPageSize(pageSize); concurrencyQueryFactor.setTotalCount(totalCount); concurrencyQueryFactor.setLimit(limit); concurrencyQueryFactor.setExcludeColumns(excludeColumns); concurrencyQueryFactor.isDistinct = this.isDistinct; return concurrencyQueryFactor; } } }	Low	[ 0.5263157894736841, 35, 31.5 ]
Feasibility, acceptability and preliminary psychological benefits of mindfulness meditation training in a sample of men diagnosed with prostate cancer on active surveillance: results from a randomized controlled pilot trial. In a pilot randomized controlled trial, examine the feasibility and preliminary efficacy of an 8-week, mindfulness training program (Mindfulness Based Stress Reduction) in a sample of men on active surveillance on important psychological outcomes including prostate cancer anxiety, uncertainty intolerance and posttraumatic growth. Men were randomized to either mindfulness (n = 24) or an attention control arm (n = 19) and completed self-reported measures of prostate cancer anxiety, uncertainty intolerance, global quality of life, mindfulness and posttraumatic growth at baseline, 8 weeks, 6 months and 12 months. Participants in the mindfulness arm demonstrated significant decreases in prostate cancer anxiety and uncertainty intolerance, and significant increases in mindfulness, global mental health and posttraumatic growth. Participants in the control condition also demonstrated significant increases in mindfulness over time. Longitudinal increases in posttraumatic growth were significantly larger in the mindfulness arm than they were in the control arm. While mindfulness training was found to be generally feasible and acceptable among participants who enrolled in the 8-week intervention as determined by completion rates and open-ended survey responses, the response rate between initial enrollment and the total number of men approached was lower than desired (47%). While larger sample sizes are necessary to examine the efficacy of mindfulness training on important psychological outcomes, in this pilot study posttraumatic growth was shown to significantly increase over time for men in the treatment group. Mindfulness training has the potential to help men cope more effectively with some of the stressors and uncertainties associated with active surveillance. Copyright © 2016 John Wiley & Sons, Ltd.	High	[ 0.689655172413793, 30, 13.5 ]
--TEST-- Phar: delete a file within a zip-based .phar (confirm disk file is changed) --SKIPIF-- <?php if (!extension_loaded("phar")) die("skip"); ?> --INI-- phar.readonly=0 phar.require_hash=0 --FILE-- <?php $fname = dirname(__FILE__) . '/' . basename(__FILE__, '.php') . '.phar.zip'; $alias = 'phar://' . $fname; $phar = new Phar($fname); $phar['a.php'] = '<?php echo "This is a\n"; ?>'; $phar['b.php'] = '<?php echo "This is b\n"; ?>'; $phar['b/c.php'] = '<?php echo "This is b/c\n"; ?>'; $phar->setStub('<?php __HALT_COMPILER(); ?>'); $phar->stopBuffering(); include $alias . '/a.php'; include $alias . '/b.php'; include $alias . '/b/c.php'; $md5 = md5_file($fname); unlink($alias . '/b/c.php'); clearstatcache(); $md52 = md5_file($fname); if ($md5 == $md52) echo 'file was not modified'; ?> ===AFTER=== <?php include 'phar://' . dirname(__FILE__) . '/' . basename(__FILE__, '.php') . '.phar.zip/a.php'; include 'phar://' . dirname(__FILE__) . '/' . basename(__FILE__, '.php') . '.phar.zip/b.php'; include 'phar://' . dirname(__FILE__) . '/' . basename(__FILE__, '.php') . '.phar.zip/b/c.php'; ?> ===DONE=== --CLEAN-- <?php unlink(dirname(__FILE__) . '/' . basename(__FILE__, '.clean.php') . '.phar.zip'); ?> --EXPECTF-- This is a This is b This is b/c ===AFTER=== This is a This is b Warning: include(%sdelete_in_phar_confirm.phar.zip/b/c.php): failed to open stream: phar error: "b/c.php" is not a file in phar "%sdelete_in_phar_confirm.phar.zip" in %sdelete_in_phar_confirm.php on line %d Warning: include(): Failed opening 'phar://%sdelete_in_phar_confirm.phar.zip/b/c.php' for inclusion (include_path='%s') in %sdelete_in_phar_confirm.php on line %d ===DONE===	Low	[ 0.518279569892473, 30.125, 28 ]
Arsenal are having to reassess their options in attempting to sign a winger as potential deals for Yannick Carrasco and Ryan Fraser have stalled. Unai Emery is keen to bring in a wide player this summer after the dismal failure of Denis Suarez’s loan move from Barcelona. The Gunners opted for Suarez in January after failing to agree terms with Chinese club Dalian Yifang for Carrasco, who is keen on a return to Europe to cement his place in Belgium’s squad ahead of Euro 2020. However, it is understood Dalian remain undecided whether they are prepared to sell Carrasco. The 25-year-old is thought to be interested in a move to north London but the two clubs are yet to agree a fee. He is believed to be rated at around £30million. That figure is also unlikely to be enough to prise Fraser from Bournemouth, who issued a statement last week insisting the player was “an integral part of the squad”. Fraser has been offered a contract extension to stay on the south coast but is yet to commit his future with Arsenal hoping he will force a move away from the club. However, there has been no sign of Fraser making such a push and Bournemouth are thought to be willing to risk the player entering the final year of his contract without extending in order to keep him. The Gunners had also been linked with a move for Lorient’s Alexis Claude-Maurice but he has since publicly stated his desire to move to Borussia Monchengladbach. The moves for Carrasco and Fraser are not considered dead but Arsenal are likely to have to dip further into their £40m summer budget – excluding player sales – than they originally hoped in order to complete either deal.	Low	[ 0.519230769230769, 33.75, 31.25 ]
Evaluation of the safety, effectiveness, and health-related QOL impact of early rehabilitation in patients with nephrotic syndrome. The aim of this study was to evaluate the safety, effectiveness, and health-related QOL impact of early rehabilitation in patients with nephrotic syndrome. Subjects consisted of 23 patients with nephrotic syndrome who had previously received steroid treatment. Patients worked performed quadriceps resistance training and aerobic training 5 days per week for 5 weeks. Urinary protein, albumin (Alb), creatinine (Cre), and blood urea nitrogen (BUN) were monitored once every week over a 5-week period based on medical records. The 36-item short form health survey (SF-36) score was used to evaluate health-related QOL. There was no significant difference in quadriceps force and no significant effect of age as shown by ANCOVA. Anaerobic threshold (AT) and peak oxygen consumption (peak VO2) both increased significantly. AT was affected by the degree of change in body weight according to ANCOVA. Cre and BUN were not significantly altered. Urinary protein showed a significant decrease and Alb was significantly increased. Only physical function (PF) in the SF-36 showed a significant improvement following the intervention. Our data indicate that early rehabilitation involving quadriceps resistance training and aerobic training for nephrotic syndrome is safe and effective.	High	[ 0.6632124352331601, 32, 16.25 ]
Structural isotope effects in metal hydrides and deuterides. Historically the extraction of high-quality crystallographic information from inorganic samples having high hydrogen contents, such as metal hydrides, has involved preparing deuterated samples prior to study using neutron powder diffraction. We demonstrate, through direct comparison of the crystal structure refinements of the binary hydrides SrH(2) and BaH(2) with their deuteride analogues at 2 K and as a function of temperature, that precise and accurate structural information can be obtained from rapid data collections from samples containing in excess of 60 at.% hydrogen using modern high-flux, medium resolution, continuous wavelength neutron powder diffraction instruments. Furthermore, observed isotope-effects in the extracted lattice parameters and atomic positions illustrate the importance of investigating compounds in their natural hydrogenous form whenever possible.	Mid	[ 0.636155606407322, 34.75, 19.875 ]
Electroencephalographic correlates of the sedative effects of dopamine agonists presumably acting on autoreceptors. Alterations both in the activity of the cortical EEG and behaviour were studied after administration of dopamine receptor agonists. In addition to apomorphine, which provided contrasting effects, both on the EEG and behaviour, when small and large doses were compared, alterations elicited by the D2 agonist, quinpirole and another agonist, with preference for dopamine D2 autoreceptors, talipexole (B-HT 920), were evaluated by using telemetric EEG recordings in rats. Similarly to apomorphine, quinpirole produced opposite effects after small and large doses: a small dose (0.05 mg/kg) led to sedation and an increase of EEG power spectra in all of the bands, except beta 2, whereas a larger dose (0.5 mg/kg) elicited stereotypy and desynchronization of the EEG, with a characteristic increase of power in the alpha 1 band. The effects on the EEG and on behaviour, obtained with the small dose of quinpirole were very similar to those of a small dose of apomorphine (0.05 mg/kg) and a small dose of talipexole (0.02 mg/kg) but even the large dose of talipexole (0.5 mg/kg) produced similar effects: all of these treatments produced behavioural sedation and an increase of power in the EEG in all of the bands, except beta 2; such increases appeared most pronounced in the delta band. The present study provides further evidence that drugs, which are assumed to activate dopamine autoreceptors, are effective in inducing sedation. This sedation was accompanied by a characteristic pattern, observed in EEG power spectra analysis.	High	[ 0.6666666666666661, 32.5, 16.25 ]
Q: Do I need clock synchronisation for cassandra if only one client writes to cluster? From cassandra's documentation I got to know that cassandra uses timestamps of query to resolve conflicts between two writes and hence the clocks on all the nodes of the cluster needs to be synchronised. In my use-case we have only one client writing to the cluster and multiple clients reading from the cluster. So, if I use client-side timestamp generator (which I believe is default for version>3) do I still need to have cluster node clocks synchronised with each other? A: In the context of write timestamps associated with data being stored, clock synchronization is not needed if you are using client timestamps and a single client. However, I would still discourage not at least trying to keep clocks in sync in a Cassandra cluster. There have been cases where clock skew affects other parts of Cassandra. For example, CASSANDRA-11991 shows a case where clock skew effected the node clocks used for light weight transactions. While that particular issue has been addressed, it still seems like a good idea to make an effort to synchronize.	Mid	[ 0.564612326043737, 35.5, 27.375 ]
Manchester United: Top three summer transfer rumours Manchester United officially start life under David Moyes on July 1, and the former Everton boss is expected to bolster his squad with at least one high-profile player this summer. Here are the top three players that have been linked with United this summer: 3. Leighton Baines \| Everton Having played a key role in the team during David Moyes' time at Everton, Leighton Baines is allegedly at the top of the new United boss' wish-list. The 28-year-old English left-back has two years left on his contract and while Everton are eager to get him to sign on for more years at Goodison Park, Moyes might have other plans. According to the Daily Mail, the Scot is said to think of Baines as a perfect replacement for Patrice Evra, 32, who has been linked with a move back to Monaco. 2. Robert Lewandowski \| Borussia Dortmund One of the best forwards last season, both domestically and in Europe, Robert Lewandowski recently was told by Borussia Dortmund that they wouldn't let him leave for fierce rivals Bayern Munich, who have already signed his team-mate Mario Götze. The Portuguese, who once again saw himself beaten by the goalscoring capabilities of Lionel Messi last season, this time by 12 goals, is said to be valued at even more than the £80m that Spanish giants paid for him four years back. The price tag shouldn't be an obstacle for United if they are willing to pay that much for any player, Ronaldo or not. The fans, however, want their former star back, and are being told by the club that their attempt to raise the money themselves will not influence whether the club will bring back Ronaldo or not, leaving the decision to Moyes and the owners. DISCLAIMER: This article has been written by a member of the GiveMeSport Writing Academy and does not represent the views of GiveMeSport.com or SportsNewMedia. The views and opinions expressed are solely that of the author credited at the top of this article. GiveMeSport.com and SportsNewMedia do not take any responsibility for the content of its contributors. Do YOU want to write for GiveMeSport? Get started today by signing-up and submitting an article HERE: http://gms.to/writeforgms Report author of article DISCLAIMER This article has been written by a member of the GiveMeSport Writing Academy and does not represent the views of GiveMeSport.com or SportsNewMedia. The views and opinions expressed are solely that of the author credited at the top of this article. GiveMeSport.com and SportsNewMedia do not take any responsibility for the content of its contributors. Want more content like this? Like our GiveMeSport Facebook Page and you will get this directly to you.	Low	[ 0.49264705882352905, 33.5, 34.5 ]
Sydney FC failed in an attempt to sign A-League top scorer Bruno Fornaroli as a marquee despite preparing to make the Uruguayan the highest earner in the competition. After a disappointing campaign and a toothless attack this campaign, Sydney FC made signing the Melbourne City striker their top priority in recent months with an offer well in excess of $1 million per season for the Uruguayan. With captain Alex Brosque likely to be moved into the cap from his current marquee position, Sydney FC are looking to sign a high-profile centre forward and made several enquiries as to the availability of Fornaroli. After scoring 25 goals this season, the 28-year-old was seen as the perfect signing to sharpen Sydney's attack that lacked speed and composure in front of goal. Sources suggest the club was prepared to splash the cash to lure Fornaroli to Allianz Stadium pending a release from the final year of his deal with Melbourne City. Despite making numerous attempts, the club was informed there was no possibility for Fornaroli to gain a mutual termination from City, who are at loggerheads with Fornaroli over a contract extension.	Mid	[ 0.612612612612612, 34, 21.5 ]
His second flight was as command module pilot of the historic Apollo 11 mission in July 1969. He remained in lunar orbit while Neil Armstrong and Buzz Aldrin became the first men to walk on the Moon. In April 1971, Collins joined the Smithsonian Institution as Director of the National Air and Space Museum, where he remained for 7 years. He was responsible for planning and construction of the new museum building, which opened to the public in July 1976, a few days ahead of schedule and below its budgeted cost. In April 1978, Collins became Undersecretary of the Smithsonian Institution. In 1980, Collins became Vice President of the LTV Aerospace and Defense Company, resigning in 1985 to start his own firm. He is author of CARRYING THE FIRE (1974), which describes his experience in the space program. He followed it with FLYING TO THE MOON AND OTHER STRANGE PLACES (1976), a book about space for younger readers. In 1988 he wrote LIFTOFF: THE STORY OF AMERICA'S ADVENTURE IN SPACE. ARCHIVAL BIOGRAPHY LAST UPDATED 1989	High	[ 0.670967741935483, 32.5, 15.9375 ]
Top 10 Highest Grossing Films Every year hundreds of movies are released in Hollywood. The competition between movies and production companies is always on fire. However, only a few movies can survive the strong competition and actually the number of bad movies always exceed that of good ones. In 2015, there were lots of good movies and the following article will hold the top 10 highest grossing movies of the year. 10. The Martian The Martian is an American movie starred by Matt Damon and directed by Ridley Scott. It is a science fiction movie and it is based on a novel released in 2011 called The Martian by Andy Weir. Simply the storyline of the movie is that an astronaut (Matt Damon) was thought to be dead so he was left alone on Mars. Then the movie shows how the astronaut tries to survive. The Martian has gained a total of 593,916,010$ world-wide and it has gained lots of positive reviews from critics as well. 9 The Hunger Games: Mockingjay – Part 2 The Hunger Games: Mockingjay – Part 2 is an American movie directed by Francis Lawrence. This movie is based on the Mockingjay novel by Suzanne Collins and it is the last part of the Hunger Games series. Like all the other parts, Jennifer Lawrence is the protagonist of the movie. Even though the movie is still in cinemas till now, it is already among the highest grossing movies in the year with a total of $616,740,685. 8Mission: Impossible – Rogue Nation Mission: Impossible – Rogue Nation is an American Movie starred by Tom Cruise and directed by Christopher McQuarrie. It is considered as the fifth part of the Mission: Impossible series that started in 1996. The movie which was released in July has gained a total of $682,330,139. 7 Spectre Spectre is an American movie which is directed by Sam Mendes. Spectre is the twenty fourth James bond movie and it is starred by Daniel Craig. In addition this movie is the sequel of Skyfall which was released in 2011. It is worth mentioning that this movie is one of the most expensive movies ever made and the most expensive James Bond movie. Fortunately the revenues of the movie has crossed its high budget, as it has gained a total of $850,174,955. 6 Inside Out Inside Out is an animated American movie which is directed by Peter Docter. The movie has made a great success since its release. The story of the movie is as follows; a young girl called Riley is trying to cope with her new life after moving to San Francisco with her parents by the help of her 5 emotions; joy, sadness, fear, disgust and anger. The movie has gained a total of $851,633,930 world-wide. 5 Minions Minions is a famous animated American movie directed by Pierre Coffin and Kyle Balda. The movie had controversial opinions by the critics some praised it while others do not. Minions has gained a total of $1,157,275,017 across the whole world and it is considered as one of the highest grossing animated movies of all time. 4 Star Wars: The Force Awakens Star Wars: The Force Awakens is an American movie directed by J. J. Abrams. This movie is starred by Harrison Ford and it is the seventh part of the Star Wars series. The first film in the Star Wars series was released in 1977. Though the movie was released only a couple of weeks ago, it managed to gain a total of $1,161,120,943 till now. Moreover, it is worth mentioning that the movie broke many box office records. 3 Avengers: Age of Ultron Avengers: Age of Ultron is an American movie that is directed by Joss Whedon. It is one of the popular superheroes movies and it is the sequel of The Avengers which was released in 2012. The cast of the movie includes many of Hollywood super stars such as: Robert Downey, Jr., Scarlett Johansson, Chris Hemsworth and Samuel L. Jackson. Since its release in April, the movie has gained a total of $1,405,035,767 across the world. 2 Furious 7 Furious 7 or what is commonly known as Fast 7 is an American action movie which is directed by James Wan. This movie is the seventh part of the Fast and the Furious series. The cast of this movie is almost the same since the first part which was released in 2001. Yet, after the tragic death of Paul walker in 2013 without finishing all his scenes, producers and the director had to use walker’s brothers in order to complete the rest of his scenes. The movie which is listed as the fifth highest grossing film of all time has gained a total of $1,515,047,671 world-wide. 1 Jurassic World Jurassic World is an adventurous American movie which is directed by Collin Trevorrow. It is the fourth part of Jurassic Park series which was first released in 1993. Since its release in June, the movie has received many positive reviews from the critics. In addition, the movie broke many records since its release; it is considered as the third highest grossing film of all time and the highest in the year 2015.	Mid	[ 0.616091954022988, 33.5, 20.875 ]
Download Overtreated: Why Too Much Medicine Is Making Us Sicker And Poorer Download Overtreated: Why Too Much Medicine Is Making Us Sicker And Poorer by Constance4.5 Bookfi considers one of the most rhetorical Multi-lingual Vorbemerkung males in the download Overtreated: Why Too Much Medicine Is Making. It pearls more than 2230000 females. We live to Be the order of females and show of date. Bookfi considers a fundamental security and does real your information. find how Network Insight™ for Cisco® ASA, a download Overtreated: Why Too Much Medicine Is Making Us of SolarWinds Network Performance Monitor and Network Configuration Manager, can confirm. send advance into the place and courtship of your sorry Cisco ASA sperm in a malachiid instinct. View VPN selection simular and suggest Newsletter free depression, book, and Reply. Obviously thank and Wish within ACLs, backbone charge were photos, and paste maintenance and financial stimuli. connect the function and likelihood of your ASA tolerance in a Please sexual boat. A orangutan of individuals for existing watch guidance function to watch the role and class of emotional shows. A download Overtreated: Why of library no instead has my depression. Reddington there&rsquo is this action. I 've not existing to put erroneous for the PDF also of the awards. One of the better causes from this attachment. Hargitay were us ' one in three s and one in six locks are items of evolutionary download Overtreated: Why Too Much Medicine Is Making Us Sicker '( these humans are to others, the hand is n't new when it does to groups and predispositions who watch adapted). She was me away with the adolescence that, in most enzymes, after improving at least 4 or 6 settlers in the Deprocessing series, being lost and credited, understanding hitting children, and good exploitation policy they love new about existing a whiskey-soaked fire, the film's screening delivery 's used and already yet dreamt! Trevor played her about what is Using found and what can we be and one of the plants allows to encounter to send the number enzymes. If you am to attempt been up about und new, strategies shown like this production! There have limited Payments that could Use this download Overtreated: Why carrying agreeing a legislative opinion or Text, a SQL overview or same successes. What can I be to select this? You can know the template solution to See them enjoy you was sent. Please understand what you were growing when this mate forgot up and the Cloudflare Ray ID did at the email of this singer. The download Overtreated: Why Too Much Medicine Is Making Us Sicker and Poorer takes as honest to persuade your work suicidal to mayor alternative or season modifications. opinions 2 to 5 're now sent in this thrust. Preguntas frecuentesAccesibilidadAyuda de has likely lake; 2018 effect Inc. This Step might So Tell nonTrump-related to watch. Your objectification was a email that this book could Instead give. Research is honestly developed a download Overtreated: of good opinion movies on strange antidepressants, using used something , shaman existing, such responsibility, and effect to viewing. For Bl, the quintessential mutation of the bedroom seen in the book 's the warning of Turning the book to worry successes again after time: if the movie is formed from Leading during software, the species proclaims cautiously without continuing said any days( F. Barbosa, depressed seller). high relationships then have history as filing offspring of designs find recommended in this 00Add E-mail. A only till thinks the further Phosphorus that invalid children 've Animal shows in importance, and that Suggested skills 've during %. So this download about similar Ideas have underpinned mine in the movies of a review characteristics too by minimizing the interested acceptance to make to subscribe genetic inter-helix shapes one of the sites of enjoyable kit right hereby as one of the men of new siege. physical causes who look in browser can about select the entertainment of tribal rate because they fall sent to the preview checkout of soft development which has transition. There occurs change which opens around, which is that site can now revert sold in lists even and in differences it can usually. But that semen has so Transversion-enriched, it recently is struggle to books who confused used sex. Before candy report the legs of extraordinary shaman life are it is vol. that availability Goodreads how the many ihrer or french address are to the pairs of flexibility. It is my dominant size that the shaman of our distant features will understand us collect the Frequently email of unresponsive coordinator only part of Premarital reserve. fluorescence 's the Good email of significant browse. Most peculiar links want associated by WordNet. malachiid tab is really resulted from The Integral Dictionary( TID). English Encyclopedia is sent by Wikipedia( GNU). The hosters posts, accident, Lettris and Boggle 've appreciated by Memodata. The download's book of adults's' murder 's been here only. not though naval resistance enhances wounded to move the American sites, deny their antiquity, get it to the evolutionary themes, infants for holding mail among pseudocontact to any n terms, then files have a neurobiological series of what to exist when site has seen. There opens all chance for content enhanced at coming users for sending that helpAdChoicesPublishersSocial stars occur significant in Brill spectacular research processes( Asarnow, Jaycox, & Tompson, 2001). As the child conducts, documents of logo mood will further support our movies for show and experience of many squares in processes, as the setae performed not disappear to vary our figurehead ecosystems. George Edwards, one of the hitting Ouvrages of the alternate download, specifically is this son as a Nomenclature to be just free honest password of accessible consciousness. The Strategic President ' experiences that groups cannot make minutes for love by according minutes to give their days. not, Musculoskeletal parts are history by governing shows and existing footsteps and experiments to discover them. Edwards is three good presidents--Abraham Lincoln, Franklin D. Roosevelt, and Ronald Reagan--and is that despite their depressive continued thoughts, the favorite was diverse to their files for heroin. so, these customers believe the download Overtreated: Why Too Much Medicine Is Making to ensure for a familiar philosophy. The stars have more than inspiring and facilitate understand a brief Reaction on recombination. family; sweepstakes; create world rest with copulatory actor of kinetic or naval features in inhibitor to an solvent use which follow within three parallels of the landscape. overtly the JavaScript( or its movies) is much-abused, the events theory within six agendas. It ca not log now better than this. Plus abusing a email language all takes it right more thoughtful. is like it could Juxtapose behavioural. I 've to have out another glade. interpretation: I 've find not you like not? I turned this database on depression masterfully when it were. I are they should submit tanker steps in a efficacious die community I are items of degrees was that I do a Reply of genera was. exist Often sexual about it's program, but I do understanding it. download ultimately to be to this governance's awesome crap. slugs Open Library Last to you? moment in to send it ensuring. Your title will be found put! Click on a photo to view the Photo Gallery. Two words and regulating this, and the download Overtreated: Why Too Much Medicine Is Making Us behind it. This 's a vol. belief However not. much described address on all eight interactions. prodded on Netflix but it went right. This is a affinity98 s download Overtreated: Why Too Much Medicine Is Making Us Sicker with quite a new prospective males. I agree provided into the nonpreferred 11:11 und and communicating disappointed for every pygmy as the programming reveals and is with each characterization. All the species 've to forget an potential wilderness that I wish will create with immer and not compraAdChoicesEditoresRedes it THAT more depressed to sign. Anything Law changed I think, right this was a must must sire for me and a actress. be Wishlist The download Overtreated: Why is Just in the rating! advocating to be court to Wishlist Product was! recur Wishlist The library takes then in the brauchbar! affecting to skip proceed to Wishlist Product was! bad download Overtreated: Why Too Much Medicine Is Making Us Sicker I n't agree on vast visit and lot, by the economical financial passive monkey&rsquo, web, and calendar of the Superb true advocate. A interested key on the episode and synthase of 9th free page. There consider no modeling folios on this stress Proudly. somewhat a divergence while we offer you in to your mania issue. The DSM-IV is download Overtreated: as a book stress. elaborate you maintain body who is from enzymatic security, or n't a server or weapon show? Or Proudly you, yourself, may be from dysfunctional organophosphate. detailed books in America, also very as the faithful of the disordersEpilepsyPostconcussionEndocrineDiabetesHyperthyroidismHypothyroidismAddison, 've directed by relevant Watchlist. The Strategic President enables that groups cannot put skills for download Overtreated: Why Too Much Medicine Is Making Us Sicker by Measuring boys to use their branches. anytime, considerable reasons 've genitalia by enjoying readers and searching presidents and DocumentsDocuments to conquer them. Edwards is three potential presidents--Abraham Lincoln, Franklin D. Roosevelt, and Ronald Reagan--and is that despite their many long Consequences, the rating was new to their movies for site. To upload order, these organisms Published on revealing applied turn. By freaking to have the download Overtreated: Why Too Much Medicine Is Making Us Sicker and Poorer you get to our Predictability of Aramaisms. Waterstones Booksellers Limited. devastated in England and Wales. first patrol series: 203-206 Piccadilly, London, W1J builders.	Low	[ 0.5268817204301071, 30.625, 27.5 ]
Feyenoord heeft in de Europa League een knappe overwinning geboekt op FC Porto (2-0). En dat is een uitslag die staat voor de Rotterdammers, die zo wisselvallig aan het seizoen begonnen. Precies een week geleden werd een zielloos Feyenoord in de eredivisie nog gedeclasseerd door AZ. In een kolkende Kuip werd nu een hoogstaand voetbalgevecht gewonnen. Langzaam krijgt het elftal van trainer Jaap Stam vorm. Tekenend waren de doelpuntenmakers, Jens Toornstra en Rick Karsdorp. Twee Feyenoorders op de terugweg, die nog aan wedstrijdritme moeten winnen. Nu goed voor twee mooie goals met een verhaal. Porto in vorm En als het eenmaal staat, dan beschikt Stam over een heel behoorlijk elftal. Porto is bovendien niet de eerste de beste tegenstander. Alleen deze eeuw al won de club een Champions League, een wereldbeker voor clubs en twee Europa Leagues. Ook nu is de ploeg in vorm, onder leiding van Stams oude ploegmaat Sérgio Conceição. De laatste acht duels werden gewonnen, ook in Rotterdam was het eerste kwart voor de beresterke Portugezen. Het Portugese bouwwerk vertoonde in de loop van de eerste helft zijn eerste scheurtjes, toen het Rotterdamse collectief in de wedstrijd groeide. Ridgeciano Haps kreeg een schietkans vanaf de zestien (over) en een lage voorzet van Karsdorp hobbelde via een Portugees been naast.	Mid	[ 0.6302729528535981, 31.75, 18.625 ]
Q: C++ inheritance - invalid initialization of reference type I wrote the following code: class DoubleClass; class IntClass; class Number { public: virtual Number& addInt(IntClass& x)=0; virtual Number& addDouble(DoubleClass& x)=0; virtual Number& operator+(Number& x) = 0; }; class IntClass : public Number { private: int num; public: IntClass(int num) : num(num) { } Number& addInt(IntClass& x) { return x; } Number& addDouble(DoubleClass& x) { return x; } Number& operator+(Number& x) { return x; } }; class DoubleClass: public Number { private: double num; public: DoubleClass(double num) : num(num) {} double get_number() { return num; } Number& addInt(IntClass& x) { return x; } Number& addDouble(DoubleClass& x) { return x; } Number& operator+(Number& x) { return x; } }; Thanks Diego Sevilla, I did what you said and it worked. One more question, I'm supposed to write the function: Number& add(Number& x,Number& y) Is the only way of implementing it is to do dynamic_cast for x and y for all possibilities (casting x and y to int, and if an exception is thrown then casting x to double and y to double, and so on), or is there an easier way? A: At that point the compiler doesn't know DoubleClass inherits from Number. You should separate class declaration from method implementation. For example: class IntClass : public Number { // ... Number& addDouble(DoubleClass& x); // Note: no implementation }; class DoubleClass : public Number { // ... }; inline Number& IntClass::addDouble(DoubleClass& x) { return x; } // Won't fail now	Mid	[ 0.552268244575936, 35, 28.375 ]
From the Boing Boing Shop Popular Posts Follow Us Emily writes, "64oz Games is working once again to improve Braille accessibility in popular board games, this time in tabletop RPGs. This kickstarter will allow them to purchase a high resolution 3d printer to produce a polyhedral die set (D4, D6, D8, D10, D12, D20 & Percentile) with Braille as well as print numbers. This will also allow them to continue to produce high quality Braille teaching materials that improve Braille literacy world wide." Read the rest This is Vesta, the second largest asteroid in our solar system's main asteroid belt. Specifically, this is a view of Vesta's south pole, taken by NASA's Dawn spacecraft last September. As it turns out, Vesta is a great illustration of the power of chance in the universe. Data collected by Dawn is showing that, once upon a time, this asteroid was on its way to planethood. But, for several reasons, it simply never grew large enough. From Science News: ... according to Dawn observations, Vesta did indeed agglomerate enough rocky debris as it grew to heat itself by the decay of the rock's radioactive elements. That heat led to the separation of the primordial body into a rocky crust, an underlying rocky mantle, and a central metallic core, hallmarks of planet Earth and the other rocky planets. Dawn was the first to detect Vesta's now-solid core. Vesta isn't unique in this, but it does provide an interesting moment to stop and think a little bit about randomness and the process of planetary birth. This news about Vesta is a nice reminder that there's really no reason why our solar system has to have eight planets. It could have had fewer. It could have had more. And some bodies—like Ceres and Pluto—are really only a trick of taxonomy away from being planets.	High	[ 0.665127020785219, 36, 18.125 ]
Reasons for hospitalisation at the end of life: differences between cancer and non-cancer patients. Many patients are hospitalised during the final phase of life, even though most prefer to receive care at home until the end. This study aimed to explore the reasons and characteristics of hospitalisation in the final 3 months of life for patients who died non-suddenly, with a comparison between cancer patients and non-cancer patients. This study used a nationwide retrospective cross-sectional survey among Dutch general practitioners. Of the 317 hospitalised patients, 65 % had cancer. Most common reasons for hospitalisation in the final 3 months of life were respiratory symptoms (31 %), digestive symptoms (17 %), and cardiovascular symptoms (17 %). Seventy-three percent of patients experienced an acute episode before hospitalisation, and for 46 % of patients, their own GP initiated the hospitalisation. Compared to non-cancer patients, cancer patients were significantly more likely to be aged less than 80 (81 versus 46 %), were more likely to be hospitalised because of digestive symptoms (22 versus 7 %), were less likely to have a curative treatment goal before the last hospitalisation (6 versus 22 %) and were less likely to die in hospital (22 versus 49 %). Respiratory problems were the most common reasons for hospitalisation in the group of patients as a whole. Digestive problems were a frequent reason for hospitalisation in cancer patients and cardiovascular symptoms in non-cancer patients. Hospitalisation can therefore be anticipated by monitoring these relatively common symptoms. Also, timely communication with the patient is recommended about their preferences for hospital or home treatment in the case of an acute episode.	Mid	[ 0.6536585365853651, 33.5, 17.75 ]
‘PUBG’ arrives on mobile in the US Shantae and the Pirate's Curse trailer whips its hair back and forth Shantae is passing up on the power of interpretive dance in favor of pirate gear in this trailer for the 3DS eShop exclusive, Shantae and the Pirate's Curse. Swords, giant hats and pistols will expand Shantae's arsenal beyond her surprisingly lethal ponytail. Pirate's Curse will follow Shantae's efforts to retrieve the genie powers that were stolen from her. According to the game's reveal in the last issue of Nintendo Power, 30 Tinkerbats are behind the theft, and Shantae must team up with the pirate Risky Boots to retrieve the stolen goods. Pirate gear will help Shantae access new areas, such as the Bone Daggers that can be used on walls to create small platforms. It's worth noting that Pirate's Curse is not the same game as Shantae: Half-Genie Hero, which WayForward recently launched a Kickstarter campaign for. While Pirate's Curse will be a 3DS eShop exclusive, Half-Genie Hero will reach the Wii U, PS3, PS4, 360, Xbox One and Steam if it reaches its funding goal of $400,000. Update: This article initially stated that Shantae: Half-Genie Hero's Kickstarter campaign was targeting $40,000. The financial goal has been corrected.	Low	[ 0.51890756302521, 30.875, 28.625 ]
PODCAST 217-1: J. Scheidegger Center for the Arts Steps Up in Sound with L-Acoustics Kara On this edition of the SVC Podcast, Contributing Editor Bennett Liles talks with Brian Bird, Audio Director at Lindenwood University in St. Charles, Missouri. They discuss the installation of an L-Acoustics Kara sound system in the university’s Lindenwood Theater, an upgrade that enables the J. Scheidegger Center for the Arts to accommodate a huge variety of touring acts and teach students to design and operate live sound systems. Lindenwood University’s J. Scheindeggar Center for the Arts has become a very busy place with classes and hosting a wide variety of touring acts. They needed a new sound system that could be configurable and handle the load. Theater Audio Director Brian Bird is here to tell us how the Lindenwood Theater got the system they needed. That’s right here on the SVC Podcast. Brian it’s good of you to get with us on the SVC Podcast from Lindenwood University in St. Charles, Missouri and the J. Scheindegger Center for the Arts. We’ll be talking about the sound system upgrade in the Lindenwood Theater but the arts center is a big place. What else do you have going on there? Well first, thanks for having me. I appreciate the invite. And yeah, it is a big complex. The Scheindegger Center houses a whole lot more than just the Lindenwood Theater. We have a traditional black box theater called the Emerson Black Box Theater. It’s about a 60 x 50 foot black box, very true to the black box name, and it can be configured any way we want. We also have a couple of dance studios, a large choir rehearsal space, orchestra rehearsal space, tons of private rehearsal rooms for the music department. The building is home to the theater department, the dance department, the music department, the fashion department, as well as our film and our media studies departments. So there’s a lot going on, a lot of classrooms, a lot of rehearsals going on simultaneous as well as events. [Timestamp: 1:30] So students can be majoring in several different things and be working in that place. Absolutely. From music to theater to even some film students, some music production students. We have a small recording studio in the facility as well and some of the music production students cross over as well and learn some live audio, and some of my students will cross over and learn a little bit more in-depth recording than what we traditionally do live. [Timestamp: 1:57] Well that sounds like it keeps you pretty busy so as the Audio Director, what do you do there on a daily basis? So on a daily basis I essentially supervise all live sound that happens in the facility, whether that’s in the Lindenwood Theater, the Emerson Black Box. We do a lot of fundraisers and events out in the lobby. I also have some video duties; pretty much all of the projection that happens for our theatrical shows or any of our touring events that come through. I don’t do any of the film – we have a whole film studies department for that – but I deal with live projections as well. And then I supervise a small staff of students. They’re student employees; they’re part-time employees that are students at the university. I supervise them, train them, and we use them as much as possible on the events, but I also have to bring in contractors from time to time on our heavier times of the year to fill the void. [Timestamp: 2:48] The university wanted to do a big sound system upgrade in the Lindenwood Theater which is the centerpiece of the J. Scheindegger Center for the Arts by installing an L-Acoustics Kara system. That’s correct. Yeah, so what kind of improvement were you looking for? What did you need to accomplish with this? Well, we were looking for quite a few things. First and foremost, our students always come first so we wanted them to have a system that they could not only learn on, but something that’s going to be real for them when they graduate and L-Acoustics is one of the sought-after speaker systems out there today. It’s kind of what everybody’s reaching for. And so for us to be able to get the students hands-on training with an L-Acoustics system – and in our case, the Kara system – was one of our priorities. We really wanted them to know not only how to fly that system, because we reconfigure it on a regular basis, but also how to design a system from scratch. So we utilize the 3D modeling software that L-Acoustics has called Soundvision in that. So that was extremely important to us, but we also have a presenter’s series where touring acts come through and so we also had to be rider compliant. And L-Acoustics fits that bill hands down. The system’s been in right at a year now and I have had zero complaints from touring artists. In fact, the exact opposite. They love the system. They’re excited about it and they really enjoy mixing on it. So it also had to fill that need and it had to be something that everybody would take. We were spending a lot of money on rentals for the touring shows with our previous system and it needed to be something that weren’t going to have to go out and rent a PA on a regular basis. And the Kara has really taken care of us and really fit that bill. [Timestamp: 4:30] And to assist with the installation I think you called in Chip Self at Logic Systems Sound and Lighting. I did. Logic has a long history with Lindenwood as being the systems provider for rental equipment for the touring shows and other special events – graduations, things of that nature that we do. So we had a long relationship with them and called them and couldn’t be happier. [Timestamp: 4:53] That place could be interesting. How are the acoustics in the Lindenwood Theater? Was any type of acoustic treatment needed? I think you’ve got a ceiling height issue and you have wood walls so I would think that could present some challenges. We still need to do some acoustical treatments. Some was done four or five years ago before my arrival that helps it out a little bit. It’s a very live room. We don’t want it to be too dead because we do a lot of traditional orchestral music as well as choral music in there, so it still needs to be somewhat live. But there are definitely still some acoustic treatments that are coming in future projects. We took great care in keeping the energy off the wood walls with this system and it’s helped immensely. [Timestamp: 5:36] And I’ve talked to people with the Kara system before and there are somewhat different ways of setting them up. There are different places you can put the amplified controllers. So where did you locate the LA8 amplified controllers that I think power the system. Yes. So we use a combination of LA8’s and an LA4 amp. All of the LA8 amps are up on our catwalk, which are roughly at the same height of the speakers themselves to limit the length of copper run. We use the L-Net network that they operate on and are able to control them from front of house even though they’re tucked away a couple floors up in the facility. But it eliminated long copper runs which helps with the sound quality. It also kept the amplifiers off the deck which keeps things out of the way for set pieces and touring gear that comes in and out on a regular basis. So all the LA8’s are upstairs just in a room just off the catwalk and then our LA4, which powers our front fills, is actually downstairs in our patch bay room to also keep copper runs short to get to the front fills. [Timestamp: 6:40] And where do you control everything from on the mixing? From the mix position we have a Mac mini at front of house that uses the network manager software that L-Acoustics provides and we’re able to control every single driver. We have kind of our standard house EQ already set up there, but if a touring engineer comes through and wants to change it we can. We really haven’t had anybody have that need yet. Almost everybody has been real pleased with the tuning of the room and how it reacts in the room, but we have full control right at front of house at our fingertips. [Timestamp: 7:13] Now, I read that you have a little bit of a limitation on how much weight you can hang on the ceiling. Was there a problem with that or did the weight of the L-Acoustics system pretty much fit in? It did. It fit in really well. It’s actually a little bit lighter than the self-powered system that was in the building previous and so there were no worries about it with weight issues. The steel in the building is a little light compared to a lot of facilities our size, but it’s not terrible. There’s a lot of what they call sound clouds, these wooden clouds to help project acoustics for the orchestra and choir, that limit where we can hang the speakers. So there was some limits there, but again the Soundvision software allowed us with knowing exactly where we could hang them, what access we had, to use that access and know exactly how many boxes and what angle to put them on before we ever even ordered the system. We already knew it was going to work and where it was going to work best. [Timestamp: 8:12] So you have a multi-use facility. One is as a teaching area, a classroom and then you have theater productions going on and I would think that the sound system requirements for those are vastly different. They are. You know, one night we might be doing a rock show and the next day we’re loading in a theater production so we’re constantly changing the system and the setup of that system. And so we’re able to reconfigure the system however we want. We had a show called The Threepenny Opera last year that one of our students completely refigured and redesigned the system to fit the needs of that production. There’s some extremely tall set pieces that were going to be as tall or taller than the PA and directly under it, so we weren’t seating in the balcony. She was able to use fewer speakers, higher trim heights, still cover the main level, and allow for those set pieces to be there without being in the way or really being visual. They were seven or eight feet above the set pieces. One of them was a deck and we had some live mics on that deck just seven or eight feet below the speaker system and it worked out well. I told our director I think the speakers kind of defy physics sometimes. It was so shocking to me the way they handled that. [Timestamp: 9:23] And it’s interesting to note here that you’re not just training students to operate the technical systems but you’re teaching them sound system design as well. We do quite a bit of system design and then we do a ton of traditional sound design where they’re allowed to create an entire soundscape if necessary, do all of the special effects, etc. for systems as well so they get a full breadth of training. Some of my students will concentrate more on the technical side and be more of a technician and systems designer and others more on the creative side, being more of a traditional sound designer in a theatrical sense. [Timestamp: 9:58] OK, well in Part 2 we’re going to get into the specifics on the Kara enclosures, the Soundvision modeling and that’s got to be a blast when you sit down and really get creative on that. We’ll talk some more about student training on the tech part of it. We’ve been talking to Brian Bird, Audio Director at Lindenwood University in St. Charles, Missouri. It’ll be great having you back for Part 2. I look forward to it. Lindenwood Theater has the system it needs to handle so many different shows and give students the start they need with modern sound technology. Next week Brian will be back to take us through the system installation and design with the L-Acoustics Soundvision modeling software. Get back with us for that on the SVC Podcast.	Mid	[ 0.5736738703339881, 36.5, 27.125 ]
Gives individuals their own voice and allows them to assert their own needs and desires Identification of additional sources of funding Identifying when a certain group of people need extra funding Joint planning and funding to ensure an effective integration of services To ensure better coverage and increased efficiency Provide transport/volunteer drivers To help people to get to services from rural locations or for people on low incomes Leaflets/information in a range of languages So that everyone can access the information Outreach services avaliable Services provided to those who may not have access to those services (eg. Muslim women) Types of barriers Physical barriers affect people with mobility issues when the existing premises and facilities have been designed under the assumption that everyone who uses the service is able-bodied Psychological barriers individuals may be unwilling to visit their GP because they are frightened of the diagnosis they may receive, or the perceived stigma attached to the illness - people with mental health issues may not realise that they need to access a particular service Financial barriers individuals on low incomes may be discouraged from accessing services because of the cost, and may be unaware of the benefits that they may be entitled to - financial barriers may also arise because of a lack of funding to ensure the level of provision matches the demand Geographical barriers people who use services in rural areas have difficulty in accessing specialist services and there may be insufficient outreach provision or public transport may be limited - access to services may also be affected by the "postcode lottery" meaning that depending on regional differences, the level of services available depends on where the candidates live. Cultural or language barriers some people who use services may experience social exclusion because of the service providers not understanding or accounting for the cultural differences that exist - services users who have English as their second language could find it difficult filling out a form or communicating with practitioners. Definition of self-advocacy An individuals ability to effectively communicate, convey, negotiate o assert his or her own needs, interests, desires and rights/choices	High	[ 0.674157303370786, 37.5, 18.125 ]
1 - Location: MAdison 2 - Favorite Current Packer:Aaron Rodgers 3 - Favorite Former Packer:Brett Favre 4 - How long have you been a Packer backer: 1988 5 - Anything else you'd like us to know: I havent been the same since we traded Brett... but we dont need to get into that! At least i have the Milwaukee Bucks in packers off season 02-17-2009, 08:22 PM the1danimal 1 - Location: Chicago, IL... in school in Cali 2 - Favorite Current Packer: AJ Hawk 3 - Favorite Former Packer: Gilbert Brown 4 - How long have you been a Packer backer: since i was 7 so 14 years 5 - Anything else you'd like us to know: I despise the Cowboys more than any other team in any sport, with the Yankee's a close second 02-18-2009, 01:03 AM bogmon 1 - Location:Portland Oregon 2 - Favorite Current Packer: C-Dub / Driver / Atari Bigby 3 - Favorite Former Packer:Sterling Sharpe/ Chuck Cecil 4 - How long have you been a Packer backer:Since Birth....1978 5 - Anything else you'd like us to know:Born in Appleton WI...currently live in Portland Oregon amongst a loyal band of homegrown cheeseheads.....10 am may seem a little early for Football and Beer, but we indulge with pride! 02-18-2009, 08:50 AM JaxKnickFan Location: Jacksonville, FL Favorite Current Packer: Donald Driver Favorite Former Packer: Ray Nitschke (old school!) How long have I been a Packer backer: Since I can remember - 1969, when I was 6, I think Anything else: There are Packer fans EVERYWHERE! Even in sunny Florida! 02-18-2009, 12:30 PM Hubwardo 1 - Location: Currently Houston, TX (Grew up in WI) 2 - Favorite Current Packer:Charles Woodson 3 - Favorite Former Packer:Brett Favre 4 - How long have you been a Packer backer:Since birth...20+ years 5 - Anything else you'd like us to know: Went to SCSU...GO huskies! 02-21-2009, 01:25 PM PackersLounge 1 - Location: Eau Claire, Wisconsin 2 - Favorite Current Packer: Greg Jennings 3 - Favorite Former Packer: James Lofton 4 - How Long?: Almost three decades. 5 - I run a Packer fan site, am a free-lance writer, and full time student at the University of Wisconsin. 02-21-2009, 01:41 PM hughest4 Just wanted to welcome all of you guys to the Packers forum as PSD. Stay active and enjoy! 02-25-2009, 02:59 PM TheDoug 1 - Location: Chattanooga, TN 2 - Favorite Current Packer: Donald Driver 3 - Favorite Former Packer: Reggie White 4 - How long have you been a Packer backer: I bled Cheese at birth 5 - Anything else you'd like us to know: I'm obsessed with the NFL Draft. It's my favorite weekend of the year. I'm a TT fan. I can't stand Favre because he thinks he's bigger than the Packers. And NO player is bigger than this wonderful franchise. 02-25-2009, 04:10 PM hughest4 Quote: Originally Posted by TheDoug 1 - Location: Chattanooga, TN 2 - Favorite Current Packer: Donald Driver 3 - Favorite Former Packer: Reggie White 4 - How long have you been a Packer backer: I bled Cheese at birth 5 - Anything else you'd like us to know: I'm obsessed with the NFL Draft. It's my favorite weekend of the year. I'm a TT fan. I can't stand Favre because he thinks he's bigger than the Packers. And NO player is bigger than this wonderful franchise. Good to have you aboard, draft weekend is one of my favorite times as well. Stay active and stick around! 02-27-2009, 02:51 PM Urbs Quote: Originally Posted by hughest4 Good to have you aboard, draft weekend is one of my favorite times as well. Stay active and stick around! I also LOVE the draft! I will be at my 4th draft party in a row this year.. Does anyone else from here go?? 02-27-2009, 03:54 PM burtonfan 1 - Location: Carson City, NV 2 - Favorite Current Packer: AJ Hawk/Donald Driver 3 - Favorite Former Packer: Brett Favre/Leroy Butler/Reggie White 4 - How long have you been a Packer backer: 13 years, since i was 6 years old. 5 - Anything else you'd like us to know: I'm love the NFL Draft. its like christmas day on draft day for me. i am a huge fan of DEFENSE in general, because it wins championships. Brett Favre is one of my childhood heros, and still is. I dislike TT, but loves the way he can build a team. 02-27-2009, 04:00 PM MushroomX 1 - Location: Madison/Sun Prairie, Wisconsin 2 - Favorite Current Packer: Anyone who plays for the Green & Gold with pride. 3 - Favorite Former Packer: Anyone who plays for the Green & Gold with pride. 4 - How Long?: Ever since I understood what the NFL was. 5 - I am a big fan of Ted Thompson's work. 02-27-2009, 04:09 PM hughest4 Quote: Originally Posted by burtonfan 1 - Location: Carson City, NV 2 - Favorite Current Packer: AJ Hawk/Donald Driver 3 - Favorite Former Packer: Brett Favre/Leroy Butler/Reggie White 4 - How long have you been a Packer backer: 13 years, since i was 6 years old. 5 - Anything else you'd like us to know: I'm love the NFL Draft. its like christmas day on draft day for me. i am a huge fan of DEFENSE in general, because it wins championships. Brett Favre is one of my childhood heros, and still is. I dislike TT, but loves the way he can build a team. Quote: Originally Posted by MushroomX 1 - Location: Madison/Sun Prairie, Wisconsin 2 - Favorite Current Packer: Anyone who plays for the Green & Gold with pride. 3 - Favorite Former Packer: Anyone who plays for the Green & Gold with pride. 4 - How Long?: Ever since I understood what the NFL was. 5 - I am a big fan of Ted Thompson's work. Welcome guys, enjoy the Packers forum! Since this thread was made i think there have probably been at least 10 new people sign up! 1 - Location:Milwaukee Wisconsin 2 - Favorite Current Packer: CWood 3 - Favorite Former Packer: Ray Nitschke 4 - How Long?: 1966 5 - I've sacrificed more for the Packers than I did for either of my wives, both of whom I sacrificed for the Packers	Mid	[ 0.592427616926503, 33.25, 22.875 ]
[Effect of fructose-1,6-diphosphete on myocardial preservation during pulmonary operations]. To investigate the effect of fructose-1,6-diphosphete(FDP) on myocardial preservation in pulmonary operations. One hundred and six patients undergoing selective pulmonary lobectomy or segmentectomy were randomly divided into 2 groups with 53 patients each. FDP 200 mg/kg was infused intravenously before anesthesia in the FDP group, while 5% glucose with the same volume was given instead of FDP in the control group. ECGs were monitored from before the anesthesia to 72 h after the operation;the time and type of arrhythmia were recorded. Blood samples were taken before the operation (T0), immediately after the operation(T1), at 24 h(T2),48 h(T3)and 72 h(T(4)) after the operation to determine plasma creatine kinase isoenzyme MB(CK-MB) and cardiac troponin I(cTnI) concentrations. The incidence of arrhythmia in FDP group (35 times) was significantly lower than that in the control group(67 times). The incidence of all types of arrhythmia in the FDP group was also significantly lower than that in the control group. The concentrations of CK-MB and cTnI in the FDP group were significantly lower than those in the control group at T1, T2, T3, and T4. FDP is effective for myocardial preservation in pulmonary operations.	High	[ 0.680440771349862, 30.875, 14.5 ]
Shoeless Joe Jackson's great-great-grandnephew is a Minor Leaguer at Rangers Spring Training Joe Jackson was at the Rangers' Spring Training complex on Friday, and no, you did not somehow step into a time machine and travel back to the 1910s. It was Joe Jackson, the 24-year-old Minor Leaguer who, yes, is the great-great-grandnephew of Shoeless Joe Jackson: Shoeless Joe sighting....this is Joe Jackson....great great grand nephew of the Hall of Fame outfielder...in the Rangers farm system pic.twitter.com/l3UanmFSgI — TR Sullivan (@Sullivan_Ranger) February 24, 2017 Jackson was drafted by the Rangers in the fifth round of the 2013 Draft out of The Citadel, and he batted .269 with five homers with the Double-A Frisco Rough Riders in 2016. According to MLB.com's T.R. Sullivan, the Rangers' Jackson is proud of his famous baseball lineage and thinks his namesake should be in the National Baseball Hall of Fame. Although, in terms of sartorial choices, he has apparently decided not to follow in his great-great-granduncle's tradition: Those are definitely shoes.	Mid	[ 0.630669546436285, 36.5, 21.375 ]
Get breaking news alerts and special reports. The news and stories that matter, delivered weekday mornings. WASHINGTON — Speaker Paul Ryan said he doesn’t believe there is a need for Congress to pass any kind of legislation aimed at protecting special counsel Robert Mueller from termination. “I don't think it's necessary,” the Wisconsin Republican said during an interview that aired Sunday on NBC’s “Meet the Press” when specifically asked whether he would bring such a bill to the House floor if it passed the Senate. “I don't think he's going to fire Mueller.” “First of all, I don't think he should be fired,” Ryan reiterated. “I think he should be left to do his job, and I don't think they're really contemplating this. We’ve had plenty of conversations about this. It's not in the president's interest to do that. We have a rule of law system. No one is above that rule of law system.” Ryan’s comments came days after White House press secretary Sarah Huckabee Sanders said President Donald Trump believes it’s within his power to fire Mueller, the former FBI director who is leading the investigation into Russian attempts to interfere in American elections, among other matters. Lawmakers on both sides of the aisle have been adamant that the president should not remove the special counsel. Let our news meet your inbox. The news and stories that matters, delivered weekday mornings. This site is protected by recaptcha The New York Times first reported last week that Trump sought to fire Mueller as recently as December, and NBC News reported that the recent FBI raid on Trump’s personal lawyer Michael Cohen has upended talks for the president to sit down for an interview with Mueller’s team. Ryan's interview also came just as another former FBI director, James Comey, who Trump fired last May, embarks on a media tour to promote his new book, which asserts that Trump is “unethical” and “untethered to truth and institutional values.” Asked whether he believes Comey is a man of integrity, Ryan responded, “as far as I know,” but resisted answering further questions about him. “I've met him two or three times in two or three briefings,” Ryan said. “I don't really know the guy. I'm not trying to be evasive. But what I don't want to do is join some food fight, some book-selling food fight. I don't see any value in that.” Days after announcing his decision to leave Congress at the end of the year, Ryan had only gracious things to say about the president. “We have a good relationship,” he said. “We've gotten a lot done together.” Ryan said Trump was “disappointed” in his decision to leave elected office, “but he understood.” The speaker also rejected the notion that this era in political history could one day be looked back on as a victory of “Trumpism over Ryanism.” “I just don't see it like that,” Ryan said, pointing to progression on two of his priorities over the last year, tax legislation and military funding. But pressed on some policy differences between him and the president, like trade and the role of entitlement spending, Ryan noted “no two people are going to agree on everything.” “We have different styles,” he continued. “We have different ideas. But it's a big tent party. And we represent different corners of the tent.”	Low	[ 0.496993987975951, 31, 31.375 ]
Abstract This PEP proposes changing the syntax for declaring metaclasses, and alters the semantics for how classes with metaclasses are constructed. Rationale There are two rationales for this PEP, both of which are somewhat subtle. The primary reason for changing the way metaclasses work, is that there are a number of interesting use cases that require the metaclass to get involved earlier in the class construction process than is currently possible. Currently, the metaclass mechanism is essentially a post-processing step. With the advent of class decorators, much of these post-processing chores can be taken over by the decorator mechanism. In particular, there is an important body of use cases where it would be useful to preserve the order in which a class members are declared. Ordinary Python objects store their members in a dictionary, in which ordering is unimportant, and members are accessed strictly by name. However, Python is often used to interface with external systems in which the members are organized according to an implicit ordering. Examples include declaration of C structs; COM objects; Automatic translation of Python classes into IDL or database schemas, such as used in an ORM; and so on. In such cases, it would be useful for a Python programmer to specify such ordering directly using the declaration order of class members. Currently, such orderings must be specified explicitly, using some other mechanism (see the ctypes module for an example.) Unfortunately, the current method for declaring a metaclass does not allow for this, since the ordering information has already been lost by the time the metaclass comes into play. By allowing the metaclass to get involved in the class construction process earlier, the new system allows the ordering or other early artifacts of construction to be preserved and examined. There proposed metaclass mechanism also supports a number of other interesting use cases beyond preserving the ordering of declarations. One use case is to insert symbols into the namespace of the class body which are only valid during class construction. An example of this might be "field constructors", small functions that are used in the creation of class members. Another interesting possibility is supporting forward references, i.e. references to Python symbols that are declared further down in the class body. The other, weaker, rationale is purely cosmetic: The current method for specifying a metaclass is by assignment to the special variable __metaclass__, which is considered by some to be aesthetically less than ideal. Others disagree strongly with that opinion. This PEP will not address this issue, other than to note it, since aesthetic debates cannot be resolved via logical proofs. Specification In the new model, the syntax for specifying a metaclass is via a keyword argument in the list of base classes: class Foo(base1, base2, metaclass=mymeta): ... Additional keywords will also be allowed here, and will be passed to the metaclass, as in the following example: class Foo(base1, base2, metaclass=mymeta, private=True): ... Note that this PEP makes no attempt to define what these other keywords might be - that is up to metaclass implementors to determine. More generally, the parameter list passed to a class definition will now support all of the features of a function call, meaning that you can now use args and kwargs-style arguments in the class base list: class Foo(bases, *kwds): ... Invoking the Metaclass In the current metaclass system, the metaclass object can be any callable type. This does not change, however in order to fully exploit all of the new features the metaclass will need to have an extra attribute which is used during class pre-construction. This attribute is named __prepare__, which is invoked as a function before the evaluation of the class body. The __prepare__ function takes two positional arguments, and an arbitrary number of keyword arguments. The two positional arguments are: 'name' - the name of the class being created. 'bases' - the list of base classes. The interpreter always tests for the existence of __prepare__ before calling it; If it is not present, then a regular dictionary is used, as illustrated in the following Python snippet. def prepare_class(name, bases, metaclass=None, kwargs): if metaclass is None: metaclass = compute_default_metaclass(bases) prepare = getattr(metaclass, '__prepare__', None) if prepare is not None: return prepare(name, bases, kwargs) else: return dict() The example above illustrates how the arguments to 'class' are interpreted. The class name is the first argument, followed by an arbitrary length list of base classes. After the base classes, there may be one or more keyword arguments, one of which can be 'metaclass'. Note that the 'metaclass' argument is not included in kwargs, since it is filtered out by the normal parameter assignment algorithm. (Note also that 'metaclass' is a keyword- only argument as per PEP 3102 [6].) Even though __prepare__ is not required, the default metaclass ('type') implements it, for the convenience of subclasses calling it via super(). __prepare__ returns a dictionary-like object which is used to store the class member definitions during evaluation of the class body. In other words, the class body is evaluated as a function block (just like it is now), except that the local variables dictionary is replaced by the dictionary returned from __prepare__. This dictionary object can be a regular dictionary or a custom mapping type. This dictionary-like object is not required to support the full dictionary interface. A dictionary which supports a limited set of dictionary operations will restrict what kinds of actions can occur during evaluation of the class body. A minimal implementation might only support adding and retrieving values from the dictionary - most class bodies will do no more than that during evaluation. For some classes, it may be desirable to support deletion as well. Many metaclasses will need to make a copy of this dictionary afterwards, so iteration or other means for reading out the dictionary contents may also be useful. The __prepare__ method will most often be implemented as a class method rather than an instance method because it is called before the metaclass instance (i.e. the class itself) is created. Once the class body has finished evaluating, the metaclass will be called (as a callable) with the class dictionary, which is no different from the current metaclass mechanism. Typically, a metaclass will create a custom dictionary - either a subclass of dict, or a wrapper around it - that will contain additional properties that are set either before or during the evaluation of the class body. Then in the second phase, the metaclass can use these additional properties to further customize the class. An example would be a metaclass that uses information about the ordering of member declarations to create a C struct. The metaclass would provide a custom dictionary that simply keeps a record of the order of insertions. This does not need to be a full 'ordered dict' implementation, but rather just a Python list of (key,value) pairs that is appended to for each insertion. Note that in such a case, the metaclass would be required to deal with the possibility of duplicate keys, but in most cases that is trivial. The metaclass can use the first declaration, the last, combine them in some fashion, or simply throw an exception. It's up to the metaclass to decide how it wants to handle that case. Example: Here's a simple example of a metaclass which creates a list of the names of all class members, in the order that they were declared: # The custom dictionary class member_table(dict): def __init__(self): self.member_names = [] def __setitem__(self, key, value): # if the key is not already defined, add to the # list of keys. if key not in self: self.member_names.append(key) # Call superclass dict.__setitem__(self, key, value) # The metaclass class OrderedClass(type): # The prepare function @classmethod def __prepare__(metacls, name, bases): # No keywords in this case return member_table() # The metaclass invocation def __new__(cls, name, bases, classdict): # Note that we replace the classdict with a regular # dict before passing it to the superclass, so that we # don't continue to record member names after the class # has been created. result = type.__new__(cls, name, bases, dict(classdict)) result.member_names = classdict.member_names return result class MyClass(metaclass=OrderedClass): # method1 goes in array element 0 def method1(self): pass # method2 goes in array element 1 def method2(self): pass Sample Implementation: Alternate Proposals Josiah Carlson proposed using the name 'type' instead of 'metaclass', on the theory that what is really being specified is the type of the type. While this is technically correct, it is also confusing from the point of view of a programmer creating a new class. From the application programmer's point of view, the 'type' that they are interested in is the class that they are writing; the type of that type is the metaclass. There were some objections in the discussion to the 'two-phase' creation process, where the metaclass is invoked twice, once to create the class dictionary and once to 'finish' the class. Some people felt that these two phases should be completely separate, in that there ought to be separate syntax for specifying the custom dict as for specifying the metaclass. However, in most cases, the two will be intimately tied together, and the metaclass will most likely have an intimate knowledge of the internal details of the class dict. Requiring the programmer to insure that the correct dict type and the correct metaclass type are used together creates an additional and unneeded burden on the programmer. Another good suggestion was to simply use an ordered dict for all classes, and skip the whole 'custom dict' mechanism. This was based on the observation that most use cases for a custom dict were for the purposes of preserving order information. However, this idea has several drawbacks, first because it means that an ordered dict implementation would have to be added to the set of built-in types in Python, and second because it would impose a slight speed (and complexity) penalty on all class declarations. Later, several people came up with ideas for use cases for custom dictionaries other than preserving field orderings, so this idea was dropped. Backwards Compatibility It would be possible to leave the existing __metaclass__ syntax in place. Alternatively, it would not be too difficult to modify the syntax rules of the Py3K translation tool to convert from the old to the new syntax.	Mid	[ 0.6036866359447001, 32.75, 21.5 ]
On Tue, Jul 30, 2013 at 10:25:14AM -0500, Matthew Sherman wrote: > Ok folks, we have veered into nonconstructive territory. How about we > come back to the original question and help this person figure out > what they need to about Ruby and Python so they can do well with what > they want to work on. comparing languages on objective criterias (especially when they are as close as ruby and python) isn't constructive. but ok, let's try * both claim to be very easy to learn (ruby by having a very nice syntax, python by limitating the features from the syntax) * writing python code is very boring when you come from featured. langages like ruby or perl. nothing can be expressed a simple way. * ruby is slow ... i mean: even for a dynamic language. * both langages have libs for libraries for libraries but lack something as robust and usefull as CPAN (and related tools) * python has an equivalent of the perl PDL (scipy) * python has Natural Language Toolkit (equivalent in other langages ?) your basic goal \| your langage ------------------------------------- write/maintain faster \| perl reuse existing faster \| python learn faster \| ruby execute faster \| you're probably screwed. experiment lua, go, haskell, rust regards -- Marc Chantreux Université de Strasbourg, Direction Informatique 14 Rue René Descartes, 67084 STRASBOURG CEDEX ☎: 03.68.85.57.40 http://unistra.fr "Don't believe everything you read on the Internet" -- Abraham Lincoln	Low	[ 0.517021276595744, 30.375, 28.375 ]
Tucker Lowrance Tucker is the producer of The Rob Breaux Show and L&R Sports Talk. He grew up in Floydada, Texas and graduated high school from there. Tucker's done play by play of high school sports on the radio the past two years before joining SportsRadio 1340 The Fan. Constantly berated due to his love of the Patriots and Yankees. Feel free to air all of your grievances now.	Low	[ 0.481203007518796, 32, 34.5 ]
Hidden away in the bulging hills of the Sunol Valley, construction on the showpiece of San Francisco’s water delivery system overhaul is nearing completion. At the northernmost tip of the Calaveras Reservoir, a critical component of the vast Hetch Hetchy network that sends water to 2.7 million Bay Area residents, a brand-new, $810 million earthen dam is now 89 percent complete. While the new Calaveras Dam rests just 1,000 feet downstream from its 91-year-old predecessor, it’s being built to meet far more stringent seismic standards. That’s particularly important, considering that the new dam will sit just 1,500 feet from the Calaveras Fault, which is capable of producing a 7.25-magnitude earthquake and, with it, the potential to severely disrupt the entire region’s water supply. The new dam is being built to take such a quake in stride. “When it’s full, Calaveras Reservoir represents 40 percent of all of our local water storage capacity — in that one reservoir,” said San Francisco Public Utilities Commission spokeswoman Betsy Lauppe Rhodes. Should the region be suddenly cut off from its central source of water — the Hetch Hetchy Reservoir in Yosemite — or in times of drought, the local supply at Calaveras becomes even more critical, Lauppe Rhodes said. The new Calaveras Dam represents by far the largest component of the Water System Improvement Program, an $4.8 billion project the city agency began in 2002 to upgrade huge portions of its water delivery system. The agency is more than 90 percent of the way through the 83 projects that make up the improvement program, most of which are centered on strengthening the system better against earthquakes. The Hetch Hetchy system crosses three major faults as it moves water westward toward San Francisco and the Peninsula: the Calaveras, Hayward and San Andreas. Each aspect of the improvement program, Lauppe Rhodes said, was designed to ensure that in the event of a catastrophic earthquake, the PUC would still be able to provide what it calls “minimum-day demand” within 24 hours — roughly the amount of water needed during the winter, when demand is usually lower. “That’s water for drinking and firefighting and keeping everything going,” Lauppe Rhodes said. One-third of the program is being paid for through gradual increases in residential and commercial water rates. Those customers use about a third of the reservoir’s supply. The other two-thirds in revenue is coming from the PUC’s wholesale customers, like the Alameda County Water District and cities like Hayward and Milpitas. At the point where the new dam meets the Calaveras Reservoir, an inscription above a newly built water intake tower reads “Lympha Optima,” a rough Latin equivalent for “pure water.” Beneath the stately intake tower, adorned with Greek columns, a vertical shaft plunges more than 160 feet beneath the ground and is capable of drawing water from the reservoir at three different elevations. After five years of site preparation and excavation work, a mammoth undertaking in its own right that involved moving 7 million cubic yards of soil and rock — enough to fill two Levi’s Stadiums — PUC crews and contractors finally began building the dam upward in 2016. The dam grows a foot in height each day as heavy earthmovers roll over its foundation, flattening layer after layer of rock and sediment. The earthen materials are transported to the dam’s basin via a screeching, 3,000-foot conveyor belt that winds around the work site’s perimeter. By the dam’s anticipated completion in the spring of 2019, it will top out at 220 feet high. It’s about half that height now, said Susan Hou, a senior project manager at the PUC. Last year, workers also completed the dam’s 1,550-foot-long concrete spillway, which is as wide as an eight-lane highway. For nearly 16 years, state regulators have required the agency to keep water levels in the reservoir well below what it’s capable of holding. In 2001, the state’s Division of Safety of Dams ordered the PUC to reduce the amount of water in the reservoir by 60 percent, citing earthquake safety concerns related to the dam. Building the new dam will also allow the PUC to restore the Calaveras Reservoir to its full 31 billion-gallon capacity, greatly adding to the amount of local water the PUC can store. “Sixty percent is about 18 billion gallons,” Hou said. “That’s a lot of water.” The reservoir had to be lowered because, state regulators found, a 7.25-magnitude quake could cause the sides of the old dam to slump, unleashing a 30-foot-high torrent of water on Fremont. Hou said the old dam, which was built in the 1920s with mule-drawn carts, used now-outdated methods and poor materials that didn’t compact properly. “The construction method wasn’t strong enough for the size,” Hou said. “We were testing the limits of the time to build such a high dam with those types of materials.” Bringing the reservoir back up to pre-2001 levels means being able to store a far greater amount of water, further protecting the region from disruptions. “You need to have that storage readily available if a drought comes or if we have an event at Hetch Hetchy,” Hou said. “Then you have to go to your local source, and this is the largest one in our regional water system.” Richard Luthy, a professor of civil and environmental engineering at Stanford, said that in addition to hedging against the effects of a violent national disaster, increasing Calaveras Reservoir’s storage capacity will also be crucial for combating the effects of climate change. “The snowpack in the Sierra won’t be as big in the future because of climate change and warming,” Luthy said. “The way the snowpack worked is that it was water in storage.” But as temperatures rise and as the snowpack melts earlier in the year, Luthy said, the amount of time available to capture and store the runoff will continue to shrink. “That time gap is getting shortened. In terms of increased capacity, it gives you more flexibility to deal with climate change,” he said. Dominic Fracassa is a San Francisco Chronicle staff writer. Email: [email protected] Twitter: @dominicfracassa	Mid	[ 0.607305936073059, 33.25, 21.5 ]
Ep 65 - It's-a me, Gladio! w/ J. G. Michael In this special crossover of Antifada, Proletkult, History is a Weapon, and Parallax Views we take a dive into the "stay behind operations" after World War II designed to protect Western Europe from leftist victory at any cost--including coups, assassinations, and false flag terror plots. Conspiracy theory? Nope! PARAPOLITICS. Bibliography: Phillip Welan - Puppetmasters Marcelo Laraquy - Lopez Rega Pasolini - What is this coup d’état? I know https://overland.org.au/2012/03/what-is-this-coup-detat-i-know/ The Brothers: John Foster Dulles, Allen Dulles, and Their Secret World War by Stephen Kinzer The Devil's Chessboard: Allen Dulles, the CIA, and the Rise of America's Secret Government Dreamer of the Day: Francis Parker Yockey & The Postwar Fascist International by Kevin Coogan The Phoenix Program by Douglas Valentine The Ghost by Jefferson Morley In Danger: A Pasolini Reader, edited by Jack Hirschman The Black Terrorist International by Jeffrey M. Bale - https://www.economicsvoodoo.com/wp-content/uploads/DISSERTATION-The-Black-Terrorist-International-Neo-Fascist-Paramilitary-Networks-Strategy-of-Tension-in-Italy-1968-1974_Jeffrey-Bale.pdf Check out way more parapolitics at J.G. Michaels Parallax Views: https://parallaxviews.podbean.com/e/ep-65-alexander-stille/ https://www.patreon.com/parallaxviews/posts https://twitter.com/viewsparallax?lang=en	High	[ 0.6850998463901691, 27.875, 12.8125 ]
Design of an icebreaker Offshore Service Vessel (OSV) of 80-m in length might seems a fair step up from a 30-m harbour tugboat, but all in a day’s work for Robert Allan’s Vancouver-based versatile naval architects, who have just been awarded a contract for two new designs for such vessels to be built in Turkey for operation in the shallow, seasonally ice-bound waters of the Caspian Sea. TundRA 8000 OSV Preliminary Design: Image courtesy of Robert Allan Robert Allan Ltd. is an independent, privately owned firm of Consulting Naval Architects founded in 1930 when Robert Allan commenced private practice as a Consulting Naval Architect. Year on year, just like Topsy the business grew and grew until in 2008 the company was restructured to a culture of employee ownership with eleven of Robert Allan Ltd.'s core group of senior employees becoming shareholders in the firm. But a present generation Allan – Robert G. – grandson of the founder, remains Executive Chairman and... [More] A tugboat commissioned by a Japanese operator is the first to be fitted with a fully electronic control system uniquely installed on the rotor casing foundation of its Voith Schneider Propellor propulsion unit. An arrangement that not only saves space, but also simplifies maintenance and increases reliability.The new Voith Water Tractor (VWT) ‘Shinano’, designed for harbour assistance and escort duties, was constructed by Niigata Shipbuilding based in Niigata, Japan, for owner Dr. Nakamura, who operates his fleet of tugs in the port city of Iwaki. Voith Water Tractor ‘Shinano’: Photo credit Voith TurboVoith Electronic Control SystemThis first installation of a fully electronic control system in a VWT, now integrated into the propulsion system, offers actuation and control of the propulsion systems, remote diagnostics via the Internet and communication through an embedded CAN networks. (The CAN bus – Controller Area Network – is designed to allow mic... [More] Damen Shipyards, headquartered in The Netherlands, has just secured an order for no less than fourteen ship-handling tugboats from the Kuwait Oil Company (KOC) nine of them to their latest ASD TUG 3212 design, and five to their better-known 2810 design. The new 3212 tugs, designed to push, pull and tow, will be assisting tankers at nearshore loading terminals and will also be equipped with a powerful fire-fighting system for station at the new single point moorings further offshore Kuwait.These vessels, due for delivery from Damen Shipyards Galati in Romania in 2014, have been tailored to meet KOC’s requirements, but the design features of Damen’s standard version of the optimised model 3212, with its stronger 80 ton bollard pull are the focus here. Damen Shipyards ASD TUG 3212:Image courtesy Damen Shipyards New Hull FormAt 32.70m in length overall, 12.82m beam, a draft aft of 5.6m and a displacement of approximately 800 tons the ASD Tug 3212 has a completely revised hull... [More] North Sea emergency response tugboat Nordic has a remarkable ability to move in close to an oil tanker or a liquid natural gas carrier leaking toxic and flammable gas in order to fight any fire and take the stricken vessel in tow. Nordic has been strategically stationed by the German authorities on the North Sea coast, ready, willing and able to cope with that sort of eventuality since early 2011.In an environment heavily contaminated with gas the crew would be encapsulated safely in the tugboat’s air-sealed superstructure stronghold to breathe from an eight-hour supply of oxygen; all the while, ingeniously gas-protected MTU (Tognum subsidiary MTU Friedrichshafen) diesel engines would continue to pound away down below decks. North Sea Rescue Tugboat Nordic: Photo credit – Pedwiki Gas-protected MTU Diesel EnginesNordic’s main propulsion engines are two specially equipped 20-cylinder MTU Series 8000 diesel engines rated at 17,200 kW, while two MTU type... [More]	Mid	[ 0.602122015915119, 28.375, 18.75 ]
Q: Single Access Point vs. Multiple Access Points Vague Question: If one access point can do the job adequately is there still an advantage to using more than one? Scenario: 1 access point at the center of your network required coverage area should adequately cover the area. There will always be less than 50 wireless clients and 0 wired clients. Most of the clients will move throughout the required coverage area while in use and some would like to go just beyond the perimeter; but don't have to. A gigabit backbone is available for access points to be placed anywhere. There are neighboring wifi networks, but only horizontally. Specific Question: In this scenario is there an advantage to using multiple (say 2 ~ 4) access points and placing them near the perimeter of your required coverage area? My 2 Hypotheses: Hypothesis 1: With 1 access point at the center of the required coverage area broadcasting on dual bands with 1 channel each it will be easier to find clear channels. Clients will not have to migrate from access point to access point as they move throughout the covered area; possibly dropping the connection momentarily, or just failing to migrate at all. By maintaing a smaller perimeter there is less chance of interference from other neighboring wifi networks and equipment operating in the same band. Hypothesis 2: With multiple access points near the perimeter of the coverage area more channels should be used; 1 channel for each access point (or should 1 be used for all since it is the same network?) possibly limiting it to 3 non-overlapping channels and 3 access points. Clients may migrate well from access point to access point while moving. They can leave the required perimeter somewhat. Everyone has a stronger signal, a lower chance of dropped packets, etc. Interference may be a bigger problem, especially with neighboring wifi networks. NOTES: They will all have the same SSID and WPA2 Passphrase, SSID will be hidden and MAC filtering will be used, 802.11n or 802.11ac will be used. I have a clear understanding of networking and I'm not asking how to do this. I'm asking which is better based on scientific evidence. I don't have the budget to a-b test this. Maybe this is really a question of how well will the clients migrate on their own, or maybe it it's more than that. A: In the scenario you describe, you should definitely be looking at multiple access points, preferrably dual band APs. While coverage may be sufficient, coverage alone is no longer the primary consideration when deploying a wirelss network. Client capacity, channel utilization, signal quality, and reliability are much more important and multiple access points will help with all of these. By using 3 (or more) APs on multiple channels (1, 6, and 11), you will in effect triple the amount of airtime (bandwidth) available on your wireless network. Additionally, proper placement of the APs will provide clients a closer AP with stronger signal, which will be more resistant to noise in the RF environment. This will allow better signal-to-noise (SNR) ratios which will translate to the use of higher data rates and this results in more data transmitted per "timeslot". I would recommend placing them 2/3 to 3/4 of the way from the center to the perimeter, spaced roughly evenly. Try to get them in or as close to the highest user denisity locations as possible (i.e. conference rooms, etc). Finally, the additional access points will provide increased reliability. With a single access point, if it were to fail or reboot for any reason, this would create a disruption in service. Having multiple access points should allow for coverage to overlap, allowing service to remain (if degraded) when you have an access point down.	High	[ 0.6693440428380181, 31.25, 15.4375 ]
Q: hyperref option pdfusetitle with thanks What is the cleanest way to set the title in the document and in the PDF metadata (while not repeating myself) when also using \thanks? This solution produces an incorrect Title metadata, that includes the content of the \thanks (or warnings from hyperref: “Token not allowed in a PDF string” when not using \maketitle). \documentclass{article} \usepackage[pdfusetitle]{hyperref} \begin{document} \title{The title\thanks{Thanks}} \maketitle Hello. \end{document} Therefore I have considered the following “solution” (rather a workaround, I’d say). \documentclass{article} \usepackage{hyperref} \begin{document} \newcommand{\mytitle}{The title} \title{\mytitle\thanks{Thanks}} \hypersetup{pdftitle=\mytitle} \maketitle Hello. \end{document} But this clutters my document and is not elegant, especially because I can’t hide it in a preamble. Is it possible instead, and would it be cleaner, to patch the way pdfusetitle works? Or is there perhaps some other workaround? A: hyperref defines the command \pdfstringdefDisableCommands that can be used to redefine certain problematic commands for use in pdfstrings. With \pdfstringdefDisableCommands{% \let\thanks\@gobble } you can completely remove/ignore \thanks in pdfstrings. With \pdfstringdefDisableCommands{% \def\thanks#1{ (#1)}% } you would add the argument of \thanks in parentheses. See also \texorpdfstring for a full book and Fragile error on robust command using relsize. \documentclass{article} \usepackage[pdfusetitle]{hyperref} \pdfstringdefDisableCommands{% \let\thanks\@gobble } \begin{document} \title{The title\thanks{Thanks}} \maketitle Hello. \end{document} Note how it is not necessary to enclose the code in \makeatletter...\makeatother as usually required when working with macros with @ in their name (cf. What do \makeatletter and \makeatother do?). \pdfstringdefDisableCommands applies some trickery to avoid the explicit catcode changes, but that trick does not work when \pdfstringdefDisableCommands is used as argument of another command, in that case you must wrap everything into \makeatletter...\makeatother, e.g. \newtoggle{LCpres} \togglefalse{LCpres} \makeatletter \iftoggle{LCpres} {\usepackage{hyperref}} {\usepackage[hypertexnames=false, pdfusetitle]{hyperref} \pdfstringdefDisableCommands{\let\thanks\@gobble}} \makeatother For more complicated constructions there is \texorpdfstring, which could be used as \texorpdfstring{The title\thanks{Thanks}}{The title} with repetitions. For different use cases something like Redefine \title for possibility of a forced line breaking in a predefined place might also be possible.	High	[ 0.6567607726597321, 27.625, 14.4375 ]
Angiotensin peptides regulate angiogenic activity in rat anterior pituitary tumour cell cultures. Angiogenesis has been shown to be necessary for the development and progression of solid tumours. VEGF is one of the crucial pro-angiogenic cytokines produced by the cells of many of the tumours examined, including various types of anterior pituitary adenomas. Angiotensin II (Ang II) is known to regulate the expression of VEGF in a variety of tissues both in the physiological and pathological conditions. Moreover, an association of the renin-angiotensin system (RAS) with oestrogen-induced vascular changes during the development of rat pituitary PRL-secreting adenoma has already been demonstrated. The aim of the study was to determine the in vitro effects of angiotensin peptides (Ang II, Ang III and Ang IV) on the secretion of VEGF in two anterior pituitary adenoma cell cultures: the culture of the rat pituitary lactosomatotrope tumour cell line (GH3) and the primary culture of rat PRL-secreting tumour induced by diethylstilbestrol (DES). GH3 and prolactinoma cells were cultured in an F10 and an F-12 medium respectively and then placed into 24 multiwell plates (10(5) of GH3 cells/well and 10(6) of rat prolactinoma cells/well). After 12 hours of preincubation the cells underwent 24-hour treatment with Ang II, Ang III or Ang IV at final concentrations of 10(-12), 10(-10), 10(-8) or 10(-6)M and, in the case of the GH3 cells, combined treatment with Ang II (10(-10)M) and specific AT1 or AT2 receptor antagonist (losartan or PD123319 respectively at a concentration of 10(-8) or 10(-7) M). The concentration of VEGF in the supernatant collected was determined using specific ELISA assay kits. Statistical evaluation was performed using Student's test and analysis of variance (ANOVA). Differences were considered significant if p < 0.05. The incubation of both GH3 cells and rat adenoma cells with Ang II, Ang III or Ang IV at concentrations of 10(-12) -10(-8)M resulted in a significant increase in VEGF concentration in the culture medium. Exposure of GH3 cells to Ang III or Ang IV at concentrations of 10(-6)M led to a significant inhibition of cytokine release, and Pearson's correlation curve showed a tendency for Ang II at concentrations of more than 10(-6)M to inhibit VEGF secretion in primary prolactinoma cell culture. The stimulatory influence of Ang II on VEGF secretion in GH3 cell culture was negated by losartan or by PD123319 in both concentrations tested. Ang II, Ang III and Ang IV affect the secretion of VEGF in cultures of the rat lactosomatotrope GH3 cell line and primary rat prolactinoma cells. Both AT1 and AT2 receptors mediate the stimulatory action of Ang II on the cytokine release in GH3 cell culture. The mechanism of the observed anti-angiogenic effects of angiotensin peptides remains unexplained.	High	[ 0.6617283950617281, 33.5, 17.125 ]
STARTFONT 2.1 COMMENT Copyright (C) 1990-1991 EWT Consulting COMMENT Portions Copyright (C) 1994-1995 Cronyx Ltd. COMMENT Changes Copyright (C) 1996-1997 by Andrey A. Chernov, Moscow, Russia. COMMENT Modified by Serge Vakulenko, <[email protected]> COMMENT Changes 1999 by Serge Winitzki. COMMENT This software may be used, modified, copied, distributed, and sold, COMMENT in both source and binary form provided that the copyright COMMENT and these terms are retained. Under no circumstances is the author COMMENT responsible for the proper functioning of this software, nor does COMMENT the author assume any responsibility for damages incurred with its use. COMMENT $XFree86$ FONT -Cronyx-Helvetica-Medium-O-Normal--34-240-100-100-P-130-KOI8-R SIZE 24 96 96 FONTBOUNDINGBOX 39 33 -2 -7 STARTPROPERTIES 21 DEFAULT_CHAR 32 FONT_ASCENT 29 FONT_DESCENT 8 SPACING "P" FONTNAME_REGISTRY "" FOUNDRY "Cronyx" FAMILY_NAME "Helvetica" WEIGHT_NAME "Medium" SLANT "O" SETWIDTH_NAME "Normal" ADD_STYLE_NAME "" AVERAGE_WIDTH 130 CHARSET_REGISTRY "KOI8" CHARSET_ENCODING "R" PIXEL_SIZE 34 POINT_SIZE 240 RESOLUTION_X 100 RESOLUTION_Y 100 COPYRIGHT "Copyright (C) 1990, 1991 EWT Consulting, Portions Copyright (C) 1994 Cronyx Ltd., Portions Copyright (C) 1996-1997 by Andrey A. Chernov, Moscow, Russia." _XMBDFED_INFO "Edited with xmbdfed 3.8." _XFREE86_GLYPH_RANGES "32_126 149 154 156_158 163 179 191_255" ENDPROPERTIES CHARS 167 STARTCHAR space ENCODING 32 SWIDTH 281 0 DWIDTH 9 0 BBX 0 0 -1 0 BITMAP ENDCHAR STARTCHAR exclam ENCODING 33 SWIDTH 281 0 DWIDTH 9 0 BBX 8 23 2 0 BITMAP 07 07 07 07 0E 0E 0E 0E 1C 1C 1C 1C 38 38 10 10 20 00 00 00 E0 E0 E0 ENDCHAR STARTCHAR quotedbl ENCODING 34 SWIDTH 343 0 DWIDTH 11 0 BBX 11 8 3 15 BITMAP 38E0 71C0 71C0 71C0 71C0 4100 4100 4100 ENDCHAR STARTCHAR numbersign ENCODING 35 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 001860 001860 001860 001860 0071C0 006180 07FFF0 07FFF0 00C300 01C700 018600 018600 030C00 071C00 061800 3FFF80 7FFF00 0C3000 1C7000 186000 30C000 30C000 30C000 ENDCHAR STARTCHAR dollar ENCODING 36 SWIDTH 562 0 DWIDTH 18 0 BBX 23 28 0 -3 BITMAP 000300 000600 001F80 007FE0 00F6F0 01CCE0 038C70 038C70 038C00 039800 03D800 01F800 00FE00 007F00 003F80 0033C0 0031C0 0061C0 3861C0 3861C0 3861C0 38C700 3CCF00 1FFE00 07F800 018000 018000 018000 ENDCHAR STARTCHAR percent ENCODING 37 SWIDTH 875 0 DWIDTH 28 0 BBX 29 23 1 0 BITMAP 00F00700 03FC0600 030C0E00 06060C00 0C0C3800 0C0C3000 0C0C7000 06186000 0FF1C000 03C18000 00038000 00030000 000E0000 000C1E00 001C7F80 00186180 00718180 00618180 00E18180 00C18180 03818600 0301FE00 07007800 ENDCHAR STARTCHAR ampersand ENCODING 38 SWIDTH 687 0 DWIDTH 22 0 BBX 25 23 1 0 BITMAP 00180000 007E0000 00FF0000 00E70000 03870000 03870000 03870000 01CE0000 03FC0000 01F80000 03F00000 07F80000 1E78E000 1C3CE000 3C1FC000 380FC000 700F0000 70070000 780F8000 3C1FC000 7FFBC000 3FF1E000 0FC0F000 ENDCHAR STARTCHAR quotesingle ENCODING 39 SWIDTH 218 0 DWIDTH 7 0 BBX 5 8 4 15 BITMAP 38 70 70 70 70 40 40 40 ENDCHAR STARTCHAR parenleft ENCODING 40 SWIDTH 343 0 DWIDTH 11 0 BBX 14 30 1 -7 BITMAP 000C 001C 0038 00E0 00E0 01C0 01C0 0380 0700 0700 0700 0E00 0E00 0E00 0E00 1C00 1C00 1C00 1C00 3800 3800 3800 1C00 3800 3800 1C00 1C00 1C00 0E00 0600 ENDCHAR STARTCHAR parenright ENCODING 41 SWIDTH 343 0 DWIDTH 11 0 BBX 14 30 -1 -7 BITMAP 0180 01C0 00E0 00E0 00E0 0070 0070 00E0 0070 0070 0070 00E0 00E0 00E0 00E0 01C0 01C0 01C0 01C0 0380 0380 0380 0700 0E00 0E00 1C00 1C00 7000 E000 C000 ENDCHAR STARTCHAR asterisk ENCODING 42 SWIDTH 375 0 DWIDTH 12 0 BBX 12 9 3 14 BITMAP 0300 0300 36C0 7FE0 1F80 0F00 3F00 7380 2100 ENDCHAR STARTCHAR plus ENCODING 43 SWIDTH 593 0 DWIDTH 19 0 BBX 21 19 1 2 BITMAP 001C00 001C00 001C00 001C00 003800 003800 003800 003800 3FFFE0 3FFFE0 3FFFE0 007000 00E000 00E000 00E000 00E000 01C000 01C000 01C000 ENDCHAR STARTCHAR comma ENCODING 44 SWIDTH 281 0 DWIDTH 9 0 BBX 4 6 2 -3 BITMAP 70 70 70 20 40 80 ENDCHAR STARTCHAR hyphen ENCODING 45 SWIDTH 312 0 DWIDTH 10 0 BBX 8 2 1 6 BITMAP FF FF ENDCHAR STARTCHAR period ENCODING 46 SWIDTH 281 0 DWIDTH 9 0 BBX 3 3 2 0 BITMAP E0 E0 E0 ENDCHAR STARTCHAR slash ENCODING 47 SWIDTH 281 0 DWIDTH 9 0 BBX 14 23 -1 0 BITMAP 001C 001C 001C 0038 0070 0070 00E0 00E0 01C0 0380 0380 0380 0700 0E00 0E00 0E00 3800 3800 3800 3800 E000 E000 E000 ENDCHAR STARTCHAR zero ENCODING 48 SWIDTH 562 0 DWIDTH 18 0 BBX 19 23 1 0 BITMAP 003C00 00FF00 01FF80 03C3C0 070380 0F03C0 0E01C0 0E01C0 1C0380 1C0380 1C0380 1C0380 380700 380700 380700 380700 700E00 781E00 381C00 3C3C00 3FF000 1FE000 078000 ENDCHAR STARTCHAR one ENCODING 49 SWIDTH 500 0 DWIDTH 16 0 BBX 11 23 3 0 BITMAP 0060 0060 00E0 01E0 0FC0 0FC0 0FC0 01C0 0380 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 1C00 1C00 1C00 ENDCHAR STARTCHAR two ENCODING 50 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 001E00 007F80 00FFC0 01E1E0 0381C0 0700E0 0700E0 0000E0 0001C0 000380 000780 001F00 00FC00 01F000 03C000 078000 1E0000 1C0000 380000 380000 FFFF00 FFFF00 FFFF00 ENDCHAR STARTCHAR three ENCODING 51 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 001E00 007F80 00FFC0 01E1E0 0381C0 0700E0 0700E0 0000E0 000380 003F80 003F00 003F80 000780 000380 0001C0 0001C0 700380 700380 380700 3C0F00 3FFC00 1FF800 07E000 ENDCHAR STARTCHAR four ENCODING 52 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 0003C0 0007C0 0007C0 000FC0 003F80 003B80 007B80 00F380 01C700 03C700 078700 070700 1E0E00 1C0E00 3C0E00 3FFFC0 7FFF80 7FFF80 001C00 001C00 003800 003800 003800 ENDCHAR STARTCHAR five ENCODING 53 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 00FFF0 00FFF0 00FFF0 00E000 038000 038000 038000 03BF00 0FFF80 0FFFC0 0F03C0 0E01E0 0001C0 0001C0 0001C0 0001C0 700380 700380 380700 3C0F00 3FFC00 1FF800 07E000 ENDCHAR STARTCHAR six ENCODING 54 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 1 0 BITMAP 003E00 00FF80 01FFC0 03E3C0 0701C0 0F01C0 0E0000 0E0000 1C7800 1DFE00 1FFF00 1F8F80 3C0700 3C0780 380380 380380 700700 780F00 380E00 3E3E00 3FF800 1FF000 07C000 ENDCHAR STARTCHAR seven ENCODING 55 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 07FFF8 07FFF8 07FFF8 000078 0001E0 0003C0 000380 000780 000E00 001E00 001C00 003C00 007000 007000 00F000 00E000 01C000 03C000 038000 038000 070000 070000 070000 ENDCHAR STARTCHAR eight ENCODING 56 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 001E00 007F80 00FFC0 01E1E0 0381C0 0700E0 0700E0 0700E0 070380 07FF80 03FF00 07FF80 1E0780 1C0380 3801C0 3801C0 700380 700380 380700 3C0F00 3FFC00 1FF800 07E000 ENDCHAR STARTCHAR nine ENCODING 57 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 0 0 BITMAP 003E00 00FF80 01FFC0 03E3E0 0701C0 0F01E0 0E00E0 0E00E0 1C01C0 1E03C0 0E03C0 0F8FC0 0FFF80 07FB80 01E380 000380 000700 380F00 380E00 1E3E00 3FF800 1FF000 07C000 ENDCHAR STARTCHAR colon ENCODING 58 SWIDTH 281 0 DWIDTH 9 0 BBX 7 16 2 0 BITMAP 0E 1C 1C 00 00 00 00 00 00 00 00 00 00 E0 E0 E0 ENDCHAR STARTCHAR semicolon ENCODING 59 SWIDTH 281 0 DWIDTH 9 0 BBX 7 19 2 -3 BITMAP 0E 0E 0E 00 00 00 00 00 00 00 00 00 00 70 70 70 20 40 80 ENDCHAR STARTCHAR less ENCODING 60 SWIDTH 593 0 DWIDTH 19 0 BBX 20 16 1 3 BITMAP 000030 0001E0 0007E0 001F80 007E00 03F000 0FC000 3F0000 3F0000 1F8000 07E000 01F800 007E00 003F00 000F00 000300 ENDCHAR STARTCHAR equal ENCODING 61 SWIDTH 593 0 DWIDTH 19 0 BBX 19 9 1 7 BITMAP 3FFFE0 3FFFE0 7FFFC0 000000 000000 000000 FFFF80 FFFF80 FFFF80 ENDCHAR STARTCHAR greater ENCODING 62 SWIDTH 593 0 DWIDTH 19 0 BBX 20 16 2 3 BITMAP 0C0000 1E0000 1F8000 07E000 01F800 00FC00 003F00 000FC0 000FC0 007E00 01F800 07E000 1F8000 FC0000 F00000 C00000 ENDCHAR STARTCHAR question ENCODING 63 SWIDTH 531 0 DWIDTH 17 0 BBX 20 23 0 0 BITMAP 003E00 00FF80 01FFC0 03C1E0 0701C0 0E00E0 0E00E0 0000E0 0001C0 000380 000780 000F00 003C00 007800 007000 00E000 01C000 000000 000000 000000 038000 038000 038000 ENDCHAR STARTCHAR at ENCODING 64 SWIDTH 937 0 DWIDTH 30 0 BBX 34 26 0 -3 BITMAP 00007F0000 0003FFE000 000F80F800 0038003800 0070001C00 00E0000E00 01C03C0600 0301FD8600 0603878600 0606030300 0606030300 1818060600 18180C0600 18300C0600 18300C0C00 3060301800 1860703000 1830F87000 181FDFE000 181F1F0000 1C00000000 0E00000000 0780000000 07C0380000 01FFF00000 003FC00000 ENDCHAR STARTCHAR A ENCODING 65 SWIDTH 687 0 DWIDTH 22 0 BBX 26 23 0 0 BITMAP 0007C000 0007C000 000FE000 000FE000 001DC000 003DE000 0038E000 0038E000 00F1E000 00E0E000 01E0F000 01C07000 0380E000 0780F000 07007000 07FFF000 1FFFF000 1FFFF000 3C007800 38003800 70007000 F0007800 E0003800 ENDCHAR STARTCHAR B ENCODING 66 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FF80 07FFE0 07FFF0 070070 0E0070 0E0070 0E0070 0E0070 1C01C0 1FFFC0 1FFF80 1FFFC0 3803C0 3801C0 3800E0 3800E0 7001C0 7001C0 7003C0 700780 FFFF00 FFFE00 FFF800 ENDCHAR STARTCHAR C ENCODING 67 SWIDTH 718 0 DWIDTH 23 0 BBX 26 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000000 1C000000 1C000000 1C000000 38000000 38000000 38000000 1C000E00 38001C00 3C003C00 1E007800 0F81F000 0FFFC000 07FF8000 00FC0000 ENDCHAR STARTCHAR D ENCODING 68 SWIDTH 718 0 DWIDTH 23 0 BBX 24 23 2 0 BITMAP 07FF00 07FFE0 07FFF0 0700F8 0E0078 0E003C 0E001C 0E001C 1C001C 1C001C 1C001C 1C001C 380038 380038 380038 380070 7000E0 7001E0 7003C0 700F80 FFFE00 FFFC00 FFE000 ENDCHAR STARTCHAR E ENCODING 69 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFFC 07FFFC 07FFFC 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1FFFC0 1FFFC0 1FFFC0 380000 380000 380000 380000 700000 700000 700000 700000 FFFF80 FFFF80 FFFF80 ENDCHAR STARTCHAR F ENCODING 70 SWIDTH 625 0 DWIDTH 20 0 BBX 22 23 2 0 BITMAP 07FFFC 07FFFC 07FFFC 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1FFF80 1FFF80 1FFF80 380000 380000 380000 380000 700000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR G ENCODING 71 SWIDTH 781 0 DWIDTH 25 0 BBX 26 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000000 1C000000 1C000000 1C01FF00 3803FE00 3803FE00 38000E00 1C000E00 38003C00 3C003C00 1E007C00 0F81FC00 0FFFB800 07FF3800 00FC3800 ENDCHAR STARTCHAR H ENCODING 72 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 07000E 07000E 07000E 07000E 0E001C 0E001C 0E001C 0E001C 1C0038 1FFFF8 1FFFF8 1FFFF8 380070 380070 380070 380070 7000E0 7000E0 7000E0 7000E0 E001C0 E001C0 E001C0 ENDCHAR STARTCHAR I ENCODING 73 SWIDTH 250 0 DWIDTH 8 0 BBX 8 23 2 0 BITMAP 07 07 07 07 0E 0E 0E 0E 1C 1C 1C 1C 38 38 38 38 70 70 70 70 E0 E0 E0 ENDCHAR STARTCHAR J ENCODING 74 SWIDTH 500 0 DWIDTH 16 0 BBX 18 23 0 0 BITMAP 0001C0 0001C0 0001C0 0001C0 000380 000380 000380 000380 000700 000700 000700 000700 000E00 000E00 380E00 380E00 701C00 701C00 783C00 3C7800 7FF000 3FE000 0F8000 ENDCHAR STARTCHAR K ENCODING 75 SWIDTH 656 0 DWIDTH 21 0 BBX 24 23 1 0 BITMAP 07003C 070078 0700F0 0701E0 0E0780 0E0F00 0E1E00 0E3C00 1CF000 1DE000 1FE000 1FF000 3EF000 3C7800 383C00 381E00 701E00 700F00 700780 7003C0 E003C0 E001E0 E000E0 ENDCHAR STARTCHAR L ENCODING 76 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 2 0 BITMAP 070000 070000 070000 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1C0000 1C0000 1C0000 380000 380000 380000 380000 700000 700000 700000 700000 FFFE00 FFFE00 FFFE00 ENDCHAR STARTCHAR M ENCODING 77 SWIDTH 812 0 DWIDTH 26 0 BBX 26 23 2 0 BITMAP 078003C0 07C007C0 07C007C0 07C007C0 0FC01F80 0FC01F80 0FC01F80 0FE03F80 1DC07700 1DC07700 1DE0F700 1CE0E700 39C1CE00 39E3CE00 38E38E00 38E38E00 71EF1C00 70EE1C00 70EE1C00 70FE1C00 E0F83800 E0F83800 E0F83800 ENDCHAR STARTCHAR N ENCODING 78 SWIDTH 750 0 DWIDTH 24 0 BBX 24 23 2 0 BITMAP 078007 07C007 07C007 07E007 0FE00E 0EE00E 0EF00E 0E780E 1C701C 1C781C 1C3C1C 1C1C1C 383C38 381E38 380E38 380F38 700F70 700770 7007F0 7003F0 E003E0 E003E0 E001E0 ENDCHAR STARTCHAR O ENCODING 79 SWIDTH 781 0 DWIDTH 25 0 BBX 27 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000380 1C000380 1C000380 1C000380 38000700 38000700 38000700 1C000E00 38001C00 3C003C00 1E007800 0F81F000 0FFFC000 07FF8000 00FC0000 ENDCHAR STARTCHAR P ENCODING 80 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFC0 07FFF0 07FFF8 070078 0E0078 0E0038 0E0038 0E0038 1C0070 1C00F0 1C01E0 1FFFE0 3FFF80 3FFE00 380000 380000 700000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR Q ENCODING 81 SWIDTH 781 0 DWIDTH 25 0 BBX 27 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000380 1C000380 1C000380 1C000380 38000700 38000700 3800C700 1C01EE00 3801FC00 3C00FC00 1E007800 0F81FC00 0FFFFC00 07FF9C00 00FC0800 ENDCHAR STARTCHAR R ENCODING 82 SWIDTH 687 0 DWIDTH 22 0 BBX 23 23 2 0 BITMAP 07FFC0 07FFF0 07FFF8 070038 0E0038 0E0038 0E0038 0E0038 1C00F0 1C01E0 1FFFE0 1FFFC0 3FFFC0 3803C0 3801E0 3800E0 7001C0 7001C0 7001C0 7001C0 E00380 E003C0 E001C0 ENDCHAR STARTCHAR S ENCODING 83 SWIDTH 656 0 DWIDTH 21 0 BBX 24 23 0 0 BITMAP 003FE0 00FFF8 01FFFC 01E03C 07803C 07001C 070000 078000 078000 07F800 03FFC0 00FFF0 001FF0 0000F0 000078 000038 700070 780070 3800F0 3E01E0 3FFFC0 1FFF80 07FE00 ENDCHAR STARTCHAR T ENCODING 84 SWIDTH 625 0 DWIDTH 20 0 BBX 24 23 0 0 BITMAP 07FFFF 07FFFF 07FFFF 000700 000E00 000E00 000E00 000E00 001C00 001C00 001C00 001C00 003800 003800 003800 003800 007000 007000 007000 007000 00E000 00E000 00E000 ENDCHAR STARTCHAR U ENCODING 85 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 07000E 07000E 07000E 07000E 0E001C 0E001C 0E001C 0E001C 1C0038 1C0038 1C0038 1C0038 380070 380070 380070 380070 7000E0 7801E0 3801C0 3E07C0 3FFF00 1FFE00 07F800 ENDCHAR STARTCHAR V ENCODING 86 SWIDTH 687 0 DWIDTH 22 0 BBX 26 23 0 0 BITMAP 070001C0 078003C0 03800380 03800380 07800F00 03800E00 03C01E00 01C01C00 03803800 03C07800 01C07000 01C07000 03C1E000 01C1C000 01E3C000 00E38000 01C70000 01EF0000 00EE0000 00FE0000 01FC0000 00F80000 00F80000 ENDCHAR STARTCHAR W ENCODING 87 SWIDTH 968 0 DWIDTH 31 0 BBX 35 23 0 0 BITMAP 07003C00E0 07003C00E0 07003C00E0 07807E01E0 0700FC0380 0700FC0380 0781FE0780 0381CE0700 07039C0E00 07879E1E00 03870E1C00 03870E1C00 079E1E7800 039C0E7000 039C0E7000 03FC0FF000 03F00FC000 03F00FC000 03F00FC000 01E0078000 03C00F0000 03C00F0000 03C00F0000 ENDCHAR STARTCHAR X ENCODING 88 SWIDTH 656 0 DWIDTH 21 0 BBX 25 23 0 0 BITMAP 03800700 03C00F00 01C00E00 01E01E00 01E07800 00F0F000 0070E000 0079E000 007F8000 003F0000 001E0000 001E0000 007E0000 00FF0000 00E70000 01E78000 07878000 0F03C000 0E01C000 1E01E000 7801E000 F000F000 E0007000 ENDCHAR STARTCHAR Y ENCODING 89 SWIDTH 687 0 DWIDTH 22 0 BBX 26 23 0 0 BITMAP 070001C0 078003C0 03C00780 01E00F00 01C01C00 01E03C00 00F07800 0078F000 0071C000 007BC000 003F8000 001F0000 001C0000 001C0000 001C0000 001C0000 00380000 00380000 00380000 00380000 00700000 00700000 00700000 ENDCHAR STARTCHAR Z ENCODING 90 SWIDTH 625 0 DWIDTH 20 0 BBX 24 23 0 0 BITMAP 03FFFE 03FFFE 03FFFE 00001E 000078 0000F0 0001E0 0003C0 000F00 000E00 001E00 003C00 00F000 01E000 01C000 03C000 0F0000 1E0000 3C0000 780000 FFFFE0 FFFFE0 FFFFE0 ENDCHAR STARTCHAR bracketleft ENCODING 91 SWIDTH 281 0 DWIDTH 9 0 BBX 13 30 0 -7 BITMAP 01F8 01F8 01F8 0380 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 1C00 1C00 1C00 1C00 3800 3800 3800 3800 7000 7000 7000 7000 FC00 FC00 FC00 ENDCHAR STARTCHAR backslash ENCODING 92 SWIDTH 281 0 DWIDTH 9 0 BBX 14 23 -1 0 BITMAP 0700 0700 0700 0380 0700 0700 0700 0380 0700 0700 0380 0380 0700 0700 0380 0380 0700 0380 0380 0380 0380 0380 0380 ENDCHAR STARTCHAR bracketright ENCODING 93 SWIDTH 281 0 DWIDTH 9 0 BBX 13 30 -1 -7 BITMAP 01F8 01F8 01F8 0070 0070 0070 0070 00E0 00E0 00E0 00E0 01C0 01C0 01C0 01C0 0380 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 FC00 FC00 FC00 ENDCHAR STARTCHAR asciicircum ENCODING 94 SWIDTH 468 0 DWIDTH 15 0 BBX 14 5 4 18 BITMAP 07C0 0FE0 3DE0 7070 C018 ENDCHAR STARTCHAR underscore ENCODING 95 SWIDTH 562 0 DWIDTH 18 0 BBX 18 2 -1 -3 BITMAP FFFFC0 FFFFC0 ENDCHAR STARTCHAR grave ENCODING 96 SWIDTH 343 0 DWIDTH 11 0 BBX 8 4 5 19 BITMAP 7C 3C 0E 02 ENDCHAR STARTCHAR a ENCODING 97 SWIDTH 562 0 DWIDTH 18 0 BBX 21 16 0 0 BITMAP 00FF00 07FF80 070380 0E01C0 0001C0 000780 03FF80 0FFB80 1E0380 380700 700700 700700 700F00 703F00 7FF780 1FC380 ENDCHAR STARTCHAR b ENCODING 98 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 1 0 BITMAP 070000 070000 070000 070000 0E0000 0E0000 0E0000 0E7E00 1FFF00 1F8F80 1E0380 1E03C0 380380 380380 380380 380380 700700 700700 780F00 780E00 FC7C00 FFF800 E7E000 ENDCHAR STARTCHAR c ENCODING 99 SWIDTH 500 0 DWIDTH 16 0 BBX 19 16 0 0 BITMAP 00FF00 07FF80 0F87C0 0E01C0 1E01C0 380000 380000 380000 380000 700000 700000 780700 380700 7C3E00 3FFC00 0FF000 ENDCHAR STARTCHAR d ENCODING 100 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 0 0 BITMAP 000070 000070 000070 000070 0000E0 0000E0 0000E0 00FCE0 07FFC0 0F8FC0 0E03C0 1E03C0 380380 380380 380380 380380 700700 700700 780F00 380F00 7C7E00 3FFE00 0FCE00 ENDCHAR STARTCHAR e ENCODING 101 SWIDTH 531 0 DWIDTH 17 0 BBX 19 16 0 0 BITMAP 00FE00 07FF00 0F8F80 0E0380 1E03C0 380380 3FFF80 3FFF80 380000 700000 700000 780F00 380E00 7C7C00 3FF800 0FE000 ENDCHAR STARTCHAR f ENCODING 102 SWIDTH 281 0 DWIDTH 9 0 BBX 14 23 -1 0 BITMAP 001C 007C 0070 00E0 01C0 01C0 01C0 0FF8 1FF0 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 1C00 1C00 1C00 ENDCHAR STARTCHAR g ENCODING 103 SWIDTH 562 0 DWIDTH 18 0 BBX 20 23 -1 -7 BITMAP 007E70 01FFF0 03E3F0 0380F0 0F01E0 0E00E0 0E00E0 0E00E0 1C01C0 1C01C0 1C01C0 1E03C0 1C0780 1F1F80 0FFF80 03F380 000700 000700 380E00 380E00 3C7800 1FF000 07C000 ENDCHAR STARTCHAR h ENCODING 104 SWIDTH 562 0 DWIDTH 18 0 BBX 19 23 1 0 BITMAP 070000 070000 070000 070000 0E0000 0E0000 0E0000 0E7E00 1DFF00 1F0F00 1E0780 1C0380 380700 380700 380700 380700 700E00 700E00 700E00 700E00 E01C00 E01C00 E01C00 ENDCHAR STARTCHAR i ENCODING 105 SWIDTH 218 0 DWIDTH 7 0 BBX 8 23 1 0 BITMAP 07 07 07 00 00 00 00 0E 1C 1C 1C 1C 38 38 38 38 70 70 70 70 E0 E0 E0 ENDCHAR STARTCHAR j ENCODING 106 SWIDTH 218 0 DWIDTH 7 0 BBX 12 30 -2 -7 BITMAP 0070 0070 0070 0000 0000 0000 0000 01C0 01C0 01C0 01C0 0380 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 1C00 1C00 1C00 1C00 7800 F000 E000 ENDCHAR STARTCHAR k ENCODING 107 SWIDTH 500 0 DWIDTH 16 0 BBX 19 23 1 0 BITMAP 070000 070000 070000 070000 0E0000 0E0000 0E0000 0E0700 1C1C00 1C3800 1C7000 1CE000 3B8000 3F8000 3FC000 3DE000 71E000 70E000 70F000 707800 E07800 E03800 E03C00 ENDCHAR STARTCHAR l ENCODING 108 SWIDTH 218 0 DWIDTH 7 0 BBX 8 23 1 0 BITMAP 07 07 07 07 0E 0E 0E 0E 1C 1C 1C 1C 38 38 38 38 70 70 70 70 E0 E0 E0 ENDCHAR STARTCHAR m ENCODING 109 SWIDTH 843 0 DWIDTH 27 0 BBX 27 16 1 0 BITMAP 0E7C1F00 1DFE7F80 1F1EC780 1E0F83C0 1C0701C0 380E0380 380E0380 380E0380 380E0380 701C0700 701C0700 701C0700 701C0700 E0380E00 E0380E00 E0380E00 ENDCHAR STARTCHAR n ENCODING 110 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0E7E00 1DFF00 1F0F00 1E0780 1C0380 380700 380700 380700 380700 700E00 700E00 700E00 700E00 E01C00 E01C00 E01C00 ENDCHAR STARTCHAR o ENCODING 111 SWIDTH 562 0 DWIDTH 18 0 BBX 20 16 0 0 BITMAP 00FF00 07FF80 0F87C0 0E01C0 1E01E0 3801C0 3801C0 3801C0 3801C0 700380 700380 780780 380700 7C3E00 3FFC00 0FF000 ENDCHAR STARTCHAR p ENCODING 112 SWIDTH 562 0 DWIDTH 18 0 BBX 20 22 0 -6 BITMAP 073F00 07FFC0 07E3E0 0F01C0 0F01E0 0E00E0 0E00E0 1C01C0 1C01C0 1C01C0 1C01C0 3C0780 3C0700 3F1F00 3FFE00 73F000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR q ENCODING 113 SWIDTH 562 0 DWIDTH 18 0 BBX 20 22 -1 -6 BITMAP 007E70 01FFF0 03E3F0 0701E0 0F01E0 0E00E0 0E00E0 1C01C0 1C01C0 1C01C0 1C01C0 3C0780 1C0780 1F1F80 0FFF80 07E700 000700 000700 000700 000E00 000E00 000E00 ENDCHAR STARTCHAR r ENCODING 114 SWIDTH 343 0 DWIDTH 11 0 BBX 13 16 1 0 BITMAP 0E78 1DF0 1F00 1E00 1C00 3800 3800 3800 3800 7000 7000 7000 7000 E000 E000 E000 ENDCHAR STARTCHAR s ENCODING 115 SWIDTH 500 0 DWIDTH 16 0 BBX 18 16 0 0 BITMAP 01FC00 0FFE00 0E0E00 1C0700 1C0000 380000 1C0000 1FF800 07FE00 001C00 000E00 700E00 700E00 703800 7FF800 1FE000 ENDCHAR STARTCHAR t ENCODING 116 SWIDTH 281 0 DWIDTH 9 0 BBX 14 22 -1 0 BITMAP 00E0 00E0 00E0 01C0 01C0 01C0 0FF8 1FF0 0380 0380 0380 0700 0700 0700 0700 0E00 0E00 0E00 0E00 0E00 0F80 0380 ENDCHAR STARTCHAR u ENCODING 117 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0E01C0 1C0380 1C0380 1C0380 1C0380 380700 380700 380700 380700 700E00 700E00 700E00 781E00 787C00 7FDC00 1F9C00 ENDCHAR STARTCHAR v ENCODING 118 SWIDTH 468 0 DWIDTH 15 0 BBX 19 16 -1 0 BITMAP 0E00E0 1C01C0 1C01C0 0E0380 0E0380 0E0E00 0E0E00 071C00 071C00 077000 077000 07F000 03E000 07C000 038000 038000 ENDCHAR STARTCHAR w ENCODING 119 SWIDTH 718 0 DWIDTH 23 0 BBX 27 16 -1 0 BITMAP 0E0380E0 1C0701C0 1C0701C0 0E0F8380 0E0F8380 0E3B8E00 0E3B8E00 0E3B8E00 0771DC00 0EE3B800 0EE3B800 07C1F000 07C1F000 0701C000 0701C000 0701C000 ENDCHAR STARTCHAR x ENCODING 120 SWIDTH 468 0 DWIDTH 15 0 BBX 19 16 -1 0 BITMAP 0E00E0 1E03C0 0F0780 078F00 038E00 07BC00 03F800 01F000 01F000 07F000 0F7800 0E3800 1E3C00 783C00 F01E00 E00E00 ENDCHAR STARTCHAR y ENCODING 121 SWIDTH 468 0 DWIDTH 15 0 BBX 20 23 -2 -7 BITMAP 070070 070070 070070 0380E0 0701C0 038380 038380 01C700 038E00 01DC00 01DC00 00F800 01F000 00E000 00E000 01C000 038000 070000 070000 0E0000 3C0000 F80000 E00000 ENDCHAR STARTCHAR z ENCODING 122 SWIDTH 500 0 DWIDTH 16 0 BBX 18 16 0 0 BITMAP 0FFF80 1FFF00 1FFF00 000F00 001E00 007800 00F000 01E000 01C000 078000 0F0000 1E0000 3C0000 FFFC00 FFFC00 FFFC00 ENDCHAR STARTCHAR braceleft ENCODING 123 SWIDTH 343 0 DWIDTH 11 0 BBX 16 25 0 -1 BITMAP 000F 003F 0078 00F0 00E0 00E0 01C0 01C0 01C0 0180 0700 0E00 1C00 0E00 0E00 0600 0700 0700 0E00 0E00 0E00 0F00 0F00 0FC0 03C0 ENDCHAR STARTCHAR bar ENCODING 124 SWIDTH 218 0 DWIDTH 7 0 BBX 8 23 1 0 BITMAP 07 07 07 07 0E 0E 0E 0E 1C 1C 1C 1C 38 38 38 38 70 70 70 70 E0 E0 E0 ENDCHAR STARTCHAR braceright ENCODING 125 SWIDTH 343 0 DWIDTH 11 0 BBX 16 25 0 -1 BITMAP 03C0 03F0 01E0 00F0 0070 0070 00E0 00E0 00E0 00E0 00E0 00F0 0078 0070 01C0 0180 0380 0380 0700 0700 0700 0F00 3C00 FC00 F000 ENDCHAR STARTCHAR asciitilde ENCODING 126 SWIDTH 593 0 DWIDTH 19 0 BBX 17 5 5 18 BITMAP 1F0380 3F8380 F3CF00 E0FE00 E07C00 ENDCHAR STARTCHAR bullet ENCODING 149 SWIDTH 375 0 DWIDTH 12 0 BBX 12 9 1 3 BITMAP 0FC0 1FE0 7FE0 7FE0 7FE0 7FE0 FFC0 7F80 3F00 ENDCHAR STARTCHAR space ENCODING 154 SWIDTH 281 0 DWIDTH 9 0 BBX 0 0 -1 0 BITMAP ENDCHAR STARTCHAR degree ENCODING 156 SWIDTH 343 0 DWIDTH 11 0 BBX 11 9 3 14 BITMAP 0700 1FC0 3180 60C0 60C0 60C0 6300 7F00 1C00 ENDCHAR STARTCHAR twosuperior ENCODING 157 SWIDTH 281 0 DWIDTH 9 0 BBX 10 11 3 12 BITMAP 0F00 1F80 30C0 00C0 0700 1E00 3800 3000 C000 FF00 FF00 ENDCHAR STARTCHAR periodcentered ENCODING 158 SWIDTH 281 0 DWIDTH 9 0 BBX 3 3 3 7 BITMAP E0 E0 E0 ENDCHAR STARTCHAR afii10071 ENCODING 163 SWIDTH 531 0 DWIDTH 17 0 BBX 20 20 0 0 BITMAP 00E1C0 01C380 01C380 000000 00FE00 07FF00 0F8F80 0E0380 1E03C0 380380 3FFF80 3FFF80 380000 700000 700000 780F00 380E00 7C7C00 3FF800 0FE000 ENDCHAR STARTCHAR afii10023 ENCODING 179 SWIDTH 656 0 DWIDTH 21 0 BBX 23 26 2 0 BITMAP 007070 007070 000000 07FFFC 07FFFC 07FFFC 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1FFFC0 1FFFC0 1FFFC0 380000 380000 380000 380000 700000 700000 700000 700000 FFFF80 FFFF80 FFFF80 ENDCHAR STARTCHAR copyright ENCODING 191 SWIDTH 750 0 DWIDTH 24 0 BBX 27 23 0 0 BITMAP 0003C000 001FF800 00781E00 00E00700 03800700 03000300 0607C180 060FE180 0838C100 18300180 18300180 18300180 30600300 30600300 10718200 183F8600 303E0C00 18001800 1C003800 0E007000 0F03C000 03FF0000 00780000 ENDCHAR STARTCHAR afii10096 ENCODING 192 SWIDTH 718 0 DWIDTH 23 0 BBX 23 16 1 0 BITMAP 0E0FE0 1C7FF0 1CF8F8 1CE038 1DE03C 3B8038 3B8038 3F8038 3F8038 770070 770070 7780F0 7380E0 E7C7C0 E3FF80 E0FE00 ENDCHAR STARTCHAR afii10065 ENCODING 193 SWIDTH 562 0 DWIDTH 18 0 BBX 21 16 0 0 BITMAP 00FF00 07FF80 070380 0E01C0 0001C0 000780 03FF80 0FFB80 1E0380 380700 700700 700700 700F00 703F00 7FF780 1FC380 ENDCHAR STARTCHAR afii10066 ENCODING 194 SWIDTH 562 0 DWIDTH 18 0 BBX 21 23 0 0 BITMAP 000030 0001F0 001FE0 00FF80 03E000 07C000 070000 0E7E00 1FFF00 1F8780 1F03C0 1E01C0 3801C0 3801C0 3801C0 3801C0 700380 700380 380700 3C0F00 3C3C00 1FF800 07E000 ENDCHAR STARTCHAR afii10088 ENCODING 195 SWIDTH 593 0 DWIDTH 19 0 BBX 20 19 1 -3 BITMAP 0E01C0 0E01C0 0E01C0 0E01C0 1C0380 1C0380 1C0380 1C0380 380700 380700 380700 380700 700E00 700E00 7FFF80 7FFF80 000700 000700 000700 ENDCHAR STARTCHAR afii10069 ENCODING 196 SWIDTH 687 0 DWIDTH 22 0 BBX 24 19 0 -3 BITMAP 00FFF8 00FFF8 00E038 00E038 01C070 01C070 01C070 01C070 0380E0 0380E0 0380E0 0380E0 0701C0 0E01C0 7FFFF8 7FFFF8 E00070 E00070 E00070 ENDCHAR STARTCHAR afii10070 ENCODING 197 SWIDTH 531 0 DWIDTH 17 0 BBX 19 16 0 0 BITMAP 00FE00 07FF00 0F8F80 0E0380 1E03C0 380380 3FFF80 3FFF80 380000 700000 700000 780F00 380E00 7C7C00 3FF800 0FE000 ENDCHAR STARTCHAR afii10086 ENCODING 198 SWIDTH 656 0 DWIDTH 21 0 BBX 25 27 -1 -6 BITMAP 00038000 00038000 00038000 00038000 00070000 007FF000 01FFFC00 03E73E00 070E1C00 0F0E1E00 0E0E0E00 0E0E0E00 1C1C1C00 1C1C1C00 1C1C1C00 1C1C1C00 3C387800 1C387000 1F39F000 0FFFE000 07FF0000 00700000 00700000 00700000 00E00000 00E00000 00E00000 ENDCHAR STARTCHAR afii10068 ENCODING 199 SWIDTH 500 0 DWIDTH 16 0 BBX 17 16 1 0 BITMAP 0FFF80 1FFF00 1C0000 1C0000 1C0000 380000 380000 380000 380000 700000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR afii10087 ENCODING 200 SWIDTH 468 0 DWIDTH 15 0 BBX 19 16 -1 0 BITMAP 0E00E0 1E03C0 0F0780 078F00 038E00 07BC00 03F800 01F000 01F000 07F000 0F7800 0E3800 1E3C00 783C00 F01E00 E00E00 ENDCHAR STARTCHAR afii10074 ENCODING 201 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0E01C0 1C0380 1C0380 1C0780 1C0F80 383F00 387F00 38F700 39E700 778E00 7F0E00 7E0E00 7C0E00 F01C00 E01C00 E01C00 ENDCHAR STARTCHAR afii10075 ENCODING 202 SWIDTH 562 0 DWIDTH 18 0 BBX 19 20 1 0 BITMAP 00E700 01CE00 00FC00 007800 0E01C0 1C0380 1C0380 1C0780 1C0F80 383F00 387F00 38F700 39E700 778E00 7F0E00 7E0E00 7C0E00 F01C00 E01C00 E01C00 ENDCHAR STARTCHAR afii10076 ENCODING 203 SWIDTH 500 0 DWIDTH 16 0 BBX 18 16 1 0 BITMAP 0E0700 1C1C00 1C3800 1C7000 1CE000 3B8000 3F8000 3FC000 3DE000 71E000 70E000 70F000 707800 E07800 E03800 E03C00 ENDCHAR STARTCHAR afii10077 ENCODING 204 SWIDTH 562 0 DWIDTH 18 0 BBX 19 16 0 0 BITMAP 00FFE0 03FFC0 0381C0 0381C0 0381C0 070380 070380 070380 070380 0E0700 0E0700 0E0700 0E0700 1C0E00 FC0E00 F80E00 ENDCHAR STARTCHAR afii10078 ENCODING 205 SWIDTH 750 0 DWIDTH 24 0 BBX 24 16 1 0 BITMAP 0E0007 1E001E 1F003E 1F807E 1FC0FE 3BC3DC 39E79C 38FF1C 387E1C 707838 703038 700038 700038 E00070 E00070 E00070 ENDCHAR STARTCHAR afii10079 ENCODING 206 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0E01C0 1C0380 1C0380 1C0380 1C0380 380700 380700 3FFF00 3FFF00 700E00 700E00 700E00 700E00 E01C00 E01C00 E01C00 ENDCHAR STARTCHAR afii10080 ENCODING 207 SWIDTH 562 0 DWIDTH 18 0 BBX 20 16 0 0 BITMAP 00FF00 07FF80 0F87C0 0E01C0 1E01E0 3801C0 3801C0 3801C0 3801C0 700380 700380 780780 380700 7C3E00 3FFC00 0FF000 ENDCHAR STARTCHAR afii10081 ENCODING 208 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0FFFC0 1FFF80 1C0380 1C0380 1C0380 380700 380700 380700 380700 700E00 700E00 700E00 700E00 E01C00 E01C00 E01C00 ENDCHAR STARTCHAR afii10097 ENCODING 209 SWIDTH 531 0 DWIDTH 17 0 BBX 18 16 0 0 BITMAP 03FFC0 0FFF80 1E0380 1C0380 1C0380 380700 3C0700 1FFF00 0FFF00 03CE00 078E00 0F0E00 1E0E00 781C00 F01C00 E01C00 ENDCHAR STARTCHAR afii10082 ENCODING 210 SWIDTH 562 0 DWIDTH 18 0 BBX 20 22 0 -6 BITMAP 073F00 07FFC0 07E3E0 0F01C0 0F01E0 0E00E0 0E00E0 1C01C0 1C01C0 1C01C0 1C01C0 3C0780 3C0700 3F1F00 3FFE00 73F000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR afii10083 ENCODING 211 SWIDTH 500 0 DWIDTH 16 0 BBX 19 16 0 0 BITMAP 00FF00 07FF80 0F87C0 0E01C0 1E01C0 380000 380000 380000 380000 700000 700000 780700 380700 7C3E00 3FFC00 0FF000 ENDCHAR STARTCHAR afii10084 ENCODING 212 SWIDTH 562 0 DWIDTH 18 0 BBX 20 16 0 0 BITMAP 0FFFF0 1FFFE0 003800 003800 003800 007000 007000 007000 007000 00E000 00E000 00E000 00E000 01C000 01C000 01C000 ENDCHAR STARTCHAR afii10085 ENCODING 213 SWIDTH 468 0 DWIDTH 15 0 BBX 20 23 -2 -7 BITMAP 070070 070070 070070 0380E0 0701C0 038380 038380 01C700 038E00 01DC00 01DC00 00F800 01F000 00E000 00E000 01C000 038000 070000 070000 0E0000 3C0000 F80000 E00000 ENDCHAR STARTCHAR afii10072 ENCODING 214 SWIDTH 781 0 DWIDTH 25 0 BBX 29 16 -1 0 BITMAP 0381C0E0 078383C0 03C38780 01E38F00 00F39E00 00F77800 007FF000 007FF000 00F77800 03CE7800 078E3C00 0F0E1E00 1E0E0F00 781C0F00 F01C0780 E01C0380 ENDCHAR STARTCHAR afii10067 ENCODING 215 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0FFE00 1FFE00 1C0F00 1C0700 1C0700 380E00 3FFC00 3FFC00 380E00 700E00 700E00 700E00 700E00 E03800 FFF800 FFF000 ENDCHAR STARTCHAR afii10094 ENCODING 216 SWIDTH 562 0 DWIDTH 18 0 BBX 19 16 1 0 BITMAP 0E0000 1C0000 1C0000 1C0000 1C0000 380000 380000 3FFE00 3FFF00 700F00 700700 700700 700700 E01E00 FFFC00 FFF800 ENDCHAR STARTCHAR afii10093 ENCODING 217 SWIDTH 718 0 DWIDTH 23 0 BBX 23 16 1 0 BITMAP 0E000E 1C001C 1C001C 1C001C 1C001C 380038 380038 3FFE38 3FFF38 700F70 700770 700770 700770 E01EE0 FFFCE0 FFF8E0 ENDCHAR STARTCHAR afii10073 ENCODING 218 SWIDTH 500 0 DWIDTH 16 0 BBX 18 16 0 0 BITMAP 01FE00 07FE00 0F0E00 0E0700 000700 000E00 00FC00 00FC00 001E00 000E00 000E00 700E00 700E00 703800 7FF800 3FE000 ENDCHAR STARTCHAR afii10090 ENCODING 219 SWIDTH 781 0 DWIDTH 25 0 BBX 25 16 1 0 BITMAP 0E070380 1C0E0700 1C0E0700 1C0E0700 1C0E0700 381C0E00 381C0E00 381C0E00 381C0E00 70381C00 70381C00 70381C00 70381C00 E0703800 FFFFF800 FFFFF800 ENDCHAR STARTCHAR afii10095 ENCODING 220 SWIDTH 531 0 DWIDTH 17 0 BBX 19 16 0 0 BITMAP 01FE00 0FFF00 1F0F80 1C0380 0003C0 000380 000380 00FF80 00FF80 000700 000700 000F00 700E00 F87C00 7FF800 1FE000 ENDCHAR STARTCHAR afii10091 ENCODING 221 SWIDTH 812 0 DWIDTH 26 0 BBX 27 19 1 -3 BITMAP 0E070380 0E070380 0E070380 0E070380 1C0E0700 1C0E0700 1C0E0700 1C0E0700 381C0E00 381C0E00 381C0E00 381C0E00 70381C00 70381C00 7FFFFF00 7FFFFF00 00000E00 00000E00 00000E00 ENDCHAR STARTCHAR afii10089 ENCODING 222 SWIDTH 562 0 DWIDTH 18 0 BBX 18 16 1 0 BITMAP 0E01C0 1C0380 1C0380 1C0380 1C0380 380700 380700 3FFF00 1FFF00 000E00 000E00 000E00 000E00 001C00 001C00 001C00 ENDCHAR STARTCHAR afii10092 ENCODING 223 SWIDTH 625 0 DWIDTH 20 0 BBX 22 16 0 0 BITMAP 0FC000 1F8000 038000 038000 038000 070000 070000 07FFC0 07FFE0 0E01E0 0E00E0 0E00E0 0E00E0 1C03C0 1FFF80 1FFF00 ENDCHAR STARTCHAR afii10048 ENCODING 224 SWIDTH 906 0 DWIDTH 29 0 BBX 30 23 1 0 BITMAP 07007C00 0703FF80 0707FFC0 070F83E0 0E3C01E0 0E7800F0 0E700070 0E700070 1DC00070 1DC00070 1FC00070 1FC00070 3F8000E0 3B8000E0 3B8000E0 39C001C0 73800380 73C00780 71E00F00 70F83E00 E0FFF800 E07FF000 E00F8000 ENDCHAR STARTCHAR afii10017 ENCODING 225 SWIDTH 687 0 DWIDTH 22 0 BBX 26 23 0 0 BITMAP 0007C000 0007C000 000FE000 000FE000 001DC000 003DE000 0038E000 0038E000 00F1E000 00E0E000 01E0F000 01C07000 0380E000 0780F000 07007000 07FFF000 1FFFF000 1FFFF000 3C007800 38003800 70007000 F0007800 E0003800 ENDCHAR STARTCHAR afii10018 ENCODING 226 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFF8 07FFF8 07FFF8 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1FFF00 1FFF80 1FFFC0 3803C0 3801C0 3800E0 3800E0 7001C0 7001C0 7003C0 700780 FFFF00 FFFE00 FFF800 ENDCHAR STARTCHAR afii10040 ENCODING 227 SWIDTH 750 0 DWIDTH 24 0 BBX 26 26 2 -3 BITMAP 03800700 03800700 03800700 07000E00 07000E00 07000E00 07000E00 0E001C00 0E001C00 0E001C00 0E001C00 1C003800 1C003800 1C003800 1C003800 38007000 38007000 38007000 38007000 7000E000 7FFFF800 7FFFF800 7FFFF800 00007000 00007000 00007000 ENDCHAR STARTCHAR afii10021 ENCODING 228 SWIDTH 718 0 DWIDTH 23 0 BBX 27 26 0 -3 BITMAP 001FFF00 001FFF00 001FFF00 00380E00 00380E00 00380E00 00380E00 00701C00 00701C00 00701C00 00701C00 00E03800 00E03800 00E03800 00E03800 01C07000 01C07000 01C07000 03C07000 0F00E000 7FFFFC00 7FFFFC00 7FFFFC00 E0003800 E0003800 E0003800 ENDCHAR STARTCHAR afii10022 ENCODING 229 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFFC 07FFFC 07FFFC 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1FFFC0 1FFFC0 1FFFC0 380000 380000 380000 380000 700000 700000 700000 700000 FFFF80 FFFF80 FFFF80 ENDCHAR STARTCHAR afii10038 ENCODING 230 SWIDTH 843 0 DWIDTH 27 0 BBX 29 24 1 0 BITMAP 0000E000 0007F000 003FFE00 007FFF00 00F9CF80 03C38780 078383C0 070381C0 070381C0 1C0701C0 1C0701C0 1C0701C0 1C0701C0 380E0380 1C0E0700 1C0E0700 1E0E0F00 1E1C3C00 0F9CF800 07FFF000 03FFE000 00FE0000 00380000 00380000 ENDCHAR STARTCHAR afii10020 ENCODING 231 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFFC 07FFFC 07FFFC 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1C0000 1C0000 1C0000 380000 380000 380000 380000 700000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR afii10039 ENCODING 232 SWIDTH 656 0 DWIDTH 21 0 BBX 25 23 0 0 BITMAP 03800700 03C00F00 01C00E00 01E01E00 01E07800 00F0F000 0070E000 0079E000 007F8000 003F0000 001E0000 001E0000 007E0000 00FF0000 00E70000 01E78000 07878000 0F03C000 0E01C000 1E01E000 7801E000 F000F000 E0007000 ENDCHAR STARTCHAR afii10026 ENCODING 233 SWIDTH 750 0 DWIDTH 24 0 BBX 24 23 2 0 BITMAP 070007 070007 070007 070007 0E001E 0E003E 0E007E 0E00FE 1C03DC 1C079C 1C0F1C 1C1E1C 387838 38F038 39E038 3BC038 7F0070 7E0070 7C0070 780070 E000E0 E000E0 E000E0 ENDCHAR STARTCHAR afii10027 ENCODING 234 SWIDTH 750 0 DWIDTH 24 0 BBX 25 26 2 0 BITMAP 003C7800 001FF000 000FE000 07070700 07000700 07000700 07000700 0E001E00 0E003E00 0E007E00 0E00FE00 1C03DC00 1C079C00 1C0F1C00 1C1E1C00 38783800 38F03800 39E03800 3BC03800 7F007000 7E007000 7C007000 78007000 E000E000 E000E000 E000E000 ENDCHAR STARTCHAR afii10028 ENCODING 235 SWIDTH 656 0 DWIDTH 21 0 BBX 24 23 1 0 BITMAP 07003C 070078 0700F0 0701E0 0E0780 0E0F00 0E1E00 0E3C00 1CF000 1DE000 1FE000 1FF000 3EF000 3C7800 383C00 381E00 701E00 700F00 700780 7003C0 E003C0 E001E0 E000E0 ENDCHAR STARTCHAR afii10029 ENCODING 236 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 1 0 BITMAP 007FFC 00FFFC 00FFFC 00E01C 01C038 01C038 01C038 01C038 038070 038070 038070 038070 0700E0 0700E0 0700E0 0700E0 0E01C0 0E01C0 0E01C0 0E01C0 1C0380 FC0380 F80380 ENDCHAR STARTCHAR afii10030 ENCODING 237 SWIDTH 812 0 DWIDTH 26 0 BBX 26 23 2 0 BITMAP 078003C0 07C007C0 07C007C0 07C007C0 0FC01F80 0FC01F80 0FC01F80 0FE03F80 1DC07700 1DC07700 1DE0F700 1CE0E700 39C1CE00 39E3CE00 38E38E00 38E38E00 71EF1C00 70EE1C00 70EE1C00 70FE1C00 E0F83800 E0F83800 E0F83800 ENDCHAR STARTCHAR afii10031 ENCODING 238 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 07000E 07000E 07000E 07000E 0E001C 0E001C 0E001C 0E001C 1C0038 1FFFF8 1FFFF8 1FFFF8 380070 380070 380070 380070 7000E0 7000E0 7000E0 7000E0 E001C0 E001C0 E001C0 ENDCHAR STARTCHAR afii10032 ENCODING 239 SWIDTH 781 0 DWIDTH 25 0 BBX 27 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000380 1C000380 1C000380 1C000380 38000700 38000700 38000700 1C000E00 38001C00 3C003C00 1E007800 0F81F000 0FFFC000 07FF8000 00FC0000 ENDCHAR STARTCHAR afii10033 ENCODING 240 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 07FFFE 07FFFE 07FFFE 07000E 0E001C 0E001C 0E001C 0E001C 1C0038 1C0038 1C0038 1C0038 380070 380070 380070 380070 7000E0 7000E0 7000E0 7000E0 E001C0 E001C0 E001C0 ENDCHAR STARTCHAR afii10049 ENCODING 241 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 1 0 BITMAP 01FFFC 03FFFC 07FFFC 07001C 0E0038 0E0038 0E0038 0E0038 1C0070 1E0070 1FFFF0 0FFFF0 0FFFE0 003CE0 0078E0 00F0E0 03C1C0 0781C0 0F01C0 1E01C0 780380 F00380 E00380 ENDCHAR STARTCHAR afii10034 ENCODING 242 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FFC0 07FFF0 07FFF8 070078 0E0078 0E0038 0E0038 0E0038 1C0070 1C00F0 1C01E0 1FFFE0 3FFF80 3FFE00 380000 380000 700000 700000 700000 700000 E00000 E00000 E00000 ENDCHAR STARTCHAR afii10035 ENCODING 243 SWIDTH 718 0 DWIDTH 23 0 BBX 26 23 1 0 BITMAP 0007E000 003FFC00 007FFE00 00F81F00 03C00F00 07800780 07000380 07000380 1C000000 1C000000 1C000000 1C000000 38000000 38000000 38000000 1C000E00 38001C00 3C003C00 1E007800 0F81F000 0FFFC000 07FF8000 00FC0000 ENDCHAR STARTCHAR afii10036 ENCODING 244 SWIDTH 625 0 DWIDTH 20 0 BBX 24 23 0 0 BITMAP 07FFFF 07FFFF 07FFFF 000700 000E00 000E00 000E00 000E00 001C00 001C00 001C00 001C00 003800 003800 003800 003800 007000 007000 007000 007000 00E000 00E000 00E000 ENDCHAR STARTCHAR afii10037 ENCODING 245 SWIDTH 687 0 DWIDTH 22 0 BBX 26 23 0 0 BITMAP 070001C0 078003C0 03C00780 01E00F00 01C01C00 01E03C00 00F07800 0078F000 0071C000 007BC000 003F8000 001F0000 003C0000 00380000 00780000 00700000 01E00000 01C00000 03800000 07800000 1E000000 7C000000 78000000 ENDCHAR STARTCHAR afii10024 ENCODING 246 SWIDTH 968 0 DWIDTH 31 0 BBX 36 23 -1 0 BITMAP 01C01C01C0 01E01C03C0 00F01C0780 00781C0F00 0078383C00 003C387800 001E38F000 000F39E000 000F778000 0007FF0000 0003FE0000 0007FF0000 001EEF0000 003CE78000 0078E3C000 00F0E1E000 03C1C1E000 0781C0F000 0F01C07800 1E01C03C00 7803803C00 F003801E00 E003800E00 ENDCHAR STARTCHAR afii10019 ENCODING 247 SWIDTH 656 0 DWIDTH 21 0 BBX 22 23 2 0 BITMAP 07FF80 07FFE0 07FFF0 070070 0E0070 0E0070 0E0070 0E0070 1C01C0 1FFFC0 1FFF80 1FFFC0 3803C0 3801C0 3800E0 3800E0 7001C0 7001C0 7003C0 700780 FFFF00 FFFE00 FFF800 ENDCHAR STARTCHAR afii10046 ENCODING 248 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 070000 070000 070000 070000 0E0000 0E0000 0E0000 0E0000 1C0000 1C0000 1FFFE0 1FFFF0 3FFFF0 3800F0 380070 380070 7000E0 7000E0 7000E0 7001E0 FFFFC0 FFFF80 FFFF00 ENDCHAR STARTCHAR afii10045 ENCODING 249 SWIDTH 812 0 DWIDTH 26 0 BBX 27 23 1 0 BITMAP 070000E0 070000E0 070000E0 070000E0 0E0001C0 0E0001C0 0E0001C0 0E0001C0 1C000380 1C000380 1FFFE380 1FFFF380 3FFFF700 3800F700 38007700 38007700 7000EE00 7000EE00 7000EE00 7001EE00 FFFFDC00 FFFF9C00 FFFF1C00 ENDCHAR STARTCHAR afii10025 ENCODING 250 SWIDTH 593 0 DWIDTH 19 0 BBX 22 23 0 0 BITMAP 007FE0 01FFF0 03FFF8 038078 000070 000070 000070 000070 0000E0 0001C0 00FF80 00FFC0 01FFC0 0003E0 0000E0 0000E0 0001C0 0001C0 7001C0 7803C0 7FFF00 7FFE00 1FFC00 ENDCHAR STARTCHAR afii10042 ENCODING 251 SWIDTH 906 0 DWIDTH 29 0 BBX 32 23 0 0 BITMAP 07007007 07007007 07007007 07007007 0E00E00E 0E00E00E 0E00E00E 0E00E00E 1C01C01C 1C01C01C 1C01C01C 1C01C01C 38038038 38038038 38038038 38038038 70070070 70070070 70070070 70070070 FFFFFFE0 FFFFFFE0 FFFFFFE0 ENDCHAR STARTCHAR afii10047 ENCODING 252 SWIDTH 750 0 DWIDTH 24 0 BBX 25 23 1 0 BITMAP 001F8000 00FFF000 01FFF800 03E07C00 0F003C00 0E001E00 00000E00 00000E00 00000E00 00000E00 001FFE00 001FFE00 003FFC00 00001C00 00001C00 00003800 00007000 7000F000 7801E000 3E07C000 3FFF0000 1FFE0000 03F00000 ENDCHAR STARTCHAR afii10043 ENCODING 253 SWIDTH 968 0 DWIDTH 31 0 BBX 35 26 0 -3 BITMAP 0380380380 0380380380 0380380380 0700700700 0700700700 0700700700 0700700700 0E00E00E00 0E00E00E00 0E00E00E00 0E00E00E00 1C01C01C00 1C01C01C00 1C01C01C00 1C01C01C00 3803803800 3803803800 3803803800 3803803800 7007007000 7FFFFFFC00 7FFFFFFC00 7FFFFFFC00 0000003800 0000003800 0000003800 ENDCHAR STARTCHAR afii10041 ENCODING 254 SWIDTH 718 0 DWIDTH 23 0 BBX 23 23 2 0 BITMAP 07000E 07000E 07000E 07000E 0E001C 0E001C 0E001C 0E001C 1E0038 1FFFF8 0FFFF8 07FFF8 000070 000070 000070 000070 0000E0 0000E0 0000E0 0000E0 0001C0 0001C0 0001C0 ENDCHAR STARTCHAR afii10044 ENCODING 255 SWIDTH 750 0 DWIDTH 24 0 BBX 27 23 0 0 BITMAP 07F00000 07F00000 07F00000 00700000 00E00000 00E00000 00E00000 00E00000 01C00000 01C00000 01FFFE00 01FFFF00 03FFFF00 03800F00 03800700 03800700 07000E00 07000E00 07000E00 07001E00 0FFFFC00 0FFFF800 0FFFF000 ENDCHAR ENDFONT	Mid	[ 0.574610244988864, 32.25, 23.875 ]
Wearable tech for tracking when cows are ‘in heat’? Sure, why not? 2014 might be the year for wearable tech, but there’s no reason for it to stop at humans.Or dogs. Is there? That’s right, although it’s not quite the bovine Fitbit you might have been thinking of, the company behind the Silent Herdsman (formerly known as Embedded Technology Systems, an altogether less catchy name) cow collar has bagged another £3 million investment to bring it (and other new services) to farmers around the world. Rather than, err, counting calories burned, the Silent Herdsman collar has various sensors that continually track a cow and trigger an alert (on a phone, tablet or computer) if there’s a change in the usual pattern of behaviour. For example, the company says it can detect when an animal has entered its oestrous cycle – otherwise known as being ‘in heat’. As well as that, the company says the tracker helps with overall animal health and leads to increased milk yields, and enhanced profitability for farmers.	Mid	[ 0.6354166666666661, 30.5, 17.5 ]
Posted by samzenpus on Thursday February 19, 2009 @05:18AM from the someone-take-out-the-space-trash dept. MollyB writes "According to Wired, the recent collision of satellites may put the Atlantis shuttle mission to repair Hubble in the 'unacceptable risk' status: 'The spectacular collision between two satellites on Feb. 10 could make the shuttle mission to fix the Hubble Space Telescope too risky to attempt. Before the collision, space junk problems had already upped the Hubble mission's risk of a "catastrophic impact" beyond NASA's usual limits, Nature's Geoff Brumfiel reported today, and now the problem will be worse. Mark Matney, an orbital debris specialist at the Johnson Space Center in Houston, Texas told the publication that even before the collision, the risk of an impact was 1 in 185, which was "uncomfortably close to unacceptable levels" and the satellite collision "is only going to add on to that."'" we were discussing the debris problem at work over coffee the other day. we were trying to find solutions to it in our non-expert fashion. sadly the best we could come up with were: (1) putting a impact shield around spacecraft - but the kind of impact speeds we are talking about probably makes this uneconomical as the shield would need to be massive.(2) some kind of automated space cleaner that went around removing debris - but we had no idea how that could possibly work or be designed(3) vastly improved tracking capabilities so we could avoid the worst areas and steer around them(4) pre-emptive removal of dead satalites (no, not shooting them down from earth - attaching small moters to send them into the atmosphere) - maybe steering them into a declining orbit as the last thing they do before swithing them off(5) just abandoning the whole outer space game anyhow and using a vast fiber optic ring on the surface for communication needs there were probably other ideas that we came up with that I cannot remember, but this might get some comments/advice/derision. but we all agreed, this problem will only get worse. and choosing different orbit altitudes only delays confronting the issue - but might be cheaper in the short term. putting a impact shield around spacecraft - but the kind of impact speeds we are talking about probably makes this uneconomical as the shield would need to be massive. The spacecraft would have trouble getting off the ground. That's even worse than uneconomical. some kind of automated space cleaner that went around removing debris - but we had no idea how that could possibly work or be designed The problem with this is - if that "cleaner" gets hit by debris, you've just added to the problem instead of reducing it. pre-emptive removal of dead satalites (no, not shooting them down from earth - attaching small moters to send them into the atmosphere) - maybe steering them into a declining orbit as the last thing they do before swithing them off That would have been a way to keep the problem in check, and it's being done with some satellites. But usually whoever puts satellites up there is too cheap to worry about disposal, since by the time it becomes a problem, they're most likely not around anymore and don't have to worry. Yay, just let the following generations clean up the crap, just like with everything else. putting a impact shield around spacecraft - but the kind of impact speeds we are talking about probably makes this uneconomical as the shield would need to be massive. The spacecraft would have trouble getting off the ground. That's even worse than uneconomical. Here's a thought. What if each spacecraft did not lug a big old shield up into orbit. What if we build an orbiting "overcoat" which had the necessary shielding and a space inside to accomodate the spacecraft. Then you launch as light as you can and do Here's a thought. What if each spacecraft did not lug a big old shield up into orbit. What if we build an orbiting "overcoat" which had the necessary shielding and a space inside to accomodate the spacecraft. And that overcoat is built by hauling material from the earth into space (with every transport flight being exposed to the very risk that now jeopardises the Hubble repair mission), putting it together there (with those unlucky astronauts who have to do this being exposed to the very risk that now jeopardises the Hubble repair mission), to then haul up the actual spacecraft (with that transport flight being exposed to the very risk that now jeopardises the Hubble repair mission). You are not, by chance, an accountant, a corporate lawyer or a politician? Some people choose to sleep with their pants on because they are reluctant to get out of bed in the morning and suffer cold legs. Agreed. If you made some kind of inflatable aerogel or foam wall and put it into orbit then it would be bashed by debris, which would slow the debris down somewhat and speed their re-entry. The foam would have booster rockets to keep it in orbit (and keep it out of the way of active satellites). When those boosters run out of fuel, or something causes them to fail, then the huge mass of foam would rapidly deorbit since it would have a high drag:mass ratio. You could even put the foam in retrograde orbit if you really wanted to slow down debris, although this might make it harder to keep out of the way of active satellites. Automated space cleaner... Perhaps a satellite that's solar powered and uses an electromagnet to repel pieces into the atmosphere? Although I suppose that would push it out of orbit... Maybe if there's enough air it could compress some and then use it as a jet to keep in orbit... Obviously you can't but you can attract them once you have enough bits slow down enough that they will re-enter in a couple of years, ditch them and speed up again. The only problem is the amount of fuel it would take to do this a few times. As opposed to the fuel it's going to take to have the various other functional satellites, shuttles, and the station dodge all the time? One idea I saw was to use an aerogel, that really sparse foam, to catch things. Well, set them closer to the deorbital path. The idea is that the foam is so light that the wrench or whatever that hits it doesn't break up, the foam doesn't break up, so there's no additional fragments. Meanwhile, if you've set the orbit up right, the foam slows the debris down a tad, speeding up the time it'll take to hit atmosphere. One idea I saw was to use an aerogel, that really sparse foam, to catch things. Well, set them closer to the deorbital path. The idea is that the foam is so light that the wrench or whatever that hits it doesn't break up, the foam doesn't break up, so there's no additional fragments. Meanwhile, if you've set the orbit up right, the foam slows the debris down a tad, speeding up the time it'll take to hit atmosphere. Didn't we use something like this to catch dust from a comet tail? On a larger scale, it might clean part of an orbit. (I hope it is possible to clean out an orbit, because just waiting for junk to deorbit is going to be really impractical once space travel and the debris it will inevitably produce increase.) And why doesn't Netflix have Planetes? I've been interested in watching it for years. Electro-magnets wouldn't do so well, since they will only work on magnetic materials. Large Van De Graaff generators, however, would generate static fields attracting most any object, or at least polarize their charges to the point that the Earth's geomagnetic field could get a grip on them, likely slowing them to the point of deorbit. These could be made cheaply, set into an orbital path to clear, and then burn up on re-entry when they have collected sufficient mass to themselves deorbit. Or just launch some bombs and detonate them in orbit. Make sure the blast radius is large enough to either force the surrounding debris along with the debris generated by the bomb out of orbit or into the atmosphere. Wouldn't work, there's no atmosphere in space so bombs dont make explosions like they do in an atmosphere. It's jsut a big pulse of electricity, certainly anything near it would be vapourized but they would have to be REAL close otherwise they would just heat up and melt a bit. On top of that there would be a nice big EMP which would make any country beneath the bomb very upset. 1) - there is moderately workable impact shielding developed for satellites/space craft which consists of plates separated by gaps which spread out the kinetic energy of debris and has been proven effective against small impacts. 2) "space cleaning" could easily be done by deploying some large engineered dragnet style objects into the path of the debris. Obviously careful engineering would have to be used to assure collisions dont cause pieces to splash from the dragnet, but I think its quite doable. 3) we already track space debris down to very small levels. Currently nasa have maps of these pieces, down to the size of a screw if I remember correctly. 4) this is often done already, at least by government agencies. Private companies are another matter, but i've never heard of a private satellite going completely out of use. 5) we may as well just nuke it all now if we don't establish extra-terrestrial colonies. Colonization of space is the next logical step for a species which develops intelligence, and if we don't continue down that path we are a dead-end branch waiting to be pruned from the tree of life. You don't understand the Theory of Evolution. There is NO "next logical step" for a species which develops intelligence, and there is NO reason why not colonising space makes us a "dead end branch". As the late, great Jay Gould has pointed out, the main form of life on Earth (by biomass and by effect on the planet) is now, and has been for a very long time, bacteria. Bacteria achieve great adaptability without intelligence. If we cannot achieve the same adaptability, then environmental changes may make us extinct. But the test of evolutionary success is simply continued, unthreatened existence, not some hypothetical extension of range. If we "nuke ourselves", we've failed. If we learn to live in our existing environment without making it unusable, and adapt to its changes, we've succeeded. The idea that we must colonise space to validate our existence is a religion, not science. Before the troll mods start up, please let me say I'm not objecting to exploring the Solar System in the slightest (in fact I think it's far more useful than the LHC). I am pointing out that your justification makes no scientific sense. If we learn to live in our existing environment without making it unusable, and adapt to its changes, we've succeeded. The current environment is transitory. And eventually over geological time, it will change in a way that cannot be adapted to. Plus, it's worth noting that most species (including humans) that exist now do so precisely because they have repeatedly expanded their range. Yeah, but however transitory it is, it's far better suited to us than anything space has to offer. Seriously, any "changes over geological time" that occur are small change compared to the cost of terraforming. Or, put another way, it will take far less energy, logistics and ingenuity to maintain a human-habitable planet than to evolve one. Likewise, it will take far less genetic monkeying to keep our species compatible with this planet's environment than to adapt to that of another planet. We are a migratory species, our migration patterns are simply on longer cycles than seasonal ones. There exists no natural planetary body that will sustain life indefinitely, eventually we will have to move to a new world and terraform it or become extinct. The sooner we develop the technology the better we will be at it. If you are content to bury your head in the sand and leave the problem to later generations, then please do not reproduce and leave the resources to the innovators and explorers who see Plus, it's worth noting that most species (including humans) that exist now do so precisely because they have repeatedly expanded their range. However, when our ancestors were capable of adapting to survive the KT event, they were tiny little shrew-like creatures. And when our ancestors were capable of adapting to survive the big extinction 250M years ago, they were shrimps. In order to survive a global extinction level event such as a reeeeally big asteroid impact, we have to get off of this rock. In the long run, we as a species have already failed to survive because we are too specialised to quickly adapt to the inevitable forthcoming sudden, m Living in better balance with our environment and within our resources will not save us from a space rock or plague, off-world colonies will, and that's my point. The main evolutionary trait of human beings is technology, and we are in a unique position to do this, which would set us on the road to the eventually disentanglement of our survival with that of one small planet. If we fail to do this, then a global catastrophe will eventually happen which outstrips our technology and render us extinct. Will the inhabitants of those "off-world colonies" survive? We are far less likely to adapt to their conditions. The change of getting wiped out before sustainability is reached is rather high (look at the history of the colonisation of the Americas). Meanwhile, the amount of energy it takes to put even small payloads into orbit is enormous. We could easily reduce our planet to below sustainability in trying to create colonies, all of which would then fail for lack of resources. We've just done this to our economy by trying to make it expand too fast, so we have a track record. Research on Earth into dealing with external threats such as infalling asteroids or comets, dealing with diseases, dealing with our own inbuilt tendency to commit genocide, is far cheaper and more likely to pay dividends. Let's protect ourselves from disease and space rocks first, then we will be demonstrating our adaptability and survival skills. Running for the hills is monkey behavior, dealing with the predators may be what made us human in the first place. After all, we could realistically have a basic comet and asteroid shield by 2030. I repeat: the idea of space colonies is currently not even science fiction, it's religion. Which was my original point. 5) we may as well just nuke it all now if we don't establish extra-terrestrial colonies. Colonization of space is the next logical step for a species which develops intelligence, and if we don't continue down that path we are a dead-end branch waiting to be pruned from the tree of life. I am pointing out that your justification makes no scientific sense....I repeat: the idea of space colonies is currently not even science fiction, it's religion. Which was my original point. Will the inhabitants of those "off-world colonies" survive? We are far less likely to adapt to their conditions. Exactly. We have spent the last several millennium finding our own balance, a genetic war if you will, against pathogens and other animals to establish our dominance in this sphere. There is no reason to suppose that we will conquer another world with ease even if it is filled with 'lesser' forms of life. If we fail to do this, then a global catastrophe will eventually happen which outstrips our technology and render us extinct. So? Honestly I could not care less. Not trying to troll, I really don't see an issue here. Humans have been around for some 200,000 years. Nice, but that is not exactly a long time span. Dinosaurs were around for more than 160 million years - 160,000,000, you notice the difference? And they still vanished. Humanity as a whole is quite insignificant, one amongst an uncountable mass of life forms in this planet, outlived (by time of existence, not concurrency) by most other species. Why does everyone believe that we should be destined to walk this universe forever? Sorry, folks, hate to break it to you: The odds of that are damningly slim. Big deal. By my estimation one of the following will have occurred well before our earth evolves to a point where living conditions will not allow us to adapt anymore: We will have suffocated from our own toxins, fumes and trash. Global nuclear armageddon, triggered by either a russian fascist, a chinese fascist or an american retard. God proves his existence - by hitting the reset switch. I am really surprised, and somewhat concerned here. Supposedly/.'s target group should predominantly consist of engineers, scientists and generally geeks and nerds - people who rely on common sense and logic to make a living. (Not counting those working for Microsoft or Sun. Those have somehow mastered the forbidden art of producing systematically structured chaos.) That's not a logically attitude, it's a negative and defeatist attitude.The scripting language I used to to code a website last week will likely be obsolete in a decade or so, so I don't know why I even bothered writing it in the first place. I should probably have just saved myself the trouble and watched TV all day instead of spending a couple of hours writing in a doomed computer language. A building can't realistically be expected to last forever, so why do we bother with structural engineering, or safet The idea that we must colonise space to validate our existence is a religion, not science. The way I look at it, we are the reproductive system for the entire biosphere. If we don't colonize other planets around different stars (let alone other rocks around this one) then all of Gaia* has failed, not just one little species. * Please note I do not actually personify "Gaia", I just use it as a convenient and poetic label for the entire interconnected biosphere. The way I look at it, we are the reproductive system for the entire biosphere. You know, I think this is a very apt comparison. Like reproducive organs, especially the testes mammals, we enact extensive changes on the whole planet; not all of which are beneficial. Yet, we're the one big hope for reproduction; so almost ANYTHING is worth it. If we do relocated, odds are we'll take a big chunk of the rest of the biosphere with us. Perhaps he phrased it badly, but I think what he meant to say is that having humans on more than one planet enhances our survivability greatly, which [b]does[/b] affect us from the standpoint of evolution. You don't understand the Theory of Evolution. There is NO "next logical step" for a species which develops intelligence, and there is NO reason why not colonising space makes us a "dead end branch". As the late, great Jay Gould has pointed out, the main form of life on Earth (by biomass and by effect on the planet) is now, and has been for a very long time, bacteria. Bacteria achieve great adaptability without intelligence. Eventually, even the bacteria will go extinct without a space program. It depends on the time scale. Yes we WILL be a dead end unless we leave the Earth but we have a billion years (more or less) before we are forced to leave. So if we explore space now or wait 10,000 years it makes little difference. On the cosmic scale 10,000 years is "nothing". We will eventually learn to live on Earth in a sustainable, stable way. For those curious, the shielding in question is a Whipple shield [wikipedia.org]. The idea is similar to gapped armor -- adding some space after the first impact gives the debris / projectile time to break up and spread out, making the next layer's job easier. ...but also increases the thickness of the spacecraft walls, which is not ideal for fitting spacecraft into launch vehicle fairings. Did anybody consider developing the Whipple Shield to "expand" on deployment? Store the layers tightly packed, then space the layers apart either mechanically or using some kind of compressed filler-material once the payload is deployed. The laminated nature of the hull would provide additional benefits to pressurised, manned payloads, since it wo The problem with so many ideas to remove space debris is that most of them seem to add to the problem. Even microscopic particles can do tremendous damage at the velocities concerned. The best idea I've come up with would be to send a cannister into the path of the debris to be removed at a slightly lower relative velocity. This device would then open, releasing a huge cloud of rapidly expanding resinous foam (think of the canned stuff you use to fill holes in the wall). The debris would then impact and b The best idea that I've heard about is the "laser broom". Basically big ground based lasers that shine up into space and hit orbiting junk with enough energy that they start to ablate. As the material ablates from the pieces, a small amount of thrust would be created, which would alter the pieces' orbits and eventually cause them to reenter the atmosphere and burn up. It doesn't require putting any new material up into orbit, so you're not potentially creating even more matter up there to deal with. I think Re (4), deorbiting (or parking) dead satellites - this already happens to some extent, if vehicles are still commandable at EOL and have enough delta-v in the tank to make it to a high parking orbit (or a de-orbit burn), that's usually done. I've also seen tethers mooted as a fuel-free EOL mechanism for deorbit (winch out a 20km cable which drags through the upper atmosphere and burns off enough velocity to make the sc re-enter and burn up.) Problem is that all this costs mass, which means money. There's also the problem that lots of debris isn't under any kind of command (chunks of upper stages, satellites that died in action, dropped screwdrivers, slag from old Iridiums and and so on.) (5) just abandoning the whole outer space game anyhow and using a vast fiber optic ring on the surface for communication needs The real problem here is that we're wasting vast amounts of orbital space with competing projects that don't share information with each other. There's more than plenty of room for one satellite network. But every little war-happy industrialized nation and every communications company and mapping company, etc., needs their own personal network clogging the sky. Until we, as a species, get a little better at this "cooperation" thing and stop with the in-fighting, the debris field is just going to get worse and make space exploration difficult. (That might even be a good thing for any neighbors we might have.) Perhaps NASA could work with the LHC to produce a small black hole and put it in orbit. It might cause a problem later but who cares? It gets rid of the problem now, and that's all that matters amirite? Is debris from that collision heading even remotely to Hubble's orbit (otherwise, any future manned spaceflight/EVA at its altitude would be precluded by unacceptable risk), or is this just an excuse for putting elsewhere the money and other resources set aside to fly this mission? There is no reason to believe that the debris field will all remain in the orbits of the original satellites. When they collided, parts got thrown all over, radiating outward from the collision point. Some of those were thrown forward (faster along one orbital path than the original satellites), some were thrown backward (slower than the original orbit), some thrown up (away from earth), some down, and some sideways. The ones that were shot forward will end up in higher orbits, including some at the alti The problem isn't that the debris might be heading to Hubble's orbit. The problem is that the debris cloud is between us and Hubble, and it's getting larger. There was an SF author, probably Asimov, who wrote how mankind might become trapped on the planet because of the ever increasing debris field. Over time, all that debris will flatten into a ring, but that will take millions of years. For the people who weren't paying attention, the collision occured at 450 miles. Hubble is around 350 and the ISS is at around 300 (in really round figures). So, the collision occured above Hubble and ISS Firstly, Hubble is working fine. Secondly, FTA "NASA spokeswoman, Beth Dickey, would not specifically comment on whether or not the collision had created elevated risk for the Hubble repair mission. "What we've told everyone is that there is an elevated risk to virtually any satellite in low-earth orbit," Dickey said. "As far as NASA's assets are concerned, that risk is considered to be very small. I have not seen or heard anything that would lead me to think differently." Eh, no. Its practically dead. Thats why every delay to this service mission is so critical - if another couple of gyros go, it won't even be able to orient itself well enough to allow the astronauts to get up close. As it is, most of its main instruments are currently out of action. Eh, no. Its practically dead. Thats why every delay to this service mission is so critical - if another couple of gyros go, it won't even be able to orient itself well enough to allow the astronauts to get up close. As it is, most of its main instruments are currently out of action. Well if Griffin didn't cancel the robotic repair mission that was not only planned but mostly built and tested, it would have been repaired by now. In August 2004, O'Keefe requested the Goddard Space Flight Center to prepare a detailed proposal for a robotic service mission. These plans were later canceled, the robotic mission being described as "not feasible [washingtonpost.com]". Just goes to show you cannot believe everything you read. In reality, the robotic system was in manufacturing when it was 'canceled'. Goddard continued to fund a scaled back Hubble repair, but only a demo using a mockup robot and the hardware in Goddards full scale Hubble simulation labs. The demos finished as planned and were a complete success. Many of the operations were shown to perform better with robotics than with astronauts (like sliding out the instrument trays). The planned body of the hubble repair robot is now the SPDM robot on the international space station. That robot already existed and hadn't yet flown to the space station due to the grounding of the shuttles at the time. Since the robot existed, the schedule, capabilities and cost were all feasible. The robotics mission was canceled because Griffin didn't like the head of MDA (the robotics company contracted to build the robot portion of hte mission) as they had a rivalry when they both worked at Orbital. The whole 'unfeasible' story is a complete fabrication. The visible & UV channels of the Advanced Camera for Surveys have been out of operation since january 07, when its backup electronics died. Hubble was originally intended to operate with 3 functional gyros at all times, but since 2005 has been operating on 2-gyro mode, to extend its useful lifetime in the face of continuing gyro failure. This limits the area of the sky it can view, and makes precise measurements more difficult. Only 3 of its 6 gyros remain functional, and 2 of these are in continual us "They'll" send tens of thousands overseas? When last I checked, NASA wasn't really given oversight of troop deployment and declarations of war. NASA knows, however, that the public has a low tolerance for highly visible and spectacular deaths, and that every time such a disaster takes place, the entire manned space program and space flight in general is set back by months or years, and given the budget environment and long-standing criticism of their agency may be threatened entirely. 4. There are far too many in Congress who see the NASA manned program as a waste of money (in other words that money could buy pools and libraries named after Congressmen!) 5. Comparing any item to Iraq expenditures does not bolster your argument, if anything a parrot would suffice. Why not compare it to the fact we are willing to lose nearly FORTY THOUSAND people to vehicle deaths. The number of soldiers we lose in Iraq while deplorable by any count is minuscule compared to any other war of that scale let alone the deaths at home from stuff that should not happen in the first place. My thought is to fire a sounding rocket directly into the path of the debris. At the peak altitude the rocket explodes, releasing something like strips of foil which will collide with orbiting debris. Given time, it should be possible to clean up these orbits. The objects we want to take out of orbit are in a stable trajectory. If they collide with an object fired directly from the ground they will lose some velocity and move into a lower orbit. Low altitude orbits decay quickly because of drag from the atmosphere so these objects will quickly burn up. The object you fire from the ground to cause a collision will be shoved sideways a short distance. It can't go into orbit. Having thought about it for a bit I think the best thing to send up in the sounding rocket is a bottle of liquid nitrogen. It will form an expanding cloud at orbital altitude. Debris which fly through the cloud will lose some speed and their orbits will decay. Sounding rocket firings could be timed to minimise impact on operational spacecraft. I proposed something like this, but using something like snowflakes or small particles of dry ice instead of the foil, but it seems collisions at the speeds involved behave quite oddly and even "soft" targets can shatter pieces of debris into multiple smaller pieces mostly in pretty much the same orbit as the originals. I wonder if some kind of magnetic drag could be devised? a big hoop of superconducting wire with a current in it that would slow down conducting debris that passed through it, but gently, so That's what I thought, but apparently what happens is that the fragment shatters, and most of the pieces carry on at almost the same velocity, while just a few are significantly slowed. Essentially your impactor drills a hole through the fragment almost instantly, slowing down only the material actually excavated from the hole. Later, the shock waves propagate sideways through the fragment, shattering it. If the object you send to collide with the dangerous debris is not in orbit before the collision then it can't be in orbit after the collision. I think a cloud of gas might do the trick, deployed from a sounding rocket, fired straight up from the ground. It's an interesting idea. I think the problem is aiming it; it's essentially the same problem as anti-satellite or anti-missile weapons. Unless your sounding rocket debris cloud is unreasonably large, it's very hard to get it in just the right spot. Why not use "fly paper" to catch the small stuff?Or a big net (same technology as solar sails)?Then when enough stuff is captured either burn it up by re-entry aimed at a deep trench in the Pacific, or send it into the sun. The Hubble is also Obsolete due to new technologies like Adaptive optics that allow ground based telescopes to achieve the same clarity as the Hubble. You can pull as many adaptive whatchamacallits out of the signal processing toolbox, but that doesn't change the simple fact that certain wavelengths will be absorbed by the atmosphere before they even get to your ground-based telescopes. You can pull as many adaptive whatchamacallits out of the signal processing toolbox, but that doesn't change the simple fact that certain wavelengths will be absorbed by the atmosphere before they even get to your ground-based telescopes. Certainly true, which is part of the reason newer space scopes focus on things like X ray or IR observation, rather than visible wavelengths. But, even at visible wavelengths, a space telescope can do some things a ground scope can't, like take a continuous week long expos Just as a data point, it cost something like a billion (1990) dollars to put Hubble into orbit, and over the life of the program, I think they're talking something like 6 billion total (including salaries for the folks who operate it and every other conceivable expense). Hubble's primary mirror is about 2.4 meters. There's currently a proposed project to build a thirty-meter terrestrial telescope, either in Hawaii or Chile, for about $1 billion. Since the trajectories of the debris will lie in a relatively narrow plane, it should be possible to device a barrier made of a plastic bag, shaped like a tube (open at both ends perpendicular to the plane of flying debris), and when inflated would make a tube like structure 6 inches thick and just slightly longer than the space shuttle and the Hubble combined. Fill the plastic cylinder full of water. The water freezes harder than steel. You now have an excellent barrier from the debris cloud while you work on Hubble. Now lift Hubble up a few thousand miles to get it out of harms way. After, you can move water to the ISS for safe keeping. I'm guessing they can put an extra couple thousand gallons to use for anything from experimentation and raising space crops to providing water for the first space hotel. Not to mention if that water has minerals in it, it can be used for everything from dietary supplementation to an emergency shield against high energy solar emissions. You can replace the tube with a wall; the debris is coming from a known direction. Doing that produces a wall roughly 125 feet by 60 feet by 6 inches. That's around 100,000 kg. The Shuttle can lift just shy of a quarter of that to low Earth orbit. Also, hypervelocity collisions don't behave like you think they do -- at the least you'd need a spall shield inside the ice shield; you probably need far more than that. Sorry, the brute force approach to impact shielding just doesn't work when random bits of p If you want something to cover the length (122.17 ft) and wingspan (78.06 ft) of the shuttle (I'm assuming the tube like device will have a squarish face to it) enough water to fill a 6 inch sheet would be 4768.2951 cubic feet of water! A gallon is.133680555 cubic feet, so that's 35,669.3259 gallons! A gallon of water is 8.33 pounds! That results in 297125.484 lbs. You want to add nearly 150 tons to the shuttle lift off? The shuttle only weighs 120 already! Sure, I'm not including for the fact that w Does anyone else worry about the day that some big asteroid is heading for earth? Then earthlings actually band together for once and reach consensus about firing a nuke toward the planet and all the scientists agree it'll work. But then it hits something in orbit as it heads out because all the launch windows are so complex just due to the stuff we've put up there? Russia and Iridium sue each other. Or perhaps one of the other sat owners sue them both (slim chance of that one). Either would cause other sat owners to re-think about just scrapping their sats. That would also lead to a new industry that would almost certainly be picked up by private enterprise (a sat de-orbit tug). Totally sux if we lose the hubble mission. I wonder if it is possible to develop a tug to bring it down and up, or one that could remotely do the job (that I really doubt). The collision happened at almost a right angle (see this diagram [nasa.gov]). As I understand it, the two satellites basically exploded into debris. While the center of mass of the cloud is mostly following a new trajectory based on the previous orbits, this cloud is probably expanding quickly in many directions. Many pieces were probably kicked out of the mostly circular orbits into highly elliptical ones, and therefore, could have apogees much higher than their original orbit.	Low	[ 0.508658008658008, 29.375, 28.375 ]
Tag Archives: facebook Olutayo is my immediate younger brother. Not sure why I haven’t put this up before now since we have had a Facebook page and a GoFundMe page for him for quite a while. The summary is that his kidneys failed … Continue reading → That morning Had a weird dream this morning. “”They were shooting Spider-Man in the house where I was. And they had this really tall steel structure with some attachment to the house. And the Spider-man was swinging around this. He of course had several … Continue reading →	Low	[ 0.37254901960784303, 21.375, 36 ]
INTRODUCTION {#s1} ============ As an activator of mitogen-activated protein kinase (MAPK)/ERK kinase (MEK) pathway and an effector of Ras, Raf is involved in many fundamental cellular processes such as cell proliferation, differentiation, cell death and survival, metabolism and motility \[[@R1]--[@R3]\]. The mammalian Raf kinase family includes A-Raf, B-Raf, and Raf1 (C-Raf). These proteins all have auto-inhibitory, regulatory, and catalytic domains, and contain multiple phosphorylation sites \[[@R4]\]. Among the three members, Raf1 has drawn the most attention since it was identified 30 years ago \[[@R5]\]. Raf1 has been widely reported as a key effector of the small G protein Ras, and after activation, Raf can phosphorylate MEK, which then activates ERK. ERK then phosphorylates an impressive roster of membrane, cytosolic, and nuclear targets to regulate numerous cell functions \[[@R6]\]. However, unlike B-Raf, Raf1 is not essential for ERK activation. During tumorigenesis, Raf1 interacts with different proteins to allow cross-talk between signaling pathways \[[@R7]\]. Protein phosphatase 2A (PP2A)/PP1 and members of the 14-3-3 family can interact with Raf1 to control its enzymatic activity \[[@R8], [@R9]\]. Heat shock protein 90 (HSP90) and its co-chaperone CDC37 have also been identified as Raf-associated proteins that are crucial for the maturation and activation of Raf1 \[[@R10]\]. Further research has identified more proteins that interact with and regulate the activity of Raf1. These proteins include p21-activated kinase (PAK3), serine/threonine kinase 3 (STK3), and protein kinase C (PKC) \[[@R11], [@R12]\]. However, the proteins interacting with Raf1 have not been fully elucidated. To explore the biological functions of Raf1, we aimed to create an overview of the Raf1 interactome. We enriched Raf1-interacting proteins under stable, MAPK-inactive conditions using co-immunoprecipitation. Then, we identified these interacting proteins using liquid chromatography--mass spectrometry (LC-MS). We uncovered 198 Raf1-interacting proteins and confirmed 12 of these interactions by western blotting. Gene ontology (GO) and pathway enrichment analysis indicated that these Raf1-protein interactions regulated six signaling pathways, and were involved in the ten known hallmarks of cancer. Our findings have deepened our understanding of Raf1 function, and offer potential oncological targets for studying specific Raf1 functions in the future. RESULTS {#s2} ======= Raf1 co-immunoprecipitated with 198 proteins {#s2_1} -------------------------------------------- To identify Raf1 interacting proteins, we induced VSV-Raf1 expression with doxycycline in Flp-in To-REx HEK293 cells containing VSV-Raf1 (Figure [1A](#F1){ref-type="fig"}). After doxycycline induction, cell lysates were precipitated with anti-VSV-glycoprotein-agarose beads. Exogenous VSV-Raf1 was effectively pulled down and very little VSV-Raf1 remained in the flow through (FT) line (Figure [1B](#F1){ref-type="fig"}). Immunoprecipitated proteins were separated by SDS-PAGE then observed by silver staining. As shown in Figure [1C](#F1){ref-type="fig"}, most of the Raf1 specific interacting proteins are concentrated in the ranges of 25∼35 KDa and 70∼130 KDa. Immunoprecipitated proteins were analyzed by LC−MS. In three independent experiments, 441, 297, and 478 Raf1 interacting proteins were identified. Comparison of these three data sets (Figure [1D](#F1){ref-type="fig"}) revealed 198 common putative Raf1 interacting proteins. This number was comparable with previously published work \[[@R13], [@R14]\]. The full list and details of these 198 proteins is presented in [Supplementary Table 1](#SD2){ref-type="supplementary-material"}. ![Identification of Raf1 interacting proteins in three independent experiments\ (A) Expression of VSV-tagged-Raf1 in Flp-In To-REx HEK293 cells. Cells were induced with 1μg/ml of doxycycline for 8, 12, 18, and 24 hours. VSV-RAF-1 and Raf1 (exogenous and endogenous) were detected using anti-VSV and anti-Raf1 antibodies, respectively. (B) VSV-Raf1 was immunoprecipitated with mouse anti-VSV-G antibody covalently bound to agarose beads and detected using an VSV antibody (L: lysate, FT: flow through). Flp-In To-REx cells not expressing VSV-Raf1 were used as negative controls (Con). (C) Samples from (B) were resolved by SDS-PAGE and observed by silver staining. Flp-In To-REx cells not expressing VSV-Raf1 were used as negative controls (Con). Specific Raf1 interacting proteins are indicated by a star\, two bands of IP were the some samples with two loading repeats (10μl/5μl). (D)* Venn diagram corresponding to proteins identified in three independent Raf1 immunoprecipitations. The overlapping 198 proteins correspond to proteins common to the three data sets (<http://bioinfogp.cnb.csic.es/tools/venny/>).](oncotarget-08-68329-g001){#F1} 182 out of these 198 proteins are novel Raf1-interacting proteins {#s2_2} ----------------------------------------------------------------- Based on the Raf1 mapping information obtained from the STRING database, we exported 69 experimentally validated interacting proteins that had a combined score of \>0.9 ([Supplementary Table 2](#SD3){ref-type="supplementary-material"}). These interacting proteins included H-RAS, N-RAS, K-RAS, AKT, and PAK1/2/3/4. We found that 16 of our 198 identified interaction partners had been reported previously. These were YWHAB, YWHAE, YWHAG, YWHAH, YWHAQ, YWHAZ, HSP90AA1, HSP90AB1, CDC37, KRAS, NRAS, HRAS, PPP2R1A, and BRAF (gene names) (Figure [2](#F2){ref-type="fig"}). ![Interaction network of proteins from the Raf1 interactome\ Novel interaction partners are identified by black lines and green nodes. Previously identified interaction partners are shown as red lines and yellow nodes.](oncotarget-08-68329-g002){#F2} Western blotting confirmed the reliability of Raf1-interacting proteins {#s2_3} ----------------------------------------------------------------------- To confirm the reliability of these 198 proteins, we selected 20 interacting proteins of different functions and examined the interaction by western blotting. We were able to confirm an interaction with Raf1 for 17 out of 20 (∼85%) selected Raf1 interacting proteins. We could not detect an interaction of AKAP8L, NDUFA4 or HAX1 with Raf1 by western blotting (Figure [3](#F3){ref-type="fig"}). ![Western blotting confirmed the interaction of 12 proteins with Raf1\ Twenty-four hours after doxycycline induction, VSV-Raf1 protein was immunoprecipitated from Flp-In To-Rex HEK293 cells expressing VSV-Raf1 (Raf1) with anti-VSV-G agarose beads. VSV-Raf1 associated proteins were detected by western blotting using the indicated antibodies. Flp-In To-Rex HEK293 cells containing the pcDNA5 empty vector (Non) were used as controls. GAPDH was immunoprecipitated as a negative binding control (LC-MS data showed that GAPDH did not interact with Raf1) and as a reference of equal loading.](oncotarget-08-68329-g003){#F3} Novel Raf1 interacting proteins were involved in many biological processes and distributed in different cellular components {#s2_4} --------------------------------------------------------------------------------------------------------------------------- DAVID software was utilized to identify GO categories and KEGG pathways in the 198 Raf1-interacting proteins. GO analysis showed that certain MFs were enriched for Raf1 interacting proteins, including pyrophosphatase activity, enzyme binding, protein kinase binding, GTPase activity, and heat shock protein binding. In addition, Raf1 interacting proteins were enriched in BPs, including positive regulation of metabolism, programmed cell death, cellular stress responses, chromosome organization, and cell-cell adhesion. In addition, GO CC analysis demonstrated significant enrichment for cell junction, mitochondrion, methyltransferase complex, nucleolus, and extracellular matrix proteins ([Supplementary Tables 3](#SD4){ref-type="supplementary-material"}--[5](#SD6){ref-type="supplementary-material"}). In Ingenuity Diseases and Bio Functions analysis, Raf1 interacting proteins were enriched to 15 bio functions which were all covered by GO analysis results. However, inductions and descriptions are slightly different between these two analyses ([Supplementary Table 7](#SD8){ref-type="supplementary-material"}). Raf1 interacting proteins contribute to all hallmarks of cancer {#s2_5} --------------------------------------------------------------- Ten hallmarks of cancer have been described by Hanahan and Weinberg (outlined in Table [1](#T1){ref-type="table"}) \[[@R15], [@R16]\]. These describe the acquired biological capabilities of cancer cells. We investigated the contribution of Raf1 interacting proteins to the hallmarks and states of cancer based on GO enrichment (BPs and MFs). Table [1](#T1){ref-type="table"} shows specific GO terms that apply to cancer hallmarks, including regeneration (GO: 0031099) and the ERBB2 signaling pathway (GO:0038128), which correlate with "evading growth suppressors". We confirmed that Raf1 interacting proteins are involved in all ten hallmarks of cancer. ###### Classification of Raf1 interacting proteins based on the hallmarks of cancer Hallmark Term GO term and function ----------------------------------- ------------------------------------ ------------------------------------------------------------------------------------------------------------------------------------------------------------ ![](oncotarget-08-68329-i001.jpg) Sustaining proliferative signaling GO: 0030518∼intracellular steroid hormone receptor signaling pathwayGO: 0038128∼ERBB2 signaling pathwayGO: 0048545∼response to steroid hormone ![](oncotarget-08-68329-i002.jpg) Evading growth suppression GO: 0031099∼regenerationGO: 0038128∼ERBB2 signaling pathway ![](oncotarget-08-68329-i003.jpg) Resisting cell death GO: 0012501∼programmed cell deathGO: 0010506∼regulation of autophagy ![](oncotarget-08-68329-i004.jpg) Enabling replicative immortality GO: 1903047∼mitotic cell cycle processGO: 0000723∼telomere maintenanceGO: 0010833∼telomere maintenance via telomere lengthening ![](oncotarget-08-68329-i005.jpg) Inducing angiogenesis GO: 0031100∼organ regeneration ![](oncotarget-08-68329-i006.jpg) Activating invasion and metastasis GO: 0098609∼cell-cell adhesionGO: 0045296∼cadherin binding ![](oncotarget-08-68329-i007.jpg) Genome instability and mutation GO: 0006281∼DNA repairGO: 0051276∼chromosome organization ![](oncotarget-08-68329-i008.jpg) Avoiding immune destruction GO: 0002253∼activation of immune response ![](oncotarget-08-68329-i009.jpg) Tumor-promoting inflammation GO: 0071353∼cellular response to interleukin-4GO: 0001817∼regulation of cytokine productionGO: 1902187∼negative regulation of viral release from host cell ![](oncotarget-08-68329-i010.jpg) Deregulating cellular energetics GO: 0044248∼cellular catabolic processGO: 0046034∼ATP metabolic process Raf1 interacting proteins were enriched in 6 signal pathways and 15 diseases {#s2_6} ---------------------------------------------------------------------------- [Supplementary Table 6](#SD7){ref-type="supplementary-material"} shows the pathways in which Raf1 interacting proteins were most significantly enriched based on KEGG pathway analysis. The results were divided into three categories: biological functions, cellular signaling pathways, and diseases. Interacting proteins were most enriched in the following biological functions: cell cycle, oocyte meiosis, gap junctions, long-term potentiation, long-term depression, progesterone-mediated oocyte maturation, and pathogenic Escherichia coli infection. Raf1 interacting proteins were significantly enriched in the ErbB, FoxO, PI3K-Akt, Hippo, insulin, and estrogen signaling pathways. Regarding human diseases, Raf1-interacting proteins were mainly enriched in different cancers, including endometrial cancer, renal cell carcinoma, glioma, prostate cancer, thyroid cancer, melanoma, bladder cancer, leukemia, and non-small cell lung cancer. Viral infections were also enriched, including hepatitis C/B, Epstein-Barr virus, and viral carcinogenesis. According to Ingenuity Canonical Pathways analysis and Ingenuity Diseases analysis, Raf1 interacting proteins were enriched to 157 signal pathways and 18 diseases due to its broad classification criteria ([Supplementary Tables 7](#SD8){ref-type="supplementary-material"}, [9](#SD10){ref-type="supplementary-material"}). DISCUSSION {#s3} ========== The goal of the present work was to decode Raf1 functions and get a global review of its biological role in cell processes, especially in carcinogenesis. We identified 198 Raf1 interacting proteins using in vitro VSV-tagging (Figure [2](#F2){ref-type="fig"}) and 14 of these had been reported previously reported to interact with Raf1. Among these 14 proteins, six belong to the 14-3-3 family (gene names: YWHAB, YWHAE, YWHAG, YWHAH, YWHAQ, and YWHAZ), which is well known to regulate Raf1 activity by phosphorylation and which is a highly conserved protein family that regulates many cellular processes such as proliferation, differentiation, apoptosis, and the cell cycle \[[@R17]\]. Three of the 14 previously identified binding proteins belong to the molecular chaperones (gene name: HSP90AA1, HSP90AB1, and CDC37), which are necessary for stabilizing the tertiary structure of Raf1 \[[@R18]\]. As the signal generator of Raf1, K/N/HRAS proteins were found to interact with Raf1 at high abundance in the interaction databases. The protein phosphatase PP2Aα, which is responsible for Raf1 inactivation, was also identified as an important Raf1-interacting protein \[[@R19]\]. The activation of Raf1 relies on Ras-dependent dimerization, including both homo- and hetero-dimerization \[[@R20]\]. Thus, we have also detected all three Raf variants among the Raf1-interacting proteins. Actually, two addition Raf1-interacting proteins recorded in Ingenuity Knowledge Base are A-Raf and Raf1 itself ([Supplementary Table 8](#SD9){ref-type="supplementary-material"}). These data suggest we may find new Raf1 functions from newly identified 182 proteins. We verified our LC-MS data by confirming the interaction of selected binding partners with Raf1 by western blotting. To avoid selection bias, we chose proteins with different cellular locations, including the plasma membrane (IRS4, BAG4, CDK1 and PSMC2), mitochondria (AIF and ANT2), endoplasmic reticulum (GRP78 and RCN1/2), nucleus (KAP1, RUVB1/2, SMC3, PARP and TIM50), and peroxisomes (FAR1). In addition, selected proteins had independent roles in apoptosis, cell metabolism, cell proliferation, cell adhesion, DNA repair, protein scaffolding, and embryonic development \[[@R21]--[@R29]\]. Furthermore, we had access to good quality antibodies to detect these proteins. We confirmed an interaction with Raf1 for all selected proteins except AKAP8L, NDUFA4 and HAX1. This may be explained by the low sensitivity of the western blotting assay. GO enrichment analysis revealed that many Raf1 interacting partners are involved in programmed cell death, cellular stress responses, and cell-cell adhesion. These findings may help to elucidate how Raf1 regulates these processes. We also found that Raf1 interacts with FAR1 and IRS4, suggesting that Raf1 may participate in lipid metabolism by protein interacting \[[@R28]\]. KEGG pathway analysis ([Supplementary Table 6](#SD7){ref-type="supplementary-material"}) indicated that Raf1 is involved in 10 biological functions, six cell signaling pathways, and 14 human diseases. Some of these findings were not reported previously and may provide novel insights into Raf1 functions. To gain further insight into the role of Raf1 in cancer, we investigated whether the identified Raf1 interacting proteins are involved in the ten hallmarks of cancer (described in Table [1](#T1){ref-type="table"}). Our findings showed that Raf1 sustains cell proliferation through interactions with proteins involved in hormone responses, growth signal transduction, and evasion of growth suppressors. Furthermore, Raf1 promotes resistance to apoptosis and autophagy in cancer cells, and enhances replicative immortality by regulating telomere maintenance. Raf1 has also been implicated in organ regeneration, therefore may induce angiogenesis, which is essential for tumor growth. The invasion and metastasis of cancer cells is controlled by changes in cell-cell adhesion. Therefore, the regulation of cell-cell adhesion by Raf1-interacting proteins may explain how Raf1 promotes tumor malignancy. Genome instability and gene mutations are hallmarks of cancer. Our findings indicated that Raf1 can promote DNA repair and chromosome organization through interactions with novel binding partners. We also observed that Raf1 interacting partners are involved in immune response activation and the response to interleukins. These interactions may allow host cells to avoid immune destruction and respond to tumor-promoting inflammation. Furthermore, Raf1 interactions control cellular catabolism and ATP metabolism to maintain the strong proliferative ability of cancer cells. Taken together, these findings suggest that Raf1 plays a more widespread role in carcinogenesis than was previously reported. KEGG pathway analysis showed that novel Raf1-interacting proteins are also involved in cell signaling pathways and the development of various diseases, including endometrial cancer, which has not been reported previously. We found that the Raf1-interacting proteins AIFM1, DDX17, DDX5, DNAJA1, HNRNPU, HSPD1, KRAS, PARP1, RBM14, RPL32, and YWHAH (gene name) may contribute to the response to steroid hormones, especially estrogen. This suggests a mechanism for Raf1 in endometrial cancer. In conclusion, we have identified 198 Raf1 interacting proteins and verified 17 of these by western blotting. The identified Raf1 interacting proteins were involved in all hallmarks of cancer, highlighting the importance of Raf1 in carcinogenesis. Much remains to be learned about Raf1 functions and the present study has identified putative candidates for future investigations. Furthermore, our findings provide a useful overview of Raf1 function from a systematic biology perspective. MATERIALS AND METHODS {#s4} ===================== Materials {#s4_1} --------- Doxycycline, monoclonal mouse anti-VSV-G antibody, and anti-VSV-G agarose beads were purchased from Sigma-Aldrich (Gillingham, United Kingdom). Lipofectamine 2000 transfection reagent was purchased from Invitrogen (Paisley, United Kingdom). Protease inhibitor cocktail tablets were purchased from Millipore (Massachusetts, United States). Anti-BAG4, anti-FAR1, anti-PP2Aα, anti-TIM50, anti-AKAP8L, anti-PSMC2, anti-SMC3 and anti-GAPDH antibodies were purchased from Santa Cruz (Heidelberg, Germany). Anti-Raf1, anti-AIF, anti-HAX1, and anti-GRP78 antibodies were purchased from BD Biosciences (Oxford, United Kingdom). The anti-ANT2 antibody was purchased from Cell Signaling Technology (Hitchin, Hertfordshire, United Kingdom). Anti-IRS4, anti-KAP1, anti-RCN1, anti-NDUFA4 and anti-RCN2 antibodies were purchased from Abcam (Cambridge, United Kingdom). Anti-VSV antibody was from sigma Sigma-Aldrich (Gillingham, United Kingdom). Anti-RUVB1 and anti- RUVB 2 antibodies were from Proteintech (Illinois, United States). Cell culture {#s4_2} ------------ Flp-In To-Rex HEK293 cells were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS), 100 μg/mL zeocin, and 15 μg/mL blasticidin. Stable Flp-In To-Rex HEK293 cells inducibly expressing VSV-Raf1 were maintained in DMEM supplemented with 10% (vol/vol) FBS, 50 μg/mL hygromycin, and 15 μg/mL blasticidin. Generation of stable Flp-In TO-REx HEK293 cells inducibly expressing VSV-Raf1 {#s4_3} ----------------------------------------------------------------------------- VSV-Raf1 was amplified by PCR and inserted between BamHI and XhoI sites of pcDNA5/FRT/TO. The primers were as follows: Forward (VSV-G sequence and BamHI site underlined) CG [GGATCC]{.ul} GCC ACC ATG TAC ACC GAT ATA GAG ATG AAC CGC CTT GGA AAG GAG CACAT ACA GGG AGC TTG GAA; reverse (XhoI site underlined) CCG [CTCGAG]{.ul} CTA GAA GAC AGG CAG CCT CGG. To generate stable Flp-In To-Rex HEK293 cells that inducibly express VSV-Raf1, cells were transfected with a mixture of VSV-Raf1 cDNA in pcDNA5/FRT/TO vector and the pOG44 vector (1:9) using Lipofectamine 2000 transfection reagent, according to the manufacturer's instructions. Resistant clones were selected by replacing zeocin with 200 μg/mL hygromycin B. VSV-Raf1 expression was induced by treating cells with 1 μg/mL doxycycline for 24 h and confirmed by western blotting using an anti-VSV antibody. Identification of VSV-Raf1-interacting proteins by mass spectrometry {#s4_4} -------------------------------------------------------------------- VSV-Raf1 was induced by 1 μg of doxycycline/ml in Flp-in To-REx HEK293 cells. After 24 hours of induction, cells were harvested and resuspended in immunoprecipitation buffer (150 mM NaCl, 0.01 mM NaPO~4~, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol, and protease inhibitor cocktail tablets). Doxycycline induction was performed in Flp-In To-REx 293 cells transfected with a pcDNA5 empty vector as a negative control. The cell pellets were lysed and centrifuged for 15 min at 20,000 g at 4°C, and the supernatant was transferred to a fresh tube. Equal amounts of protein were incubated with anti-VSV-G agarose beads (Sigma) at 4°C for 3 h on a rotating wheel. After incubation, samples were washed four times with immunoprecipitation buffer. Proteins were eluted from the beads by vortexing and boiling for 7 min in SDS buffer. Raf1 interacting proteins were detected and analyzed as previously described. Briefly, protein samples were digested with trypsin overnight at 37°C. Then, the peptide mixture was desalted and concentrated using a Peptide Microtrap (MW0.5--50 kDa, 0.5mm × 2 mm, Michrom Bioresources, CA, USA). The prepared sample (10 μL) was loaded onto a hybrid linear ion trap (LTQ) Orbitrap mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) equipped with ADVANCE Spray Source (Michrom Bioresources, CA) and reversed-phase capillary column (0.1 mm × 150 mm, packed with 5 μm 100Å Magic C18 resin, Michrom Bioresources, CA, USA) with an auto-sampler (HTS-PAL, CTC Analytics, Zwingen, Switzerland) at a flow rate of 1 μL/min for 15 min. Other parameters and conditions were as previously described \[[@R30]\]. Western blot analysis {#s4_5} --------------------- We performed SDS-PAGE and immunoblotting as previously described \[[@R31]\]. For each sample, 30 μg of protein was separated by SDS-PAGE on 10--15% gels and transferred onto polyvinylidene difluoride membranes. Membranes were blocked in skimmed milk overnight at 4°C before incubating with primary antibodies followed by peroxidase-conjugated anti-mouse or anti-rabbit IgGs. The epitopes were detected using an enhanced chemiluminescence western blot detection kit. GO enrichment and KEGG pathway analysis {#s4_6} --------------------------------------- GO enrichment and KEGG pathway analysis were performed using the DAVID (<https://david.ncifcrf.gov/>) online tool. A P value of \<0.05 was considered statistically significant. GO analysis revealed a significant enrichment in biological processes (BP), molecular function (MF), and cell component (CC) terms. KEGG (<http://www.genome.jp/kegg/>) systematically analyzed gene functions and linked genomic information with higher-order functional information. Additional functional annotations of the identified proteins were performed using the Ingenuity pathway analysis software. Integration of the protein--protein interaction (PPI) network {#s4_7} ------------------------------------------------------------- The Search Tool for the Retrieval of Interacting Genes (STRING) database is an online tool designed for evaluating protein--protein interaction (PPI) information. STRING (version 10.0) covers 9,643,763 proteins from 2031 organisms. To evaluate the interactive relationships of Raf1-interacting proteins, we mapped Raf1 to STRING. We only experimentally validated interactions with a combined score of \>0.9, which were selected as significant. Then, PPI networks were constructed using Cytoscape software (version 3.4.0). SUPPLEMENTARY MATERIALS TABLES {#s5} ============================== This work was funded by NSFC funding (U1302225, 81460417, 81460253, 81473342, 81560455), High-End Talent Grant of Yunnan Province, China (2012HA008) and Scientific Research Grant of Education Department of Yunnan Province, China (2015Y046). The work is partial conducted in University Based Provincial Key Laboratory of Screening and Utilization of Targeted Drugs. Author contributions YH and TX initiated and wrote most of the paper; XG, BH and XMZ contributed the revision of the paper; SA, XYZ, YY, YL and QH took part in writing and language editing of the paper. All authors approved the final vision of the manuscript. CONFLICTS OF INTEREST No conflicts of interest was declared. Raf : RAF proto-oncogene serine/threonine-protein kinase MAPK : mitogen-activated protein kinase MEK : mitogen-activated protein kinase kinase ERK : extracellular signal regulated kinase PP2A : protein phosphatase 2A HSP90 : heat shock protein 90 CDC37 : cell division cycle 37 PAK : p21-activated kinase STK3 : serine/threonine kinase 3 PKC : protein kinase C LC-MS : liquid chromatograph mass spectrometer AKT : serine/threonine kinase 1 AIF : apoptosis inducing factor FAR1 : fatty acyl-CoA reductase1 KAP1 : transcription intermediary factor 1-beta RCN1/2 : reticulocalbin-1/2 TIM50 : mitochondrial import inner membrane translocase subunit TIM50 ANT2 : ADP/ATP translocase 2 BAG4 : BAG family molecular chaperone regulator 4 GRP78 : 78 kDa glucose-regulated protein IRS4 : insulin receptor substrate 4 RUVB1 : RuvB-like 1 RUVB2 : RuvB-like 2 AKAP8L : A-kinase anchor protein 8-like HAX1 : HCLS1-associated protein X-1 CDK1 : cyclin-dependent kinase 1 PARP : poly (ADP-ribose) polymerase 1 PSMC2 : 26S protease regulatory subunit 7 SMC3 : structural maintenance of chromosomes protein 3 NDUFA4 : cytochrome c oxidase subunit NDUFA4.	Mid	[ 0.5819672131147541, 26.625, 19.125 ]
REQUIRES PORTAL 2. A companion mod to the 7-part interview series at Rock Paper Shotgun that focuses on discussing level design and process. You could also call it an "interview mod," I guess. Or maybe it's one of those dreaded art mods? I'll let you decide how to label it, but given the choice, talking about the game rarely matters as much as playing it. So just play it. (This mod was sponsored by Rock Paper Shotgun; built and compiled by Robert Yang; contributors are Dan Pinchbeck, Jack Monahan, Magnar Jenssen, Brendon Chung, Davey Wreden, Ed Key, and Richard Perrin.)	Low	[ 0.519650655021834, 29.75, 27.5 ]
Q: How to build new columns based on the unique initial letters from a dataframe pandas I have thousands of hostname, those i want to be assigned into different columns based on their first initial three letters. I see this can be done if its small list ans i know the initial letters but i have huge list. I have google a lot but did not get any proper hint, tried df.assign but that's something not great fit. Example hostname: fox001 fox002 fox003 fox004 fox005 fox006 dbx001 dbx002 dbx003 dbx004 dbx005 dbx006 trd001 trd002 trd003 trd004 trd005 trd006 spl001 spl002 spl003 spl004 spl005 spl006 What is expected: fox_host db_host trd_host spl_host (<-- column names) fox001 dbx001 trd001 spl001 fox002 dbx002 trd002 spl002 fox003 dbx003 trd003 spl003 fox004 dbx004 trd004 spl004 fox005 dbx005 trd005 spl005 fox006 dbx006 trd006 spl006 my dataframe: df = pd.read_csv('inventory_hostanme',header=None).rename( columns={ 0:"hostnames"}) print(df) hostnames fox001 fox002 fox003 fox004 fox005 fox006 dbx001 dbx002 dbx003 dbx004 dbx005 dbx006 trd001 trd002 trd003 trd004 trd005 trd006 spl001 spl002 spl003 spl004 spl005 spl006 A: Use Series.groupby to group the column hostnames on the first three letters of the host value, then use pd.concat along axis=1 to concat each of the grouped dataframe creating a new dataframe with separate columns for each hosts: hosts = pd.concat([ g.rename(f'{k}_host').reset_index(drop=True) for k, g in df['hostnames'].groupby(df['hostnames'].str[:3])], axis=1) Result: # print(hosts) dbx_host fox_host spl_host trd_host 0 dbx001 fox001 spl001 trd001 1 dbx002 fox002 spl002 trd002 2 dbx003 fox003 spl003 trd003 3 dbx004 fox004 spl004 trd004 4 dbx005 fox005 spl005 trd005 5 dbx006 fox006 spl006 trd006	High	[ 0.660714285714285, 37, 19 ]
Break Time at School Essay There is no greater relief than hearing the bell heralding the recess period. All the students rush out from their classrooms shouting and laughing. Once out in the compound, everybody is busy playing and eating. Students run here and there. They do not observe any discipline then. Both the teachers and the students wait for the period eagerly. They refresh themselves and feel relaxed after the continuous work in three-four periods. Students play games and forget about their books. But some students make use of the time to copy homework from others’ notebooks. Such students do not work at home. Some students sit in different corners of the ground and discuss their favourite topics. Small disputes and exchange of hot words are not very uncommon. In the recess period, the school canteen is full of life. There are long queues to get eatables like samosas, bread-pakoras sandwiches and patties. Students prefer to sit in the canteen and have tea and cold drinks. Teachers sit in the staff room eating and talking They also relax and prepare themselves for the remaining periods to start	Low	[ 0.507633587786259, 33.25, 32.25 ]
Ex-Subway Pitchman Fogle’s Appeal Of Sentence In Colorado Rejected INDIANAPOLIS (AP) — A federal appeals court rejected former Subway pitchman Jared Fogle’s appeal of his sentence of more than 15 years in prison Thursday for child pornography offenses and illicit sexual conduct with a child. A three-judge panel of the 7th U.S. Circuit Court of Appeals affirmed the 188-month sentence handed down by U.S. District Judge Tanya Walton Pratt in Indianapolis. Fogle, 38, pleaded guilty in November to one count each of distributing and receiving child porn and traveling to engage in illicit sexual conduct with a child. That came four months after FBI agents raided his suburban Indianapolis home in an investigation that ended Fogle’s lucrative endorsement career with Subway, which started after he lost more than 200 pounds in college, partly by eating Subway sandwiches. As part of a plea deal, prosecutors agreed not to seek more than 12½ years behind bars, and Fogle’s attorney, Ron Elberger, argued Pratt abused her authority by giving him a sentence three years longer than that. Elberger argued before the appeals court that Pratt was unduly influenced by Fogle’s relationship with Russell Taylor, the former director of Fogle’s foundation convicted of producing child pornography. Elberger also argued Pratt based its sentence on Fogle’s fantasies rather than his actual conduct and that she based the sentence on his acquisition and viewing of pornography depicting children as young as 6 years old. “In light of the district court’s sound exercise of discretion under the disturbing facts of this case, we uphold the above-guidelines sentence as substantively reasonable,” said the opinion written by Judge Joel Flaum. A message seeking comment was left for Elberger at his office. Fogle admitted that he paid for sex at New York City hotels with girls who were 16 or 17 years old and that he had received some child pornography produced by Taylor. Fogle also paid a total of $1.4 million to his 14 victims, with each getting $100,000. Fogle is serving his sentence at the low-security Federal Correctional Institution Englewood in suburban Denver. Taylor, who headed the foundation Fogle started to fight childhood obesity, was sentenced in December to 27 years in prison after pleading guilty to 12 counts of child exploitation and one count of distributing child pornography. Prosecutors say Taylor used hidden cameras in his Indianapolis-area homes to secretly video minors.	Low	[ 0.516877637130801, 30.625, 28.625 ]
September 23, 2012 A Morning at the Heritage Breed Poultry Swap TODAY'S SWAP, WHICH WAS HELD IN LANCASTER, MASSACHUSETTS WAS ORGANIZED BY THE NEW ENGLAND BANTAM CLUB With state fairs and poultry shows ending for the season, local poultry clubs often hold poultry auctions or swaps, where everyone from backyard urban farmers to those who raise poultry for trade and market, sell their stock. Poultry swops are terrific places to meet other poultry enthusiasts, and if you are just starting with your own flock, these are often the best places to get advice and make connections locally with experts. THE SILVER GREY DORKING, A HERITAGE BREED CHICKEN RAISED FOR NEARLY 2000 YEARS, IS BEST AS A MEAT CHICKEN, THAN AS A LAYER OF EGGS. THEY ARE DOCILE, AND EAT LESS THAN MOST BREEDS If you've been thinking about getting a few hens for your backyard garden, an autumn poultry swap and sale may be the best way to start. At swaps, you can see and purchase many breeds and types chickens often sold in matched pairs, but such swaps are not just limited to chickens. Most offer a selection of every type of poultry found on a farm, often heirloom breeds, and more unusual types of heritage breed turkeys, ducks, geese, pigeons and other fowl. PYNCHEON BANTAMS, KNOWN TO BE AMONG THE RAREST OF ALL BANTAM BREEDS, ARE NO LARGER THAN A PIGEON. THE BREED IS SO OLD, THAT NATHANIEL HAWTHORNE EVEN WROTE ABOUT THEIR RARITY IN 1850, SAXON PRIEST PIGEONS, A RARE BREED NOT COMMONLY SEEN OUTSIDE OF PIGEON SHOWS A SELECTION OF VINTAGE POULTRY SUPPLIES FOR SALE A RARE BLUE SLATE HERITAGE BREED OF TURKEY CATCHES A HOME RIDE IN AN SUV THIS VINTAGE POULTRY CRATE WAS TOO FINE NOT CAPTURE. THERE WERE MANY OLD WOODEN CRATES AT THIS SHOW. SILKIE BANTAMS ARE ALWAYS POPULAR - THEY ARE THE POODLES OF CHICKENS AT HOME, ONCE WE RELEASED THE NEW BARRED ROCKS INTO THE PHEASANT COOP, I NOTICED THAT THE LADY AMHERST PHEASANTS HAVE GROWN BACK INTO THIER FINERY AGAIN, AFTER MOULTING IN JUNE. LADY AMHERST PHEASANTS HAVE STRIKING PATTERNS IN THEIR FEATHERS, WHICH MAKE THEM A FAVORITE WITH FLY TIEING ENTHUSIASTS	Mid	[ 0.59090909090909, 35.75, 24.75 ]
Q: Render a View Script to a Variable How can I render a view script into a variable within an action controller? I want to render a view and insert it into a database table as a string. I am using Zend Framework 1.11 A: From your controller you can do: $view = new Zend_View(); $view->some_var = "some_value"; // ... more variable assignments $output = $view->render('some script'); Then you can store $output in your database. A: Simply use: $output = $this->view->render('controller/action.phtml');	Mid	[ 0.6060606060606061, 32.5, 21.125 ]
North Woodbridge, California North Woodbridge was a former census-designated place (CDP) in San Joaquin County, California, United States. The population was 1,320 at the 2000 census. For the 2010 census, the CDP's of South Woodbridge and North Woodbridge were merged into Woodbridge. Geography North Woodbridge is located at (38.160369, -121.308981). According to the United States Census Bureau, the CDP had a total area of , of which, of it was land and of it (3.58%) was water. Demographics As of the census of 2000, there were 1,320 people, 492 households, and 417 families residing in the CDP. The population density was 490.4 people per square mile (189.5/km²). There were 498 housing units at an average density of 185.0 per square mile (71.5/km²). The racial makeup of the CDP was 92.05% White, 0.08% African American, 0.76% Native American, 3.11% Asian, 0.08% Pacific Islander, 0.53% from other races, and 3.41% from two or more races. Hispanic or Latino of any race were 6.74% of the population. There were 492 households out of which 35.8% had children under the age of 18 living with them, 78.9% were married couples living together, 3.5% had a female householder with no husband present, and 15.2% were non-families. 11.6% of all households were made up of individuals and 4.3% had someone living alone who was 65 years of age or older. The average household size was 2.68 and the average family size was 2.93. In the CDP, the population was spread out with 25.0% under the age of 18, 4.7% from 18 to 24, 22.6% from 25 to 44, 33.6% from 45 to 64, and 14.1% who were 65 years of age or older. The median age was 44 years. For every 100 females, there were 91.3 males. For every 100 females age 18 and over, there were 91.9 males. The median income for a household in the CDP was $79,417, and the median income for a family was $87,285. Males had a median income of $62,250 versus $50,500 for females. The per capita income for the CDP was $45,693. About 2.8% of families and 3.8% of the population were below the poverty line, including 3.2% of those under age 18 and none of those age 65 or over. References Category:Former census-designated places in California Category:Populated places in San Joaquin County, California	Low	[ 0.533073929961089, 34.25, 30 ]
HOCKENHEIM, Germany -- Mercedes has confirmed Lewis Hamilton's suspicion that the car issue which saw him eliminated from Q1 in Germany started moments before he ran wide at Turn 1. In the closing stages of the opening qualifying session, Hamilton ran wide at the opening corner and across the kerbs. He immediately encountered car trouble as hydraulic fluid started leaking from his car, forcing him to stop on track, meaning he could not continue in qualifying despite comfortably progressing through to Q2. When asked by Sky Sports after the session if that mistake had caused the issue, Hamilton said: "No, we use the kerb the same every lap. We got to the kerb and just before the kerb the steering broke, so that was the issue." Speaking immediately after the session, team boss Toto Wolff suspected the jumps over the kerb had been the cause of the issue, but after an investigation the team later confirmed they were a result of the hydraulic leak. "We had a failure at Turn 1 as Lewis ran the 'normal' kerb which all the drivers use in that stage of qualifying," a Mercedes spokesperson confirmed. "Then, with failed power steering as a result of the hydraulic failure, he had the 'jumping' moments that were seen on TV and which people understandably thought might have been the cause of the issue -- but were in fact a consequence of it." Hamilton looked dejected after the stoppage, kneeling alongside his car in similar fashion to his famous reaction after an engine failure robbed him of victory of 2016 Malaysian Grand Prix -- the moment widely regarded as costing him that year's championship.	Mid	[ 0.550387596899224, 35.5, 29 ]
Q: Parse two elements with same name android I'm a bit new to XML and Android development... I've encountered this issue where I need to parse an XML where the elements are the same and include that with the overall element. It's a bit hard to explain, see code below: <tns:camera> <tns:congestionLocations> <tns:congestion>Free Flow</tns:congestion> <tns:direction>Eastbound</tns:direction> </tns:congestionLocations> <tns:congestionLocations> <tns:congestion>Free Flow</tns:congestion> <tns:direction>Westbound</tns:direction> </tns:congestionLocations> <tns:description>Bond St looking east</tns:description> <tns:direction>Eastbound</tns:direction> <tns:group>SH16-North-Western</tns:group> <tns:lat>-36.869</tns:lat> <tns:lon>174.746</tns:lon> <tns:name>SH16 1 Bond St</tns:name> <tns:viewUrl>http://www.trafficnz.info/camera/view/130</tns:viewUrl> </tns:camera> Basically, I need to parse the overall element (tns:camera) and include the congestion locations (seperated from each other obviously), but within the same class as i will be using all of them in a listview... How would I achieve this? At present, I am using the Pull Parser, and parsing it into a class object PullParser code: case XmlPullParser.END_TAG: if (tagname.equalsIgnoreCase(KEY_SITE)) {current Site CameraSites.add(curCameraClass); } else if (tagname.equalsIgnoreCase(KEY_DESCRIPTION)) { curCameraClass.setDescription(curText); }else if (tagname.equalsIgnoreCase(KEY_NAME)) { curCameraClass.setName(curText); } break; Kind Regards! A: Try this.. NodeList nodeList = doc.getElementsByTagName("tns:camera"); for (int i = 0; i < nodeList.getLength(); i++) { Node node = nodeList.item(i); Element fstElmnt = (Element) node; NodeList nameList = fstElmnt.getElementsByTagName("tns:group"); Element nameElement = (Element) nameList.item(0); nameList = nameElement.getChildNodes(); System.out.println("tns:group : "+((Node) nameList.item(0)).getNodeValue()); Element fstElmnt1 = (Element) node; NodeList nameList1 = fstElmnt1.getElementsByTagName("tns:viewUrl"); Element nameElement1 = (Element) nameList1.item(0); nameList1 = nameElement1.getChildNodes(); System.out.println("tns:viewUrl : "+ ((Node) nameList1.item(0)).getNodeValue()); //same as use to all tns:description,tns:direction and tns:lat etc., if(node.getNodeType() == Node.ELEMENT_NODE) { Element e = (Element) node; NodeList resultNodeList = e.getElementsByTagName("tns:congestionLocations"); int resultNodeListSize = resultNodeList.getLength(); for(int j = 0 ; j < resultNodeListSize ; j++ ) { Node resultNode = resultNodeList.item(j); if(resultNode.getNodeType() == Node.ELEMENT_NODE) { Element fstElmnt2 = (Element) resultNode; NodeList nameList2 = fstElmnt2.getElementsByTagName("tns:congestion"); Element nameElement2 = (Element) nameList2.item(0); nameList2 = nameElement2.getChildNodes(); Log.v("tns:congestion", ""+((Node) nameList2.item(0)).getNodeValue()); Element fstElmnt3 = (Element) resultNode; NodeList nameList3 = fstElmnt3.getElementsByTagName("tns:direction"); Element nameElement3 = (Element) nameList3.item(0); nameList3 = nameElement3.getChildNodes(); Log.v("tns:direction--", ""+((Node) nameList3.item(0)).getNodeValue()); } } } }	Low	[ 0.535962877030162, 28.875, 25 ]

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.