text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
listlengths 3
3
|
|---|---|---|
NY futures collapsed further this week, as December dropped another 273 points to close at 66.74 cents. The December contract looks like it fell over a cliff ever since it broke below crucial support at just over 72 cents. Today marked the 10th consecutive lower close for a combined loss of 636 points. Even more dramatic is the drop from the May 15 high, when the spot month at the time (July contract) was trading as high as 88.40 cents synthetically. Just five-and-a-half weeks later the current spot month (Dec contract) is trading nearly 2200 points lower. However, while the futures market has experienced these extreme swings, the cash market has seen a much more moderate trading range of around 7-10 cents during the same time frame, depending on the growth. While the exacerbated move to the high 80s was fueled by short covering, the current selloff has been the result of aggressive spec and trade selling. The first wave down was clearly caused by spec long liquidation in July, as July open interest was melting away rapidly, while Dec open interest was still going up. However, July was pulling Dec down with it and this caused the trade to hasten its new crop short hedging, which eventually forced Dec through support and led to the precipitous fall we have witnessed over the last ten sessions. In the first nine sessions of this decline December open interest actually went up by around 1.6 million bales to over 16.0 million bales! The scary thing is that spec long liquidation in December might still be ahead of us and today we probably saw the first wave of spec longs headed for the exit. The current open interest in December is the second highest ever for this day, surpassed only marginally by the 16.2 million bales that were open in 2008. Therefore, if speculators, many of which are guided by algorithms, were to hit the ‘flush’ button, then this selloff might have a lot further to go. Today was a great example of the divergence between supportive fundamentals and speculators that couldn’t care less, when a massive export sales report was shrugged off by the market and prices continued to collapse. US export sales for the week that ended on June 15 were surprisingly strong at 652,300 running bales combined, of which 177,000 bales were basically for prompt shipment (June/July). There were a total of 17 markets participating in the buying, although Vietnam and China accounted for the lion’s share. Shipments of 266,300 running bales were still above the pace needed to reach the current USDA estimate of 14.5 million statistical bales. Total sales for the current season have now reached 15.2 million statistical bales, of which 13.05 million bales have already been exported. Commitments for August onward shipment have already reached 4.1 million statistical bales, of which a substantial amount will be shipped from existing inventories. This brings us to the certified stock, which has kept building in recent weeks and currently measures nearly 488,000 bales. According to our calculation the unsold balance of the 2016/17 crop is down to around 0.4 million bales, although this number could vary by several hundred thousand bales depending on how many of the August onwards commitments are being shipped out of existing stocks. Nevertheless, we are getting to a point of being technically sold out and we believe that most of the certified stock is already part of existing sales. It will therefore be interesting to see what happens when July goes into its notice period next week. If the certified stock remains with current owners or if some takers were to emerge, it could send a bullish signal to the market and serve as a warning to the many December bears. So where do we go from here? After a parabolic move to the upside last month, we now have a similar situation to the downside. Given the still sizeable spec net long position in December this selling pressure could persist as long as speculators feel a need to get out of the cotton market. We have seen similar moves in other soft commodities recently, be it sugar, coffee or cocoa. Also, when markets are in liquidation mode they can remain in “extreme oversold” conditions for quite a while and therefore momentum indicators need to be viewed with some caution. The best hope for the bulls is that next week’s notice period will serve as a reality check and remind the market that a) we are sold out of current crop and b) new crop is still a long way from being made. Although West Texas has seen a few thunderstorms yesterday and is expecting more moisture over the weekend, the crop still has a lot of weather to negotiate. The same goes for parts of the Mid-South and Southeast, where many fields have been inundated with too much moisture in recent weeks. We understand that in Alabama some fields have actually been wiped out by flooding. This may not matter much to speculators who feel trapped on the wrong side of the primary trend, which is now clearly down. We therefore have not way of knowing where the bottom of this powerful selloff is. This Market Report may not be reproduced without the prior written consent of Plexus Cotton. Sharing and/or quotation of the excerpt paragraph (as presented on the Market Report landing page) accompanied by attribution to Plexus Cotton and/or link to the full report, is permitted. | Low | [
0.532051282051282,
31.125,
27.375
]
|
The Dow Jones Industrial Average closed at a record, adding more than 200 points to its election-week rally as investors scooped up shares of large banks and manufacturers. The moves partly reflected expectations that a Trump administration would push to scale back financial regulation and increase government spending in a bid to boost economic growth. J.P.... | Low | [
0.485327313769751,
26.875,
28.5
]
|
New dual descriptor for chemical reactivity. In this paper, a new dual descriptor for nucleophilicity and electrophilicity is introduced. The new index is defined in terms of the variation of hardness with respect to the external potential, and it is written as the difference between nucleophilic and electrophilic Fukui functions, thus being able to characterize both reactive behaviors. It is shown that the new descriptor correctly predicts the site reactivity induced by different donor and acceptor groups in substituted phenyl molecules. Also, the Dunitz-Burgi attack on ketones and aldehydes has been revisited to illustrate the stereoselective capability of this new index. Finally, its predictive ability has been tested successfully on different series of conjugated and nonconjugated carbonyl compounds. | High | [
0.6988950276243091,
31.625,
13.625
]
|
## hashtable.api # # Typeagnostic hashtable api. # Compiled by: # src/lib/std/standard.lib ### "If life were fair, there would be no hope for most of us; ### we would be doomed to our just desserts. ### Fortunately, the gods are not that cruel!" # This api is implemented in: # # src/lib/src/hashtable.pkg # api Hashtable { # Hashtable (X, Y); # Type of a hashtable mapping X to Y. # Create a new hashtable given a hash-fn # and an equality predicate. # # The int is a size hint and # the exception is to be raised by find. # make_hashtable : ( (X -> Unt), # Hashing function. ((X,X) -> Bool) # Equality predicate. ) -> { size_hint: Int, not_found_exception: Exception } # -> Hashtable (X,Y); clear: Hashtable(X,Y) -> Void; # Remove all elements from the table. set: Hashtable (X,Y) -> (X,Y) -> Void; # Insert key-val pair; discard any pre-existing entry with that key. contains_key: Hashtable(X,Y) -> X -> Bool; # Return TRUE iff the key is in the table. look_up: Hashtable (X,Y) -> X -> Y; # Find an item. If it doesn't exist raise table.not_found_exception. find: Hashtable( X, Y) -> X -> Null_Or(Y); # Look for an item. Return NULL if the item doesn't exist. remove: Hashtable( X, Y) -> X -> Y; # Remove and return item. If item is missing raise table.exception_not_found. vals_count: Hashtable(X,Y) -> Int; # Return the number of items in the table vals_list: Hashtable(X,Y) -> List(Y); keyvals_list: Hashtable(X,Y) -> List ((X,Y)); # Return a list of the items (and their keys) in the table. apply: (Y -> Void) -> Hashtable (X,Y) -> Void; keyed_apply: ((X,Y) -> Void) -> Hashtable(X,Y) -> Void; # Apply a function to the entries of the table. map: (Y -> Z) -> Hashtable(X,Y) -> Hashtable(X, Z); keyed_map: ((X,Y) -> Z) -> Hashtable(X,Y) -> Hashtable(X, Z); # Map a table to a new table that has the same keys. fold: ( (Y, Z) -> Z) -> Z -> Hashtable(X,Y) -> Z; foldi: ((X, Y, Z) -> Z) -> Z -> Hashtable(X,Y) -> Z; # Fold a function over the elements of a table. map_in_place: (Y -> Y) -> Hashtable(X,Y) -> Void; keyed_map_in_place: ((X,Y) -> Y) -> Hashtable(X,Y) -> Void; # Modify the hashtable items in place. filter: (Y -> Bool) -> Hashtable(X,Y) -> Void; keyed_filter: ((X,Y) -> Bool) -> Hashtable(X,Y) -> Void; # Remove any hashtable items that do not satisfy the given predicate. copy: Hashtable(X,Y) -> Hashtable(X,Y); # Copy a hashtable. bucket_sizes: Hashtable(X,Y) -> List(Int); # # Returns a list of the sizes of the various buckets. # This allows users to gauge the quality of their hash-fn. }; # api Hashtable. ## AUTHOR: John Reppy ## AT&T Bell Laboratories ## Murray Hill, NJ 07974 ## [email protected] ## COPYRIGHT (c) 1993 by AT&T Bell Laboratories. ## Subsequent changes by Jeff Prothero Copyright (c) 2010-2015, ## released per terms of SMLNJ-COPYRIGHT. | Mid | [
0.5462012320328541,
33.25,
27.625
]
|
Ex-Brocade HR chief gets four month prison sentence Former Brocade human resources chief Stephanie Jensen was sentenced to 4 months in prison today and fined $1.25m for her part in a stock option backdating scheme. Jensen must also spend her first three months after her prison term in a halfway house and will be under supervised release for one year. "I would do anything to be able to go back in time and make different choices and spare others from the impact of all this," Jensen told US District Judge Charles Brewer in San Francisco. "I stand before you today with sadness and humility and regret." Jensen was convicted last Dec. of conspiracy and falsifying corporate records at Brocade. She and her former boss, then-CEO Gregory Reyes, were both charged with manipulating employee options records between 2000 and 2004 so they appeared to have been awarded when Brocade's stock was at quarterly lows. By failing to disclose the scheme with investors and regulators, US feds say the two illegally inflated Brocade's earnings. Reyes was sentenced in Aug. to 21 months in prison and fined $15m for heading the financial skulduggery. Both Jensen and Reyes currently remain free pending appeal. Judge Breyer said that although he believed the sincerity of Jensen's remorse, her sentence would deter other executives from aiding in illegal backdating schemes. Prosecutors has sought a prison sentence of six months for Jensen, while her lawyer sought probation and community service. Jensen and Reyes are the first two executives to be charged for illegal backdating. To date, a total of 17 executives have been charged with the offense. Nine have plead guilty. In May, Brocade paid $7m to settle SEC charges for falsifying reports of income through backdating. The company neither admitted nor denied any wrongdoing. ® | Mid | [
0.575569358178053,
34.75,
25.625
]
|
Monday, May 3, 2010 Of all the insulting, disrespectful... "I've never been so pissed off in my life." Reynolds Portman IV cranked the wheel of the Jaguar XJ13 hard as they ascended the steep, winding road. "The nerve of those people, asking for proof of our membership." Constance "Connie" Portman, his wife of seventeen months, adjusted the temperature of her heated leather seat. "Connie, this is obviously a rhetorical question, but I'll ask it anyway." Reynolds' gin blossoms glowed with ire; his pores contracted like clam pits. "Who in his right mind isn't fully aware that the Portmans landed in this country on the Mayflower, that the Portman Trading Company was the first supplier of fine spirits to the native Americans?" The car rolled slowly under the receding garage door and came to a stop. "Well, sugar angel, we were both aware of the new rule at the club." Connie's Manolo Blahniks clacked hard on the smooth pavement as she stepped past Carlos, who had opened her door. "We're now required to produce our legacy paperwork when requested, or we're not allowed inside." "I know, I know, but it's utterly absurd, Con Con. Am I supposed to carry around a notarized copy of my family tree every time I feel like taking in nine holes of golf? It's insulting and disrespectful. I feel like I was profiled today simply for wearing an obvious off-the-rack blazer." "Come on, love. Let's just go inside and cool down. I'll tell Maria to bring a pitcher of martinis out to the pool area. By the way, have you paid the staff yet this week?" "Oh, I guess I haven't," Reynolds replied. "There are some envelopes of cash in the freezer. If anyone complains about the amount, just tell them they can be replaced...today." | Mid | [
0.5766871165644171,
35.25,
25.875
]
|
Q: clearInterval() not working javascript I have the following code. This is what I tried to clear the interval, but it didn't work. Kindly help me. $(document).ready(function(){ var intervalId; $(window).focus(function(){ var intervalId = setInterval(function(){ console.log('working'); }, 5000); }); $(window).blur(function(){ clearInterval(intervalId); }); }); A: Do not redeclare intervalId, then it becomes a local scope to the focus function: $(window).focus(function() { intervalId = setInterval(function() { console.log('working'); }, 5000); }); Consider this part: $(document).ready(function() { var intervalId; $(window).focus(function() { // intervalId is not the same as the `window.intervalId` // The scope changes. var intervalId = setInterval(function() { //------^^^---------- Remove this var. }); }); }); | Mid | [
0.5532879818594101,
30.5,
24.625
]
|
Large and complex 3D content in Unity One of the biggest issues our 3D developer partners encounter is the sheer amount of time it takes to optimize and import large 3D models. While, for example Unity has announced that they're working on improving their FBX-support, we decided to approach the problem from a different perspective: what if you could stream the 3D content directly at runtime while skipping the time-consuming optimization and import phases altogether? That’s exactly what we did. Umbra Composit is now the fastest and easiest way to use large and complex 3D content in your application. Before we dive deeper, the video below features a brief overview of Composit for Unity and a visualization using scanned 3D content measuring up to 2 billion polygons and 700 gb of texture data! A 700 gigabyte scanned 3D model of Helsinki city Role of the cloud Anyone familiar with scanned 3D models knows how big the data sets can get - a few hundred gigabytes of point cloud data isn’t a rare occurrence. Increase the capture quality, scan a larger area and we're starting to talk terabytes, even petabytes of data. Storing and transferring such large amounts of data becomes a burden in and of itself. Imagine trying to display that amount of 3D data on an iPhone, iPad or the HoloLens. That's where Umbra Composit steps in. Umbra processes your 3D data into a format that is streamed directly into the end-user's device. That data is based on content visibility and distance to the camera in your application's runtime. Umbra's cloud processing automatically applies the following 3D optimizations to your content: Level of detail (LOD) generation and management Mesh, texture and draw call optimization Occlusion culling Retargeting for specific viewing platforms These optimizations respect the strict performance budgets imposed by mobile, AR and VR-devices while making sure your application maintains the desired frame rate. And naturally, it saves an awful lot of time spent on manual optimization work. To reiterate, Umbra actually streams the content to be rendered on the end-device. This means that umbrafied 3D content can be used even if a network connection isn't available, which wouldn’t be possible if the rendering was done in the cloud. Additionally, when something changes in the original 3D data set, just reprocess it through Umbra Composit and it’ll be automatically updated in your application (check our Downloads page for supported inputs). Finally, you’ll have more time to focus on creating better, more immersive and visually stunning experiences instead of wrestling with getting the content to work. The Helsinki 3D data set is available for viewing in our ARKit-compatible iOS-application. If you're struggling with heavy 3D content in your Unity application, whether you're dealing with point clouds, large BIM, CAD, architectural, HVAC, MEP or structural designs, contact us and let's discuss how Umbra can help you! Want to find out more on how to stream a huge 3D model into Unity? Check out this post. | High | [
0.7272727272727271,
38,
14.25
]
|
Q: Hidden file attributes In Python, how do you make a particular file hidden? Or how do you set the file attribute as 'hidden' without using external API's/modules such as WIN32API, etc. Surely there is something in the standard libraries? As the os module does allow to set the "read" and 'write' attributes, it is very strange that there is no mention in the os docs of 'hidden'... A: Use fn = 'c:\\file.txt' p = os.popen('attrib +h ' + fn) t = p.read() p.close() | Mid | [
0.577669902912621,
29.75,
21.75
]
|
To Hell and Back KOA Campgrounds Author: Robert H. Date of Trip: July 2009 Any KOA can be a wonderful place for camping. Well, if it is managed correctly. The KOA in Cherokee North Carolina is one that is very poorly operated. The staff appears friendly and smile well. On the other hand there is a predominant "we don't care" attitude. it's as though they smile as long as they get your money, but the specifics and happiness of any one camper is none of their concern. My wife and I planned our trip to KOA in Cherokee months ago. The pictures on the site really look great. However, as many know, a picture does not always say a thousand words but, actions speak volumes. We were very specific when we reserved our cabin. My wife's 88 year old grandmother wanted to join us. We clearly stated that we would need a cabin close to the bath house due to toileting needs of her grandmother. We were assured they would do everything they could to accommodate us. Remember our reservations were made months in advance. When we arrived at our campsite we were greeted with cabins quite away from the bath house. In fact we even had to cross a small bridge to get to the bath house. So we ended up using a portable toilet for Granny and had to dump it and clean it every day. Furthermore, our firepit was loaded with trash including half eaten food. The icing on the cake, almost literal in a way, was the blue tarp on the top of our cabin. We were to discover at 2am that it leaked and it leaked right onto our heads. This was replaced the next morning with a larger green tarp and they refused to move us despite the fact that there were numerous cabins near the store, and consequently right beside a bathouse, that were all empty and remained empty the length of our trip. We were assured that all of those cabins were reserved. On our first day my 10 year old daughter wanted to go to the bouncing pillow. She was given permission and ran off excitedly. Ten minutes later she returned and asked for money. We found out the hard way that they charge for the use of the bounce pillow and to play putt-putt golf. This was disappointing to say the least. On the KOA website the picture of the kids enjoying the amenities does not include the faces of the disgruntled parents who found out that it would cost them dearly to have their children play. Remember what I said about pictures and actions. Finally, the overall incompetence of the management and staff was shown on the day I decided to access the internet from my cabin by paying for Wifi at my cabin. They advertise free Wifi however, they don't tell you that it is only by the main building and not at your site. In any event, I paid the fee for one day through paypal. Then I found that the internet does not work, except to allow you to pay for service. When I went to the store and explained my problem to the management I was told that I should have paid for a code at the office as paying through paypal always results in nonfunctioning service(there is no sign anywhere that explains this. Of course, they absolutely would not give me a refund as paypal was through corporate. When I asked the KOA corporate office for a refund they directed me back to the management at the KOA in Cherokee. All of this is an example of a poorly managed KOA and a corporate office that obviously does not care. In contrast, we stayed at a KOA in Rodanthe, NC. This was a wonderful experience which we were a little apprehensive about when we reserved the cabin. To our surprise we were in a clean comfortable cabin that provided a spigot right outside the cabin to clean dishes or anything else. The firepit was empty and there was a clean picnic table and a swing on the front porch. My then 9 year old daughter had a blast. Not only did she play Putt-Putt golf for free and jump on the bouncing pillow at no charge, but the teenagers there actually engaged the younger children. The management provided kids handfuls of waterballoons to use at the launchers. All of this was no charge. My daughter rented banana bike without some exhorbitant deposit and it was inexpensive. The staff was knowledgeable about the area and presented a genuine warm friendliness. As a matter of fact, they provided an actual outdoor movie (the Cherokee KOA claims to do one nightly, they did one when we were there and it was inside). The staff actually stayed around during the movie and interacted with the campers - young and old. The KOA at Cherokee and KOA's corporate executives should learn from the people who do things right. KOA on the Outer Banks in North Carolina Knows how to treat their customers. I guess this review should have been entitled from Heaven to Hell in KOA. | Mid | [
0.5542168674698791,
34.5,
27.75
]
|
INTRODUCTION {#s1} ============ Chronic lymphocytic leukemia (CLL) is characterized by the accumulation of malignant CD5^+^ B lymphocytes in the peripheral blood and lymphoid tissues \[[@R1], [@R2]\]. Frontline therapies for CLL have been based in the administration of cytostatic drugs (chlorambucil, fludarabine), which, in many cases, control the disease efficiently and are well tolerated \[[@R3]\]. However, patients carrying certain prognostic markers, such as del17p13 or unmutated IgH~V~, do not respond well to these therapies \[[@R3], [@R4]\]. CLL treatment has greatly improved with the development of more specific agents, such as monoclonal antibodies (obinutuzumab, anti-CD20), kinase inhibitors (CAL-101/idelalisib, for PI3Kδ; ibrutinib, for Bruton tyrosine kinase; sotrastaurin, for PKCβ), or Bcl-2 inhibitors (ABT-263, ABT-199) \[[@R3], [@R5]\]. These agents are currently in clinical trials or already approved, due to the promising results in most CLL cases. However, the long-term efficacy of these treatments, particularly in refractory CLL cases, is not known. It is therefore crucial to continue searching for new compounds, which could be useful in the treatment of CLL, especially in the advanced setting. Arsenic trioxide (ATO) is a successfull treatment in acute promyelocytic leukemia \[[@R6]\] and is being trialed in other malignancies, generally in combined therapies \[[@R7], [@R8]\]. In the case of CLL, we and others have shown that ATO effectively induces *in vitro* apoptosis in all CLL cases tested, including those with unfavorable prognosis \[[@R9], [@R10]\]. ATO, alone or in combination with other treatments, could thus be an efficient therapeutic agent for CLL. It is now well established that the CLL microenvironment activate survival pathways on the malignant cells that favor drug resistance and contribute to disease progression \[[@R11], [@R12]\]. Targeting these pathways has thus become an important issue when studying the effect of cytotoxic drugs on CLL. For example, CAL-101 was shown to down-regulate the chemokine and B-cell receptor signaling induced by stroma and to sensitize CLL cells towards bendamustine, fludarabine, and dexamethasone \[[@R13]\]. Blocking the heat shock protein 90 inhibited the stroma-induced NF-κB signaling and synergistically enhanced the effect of fludarabine \[[@R14]\]. Likewise, blocking PI3K activity regulated the Akt/FoxO3a/Bim axis and increased the cytotoxic effect of fludarabine and bendamustine on CLL cells cultured on stroma \[[@R15]\]. Whether stromal cells influence the response of CLL cells to ATO has not been carefully studied. We recently showed that matrix metalloproteinase-9, a common component of the CLL microenvironment, contributes to the CLL resistance to ATO and fludarabine by preventing downregulation of anti-apoptotic proteins of the Bcl-2 family \[[@R16]\]. Complete understanding of how stromal cells protect CLL cells from the action of ATO will allow the development of strategies that overcome this protection. In the present report we have studied the survival mechanisms induced by stromal cells, responsible for the CLL resistance to ATO. We have also studied whether the modulation of these mechanisms renders CLL cells sensitive to ATO in the presence of stromal cells. RESULTS {#s2} ======= Stromal cells protect CLL cells from the apoptotic effect of ATO {#s2_1} ---------------------------------------------------------------- To determine if different types of stromal cells influenced the response of CLL cells to ATO, we studied the effect of ATO in co-cultures of CLL-bone marrow stromal cells. In initial experiments, CLL cells from 9 different samples were cultured in suspension or with HS-5 cells (fibroblastoid properties \[[@R17], [@R18]\]) and treated with 1 or 2 μM ATO. The average constitutive viability of these samples was 82% (range 70--92%) and was normalized to 100. ATO reduced the viability of suspended cells in a dose-dependent manner, resulting in 32% (24 h) and 12% (48 h) viable cells, upon exposure to 2 μM ATO (Figure [1A](#F1){ref-type="fig"}). No significant decrease in cell viability was observed at earlier times. Co-culture with HS-5 cells significantly protected CLL cells against the cytotoxic effect of ATO. This was already observed using 1 μM ATO and it was clearly obvious with 2 μM, which only reduced CLL cell viability to 69% (24 h) and 54% (48 h) (Figure [1A](#F1){ref-type="fig"}). All subsequent experiments were therefore performed using 2 μM ATO. {#F1} We next study whether HS-27A cells (epithelioid properties \[[@R17], [@R18]\]) also protected CLL cells from the action of ATO. HS-27A cells prevented CLL apoptosis induced by ATO in the 8 samples studied. Indeed, in the presence of 2 μM ATO, average viability values were 71% (24 h) and 67% (48 h), compared to 26% and 13%, respectively, for suspended cells (Figure [1B](#F1){ref-type="fig"}). We also tested the effect of culturing CLL cells on primary stroma derived from a CLL patient. Figure [1C](#F1){ref-type="fig"} shows that primary stroma also protected CLL cells (6 different patients) from ATO-induced apoptosis, since after 24 h, 2 μM ATO only decreased CLL cell viability to 79%, compared to 37% for suspended cells. After 48 h exposure to 2 μM ATO, these values were 61% and 14%, respectively, for stroma-cultured or suspended CLL cells (Figure [1C](#F1){ref-type="fig"}). In control experiments, 2 μM ATO was not cytotoxic for HS-5, HS-27A or primary stromal cells, measured after 24 or 48 h (Figure [1D](#F1){ref-type="fig"}). Altogether these results indicated that stromal cells overcame the apoptotic effect of ATO on CLL cells, thus contributing to their survival and drug resistance. The protecting effect against ATO induced by stroma involves interactions with CLL cells through α4β1 and αLβ2 integrins {#s2_2} ------------------------------------------------------------------------------------------------------------------------ We next studied whether physical contact between CLL and stroma was necessary for the observed survival effect. Because the α4β1 and αLβ2 integrins, present on CLL cells, contribute to these interactions \[[@R12]\], we examined the effect of blocking these integrins on the CLL response to ATO. CLL cells were treated with anti-α4 or anti-β2 blocking antibodies and incubated with HS-5 stromal cells for 48 h, in the absence or presence of ATO. The average viability of control cells (without antibody treatment) at this time was 68% and was normalized to 100. In the absence of ATO, blocking α4β1 or αLβ2 integrins did not significantly reduce the viability of CLL cells co-cultured with HS-5 stromal cells (Figure [2A](#F2){ref-type="fig"}). However, in the presence of ATO the anti-α4 and anti-β2 integrin antibodies significantly reduced cell viability to 53% and 57%, respectively, while control antibodies had no effect (Figure [2A](#F2){ref-type="fig"}). The simultaneous blocking of both integrins increased this effect, decreasing the viability of CLL cells to 32% (Figure [2A](#F2){ref-type="fig"}). {#F2} Similar results were obtained for CLL cells cultured on HS-27A stromal cells (Figure [2B](#F2){ref-type="fig"}). In this case, in the presence of ATO, the anti-α4 antibody was even more effective than in HS-5 co-cultures, reducing cell viability to 37% and to 28% when combined with anti-β2 antibody (Figure [2B](#F2){ref-type="fig"}). The higher effect of the anti-α4 antibody was probably due to the high levels of VCAM-1 (α4β1 ligand) expressed by HS-27A cells upon stimulation with TNFα (\[[@R18]\] and Figure [2C](#F2){ref-type="fig"}). In contrast, VCAM-1 was not induced on HS-5 cells (Figure [2C](#F2){ref-type="fig"}). Additionally, the anti-α4 or β2 integrin antibodies did not reduce the viability of HS-5 or HS-27A stromal cells, either in the absence or presence of ATO (Figure [2D](#F2){ref-type="fig"}). We next determined whether the requirement for direct interactions between CLL and stromal cells was a characteristic of the response to ATO or common to other cytotoxic agents, such as fludarabine. In the absence of stroma, 5 μM fludarabine reduced the viability of CLL cells from 72% to 33% (average of 3 samples) after 48 h. At this time, the average viability of control cells co-cultured with stroma was 82% (HS-5 cells) and 84% (HS-27A cells) and was normalized to 100. HS-5 (Figure [2E](#F2){ref-type="fig"}) and HS-27A (Figure [2F](#F2){ref-type="fig"}) cells protected CLL cells from the effect of fludarabine, resulting in 85% and 91% viable cells (compared to normalized control), respectively. As in the case of ATO, the anti-α4 or anti-β2 antibodies partially restored the sensitivity of CLL cells to fludarabine in the presence of both types of stromal cells (Figure [2E](#F2){ref-type="fig"}, [2F](#F2){ref-type="fig"}). The simultaneous blocking of both integrins was more effective, reducing CLL cell viability to 20% (HS-5 co-cultures, Figure [2E](#F2){ref-type="fig"}) and to 31% (HS-27A co-cultures, Figure [2F](#F2){ref-type="fig"}). Therefore, CLL-stromal cell contact via integrins appears to be a general requirement for the drug resistance effect of stroma. Because HS-5 and HS-27A cells behave similarly, subsequent experiments were performed with HS-27A cells. Survival pathways induced by co-culturing CLL cells with stromal cells and effect of ATO treatment {#s2_3} -------------------------------------------------------------------------------------------------- To determine the survival mechanisms contributing to CLL cell resistance to ATO, we first analyzed the possible activation of protein kinases relevant for CLL viability \[[@R19]\]. CLL cells were cultured in suspension or with HS-27A cells for 24 h in the absence or presence of ATO. Western blotting analyses showed that, in cultures of CLL cells alone, ATO significantly reduced the phosphorylation of Akt, PKC, and Lyn, compared to the values of control cells (Figure [3A](#F3){ref-type="fig"}). In correlation with this, the average viability of these cells decreased from 64% (no ATO) to 28% (ATO treated). Phosphorylated ERK was hardly detectable under these conditions in the samples studied. Co-culturing CLL cells with stroma resulted in the significant activation of Akt, PKC, ERK and Lyn. These kinases remained phosphorylated after 24 h, even in the presence of ATO, indicating their sustained activation by stroma (Figure [3A](#F3){ref-type="fig"}). {#F3} We also examined the activation of NF-κB and STAT3, two transcription factors important for CLL cell survival \[[@R20], [@R21]\]. NF-κB activation was measured based on the phosphorylation levels of the associated inhibitory protein IκB \[[@R22]\]. The basal phosphorylation of IκB and STAT3 on suspended CLL cells was low and did not change in the presence of ATO (Figure [3B](#F3){ref-type="fig"}). Phospho-IκB and phospho-STAT3 were significantly increased by stroma and remained elevated upon treatment with 2 μM ATO (Figure [3B](#F3){ref-type="fig"}). Altogether these results indicated that the survival pathways induced by stroma on CLL cells were not suppressed by treatment with 2 μM ATO. Regulation of Bcl-2 family proteins in CLL cells co-cultured with stromal cells and exposed to ATO {#s2_4} -------------------------------------------------------------------------------------------------- To further characterize the mechanisms of resistance to ATO induced by stroma, we studied the regulation of Bcl-2 family proteins \[[@R23]\]. CLL cells were cultured alone or with HS-27A cells and treated or not with 2 μM ATO for 24 h. Figure [4](#F4){ref-type="fig"} shows the Western blotting results of a representative patient and the quantitation of all patients studied. In suspended CLL cells, ATO significantly diminished the expression of Mcl-1 and Bfl-1 (anti-apoptotic) and upregulated Bim and Noxa (pro-apoptotic), compared to control cells (Figure [4A](#F4){ref-type="fig"}). This correlated with the lower viability after 24 h of cells treated with ATO (34%) compared to control cells (65%). {#F4} Co-culturing CLL cells with HS-27A cells, resulted in a significant increase of Mcl-1, Bcl-xL and Bfl-1, and these proteins remained elevated in the presence of 2 μM ATO (Figure [4A](#F4){ref-type="fig"}). Stromal cells also prevented the upregulation of Bim and Noxa by ATO (Figure [4A](#F4){ref-type="fig"}), in correlation with the elevated viability (average 56%) observed on these cells. Moreover, the ratios of anti-apoptotic/pro-apoptotic well-known partners \[[@R23]\] were also significantly increased by stroma and remained elevated upon ATO treatment (Figure [4B](#F4){ref-type="fig"}). Altogether these results suggested that Mcl-1, Bcl-xL, and Bfl-1 were possible contributors to the resistance of CLL cells to ATO induced by stroma. Involvement of the PI3K and PKC signaling pathways in the stroma-induced resistance of CLL cells to ATO {#s2_5} ------------------------------------------------------------------------------------------------------- To determine which of the survival pathways described above was responsible for the resistance of CLL cells to ATO, we first blocked protein kinases and transcription factors with specific inhibitors. Except for Stattic, that was used at 2.5 μM, the inhibitors were used at 5 μM. This concentration had little effect on basal cell viability (see below) but it was sufficient to inhibit kinase phosphorylation \[[@R10], [@R21]\]. CLL cells were incubated with inhibitors or vehicle for 1 h prior to culturing with HS-27A cells for 24 h, in the absence or presence of 2 μM ATO. The viability of untreated CLL cells cultured with stromal cells for 24 h (40%--75%) was normalized to 100. Figure [5A](#F5){ref-type="fig"} shows that in the absence of ATO, only the inhibition of PI3K with LY294002 or STAT3 with Stattic had a limited effect, reducing cell viability to 83% and 72%, respectively. However, in the presence of ATO, blocking PI3K, Akt, PKC, NF-κB or STAT3 activities significantly overcame the survival effect induced by stromal cells (Figure [5A](#F5){ref-type="fig"}). In contrast, inhibiting MEK/ERK with UO126 or Lyn with PP2 had no effect, albeit these inhibitors efficiently blocked the phosphorylation of these kinases (Figure [5A](#F5){ref-type="fig"}). {#F5} The above results established that PI3K and PKC signaling were essential for the resistance to ATO induced by stroma. Because PI3Kδ and PKCβ are major isoforms in CLL cells and current targets in clinical trials \[[@R3], [@R5], [@R24], [@R25]\], we tested the effect of specifically blocking these isoforms in our system. CLL cells were treated or not with various concentrations of idelalisib or sotrastaurin and cultured with HS-27A cells for 24 h, with or without 2 μM ATO. Figure [5B](#F5){ref-type="fig"}, [5C](#F5){ref-type="fig"} shows that, in the absence of ATO, these inhibitors decreased less than 20% the viability of CLL cells cultured on stromal cells. However, in the presence of ATO, idelalisib and sotrastaurin significantly reduced CLL cell viability in a dose-dependent manner, while UO126 behave as the control with no inhibitors (Figure [5B](#F5){ref-type="fig"}, [5C](#F5){ref-type="fig"}). The calculated combination index in these assays was \< 1 for all concentrations of idelalisib and sotrastaurin tested (Figure [5D](#F5){ref-type="fig"}, [5E](#F5){ref-type="fig"}), indicating a synergistic cooperation between ATO and these inhibitors. Blocking PI3Kδ and PKCβ activities simultaneously did not significantly increase the effect of each individual inhibitor (not shown). Blocking the PI3Kδ or PKCβ signaling pathways prevents Mcl-1 upregulation and the resistance to ATO induced by stromal cells {#s2_6} ---------------------------------------------------------------------------------------------------------------------------- To confirm the involvement of PI3Kδ and PKCβ in the resistance to ATO, we first studied whether idelalisib and sotrastaurin inhibited the activation of Akt, NF-κB and STAT3 (see Figure [5A](#F5){ref-type="fig"}). Both inhibitors were used at 2.5 μM and activation of Akt was determined by the phosphorylation of the S473 residue, a target of PI3K and PKC \[[@R26], [@R27]\]. The viability of control cells (no inhibitors or ATO) in these experiments was 60% and was normalized to 100. In the presence of ATO, idelalisib and sotrastaurin significantly reduced the stroma-induced phosphorylation of S473-Akt, IκB and STAT3 (Figure [6A](#F6){ref-type="fig"}). The decrease in S473-Akt phosphorylation was also observed on control CLL cells unexposed to ATO (Figure [6A](#F6){ref-type="fig"}). However, only in the presence of this agent the dephosphorylation of S473-Akt, STAT3 and IκB correlated with a significant reduction in cell viability to 52% (idelalisib) and 49% (sotrastaurin) (Figure [6B](#F6){ref-type="fig"}). Blocking MEK with UO126 had no effect (Figure [6A](#F6){ref-type="fig"}), confirming the specific involvement of PI3Kδ and PKCβ in the mechanism of resistance to ATO. {#F6} Further analysis of the same samples demonstrated that idelalisib and sotrastaurin significantly downregulated Mcl-1, both in untreated and ATO-treated cells, while UO126 did not (Figure [6A](#F6){ref-type="fig"}). As above, only in the presence of ATO, downregulation of Mcl-1 correlated with a decrease in cell viability (Figure [6B](#F6){ref-type="fig"}). Moreover, idelalisib and sotrastaurin did not significantly reduce the expression of Bcl-xL, Bcl-2 or Bfl-1 (Figure [6A](#F6){ref-type="fig"}), suggesting a role for Mcl-1 in the resistance to ATO induced by stroma. The pro-apoptotic proteins Bim, Noxa, Bax and Puma did not change under these conditions (Figure [6A](#F6){ref-type="fig"}). To then determine whether PI3Kδ and PKCβ regulated Mcl-1 via NF-κB and/or STAT3, we examined the effect of inhibiting these transcription factors. Blocking NF-κB or STAT3 resulted in a significant decrease of Mcl-1, in untreated and ATO-treated cells, while Bcl-xL and Bcl-2 remained unchanged (Figure [6C](#F6){ref-type="fig"}). Again, the decrease of Mcl-1 correlated with reduced cell viability (55% and 48%, respectively for NF-κB and STAT3 inhibition) only in cells exposed to ATO. In contrast, downregulation of Mcl-1 did not decreased cell viability on control cells (89.5% and 80.2%, respectively, for NF-κB and STAT3 inhibition). Key role for Mcl-1 in the resistance of CLL cells to ATO induced by stromal cells {#s2_7} --------------------------------------------------------------------------------- The above results strongly suggested that Mcl-1 downregulation was due to inhibition of the PI3Kδ/PKCβ-NF-κB/STAT3 signaling pathways, rather than a mere consequence of cell death. To confirm this, we measured Mcl-1 levels at shorter times of cell exposure to idelalisib or sotrastaurin, in the absence or presence of ATO. After 3 h of treatment, Mcl-1 expression started to decrease and was reduced 1.8-fold after 8 h in ATO-treated samples (Figure [7A](#F7){ref-type="fig"}). Cell viability at these times remained unchanged (Figure [7B](#F7){ref-type="fig"}). After 24 h of treatment, Mcl-1 decreased both in control cells and in ATO-treated cells (Figure [7A](#F7){ref-type="fig"}). However, only the viability of cells exposed to ATO was significantly reduced at this time, in correlation with the decrease Mcl-1 levels (Figure [7B](#F7){ref-type="fig"}). Bim expression was also analyzed at these times but no significant changes were observed (Figure [7A](#F7){ref-type="fig"}). These results strongly suggested that downregulation of Mcl-1 preceded the onset of apoptosis induced by ATO. {ref-type="fig"} and cultured on HS-27A cells, with or without 2 μM ATO, for the indicated times. Western blotting analyses are shown for a representative patient and Mcl-1 values quantitated for the two samples analyzed (P41, P48). **(B)** Average cell viability of the same samples used in (A). **(C)** CLL cells (P10, P32, P35, P40, P41, P42, P48) were treated for 1 h with vehicle, 5 μM UO, idelalisib or sotrastaurin (2.5 and 25 μM each), and cultured on HS-27A cells with 2 μM ATO. Cell viability and Mcl-1 expression were determined after 24 h. Pearson\'s correlation (r) and *P* values are shown. **(D, E)** 24 × 10^6^ CLL cells (P32, P40, P41, P42) were nucleofected with the indicated siRNAs and cultured in suspension or with HS-27A cells. After 16 h at 37°C, 2 μM ATO was added and cells further incubated for 24 h. Nucleofected samples were analyzed by Western blotting (D) and cell viability determined by flow cytometry (E). NC (nucleofection control): CLL cells nucleofected with control siRNA and cultured in suspension. **(F)** CLL cells (P32, P41, P42, P43, P48) were treated for 1 h with or without the indicated concentrations of MIM1 and cultured with HS-27A cells in the absence or presence of 2 μM ATO. After 24 h, cell viability was determined by flow cytometry. **(G)** 8--10 × 10^6^ CLL cells were treated with the indicated concentrations of MIM1 and cultured as in (F). Protein expression was analyzed by Western blotting. \*or ^Δ^ *P* ≤ 0.05; \*\*or ^ΔΔ^ *P* ≤ 0.01; \*\*\*or ^ΔΔΔ^ *P* ≤ 0.001.](oncotarget-06-44832-g007){#F7} We next studied whether there was a direct correlation between Mcl-1 expression and cell viability. CLL cells were treated or not with various concentrations of idelalisib or sotrastaurin and cultured with stromal cells, with or without ATO. UO126 was added as a control in these experiments. Analyses of cell viability and Mcl-1 levels after 24 h demonstrated a strong positive correlation (*P* \< 0.0001, *r* = 0.8320) between both parameters (Figure [7C](#F7){ref-type="fig"}). To further establish the crucial role of Mcl-1 in the stroma-induced CLL cell resistance to ATO, we blocked the expression or function of this molecule with specific siRNAs or inhibitors. CLL cells (4 different samples) were nucleofected with Mcl-1 or control siRNAs and co-cultured with HS-27A cells for 24 h, with or without ATO. In suspended CLL cells, gene silencing Mcl-1 decreased cell viability to \< 10% after 24 h, confirming the importance of Mcl-1 in preventing spontaneous apoptosis of these cells. Western blotting analyses confirmed that the Mcl-1 siRNA significantly reduced Mcl-1 expression in untreated (50% average reduction) or ATO-treated (70% average reduction) cells, compared to control values normalized to 1 (Figure [7D](#F7){ref-type="fig"}). Because of the stringency of the nucleofection procedure, the viability of CLL cells transfected with control siRNA was 36% after the 24 h co-culture, and this was normalized to 100. Treatment of these cells with 2 μM ATO did not reduce this viability, confirming the protection of stromal cells against this agent (Figure [7E](#F7){ref-type="fig"}). In contrast, transfection with Mcl-1 siRNA diminished the viability of CLL cells unexposed to ATO to 57.1% (compared to normalized control) (Figure [7E](#F7){ref-type="fig"}), again reflecting the importance of Mcl-1 in basal cell survival. Exposure to ATO further reduced this viability to 36.5% (compared to normalized control) (Figure [7E](#F7){ref-type="fig"}). To determine if this was due to the net effect of ATO, we used cells transfected with control siRNA and kept in suspension as a control system. ATO reduced the viability of these cells from 52% to 29% (Figure [7E](#F7){ref-type="fig"}), and this difference (23%) was very similar to that observed for Mcl-1 siRNA-transfected cells cultured on stroma (19%) (Figure [7E](#F7){ref-type="fig"}). These results confirmed that the lack of Mcl-1 nearly completely restored the sensitivity of CLL cells to ATO in the presence of stroma. We also study the effect of blocking Mcl-1 function with the specific inhibitor MIM1. CLL cells were incubated with various concentrations of vehicle or MIM1 prior to their culture with stromal cells and treatment with 2 μM ATO. Figure [7F](#F7){ref-type="fig"} shows that MIM1 sensitized CLL cells to ATO in a dose-dependent manner, reducing cell viability to 29% at the highest concentration tested. To confirm that this was due to Mcl-1, we analyzed by Western blotting the expression of Mcl-1 on the samples treated with MIM1. Figure [7G](#F7){ref-type="fig"} shows that MIM1 specifically induced the degradation Mcl-1 but not Bcl-xL or Bcl-2, used as controls. Altogether these results established a central role for Mcl-1 in the mechanism of resistance to ATO induced by stromal cells. Figure [8](#F8){ref-type="fig"} shows a schematic representation of this mechanism, including the identified survival signals induced by stroma and how their inhibition will render CLL cells sensitive to ATO. {#F8} DISCUSSION {#s3} ========== We previously showed that ATO could constitute an efficient treatment in CLL, particularly in combined therapies \[[@R10], [@R16], [@R28]\]. To further explore the potential clinical use of this agent, we have now studied the influence of bone marrow stromal cells on the response of CLL cells to ATO. We report that: 1) stromal cells induce CLL cell resistance to ATO via activation of the PI3Kδ-PKCβ/STAT3-NF-κB pathways; 2) Mcl-1 plays a central role in the mechanism of resistance to ATO; 3) blocking PI3Kδ and PKCβ with specific inhibitors overcomes the survival effect of stroma on CLL cells exposed to ATO. The three types of stromal cells used in study, whether fibroblastoid-like, epithelioid-like or derived from a CLL bone marrow sample, protected CLL cells from the apoptotic action of ATO. This protection mostly involved physical cell-cell contact. Among the several receptor-ligand interactions that take place between CLL and stromal cells \[[@R12]\], our results show that blocking α4β1 and αLβ2 integrins was sufficient to overcome the protective effect of stroma. This is agreement with previous studies showing a role for β1 and β2 integrins in the microenvironment-induced survival of CLL cells \[[@R29], [@R30]\]. Besides the well-known ligands for these integrins (VCAM-1, fibronectin, ICAM-1) present in bone marrow stroma, an additional cell-cell interaction contributing to the survival effect may be provided by MMP-9. MMP-9 is also present in stroma, is a ligand for α4β1 \[[@R31]\], and has a reported protective role against ATO \[[@R16]\]. It is now well established that co-culturing CLL cells with stromal cells results in reciprocal activation of several signaling pathways, which promote cell survival and drug resistance \[[@R12], [@R32]\]. In our study, we detected activation of the Lyn, ERK, Akt and PKC kinases, as well as of the transcription factors NF-κB and STAT3. We and others have reported a role for Lyn in CLL cell survival \[[@R21], [@R33]\]. However, our present results show that Lyn (or ERK) was not involved in the mechanism of resistance of CLL cells to ATO induced by stroma. In contrast, inhibition of PI3K (upstream of Akt) or PKC activities overcame the protective effect of stroma and rendered CLL cells sensitive to ATO. PI3K and PKC were previously shown to play important roles in the survival of suspended CLL cells induced by IL-4 or phorbol esters \[[@R34]\]. Likewise, PI3K and PKC also mediated the survival signals induced by BCR, adhesion molecules and chemokines \[[@R35], [@R36]\]. Additionally, several inhibitors of the PI3K/Akt and PKC pathways have rendered promising results *in vitro* and *in vivo*, and may potentially have therapeutic application in CLL \[[@R5], [@R37], [@R38]\]. Our present results reveal new functions for PI3K and PKC in the resistance of CLL cells to ATO, highlighting the role of these kinases in the response to several cytotoxic drugs. Further insight into the mechanism of resistance to ATO induced by stroma was obtained by using idelalisib and sotrastaurin as inhibitors for the PI3Kδ and PKCβ isoforms, respectively. The study of these isoforms was chosen because of their predominant expression in CLL and their well-established role in CLL cell survival, as effectors of the B-cell receptor. Indeed, both PI3Kδ and PKCβ are either directly associated to the B-cell receptor (PI3Kδ), or activated by Bruton tyrosine kinase (BTK), another B-cell receptor-associated kinase (PKCβ) \[[@R24], [@R25], [@R39]\]. Idelalisib has recently entered clinical trials for CLL \[[@R3]\] and sotrastaurin has yielded very promising preclinical results \[[@R5]\]. Notably, PKCβ-dependent activation of NF-κB has been shown to be crucial for induction of CLL survival by stromal cells \[[@R40]\]. Our present results show that blocking PI3Kδ and PKCβ activities was sufficient to inhibit further downstream signaling (Akt, NF-κB, STAT3 activation) and to overcome the survival effect of stroma. PI3Kδ and PKCβ are therefore key survival pathways in the response of CLL cells to ATO in the presence of stromal cells. The fact that we did not observe an additive or synergistic effect when idelalisib and sotrastaurin were used together, suggests that PI3Kδ and PKCβ are independently activated but converge in subsequent signaling. Indeed, both kinases can directly or indirectly phosphorylate Akt at T308 and/or S473 \[[@R26], [@R41]\], and activate the transcription factors NF-κB and STAT3 \[[@R40], [@R42]\]. Additionally, since BTK is upstream of the PKCβ signaling pathway, it is possible that ibrutinib, a BTK inhibitor approved for treatment of CLL \[[@R12]\], will also render CLL cells sensitive to ATO in the presence of stroma. We have further characterized the mechanism of resistance to ATO induced by stroma by studying the regulation of proteins from the Bcl-2 family. In agreement with our previous observations on the protective role of MMP-9 against ATO \[[@R16]\], our results show that ATO did not increase the pro-apoptotic members Bim, Bax, Noxa or Puma in CLL-stromal cell co-cultures. This differs from the previously described upregulation of some of these proteins by ATO in myeloma \[[@R43]\] and ovarian cancer cells \[[@R44]\]. With regard to the anti-apoptotic members of the Bcl-2 family, our study clearly demonstrates a central role for Mcl-1 in the mechanism of resistance to ATO. This is based on the following evidences: First, Mcl-1 was upregulated by stroma and remained high in the presence of ATO. Second, idelalisib and sotrastaurin decreased Mcl-1 expression in CLL-stromal cell co-cultures treated with ATO, in correlation with a reduced CLL cell viability. Third, inhibition of NF-κB and STAT3, known to regulate Mcl-1 \[[@R45]\], also decreased Mcl-1 levels. This confirmed the involvement of these transcription factors in the mechanism of resistance to ATO and the transcriptional regulation of Mcl-1 by stroma. Fourth, gene silencing Mcl-1 or inhibiting its function, overcame the resistance to ATO induced by stroma. Mcl-1 is a key survival molecule in CLL, recently shown to undergo complex regulation in the context of bone marrow stroma \[[@R46]\]. Indeed, upregulation of Mcl-1 by stroma is central to the protective effect against CLL cell spontaneous apoptosis or apoptosis induced by fludarabine \[[@R47]\], fludarabine/bendamustine \[[@R48]\], or Bcl-2-directed compounds \[[@R49]\]. We also recently reported a role for Mcl-1 in the protection against ATO induced by MMP-9 on CLL cells \[[@R16]\]. Our present results establish that Mcl-1 is a main target to overcome the survival effect of stroma and render CLL cells sensitive to ATO. In summary, we report for the first time that the mechanism by which bone marrow stromal cells induce resistance of CLL cells to ATO consists in activation of the PI3Kδ-PKCβ/NF-κB-STAT3/Mcl-1 pathways. We further show that the specific inhibitors idelalisib (PI3Kδ) or sotrastaurin (PKCβ), as well as the BH3-mimetic MIM1 overcome the stroma-induced resistance to this agent. Given the promising results obtained with idelalisib and sotrastaurin and the effectiveness of low concentrations of ATO in all types of CLL \[[@R9], [@R10]\], the combination of ATO with these inhibitors (or with BH3-mimetics) may represent an efficient alternative for the clinical treatment of this malignancy. MATERIALS AND METHODS {#s4} ===================== Patients and cells {#s4_1} ------------------ Approval was obtained from the CSIC Bioethics Review Board for these studies. All patients signed an informed consent before blood was drawn. B-lymphocytes were purified from the 48 CLL samples listed in Table [1](#T1){ref-type="table"}, using Ficoll-Paque^TM^ PLUS (GE Healthcare, Uppsala, Sweden) centrifugation and, if necessary, negative selection with anti-CD3-conjugated Dynabeads (Invitrogen Dynal AS, Oslo, Norway). The resulting B cell population was mostly \>90% CD19^+^, determined on a Coulter Epics XL flow cytometer (Beckman Coulter, Fullerton, CA). Primary stromal cells (BMSC) were obtained from a bone marrow sample of a CLL patient after 3 week culture in IMDM (Lonza, Amboise, France)/20% FBS, and maintained for up to 4 weeks in IMDM/15% FBS. The HS-5 stromal cell line, with fibroblastoid properties \[[@R17], [@R18]\], was obtained from Dr. Atanasio Pandiella (Cancer Research Center, Salamanca, Spain). The HS-27A stromal cell line, with epithelioid properties and functionally different than HS-5 cells \[[@R17], [@R18]\] was purchased from ATCC (Manassas, VA, USA). Both cell lines were cultured in RPMI/10% FBS. ###### Clinical characteristics of the CLL patients Patient Sex/Age Stage Ig Status CD38/ZAP70[^a^](#tfn_001){ref-type="table-fn"} α4 integrin[^a^](#tfn_001){ref-type="table-fn"} (%) β1 integrin[^a^](#tfn_001){ref-type="table-fn"} (%) --------- --------- ------- ----------- ------------------------------------------------ ----------------------------------------------------- ----------------------------------------------------- 1 M/57 C/IV ND −/+ ND ND 2 M/69 C/IV ND −/+ 37.0 72.7 3 F/72 C/IV Mutated −/+ 74.9 99.2 4 M/67 B/II Mutated −/+ ND ND 5 M/65 A/I Mutated −/− 78.5 92.0 6 M/79 A/I Unmutated −/+ 95.1 99.2 7 M/ND B/III ND +/+ 82.4 95.0 8 M/79 B/II Unmutated +/− 47.3 95.7 9 M/77 A/0 Unmutated +/ND 45.0 ND 10 F/55 B/II Unmutated −/ND 89.0 89.4 11 M/44 B/II Unmutated −/+ 10.5 63.8 12 M/68 A/0 Mutated −/+ 12.5 41.2 13 M/59 C/IV Unmutated +/+ 29.9 33.2 14 M/85 C/IV Unmutated +/− 25.7 47.1 15 F/73 A/II Mutated −/− 75.9 47.8 16 ND ND ND ND 39.8 16.8 17 M/ND ND ND ND 37.0 80.3 18 M/80 B/II Unmutated −/+ 20.0 37.4 19 F/ND ND ND ND 97.9 17.5 20 M/58 A/II Mutated −/ND 50.0 99.0 21 M/48 B/I Unmutated +/+ 30.0 66.1 22 F/54 B/II Unmutated +/− 92.5 82.5 23 ND ND ND ND ND ND 24 F/82 C/IV Unmutated +/ND 99.2 99.5 25 M/73 B/II Unmutated +/+ 94.1 98.0 26 F/70 C/IV ND +/ND 80.7 78.2 27 M/72 C/IV Unmutated +/ND 48.9 54.3 28 M/44 B/II Unmutated −/+ 18.6 35.0 29 M/61 C/IV Unmutated +/ND 60.9 70.9 30 F/69 C/IV Unmutated +/ND 99.0 97.4 31 M/79 A/I ND −/+ 94.0 99.9 32 F/38 C/III Unmutated +/+ 95.3 91.7 33 F/67 B/II Unmutated +/− 97.1 99.3 34 F/55 B/II Mutated −/+ 98.7 97.0 35 F/65 A/I Unmutated −/+ 19.8 53.5 36 M/65 B/II Mutated −/ND 97.1 92.5 37 M/50 A/0 ND −/+ 40.5 32.5 38 F/69 B/II ND −/+ 63.2 51.4 39 M/74 B/II Unmutated +/+ 34.9 51.3 40 M/74 B/II Mutated −/ND 26.1 40.9 41 M/73 A/0 ND −/− 58.3 68.9 42 M/80 A/I Mutated −/+ 36.2 87.4 43 F/63 A/0 Mutated −/ND 98.8 95.4 44 M/54 A/0 ND −/+ 95.2 97.0 45 M/ND ND Mutated −/− 45.6 60.0 46 F/45 A/I Unmutated −/+ 54.3 75.6 47 M/46 A/I Mutated −/+ 78.4 95.8 48 M/75 B/II Unmutated −/+ 75.7 73.9 ^a^The expression of CD38, ZAP-70 and α4β1 integrin has clinical prognostic value \[[@R1], [@R2]\]. ND, not determined. Antibodies and reagents {#s4_2} ----------------------- Rabbit polyclonal antibodies (RpAbs) to PKC (sc-10800), STAT3 (sc-482), Mcl-1 (sc-819), Bcl-xL (sc-634), Bfl-1 (sc-8351), Bax (sc-526), Noxa (sc-52), and mouse monoclonal Abs (mAbs) to Akt (sc-5298), Lyn (sc-7274), IκBα (sc-1643), Bcl-2 (sc-509), Puma (sc-374223), VCAM-1 (vascular cell adhesion molecule-1, sc-13160), and ICAM-1 (intercellular adhesion molecule-1, sc-107) were from Santa Cruz Biotechnology (Santa Cruz, CA). RpAb to Bim (559685) and mAb to β2 integrin (556084) were from BD Pharmingen (Franklin Lakes, NJ). mAbs to vinculin (V9131) and β-actin (A5316) were from Sigma-Aldrich (St. Louis, MO). mAb to CD19 was from Diaclone (Besançon, France). mAbs against CD38 (16BDH), CD3 (T3B), α4 integrin (HP2/1, function blocking), α4 integrin (HP1/7, inactive control, isotype matched for HP2/1 and anti-β2 Abs), and β1 integrin (Alex1/4) were from Dr. F. Sánchez-Madrid (Hospital de la Princesa, Madrid, Spain). RpAbs to phospho-Akt (T308), phospho-Akt (S473), phospho-PKC (pan, βII Ser660), phospho-ERK1/2 (T202/Y204) and phospho-IκBα (S32/36), and mAb to total ERK1/2 were from Cell Signaling Technology Inc. (Beverly, MA). Rabbit mAb to phospho-Lyn (Tyr396) was from Abcam (Cambridge, UK). mAb to phospho-STAT3 (Tyr705) was from BD Biosciences (Erembodegem, Belgium). HRP-labelled Abs to rabbit or mouse immunoglobulins were from Dako (Glostrup, Denmark). FITC-Annexin V was from Immunostep (Salamanca, Spain). Arsenic trioxide (ATO), fludarabine, and propidium iodide (PI) were from Sigma-Aldrich. Kinase inhibitors PP2 (Src), UO126 (MEK), Bisindolylmaleimide I (BisI, PKC), LY294002 (PI3K), and Triciribine/API-2 (Akt), the Mcl-1 inhibitor MIM1 (\#444130), and the NF-κB activation inhibitor (\#481407) were from Calbiochem (Darmstadt, Germany). CAL-101/idelalisib (PI3Kδ), sotrastaurin (pan-PKC inhibitor with high efficiency for PKCβ), and Stattic (STAT3) inhibitors were from Selleck Chemicals (Houston, TX). CLL-stromal cell co-culture {#s4_3} --------------------------- Bone marrow stromal cells were seeded onto gelatin-coated wells of 96- or 6-well plates. After 4--6 h, HS-27A cells were stimulated with 15--20 ng/ml TNFα overnight at 37°C, 5% CO~2~, to induce VCAM-1 expression. CLL cells (2--5 × 10^6^/ml), with or without previous incubation for 1 h with antibodies or inhibitors, were added to the confluent stromal cell monolayers or cultured in suspension for comparison. After 2 h at 37°C, 2 μM ATO was added or not to the cultures and cells further incubated for various times. CLL cells were gently collected with culture medium for further analysis. The integrity of the stromal cell monolayer was confirmed by phase contrast microscopy. The presence of stromal cells on CLL cell preparations, determined by flow cytometry, was \< 1%. Cell viability analyses {#s4_4} ----------------------- 2 × 10^5^ CLL cells, cultured in suspension or stroma and with or without ATO, were suspended in 300 μl binding buffer (Immunostep) containing 1 μl FITC-Annexin V and 1.5 μg/ml PI. Cell viability was determined on a Coulter Epics XL flow cytometer (Beckman Coulter, Fullerton, CA). For cooperativity analyses, CLL cells were incubated with increasing concentrations of idelalisib or sotrastaurin prior to the addition of 2 μM ATO, and cell viability was determined after 24 h. Synergism or additivity between ATO and these inhibitors was determined using the CompuSyn software (BioSoft, Cambridge, UK). This program allows the calculation of the combination index based on the algorithm of Chou and Talalay (50). Combination index values \< 1 indicate synergism, whereas values = 1 indicate an additive effect. Western blotting {#s4_5} ---------------- 8--10 × 10^6^ CLL cells were lysed (20 min, 4°C) in ice-cold 20 mM Tris-HCl pH 7.5, 137 mM NaCl, 10% glycerol, 1% NP-40, 1 mM NaF, 1 mM Na~3~VO~4~, containing protease/phosphatase inhibitor cocktails (Roche Diagnostics GmbH, Mannheim, Germany) and analyzed by SDS-PAGE and Western blotting on nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA). To detect multiple proteins on the same membrane, after identification of the first protein, membranes were washed with TBS/0.1% Tween^®^20 for 10 min, followed by 3 × 30 min incubation in 1% glycine pH 2.2, 1% SDS, 0.0005% NP-40, at room temperature. Membranes were washed 1 × 10 min with TBS/Tween, blocked with 5% BSA for 1 h, and re-probed with subsequent primary and secondary Abs. Protein bands were developed using the enhanced chemiluminiscent detection method (GE Healthcare Europe GmbH, Barcelona, Spain) and quantitated using the MultiGauge V3.0 program (Fujifilm Global Lifescience, Düsseldorf, Germany). Protein load was corrected using vinculin as internal standard. RNA interference experiments {#s4_6} ---------------------------- The following siRNA sequences were from Sigma-Aldrich: Mcl-1: sense 5′-GGACUUUUAUACCUGUUAUdTT-3′; control siRNA: sense 5′-AUUGUAUGCGAUCGCAGACdTT-3′. CLL cells were nucleofected with siRNAs (200--400 nM/10^6^ cells) in 100 μl Human B Cell Nucleofector^TM^ solution (Lonza) using the U-15 program of the Nucleofector device I (Amaxa, Cologne, Germany). Immediately after nucleofection, 12 × 10^6^ CLL cells were seeded onto wells coated with HS-27A cells or kept in suspension. After 16 h at 37°C, 2 μM ATO was added and cells further incubated for 24 h. CLL cell viability was determined by flow cytometry. Statistical analyses {#s4_7} -------------------- Statistical significance of the data was determined using the two-tailed Student\'s *t*-test. Pearson\'s correlation was used to assess the strength and direction of association between cell viability in response to ATO and Mcl-1 expression. The Cohen interpretation of correlation coefficient (r) indicates that 0.10 \< r \< 0.29 represents a weak correlation; 0.30 \< r \< 0.49 represents a moderate correlation; and coefficients \> 0.50 represent a strong correlation. A *p* value of ≤ 0.05 was considered significant. Analyses were performed using the GraphPad InStat v3.06 software (GraphPad Software, San Diego, CA, USA). All values are expressed as means ± standard deviation. We thank all the CLL patients who donated samples for this study, Dr. Estefanía Ugarte-Berzal for expert advice on some experiments and Dr. Pedro Lastres for valuable help with the flow cytometry analyses. **CONFLICTS OF INTEREST** The authors declare that there are no conflicts of interest. **FINANCIAL SUPPORT** This work was supported by grants SAF2012--31613 (AGP) and RTICC (Red Temática de Investigación Cooperativa en Cáncer) RD12/0036/0061 (AGP), from the Ministry of Economy and Competitiveness (MINECO), Spain; S2010/BMD-2314-Neoplasbim (AGP) from the Comunidad de Madrid/European Union; and a grant from the Fundación para la Investigación Biomédica Hospital Universitario Puerta de Hierro, Madrid (JAGM). IAJ was supported by the Junta de Ampliación de Estudios program, JAEPre2010--00607, CSIC/European Union, and by MINECO. | Mid | [
0.6309341500765691,
25.75,
15.0625
]
|
Added to shortlist This home is in your shortlist. To access your shortlist click the icon in the navigation Add to shortlist This home is not yet in your shortlist 3 chambres Couchages 6 1 salles de bain Notre maison Home on acreage in peaceful location. Forty-five mins to Brisbane city or beaches. Mountain area within the Sunshine Coast Hinterland. Home to the Woodford Festival. Small town within 4klms, beautiful tourist drives. Domestic animals, two dogs, a cat and 2 chickens. Several sheep which graze over two properties, they like company but do not require any care. There are dams and ponds on property, so not suitable property if you gave small children. Extensive gardens, and large outdoor entertainment area. | Low | [
0.504504504504504,
28,
27.5
]
|
How to apply face serum You may live by the skin care mantra of cleanse, tone and mositurize but do you know where the face serum fits in? Serums are relative newcomers to the anti aging skin care market and a lot of people (me included when I first starting using it) are unclear about exactly when and how to apply a skin serum to get the most benefit. It’s an additional step in the daily skin care regimen and we’re not sure just when to use it. Under or over your moisturizer – last thing before your makeup – sometimes skin care manufacturers don’t make it clear. You might assume that if you don’t get guidance from the makers – it doesn’t matter how you apply it. But it does – applying your serum properly has a real impact on how well the active anti aging ingredients penetrate below the skin’s surface. Ultimately it can make a difference as to whether you get the positive results you want. Take time with face serum Corrrect application of all skin care products is important – especially if they contain active ingredients that need to penetrate to the dermis to be effective. Not applying products in the right way can mean the active ingredients just sit on the surface and fail to have any effect at all. The purpose of a face serum is to deliver active ingredients to your skin – if you don’t put it on right the money you’ve spent could be wasted. It’s definitely worth taking a little bit of time now to learn the best way of applying face serum to get the most from the active ingredients. Stick to one brand Speaking from experience I don’t always buy the products I use from only one brand. I use them at different rates and sometimes I find that the cream from one brand suits me whilst the cleanser from the same line just doesn’t. Or I buy from different brands at different times because I run out of things or get tempted by new skin care products. Like most women – I have ended up with a bit of an odd assortment of bottles and jars on my bathroom shelf. But does it matter that your skin serum is not the same brand as your hydrating cream? My view is that where products are designed to work together you will tend to get better results. Take the wonderful Skin Medica TNS Regeneration System Kit – the moisturizer and the anti aging serum are sold as a kit and they work perfectly together as they are designed to do. Worth getting because results are much better together than alone. There are many other brands out there – Murad Skin Care for example – where skin care is sold in a package or kit usually including a serum. Obviously they sell more products this way but customers benefit too. Different brands may clash Serums and moisturizers can be layered on the skin without problems if they are designed to go together. Not always the case if you mix and match brands though. I see quite a lot of reports in beauty forums and customer reviews that even the best skin serum doesn’t work very well with the customer’s normal moisturizer. The result – difficulty in applying make up or peeling and ‘pilling’ of foundation on the skin. Definitely not this season’s best look! The cause of the problem is likely to be the conflict between the serum formulation – usually a gel type base – and the face moisturizer which is often a lotion or a cream. Don’t apply too much face serum If you get problems with serums splitting or not sinking in – it may be nothing to do with the product. It may simply be you are applying too much in the hope of instant younger looking skin. It’s a common problem according to dermatologists. Putting on too much cream or serum is a recipe for problems. Skin can only absorb so much and the residue will remain on the surface and can block pores causing breakouts or coagulate and ruin your makeup. Start off by reading the instructions on the packaging and use only the amount of product recommended. Don’t overload your skin. Active ingredients have to work together The other issue with using competing brands of skin care is that the ingredients may cause conflicts and confusion. An active ingredient in your serum may cause irritation when combined with a different active in your face cream or they may just cancel one another out. Quality brands have been formulated to deliver outcomes – skin clarity, reduction in fine lines – based on a set of ingredients that work together. Using products from the same line will reinforce the results – using a randomly chosen alternative may undermine them. How to apply face serum – top tips Whether your face serum give you the results you want will depend at least in part on how well you apply it – so here’s some great tips to follow to make sure you get the results you want: Active ingredients penetrate better when skin is clean, warmed and slightly moist so cleanse thoroughly in your normal manner and then apply toner if you use one. Apply tiny dots of serum all over your face and then blend lightly and quickly all over with your middle finger Use short light but firm strokes to apply your face serum. Do not stretch, pull or rub the skin. Whilst the serum is still wet after applying gently tap the surface of your face with your fingers for half a minute. You can use all your fingers both hands on either side of your face very lightly. The tapping action encourages the serum to sink fully into the deeper layers of the skin as far as it is able to go. If you feel any tingling sensations when you apply the serum – don’t worry. Tingling can be a sign the active ingredients in the serum are getting to the dermis – where they need to be if they are going to work. Types of serum ingredients where you may see this result include vitamin C and retinoids Only when your serum is fully dry – touch dry on your face – should you apply your moisturizer in a similar manner. Let that sink in fully before you apply your foundation and normal makeup. Of course – understanding how to apply face serum is the first step – what really makes a difference is doing it! email About Eileen I am the publisher of Simply Anti Aging and a web author researching and writing on all aspects of anti aging. I'd love you to connect with me onGoogle+ | Mid | [
0.5728395061728391,
29,
21.625
]
|
I, too, have been looking for this title, and hit a dead end at the Museum. I'm anxious to see what becomes of this thread! LeeAnne Krause U of S. Carolina >>> [email protected] 09/20/00 02:29PM >>> Thanks...I don't think this is the same title. I'm looking for Corn Is Life; the Museum of Northern Arizona also released a video called Hopi (I think that's the one in the catalog)...unless you have other info??? | Low | [
0.45309381237524904,
28.375,
34.25
]
|
Q: Rails Passenger & mysql Access denied for user I have a rails application running on Fedora 20 against Apache & mysql (Maria db) It worked with no issues until a recent update to Fedora , afterwards passanger failed with this error Web application could not be started Access denied for user 'user'@'localhost' to database 'TheDB' (Mysql2::Error) running rails from the command line using WEBrick works fine, it is also possible to connect to the mysql with mysql -u user -h loalhost m -p reinstalling passenger & mysql2 gem did not help After a few hours of tackling this I am drawing a complete blank on what else to try I will welcome any ideas A: If you can connect using the right username and password from command line but your scripts cannot connect using the same credentials, check the the database mysql, table user for the correct values in the column Host. SELECT Host FROM mysql.user WHERE User='myusername'; From http://dev.mysql.com/doc/refman/5.1/en/connection-access.html : Identity checking is performed using the three user table scope columns (Host, User, and Password). The server accepts the connection only if the Host and User columns in some user table row match the client host name and user name and the client supplies the password specified in that row. Check if the sorting rules are not affecting you : The server uses the first row that matches the client host name and user name. | High | [
0.682860998650472,
31.625,
14.6875
]
|
Product Information Description What is Somatropin? Somatropin is a protein-based poly-peptide hormone, designed to stimulate growth, cell reproduction and regeneration. Our homeopathic Somatropin is the trusted choice for men and women who want to look and feel their best at an affordable cost. We invite you to research Somatropin and determine if our homeopathic Somatropin is right for you. When you are ready, we are here for you and are your partners each step of the journey. * These statements have not been evaluated by the Food and Drug Administration. This product is not intended to diagnose, treat, cure, or prevent any disease. Product Directions / Additional Info Place 5 to 6 drops under tongue 4 times per day (or fewer drops more often) for absorption into the soft tissue for 25 consecutive days; start taking drops again after 5 days. For maximum effort, do not eat, drink, or swallow for up to 15 minutes. Warning: Do not use if seal is broken, torn, or missing. If pregnant or nursing, consult a health care professional before taking this product. If you have negative reactions or symptoms consult a health care professional immediately. KEEP OUT OF REACH OF CHILDREN. Description: JUGGERNAUT® HP is the optimal pre-workout solution to support the intensity and drive of your workout, while simultaneously helping you to push until that last rep is achieved.* With included ingredients such as Agmatine Sulfate, CarnoSyn® and Creatine MagnaPower®, JUGGERNAUT® ... Ask A Question Customer Reviews Health Notes Disclaimer: This scientific independent research is provided by Aisle7 and is for informational use only. GNC provides this information as a service but does not endorse it. Likewise, Aisle7 does not recommend or endorse any specific products. Somatropin As of the last update, we have found no reported interactions between this medicine and specific foods, supplements, or other compounds. It is possible that unknown interactions exist. Taking medicines with meals, on an empty stomach, or with alcohol may influence their effects; refer to the manufacturers' package information for details as this is not covered here. If you take medication, always discuss the potential risks and benefits of adding a new supplement with your doctor or pharmacist. Healthnotes and/or its suppliers make no warranties or representations as to the accuracy or completeness of this content herein or that of any organization referred or linked to within this content and will not be liable for any damages arising out of your access to or use of any information found herein or that of any organization referred to within this content. | Low | [
0.5010266940451741,
30.5,
30.375
]
|
<!doctype html> <html lang="en"> <head> <title>Code coverage report for tests/unit/tabs-pane.spec.js</title> <meta charset="utf-8" /> <link rel="stylesheet" href="../../prettify.css" /> <link rel="stylesheet" href="../../base.css" /> <meta name="viewport" content="width=device-width, initial-scale=1"> <style type='text/css'> .coverage-summary .sorter { background-image: url(../../sort-arrow-sprite.png); } </style> </head> <body> <div class='wrapper'> <div class='pad1'> <h1> <a href="../../index.html">all files</a> / <a href="index.html">tests/unit/</a> tabs-pane.spec.js </h1> <div class='clearfix'> <div class='fl pad1y space-right2'> <span class="strong">100% </span> <span class="quiet">Statements</span> <span class='fraction'>4/4</span> </div> <div class='fl pad1y space-right2'> <span class="strong">100% </span> <span class="quiet">Branches</span> <span class='fraction'>0/0</span> </div> <div class='fl pad1y space-right2'> <span class="strong">100% </span> <span class="quiet">Functions</span> <span class='fraction'>2/2</span> </div> <div class='fl pad1y space-right2'> <span class="strong">100% </span> <span class="quiet">Lines</span> <span class='fraction'>4/4</span> </div> </div> </div> <div class='status-line high'></div> <pre><table class="coverage"> <tr><td class="line-count quiet">1 2 3 4 5 6 7 8 9 10 11 12 13 14</td><td class="line-coverage quiet"><span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-yes">1×</span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-yes">1×</span> <span class="cline-any cline-yes">1×</span> <span class="cline-any cline-yes">1×</span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span> <span class="cline-any cline-neutral"> </span></td><td class="text"><pre class="prettyprint lang-js">import chai, {expect} from 'chai' import sinon from 'sinon' import sinonChai from 'sinon-chai' import {shallowMount, mount} from '@vue/test-utils' import TabsPane from '../../src/tabs/tabs-pane' chai.use(sinonChai) describe('TabsPane.vue', () => { it('存在.', () => { expect(TabsPane).to.exist }) }) </pre></td></tr> </table></pre> <div class='push'></div><!-- for sticky footer --> </div><!-- /wrapper --> <div class='footer quiet pad2 space-top1 center small'> Code coverage generated by <a href="http://istanbul-js.org/" target="_blank">istanbul</a> at Sat Dec 01 2018 21:13:27 GMT+0800 (CST) </div> </div> <script src="../../prettify.js"></script> <script> window.onload = function () { if (typeof prettyPrint === 'function') { prettyPrint(); } }; </script> <script src="../../sorter.js"></script> </body> </html> | Low | [
0.49403341288782804,
25.875,
26.5
]
|
# Webcamoid, webcam capture application. # Copyright (C) 2016 Gonzalo Exequiel Pedone # # Webcamoid is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # Webcamoid is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with Webcamoid. If not, see <http://www.gnu.org/licenses/>. # # Web-Site: http://webcamoid.github.io/ exists(akcommons.pri) { include(akcommons.pri) } else { exists(../../../../akcommons.pri) { include(../../../../akcommons.pri) } else { error("akcommons.pri file not found.") } } CONFIG += plugin link_prl HEADERS = \ src/plugin.h \ src/mediawritergstreamer.h \ src/outputparams.h \ ../mediawriter.h INCLUDEPATH += \ ../../../../Lib/src \ ../ LIBS += -L$${OUT_PWD}/../../../../Lib/$${BIN_DIR} -l$$qtLibraryTarget($${COMMONS_TARGET}) OTHER_FILES += pspec.json !isEmpty(GSTREAMERINCLUDES): INCLUDEPATH += $${GSTREAMERINCLUDES} !isEmpty(GSTREAMERLIBS): LIBS += $${GSTREAMERLIBS} isEmpty(GSTREAMERLIBS) { CONFIG += link_pkgconfig PKGCONFIG += \ gstreamer-1.0 \ gstreamer-app-1.0 \ gstreamer-audio-1.0 \ gstreamer-video-1.0 \ gstreamer-pbutils-1.0 } QT += qml concurrent SOURCES = \ src/plugin.cpp \ src/mediawritergstreamer.cpp \ src/outputparams.cpp \ ../mediawriter.cpp akModule = MultiSink DESTDIR = $${OUT_PWD}/../../$${BIN_DIR}/submodules/$${akModule} TEMPLATE = lib INSTALLS += target android { TARGET = $${COMMONS_TARGET}_submodules_$${akModule}_lib$${TARGET} target.path = $${LIBDIR} } else { target.path = $${INSTALLPLUGINSDIR}/submodules/$${akModule} } | Mid | [
0.547619047619047,
34.5,
28.5
]
|
James Hackman James Hackman (baptized 13 December 1752, hanged 19 April 1779), briefly Rector of Wiveton in Norfolk, was the man who murdered Martha Ray, singer and mistress of John Montagu, 4th Earl of Sandwich. Early life Baptized on 13 December 1752 at Gosport, Hampshire, Hackman was the son of William and Mary Hackman. His father had served in the Royal Navy as a lieutenant. Hackman was apprenticed to a mercer, and although according to some accounts he became a member of St John's College, Cambridge, no record of this can be traced at Cambridge. Career In 1772, Hackman was purchased a commission as an ensign in the 68th Regiment of Foot, and in 1776 was promoted lieutenant, but by early 1777 he had resigned from the army to become a clergyman. On 24 February 1779, Hackman was ordained a deacon of the Church of England and on 28 February a priest, and on 1 March 1779 was instituted as Rector of Wiveton, a place that he may never have visited. Martha Ray In about 1775, while he was a serving army officer, Hackman visited Lord Sandwich's house at Hinchingbrooke and met his host's mistress Martha Ray. She was "a lady of an elegant person, great sweetness of manners, and of a remarkable judgement and execution in vocal and instrumental music" who had lived with Lord Sandwich as his wife since the age of seventeen and had given birth to nine of his children. Sandwich also had a wife, from whom he was separated, who was considered mad and who lived in an apartment at Windsor Castle. This was the same Lord Sandwich who is said to have called for a piece of beef between two pieces of bread, thus originating the word sandwich. He was a patron of the explorer Captain James Cook, who named the Sandwich Islands after him. Hackman struck up a friendship with Martha Ray (who was several years older than he was) and was later reported to have become besotted with her. They may have become lovers and discussed marriage, but this is disputed. Although rich, Sandwich was usually in debt and offered Martha Ray no financial security. However, whatever was between Hackman and Martha Ray ended when he was posted to Ireland. On 7 April 1779, a few weeks after his ordination as a priest of the Church of England, Hackman followed Martha Ray to Covent Garden, where she had gone to watch a performance of Isaac Bickerstaffe's comic opera Love in a Village with her friend and fellow singer Caterina Galli. Suspecting that Ray had a new lover, when Hackman saw her in the theatre with William Hanger, 3rd Baron Coleraine, he left, fetched two pistols, and waited in a nearby coffee house. After Ray and Galli came out of the theatre, Hackman approached the ladies just as they were about to get into their carriage. He put one pistol to Ray's forehead and shot her dead. With the other he then tried to kill himself but made only a flesh wound. He then beat himself with both discharged pistols until he was arrested and taken, with Martha Ray's body, into a tavern in St James's Street. Two letters were found on Hackman, one addressed to his brother-in-law, Frederick Booth, and a love letter to Martha Ray: both later appeared in evidence at the murder trial. When Lord Sandwich heard what had happened, he "wept exceedingly". On 14 April 1779, Martha Ray was entombed inside the parish church of Elstree, Hertfordshire, but her body was later moved into the cemetery. On the instructions of Lord Sandwich, she was buried in the clothes she had been wearing when killed. Trial Hackman was quickly committed to the Tothill Fields Bridewell. As "James Hackman, Clerk", he was indicted for "the wilful murther of Martha Ray, spinster" on the inquisition of the coroner. On 16 April 1779, just nine days after the event, Hackman was tried for murder at the Old Bailey. Despite having previously decided to plead guilty, in the event he pleaded not guilty, explaining that "the justice of my country ought to be satisfied by suffering my offence to be proved". John McNamara, Esq., gave evidence that on the evening of 7 April, he believed at some time after eleven o'clock, he came out of the playhouse with Martha Ray, and having seen her "in some difficulties at the playhouse", offered his help in handing her to her carriage. She took his arm. As they came out of the passage into the Covent Garden playhouse and were two steps from the carriage, he heard the report of a pistol, while Miss Ray was still holding his right arm with her left hand. She fell instantly. He thought the pistol had been "fired out of wantonness" and that Miss Ray had fainted. He knelt to help her, but found blood on his hands, and got her into the Shakspeare tavern. He did not see Hackman at the time, but after he had been arrested, asked him what had possessed him, and he answered "that it was not a proper place to ask that question, or something to that effect... I asked him his name, and I understood from him that his name was Hackman; I think he pronounced his name with an H. I asked him if he knew anybody. He said, he knew a Mr. Booth, in Craven-street in the Strand, and desired he might be sent for. He desired to see the lady. I did not tell him she was dead; somebody else did. I objected to his seeing her at that time. I had her removed into another room. From the great quantity of blood I had about me I got sick, and was obliged to go home. I know no more about it." Mary Anderson, a fruit seller, gave evidence that she was standing close by the carriage. She is recorded as saying: Anderson said she had identified Hackman in Tothill Fields Bridewell the next day and she did so again in court, pointing to the prisoner. Richard Blandy, a constable, gave evidence that he had been coming from Drury-Lane house and that as he came by the piazzas in Covent Garden he heard two pistol shots and then heard somebody say two people were killed. Approaching, he saw the surgeon had Hackman and a pistol in his hand. A Mr Mahon had given Blandy the pistol and asked him to take care of the prisoner and to take him to Mahon's house. The prisoner was bloody, wounded in the head, and very faint. When Blandy came to the corner by the Red Lion, the door was shut, and he was then asked to take the prisoner back to the Shakspeare tavern, where Mr Mahon was. Blandy searched the prisoner's pocket and found two letters, which he gave to Mr Campbell, master of the Shakspeare tavern. He could say nothing else about the letters. James Mahon, an apothecary, gave evidence that he lived at the corner of Bow Street. Coming through the piazzas in Covent-Garden, he heard two pistols go off. Going back, he saw a gentleman lying on the ground, with a pistol in his left hand, beating himself violently and bleeding copiously. The prisoner was the gentleman. Mahon had taken the pistol away from him and given it to the constable, asking him to take the prisoner to his house for the wound to be dressed. He had seen nothing of the lady until two or three minutes later he saw her lying at the bar, with a mortal wound, and said he could not help her. Dennis O'Bryan, a surgeon, gave evidence that he had examined Miss Ray's body at the Shakspeare tavern on the night of the murder. He found the wound to be mortal, could find no sign of life, and pronounced the woman dead. The wound was in the 'centra coronalis' (the crown of the head) and the ball had come out under the left ear. Hackman gave evidence for himself, reading a prepared statement to the court, which was probably written by the lawyer and writer James Boswell, who although not professionally engaged was closely associated with the defence. The statement afterwards appeared in all the newspapers. Hackman admitted that he had killed Ray, but he claimed he had only meant to kill himself. He said: Hackman's defence counsel submitted to the court that Hackman was insane and that the killing of Martha Ray was unpremeditated, as shown by the letter to her found on him. William Halliburton was sworn and produced the other letter found in the prisoner's pocket, which he said he had had from Booth. Mahon identified it as a letter taken from the prisoner, which he said Booth had opened and read in his presence. The letter, addressed to "Frederick Booth, Esq. Craven street, in the Strand", was read into the record: Mr Justice Blackstone, presiding at the trial, summed up the case against Hackman. He told the jury that the crime of murder did not demand "a long form of deliberation" and that Hackman's letter to Frederick Booth showed "a coolness and deliberation which no ways accorded with the ideas of insanity". Hackman was convicted and sentenced to be hanged. In a newspaper report of the trial, Hackman was described as five feet nine inches tall, "very genteely made, and of a most polite Address". After the trial, James Boswell told Frederick Booth that Hackman had behaved "with Decency, Propriety, and in such a Manner as to interest everyone present". Execution Hackman was hanged at Tyburn on 19 April 1779. He travelled there in a mourning coach, accompanied by the sheriff's officer and two fellow clergymen, the Rev. Moses Porter, a curate friend from Clapham, and the Rev. John Villette, the chaplain of Newgate Prison. James Boswell later denied rumours that he had also been in the coach. At Tyburn, "Hackman... behaved with great fortitude; no appearances of fear were to be perceived, but very evident signs of contrition and repentance". His body was later publicly dissected at Surgeons' Hall, London. Aftermath Hackman's case became famous, and The Newgate Calendar later noted that: Horace Walpole remarked that the murder fascinated much of London during April 1779. At first, given Sandwich's position as First Lord of the Admiralty, a political motive was suspected. Not long before, Sandwich and Martha Ray had found themselves fleeing from Admiralty House, where a mob was rioting against the government and in particular against what it saw as the mistreatment of Admiral Keppel. The affair inspired Sir Herbert Croft's epistolary novel Love and Madness (1780), an imagined correspondence between Hackman and Martha Ray. In this, Hackman is dealt with sympathetically. He is represented as a man of sensibility suffering from an extreme case of unrequited love who descends into suicidal and homicidal despair, even to the point that the reader is invited to identify with Hackman rather than with his victim. Samuel Johnson and Topham Beauclerk debated whether Hackman had meant to kill only himself. Johnson believed that the two pistols Hackman took with him to Covent Garden meant that he intended there to be two deaths. Boswell himself (who had visited Hackman in prison) wrote that the case showed "the dreadful effects that the passion of Love may produce". In his Mind-Forg'd Manacles (1987), the social historian Roy Porter argues that Hackman was well aware of the madness of his passion. In The Luck of Barry Lyndon, Thackeray has his protagonist describe having met Hackman 'at one of Mrs Cornely's balls, at Carlisle House, Soho'. Likenesses A mezzotint of Hackman by Robert Laurie, after Robert Dighton, was published in 1779. Another engraving of Hackman (artist unknown) was used as an illustration in The Case and Memoirs of the Late Rev. Mr James Hackman (1779). References Notes Category:1750s births Category:1779 deaths Category:People from Gosport Category:Executed priests Category:18th-century English Anglican priests Category:People executed by the Kingdom of Great Britain Category:68th Regiment of Foot officers Category:Executed English people Category:People executed by England and Wales by hanging Category:English people convicted of murder Category:People convicted of murder by England and Wales Category:People executed at Tyburn | Mid | [
0.5458248472505091,
33.5,
27.875
]
|
Screening and therapy of pulmonary hypertension in systemic sclerosis. Systemic sclerosis is a major risk factor for the development of pulmonary arterial hypertension. Often this disease is far advanced by the time it is detected in the individual patient, severely impacting quality of life and survival. Therapeutic options available for patients with scleroderma-associated pulmonary arterial hypertension have increased significantly over the last few years, fueling our desire to improve early detection of disease. During the course of this manuscript I will review the literature examining approaches towards screening for scleroderma-associated pulmonary arterial hypertension. I will then discuss the most recent studies examining therapeutic options for patients with this disease. | High | [
0.708333333333333,
29.75,
12.25
]
|
Wedding receptions in Sugar Land are in demand, and the top venue is Hilton Garden Inn Houston Sugar Land. No other Houston hotel is more committed to offering you the wedding of your dreams. We've got it all: the finest wedding venue in Houston, Texas with 6,703 sq. ft. of space, catering expert Planning for 50 to 300 guests Private Property Houston is the perfect, affordable destination for your celebration. Private Property Houston is located 8 miles from downtown offering an outdoor natural country outdoor feeling close to the city. The Firehouse Saloon, owned and operated by firefighters for over 20 years, is a unique and rustic country bar in Houston, TX. A music venue featuring the best in Texas music, we are also the perfect place to host any private party or event. Next time you’re looking for a place to enjoy live ent The Embassy Suites Houston Energy Corridor is the closest Energy Corridor hotel to both Houston area airports, downtown Houston and the famed Houston Galleria. The hotel provides a full-service restaurant and bar that offers complimentary cooked-to-order hot breakfast as well as lunch and dinner ser Multiplicity’s Outdoor Event Venue is a beautifully landscaped acre tucked away in charming Old Town Katy, convenient to Houston and surrounding areas. Amenities include a lovely and unique gazebo with stained glass windows; a climate-controlled cabana for food service set-up, with refrigerator, buf Northgate Country Club features a stunning setting for both indoor and outdoor ceremonies, either in our striking clubhouse or our garden court gazebo.We gladly welcome rehearsal dinners, ceremonies and receptions. Our clubhouse can accommodate up to 320 guests with a dance floor, all in the same r A Fulshear landmark since 1986, Weston Lakes Country Club is known for hosting many memorable weddings, receptions, rehearsal dinners, bridal showers and luncheons. Our romantic ballroom overlooks the beautiful lakeside ceremonial area, perfect for a sunset wedding. Whether you are planning an ex Let Las Alamedas guide you in planning your special event. You can have appetizers or entrees as a pre-set menu for plated, buffet or standing receptions. Our bar offers a large variety of Margaritas, tequila and beer and wine. We can accommodate up to 100 for a seated dinner or 130 for a cocktai The company, La Villa Ballroom, is a full service banquet, ballroom, and reception center. It is a great place for any of your occasions, such as weddings, Quinceaneras, birthday parties, graduation, corporate and civic events. The company, La Villa Ballroom, offers catering, limo service, DJ, cak Royal Palace Banquet and Event Center is one of the most beautiful wedding venues in Houston. It also ranks high as one of the most affordable wedding venues in Houston where you have flexibility to bring your own theme and vendors. Royal Palace Banquet and Event Center is designed and equipped with The Courtyard Houston Hobby Airport is centrally located between Houston, the Port of Houston and the island of Galveston. We offer a specious hotel room with coffee, tea and luxurious, comfortable bedding. We offer a landscaped courtyard and gazebo, outdoor pool and whirlpool along with complimen At Marriott Hotels & Resorts®, it's our mission to make every business trip a pleasure and every vacation the trip of a lifetime. Enjoy amenity-filled guest rooms, superb dining, exemplary meeting facilities and our time-honored spirit to serve®. We are a full service hotel located in the Houston Hobby area. We have a 1950 square foot ballroom that is ideal for a wedding reception with 125 guest or less. Our food and service is outstanding! Our professional sales and catering team has what it takes to make the most of your special day. Group travel, event planning, business travel and meeting planning are quick and easy when you book your group accommodations. Have your next conference, reunion, meeting or special event. Located two miles from NASA's Johnson Space Center. * Please note - we are unable to allow DJ's or Live Musici The Admiral is Clear Lake’s premier waterfront wedding facility. This 5,000 square foot venue provides the perfect backdrop to host weddings and receptions. An exceptional view of Clear Lake and beautiful architectural details create the refinement and elegance that make The Admiral a first class de Houston & The Bay Area's most sought after entertainment boats serving all type of cruises including wedding & receptions, Birthdays, Anniversaries, Corporate and company cruises and events. Please Call our friendly and professional staff to book your next cruise on Clear Lake & Galveston Bay. Bridge Water Events is Baytown's premier waterfront event facility. We are proud to provide a full service facility to accommodate your special occasion. Our goal is to create a personalized event package that is special to you and your guests. We strive to make your experience at Bridge Water Home of 2008 model luxury yacht,the FantaSea. Accommodations for up to 149 passengers,this floating venue is ideal for weddings, social events, corporate functions or any reason to celebrate. Public Dinner Cruises are ideal for small groups, birthdays, anniversaries or graduations. Fun themed even Please Sign In Forgot Your Password? Enter your e-mail address and we'll send you a newly generated password. Upon receiving your new password, it is recommended that you login and immediately change your password to something you will remember. Email: TO: RE: Please send me more information about your services and pricing. Date Flexible Allow other venues in the area to respond to my request Your Information has been sent! Would you like to receive additional quotes? Venues Caterers DJs Photographers Officiants Event Planners Start Time: Duration: Contact me by email Contact me by email or phone Request Free Quotes From Event Venues and Vendors Event Type: Event Date: Location: Attendees: Which types of businesses would you like to receive free quotes from? Venues Caterers DJs Photographers Officiants Event Planners Contact me by email Contact me by email or phone Request Free Quotes From Event Venues and Vendors Would you like to receive additional quotes? Supplies + Rentals Bands + Musicians Entertainers Videography Audio + Visual Staffing + Services Transportation Flowers Audio + Visual Start Time: Duration: Write a Recommendation A recommendation from you goes a long way to helping others learn about local event businesses! | Mid | [
0.548693586698337,
28.875,
23.75
]
|
// // QAListViewController.m // MobileRTCSample // // Created by Zoom Video Communications on 2019/10/28. // Copyright © 2019 Zoom Video Communications, Inc. All rights reserved. // #import "QAListViewController.h" #import "QAListTableViewCell.h" typedef NS_ENUM(NSInteger, ZoomSampleQAListType) { ZoomSampleQAListType_All = 0, ZoomSampleQAListType_My, ZoomSampleQAListType_Open, ZoomSampleQAListType_Answered, ZoomSampleQAListType_Dismissed, }; @interface QAListViewController()<UITableViewDataSource, UITableViewDelegate, MobileRTCMeetingServiceDelegate> @property (nonatomic, strong) UITableView *tableView; @property (nonatomic, strong) NSArray *tableDataSource; @property (nonatomic, assign) ZoomSampleQAListType type; @end @implementation QAListViewController - (void)viewDidLoad { [super viewDidLoad]; self.modalPresentationStyle = UIModalPresentationFullScreen; self.navigationController.navigationBar.translucent = NO; [[MobileRTC sharedRTC] getMeetingService].delegate = self; self.title = @"QA List"; UIBarButtonItem *closeItem = [[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemDone target:self action:@selector(onDone:)]; [self.navigationItem setLeftBarButtonItem:closeItem]; [self.navigationItem.leftBarButtonItem setTintColor:RGBCOLOR(0x2D, 0x8C, 0xFF)]; UIBarButtonItem *moreItem = [[UIBarButtonItem alloc] initWithBarButtonSystemItem:UIBarButtonSystemItemAdd target:self action:@selector(onAdd:)]; [self.navigationItem setRightBarButtonItem:moreItem]; [self.navigationItem.rightBarButtonItem setTintColor:RGBCOLOR(0x2D, 0x8C, 0xFF)]; float h; if (IPHONE_X) { h = SCREEN_HEIGHT-self.navigationController.navigationBar.frame.size.height - SAFE_ZOOM_INSETS; } else { h = SCREEN_HEIGHT-self.navigationController.navigationBar.frame.size.height - 20; } self.tableView = [[UITableView alloc] initWithFrame:CGRectMake(0, 0, SCREEN_WIDTH, h) style:UITableViewStyleGrouped]; self.tableView.dataSource = self; self.tableView.delegate = self; self.tableView.rowHeight = 230; if (@available(iOS 11.0, *)) { self.tableView.contentInsetAdjustmentBehavior = UIScrollViewContentInsetAdjustmentNever; self.tableView.estimatedSectionFooterHeight = 0; self.tableView.estimatedSectionHeaderHeight = 0; self.tableView.estimatedRowHeight = 0 ; } else { self.automaticallyAdjustsScrollViewInsets = NO; } [self.view addSubview:self.tableView]; self.tableView.backgroundColor = [UIColor whiteColor]; self.tableView.showsVerticalScrollIndicator = NO; self.tableView.tableFooterView = [[UIView alloc] initWithFrame:CGRectZero ]; [self.tableView registerClass:[QAListTableViewCell class] forCellReuseIdentifier:@"cell"]; if ([[[MobileRTC sharedRTC] getMeetingService] isWebinarAttendee]) { self.type = ZoomSampleQAListType_All; self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getAllQuestionList]; } else { self.type = ZoomSampleQAListType_Open; self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getOpenQuestionList]; } } - (void)didReceiveMemoryWarning { [super didReceiveMemoryWarning]; // Dispose of any resources that can be recreated. } - (void)onDone:(id)sender { [self dismissViewControllerAnimated:YES completion:NULL]; } - (void)onAdd:(id)sender { UIAlertController *alertController = [UIAlertController alertControllerWithTitle:nil message:nil preferredStyle:UIAlertControllerStyleActionSheet]; if ([[[MobileRTC sharedRTC] getMeetingService] isWebinarAttendee]) { [alertController addAction:[UIAlertAction actionWithTitle:@"Add Question" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { [[[MobileRTC sharedRTC] getMeetingService] addQuestion:@"Test-Add-Qestion" anonymous:NO]; }]]; } if ([[[MobileRTC sharedRTC] getMeetingService] isWebinarAttendee]) { [alertController addAction:[UIAlertAction actionWithTitle:[NSString stringWithFormat:@"All Questions(%@)",@([[[MobileRTC sharedRTC] getMeetingService] getALLQuestionCount])] style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { self.type = ZoomSampleQAListType_All; [self updateData]; }]]; [alertController addAction:[UIAlertAction actionWithTitle:[NSString stringWithFormat:@"My Questions(%@)",@([[[MobileRTC sharedRTC] getMeetingService] getMyQuestionCount])] style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { self.type = ZoomSampleQAListType_My; [self updateData]; }]]; } else { [alertController addAction:[UIAlertAction actionWithTitle:[NSString stringWithFormat:@"Open Questions(%@)",@([[[MobileRTC sharedRTC] getMeetingService] getOpenQuestionCount])] style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { self.type = ZoomSampleQAListType_Open; [self updateData]; }]]; [alertController addAction:[UIAlertAction actionWithTitle:[NSString stringWithFormat:@"Answered Questions(%@)",@([[[MobileRTC sharedRTC] getMeetingService] getAnsweredQuestionCount])] style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { self.type = ZoomSampleQAListType_Answered; [self updateData]; }]]; [alertController addAction:[UIAlertAction actionWithTitle:[NSString stringWithFormat:@"Dismissed Questions(%@)",@([[[MobileRTC sharedRTC] getMeetingService] getDismissedQuestionCount])] style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { self.type = ZoomSampleQAListType_Dismissed; [self updateData]; }]]; } [alertController addAction:[UIAlertAction actionWithTitle:NSLocalizedString(@"Cancel", nil) style:UIAlertActionStyleCancel handler:^(UIAlertAction *action) { }]]; if (IS_IPAD) { UIPopoverPresentationController *popover = alertController.popoverPresentationController; if (popover) { popover.sourceView = self.navigationController.view; popover.sourceRect = CGRectMake(SCREEN_WIDTH,64,1.0,1.0);; popover.permittedArrowDirections = UIPopoverArrowDirectionAny; } } if (alertController.actions.count > 1) { AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; [[appDelegate topViewController] presentViewController:alertController animated:YES completion:nil]; } } #pragma mark - Table view data source - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { // Return the number of sections. return 1; } - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { // Return the number of rows in the section. return self.tableDataSource.count; } - (CGFloat)tableView:(UITableView *)tableView heightForFooterInSection:(NSInteger)section { return 0.01; } - (CGFloat)tableView:(UITableView *)tableView heightForHeaderInSection:(NSInteger)section { return 0.01; } - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:@"cell" forIndexPath:indexPath]; MobileRTCQAItem * item = [_tableDataSource objectAtIndex:indexPath.row]; NSString *answerSting = @""; NSArray *answerList = [item getAnswerlist]; for (NSInteger i = 0; i < answerList.count; i ++) { MobileRTCQAAnswerItem *answeritem = [answerList objectAtIndex:i]; if (i > 0 && i < answerList.count) answerSting = [answerSting stringByAppendingString:@", "]; answerSting = [answerSting stringByAppendingString:[answeritem getText]]; } ((QAListTableViewCell *)cell).contentLabel.text = [NSString stringWithFormat:@"QuestionId:%@ \nText:%@ \nTime:%@ \nSenderName:%@ \nisAnonymous:%@ \nisMarkedAsAnswered:%@ \nisMarkedAsDismissed:%@ \ngetUpvoteNumber:%@ \ngetHasLiveAnswers:%@ \ngetHasTextAnswers:%@ \nisMySelfUpvoted:%@ \namILiveAnswering:%@ \nisLiveAnswering:%@ \ngetLiveAnswerName:%@ \nAnswer:%@",[item getQuestionId],[item getText], [item getTime], [item getSenderName], @([item isAnonymous]), @([item isMarkedAsAnswered]), @([item isMarkedAsDismissed]), @([item getUpvoteNumber]), @([item getHasLiveAnswers]), @([item getHasTextAnswers]), @([item isMySelfUpvoted]), @([item amILiveAnswering]), @([item isLiveAnswering]), [item getLiveAnswerName], answerSting]; return cell; } - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { [tableView deselectRowAtIndexPath:indexPath animated:YES]; MobileRTCQAItem *questionItem = [_tableDataSource objectAtIndex:indexPath.row]; UIAlertController *alertController = [UIAlertController alertControllerWithTitle:nil message:nil preferredStyle:UIAlertControllerStyleActionSheet]; if ([[[MobileRTC sharedRTC] getMeetingService] isMeetingHost] || [[[MobileRTC sharedRTC] getMeetingService] isMeetingCoHost] || [[[MobileRTC sharedRTC] getMeetingService] isWebinarPanelist] ) { if (!questionItem.isMarkedAsDismissed) { [alertController addAction:[UIAlertAction actionWithTitle:@"Add Answer" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] answerQuestionPublic:[questionItem getQuestionId] answerContent:@"QA-Answer-Question-Test"]; NSLog(@"Answer Question ===> %@",@(ret)); }]]; [alertController addAction:[UIAlertAction actionWithTitle:@"Dismiss Question" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] dismissQuestion:[questionItem getQuestionId]]; NSLog(@"Dismiss Question ===> %@",@(ret)); }]]; } if (questionItem.isMarkedAsDismissed) { [alertController addAction:[UIAlertAction actionWithTitle:@"Reopen Question" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] reopenQuestion:[questionItem getQuestionId]]; NSLog(@"Reopen Question ===> %@",@(ret)); }]]; } if (!questionItem.amILiveAnswering && ![questionItem isMarkedAsDismissed] && ![questionItem isMarkedAsAnswered]) { [alertController addAction:[UIAlertAction actionWithTitle:@"Start Living" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] startLiving:[questionItem getQuestionId]]; NSLog(@"Start Living ===> %@",@(ret)); }]]; } if (questionItem.amILiveAnswering && ![questionItem isMarkedAsDismissed] && ![questionItem isMarkedAsAnswered]) { [alertController addAction:[UIAlertAction actionWithTitle:@"End Living" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] endLiving:[questionItem getQuestionId]]; NSLog(@"End Living ===> %@",@(ret)); }]]; } } else { // attendee if ([[[MobileRTC sharedRTC] getMeetingService] isAllowCommentQuestion] && ![questionItem isMarkedAsDismissed]) { [alertController addAction:[UIAlertAction actionWithTitle:@"Attendee Comment Answer" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] commentQuestion:[questionItem getQuestionId] commentContent:@"QA-Attendee-comment-Question-Test"]; NSLog(@"Comment ===> %@",@(ret)); }]]; } } if ([[[MobileRTC sharedRTC] getMeetingService] isAllowAttendeeUpVoteQuestion] && ![questionItem isMarkedAsDismissed]) { if (!questionItem.isMySelfUpvoted) { [alertController addAction:[UIAlertAction actionWithTitle:@"Vote Up" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] voteupQuestion:[questionItem getQuestionId] voteup:YES]; NSLog(@"Vote Up ===> %@",@(ret)); }]]; } else { [alertController addAction:[UIAlertAction actionWithTitle:@"Unvote Up" style:UIAlertActionStyleDefault handler:^(UIAlertAction *action) { BOOL ret = [[[MobileRTC sharedRTC] getMeetingService] voteupQuestion:[questionItem getQuestionId] voteup:NO]; NSLog(@"Unvote Up ===> %@",@(ret)); }]]; } } [alertController addAction:[UIAlertAction actionWithTitle:NSLocalizedString(@"Cancel", nil) style:UIAlertActionStyleCancel handler:^(UIAlertAction *action) { }]]; if (IS_IPAD) { UITableViewCell * cell = [_tableView cellForRowAtIndexPath:indexPath]; UIPopoverPresentationController *popover = alertController.popoverPresentationController; if (popover) { popover.sourceView = cell; popover.sourceRect = cell.bounds; popover.permittedArrowDirections = UIPopoverArrowDirectionAny; } } if (alertController.actions.count > 1) { AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; [[appDelegate topViewController] presentViewController:alertController animated:YES completion:nil]; } } - (void)updateData { switch (self.type) { case ZoomSampleQAListType_All: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getAllQuestionList]; break; case ZoomSampleQAListType_My: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getMyQuestionList]; break; case ZoomSampleQAListType_Open: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getOpenQuestionList]; break; case ZoomSampleQAListType_Answered: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getAnsweredQuestionList]; break; case ZoomSampleQAListType_Dismissed: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getDismissedQuestionList]; break; default: self.tableDataSource = [[[MobileRTC sharedRTC] getMeetingService] getAllQuestionList]; break; } [self.tableView reloadData]; } - (void)onSinkQAAddQuestion:(NSString *_Nonnull)questionID success:(BOOL)success { NSLog(@"Webinar Q&A--onSinkQAAddQuestion success=%@ questionID=%@", @(success), questionID); [self updateData]; } - (void)onSinkQAAddAnswer:(NSString *_Nonnull)answerID success:(BOOL)success { NSLog(@"Webinar Q&A--onSinkQAAddAnswer success=%@ answerID=%@", @(success), answerID); [self updateData]; } - (void)onSinkQuestionMarkedAsDismissed:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkQuestionMarkedAsDismissed questionID=%@", questionID); [self updateData]; } - (void)onSinkReopenQuestion:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkReopenQuestion questionID=%@", questionID); [self updateData]; } - (void)onSinkReceiveQuestion:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkReceiveQuestion questionID=%@", questionID); [self updateData]; } - (void)onSinkReceiveAnswer:(NSString *_Nonnull)answerID { NSLog(@"Webinar Q&A--onSinkReceiveAnswer answerID=%@", answerID); [self updateData]; } - (void)onSinkQuestionMarkedAsAnswered:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkQuestionMarkedAsAnswered questionID=%@", questionID); [self updateData]; } - (void)onSinkUserLivingReply:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkUserLivingReply questionID=%@", questionID); [self updateData]; } - (void)onSinkUserEndLiving:(NSString *_Nonnull)questionID { NSLog(@"Webinar Q&A--onSinkUserEndLiving questionID=%@", questionID); [self updateData]; } - (void)onSinkVoteupQuestion:(NSString *_Nonnull)questionID orderChanged:(BOOL)orderChanged { NSLog(@"Webinar Q&A--onSinkUpvoteQuestion questionID=%@ orderChanged=%@", questionID, @(orderChanged)); [self updateData]; } - (void)onSinkRevokeVoteupQuestion:(NSString *_Nonnull)questionID orderChanged:(BOOL)orderChanged { NSLog(@"Webinar Q&A--onSinkRevokeUpvoteQuestion questionID=%@ orderChanged=%@", questionID, @(orderChanged)); [self updateData]; } - (void)OnRefreshQAData { [self updateData]; } - (void)onMeetingStateChange:(MobileRTCMeetingState)state { if(state == MobileRTCMeetingState_WebinarPromote || state == MobileRTCMeetingState_WebinarDePromote) { [self dismissViewControllerAnimated:YES completion:nil]; } } @end | Low | [
0.48214285714285704,
33.75,
36.25
]
|
Comments: 8 pages, 1 figure; added proof that any p which a.a.s. guarantees a non-trivial cycle space generated by Hamilton circuits must be significantly larger than the threshold for hamiltonicity of G(n,p) | High | [
0.6656934306569341,
28.5,
14.3125
]
|
Big Daddy's BBQ (Largo) closed down In my quest for good BBQ, I went hunting for another BBQ restaurant recommended by this board, Big Daddy's BBQ (12670 Starkey Rd, Largo). It's no longer there, replaced a few months ago (I gather) by Turner's Table, a generic (IMO) sandwich and burger place. Recommended from Chowhound It's the season of presents, ornaments, bright reds and golds. Watch Chef Jayce Baudry channel all that inspiration into his latest creation, the Christmas Present Cake. This is the ultimate holiday table center piece. If you want to spend more time caroling, and sipping wine instead of hanging in the kitchen, watch Chef Jansen Chan (International Culinary Center). make colored sugar, the easiest way to make basic sugar cookies shine on your holiday table. The holidays mean it's time for bubbly. Let Wine & Spirit Education Trust (WSET) educator Vanessa Price teach you how to open a bottle properly and safely: without hurting somebody, or ruining that spark. | Low | [
0.527881040892193,
35.5,
31.75
]
|
/*---------------------------------------------------------------------------*\ ========= | \\ / F ield | OpenFOAM: The Open Source CFD Toolbox \\ / O peration | \\ / A nd | Copyright (C) 2011 OpenFOAM Foundation \\/ M anipulation | ------------------------------------------------------------------------------- License This file is part of OpenFOAM. OpenFOAM is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. OpenFOAM is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with OpenFOAM. If not, see <http://www.gnu.org/licenses/>. Description tensorField with IO. \*---------------------------------------------------------------------------*/ #include "tensorIOField.H" // * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * // namespace Foam { defineTemplateTypeNameAndDebugWithName(tensorIOField, "tensorField", 0); } // ************************************************************************* // | Mid | [
0.609345794392523,
40.75,
26.125
]
|
In the second season premiere of ABC Family's acclaimed original drama series "The Fosters," some will face the consequences of their past mistakes while others will fight fiercely to ensure a more promising future for their growing family. The season premieres Monday, June 16 at 9:00 p.m. ET/PT on ABC Family. In the episode titled "Things Unknown," it's a big day for Callie as her future with the Fosters hinges on the revelation that Donald is not her birth father. What happens next could threaten to separate Callie and Jude once again. Brandon struggles to recover and come to terms with his guilt over sleeping with Dani, and big questions still remain about what Mike was up to the night Ana disappeared. Meanwhile, Jesus and Emma's relationship impacts Emma's standing with her teammates, which causes tension between them. Mariana has made a big change, much to Stef's dismay. The episode was written by "The Fosters" Executive Producers Bradley Bredeweg and Peter Paige and directed by Norman Buckley.Winner of 2014's GLAAD Media Award for Outstanding Drama Series and 2013's Teen Choice Award for Choice TV Breakout Show, "The Fosters" is executive-produced by Jennifer Lopez, ("American Idol," "What to Expect When You're Expecting," "The Back-Up Plan") and created by Bradley Bredeweg and Peter Paige ("Queer As Folk"), who also serve as executive producers and writers, along with Joanna Johnson ("Make It or Break It"). "The Fosters" stars Teri Polo ("Meet the Parents") as Stef Adams Foster, Sherri Saum ("In Treatment") as Lena Adams Foster, Jake T. Austin ("Wizards of Waverly Place") as Jesus Adams Foster, Hayden Byerly ("Parenthood") as Jude Adams Foster, David Lambert ("Aaron Stone") as Brandon Adams Foster, Maia Mitchell ("Teen Beach Movie") as Callie Jacob, Danny Nucci ("Titanic") as Mike Foster and Cierra Ramirez ("The Secret Life of the American Teenager") as Mariana Adams Foster. Greg Gugliotta, Elaine Goldsmith Thomas, Benny Medina, and John Ziffren also serve as executive producers. The series is produced by Nuyorican Productions, Inc., and Prodco, Inc. Part of the Disney/ABC Television Group, ABC Family is distributed in over 97 million homes. ABC Family features programming reflecting today's families, entertaining and connecting with adults through relatable programming about today's relationships - told with a mix of diversity, passion, humor and heart. ABC Family's programming is a combination of network-defining original series and original movies, quality acquired series and blockbuster theatricals. For 2014, ABC Family has launched the "WATCH ABC Family" authenticated service which allows viewers with participating TV subscription services access to 24/7 live viewing of the network, as well as continued on demand access to such popular series at home and on the go via a wide array of devices. ABC Family is also the destination for annual Holiday events with "13 Nights of Halloween" and "25 Days of Christmas." ABC Family. A New Kind of Family. | Mid | [
0.6086956521739131,
33.25,
21.375
]
|
Kenneth Rijock Thursday, February 9, 2017 PANAMA'S COURTS DISMISSING ALL SUITS BY NONRESIDENT FOREIGN NATIONALS Anger against foreign nationals, in the country's the post-Panama Papers/Odebrecht scandal internal political atmosphere, appears to have manifested itself in the local court system, known for its corruption, and favoritism towards Panamanians. Attorneys in Panama City are reporting to clients, who are nonresident plaintiffs on the civil side, or complainants on the criminal side, that their cases are being dismissed by the judiciary, without any substantive or procedural grounds. Anti-American sentiment appears to be increasing, and thee has not been any official push back against it. Apparently, the mere fact that they do not reside in the Republic of Panama has been deemed sufficient to close out their previously-filed claims. Appeals of these abrupt, and obviously politically-motivated, decisions will most likely be futile, if permitted at all, because of the multiple scandals surrounding the Supreme Court of Justice, Panama's high court. Many of the justices, appointed by former (and fugitive) President Ricardo Martinelli, have been angered by media allegations of corruption, much of which originated from outside the country. Dodgy deposits, from Venezuela and Colombia, continue to be accepted in local banks, and wealthy nationals from those countries appear to be accepted in Panama, as residents, but North Americans and Europeans are generally not welcome to open new accounts. On a Country Risk note, if foreign companies no longer have access to the court system, to redress possible future wrongs, suffered at the hands of Panamanian businesses, then foreign investors must avoid Panama, and foreign financial institutions should not incur any significant exposure there. This means that Panama should be effectively red-lined, for all Country Risk purposes, until the situation improves. | Mid | [
0.5695931477516061,
33.25,
25.125
]
|
--- abstract: 'A one-dimensional cluster model with next-nearest-neighbor interactions and two additional composite interactions is solved; the free energy is obtained and a correlation function is derived exactly. The model is diagonalized by a transformation obtained automatically from its interactions, which is an algebraic generalization of the Jordan-Wigner transformation. The gapless condition is expressed as a condition on the roots of a cubic equation, and the phase diagram is obtained exactly. We also find that the distribution of roots for this algebraic equation determines the existence of long-range order, and we again obtain the ground-state phase diagram. Finally, we note that our results are universally valid for an infinite number of solvable spin chains whose interactions obey the same algebraic relations.' --- [Exact solution of cluster model with\ next-nearest-neighbor interaction]{} Yuji Yanagihara$^{*}$, Kazuhiko Minami$^{\dagger}$ $^{*}$General Education, Fukui College, National\ Institute of Technology, Fukui 916-8507, Japan\ $^{\dagger} $Graduate School of Mathematics, Nagoya University,\ Furo-cho, Chikusa-ku, Nagoya, Aichi, 464-8602, Japan Introduction ============ Quantum spin models have been widely investigated as a basic theme in statistical physics, mathematical physics, and condensed matter physics. In one-dimension, there exist many solvable systems, and there also exsit general relationships with two-dimensional classical systems. Specifically, a one-dimensional XY-model was introduced in \[1\]-\[4\] and was later found to be equivalent to the two-dimensional rectangular Ising model\[5\]. In the 2000s, the cluster models attracted wide attention. The ground state of this model is called the cluster state, which is a candidate of a resource for measurement-based quantum computation(MBQC)\[6\]\[7\]\[8\]. The one-dimensional cluster model was first introduced and solved by Suzuki\[5\] and has been investigated by numerous researchers\[9\]-\[22\]. A new method of fermionization has recently been introduced\[23\], and an infinite number of new solvable models have been reported in \[23\]-\[25\]. In this method, the transformation that diagonalizes the system is obtained automatically from the interactions of the model. The Hamiltonian is diagonalized using only algebraic relations of the interactions, and therefore, the equivalences of the models are immediately understood. In the case of the XY model, the transformation results in the Jordan-Wigner transformation\[26\]\[2\]; thus, this new transformation can be regarded as the algebraic generalization of the Jordan-Wigner transformation. In this paper, we investigate the cluster model with next-nearest-neighbor interactions and two additional composite interactions. The Hamiltonian is $$\begin{aligned} - \beta \mathcal{H} &=& K_0 \sum_{j = 1}^N \sigma_j^x \sigma_{j+1}^z \sigma_{j+2}^x +K_1 \sum_{j = 1}^N \sigma_j^x 1_{j+1} \sigma_{j+2}^x \nonumber \\ & & +K_2 \sum_{j=1}^N \sigma_j^x \sigma_{j+1}^x \sigma_{j+2}^z \sigma_{j+3}^x\sigma_{j+4}^x +K_{-1} \sum_{j=1}^N \sigma_j^x \sigma_{j+1}^y 1_{j+2} \sigma_{j+3}^y \sigma_{j+4}^x , \label{Hamiltonian} % ←ラベル付け Hamiltonian \end{aligned}$$ where $ 1_j $ is the identity operator at site $j$. When $ K_2 = K_{-1} = 0 $, this model becomes the cluster model with next-nearest-neighbor interactions and found to be equivalent \[24\] to the XY chain, which can be diagonalized by the Jordan-Wigner transformation. However, the model (\[Hamiltonian\]) cannot be diagonalized by the Jordan-Wigner transformation when $ K_2 \neq 0 $ or $ K_{-1} \neq 0 $. Our formula can diagonalize this Hamiltonian. The formula in this paper is summarized as follows. Let the number of sites be $N = 2M$ , where $M$ is even, and let us assume a cyclic boundary condition $ \sigma_{N+i}^k = \sigma_i^k $ ( $ k = x , y , z $ ). Let us consider two series of operators $ \{ \eta_j \} $ and $ \{ \zeta_j \} $, which are defined as $$\begin{aligned} \eta_{2j-1} = \sigma_{2j-1}^x \sigma_{2j}^z \sigma_{2j+1}^x , \ \ \eta_{2j} = \sigma_{2j}^x 1_{2j+1} \sigma_{2j+2}^x , \ \ ( 1 \leq j \leq \frac{N}{2} - 1) \notag \\ \eta_{N-1} = \sigma_{N-1}^x \sigma_{N}^z \sigma_{1}^x ,\ \ \eta_{N} = \sigma_{N}^x 1_{1} \sigma_{2}^x , \label{op1} % ←ラベル op1 \end{aligned}$$ and $$\begin{aligned} \zeta_{2j-1} = \sigma_{2j}^x \sigma_{2j+1}^z \sigma_{2j+2}^x , \ \ \zeta_{2j} = \sigma_{2j+1}^x 1_{2j+2} \sigma_{2j+3}^x , \ \ ( 1 \leq j \leq \frac{N}{2}-1 ) \notag \\ \zeta_{N-1} = \sigma_{N}^x \sigma_1^z \sigma_{2}^x , \ \ \zeta_{N} = \sigma_{1}^x 1_2 \sigma_{3}^x . \label{op2} % ←ラベル op2 \end{aligned}$$ Note that the operators $ \eta_j $ and $ \zeta_k $ are the interactions found in the Hamiltonian (\[Hamiltonian\]), and the operators $\eta_j $ and $\zeta_k $ commute with each other for all $j$ and $k$. Next, following equation (2.9) in \[23\], we introduce transformations $ \varphi_1(j) $, $ \varphi_2(j) $, and $ \varphi_3(j) $, $ \varphi_4(j) \ $( $ 1 \leqq j \leqq M $ ) as $$\begin{gathered} \varphi_1(j) = \frac{1}{\sqrt{2}} e^{i \frac{ \pi }{2} (k-1)} \eta_0 \eta_1 \cdots \eta_k \ \ ( k=2j-2), \notag \\ \varphi_2(j) = \frac{1}{\sqrt{2}} e^{i \frac{ \pi }{2} (k-1)} \eta_0 \eta_1 \cdots \eta_k \ \ ( k=2j-1), \notag \\ \varphi_3(j) = \frac{1}{\sqrt{2}} e^{i \frac{ \pi }{2} (k-1)} \zeta_0 \zeta_1 \cdots \zeta_k \ \ ( k=2j-2), \notag \\ \varphi_4(j) = \frac{1}{\sqrt{2}} e^{i \frac{ \pi }{2} (k-1)} \zeta_0 \zeta_1 \cdots \zeta_k \ \ ( k=2j-1) , \label{a} % ←ラベル付け a \end{gathered}$$ where $$\eta_0 = i \sigma_1^x \sigma_2^x \ \ \ {\rm and } \ \ \ \zeta_0 = i \sigma_2^x \sigma_3^x \label{b} % ←ラベル付け b$$ are the initial operators. Then, the operators $ \varphi_l(j) $ satisfy $ \{ \varphi_1(j) , \varphi_2(k) \} = \delta_{jk} $, $ \{ \varphi_3(j) , \varphi_4(k) \} = \delta_{jk} $, and $[ \varphi_l(j) , \varphi_m(k) ] = 0 $ ( $ l = 1,2 $ , $ m = 3, 4$) for all $j$ and $k$. Therefore, the operators $ \varphi_l(j) $ form two series of Majorana fermions. The Hamiltonian (\[Hamiltonian\]) is expressed as the sum of two-body products of $ \varphi_l(j) $. Hence, the Hamiltonian (\[Hamiltonian\]) can be diagonalized. The transformations from $ \eta_j $ to $ \varphi_1 $ and $ \varphi_2 $ ( $\zeta_j$ to $ \varphi_3 $ and $ \varphi_4 $ ) are clearly different from the Jordan-Wigner transformation as shown in (12)-(15). From the transformations (\[a\]), we can derive the free energy and a correlation function exactly. Next, let us consider the algebraic equation $$\alpha_2 z^3 + \alpha_1 z^2 - z + \alpha_{-1} =0 , \label{equ1} % ←ラベル equ1$$ where $ \alpha_{-1} = K_{-1}/K_0 $, $ \alpha_1 = K_1/K_0 $, $\alpha_2 = K_2/K_0 $, and also consider three subsets of the complex plane $$C_u = \{ z \in \mathbb{C} \ | \ |z| = 1 \}, \ \ D_O = \{ z \in \mathbb{C} \ | \ |z| > 1 \}, \ \ D_I = \{ z \in \mathbb{C} \ | \ |z| < 1 \}.$$ We find that there is no energy gap above the ground state if and only if at least one root of equation (\[equ1\]) belongs to the unit circle $C_u$. In another way, we find that long-range order exists if and only if one root of the cubic equation (\[equ1\]) belongs to $D_{O}$, with the other two roots belonging to $D_{I}$. Clearly, the boundary of the phase in terms of the long-range order satisfies the gapless condition; therefore, we obtain a consistent phase diagram from two different procedures. We also find that the phase diagram has a symmetry under a shift of indices from $ j $ to $ j+1 $ for $ K_j $. These results are obtained using only the algebraic relations of the interactions. Hence, the results we obtained are universally valid for models consisting of the interactions that obey the same algebraic relations. In section 2, we diagonalize the Hamiltonian (\[Hamiltonian\]) exactly by applying the transformation (\[a\]) and obtain the free energy. In section 3, we consider the gapless condition and obtain a corresponding phase diagram. In section 4, a correlation function is introduced, and the asymptotic limit is obtained exactly. In section 5, we demonstrate that long-range order exists if and only if the roots of equation (\[equ1\]) satisfy the condition described above, and again, we obtain the same phase diagram. In section 6, we consider the symmetry of the phase diagram, and illustrate that the results obtained in this paper are valid for an infinite number of Hamiltonians that satisfy our condition. Diagonalization and the free energy =================================== In this section, we diagonalize the Hamiltonian (\[Hamiltonian\]) and derive the free enegy. The operators $ \eta_j $ and $ \eta_k $ ( $\zeta_j $ and $\zeta_k $ ) are called $ adjacent $ if $ (j,k)=(j,j+1) $ $( 1 \leq j \leq N -1 ) $ or $ (j,k) = ( N , 1 ) $ . Then, the operators $ \{ \eta_j \} $ in (\[op1\]) satisfy the relations $$\eta_j \eta_k = \begin{cases} - \eta_k \eta_j & \eta_j \ {\rm and } \ \eta_k \ {\rm are } \ adjacent \\ \eta_k \eta_j & \eta_j \ {\rm and } \ \eta_k \ {\rm are \ not } \ adjacent \\ 1 & j=k, \end{cases} \label{2} % ← ラベル付け 2$$ and $ \{ \zeta_j \} $ satisfy the same relations replacing $\eta_j $ by $ \zeta_j $ in $ (\ref{2}) $. Note that $$(\eta_1 \cdots \eta_k )^2 = (\zeta_1 \cdots \zeta_k )^2 = (-1)^{k-1} \ \ ( k < N). \label{alt} % ラベル付け alt$$ Other interactions in (\[Hamiltonian\]) are obtained from $ \eta_j $ and $ \zeta_k $ as $$\begin{gathered} \eta_{2j-1} \eta_{2j} \eta_{2j+1} = \sigma_{2j-1}^x \sigma_{2j}^y 1_{2j+1} \sigma_{2j+2}^y \sigma_{2j+3}^x, \notag \\ \eta_{2j} \eta_{2j+1} \eta_{2j+2} = -\sigma_{2j}^x \sigma_{2j+1}^x \sigma_{2j+2}^z \sigma_{2j+3}^x \sigma_{2j+4}^x, \notag \\ \zeta_{2j-1} \zeta_{2j} \zeta_{2j+1} = \sigma_{2j}^x \sigma_{2j+1}^y 1_{2j+2} \sigma_{2j+3}^y \sigma_{2j+4}^x, \notag \\ \zeta_{2j} \zeta_{2j+1} \zeta_{2j+2} = -\sigma_{2j+1}^x \sigma_{2j+2}^x \sigma_{2j+3}^z \sigma_{2j+4}^x \sigma_{2j+5}^x . \end{gathered}$$ Then the Hamiltonian (1) is written in terms of $ \eta_j $ and $ \zeta_k $ as $$\begin{aligned} -\beta \mathcal{H} &=& K_0 \sum_{j=1}^M ( \eta_{2j-1} + \zeta_{2j-1} ) + K_1 \sum_{j=1}^M ( \eta_{2j} + \zeta_{2j} ) \nonumber \\ &-& K_2 \sum_{j=1}^M ( \eta_{2j} \eta_{2j+1} \eta_{2j+2} + \zeta_{2j} \zeta_{2j+1} \zeta_{2j+2} ) \nonumber \\ &+& K_{-1} \sum_{j=1}^M (\eta_{2j-1} \eta_{2j} \eta_{2j+1} + \zeta_{2j-1} \zeta_{2j} \zeta_{2j+1} ) . \label{mo} % ←ラベル mo \end{aligned}$$ Next, let us consider the transformations $ \varphi_k(j) $ ( $ k = 1, 2, 3, 4 $ , $ 1 \le j \le M $ ) introduced in (\[a\]). They are written in terms of the Pauli operators as $$\begin{aligned} \varphi_1(j) &=& \frac{ 1 }{ \sqrt{2} } \left( \prod_{\nu=1}^{j-1} 1_{2\nu-1} \sigma_{2\nu}^z \right) \sigma_{2j-1}^x \sigma_{2j}^x, \label{star1} \\ % ←ラベル付け star1 \varphi_2(j) &=& \frac{ 1 }{ \sqrt{2} } \left( \prod_{\nu=1}^{j-1} 1_{2\nu-1}\sigma_{2\nu}^z \right) 1_{2j-1} \sigma_{2j}^y \sigma_{2j+1}^x, \label{star2} \\ % ←ラベル付け star2 \varphi_3(j) &=& \frac{ 1 }{ \sqrt{2} } \left( \prod_{\nu=1}^{j-1} 1_{2\nu} \sigma_{2\nu+1}^z \right) \sigma_{2j}^x \sigma_{2j+1}^x, \label{star3} \\ % ←ラベル付け star3 \varphi_4(j) &=& \frac{ 1 }{ \sqrt{2} } \left( \prod_{\nu=1}^{j-1} 1_{2\nu}\sigma_{2\nu+1}^z \right) 1_{2j} \sigma_{2j+1}^y \sigma_{2j+2}^x \ \ ( j = 1, 2, 3 \cdots ). \label{star4} % ←ラベル付け star4 \end{aligned}$$ They are clearly different from the Jordan-Wigner transformation. The initial operators $ \eta_0 = i \sigma_1^x \sigma_2^x $ and $ \zeta_0 = i \sigma_2^x \sigma_3^x $ are not necessary to diagonalize the Hamiltonian, but introduced to avoid boundary terms in (\[star1\]) - (\[star4\]). The initial operators satisfy the relations $$\begin{gathered} \eta_0^2 = -1 , \ \zeta_0^2 = -1 , \ \eta_0 \zeta_0 = \zeta_0 \eta_0 , \notag \\ \eta_0 \eta_1 = -\eta_1 \eta_0 , \ \ \eta_0 \eta_j = \eta_j \eta_0 \ \ ( 2 \leqq j \leqq N ), \notag \\ \zeta_0 \zeta_1 = -\zeta_1 \zeta_0 , \ \ \zeta_0 \zeta_j = \zeta_j \zeta_0 \ \ ( 2 \leqq j \leqq N ). \label{c} % ←ラベル付け c \end{gathered}$$ From (\[alt\]) and (\[c\]), we find that $$\{ \varphi_l(j) , \varphi_m(k) \} = \delta_{lm} \delta_{jk} \ \ ( l,m = 1,2 \ {\rm or } \ l,m = 3,4, \ \ 1 \leqq j , k \leqq M ) , \label{anti} % ←ラベル anti$$ and $ \varphi_l (j) $ ($ l = 1, 2 $) and $ \varphi_m (k) $ ($ m = 3, 4 $) commute with each other. Moreover, we find $$\begin{aligned} (+2i)\varphi_{2}(j)\varphi_{1}(j+2) &=&\eta_{2j}\eta_{2j+1}\eta_{2j+2} \hspace{0.3cm} =-\sigma^{x}_{2j}\sigma^{x}_{2j+1}\sigma^{z}_{2j+2}\sigma^{x}_{2j+3}\sigma^{x}_{2j+4}, \nonumber\\ (-2i)\varphi_{2}(j)\varphi_{1}(j+1) &=&\eta_{2j} \hspace{2.1cm} =\sigma^{x}_{2j} 1_{2j+1} \sigma^{x}_{2j+2}, \label{et} \\ %←ラベル付け et (+2i)\varphi_{2}(j)\varphi_{1}(j) \hspace{0.7cm} &=&\eta_{2j-1} \hspace{1.75cm} =\sigma^{x}_{2j-1}\sigma^{z}_{2j}\sigma^{x}_{2j+1}, \nonumber\\ (-2i)\varphi_{2}(j)\varphi_{1}(j-1) &=&\eta_{2j-3}\eta_{2j-2}\eta_{2j-1} =\sigma^{x}_{2j-3}\sigma^{y}_{2j-2}1_{2j-1}\sigma^{y}_{2j}\sigma^{x}_{2j+1}, \nonumber\end{aligned}$$ and $$\begin{aligned} (+2i)\varphi_{4}(j)\varphi_{3}(j+2) &=&\zeta_{2j}\zeta_{2j+1}\zeta_{2j+2} \hspace{0.3cm} =-\sigma^{x}_{2j+1}\sigma^{x}_{2j+2}\sigma^{z}_{2j+3}\sigma^{x}_{2j+4}\sigma^{x}_{2j+5}, \nonumber\\ (-2i)\varphi_{4}(j)\varphi_{3}(j+1) &=&\zeta_{2j} \hspace{2.1cm} =\sigma^{x}_{2j+1}1_{2j+2}\sigma^{x}_{2j+3}, \\ %式番号付き (+2i)\varphi_{4}(j)\varphi_{3}(j) \hspace{0.7cm} &=&\zeta_{2j-1} \hspace{1.75cm} =\sigma^{x}_{2j}\sigma^{z}_{2j+1}\sigma^{x}_{2j+2}, \nonumber\\ (-2i)\varphi_{4}(j)\varphi_{3}(j-1) &=&\zeta_{2j-3}\zeta_{2j-2}\zeta_{2j-1} =\sigma^{x}_{2j-2}\sigma^{y}_{2j-1}1_{2j}\sigma^{y}_{2j+1}\sigma^{x}_{2j+2}. \nonumber\end{aligned}$$ Then the Hamiltonian is written as $$\begin{aligned} -\beta \mathcal{H} = \ \ \ &(-2i) K_{-1} \sum_{j=1}^M ( \varphi_2(j) \varphi_1(j-1) + \varphi_4(j) \varphi_3(j-1) ) \notag \\ + &(+2i) K_0 \sum_{j=1}^M ( \varphi_2(j) \varphi_1(j) + \varphi_4(j) \varphi_3(j) ) \notag \\ + &(-2i) K_1 \sum_{j=1}^M ( \varphi_2(j) \varphi_1(j+1) + \varphi_4(j) \varphi_3(j+1) ) \notag \\ + &(-2i) K_2 \sum_{j=1}^M ( \varphi_2(j) \varphi_1(j+2) + \varphi_4(j) \varphi_3(j+2) ) , \label{majo} %←ラベル majo \end{aligned}$$ which is the sum of two-body products of the Majorana fermion operators $ \varphi_l(j) $. For the purpose to check the boundary condition, let us consider the boundary terms $$\begin{aligned} \varphi_2 (M) \varphi_1 (M+l) &=& \frac{i}{ \sqrt{2} } ( - \sigma_2^z \sigma_4^z \cdots \sigma_N^z ) \sigma_N^x \sigma_1^x \cdot \varphi_1 (M+l) , \\ \varphi_4 (M) \varphi_3 (M+l) &=& \frac{i}{ \sqrt{2} } ( - \sigma_1^z \sigma_3^z \cdots \sigma_{N-1}^z ) \sigma_1^x \sigma_2^x \cdot \varphi_3(M+l) . \end{aligned}$$ Then the cyclic boundary condition $ \sigma_{N+i}^k = \sigma_i^k $ yields, for $ l = 1$ and $ 2 $, that $$\varphi_1 (M+l) = \begin{cases} \varphi_1 (l) & \ \sigma_2^z \sigma_4^z \cdots \sigma_N^z = -1 \\ -\varphi_1 (l) & \ \sigma_2^z \sigma_4^z \cdots \sigma_N^z = 1 \end{cases} \label{d} %← ラベル付け d$$ and $$\varphi_3(M+l) = \begin{cases} \varphi_3(l) & \ \sigma_1^z \sigma_3^z \cdots \sigma_{N-1}^z = -1 \\ -\varphi_3(l) & \ \sigma_1^z \sigma_3^z \cdots \sigma_{N-1}^z = 1. \end{cases} \label{e} %←ラベル付け e$$ Next let us introduce the Fourier transformation $$\varphi_l (j) = \frac{1}{ \sqrt{M} } \sum_{ 0 \leq q < \pi } ( e^{iqj} C_l(q) + e^{-iqj} C_l^{\dagger}(q) ),$$ where $$\begin{aligned} \{ C_l^{\dagger}(p) , C_m(q) \} &= \delta_{lm} \delta_{pq} , \notag \\ \{ C_l^{\dagger}(p) , C_m^{\dagger}(q) \} &= \{ C_l(p), C_m(q) \} = 0 \ \ ( l, m = 1, 2 \ {\rm or } \ l, m = 3, 4 ), \end{aligned}$$ and $ C_l^{\dagger} (p) $, $ C_l (p) $ $ ( l = 1 , 2 ) $ and $ C_m^{\dagger} (q) $, $ C_m (q) $ $ ( m = 3 , 4 ) $ commute with each other. From (\[d\]) and (\[e\]), we find $$q = \frac{2k}{M} \pi \ \ ( k = 0 ,1 , \cdots , \frac{M}{2} - 1 )$$ when $ \sigma_2^z \sigma_4^z \cdots \sigma_N^z = -1 $ and when $ \sigma_1^z \sigma_3^z \cdots \sigma_{N-1}^z = -1 $. We also find $$q = \frac{2k-1}{M} \pi \ \ ( k = 1 , 2 , \cdots , \frac{M}{2} ) \label{bc} % ←ラベル付け bc$$ when $ \sigma_2^z \sigma_4^z \cdots \sigma_N^z = 1 $ and when $ \sigma_1^z \sigma_3^z \cdots \sigma_{N-1}^z = 1 $. Without loss of generality, we can assume (\[bc\]). The Hamiltonian is then expressed as $$- \sum_{ 0 < q < \pi } ( W_{12}(q) + W_{34}(q) ) , \label{dia1} %ラベル dia1$$ where $$\begin{gathered} W_{12} (q) = 2i L(q) C_2 ^{\dagger} (q) C_1 (q) + 2i L (q)^{\ast} C_2(q) C_1^{\dagger} (q) , \notag \\ W_{34} (q) = 2i L(q) C_4 ^{\dagger} (q) C_3 (q) + 2i L (q)^{\ast} C_4 (q) C_3^{\dagger} (q) , \end{gathered}$$ and $$L(q) = K_{-1} e^{-iq} - K_0 + K_1 e^{iq} + K_2 e^{2iq} . \label{dia2} % ラベル$$ Here $ L(q)^{\ast} $ is the complex conjugate of $ L(q) $ . For each $q>0$, the Hamiltonian is therfore the sum of two commutative operators. We obtain $$\begin{aligned} A(q) = L(q) L(q)^{\ast} &= K_{-1}^2 + K_0^2 + K_1^2 + K_2^2 - 2( K_{-1} K_0 + K_0 K_1 - K_1K_2 ) \cos q \notag \\ & \ \ \ \ +2( K_{-1} K_1 - K_0 K_2 ) \cos2q + 2K_{-1} K_2 \cos3q , \end{aligned}$$ which is real and non-negative. With respect to the basis $ \left| 0 \right \rangle $ , $ C_1^{\dagger}(q) \left| 0 \right \rangle $ , $ C_2^{\dagger}(q) \left| 0 \right \rangle $ , $ C_2^{\dagger}(q) C_1^{\dagger}(q) \left| 0 \right \rangle $ , $ W_{12}(q) $ is expressed as $$\begin{pmatrix} 0 & 0 & 0 & 0 \\ 0 & 0 & 2iL(q)^{\ast} & 0 \\ 0 & -2iL(q) & 0 & 0 \\ 0 & 0 & 0 & 0 \end{pmatrix},$$ and its eigenvalues are found to be $ 0 , 0 , \pm 2 \sqrt{A(q)} $. In the same way, the eigenvalues of $ W_{34}(q) $ are found to be $ 0 , 0 , \pm 2 \sqrt{A(q)} $. The partition function is obtained as $$\begin{aligned} Z &= \prod_{0<q<\pi} ( e^0 + e^0 + e^{\Lambda(q)} + e^ {-\Lambda(q) })^2 \notag \\ &= \prod_{0<q<\pi} ( e^{\frac{1}{2} \Lambda(q) } + e^{ - \frac{1}{2} \Lambda(q) } )^4 , \end{aligned}$$ where $ \Lambda(q) = 2 \sqrt{A(q)} $ . The free energy is $$\begin{aligned} - \beta f &= \lim_{ N \to \infty } \frac{ \log Z }{N} \notag \\ &= \frac{1}{ \pi } \int_0^{\pi} \log( e^{ \frac{1}{2} \Lambda(q) } + e^{ - \frac{1}{2} \Lambda(q) } ) d q , \label{f} %ラベル付け f \end{aligned}$$ where we have used that $ \displaystyle \Delta q = \frac{2}{ N/2 } \pi $. When $ K_2 = K_{-1} = 0 $, the free energy (\[f\]) becomes identical to that of the XY chain. In fact, if we introduce $$\eta_{2j-1}^{(1)} = \sigma_{2j-1}^x \sigma_{2j}^x \ , \ \eta_{2j}^{(1)} = \sigma_{2j}^y \sigma_{2j+1}^y \ , \ \zeta_{2j-1}^{(1)} = \sigma_{2j}^x \sigma_{2j+1}^x \ , \ \zeta_{2j}^{(1)} = \sigma_{2j+1}^y \sigma_{2j+2}^y, \label{XY} %←ラベル付け XY$$ then the operators $ \eta_j^{(1)} $ and $ \zeta_k^{(1)} $ satisfy the same relations as $ \eta_j $ and $ \zeta_k $, and $ K_0 \sum_j ( \eta_{2j-1}^{(1)} + \zeta_{2j-1}^{(1)} ) $ and $ K_1 \sum_j ( \zeta_{2j}^{(1)} + \eta_{2j}^{(1)} ) $ are nothing but the interactions of the XY chain. Thus the model (\[Hamiltonian\]) with $ K_2 = K_{-1} = 0 $ and the XY chain obay the same algebraic relation, and therefore result in the same free energy. Gapless condtion and the phase diagram ====================================== Let us consider the gapless condition that $ A(q) = |L(q)|^2 = 0 $ with some $q$. The condition $ L(q) = 0 $ is equivalent to $$\alpha_2 z^3 + \alpha_1 z^2 - z + \alpha_{-1} = 0 , \label{gap} % ← 再びラベル付け gap$$ where $ z = e^{iq} $, $ \alpha_{-1} = K_{-1}/K_0 $ , $ \alpha_1 = K_1/K_0 $ , $\alpha_2 = K_2/K_0 $. Thus the model is gapless if and only if the algebraic equation (\[gap\]) has a root that belongs to $ C_u = \{ z \in \mathbb{C} \ | \ |z| = 1 \ \} $. We find that the condition is equivalent to ($ X1 $) or ($ X2 $) or ($ X3 $), where $$\begin{aligned} & (X1) \ \ \alpha_1 = -\alpha_{-1} + ( \alpha_2 -1 ) \ \ {\rm or } \ \ \alpha_1 = -\alpha_{-1} - ( \alpha_2 -1 ) , \notag \\ & (X2) \ \ \alpha_{-1} \neq 0 \ \ {\rm and } \ \ \alpha_1 = \alpha_{-1} - \frac{ \alpha_2( 1+\alpha_2 ) }{ \alpha_{-1} } \ \ {\rm and } \ \ (1+\alpha_2)^2 - 4\alpha_{-1}^2 < 0, \notag \\ & (X3) \ \ \alpha_{-1} = 0 \ \ {\rm and } \ \ -2<\alpha_1 < 2 \ \ {\rm and } \ \ \alpha_2 = -1. \end{aligned}$$ A derivation is given in Appndix A. These ($X1$) - ($X3$) form the boundary of each phase in the diagram shown in Figure 1 and 2. {width="15cm"} {width="15cm"} Correlation function and the ground state phase transition ========================================================== Next let us investigate a ground-state correlation function and its asymptotic behavior. The correlation function we consider is $$I(2n) = \langle \ \sigma_{2j}^x \sigma_{ 2j+2n }^x \ \rangle_0 , \label{co1} % ラベル co1$$ where $\langle \ \ \rangle_0 $ is the ground-state expectation. In the thermodynamic limit, we obtain the exact expression $$I(2n) = \left( \frac{2}{i} \right )^n \begin{vmatrix} D(1) & D(2) & \cdots & D(n) \\ D(0) & D(1) & \cdots & D(n-1) \\ \vdots & \vdots & \ddots & \vdots \\ D(2-n) & D(3-n) & \cdots & D(1) \end{vmatrix} , \label{to} % ← ラベル付け to$$ where $$D(r) = \frac{i}{4 \pi } \int_{- \pi}^{\pi} d q \left( e^{-iqr} \frac{ \sqrt{A(q)} }{ L(q)^{\ast} } \right) . \label{co2} % ←ラベル co2$$ A derivation of (\[to\]) and (\[co2\]) is given in Appendix B. The determinant (\[to\]) is a Toeplitz determinant, i.e. $ ( j , k ) $ elements depend only on $ k-j=r $ . We can therefore apply the Szegö’s theorem to obtain the asymptotic limit $ n \to \infty $ of the determinant. Let $ C(r)=\frac{2}{i}D(r+1) $ , then (\[to\]) is expressed as $$\begin{vmatrix} C(0) & C(1) & \cdots & C(n-1) \\ C(-1) & C(0) & \cdots & C(n-2) \\ \vdots & \vdots & \ddots & \vdots \\ C(1-n) & C(2-n) & \cdots & C(0) \end{vmatrix} . \label{to1} % ←ラベル to1$$ Let us introduce $ f(p) $ by the relation $$C(r) = \frac{1}{2 \pi} \int_{ -\pi }^{\pi} e^{-ipr} f(p) d p . \label{C} %←ラベル C$$ Then the Szegö’s theorem says that the asymptotic form of (\[to\]) is $$\lim_{ n \to \infty } \frac{ \text{det} ( \{ C(r) \} ) }{ \lambda^n } = \text{exp} \left( \sum_{n=1}^{\infty} n g_n g_{-n} \right) , \label{seg} % ←ラベル seg$$ where $$g_n = \frac{1}{ 2 \pi } \int_{ -\pi }^{\pi} e^{-ipn} \log f(p) dp \label{defgn} % ←ラベル付け defgn$$ and $ \lambda $ = exp $ g_0 $ . Note that $ g_{-n} = -g_n $. We obtain, from (\[co2\]) and (\[C\]) that $$f(p) = \frac{ \sqrt{ L(p) L(p)^{\ast} } }{ L(p)^{\ast} } e^{-ip} = \sqrt{ \frac{ e^{ -ip} L(p) } { e^{ip} L(p)^{\ast} } } ,$$ thus $$\log f(p) = \frac{1}{2} \log ( \alpha_{-1} e^{-2ip} - e^{-ip} + \alpha_1 + \alpha_2 e^{ip} ) - \frac{1}{2} \log ( \alpha_{-1} e^{2ip} - e^{ip} + \alpha_1 + \alpha_2 e^{-ip} ).$$ With the use of the equality $$\alpha_{-1} e^{-2ip} - e^{-ip} + \alpha_1 + \alpha_2 e^{ip} = A ( 1 + a_1 e^{ip} ) ( 1 + a_2 e^{-ip} ) ( 1 + a_3 e^{-ip} ) , \label{c1} % ←ラベル付け c1$$ $$A = (-t) \alpha_2 , \ \ a_1 = \frac{-1}{t} , \ \ a_2 + a_3 = \frac{ \alpha_1}{ \alpha_2 } + t , \ \ a_2 a_3 = \frac{-1}{t} \frac{ \alpha_{-1} }{ \alpha_2 }, \label{c2} % ラベル付け c2$$ where $ t $ is a real solution of the equation $ \alpha_{-1} - t + \alpha_1 t^2 + \alpha_2 t^3 = 0 $, and the factor $A$ is independent of $p$, we obtain $$\begin{aligned} \log f(p) &= \frac{1}{2} \left( \log ( 1+ a_1 e^{ip} ) + \log ( 1+a_2 e^{-ip} ) + \log ( 1+ a_3 e^{-ip} ) \right) \notag \\ & \ \ -\frac{1}{2} \left( \log ( 1+ a_1 e^{-ip} ) + \log ( 1+a_2 e^{ip} ) + \log ( 1+ a_3 e^{ip} ) \right). \label{logf} \end{aligned}$$ Then we consider the following four cases: - $ |a_1|<1 $ and $ |a_2|<1 $ and $ | a_3|<1 $, - $ |a_1|>1 $ and $ |a_2|>1 $ and $ | a_3|<1 $, - $ |a_1|>1 $ and $ |a_2|<1 $ and $ | a_3|>1 $, - the other cases. [ **case($ \rm i $)** ]{} Let $ |b|<1 $, then $$\frac{1}{2\pi} \int_{- \pi}^{\pi} e^{-inp} \log ( 1+be^{ip} ) dp = \begin{cases} \frac{(-1)^{n-1} }{n} b^n \ \ ( n > 0 ) \\ 0 \ \ \ \ otherwise \end{cases} \label{b1} % ←ラベル付け b1$$ and $$\frac{1}{2\pi} \int_{- \pi}^{\pi} e^{-inp} \log ( 1+be^{-ip} ) dp = \begin{cases} \frac{(-1)^{-n-1} }{-n} b^{-n} \ \ ( n<0) \\ 0 \ \ \ \ otherwise \end{cases} . \label{b2} % ←ラベル付け b2$$ From (\[defgn\]), (\[logf\]), (\[b1\]) and (\[b2\]), we obtain $$g_0 = 0, \ \ \ g_n = \frac{1}{2} \frac{(-1)^{n-1}}{n} ( a_1^n - a_2^n - a_3^n ) \ \ (n>0) .$$ Then from (\[seg\]) we obtain $$\lim_{ n \to \infty } I(2n) = \left[ ( 1-a_1^2 ) ( 1-a_2^2 ) ( 1-a_3^2 ) ( 1-a_1 a_2 )^{-2} ( 1 - a_1 a_3 )^{-2} ( 1 - a_2 a_3 )^2 \right]^{ \frac{1}{4} } . \label{as1} % ←ラベル付け as1$$ [ **case($ \rm ii $)** ]{} Let $|b|>1$, then $$\frac{1}{2\pi} \int_{- \pi}^{\pi} e^{-inp} \log ( 1+be^{-ip} ) dp = \frac{(-1)^n}{n} + \begin{cases} \frac{(-1)^{n-1} }{n} \left( \frac{1}{b} \right )^n \ \ ( n>0 ) \\ 0 \ \ \ \ otherwise \end{cases} \label{b3} % ←ラベル付け b3$$ and $$\frac{1}{2\pi} \int_{- \pi}^{\pi} e^{-inp} \log ( 1+be^{ip} ) d p = \frac{(-1)^n}{-n} + \begin{cases} \frac{(-1)^{-n-1} }{-n} \left( \frac{1}{b} \right)^n\ \ ( n<0) \\ 0 \ \ \ \ otherwise \end{cases} . \label{b4} % ←ラベル付け b4$$ From (\[defgn\]), (\[logf\]), (\[b3\]) and (\[b4\]), we obtain $$\lim_{ n \to \infty }I(2n) = \left[ \left( 1-\frac{1}{a_1^2} \right) \left( 1-\frac{1}{a_2^2} \right) \left( 1- a_3^2 \right) \left( 1-\frac{1}{ a_1 a_2 } \right)^{-2} \left( 1-\frac{ a_3 }{ a_1 } \right)^2 \left( 1-\frac{ a_3 }{ a_2 } \right)^{-2} \right]^{\frac{1}{4}} . \label{as2} % ←ラベル付け as2$$ The limit $ \displaystyle \lim_{ n \to \infty } I(2n) $ in the case ($ \rm iii $) is obtained from (\[as2\]) with $ a_2 $ and $ a_3 $ replaced by $ a_3 $ and $ a_2 $, respectively. In the case ($ \rm iv $), it is easy to derive that $ \displaystyle \sum_{n=1}^{\infty} n g_n g_{-n} = -\infty $ and $ \displaystyle \lim_{n \to \infty} I(2n) = 0 $. From (\[as1\]) and (\[as2\]), we find that $ \displaystyle I( \infty ) = \lim_{n \to \infty } I(2n) >0 $ if and only if $a_1$ , $a_2$ and $a_3$ satisfy ($ \rm i $) or ($ \rm ii $) or ($ \rm iii $). Next let us consider the ground state phase diagram. From (\[c1\]), we obtain $$\alpha_2 (e^{ip})^3 + \alpha_1 ( e^{ip} )^2 - e^{ip} + \alpha_{-1} = A a_1 ( e^{ip} + \frac{1}{a_1} )( e^{ip} + a_2 )( e^{ip} + a_3 ) .$$ Therefore, $ -1/a_1 $ , $ -a_2 $ and $ -a_3 $ are the roots of the cubic equation $$\alpha_2 z^3 + \alpha_1 z^2 - z + \alpha_{-1} = 0 . \label{equ3} % ←再びラベル付け equ3$$ Hence ($ \rm i $) - ($ \rm iii $) is satisfied if and only if $${ \rm one \ root \ of \ (\ref{equ3}) \ belongs \ to } \ D_O \ { \rm and \ the \ other \ two \ roots \ belong \ to } \ D_I , \label{con} % ←ラベル付け con$$ where $ D_O = \{ z \in \mathbb{C} \ | \ |z|>1 \} $ and $ D_I = \{ z \in \mathbb{C} \ | \ |z| < 1 \} $. The equation (\[equ3\]) is nothing but the equation (\[gap\]) ( the same equation appears after (\[c2\]) ). Therefore the boundary of the region $ I(\infty) > 0 $ satisfies the gapless condition, i.e. the curves corresponding to the gapless condition form the boundary of the ground state phase transition in terms of the correlation function (\[co1\]). The results are shown in Figure 1 and 2. Note that the ground state phase diagram is already obtained in \[24\] for $ K_2 = 0 $. It is easy to convince that the phase diagram in Figure 1 with $ \alpha_2 = 0 $ is identical to the diagram in \[24\]. Symmetry and Generalizations ============================ Let us first consider the symmetry of the phase diagram. When $ K_{0} \neq 0 $ and $ \alpha_{2} = 0 $, the gapless condition is simplified and expressed as $$\begin{aligned} && (X1) \hspace{0.5cm} (-\alpha_{1}) = -(-\alpha_{-1})\pm 1, \nonumber\\ && (X2) \hspace{0.5cm} (-\alpha_{-1}) \neq 0, \hspace{0.3cm} (-\alpha_{1}) = (-\alpha_{-1}), \hspace{0.3cm} 1 - 4(-\alpha_{-1})^{2} < 0, \nonumber\\ && (X3) \hspace{0.5cm} {\rm cannot\:\: be\:\: satisfied}. \label{cond-alpha} \end{aligned}$$ When $K_{1}\neq 0$ and $\alpha_{-1}=0$, let us consider the variables $\beta_{-1}=K_{-1}/K_{1}$, $\beta_{0}=K_{0}/K_{1}$, and $\beta_{2}=K_{2}/K_{1}$, i.e. the normalization by $K_{1}$ instead of $K_{0}$. In this case the condition is expressed as $$\begin{aligned} && (X1) \hspace{0.5cm} \beta_{2}=-(-\beta_{0})\pm 1, \nonumber\\ && (X2) \hspace{0.5cm} {\rm cannot\:\: be\:\: satisfied}. \nonumber\\ && (X3) \hspace{0.5cm} \beta_{-1}= 0, \hspace{0.3cm} \beta_{2}=(-\beta_{0}), \hspace{0.3cm} (-\beta_{0})<-1/2 \:\:{\rm or\:\:} 1/2<(-\beta_{0}). \label{cond-beta} \end{aligned}$$ From (\[majo\]), we find the natural coupling constants of this model are $K_{-1}$, $-K_{0}$, $K_{1}$, $K_{2}$. Thus when we consider the shift of indices of $K_{j}$ from $j$ to $j+1$, the correspondences of $\alpha_{j}$ and $\beta_{j}$ are $$\begin{aligned} (-\alpha_{-1})=\frac{K_{-1}}{-K_{0}} \mapsto \frac{-K_{0}}{K_{1}}=(-\beta_{0}), \hspace{0.5cm} (-\alpha_{1})=\frac{K_{1}}{-K_{0}} \mapsto \frac{K_{2}}{K_{1}}=\beta_{2}. \label{alpha-beta}\end{aligned}$$ When we replace $ \alpha_j $ with corresponding $ \beta_j $ in (\[cond-alpha\]), we find that the condition (\[cond-alpha\]) becomes (\[cond-beta\]). In both cases, the phase diagrams are also identical to that of the XY chain with an external field. Next we will consider a generalization of the results obtained in Section 2-5. We solve the model (\[Hamiltonian\]) using only the algebraic relations of the operators (\[2\]). Hence the model (\[mo\]) generated from the operators which satisfy (\[2\]) can be simultaneously diagonalized, and its string order parameter (\[co1\]) yields the same phase diagram as shown in Figure 1 and 2. For example, from the operators (\[XY\]), the model $$K_0 \sum_{j=1}^N \sigma_j^x \sigma_{j+1}^x + K_1 \sum_{j=1}^N \sigma_j^y \sigma_{j+1}^y + K_2 \sum_{j=1}^N \sigma_j^x \sigma_{j+1}^z \sigma_{j+2}^z \sigma_{j+3}^x + K_{-1} \sum_{j=1}^N \sigma_j^y \sigma_{j+1}^z \sigma_{j+2}^z \sigma_{j+3}^y \label{ex1} %ラベル ex1$$ is generated from (\[mo\]), its string order parameter (\[co1\]) in this case is $$I(n) = \langle \prod_{k=1}^n ( \sigma_{2(j+k)-1}^y \sigma_{2(j+k)}^y ) \rangle_0 = \langle \prod_{k=1}^{2n} \sigma_{2j+k}^y \rangle_0 , \label{st1} % ラベル st1$$ and this model results in the free energy (\[f\]) and the phase diagram shown in Figure 1 and 2. We introduce, in this paper, two series of operators $\{\eta_{j}\}$ and $\{\zeta_{j}\}$, which commute with each other. As a result, our model factorizes into two commutative spin chains as discussed in \[24\] and \[27\]. One series of operators, however, can yield the free energy (\[f\]) and the phase diagram shown in Figure 1 and 2. For example, the series of operators, $$\begin{aligned} \eta_{2j-1}^{(3)} = \sigma^{z}_{j}, \hspace{0.6cm} \eta_{2j}^{(3)} = \sigma^{x}_{j} \sigma^{x}_{j+1} \label{zXYcluster} \end{aligned}$$ yields the Hamiltonian $$\begin{aligned} -\beta{\cal H} = K_{0}\sum_{j=1}^{N} \sigma^{z}_{j} + K_{1}\sum_{j=1}^{N} \sigma^{x}_{j} \sigma^{x}_{j+1} + K_{2}\sum_{j=1}^{N} \sigma^{x}_{j} \sigma^{z}_{j+1} \sigma^{x}_{j+2} + K_{-1}\sum_{j=1}^{N }\sigma^{y}_{j} \sigma^{y}_{j+1} . \label{ex2} % ラベル ex2 \end{aligned}$$ This Hamiltonian is composed of the XY interactions, an external field and the cluster interactions. The string order parameter (\[co1\]) in this case is $$I(n) = \langle \prod_{k=1}^n ( \sigma_{j+k-1}^x \sigma_{j+k}^x ) \rangle_0 = \langle \sigma_{j}^x \sigma_{j+n}^x \rangle_0 ,$$ and this model also results in (\[f\]) and the diagram in Figure 1 and 2. In case of both (\[XY\]) and (\[zXYcluster\]), the transformation (\[a\]) results in the Jordan-Wigner transformation, and in case of (\[op1\]) and (\[op2\]), the transformation becomes (\[star1\]) - (\[star4\]). Generally, an infinite number of operators that satisfy the condition (\[2\]), including (\[XY\]) and (\[zXYcluster\]), are given in Table 1 and 2 in \[24\]. Our present results are universally valid for these infinite number of solvable spin chains. Conclusion ========== In this paper, we obtain the exact solution of the model (\[Hamiltonian\]), which is a cluster model that considers next-nearest-neighbor interactions and two additional compsite interactions. We introduce the series of operators (\[op1\]) and (\[op2\]), which satisfy the algebraic relation (\[2\]). Then, we introduce the transformations (\[a\]), and the model (\[Hamiltonian\]) is diagonalized. We derive the free energy (\[f\]), consider a correlation function (\[co1\]), and derive its exact expressions (\[to\]) and (\[co2\]). We obtained the ground-state phase diagram, as shown in Figure 1 and 2, from the gapless condition, and from the asymptotic behavior of the correlation function, which is classified by the location of the roots of an algebraic equation (\[equ3\]). The exact solution is obtained using only the algebraic relation (\[2\]) of the interactions. Finally, we note that an infinite number of solvable models, generated from operators that satisfy (\[2\]), yield exactly the same results obtained in this paper. Our transformation can be regarded as an algebraic generalization of the Jordan-Wigner transformation. This paper provides a nontrivial example that cannot be solved by the Jordan-Wigner transformation but can be solved by our method. acknowledgements {#acknowledgements .unnumbered} ================ The authors would like to thank Prof. T. Chikyu, Prof. K. Nomura, and Prof. H. Katsura for their comments. This work was supported by JSPS KAKENHI Grant Number JP19K03668. The gapless condition ===================== Here we show the derivation of the condition that the equation (\[gap\]) has a root which belongs to $C_u$ if and only if ($X1$) or ($X2$) or ($X3$) is satisfied. First, if the equaion (\[gap\]) has a root 1 or -1, then ($X1$) is satisfied. Next, we assume that the equation (\[gap\]) has imaginary roots which belong to $C_u$. When $ \alpha_2 \neq 0 $ and $ \alpha_{-1} \neq 0 $, let $c$, $\bar{c} $ and $B$ be the roots of the equaion (\[gap\]), where $c$, $\bar{c}$ are imaginary and $B$ is real. Then from the cubic equation (\[gap\]), we obtain $$c + \bar{c} + B = -\frac{\alpha_1}{\alpha_2} \ \ , \ \ c \bar{c} B = -\frac{\alpha_{-1}}{\alpha_2}.$$ Thus $c$ and $\bar{c}$ are the imaginary roots of the quadratic equation $$z^2 + ( \frac{\alpha_1}{\alpha_2} +B )z - \frac{\alpha_{-1}}{B \alpha_2} = 0. \label{qe} %ラベル qe$$ From (\[qe\]), we obtain $$( \frac{ \alpha_1}{\alpha_2}+B )^2 + \frac{4 \alpha_{-1} }{ B \alpha_2 } <0 \label{imacon} %ラベル imacon$$ and $$| c | = | \bar{c} | = \sqrt{ -\frac{\alpha_{-1} }{ B \alpha_2} }. \label{ab} %ラベル ab$$ From $ |c | = |\bar{c}| = 1 $ and (\[ab\]), we obtain $$B = -\frac{ \alpha_{-1} }{ \alpha_2 }. \label{B} %ラベル B$$ By inserting (\[B\]) to the equation (\[gap\]), we obtain $$\alpha_1 = \alpha_{-1} - \frac{ \alpha_2 ( 1+ \alpha_2) }{ \alpha_{-1}}. \label{X21} %ラベル X21$$ On the other hand, From (\[imacon\]), (\[B\]) and (\[X21\]), we find $$( 1+ \alpha_2 )^2 - 4 \alpha_{-1}^2 < 0. \label{X22} %ラベル X22$$ From (\[X21\]) and (\[X22\]) we obtain ($X2$). When $ \alpha_2 \neq 0 $ and $ \alpha_{-1} = 0 $, the equation (\[gap\]) becomes $ z ( \alpha_2 z^2 + \alpha_1 z - 1 ) = 0 $. Thus the imaginary roots of (\[gap\]) are $$z = -\frac{ \alpha_1 \pm{i} \sqrt{ - 4 \alpha_2 - \alpha_1^2 } }{ 2 \alpha_2}, \label{X3} % ラベル X3$$ where $ - 4 \alpha_2 - \alpha_1^2 > 0 $ is necessary. From (\[X3\]), we find $ \displaystyle |z| = \frac{ \sqrt{ - \alpha_2 } } { | \alpha_2 | } $, and the condition ($X3$) is obatined. When $ \alpha_2 = 0 $, the equation (\[gap\]) becomes a quadratic equation $ \alpha_1 z^2 - z + \alpha_{-1} = 0 $. From this equation, we obtain the condition that $ \alpha_1 = \alpha_{-1} $ and $ 1-4\alpha_{-1}^2 < 0 $, which is containd in ($X2$). Consequently, ($X1$) or ($X2$) or ($X3$) is a necessary condition. In contradiction, when ($X1$) or ($X3$) is satisfied, it is easy to show that the equation (\[gap\]) has a root which belongs to $C_u$. When ($X2$) is satisfied, the equation (\[gap\]) becomes $ ( \alpha_2 z + \alpha_{-1} ) \{ \alpha_{-1} z^2 -(\alpha_2 + 1 ) z + \alpha_{-1} \} = 0 $. Thus (\[gap\]) has imaginary roots $$z = \frac{ (1+\alpha_2 ) \pm{i} \sqrt{ 4 \alpha_{-1}^2 - ( \alpha_2+1)^2} }{ 2 \alpha_{-1} },$$ from which we find $ |z| = 1 $. Therefore, ($X1$) or ($X2$) or ($X3$) is sufficient. Correlation functions ====================== Here we derive the expression (\[to\]) and (\[co2\]) of the ground-state correlation function defined in (\[co1\]). The Hamiltonian is diagonalized by the canonical transformation $$\begin{gathered} \xi_k(q) = \frac{1}{\sqrt{2A(q)}} ( -iL(q)C_k(q) + \sqrt{A(q)} C_{k+1}(q)) \ \ ( k=1, 3), \notag \\ \xi_k(q) = \frac{1}{\sqrt{2A(q)}} ( -iL(q)C_{k-1}(q) - \sqrt{A(q)} C_{k}(q)) \ \ ( k=2, 4) \label{g} % ラベル付け g \end{gathered}$$ as $$-\beta \mathcal{H} = \sum_{0<q<\pi} \Lambda(q) \{ \xi_1^{\dagger}(q) \xi_1(q) -\xi_2^{\dagger}(q) \xi_2(q) +\xi_3^{\dagger}(q) \xi_3(q) -\xi_4^{\dagger}(q) \xi_4(q) \}.$$ From (\[g\]), We obtain $$C_2^{\dagger}(q) C_1(q) = \frac{i}{2} \frac{ \sqrt{A(q)} }{ L(q) } ( \xi_1^{\dagger}(q) \xi_1(q) +\xi_1^{\dagger}(q) \xi_2(q) -\xi_2^{\dagger}(q) \xi_1(q) -\xi_2^{\dagger}(q) \xi_2(q) ). \label{c2c1} % ←ラベル付け c2c1$$ On the other hand, $$\sigma_{2j}^x \sigma_{2j+2n}^x = \prod_{k=1}^n \sigma_{2(j+k)-2}^x 1_{2(j+k)-1} \sigma_{2(j+k)}^x$$ and from (\[et\]) $ \sigma_{2j}^x 1_{2j+1} \sigma_{2j+2}^x = \frac{2}{i} \varphi_2(j) \varphi_1(j+1) $, therefore $$I(2n) = \left( \frac{2}{i} \right)^n \left\langle \prod_{k=1}^n \varphi_2(j+k-1) \varphi_1(j+k) \right\rangle_0 .$$ Using the Wick’s theorem, $I(2n) $ is expressed as $$I(2n) = \left( \frac{2}{i} \right)^n \sum_P \text{sgn}(P) \prod_{k=1}^n \left\langle \varphi_2(j+k-1) \varphi_1(P(j+k)) \right\rangle_0 , \label{r} %ラベル付け r$$ where $P$ are the permutations of the indices. The sum (\[r\]) is the determinant $$\left( \frac{2}{i} \right)^n \begin{vmatrix} G_{j,j+1} & G_{j,j+2} & \cdots & G_{j,j+n} \\ G_{j+1,j+1} & G_{j+1,j+2} & \cdots & G_{j+1,j+n} \\ \vdots & \vdots & \ddots & \vdots \\ G_{j+n-1,j+1} & G_{j+n-1,j+2} & \cdots & G_{j+n-1,j+n} \end{vmatrix} , \label{det3} %ラベル det3$$ where $ G_{l,m} = \langle \varphi_2(l) \varphi_1(m) \rangle_0 $. Because of the translational invariance, (\[det3\]) is expressed as (\[to\]). From (\[c2c1\]) and the fact that the ground-state correlation functions satisfy $ \langle \xi_1^{\dagger} (q) \xi_1 (q) \rangle_0 = 1$, $ \langle \xi_2^{\dagger} (q) \xi_2 (q) \rangle_0 = \langle \xi_2^{\dagger} (q) \xi_1 (q) \rangle_0 = \langle \xi_1^{\dagger} (q) \xi_2 (q) \rangle_0 = 0 $, we obtain $$\begin{aligned} G_{j,j+r} &= \frac{1}{M} \sum_{0<q<\pi} [ e^{iqr} \langle C_2^{\dagger}(q) C_1(q) \rangle_0 + e^{-iqr} \langle C_2(q) C_1^{\dagger}(1) \rangle_0 ] \notag \\ &= \frac{1}{M} \frac{i}{2} \sum_{0<q<\pi} \left( e^{iqr} \frac{ \sqrt{A(q)} }{ L(q) } + e^{-iqr} \frac{ \sqrt{A(q)} }{ L(q)^{\ast} } \right) . \label{D} % ラベル D \end{aligned}$$ In the thermodynamic limit, (\[D\]) results in (\[co2\]). [99]{} Y. Nambu, Prog. Theor. Phys. [**5** ]{},1 (1950). E.Lieb, T.Shultz, and D.Mattis, Ann. Phys. [**16**]{}, 407 (1961). S. Katsura, Phys. Rev. [**127**]{}, 1508 (1962). T. Niemeijer, Physica [**36**]{}, 377 (1967). M. Suzuki, Prog. Theor. Phys. [**46** ]{}, 1337 (1971). H. J. Briegel and R. Raussendorl, Phys. Rev. Lett. [**86**]{}, 910 (2001). R. Raussendorf and H. J. Briegel, Phys. Rev. Lett. [**86**]{}, 5188 (2001). R. Raussendorf, D. E. Browne, and H. J. Briegel, Phys. Rev. A [**68**]{}, 022312 (2003). S. O. Skrøvseth and S. D. Bartlett, Phys. Rev. A [**80**]{}, 022316 (2009). P. Smacchia, L. Amico, P. Facchi, R. Fazio, G. Florio, S. Pascazio, and V. Vedral, Phys. Rev. A[**84**]{}, 022304 (2011). W. Son, L. Amico, R. Fazio, A. Hamma, S. Pascazio, and V. Vedral, Europhys Lett. [**95**]{}, 50001 (2011). S. Montes and A. Hamma, Phys. Rev. E[**86**]{}, 021101 (2012). W. Son, L. Amico, and v. Vedral, Quautum Information Processing [**11**]{}, 1961 (2012). J. Cui, L. Amico, H. Fan, M. Gu, A. Hamma, and V. Vedral, Phys. Rev. B[**88**]{}, 125117 (2013). S. M. Giampaolo and B. C. Hiesmayr, New J. Phys. [**16**]{}, 093033 (2014). J. C. Bridgeman, A. O’ Brien, S. Bartlett, and A. C. Doherty, Phys. Rev. B[**91**]{}, 165129 (2015). T. Ohta, S. Tanaka, I. Danshita, and K. Totsuka, J. Phys. Soc. Jpn. [**84**]{}, 063001 (2015). V. Lahtinen and E. Ardonne, Phys. Rev. Lett. [**115**]{}, 237203 (2015). T. Ohta, S. Tanaka, I. Danshita, and K. Totsuka, Phys. Rev. B[**93**]{}, 165423 (2016). J. K. Pachos and M. B. Plenio, Phys. Rev. Lett. [**93**]{}, 056402 (2004). A. Kopp, and S.Chakravarty, Nat. Phys. [**1**]{}, 53 (2005). A. C. Doherty and S. D. Bartlett, Phys. Rev. Lett. [**103**]{}, 020506 (2009). K. Minami, J. Phys. Soc. Jpn, [**85**]{}, 024003 (2016). K. Minami, Nuclear Physics B [**925**]{}, 144 (2017). K. Minami, Nuclear Physics B [**939**]{}, 465–484 (2019). P. Jordan and E. Wigner, Z. Physik [**47**]{}, 631 (1928) J. H. H. Perk, arXiv:1710.03384v2 | Mid | [
0.651622002820874,
28.875,
15.4375
]
|
1. Introduction {#s1} =============== Electroencephalography (EEG) (Cecotti and Graser, [@B8]; Narizzano et al., [@B34]; Freche et al., [@B13]) is one of the most important non-invasive neuroimaging modalities used in cognitive neuroscience research (Mullen et al., [@B32]; Mete et al., [@B30]; Luo et al., [@B26]) and brain-computer interface (BCI) development (Ahn and Jun, [@B2]; Arnulfo et al., [@B5]; Sargolzaei et al., [@B37]; Kumar et al., [@B22]). However, EEG-based cognitive neuroscience and BCI fields currently face a bottleneck in that high sampling rate and high-sensitivity EEG amplifier hardware are extremely expensive and generally complicated to operate for collecting signals (Jiang et al., [@B19]). Ideally, EEG amplifiers with high sampling rates and sensitivities are preferred to record high-resolution brain activities underlying different stimuli. Lowering the sampling rate and sensitivity may influence the utility of acquired signals (Wu et al., [@B41]). Therefore, extensive efforts have been dedicated to reconstructing high-sampling-sensitivity EEG (HSS-EEG) signals from low-sampling-sensitivity EEG (LSS-EEG) signals to improve performance. The up-sampling operation is one of the conventional time-series reconstruction methods. By using an up-sampling operation, the reconstructed signals are up-sampled and with different sensitivity. The reconstruction methods can be divided into three categories: 1. Reconstruction by interpolation (Erkorkmaz, [@B12]). 2. Reconstruction by mathematical modeling (Naldi et al., [@B33]). 3. Reconstruction by deep neural networks (Jin et al., [@B20]). Among the methods for reconstructing EEG signals by interpolation algorithms, such as bilinear interpolation, nearest neighbor interpolation, and spline interpolation, several are based on the successive assumption of signal values (Marques et al., [@B28]). Such an assumption does not consider the complexity of signals, and, therefore, it is difficult to represent brain activity from reconstructed signals. Reconstruction based on mathematical models, such as compressive sensing, subspace projection, and frequency transformation, optimizes an objective function that incorporates mathematical models and prior information in the different domains of the signals. These algorithms greatly improve signal performance and quality; however, they may still lose the details representing brain activity and suffer from artifacts. In addition, reconstruction by a single mathematical model and a single domain has simplified the range of applications of reconstructed EEG signals. These algorithms greatly improve signal performance and quality (Choudhary et al., [@B10]); however, they may still lose the details representing brain activity and suffer from artifacts. Additionally, the high computational cost of constructing mathematical models remains another potential risk in practical applications. In contrast to interpolation and mathematical models, the recent explosive development of deep neural networks (DNNs) has shed light on novel opinions and promised potential in the field of signal reconstruction. In recent years, most DNNs studies have focused on image signal reconstruction from the perspective of noise, super-resolution, and denoising (LeCun et al., [@B23]). A state-of-the-art image reconstruction performance was obtained by the new game theoretic generative model of generative adversarial networks (GANs) (Goodfellow et al., [@B14]). GANs are used to generate images from artificial data, construct high-resolution (HR) images from low-resolution (LR) copies (Ledig et al., [@B24]), and denoise CT images from noisy images (Yang et al., [@B42]), and such models achieve the best performance in reconstruction tasks. Inspired by the applications of GANs in the image reconstruction field, researchers have focused on reconstructing EEG signals using GANs. Research on "GANs conditioned by brain signals" (Kavasidis et al., [@B21]) has used GANs to generate images seen by subjects from recorded EEG signals. Another deep EEG super-resolution study used GANs to produce HR EEG data from LR samples by generating channel-wise up-sampled data to effectively interpolate numerous missing channels (Hartmann et al., [@B16]). Such an algorithm produced higher spatial resolution EEG signals to improve performance. Although GANs have been used to reconstruct images from EEG signals with a visualized spatial feature space, the sampling rate and sensitivity resolution in the temporal feature space are still two key limitations of EEG signals. To counterbalance the performance of EEG signals and the cost of EEG amplifiers, we propose using a GAN with the Wasserstein distance (WGAN) model as the discrepancy measure between different sampling rates and sensitivities and a spatial-temporal-frequency loss function that computes the difference between EEG signals in an established feature space. The GAN/WGAN architecture is used to encourage the reconstructed LSS-EEG signals to share the same distribution as the HSS-EEG signals. Because EEG signals are multi-channels time-series data, instead of using the mean square error by temporal features as the loss function, we propose a novel spatial-temporal-frequency loss function, which is robust enough for the EEG signals, to extract the spatial-temporal-frequency features for reconstruction. By using the GAN/WGAN architecture and the carefully designed loss function to reconstruct HSS-EEG signals from LSS-EEG signals, this study has made two contributions: 1. The GAN/WGAN architectures are trained by EEG signals of different sampling rates and different sensitivities to compare the classification performances of the reconstructed EEG signals. 2. The spatial-temporal-frequency loss is applied to maintain robustness of GAN/WGAN architectures training, and the loss function helps reconstruction signals to obtain more discriminant patterns. 2. Methods {#s2} ========== 2.1. EEG Signal Reconstruction Model ------------------------------------ For the reconstruction of EEG signals, let $z \in R^{N \times T_{1} \times S}$ denote the LSS-EEG signals from distribution *P*~*L*~, and $x \in R^{N \times T_{2} \times S}$ denote the HSS-EEG signals from the real distribution *P*~*H*~. In the definition, *N* denotes the number of channels, and *T*~1~ and *T*~2~ denote the samples of one trial for LSS-EEG signals and HSS-EEG signals during recordings, respectively. *S* denotes the number of trials for the motor-based tasks. The reconstruction goal is to formulate a function *f*(*z*) that projects LSS-EEG signals *z* to HSS-EEG signals *x*: f ( z ) : z → x In fact, the reconstruction function maps the LSS-EEG samples from *P*~*L*~ into a certain distribution *P*~*C*~, and our goal is to adjust a certain distribution *P*~*C*~ to make it close to the real distribution *P*~*H*~ by varying the function *f*(*z*). The reconstruction has two procedures with GAN. In the generation procedure, the object is to adjust EEG samples from distribution *P*~*L*~ to distribution *P*~*C*~. In the discriminator procedure, the object is to adjust EEG samples from distribution *P*~*C*~ to distribution *P*~*H*~. The reconstruction procedure can ultimately be treated as a procedure to adjust EEG samples from one distribution to another. Typically, since EEG signals are nonlinear and non-stationary, the noise model in such signals is complicated, and the reconstruction mapping relationship is non-uniformly distributed across the signals. Thus, there is no clear indication of how the distributions of LSS-EEG and HSS-EEG signals are related to each other. It is difficult to reconstruct LSS-EEG signals using conventional methods. However, the uncertainties in the noise model and the reconstruction mapping relationship can be ignored by using deep neural networks (DNNs), as the DNNs can efficiently learn high-level features from nonlinear and non-stationary signals and reconstruct a representation of the data distribution from modest-sized signal patches. Therefore, the GAN framework based on DNN is suitable for EEG signal reconstruction. In summary, a modified GAN framework with the Wasserstein distance and temporal-spatial-frequency (TSF) loss is introduced to reconstruct HSS-EEG signals from LSS-EEG signals. 2.2. GAN With Wasserstein Distance ---------------------------------- The GAN framework consists of two opposing neural networks, a generator *G*, and a discriminator *D*, that are optimized to minimize a two-player min-max problem (Goodfellow et al., [@B14]). The discriminator is trained to distinguish the generated samples from the real samples, while the generator is trained to generate fake samples that are not determined as fake by the discriminator. For the reconstruction of EEG signals, we further defined the discriminator *D*~θ~*D*~~ and the generator *G*~θ~*G*~~ to solve the min-max problem: m i n θ G m a x θ D L G A N ( D θ D , G θ G ) = E x \~ P H \[ l o g D θ D ( x ) \] \+ E z \~ P L \[ l o g ( 1 \- D θ D ( G θ G ( z ) ) ) \] where *E*(·) denotes the expectation operator. When the discriminator meets the real data, it will satisfy *D*~θ~*D*~~(*x*) = 1 to discriminate the real data. Here, *D*~θ~*D*~~(*x*) = 1 reaches the expectation for *logD*~θ~*D*~~(*x*). When the discriminator meets the generated data, it will satisfy *D*~θ~*D*~~(*G*~θ~*G*~~(*z*)) = 0 to discriminate the generated data. Here, *D*~θ~*D*~~(*G*~θ~*G*~~(*z*)) = 0 reaches the expectation for *log*(1−*D*~θ~*D*~~(*G*~θ~*G*~~(*z*))). Therefore, the minimax optimal function is designed by the expectation operator. The general reconstruction idea is to train a generator for the purpose of fooling a differentiable discriminator that is trained to distinguish reconstructed HSS-EEG signals from real HSS-EEG signals. In constructing EEG signals, GANs suffer from remarkable training difficulty due to the nonlinear and non-stationary characteristics of EEG signals. To overcome the training problem of the original GAN framework, instead of using Jensen--Shannon divergence, the WGAN framework uses the Wasserstein distance to compare sample distributions (Gulrajani et al., [@B15]). From the definition of WGAN, the min-max problem optimized by *D*~θ~*D*~~ and *G*~θ~*G*~~ can be written: m i n θ G m a x θ D L W G A N ( D θ D , G θ G ) = \- E x \~ P H \[ D θ D ( x ) \] \+ E z \~ P L \[ D θ D ( G θ G ( z ) ) \] \+ λ E x \~ \~ P R \[ ( \| \| ∇ x \~ ( D ( x \~ ) ) \| \| 2 \- 1 ) 2 \] In the min--max problem, the Wasserstein distance is estimated by the first two terms. The last term is the gradient penalty for network regularization. In the penalty term, *P*~*R*~ denotes the distribution of uniform samples $\overset{\sim}{x}$ along straight lines connecting pairs of generated and real samples. $\nabla_{\overset{\sim}{x}}{( \cdot )}$ is the gradient calculator, and the parameter λ is a constant weighting parameter for the penalty term. In fact, the WGAN framework removes the log function and drops the last sigmoid layer to keep the gradient while training the min-max problem. The discriminator *D*~θ~*D*~~ and the generator *G*~θ~*G*~~ are trained alternatively by optimizing one and updating the other. 2.3. TSF-MSE Loss Function -------------------------- To allow the generator to transform the data distribution from a low sampling rate and sensitivity to a high sampling rate and sensitivity, another part of the loss function needs to be added to the GAN/WGAN architecture to retain the detail and information content of the EEG signals. A widely used loss function for signal details and information contents is the mean square error (MSE) loss function (Yang et al., [@B42]). Typically, as the common MSE is computed by minimizing the point-wise error in image processing, the temporal MSE is computed by minimizing the time sampling point-wise error between a LSS-EEG patch and a HSS-EEG patch by the time step: L T \- M S E ( G θ G ) = E ( x , z ) \[ 1 T 2 \| \| G ( z ( t ) ) \- x ( t ) \| \| F 2 \] where \|\|·\|\|~*F*~ denotes the Frobenius norm, *L*~*T*−*MSE*~ denotes the temporal MSE for the generator *G*~θ~*G*~~, *t* is the time step of real EEG signals and generated EEG signals, and *T* is the number of time steps for each batch. In contrast to images, EEG signals are multi-channel time-series data, and the spatial and frequency features must be considered for reconstruction. Therefore, in addition to the temporal MSE *L*~*T*−*MSE*~ between time steps, the spatial MSE *L*~*S*−*MSE*~ between channels and the frequency MSE *L*~*F*−*MSE*~ between signal batches also need to be considered for encouraging the GAN/WGAN architecture to construct more accurate HSS-EEG signals. Recently, common spatial patterns (CSP) have been widely used to extract spatial features from EEG signals (Luo et al., [@B27]), and power spectral density (PSD) features are widely used to extract frequency features from EEG signals (Petroff et al., [@B36]). The CSP algorithm is used to compute the optimal projection vectors to project the original EEG signal to a new space to obtain good spatial resolution and discrimination between different classes of EEG signals. The PSD algorithm is used to compute the power values on specific frequencies to compose a spectra. Using these two algorithms, the spatial MSE *L*~*S*−*MSE*~ and the frequency MSE *L*~*F*−*MSE*~ are defined for the generator: L S \- M S E ( G θ G ) = E ( x , z ) \[ 1 C 2 \| \| G ( C S P ( z ( c ) ) ) \- C S P ( x ( c ) ) \| \| F 2 \] L F \- M S E ( G θ G ) = E ( x , z ) \[ 1 N 2 \| \| G ( P S D ( z ( n ) ) ) \- P S D ( x ( n ) ) \| \| F 2 \] where *CSP*(·) and *PSD*(·) are the CSP feature and PSD feature extractor, respectively. *c* is the channel of real EEG signals and the same of the generated EEG signals, *C* is the number of channels, *n* is the batch of real EEG signals and the same as that of the generated EEG signals, and *N* is the number of batches. For convenience, the TSF loss is computed by weighting three such MSE losses: L T S F \- M S E ( G θ G ) = λ T · L T \- M S E ( G θ G ) \+ λ S · L S \- M S E ( G θ G ) \+ λ F · L F \- M S E ( G θ G ) , where λ~*T*~, λ~*S*~, λ~*F*~ are the weights of three such different MSE losses, respectively. Datasets with different sampling rates and sensitivities will obtain different weights, and, thus, the values of the weights will be determined by experiments. In addition, to confirm that the EEG signals are temporally and spatially coherent, a regularization loss *L*~*TV*~(*G*~θ~*G*~~) based on total variation is used in the generator: L T V ( G θ G ) = 1 C T ∑ c = 1 C ∑ t = 1 T \| \| ∇ z G θ G ( z ) c , t \| \| where ∇~*z*~(·) is the gradient calculator; the gradient regularization loss will encourage temporal and spatial coherence of the reconstruction. Combining Equations (3), (7), and (8), the overall joint reconstruction loss function is expressed as m i n θ G m a x θ D L T S F \- M S E ( G θ G ) \+ λ 1 L W G A N ( D θ D , G θ G ) \+ λ 2 L T V ( G θ G ) where λ~1~ and λ~2~ are the weights for controlling the trade-off among the WGAN adversarial loss, the TSF-MSE loss and the TV loss. 2.4. Network Structures ----------------------- The proposed WGAN-EEG reconstruction framework is illustrated in [Figure 1](#F1){ref-type="fig"}. The WGAN-EEG framework consists of three parts to reconstruct HSS-EEG signals from LSS-EEG signals. For the first part of the deep generator *G*~θ~*G*~~, "B residual blocks" with an identical layout that was proposed by "Kaiming He" (He et al., [@B17]) are employed in the generator network. To facilitate the high sensitivity of EEG signals, 16 "B residual blocks" are applied to LSS-EEG signals to extract deep features for the generator. In each "B residual block," following the common usage of the deep learning community, two convolutional layers with small 3\*3 kernels, 1 stride, and 64 feature maps (k3n64s1) are followed by a batch-normalization layer (BN) and the ReLU activation function (Ioffe and Szegedy, [@B18]). To increase the sampling rate of the input EEG signals, the trained deconvolutional layer (stride = 0.5) is followed by "B residual blocks" to increase the sampling rate. In real-world application, the WGAN-EEG architecture is trained well to fit HSS-EEG signals before usage. In the usage scenario, the recorded LSS-EEG signals are incorporated into the well-trained architecture to reconstruct HSS-EEG signals to improve the sensitivity. {#F1} The second part of the WGAN-EEG framework is the TSF-MSE loss calculator, which is realized in [Figure 1](#F1){ref-type="fig"}. The reconstructed output HSS-EEG signals *G*~θ~*G*~~(*z*) from the generator *G*~θ~*G*~~ and the ground truth HSS-EEG signals *x* are fed into the calculator to extract the CSP features and the PSD features. Then, using the extracted features, the TSF-MSE loss is computed by Equations (4), (5), (6). The reconstruction error computed by the loss function is then back-propagated to update the generator network\'s weights. The third part of the WGAN-EEG used to discriminate real HSS-EEG signals from generated HSS-EEG samples, the discriminator network *D*~θ~*D*~~, is shown in [Figure 2](#F2){ref-type="fig"}. Here, we followed the architectural guidelines for the discriminator to use the LeakyReLU activation function and avoid max-pooling along the network (Zhang et al., [@B43]). The discriminator network contains eight convolutional layers with an increasing number of filter kernels by a factor of 2. In fact, the convolutional kernels are increased from 64 to 512 kernels, and the stride is alternatively increased from 1 to 2 to reduce the EEG signal sampling rate when the number of features is doubled. In the discriminator, each convolutional layer is followed by a LeakyReLU activation function and a batch-normalization layer. After eight convolutional layers, there are two FCN layers, of which the first layer has 1,024 outputs with the LeakyReLU activation function, and the second layer has a single output. Following the instructions of the WGAN (Gulrajani et al., [@B15]), the discriminator of the WGAN-EEG has no sigmoid cross entropy layer. {#F2} The WGAN-EEG framework is trained by using EEG signal batches and applied on the entity of each signal trial. The details of training the WGAN have been described in the experiments. 3. Results {#s3} ========== 3.1. Experimental Datasets -------------------------- To explore the feasibility and performance of the proposed algorithm, three EEG signal datasets with different sampling rates and sensitivities are applied to train and evaluate the proposed networks. [Table 1](#T1){ref-type="table"} illustrates the details of these three different EEG datasets. 1. Action Observation (AO) dataset (Luo et al., [@B26]): The AO dataset[^1^](#fn0001){ref-type="fn"} was collected from our previous research on different speed modes during AO. The EEG signals were acquired from the "NeuroScan SymAmp2" device with 64 channels, and the sampling rate and sensitivity were 250 Hz and 0.024 μV/bit, respectively. In this dataset, six subjects were invited to observe a robot\'s actions at four different speeds. Thus, the dataset had 24 subsets for each subject in each AO speed mode. Each subset contained 384 trials with 192 trials of left leg movements and 192 trials of right leg movements for a binary classification, and each trial lasted 5 s. To train the GAN/WGAN, a "leave-one-rest" strategy is used for training. In our pre-training experiments, more signals caused a problem of over-fitting and a large time complexity for GAN/WGAN training. Since 13 subsets containing 4,992 trials were enough to obtain the best performance, we left one subset and randomly selected 13 subsets from the remaining 23 subsets for training; the left subset was reconstructed after obtaining the well-trained GAN/WGAN. Therefore, all 24 subsets were reconstructed through 24 rounds of the above procedure. Because the AO dataset was acquired at a sampling rate of 250 Hz, we down-sampled all trials of EEG samples to the sampling rate of 125 Hz for the sake of sampling rate reconstruction. 2. Grasp and Lift (GAL) dataset (Luciw et al., [@B25]): The GAL dataset[^2^](#fn0002){ref-type="fn"} recorded EEG signals while the subjects grasped and lifted an object. The EEG signals were acquired using the "BrainAmp" device with 32 channels, and the sampling rate and sensitivity were 500 Hz and 0.1 μV/bit, respectively. In this dataset, 12 subjects executed six movements for 1,560 trials, and each trial lasted 0.5 s; thus, the classification of EEG signals contained six categories. To train the GAN/WGAN, a "leave-one-rest" strategy is used for training. The 9,360 trials carried out by six subjects were enough to train the GAN/WGAN, and we thus left one subject\'s signals and randomly selected six subjects\' signals from the remaining 11 subjects\' signals for training; the left subjects\' signals were reconstructed after obtaining the well-trained GAN/WGAN. Therefore, all 12 subjects\' signals were reconstructed through 12 rounds of the above procedure. In the experiment, to validate the reconstruction of the sampling rate, all signals were down-sampled to a sampling rate of 250 Hz. 3. Motor Imagery (MI) dataset (Tangermann et al., [@B40]): The MI dataset[^3^](#fn0003){ref-type="fn"} was from the "BCI competition IV dataset 2a." Nine subjects participated in the MI experiment during which EEG signals were recorded while the subject imagined his/her own leg, foot, and tongue movements, and each trial lasted for 4 s. There were 22 channels, and the sampling rate and sensitivity were 250 Hz and 100 μV/bit, respectively. In this dataset, nine subjects executed four motor imagery tasks, and each subject had 576 trials of EEG signals for a four categories for classification.To train the GAN/WGAN, a "leave-one-rest" strategy is used for training. The 4,032 trials carried out by seven subjects were enough to train the GAN/WGAN, and we thus left one subject\'s signals and randomly selected seven subjects\' signals from the remaining eight subjects\' signals for training; the left subjects\' signals were reconstructed after obtaining the well-trained GAN/WGAN. Therefore, all nine subsets were reconstructed through nine rounds of the above procedure. For the same purpose, all trials of EEG signals were down-sampled at a sampling rate of 125 Hz. ###### Details of the three different EEG datasets. **Datasets** **Action observation** **Grasp and lift** **Motor imagery** --------------------------- ------------------------ -------------------- ------------------- Sampling rate/s 250 500 250 Sensitivity/bit 0.024 μV/bit 0.1 μV/bit 100 μV/bit Channels 64 32 22 Classification categories 2 6 4 Subject number 6 12 9 Trials/Subject 384 576 1,560 Trial duration/s 5 s 0.5 s 4 s Device NeuroScan SymAmp2 BrainAmp Unknown 3.2. Training Details --------------------- In the training procedure, we trained six models using the GAN/WGAN framework within three different datasets. All down-sampled training EEG samples were fed into the generator, and the real training EEG samples were fed into the discriminator. The generated EEG samples and the real EEG samples were discriminated by the TSF-MSE loss function to update the generator and the discriminator for solving the min-max problem. Because the AO dataset and the GAL dataset have high sampling rates and a high number of channels, models for these two datasets were trained over 30 epochs. However, the MI dataset has a lower sampling rate and fewer channels, and, therefore, this dataset was trained over 20 epochs. Each epoch traverses all the data in the corresponding dataset. According to the different devices used to record EEG signals, the generators of the GAN/WGAN frameworks were specified by different scopes of generation for different datasets. We specified the generation scopes of \[−40, 40 μV\], \[−50, 50 μV\], and \[−100, 100 μV\] for the AO dataset, the GAL dataset, and the MI dataset, respectively. In our experiments, we randomly extracted pairs of signal patches from down-sampled EEG signals and real EEG signals as our training inputs and labels. The patch size is *N*\*τ, where *N* is the channel number for different datasets, and τ is the EEG samples from the temporal domain. Since the limited trials of EEG signals (\<500 trials for one subject) and smaller values of τ will construct more accurate sequential relationships for the EEG signals, following our previous research (Luo et al., [@B27]), we cropped a minimal length for the training of the deep neural network. According to the pre-experiment, we set τ = 12 to satisfy the minimal length for the convolution in the GAN/WGAN architecture. In the optimization of the generator and the discriminator, according to current research (Basu et al., [@B7]), the GAN models were optimized by the Adam algorithm (Basu et al., [@B7]), and the WGAN models were optimized by the RMSprop algorithm (Mukkamala and Hein, [@B31]). The optimization procedure for the GAN/WGAN architectures is shown in [Figure 3](#F3){ref-type="fig"}. The mini-batch size was set to 32. Following the instructions of the GAN/WGAN frameworks (Goodfellow et al., [@B14]; Gulrajani et al., [@B15]), the Adam optimizer\'s hyperparameters were set as $\alpha = 10^{- 5},\beta_{1} = 0.5,\beta_{2} = 0.9$, and the RMSprop optimizer\'s hyperparameters were set as α = 10^−5^, β = 0.9. The hyperparameter for the gradient penalty of WGAN framework was set as λ = 10 according to the suggestion in the reference (Gulrajani et al., [@B15]). The hyperparameters for the SRGAN/SRGAN frameworks in Equation (9) were set as $\lambda_{1} = 10^{- 3}$ and $\lambda_{2} = 2*10^{- 8}$ by the suggestions of reference (Ledig et al., [@B24]). The hyperparameters in the TSF-MSE loss function of Equation (7) and the joint reconstruction were set of different values according to the experimental experience of each reconstruction round, and the average values with standard deviations of all parameters in three datasets are given in [Table 2](#T2){ref-type="table"}. The optimization processes for the GAN framework and the WGAN framework are similar; however, some places are changed to the corresponding optimizer and the loss functions (see [Figure 3](#F3){ref-type="fig"}). {#F3} ###### The hyperparamter λ~*T*~, λ~*S*~, λ~*F*~ tuning of the novel TSF-MSE loss function for all experiments. **Reconstruction** **λ~*T*~** **λ~*S*~** **λ~*F*~** -------------------- ------------- ------------- ------------- *AO*−\>*AO* 0.46 ± 0.12 0.23 ± 0.06 0.30 ± 0.09 *GAL*−\>*GAL* 0.44 ± 0.13 0.21 ± 0.08 0.35 ± 0.06 *MI*−\>*MI* 0.53 ± 0.16 0.20 ± 0.11 0.27 ± 0.03 *GAL*−\>*AO* 0.47 ± 0.12 0.18 ± 0.09 0.31 ± 0.07 *MI*−\>*AO* 0.41 ± 0.13 0.31 ± 0.08 0.27 ± 0.09 *AO*−\>*GAL* 0.50 ± 0.14 0.22 ± 0.09 0.33 ± 0.06 *MI*−\>*GAL* 0.52 ± 0.12 0.22 ± 0.08 0.25 ± 0.08 *AO*−\>*MI* 0.60 ± 0.18 0.31 ± 0.09 0.07 ± 0.01 *GAL*−\>*MI* 0.58 ± 0.17 0.33 ± 0.08 0.06 ± 0.01 The GAN/WGAN frameworks were implemented in Python 2.7 with the Tensorflow 1.8 library. Two NVIDIA 1080Ti GPUs were used in this study. 3.3. Network Convergence ------------------------ To visualize the convergence of the GAN/WGAN frameworks, the conventional temporal MSE, frequency MSE, spatial MSE, the proposed TSF-MSE losses, and the Wasserstein distance for validation of three different datasets were computed according to Equations (2), (3), (4), and (5). [Figure 4](#F4){ref-type="fig"} shows the averaged temporal MSE, frequency MSE, spatial MSE, and TSF-MSE losses vs. the number of epochs for different datasets within the GAN/WGAN frameworks. {#F4} From [Figures 4A--D](#F4){ref-type="fig"}, for a given framework and dataset, we have compared the variations and differences between the conventional temporal MSE, frequency MSE, spatial MSE, and our proposed TSF-MSE. In the four figures, all of the iterative curves are shown to have decreased rapidly within the first 10 epochs (each epoch contains 10 error recordings), and the initial decreases indicated that these two metrics are positively correlated for the EEG signal reconstruction. However, for each dataset or when using GAN/WGAN frameworks, the loss results of TSF-MSE were lower than the loss results of conventional temporal MSE, frequency MSE, and spatial MSE. In addition, of these four losses, the WGAN frameworks oscillated in the convergence process, while the GAN frameworks smoothed in the convergence process. Comparing the oscillation of losses, the TSF loss exhibited varied smoothing for the WGAN framework compared to the GAN framework for each dataset. These observations of network convergence suggested that the conventional MSE losses and our proposed TSF-MSE loss have different focuses within the GAN/WGAN frameworks. By applying the generators, the difference between conventional MSE losses and our proposed TSF-MSE loss will be further revealed in the reconstructed EEG signals. [Figure 5](#F5){ref-type="fig"} illustrates the Wasserstein distance estimation vs. the number of epochs for three different datasets. The plotted Wasserstein values were estimated by the definition of −*E*~*x*\~~*P**H*~~\[*D*~θ~*D*~~(*x*)\]+*E*~*z*\~~*P**L*~~\[*D*~θ~*D*~~(*G*~θ~*G*~~(*z*))\] in Equation (3). From the figure, we have found a reduction in the Wasserstein distances as the number of epochs increased, but different datasets have different decay rates of the reducing Wasserstein distance. For the curves of the three datasets, we noted that the Wasserstein distance we computed is a surrogate that has not been normalized by the total number of EEG signal samplings, and, therefore, the curves would have decreased to close to zero after 100 epochs by using the normalization for the EEG signals. ![The Wasserstein distance estimation vs. the number of epochs for three different datasets. The plotted Wasserstein values are estimated by the definition of −*E*~*x*\~~*P**H*~~\[*D*~θ~*D*~~(*x*)\]+*E*~*z*\~~*P**L*~~\[*D*~θ~*D*~~(*G*~θ~*G*~~(*z*))\] in Equation (3). For the curves of these three datasets, we note that the Wasserstein distance we computed is a surrogate that has not been normalized by the total number of EEG signal samplings, and, therefore, the curves would have decreased to close to zero after 100 epochs by using the normalization for the EEG signals.](fninf-14-00015-g0005){#F5} 3.4. Reconstruction Results --------------------------- To show the reconstruction effects of the GAN/WGAN frameworks with our proposed TSF-MSE loss function, we considered two different aspects of the reconstruction results. The first one was the sampling rate reconstruction by the same sensitivity signals\' GAN/WGAN frameworks, which is shown in [Figure 6](#F6){ref-type="fig"}. The second one was the sensitivity rate reconstruction by the different sensitivity signals\' GAN/WGAN frameworks, which is shown in [Figure 7](#F7){ref-type="fig"}. Since the proposed reconstruction method used a novel TSF-MSE loss function for the training of GAN/WGAN architectures, the statistical temporal, frequency, and spatial results were also compared between the original signals and the reconstructed signals. [Figures 8](#F8){ref-type="fig"}--[10](#F10){ref-type="fig"} illustrated the mean temporal error, mean spectra difference, and brain electrical activity mapping on 12 Hz of a single trial compared with the original EEG signals and all reconstructed EEG signals. {#F6} {#F7} {#F8} {#F9} {#F10} To plot the reconstruction results of different models and situations, we chose the same trial from each dataset for the comparison experiments. Because the number of channels differs for each dataset, we choose the "*FPz*" channel for the experiments to plot the figures. In addition, as one trial over a long period of time will hide some details of the reconstruction signals, we chose the 50 ms range of (500 and 550 ms) for the AO and MI datasets and the 50 ms range of (100 and 150 ms) for the GAL dataset to plot the details of the reconstruction results. From the reconstruction results by the same details shown in [Figure 6](#F6){ref-type="fig"}, we have found that the signals\' proximity between the reconstructed data and the original data decreased in the following order for the three datasets: AO \> GAL \> MI. The difference between the GAN framework and the WGAN framework cannot be realized at the signal level. In the figures shown in [Figure 7](#F7){ref-type="fig"}, the high sensitivity EEG signals\' GAN/WGAN frameworks reconstructed the low sensitivity EEG signals well, such as the AO and GAL data reconstructed by the MI GAN/WGAN frameworks. However, the low sensitivity EEG signals\' GAN/WGAN models cannot reconstruct accurate high sensitivity EEG signals, such as MI data reconstructed by the AO and GAL GAN/WGAN frameworks. For the statistical results in [Figures 8](#F8){ref-type="fig"}--[10](#F10){ref-type="fig"}, we have found that excepting for the temporal errors, reconstructed EEG signals show the same regulations on frequency and spatial features. For the reconstructions of the same sensitivity, the mean spectra results have shown that WGAN architectures outperform than GAN architectures, so do the brain electrical activity mapping (BEAM) results for reconstructions of the same sensitivity. As for the reconstructions of different sensitivity, we have found that higher sensitivity models bring lower spectra difference and more distinct ERS/ERD phenomenon on BEAMs, while lower sensitivity models bring higher spectra difference and less distinct ERS/ERD phenomenon on BEAMs. 3.5. Classification Results --------------------------- In fact, the qualitative analysis could not yield promising insight regarding HSS-EEG signals reconstructed by LSS-EEG signals. Hence, a quantitative analysis was applied to explore the performance of reconstructed EEG signals. In this paper, because the AO dataset corresponded to action observation, the GAL dataset corresponded to action execution, and the MI dataset corresponded to motor imagery, these three datasets caused the same event-related desynchronization/event-related synchronization (ERD/ERS) phenomenon, which can be classified by filter bank common spatial patterns (FBCSP) and a support vector machine (SVM) (Luo et al., [@B27],[@B26]). The ERS/ERD phenomenon from EEG signals is common on three motor-related datasets, and such phenomena are usually used for the motor-based BCI. Therefore, the ERS/ERD phenomenon will be the key index with which to measure the performance of BCI system by EEG signals. This study thus selected the ERS/ERD phenomenon from EEG signals as a quantitative measure, and FBCSP features with an SVM classifier were applied to explore the performances of the original signals and the reconstructed signals. For comparison with different models and different sensitivities, there were several hyperparameters for the FBCSP features, SVM classifier, and deep learning classifier: 1. Because all three datasets contain the ERD/ERS phenomenon, which is detected on the band of \[8, 30 Hz\], the filter bank strategy is used to divide the whole band to obtain universality for different subjects. In this study, the width and overlapping ratio were set to 4 and 2 Hz for the filter bank dividing, as shown in [Table 3](#T3){ref-type="table"}. After the EEG signals are filtered by the optimal filter bank, the CSP algorithm was included to extract FBCSP features (Ang et al., [@B3]). 2. The CSP algorithm (Ang et al., [@B3]) is presented to every filter result to extract the optimal spatial features by computing a problem of maximizing the power ratio for different AO/AE/MI tasks. Then, the maximizing power ratio is computed by the singular value decomposition (SVD) algorithm to obtain eigenvalues and eigenvectors. Because different datasets have EEG signals from different channels, the number of eigenvalues used for constructing the CSP spatial vector were set to *m* = 8, *m* = 4, and *m* = 4 for the AO dataset, the GAL dataset, and the MI dataset, respectively. 3. In the classification, the SVM classifier was issued to classify the extracted FBCSP features from three different datasets. To overcome the non-stationary and nonlinear characteristics of EEG signals, the linear kernel with hyperparameters was set to *c* = 0.01 and *g* = 2 for the classifiers for all datasets. To compare the classification performance for both the original data and the reconstructed data, an 8\*8 cross-validation strategy was applied to each dataset, and the average classification results were recorded. 4. In order to validate the performance improvement of reconstructed signals, a convolutional neural networks based deep learning model "FBCSPNet" from reference (Schirrmeister et al., [@B38]) was introduced to compare the classification performance between original signals and reconstructed signals. Experimental parameters were set as the same from the reference for AO/GAL/MI datasets. ###### The optimal division of bandpass filters. ---------------- ------------ ------------ ------------ ------------ ------------ Sub-bands *fb*~1~ *fb*~2~ *fb*~3~ *fb*~4~ *fb*~5~ Frequency (Hz) \[8, 12\] \[10, 14\] \[12, 16\] \[14, 18\] \[16, 20\] Sub-bands *fb*~6~ *fb*~7~ *fb*~8~ *fb*~9~ *fb*~10~ Frequency (Hz) \[18, 22\] \[20, 24\] \[22, 26\] \[24, 28\] \[26, 30\] ---------------- ------------ ------------ ------------ ------------ ------------ Classification results for the sampling rate reconstruction by the same sensitivity signals\' GAN/WGAN frameworks are shown in [Tables 4](#T4){ref-type="table"}--[6](#T6){ref-type="table"} for AO dataset, GAL dataset, and MI dataset, respectively. In addition, classification results for the sensitivity rate reconstruction by the different sensitivity signals\' GAN/WGAN frameworks are shown in [Tables 7](#T7){ref-type="table"}--[9](#T9){ref-type="table"} for AO datset, GAL dataset, and MI dataset, respectively. In all tables, the results are presented by classification accuracy forms, and a paired *t*-test statistical technique was used to detect whether the reconstructed EEG signals significantly outperform than the original EEG signals. P-value of the t-test statistics are provided in the tables, and ^\*^*p* \<0.05 and ^\*\*^*p* \<0.01 represent the results compared among two columns are significantly different and extremely significantly different. ###### Classification results of GAN/WGAN frameworks for the sampling rate reconstruction of the same sensitivity signals in AO dataset. **Subjects** **Original data (a)** **Spline data (b)** **GAN up-sampling (c)** **WGAN up-sampling (d)** -------------- ----------------------- --------------------- ------------------------- -------------------------- AO-1 62.83 58.72 64.51 **69.52** AO-2 53.12 51.67 52.83 **55.61** AO-3 70.31 68.92 **73.96** 72.66 AO-4 75.26 71.78 73.96 **80.99** AO-5 59.12 58.27 61.28 **64.22** AO-6 74.22 70.30 73.96 **76.82** AO-7 55.43 54.28 **60.72** 59.83 AO-8 58.27 55.42 **59.82** 59.73 AO-9 77.08 76.07 83.85 **84.37** AO-10 68.49 68.78 **75.26** 70.57 AO-11 79.17 74.64 87.76 **89.85** AO-12 73.44 66.15 66.67 **75.53** AO-13 55.83 59.42 61.42 **63.49** AO-14 61.82 55.23 63.83 **65.72** AO-15 55.49 53.82 56.29 **58.73** AO-16 62.42 57.59 63.86 **65.82** AO-17 64.58 57.81 58.59 **67.44** AO-18 53.28 53.28 55.87 **57.89** AO-19 52.82 51.87 55.89 **57.63** AO-20 63.83 62.57 **68.59** 67.83 AO-21 70.31 61.98 61.98 **72.91** AO-22 57.55 55.73 57.29 **59.37** AO-23 61.83 58.89 **63.82** 63.58 AO-24 59.27 58.73 62.82 **63.93** AVG 63.57 60.91 65.41 67.67 *T*-test -- a vs. b c vs. a d vs. a *p*-value -- \*\**p* \<0.01 \**p* \<0.05 \*\**p* \<0.01 *The bold text is the best performance*. ###### Classification results of GAN/WGAN frameworks for the sampling rate reconstruction of the same sensitivity signals in GAL dataset. **Subjects** **Original data (a)** **Spline data (b)** **GAN up-sampling (c)** **WGAN up-sampling (d)** -------------- ----------------------- --------------------- ------------------------- -------------------------- GAL-1 69.23 68.71 72.81 **75.63** GAL-2 65.06 65.42 **68.93** 68.72 GAL-3 74.04 71.69 79.83 **80.54** GAL-4 59.17 58.66 **62.82** 61.93 GAL-5 79.94 74.48 **83.61** 82.83 GAL-6 69.04 69.76 74.63 **75.59** GAL-7 74.33 68.79 **68.67** 68.27 GAL-8 79.81 77.62 79.82 **80.42** GAL-9 64.04 63.48 72.24 **72.68** GAL-10 65.38 65.48 74.81 **75.61** GAL-11 63.21 62.52 **72.60** 72.07 GAL-12 74.10 72.42 **72.85** 72.36 AVG 69.78 68.25 73.63 73.89 *T*-test -- a vs. b c vs. a d vs. a *p*-value -- \**p* \<0.05 \**p* \<0.05 \**p* \<0.05 *The bold text is the best performance*. ###### Classification results of GAN/WGAN frameworks for the sampling rate reconstruction of the same sensitivity signals in the MI dataset. **Subjects** **Original data (a)** **Spline data (b)** **GAN up-sampling (c)** **WGAN up-sampling (d)** -------------- ----------------------- --------------------- ------------------------- -------------------------- MI-1 60.59 57.82 61.62 **62.81** MI-2 70.31 68.58 71.18 **73.35** MI-3 53.47 53.82 54.93 **56.81** MI-4 59.38 56.71 **61.83** 60.62 MI-5 72.22 70.49 73.88 **76.57** MI-6 67.36 65.73 68.72 **68.81** MI-7 56.25 55.41 **58.83** 57.61 MI-8 57.81 56.43 **58.81** 57.69 MI-9 60.42 58.67 **62.73** 61.85 AVG 61.98 60.41 63.61 64.01 *T*-test -- a vs. b c vs. a d vs. a *p*-value -- \*\**p* \<0.01 \*\**p* \<0.01 \*\**p* \<0.01 *The bold text is the best performance*. ###### Classification results for the sensitivity rate reconstruction of AO dataset by the different sensitivity signals\' GAN/WGAN frameworks. **Subjects** **Original data (a)** **GAL-WGAN (b)** **GAL-GAN (c)** **MI-WGAN (d)** **MI-GAN (e)** ------------------------------------------------------- ----------------------- ------------------ ----------------- ----------------- ---------------- **AO dataset reconstructed by the gal and mi models** AO-1 62.83 **64.81** 64.57 60.73 61.82 AO-2 53.12 55.82 **56.18** 53.27 52.63 AO-3 70.31 72.13 **73.18** 69.53 70.83 AO-4 75.26 73.44 **75.78** 67.71 69.53 AO-5 59.12 61.73 **62.16** 58.83 56.76 AO-6 74.22 76.56 **77.87** 76.82 75.26 AO-7 55.43 **57.61** 56.89 55.43 54.68 AO-8 58.27 **59.46** 58.83 56.27 56.29 AO-9 77.08 76.56 **77.34** 72.14 73.44 AO-10 68.49 72.66 70.57 **75.26** 71.09 AO-11 79.17 83.07 **83.85** 78.91 81.51 AO-12 **73.44** 71.62 72.57 70.57 66.93 AO-13 55.83 56.73 **56.94** 54.87 55.16 AO-14 61.82 62.73 **63.81** 60.57 60.81 AO-15 55.49 **56.81** 56.43 55.36 55.61 AO-16 62.42 63.55 **64.31** 61.28 61.37 AO-17 **64.58** 61.72 60.03 55.47 56.25 AO-18 53.28 53.89 **53.61** 52.13 52.28 AO-19 52.82 53.61 **54.18** 52.36 53.17 AO-20 63.83 **64.81** 63.76 62.67 62.89 AO-21 **68.72** 63.59 62.18 57.62 58.73 AO-22 57.55 59.11 59.55 60.42 **61.46** AO-23 61.83 62.81 **63.75** 62.19 61.68 AO-24 59.27 60.73 **60.81** 59.36 59.81 AVG 63.51 64.40 64.55 62.07 62.08 *T*-test -- b vs. a c vs. a d vs. a e vs. a *p*-value -- \**p* \<0.05 \**p* \<0.05 *p* = 0.0738 \**p* \<0.05 *The bold text is the best performance*. ###### Classification results for the sensitivity rate reconstruction of GAL dataset by the different sensitivity signals\' GAN/WGAN frameworks. **Subjects** **Original data (a)** **AO-WGAN (b)** **AO-GAN (c)** **MI-WGAN (d)** **MI-GAN (e)** ------------------------------------------------------- ----------------------- ----------------- ---------------- ----------------- ---------------- **GAL dataset reconstructed by the ao and mi models** GAL-1 69.23 **73.53** 72.76 72.56 70.19 GAL-2 **65.06** 63.21 62.88 61.86 61.03 GAL-3 **74.04** 59.74 66.03 61.99 58.59 GAL-4 59.17 59.74 **66.03** 61.99 58.59 GAL-5 79.94 76.28 **80.96** 76.15 77.18 GAL-6 69.04 **73.33** 72.56 73.21 76.35 GAL-7 **74.33** 69.77 66.25 64.82 66.91 GAL-8 79.81 78.53 74.17 **81.92** 79.49 GAL-9 64.04 65.58 65.58 64.30 **67.63** GAL-10 65.38 62.76 62.24 60.64 **67.50** GAL-11 63.21 85.13 85.00 **85.51** 85.38 GAL-12 74.10 **76.47** 72.76 69.94 73.72 AVG 69.78 70.34 **70.60** 69.57 70.21 *T*-test -- b vs. a c vs. a d vs. a e vs. a *p*-value -- *p* = 0.821 *p* = 0.731 *p* = 0.937 *p* = 0.870 *The bold text is the best performance*. ###### Classification results for the sensitivity rate reconstruction of MI dataset by the different sensitivity signals\' GAN/WGAN frameworks. **Subjects** **Original data (a)** **AO-WGAN (b)** **AO-GAN (c)** **GAL-WGAN (d)** **GAL-GAN (e)** ------------------------------------------------ ----------------------- ----------------- ---------------- ------------------ ----------------- **MI dataset reconstructed by the gal and ao** **GAN/wgan models** MI-1 60.59 61.63 59.90 58.33 **67.53** MI-2 70.31 71.70 69.10 **75.00** 73.26 MI-3 53.47 **58.16** 54.17 53.99 55.03 MI-4 59.38 **68.58** 68.58 64.41 66.67 MI-5 72.22 68.92 **76.22** 73.09 66.67 MI-6 67.36 **70.49** 70.49 69.62 68.75 MI-7 56.25 58.68 **73.44** 58.85 60.07 MI-8 57.81 54.34 54.51 **63.54** 56.60 MI-9 **60.42** 57.12 57.99 56.08 55.90 AVG 61.98 63.29 **64.93** 63.66 63.39 *T*-test -- b vs. a c vs. a d vs. a e vs. a *p*-value -- *p* = 0.380 *p* = 0.215 *p* = 0.175 *p* = 0.215 *The bold text is the best performance*. [Tables 4](#T4){ref-type="table"}--[6](#T6){ref-type="table"} illustrate the up-sampling classification results compared with the original data, the spline reconstructed data, the GAN reconstructed data, and the WGAN reconstructed data. Among the three datasets, we have found that the WGAN reconstructed data achieved the best classification performance. In the AO dataset, the WGAN reconstructed signals achieved the best classification accuracy (67.67%), which was higher than those of the original data (63.57%), the spline reconstructed data (60.91%), and the GAN reconstructed data (65.41%). In the GAL dataset, the WGAN reconstructed signals achieved the best classification accuracy (73.89%), which was higher than those of the original data (69.78%), the spline reconstructed data (68.25%), and the GAN reconstructed data (73.63%). In the MI dataset, the WGAN reconstructed signals achieved the best classification accuracy (64.01%), which was higher than those of the original data (61.98%), the spline reconstructed data (60.41%), and the GAN reconstructed data (63.61%). From the *t*-test statistical results that computed compared signals, the reconstructed GAN/WGAN model signals exhibited significant improvement of classification, producing a better performance than the original signals, while spline reconstructed signals exhibited significant reduction of classification performance, lower that of the original signals. The significant improvement and reduction are presented for all AO/GAL/MI datasets (^\*^*p* \<0.05). Specifically for the WGAN model in AO dataset and GAN/WGAN model in MI dataset, the classification performances presented were extremely significant (^\*\*^*p* \<0.01). Therefore, we have concluded that the GAN/WGAN models with proposed TSF-MSE loss function showed a significant improvement for reconstructing EEG signals with the same sensitivity. [Tables 7](#T7){ref-type="table"}--[9](#T9){ref-type="table"} give the classification results compared with the GAN/WGAN models trained with different sensitivities. [Table 7](#T7){ref-type="table"} gives the classification results of the AO data reconstructed by the GAL/MI trained GAN/WGAN models. [Table 8](#T8){ref-type="table"} gives the classification results of the GAL data reconstructed by the AO/MI trained GAN/WGAN models. [Table 9](#T9){ref-type="table"} gives the classification results of the MI data reconstructed by the AO/GAL trained GAN/WGAN models. For the AO dataset, signals reconstructed by the GAL-GAN model achieve the best average classification accuracy (64.55%), which was higher than those of the original data (63.51%) and the data reconstructed by the GAL-WGAN (64.40%), the MI-WGAN (62.07%), and the MI-GAN (62/08%). For the GAL dataset, signals reconstructed by the AO-GAN model achieve the best average classification accuracy (70.60%), which is higher than those of the original data (69.78%) and the data reconstructed by the AO-WGAN (70.34%), the MI-WGAN (69.57%), and the MI-GAN (70.21%). For the MI dataset, signals reconstructed by the AO-GAN model achieved the best average classification accuracy (64.93%), which was higher than those of the original data (61.98%) and the data reconstructed by the AO-WGAN (63.29%), the MI-WGAN (63.66%), and the MI-GAN (63.39%). The GAN model performed better than the WGAN model for reconstructing EEG signals by different sensitivities, and LSS-EEG signals reconstructed by HSS-EEG models will increase the sampling rate and sensitivity of signals, which will increase the classification performance. From the *t*-test statistical results that computed between compared signals, the AO dataset reconstructed signals by GAL-WGAN and GAL-GAN, showing significant improvement of classification performance than the original signals (\**p* \<0.05), while other datasets reconstructed signals showed no significant performance compared to the original signals(\**p* \> 0.05). In addition, AO dataset reconstructed signals by MI-GAN a classification performance that was significantly worse than the original signals (\**p* \<0.05). Therefore, we have concluded that the GAN/WGAN models with proposed TSF-MSE loss function showed significant performance improvement with enough data and no significant performance improvement without enough data for reconstructing EEG signals with the same sensitivity. Besides, if there is a large gap of sensitivity between two EEG signals datasets, the lower sensitivity based GAN model will cause significant worse performance of reconstructing high sensitivity signals to low sensitivity signals (such as MI-GAN applied to AO dataset). Since this study has proposed a novel loss function to build the GAN/WGAN architectures for reconstructions, we have also compared the mean classification accuracy between temporal-MSE based GAN/WGAN architectures and TSF-MSE based GAN/WGAN architectures. Due to the single spatial-MSE and frequency-MSE cannot reconstruct signals, these two losses were not included in the comparison. [Table 10](#T10){ref-type="table"} illustrates the comparison results for all reconstructions and datasets. We have also used a paired *t*-test statistical technique to detect whether the TSF-MSE based GAN/WGAN architectures significantly outperform than the temporal-MSE based GAN/WGAN architectures. In [Table 10](#T10){ref-type="table"}, *AO*−\>*AO* means AO dataset reconstructed by the same sensitivity AO dataset, *GAL*−\>*AO*/*MI*−\>*AO* represents AO dataset reconstructed by the different sensitivity GAL/MI datasets, and so forth. Experimental results have shown that no matter GAN architecture or WGAN architecture, TSF-MSE loss function outperformed the conventional temporal-MSE loss function (\**p* \<0.05). Therefore, the novel loss function proposed by us will significantly improve the performance of the reconstructed EEG signals. ###### The comparison results between Temporal-MSE and TSF-MSE of constructing GAN/WGAN architectures for reconstruction. **Reconstruction** **Temporal-GAN (a)** **TSF-GAN (b)** **Temporal-WGAN (c)** **TSF-WGAN (d)** -------------------- ---------------------- ----------------- ----------------------- ------------------ *AO*−\>*AO* 64.86 65.41 64.32 **67.67** *GAL*−\>*GAL* 71.43 **74.64** 72.68 73.89 *MI*−\>*MI* 62.43 63.61 63.83 **64.01** *GAL*−\>*AO* 64.16 **64.55** 63.85 64.40 *MI*−\>*AO* **62.31** 62.07 61.84 62.08 *AO*−\>*GAL* 68.84 **70.60** 68.73 70.34 *MI*−\>*GAL* 68.93 **70.21** 69.29 69.57 *AO*−\>*MI* 62.35 **64.93** 62.86 63.29 *GAL*−\>*MI* 62.19 63.39 62.28 **63.66** *T*-test -- b vs. a -- d vs. c *p*-value -- \*\**p* \<0.01 -- \**p* \<0.05 *The bold text is the best performance*. Classification of reconstructed signals between the "FBCSP+SVM" classifier and "FBCSPNet" classifier Schirrmeister et al. ([@B38]) are illustrated in [Table 11](#T11){ref-type="table"}. The results have shown average classification results of "FBCSP+SVM" and "FBCSPNet" for both GAN and WGAN models on three datasets. The improved ratios have shown that the GAN model and WGAN model bring 3.75 and 5.25% improvement on the average, respectively, to all three datasets for the "FBCSP+SVM" classifier. In addition, the GAN model and WGAN model bring 1.68 and 2.21% improvement on average, respectively, for all three datasets for "FBCSPNet" classifier. Therefore, we have concluded that EEG signals reconstructions by GAN/WGAN model are advantageous to the classification performance for different classifiers. If the classifier exhibits the a better performance, it has the ability to obtain more discriminant ERD patterns, so the improvement of the deep learning classifier is less than the conventional classifier. ###### The comparison average results of three datasets between FBCSP+SVM classifier and FBCSPNet classifier. **FBCSP+SVM** **FBCSPNet** ---------------- --------------- -------------- ------- ------- ------- ------- AO dataset 63.57 65.41 67.67 67.29 68.41 68.84 GAL dataset 69.78 73.63 73.89 73.61 74.82 75.23 MI dataset 61.98 63.61 64.01 65.47 66.64 66.86 Average 65.11 67.55 68.52 68.79 69.95 70.31 Improved Ratio -- 3.75% 5.25% -- 1.68% 2.21% In order to intuitively represent the differences between EEG signals reconstruction by the same sensitivities or different sensitivities of EEG signals, [Figure 11](#F11){ref-type="fig"} illustrates the average results of these comparisons. In [Figure 11](#F11){ref-type="fig"}, the [Figure 11A](#F11){ref-type="fig"} shows the average results of [Tables 4](#T4){ref-type="table"}--[6](#T6){ref-type="table"} and [Figure 11B](#F11){ref-type="fig"} shows the average results of [Tables 7](#T7){ref-type="table"}--[9](#T9){ref-type="table"}. From the average figures, the disciplines of EEG signals reconstruction by the GAN/WGAN models analyzed above can be found. {#F11} 4. Discussion {#s4} ============= 4.1. Reconstruction by Using GAN/WGAN Frameworks and TFS-MSE Loss ----------------------------------------------------------------- The purpose of this paper is to reconstruct HSS-EEG signals from LSS-EEG signals by using GAN/WGAN frameworks with a carefully designed loss function. In this paper, among the experiments of three different EEG datasets, we have compared the performance of GAN/WGAN frameworks for up-sampling with the same sensitivity and reconstruction with different sensitivities. The classification performances show significant improvement in terms of reconstructions of the same sensitivity. For AO dataset, the classification performances also show significant improvement by reconstructions of GAL-WGAN and GAL-GAN. However, other datasets reconstruction signals with different sensitivity have no significant improvement than original signals. There are two possible reasons for the statistical results. One possible reason is that the AO dataset has enough subsets (a total of 24) to compute the *t*-test index. However, datasets GAL and MI with 12 subsets and nine subsets, respectively, are not sufficient to compute the *t*-test index. Another possible reason may be due to the signal amplitude range for the GAN/WGAN reconstruction. In our experiments, the reconstructed signals amplitude range was set as the same as the original signals, and the amplitude range may have prevented the variations of reconstructed signals brought by the signals with different sensitivity. Therefore, in future works, more experiments for different ranges are also needed for a same dataset to confirm the relationship between signal amplitude range and patterns classification performance. For the average classification accuracy for all experiments, the up-sampled EEG signals performed better than the original data, and we think this might be due to the fact that the reconstruction procedure obtains more discriminant signals. In addition, the original temporal-MSE and the proposed TSF-MSE as loss functions were also compared. The up-sampling reconstruction with the same sensitivity results have demonstrated that using the WGAN helps to improve signal qualities and statistical properties. Comparing the reconstruction HSS-EEG signals and the original real HSS-EEG signals in [Figures 6](#F6){ref-type="fig"}, [8A](#F8){ref-type="fig"}, [9A](#F9){ref-type="fig"}, [10A](#F10){ref-type="fig"}, we can see that the WGAN framework helps to solve the problem of the over-smoothing effect suffered by the conventional temporal-MSE signal generators (Aydin et al., [@B6]). Although the reconstructed HSS-EEG signals shared a similar result, as in [Figures 6](#F6){ref-type="fig"}, [8A](#F8){ref-type="fig"}, [9A](#F9){ref-type="fig"}, and [10A,B](#F10){ref-type="fig"}, the quantitative analysis of classifying signals by a machine learning model, as given in [Tables 4](#T4){ref-type="table"}--[6](#T6){ref-type="table"}, [Figure 11A](#F11){ref-type="fig"}, have shown that the WGAN framework yields a higher classification accuracy and obtains more reliable statistical properties due to more discriminant patterns. However, if we use GAN/WGAN frameworks alone, the critical ERD/ERS of brain activity characteristics in the EEG signals will be reduced along with the single temporal loss. Theoretically, the GAN/WGAN frameworks are based on generative models, and such models generate naturally appearing HSS-EEG signals but cause severe distortion of the ERD/ERS characteristics in the EEG signals (Choi et al., [@B9]). Therefore, an additive loss function should be included to guarantee that the ERD/ERS characteristics remain the same for the reconstruction. Beyond the above analysis, the TSF-MSE loss function was introduced to guarantee the ERD/ERS characteristics during the training of the GAN/WGAN frameworks, and the classification performance of ERD/ERS characteristics can be found in the compared results in [Table 10](#T10){ref-type="table"}. As is well known, the temporal-MSE loss was the basis of the time-series data, and such loss will guarantee the reconstructed shape of the temporal domain. However, EEG signals are multi-channel time-series data, and the spatial domain is thus also important in the reconstruction. In addition, most ERD/ERS characteristics are reflected in the frequency domain, making the frequency domain also important in the reconstruction. Therefore, the TSF-MSE constructed by the original signals from the temporal domain, the FB-CSP features from the spatial domain, and the PSD features from the frequency domain have been introduced in this paper to guarantee the EEG signals temporal characteristics, spatial characteristics, and ERD/ERS characteristics (Strohmeier et al., [@B39]). Additionally, the TSF-MSE-based GAN/WGAN models cause lower losses than the temporal MSE, frequency MSE, and spatial MSE-based GAN/WGAN models (see [Figure 4](#F4){ref-type="fig"}). Our proposed TSF-MSE-based WGAN framework outperformed the other models in reconstructing up-sampled EEG signals with the same sensitivity. These results demonstrate that we can use this method to increase the sampling rate of EEG signals to achieve higher performance in brain-computer interfaces (BCIs) or EEG-based rehabilitation treatments. 4.2. EEG Signal Reconstruction With Different Sensitivities ----------------------------------------------------------- In this paper, in addition to reconstructing HSS-EEG signals from the same sensitivity, we also reconstructed HSS-EEG signals from different sensitivities. In fact, if EEG signals with low sensitivity can be reconstructed into high-sensitivity signals, the reconstructed HSS-EEG signals will contain more details of the ERD/ERS characteristics, which will improve the classification performance for many applications. Among the experimental results shown in [Tables 4](#T4){ref-type="table"}--[9](#T9){ref-type="table"}, we can conclude that the average classification accuracies of WGAN framework are higher than GAN framework for reconstruction with the same sensitivity on all datasets, while the GAN framework obtained better average classification accuracies for reconstruction with different sensitivities on all datasets. In addition, a larger gap in the sensitivity will significantly increase the average classification accuracies of all datasets, while a smaller gap in the sensitivity will result in a smaller difference in the average classification accuracies of all datasets (see the comparison results in [Tables 7](#T7){ref-type="table"}--[9](#T9){ref-type="table"}, [Figure 11B](#F11){ref-type="fig"}). We can also find indicators for different sensitivity gaps in [Figure 7](#F7){ref-type="fig"}. For example, considering the AO data reconstructed by the MI-GAN and MI-WGAN models (see [Figure 7B](#F7){ref-type="fig"}), a high-sensitivity signal reconstructed by the low-sensitivity GAN/WGAN models caused the signals to be overfitted and exceed the original data range. Hence, the reconstructed results contained fewer ERD/ERS characteristics to classify the EEG signals, and the classification accuracy was lower than the results using the original data. Conversely, for the MI data reconstructed by the AO-GAN and AO-WGAN models (see [Figure 7F](#F7){ref-type="fig"}), we can see that the low-sensitivity MI data reconstructed by the high sensitivity models presented more variations in the temporal domain. Because the variations in the time-series represented detailed characteristics of ERD/ERS, the reconstructed high sensitivity EEG signals performed better in the classification of ERD/ERS characteristics. Therefore, in practical applications, we can train a high-sensitivity GAN model for EEG signal reconstruction. By applying the GAN/WGAN models, the ERD/ERS characteristics extracted from low sensitivity devices can be enhanced for use in real-time and real-application BCI or rehabilitation treatment. In contrast to the results of reconstructing HSS-EEG signals with the same sensitivity, the GAN framework performed better than the WGAN framework for reconstructing HSS-EEG signals with different sensitivities. An approaching value range caused a smaller difference between the GAN framework and the WGAN framework (the AO dataset and the GAL dataset), but a separated value range caused a large difference between the GAN framework and the WGAN framework. Therefore, the difference in the classification performance was caused by the different value ranges of different sensitivities. We suggest two reasons for this difference: first, the WGAN framework contained a gradient penalty, and such a penalty would be out of the value ranges for different value ranges. The penalty then influenced the convergence of the WGAN framework (Mescheder et al., [@B29]), and, thus, the results of the WGAN framework were lower than the results of the GAN framework. Second, the WGAN framework used an RMSprop optimizer to train deep neural networks, but the GAN framework used an Adam optimizer (Basu et al., [@B7]). In fact, the Adam optimizer has a momentum gradient procedure, which will be fitted for regressing different value ranges. Hence, the different value ranges can be reconstructed by the Adam optimizer (Zou et al., [@B44]). In all of these, if we have recorded the highest sensitivity EEG signals, we must also record low-sensitivity EEG signals. We can use the highest sensitivity EEG signals to train a GAN/WGAN model to reconstruct the low sensitivity EEG signals, and the reconstructed EEG signals can be used to improve classification performance for the construction of real-time and real-application BCIs or rehabilitation treatment. 4.3. The Application of Reconstructed EEG Signals by GAN/WGAN Frameworks ------------------------------------------------------------------------ Over the past decade, most EEG-based studies have been focused on constructing BCIs or developing rehabilitation treatments (Ang et al., [@B4]). However, there are two main limitations to the application of EEG signals when constructing such systems, namely, the cost and portability of EEG recording devices. In fact, HSS-EEG signals will yield the best performance in BCIs and rehabilitation treatments, although HSS-EEG signals are usually recorded by expensive devices, posing an inconvenience. For example, in the "NeuroScan SymAmp2" device (Chu et al., [@B11]), the recording system consists of two computers and one device to link them together. One computer is used to present a stimulus for the BCI or rehabilitation treatment, and the other computer is used to record and store the EEG signals for computing the BCI or rehabilitation results. Subjects must sit in a room to wear a "NeuroScan Quik Cap" to collect data. The collection procedure is complex, and the resistance must be maintained under 5 kΩ by using conductive paste on each electrode (Agnew et al., [@B1]). Because the resistance is kept low and the device has a high sensitivity, the recorded EEG signals will have the ERD/ERS characteristics required for classification in BCI and rehabilitation treatment. In general, the "NeuroScan SymAmp2" device is expensive, and the EEG signals must be recorded indoors in a limited environment (e.g., a dimly lit, sound-attenuated room). Hence, it is difficult to implement the results of the "NeuroScan SymAmp2" device (the same sensitivity as signals in AO dataset) in applications such as BCI and rehabilitation treatment. Nevertheless, low-cost and portable devices, such as "Emotiv" (the same sensitivity as signals in MI dataset), have high electrode resistance and a low sampling rate and sensitivity for recording EEG signals. The device only provides poor ERD/ERS characteristics for classification in BCI and rehabilitation treatment applications. The "Emotiv" device can be worn at any time via a simple process without requiring the resistance to be kept level (Neale et al., [@B35]). The energy supply for the device is a battery, and the device uses WiFi or Bluetooth communication. These advantages allow the device to be inexpensive, portable, and convenient for constructing BCIs and developing rehabilitation treatment. These mutual contradictions for signal precision and signal cost and portability inspire us to train a model to reconstruct HSS-EEG signals from LSS-EEG signals. The trained model meets the requirements of high precision and portability with low cost and can be used to improve EEG-based applications. In fact, signal reconstruction is a difficult problem in digital signal processing, but an effective and feasible reconstruction method could significantly promote the application of signals. In this study, by using a GAN framework with Wasserstein distance and the carefully designed TSF-MSE loss function, well-trained reconstruction models have been shown to be able to reconstruct HSS-EEG signals from LSS-EEG signals. Experimental results reveal that LSS-EEG signals (just like those recorded by "Emotiv") reconstructed by the HSS-EEG signals (just like those recorded by "NeuroScan SymAmp2") trained models and enhanced the average classification accuracies of ERD/ERS characteristics for action observation, action execution, and motor imagery. These results inspire new ways to construct BCIs or develop novel rehabilitation treatments, but more researches need to be done to explore significant enhancement reconstruction methods across EEG signals with different sensitivities. Based on the method of this paper, the improvement of sampling rate and sensitivity will improve the specific ERD/ERS phenomenon of MI, AO, and AE, so as to improve the performance of the BCI system. Although the CNN- based GAN/WGAN architectures will take a significant amount of time to build an available GAN/WGAN architecture, once the reconstruction model is built, the use of such a model will not take long, and the reconstructed EEG time series can be obtained within a specific time (\<1 s for a trial). In future works, we can either reduce the complex of GAN architecture or improve the computational efficiency to reduce the usage time for reconstructing GAN/WGAN architecture. Then, the GAN/WGAN architectures will be used for real-time inference. In general, we used a low-cost, portable device to collect LSS-EEG signals for use in BCI or rehabilitation treatment. Before analyzing the collected data, the GAN/WGAN reconstruction models were applied to reconstruct HSS-EEG signals. The reconstructed HSS-EEG signals can significantly improve the classification performance and information transfer rate for use in BCIs or rehabilitation treatments. 5. Conclusion {#s5} ============= In this paper, we have proposed a contemporary deep neural network that uses a GAN/WGAN framework with a TSF-MSE-based loss function for LSS-EEG signal reconstruction. Instead of designing a complex GAN framework, this work has been dedicated to designing a precise loss function that guides the reconstruction process so that the reconstructed HSS-EEG signals are as close to the ground truth as possible. Our experimental results suggest that the GAN/WGAN frameworks give a significant improvement on the classification performance of EEG signals reconstruction with the same sensitivity, but the classification performance improvements of EEG signal reconstructions with different sensitivity were not significant, which further exploration. The carefully designed TSF-MSE-based loss function solves the well-known over-smoothing problem and seems to result in more discriminant patterns than the original EEG signals; this will improve the classification performance of EEG signals. The reconstructed HSS-EEG signals will be beneficial for use in BCI and rehabilitation treatment applications. Future studies will focus on the reconstruction signal amplitude ranges of EEG signals with different sensitivity and selection of datasets to confirm the required number of signals and to explore the significant performance improvement of EEG signal reconstruction with different sensitivity. In addition, the efficiency of EEG signal reconstruction by the GAN/WGAN frameworks will be studied further in the future. Data Availability Statement {#s6} =========================== The datasets generated for this study can be found in: 1. <https://pan.baidu.com/s/1NC4-ywOssfX2nUMaEeGlRw> please use the extract code "g8ip" in the dialog box to access the Datasets. 2. <https://www.kaggle.com/c/grasp-and-lift-eeg-detection> 3. BCI Competition IV "Dataset 2b": <http://www.bbci.de/competition/iv/#datasets>. Author Contributions {#s7} ==================== TL and YF designed the experiments. YF and LC completed the experiments. TL and GG analyzed the EEG data. CZ, LC, GG, and TL wrote the paper. Conflict of Interest {#s8} ==================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors want to thank the members of the digital Fujian internet-of-thing laboratory of environmental monitoring at the Fujian Normal University and the brain-like robotic research group of Xiamen University for their proofreading comments. The authors are very grateful to the reviewers for their constructive comments, which have helped significantly in revising this work. ^1^<https://pan.baidu.com/s/4gap5N4>. ^2^<https://www.kaggle.com/c/grasp-and-lift-eeg-detection/data>. ^3^<http://www.bbci.de/competition/iv/#datasets>. **Funding.** This work was supported by the National Natural Science Foundation of China under Grant (Nos. U1805263, 61672157, 61976053, and 61673322). The funding body played a role in supporting the experiments. EEG : electroencephalography HSS-EEG : high sampling rate and sensitivity EEG LSS-EEG : low sam-pling rate and sensitivity EEG DNNs : deep neural networks GAN : generative adversarial network WGAN : GAN with Wasserstein distance HR : high resolution LR : low resolution FBCSP : filter bank common spatial pattern PSD : power spectral density TSF-MSE : temporal-spatial-frequency mean square error AO : action observation GAL : grasp and lift MI : motor imagery ReLU : rectified linear unit BN : batch normalization SVM : support vector machine SVD : singular value decomposition ERD/ERS : event-related desynchronization/event-related synchronization. [^1]: Edited by: Gaute T. Einevoll, Norwegian University of Life Sciences, Norway [^2]: Reviewed by: Gautam Agarwal, University of California, Berkeley, United States; Alexander J. Stasik, University of Oslo, Norway [^3]: †These authors have contributed equally to this work | High | [
0.6631578947368421,
31.5,
16
]
|
From Bulbapedia, the community-driven Pokémon encyclopedia. SR redirects here. For the move commonly shortened to "SR", see Stealth Rock (move). Soft resetting (often shortened as SRing) is a feature found in the core series Pokémon games, as well as several other Pokémon games. It involves holding certain buttons on the game system at the same time, which causes the game to return to the startup screen. A "soft reset" contrasts to a "hard reset", which is restarting the game by rebooting the system itself. A soft reset can be performed at any time during gameplay, except while the game is saving. Purpose This practice is widely considered useful, as rebooting the game (whether by soft resetting or hard resetting) will affect the values generated by the pseudorandom number generator. Commonly, it is used to attempt to generate an in-game event Pokémon that is Shiny, or has particular IVs or Nature. Soft resetting is faster than hard resetting because only the game and not the system needs to reboot, so it's often used due to the already time-consuming nature of attempting to generate a Pokémon with these specific qualities. Soft resetting specifically for a Shiny Pokémon is often called Shiny resetting. Games This section is incomplete. Please feel free to edit this section to add missing information and complete it. Soft resetting exists in all core series Pokémon games prior to games released on the Nintendo Switch (Pokémon: Let's Go, Pikachu! and Let's Go, Eevee! and Pokémon Sword and Shield), likely due to the system being able to close software much faster. It also exists in the following other games: Additionally, all games released on Wii or Wii U have a reset function built into the system firmware. Likewise, all Virtual Console titles have a reset function accessible from the Virtual Console menu (in addition to any built-in soft reset methods they may already have). Button combinations GB/GBC/GBA games: Press and hold A, B, Start, and Select. XD: Gale of Darkness: Press and hold B, X, and Start. DS games: Press and hold L, R, Start, and Select. 3DS games: Press and hold L, R and Start or Select. Switch games: N/A. The fastest way to reset is to close the game from the Switch's Home Menu, then reopen it. | Mid | [
0.6538461538461531,
38.25,
20.25
]
|
Q: Adding a request.user in a ManyToMany field I am trying to add a request.user to a manytomany field to create an item. But I receive this error: TypeError at /api/v1/movies/ 'User' object is not iterable Models.py class Movie(models.Model): class Movie(models.Model): title = models.CharField(max_length=100) genre = models.CharField(max_length=100) year = models.IntegerField() created_at = models.DateTimeField(auto_now_add=True) updated_at = models.DateTimeField(auto_now=True) owners = models.ManyToManyField('auth.User', related_name='movies') views.py # Create a new movie def post(self, request): serializer = MovieSerializer(data=request.data) if serializer.is_valid(): serializer.save(owners=request.user) return Response(serializer.data, status=status.HTTP_201_CREATED) return Response(serializer.errors, status=status.HTTP_400_BAD_REQUEST) A: Per comment and updated question, the desired behavior is multiple users. Assuming that your MovieSerializer is a subclass of ModelSerializer and that you have used the default (PrimaryKeyRelatedField) binding for the owners serializer field, you should be able to add the requestor in the initial data: def post(self, request): serializer = MovieSerializer(data=dict(request.data, owners=[request.user.id])) if serializer.is_valid(): serializer.save() ... NOTE: since owners is a ManyToMany relation, you need to stick the user in an array, and for serialization this needs to be the pk of the user, not the object. | Mid | [
0.608142493638676,
29.875,
19.25
]
|
Texans Looking Like Franchise On The Brink Of Taking Next Step You know things are right when Texans coach Gary Kubiak finally wins a replay challenge. It just seemed Sunday the Texans could do little wrong and managed to get almost everything right during their 30-12 win over the Cleveland Browns at Reliant Stadium. The victory is tempered some by the struggling franchise the Texans overwhelmed, but we are still talking about a team building a winning reputation. As wins go, Sunday’s was significant. First, we wanted to see the Texans face an inferior opponent and treat them as such without any of those lulls they are prone to have. They did that. But even bigger, the Texans hit some milestones in their third consecutive win that gives strong indication the franchise has turned the corner and bigger things are ahead. The AFC South leaders are 6-3 and three games above .500 for the first time in franchise history. It stands to reason the franchises’ first division title and playoff berth are within reach now with a favorable season-ending schedule. “Winning in this league has to be short-lived,” said running back Arian Foster. “You have to keep pushing and keep focused on the goal at the end of the year and that’s the playoffs. That’s our initial goal. “Right now we are sitting where we want to be, first in the division and 6-3. But as everyone knows things can go downhill real fast in this league so we have to remain focused.” If Sunday’s performance is any indication, the Texans should have no problem attaining their goals. Save for a play here or there, they dominated the Browns in all facets. It’s hard to say which side of the ball had the impressive performance. The Texans defense just pummeled the offensively-Browns, holding an opponent to under 200 yards of total offense for the third consecutive game. The unit created turnovers that turned into points and nearly scored itself. It’s hard to imagine asking for much more. But then there was Texans offense, which is still without its best weapon in All-Pro Andre Johnson. They looked as lethal as it has at any other point this season with the running back duo of Ben Tate and Foster just flat wore down the Browns defense. For the second time in three games, both backs rushed for over 100 yards with Foster going for 124 yards and a score while Tate came off the bench to rush for 115 yards, one touchdown and a ridiculous 9.6 yards per carry on 12 rushing attempts. Talk about an advantage when you have two backs running the football the way the Foster and Tate are, taking away any pressure that may exist with Johnson missing his fifth straight game and counting due to a hamstring injury. About the biggest problem the Texans have right now is correctly predicting which back has the hot hand at the right time. “It’s fun to watch right now,” Texans coach Gary Kubiak said of his duo backfield. “It’s almost like a competition because they just go back and forth.” It makes you wonder just how much better the Texans will be once their best deep threat returns to the lineup maybe this upcoming week at Tampa Bay or possibly following the bye week. When you consider the way the defense continues to fly around and limit opposing offenses, it’s realistic to be believe the Texans will be one of the best teams in the AFC come December. But the Texans understand while outsiders can afford to look down the road, they have to remain focused what’s directly ahead. That happens to be Tampa Bay followed by a much needed bye week after that. “It feels great,” safety Glover Quin said of being 6-3. “It will feel even better if we go out and get the next one and be 7-3, so that’s our focus right now. “We’ll enjoy this win, it feels good to be 6-3 at this point in the season but we have to come right back against Tampa.” Here’s a link to the updated version of this great song. Share this with everyone you know and take it viral. all the way to the Superbowl!!! We need 70,000 fans singing this at the games. GOOOOO!! TEXANS!! | Mid | [
0.587378640776699,
30.25,
21.25
]
|
# -*- coding: utf8 -*- # This file is part of PYBOSSA. # # Copyright (C) 2015 Scifabric LTD. # # PYBOSSA is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # PYBOSSA is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # # You should have received a copy of the GNU Affero General Public License # along with PYBOSSA. If not, see <http://www.gnu.org/licenses/>. from pybossa.jobs import get_inactive_users_jobs, get_non_contributors_users_jobs from default import Test, with_context from factories import TaskRunFactory, UserFactory from pybossa.core import user_repo import datetime from dateutil.relativedelta import relativedelta import calendar # from mock import patch, MagicMock class TestEngageUsers(Test): @with_context def test_get_inactive_users_jobs_no_users(self): """Test JOB get without users returns empty list.""" jobs_generator = get_inactive_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should not be any job." assert len(jobs) == 0, msg @with_context def test_get_inactive_users_jobs_with_users(self): """Test JOB get with users returns empty list.""" TaskRunFactory.create() jobs_generator = get_inactive_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should not be any job." assert len(jobs) == 0, msg @with_context def test_get_inactive_users_returns_jobs(self): """Test JOB get inactive users returns a list of jobs.""" today = datetime.datetime.today() old_date = today + relativedelta(months=-1) date_str = old_date.strftime('%Y-%m-%dT%H:%M:%S.%f') # substract six months and take care of leap years one_year = today + relativedelta(months=-6, leapdays=1) one_year_str = one_year.strftime('%Y-%m-%dT%H:%M:%S.%f') user = UserFactory.create() user_recent = UserFactory.create() # 1 month old contribution tr = TaskRunFactory.create(finish_time=date_str) print(tr.user_id, tr.finish_time) # 1 year old contribution tr_year = TaskRunFactory.create(finish_time=one_year_str) print(tr_year.user_id, tr_year.finish_time) # User with a contribution from a long time ago tr2 = TaskRunFactory.create(finish_time="2010-08-08T18:23:45.714110", user=user) # User with a recent contribution tr3 = TaskRunFactory.create(user=user) print(tr2.user_id, tr2.finish_time) print(tr3.user_id, tr3.finish_time) user = user_repo.get(tr.user_id) jobs_generator = get_inactive_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should be one job." assert len(jobs) == 1, msg job = jobs[0] args = job['args'][0] assert job['queue'] == 'quaterly', job['queue'] assert len(args['recipients']) == 1 assert args['recipients'][0] == tr_year.user.email_addr, args['recipients'][0] assert "UNSUBSCRIBE" in args['body'] assert "Update" in args['html'] @with_context def test_get_inactive_users_returns_jobs_unsubscribed(self): """Test JOB get inactive users returns an empty list of jobs.""" tr = TaskRunFactory.create(finish_time="2010-07-07T17:23:45.714210") user = user_repo.get(tr.user_id) user.subscribed = False user_repo.update(user) jobs_generator = get_inactive_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should be zero jobs." assert len(jobs) == 0, msg class TestNonContributors(Test): @with_context def test_get_non_contrib_users_jobs_no_users(self): """Test JOB get without users returns empty list.""" jobs_generator = get_non_contributors_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should not be any job." assert len(jobs) == 0, msg @with_context def test_get_non_contrib_users_jobs_with_users(self): """Test JOB get with users returns empty list.""" TaskRunFactory.create() user = user_repo.get(1) jobs_generator = get_non_contributors_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should not be any job." assert len(jobs) == 1, msg job = jobs[0] args = job['args'][0] assert args['recipients'][0] == user.email_addr, args['recipients'][1] @with_context def test_get_non_contrib_users_returns_jobs(self): """Test JOB get non contrib users returns a list of jobs.""" TaskRunFactory.create() user = user_repo.get(1) jobs_generator = get_non_contributors_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should be one job." print(jobs) assert len(jobs) == 1, msg job = jobs[0] args = job['args'][0] assert job['queue'] == 'quaterly', job['queue'] assert len(args['recipients']) == 1 assert args['recipients'][0] == user.email_addr, args['recipients'][0] assert "UNSUBSCRIBE" in args['body'] assert "Update" in args['html'] @with_context def test_get_non_contrib_users_returns_unsubscribed_jobs(self): """Test JOB get non contrib users returns a list of jobs.""" TaskRunFactory.create() user = user_repo.get(1) user.subscribed = False user_repo.update(user) jobs_generator = get_non_contributors_users_jobs() jobs = [] for job in jobs_generator: jobs.append(job) msg = "There should be zero jobs." assert len(jobs) == 0, msg | Mid | [
0.5386138613861381,
34,
29.125
]
|
The New York Times recently reported that the sputtering economy and soaring food costs are forcing Americans to become thriftier at the table. Among other things, restaurant alcohol sales are down, and discount domestic beers are gaining at the expense of pricier imports. Wine went unmentioned, but strapped oenophiles are also scaling back. That is not such a hardship in major cities like New York, Los Angeles, and San Francisco, which are home to sophisticated wine boutiques carrying toothsome Bourgeuils, Brouillys, and other inexpensive elixirs. But does this QPR cornucopia (QPR stands for quality-price ratio and is an acronym often used by wine buffs to denote good value) extend to the suburbs and the sticks? What's the cheap stuff like out there? To find out, I visited a Total Wine & More outlet in Wilmington, Del., last month. Total claims to be the country's biggest independent wine retailer (meaning it's not part of some larger enterprise, like Costco), and given the chain's 52 locations in 10 states and its combined sales of more than 33 million bottles a year, I'm inclined to take their word for it. The Wilmington store was cavernous, with an enormous selection of discount wines. My self-assigned mission: to see whether there were any $15-and-under wines, domestic or imported, that I'd be willing to recommend. Advertisement Twenty-two bottles and $298.21 later, I can report that I discovered some good wines and had an unexpectedly edifying experience. Over the last decade, international demand for lower-priced French wines has fallen sharply, which helps explain why thousands of French vintners are now struggling to stay in business. The French are not being beaten on price. They are being beaten on taste, and I now understand more than ever why that's the case. The Total store was filled with exuberantly fruity cabernets, Syrahs, and sauvignon blancs from Australia, Chile, South Africa, and other countries. Many of them are not to my liking—I prefer leaner, drier, more mineral-driven wines—but it's easy to see why they are so appealing, particularly relative to what was on offer from France. There was no shortage of $15-and-under French wines, but the choices were uninspired. I liked the warm, spicy 2005 S.C.V. Castelmaure Corbières Col des Vents ($9.99), a red from a cooperative in the Languedoc, but the other French wines I tasted were decidedly limp. There was nothing interesting from the Loire, and the Beaujolais section appeared to be composed almost entirely of Georges Duboeuf bottlings. It is not that France doesn't produce good cheap wines; the Loire is a QPR nirvana. Ditto Beaujolais, the Languedoc, Mâcon, and the Rhône Valley. But the better ones are generally made in small quantities, and while they are readily available in New York and other big cities, they were not on the shelves in Wilmington. Conversely, I was struck by the depth of the Spanish section. I knew that Spain had become a popular source of budget wines; nonetheless, I was surprised by the size and quality of Total's Spanish inventory. There were a number of $15-and-under offerings, for instance, from estimable importer Eric Solomon, who has a vast Iberian portfolio. One of his wines, the 2006 Artazu Artazuri ($11.99), a Grenache from the Navarra region, was superb. It packed plenty of ripe, dark fruit, nicely offset by a subtle herbal kick and terrific acidity—all in all, an excellent red for the money. Another winner was the 2004 Cune Rioja Crianza ($13.99), a pleasantly juicy wine that hit all the right Rioja notes (cherries, plums, tobacco, a whiff of nuts). Having written several years ago about the dearth of good cheap wines from California, I expected the $15-and-under domestic selection to be grim, and, by and large, it was. I did, however, find a few exceptions—and surprising ones, too. The Gruet Brut nonvintage ($13.99) is—I kid you not—a quaffable sparkling wine from New Mexico, with an attractive, yeasty bouquet and a pleasantly creamy texture. It won't cause Olivier Krug any lost sleep, but it was a lot better than the comparably priced champagne that I tried, the anemic Francois Montand Blanc de Blancs nonvintage. The 2006 King Estate Signature Collection Pinot Gris ($13.99), from Oregon, also impressed me. It was a zesty, refreshing wine with good pear and citrus notes and a fine mineral edge; if you are looking for a summer white, this would be an excellent choice. California wasn't entirely shut out; I enjoyed the 2006 Cline Ancient Vines Zinfandel ($11.99). The bouquet, bursting with white pepper, put me in mind of a Châteauneuf-du-Pape, and while the wine was plenty ripe, it was neither jammy nor excessively alcoholic, two traits that have become sadly typical of zins. They have also become all too typical of Australian reds, and the ones I tried were no exception. I did, however, taste a decent Australian white, the 2006 d'Arenberg the Hermit Crab ($13.99). A blend of viognier and Marsanne, the Hermit Crab delivered a convincing head fake: The nose, bursting with tropical fruits, suggested something confected and plump, but the wine, though ripe, was pleasantly restrained, thanks in part to a subtle and much-appreciated mineral note. The store also had a formidable array of Italian wines. The 2007 Cusumano Nero d'Avola ($12.99), a Silician red marked by ripe cherries and a good whiff of tobacco, was an easy-sipping wine that would go well with pizza or pasta. Even better, though, was the 2006 Prunotto Dolcetto d'Alba ($14.99) from the Piedmont region, which had crisp, succulent cherry fruit, nice herbal and floral overtones, and excellent acidity. A group of Italians, including famed importer Marc de Grazia, teamed up in 1995 to create an Argentine winery called Altos las Hormigas. The 2006 Altos Las Hormigas ($8.49), made entirely of Malbec, Argentina's signature grape, served up gentle waves of blackberry fruit along with an appealing savory note; it went down very smoothly and is a particularly good value. In a very different vein, I really liked the 2007 Loosen Bros. Dr. L Riesling ($12.99) from Germany. The wine comes from the Mosel area, Germany's Riesling heartland, and has the classic Mosel profile: ripe peaches, a twist of lime, and subtle underlying acidity and minerality that parry the sweetness. It is a wine that begs to be served with Indian or Thai takeout. All in all, then, a reasonably successful trip to the corner liquor store. And if there's not a Total location in your neighborhood? Anywhere you look, you are going to struggle to find inexpensive domestic wines worth drinking—it's the cardinal sin of American winemaking, in my opinion. Generally speaking, the foreign shelves will have much more to offer. Of course, French, Italian, and Spanish wines can be confusing in ways that, say, California merlots and chardonnays are not. One usually surefire method of finding interesting foreign wines: Let the importer be your guide. The United States is blessed with a small army of superb importers, who bring in excellent wines at all price points. If any of the names on this list are on the label, you can be reasonably certain you've got yourself a good bottle. | Mid | [
0.631325301204819,
32.75,
19.125
]
|
Breitbart is not a news website. Nor is it a media outlet, and its staff are not ordinary journalists. Breitbart is a political project, with a specific political agenda, and staffed by willing propagandists. As Hope not Hate’s new report, Breitbart: A rightwing plot to shape Europe’s future shows, while ostensibly a rightwing news outlet like any other, Breitbart is in reality part of a transatlantic political movement with a common worldview and coordinated objectives. It doesn’t just report on events: it seeks to make them and (mis-)shape them. Indeed, Breitbart publishes falsehoods and peddles half-truths. Its unsubstantiated conclusions are drawn from its existing prejudices and published to advance its agenda; Breitbart is a click-hate echo chamber. It fits comfortably within a contemporary movement of people, political parties and philosophical currents that seemingly aim to undermine the current liberal democratic progressive consensus and the societal norms that are derived from it. While Breitbart regularly publishes content that is anti-feminist, homophobic and transphobic, central to its politics is a rejection of multiculturalism, manifest as opposition to immigration and liberal refugee policies. As shown by an analysis of the last 500 articles published on Breitbart London in our new report, one of the website’s main focuses is on migration, especially Muslim immigration into Europe. The heavy focus on the issue is probably derived from the outlook of former Breitbart executive chair Steve Bannon, who believes we are in the grip of a civilisational conflict between the west and the Muslim world. Whatever the driving force behind it, Breitbart’s “reporting” related to Islam and Muslims is often completely indistinguishable from the anti-Muslim “counter-jihad” movement’s rhetoric (a movement we recently profiled), or even that of the extreme far right. Take for example the Breitbart article, “Political Correctness Protects Muslim rape Culture”. Based on an unsubstantiated claim that there is indeed a “rape epidemic”, the piece states that “the epidemic is a byproduct of the influx into Europe of a million, mostly Muslim, migrants”, arguing that: “It’s just not politically correct to talk openly about Islam’s rape culture” and that “like honor killings, with massive Muslim immigration on the horizon, it could be coming to a town near you all too soon”. In stark contrast to the website’s regular downplaying of “the radical feminist ‘rape culture’ panic” – despite research suggesting that 23% of female undergraduate students in the US have reported experiencing sexual assault since enrolling in college – the portrayal of Muslims as not just culturally different but also a physical and sexual threat (a traditional tactic of the anti-immigrant far right) is commonplace on Breitbart. While it is a digital platform, it would be wrong to see Breitbart’s threat as merely online. In February 2014 it opened its first international section with the launch of Breitbart London. At the time of its launch, along with a new branch in Texas, Bannon made clear the motivation for the expansion across the Atlantic: “We look at London and Texas as two fronts in our current cultural and political war.” The establishment of a British branch was accelerated in order to support a “nascent European Tea Party” before the May 2015 elections. The offline soldiers in his “political war” here in the UK have been Ukip. “We effectively became the Ukip comms office,” one Breitbart employee told the Spectator following the 2015 general election. “Any criticism of the sainted Farage was completely banned,” said another. Plans have also been announced (though have yet failed to materialise) to expand the Breitbart brand to the continent, with editions planned in France and Germany. Both countries have elections soon. It has also emerged that there are plans to launch in Italy, too, with the country facing growing economic issues and the increased likelihood of elections this year. Despite these announcements, the chance of a French Breitbart opening in time for the elections is slim, though this has certainly not stopped its existing platforms providing plenty of coverage to the Front National. In the last year alone, Breitbart has published more than 200 articles with Le Pen in the title and many more where she and her party are mentioned. Last November, a tweet by Marion Maréchal-Le Pen – a prominent Front National official who is also a niece of Marine Le Pen – fuelled speculation about a link-up between Breitbart and the party. Maréchal-Le Pen said she had an accepted an invitation to work together with Bannon, who had described her as a “rising star” (Bannon later denied, via an aide, reaching out to her). Similar exposure has been given to Dutch far-right leader Geert Wilders – who is also a Breitbart columnist – predicted to poll well in next week’s Dutch elections; and the anti-Islam Alternative für Deutschland in Germany, while strong support was offered to Norbert Hofer, the far-right Freedom party candidate, during his failed bid to become Austrian president last year. Along with far-right and populist parties, Breitbart poses a threat to the liberal progressive consensus established after the second world war, and with it protections offered to vulnerable minorities, especially Muslims. | Low | [
0.515151515151515,
27.625,
26
]
|
Q: free memory when working with large matrices I am trying to use the following command: X = H \ [ Xp(:) Yp(:) ones(wp*hp,1) ]'; where Xp(:) & Yp(:) are large matrices and am running into an "out of memory" error.I cannot clear any of the data in the workspace since it is needed for the rest of the processing. *How can I divide this operation to blocks? *Is it a good approach? *What other options do I have? this is a memory output just before this command: Maximum possible array: 4005 MB (4.199e+09 bytes) * Memory available for all arrays: 4005 MB (4.199e+09 bytes) * Memory used by MATLAB: 1804 MB (1.891e+09 bytes) Physical Memory (RAM): 4018 MB (4.213e+09 bytes) A: It depends a little on where the out of memory is occurring (i.e. in creating [ Xp(:) Yp(:) ones(wp*hp,1) ] or in calculating X). The first thing I'd suggest is splitting the problem into separate operations along the lines of, mat = [ Xp(:) Yp(:) ones(wp*hp,1) ]'; X = nan(size(H,2),size(mat,2)); for idx = 1:size(mat,2) X(:,idx) = H\mat(:,idx); end which will require less memory. If the problem is in the size of mat then you can try %mat = [ Xp(:) Yp(:) ones(wp*hp,1) ]'; X = nan(size(H,2),numel(Xp)); for idx = 1:numel(Xp) X(:,idx) = H\[Xp(idx); Yp(idx); 1]; end | Mid | [
0.6318181818181811,
34.75,
20.25
]
|
American Guitar Academy The American Guitar Academy was founded in The United States in 1991. It opened its first international location in Tokyo, Japan in 2011. It claimed to be the only guitar school in Japan offering classes in multiple languages including Japanese, English, Spanish, French, Italian, and German. American Guitar Academy teaches all styles of acoustic and electric guitar from Jazz, Rock, Blues, Pop, Funk, Classical, Flamenco, Tango, Folk and R&B and more. General information As of October 2014 they opened their second branch in the Roppongi area. Currently they have 8 guitar teachers from 8 different countries. Their courses range from beginner to advanced level guitar classes in a private or group setting, guitar ensembles, a live performance workshop, and music theory, sight singing and ear training for part their International Music School Program. Their International School Music Program prepares students who want to go overseas to study music at the university level and their IMSP’s music theory and sight singing and ear training courses are open to all instruments, not just guitar. Michael Kaplan, the current director of The American Guitar Academy, has published a book of bebop guitar transcriptions released by Berklee Press and Hal Leonard. He has also worked with Dr. Mike Diliddo and Jamey Aebersold on a guitar comping book. The American Guitar Academy is currently in the process of working with Bill Edwards, the author of Fretboard Logic, as well as Truefire, one of the largest online video guitar lessons resources on the internet. They are consistently moving forward with new projects and look forward to continuing to change the landscape of guitar education in Japan. References Category:Schools in Tokyo | High | [
0.7034883720930231,
30.25,
12.75
]
|
--- layout: download-releases.hbs title: Versões Anteriores modules: "<code>NODE_MODULE_VERSION</code> Se refere ao número de versão de ABI (application binary interface) do Node.js, usado para determinar quais versões do Node.js que compilam binários de complemento do C++ que podem ser carregados sem precisarem ser re-compilados. Ele costumava ser armazenado como um valor hexadecimal em versões anteriores, mas agora é representado como um inteiro." --- ### io.js & Node.js As versões 1.x até 3.x foram chamadas de "io.js", pois faziam parte do fork do io.js. A partir do Node.js 4.0.0 as antigas linhas de lançamento do io.js convergiram com o Node.js 0.12.x para as versões unificadas do Node.js. <div class="highlight-box"> #### Procurando pelo último lançamento de uma versão? * [Node.js 10.x](https://nodejs.org/dist/latest-v10.x/) * [Node.js 8.x](https://nodejs.org/dist/latest-v8.x/) * [Node.js 6.x](https://nodejs.org/dist/latest-v6.x/) * [Node.js 4.x](https://nodejs.org/dist/latest-v4.x/) * [Node.js 0.12.x](https://nodejs.org/dist/latest-v0.12.x/) * [Node.js 0.10.x](https://nodejs.org/dist/latest-v0.10.x/) * [Todas versões](https://nodejs.org/dist/) </div> | Mid | [
0.593123209169054,
25.875,
17.75
]
|
11 февраля на брифинге Минобороны РФ генерал-майор Игорь Конашенков заявил следующее (важные моменты выделены мной): Поскольку Игоря Конашенкова неоднократно ловили на лжи, можно было бы ограничиться цитатой спикера МИД РФ Марии Захаровой: Однако я все-таки решил поподробнее изучить это заявление российского Минобороны, и вот что получилось: Расшифровка брифинга спикера антиигиловской коалиции полковника Уоррена от 10 февраля, на который ссылается Минобороны, доступна здесь. Приведу отрывок, где Уоррен говорит о бомбардировках больниц в Алеппо: With the destruction of the two main hospitals in Aleppo by Russian and regime attacks, over 50 thousand Syrians are now without any access to live-saving assistance. Humanitarian organizations are responding, but ongoing military operations by Russia and the Syrian regime, as well as pro-regime forces are making access to populations in need increasingly difficult. | Mid | [
0.64,
22,
12.375
]
|
Vascular lesions of the breast. Vascular lesions of the breast comprise a heterogeneous group that includes a variety of benign, atypical, and malignant lesions. The presentation of these lesions ranges from those that are microscopic and discovered incidentally, to large tumors that may extensively involve the breast parenchyma and skin. In addition, some non-vascular breast lesions have features that may mimic those of vascular lesions and need to be distinguished from them in order to avoid an erroneous diagnosis. In this review, we discuss the spectrum of vascular lesions of the breast with particular emphasis on those lesions of greatest clinical importance, angiosarcoma and atypical vascular lesions. We also discuss lesions that may be mistaken for vascular lesions. | High | [
0.673076923076923,
35,
17
]
|
Direct and indirect evidences of BDNF and NGF as key modulators in depression: role of antidepressants treatment. Depression is one of the most prevalent, recurrent and life-threatening mental illnesses. However, the precise mechanism underlying the disorder is not yet clearly understood. It is therefore, essential to identify the novel biomarkers which may help in the development of effective treatment. In this milieu, the profile of the brain-derived neurotrophic factor (BDNF) and nerve growth factor (NGF) were considered as biomarkers in the light of pathophysiology of depression and its treatment. Previously, we have reported that BDNF level in the postmortem brain of suicide victims was significantly lower than those of normal controls. We also found decreased BDNF levels in the specific brain regions of the learned helplessness model of depression in rat, and was found to increase normal level following chronic fluoxetine hydrochloride treatment. NGF is another important member of neurotrophin, which is dysregulated in the pathophysiology of depression in some models of peripheral nerve damage and stress. The results shown evidences of the effect of antidepressants on modulating depression via the NGF in preclinical and clinical models of depression, but conflicted, therefore make it currently difficult to affirm the therapeutic role of antidepressants. Here, we review some of the preclinical and clinical studies aimed at disclosing the role of BDNF and NGF mediated pathophysiological mechanisms of depression and the new therapeutic approaches targeting those key molecules. In addition, an important link between BDNF, NGF and depression has been discussed in the light of current existing knowledge. | High | [
0.6799007444168731,
34.25,
16.125
]
|
Valiant Integrated Services - Herndon, VA3.4 Directs preparation of directives to program managers outlining policy, program, or operations changes to be implemented.... Estimated: $120,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Lily Transportation - Altoona, PA3 Lily Transportation is a privately held premium logistics services company that provides Dedicated Contract Carriage Systems; due to additional growth we are... Estimated: $58,000 - $77,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. DBi Services - Vienna, VA From this sales plan, the general manager and division and branch managers will develop equipment needs and personnel needs budget.... Estimated: $80,000 - $110,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Deputy - Atlanta, GA WHY JOIN DEPUTY? Be one of our first hires in the US in a high growth SaaS startup and fast-track your career development! We've raised $25M Series A round... Estimated: $140,000 - $180,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. PepsiCo - Nashville, TN3.9 Build advisory relationship with Dollar General merchandising/ insights team. This role will support the Dollar General Frito-Lay insights agenda across the... Estimated: $110,000 - $150,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Submits hiring recommendations to General Manager for approval. The Assistant General Manager (AGM) functions in conjunction with and in the short-term absence... Estimated: $130,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Manages through managers and is accountable for the contract. Sodexo is currently seeking an experienced General Manager in food services to join our team at... Estimated: $100,000 - $140,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Compass Group - Manassas, VA3.4 The General Manager, reporting directly to the Regional Vice President, holds duties related to day to day operations of a Company account.... Estimated: $62,000 - $80,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Pragmatics - Reston, VA3.7 Is seeking a Vice President and General Manager for Defense & Intelligence to support a growing and profitable business segment.... Estimated: $120,000 - $160,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Vulcan Materials Company - Herndon, VA3.8 At least 5 years recent experience in general management with P&L responsibility. Establish performance goals and objectives for the area and various functions... Estimated: $110,000 - $150,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Evercommerce - Atlanta, GA The General Manager will be accountable for driving revenue and managing expenses to achieve portfolio P&L targets.... Estimated: $120,000 - $160,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. As a General Manager, you’ll be responsible for the growth and success of Bird in your cities. Bird is a last-mile electric vehicle sharing company dedicated to... Estimated: $120,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. TxV Aero Composites - Bristol, RI TxV Aerospace Composites LLC is currently seeking a General Manager to lead, manage and optimize the overall operations of our manufacturing facility and team... Estimated: $130,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Sodexo - Fairfax, VA3.8 The successful candidate will serve as the General Manager for the Building Services department, overseeing the day-to-day operations and ensuring relaxing,... Estimated: $120,000 - $150,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. NRG Energy - Phoenix, AZ3.9 Build positive image within the community among customers, politicians, developers and plant managers. The General Manager is responsible for the Energy Center... Estimated: $120,000 - $160,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Traverse City - Traverse City, MI4 We are currently looking for a General Manager to oversee franchise operations. The above information on this job description has been described to indicate the... Estimated: $78,000 - $100,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. The General Manager reports directly to the Regional General Manager. The General Manager directly supervises the facility Commercial Operations team, Plant... Estimated: $100,000 - $130,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. We are seeking a General Manager who will be responsible for the club/lounge operation; Sodexo Aviation is seeking an experienced Club/Lounge General Manager... Estimated: $76,000 - $100,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. The General Manager will promote a positive team environment to better serve our customers. The General Manager oversees all aspects of the Fixed Base Operation... Estimated: $66,000 - $87,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Salix Pharmaceuticals, Inc. - Remote Overview This position will provide leadership and direction for US and Canadian Solta Medical business and will be responsible for driving the short and long... Estimated: $120,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Bausch Health - Remote3.7 Overview This position will provide leadership and direction for US and Canadian Solta Medical business and will be responsible for driving the short and long... Estimated: $130,000 - $170,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Valeant - Remote3.4 Overview This position will provide leadership and direction for US and Canadian Solta Medical business and will be responsible for driving the short and long... Estimated: $120,000 - $160,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. TravelCenters of America - Willcox, AZ3.3 We are looking for a Manager for a fast food restaurant near you! Coach and develop restaurant employees to build a strong team that can work together to... Estimated: $50,000 - $67,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. goPuff - Greensboro, NC GoPuff is seeking a rockstar, self-starting and entrepreneurial individual to lead the Greensboro, NC territory as General Manager.... Estimated: $49,000 - $64,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. Opendoor - Tucson, AZ The General Manager. The General Manager—Tucson will have ultimate responsibility for our success in Tucson.... Estimated: $110,000 - $150,000 a year Please note that all salary figures are approximations based upon third party submissions to SimplyHired or its affiliates. These figures are given to the SimplyHired users for the purpose of generalized comparison only. Minimum wage may differ by jurisdiction and you should consult the employer for actual salary figures. | Low | [
0.512658227848101,
30.375,
28.875
]
|
Q: Example for $c(fg)\neq c(f)c(g)$ Let $R$ be a ring and let $f(X)$ be a nonzero polynomial in $R[X]$. The content of $f$ is the ideal $c(f)$ generated by the coefficients of f. The ring is called Gaussian if $c(fg)=c(f)c(g)$ for all $f,g \in R[X]$. Do you know an example where $c(fg)\neq c(f)c(g)$? Thanks a lot. A: Take $R=\mathbb{F}_2[x,y]$. In order to see why $R[X]$ is not Gaussian, take $f(X)=g(X)=x+yX$. Then $fg=f^2=x^2+y^2X^2$ and therefore $$c(fg)=c(f^2)=\langle x^2,y^2\rangle.$$ On the other hand $$c(f)c(g)=c(f)^2=\langle x^2,y^2,xy\rangle.$$ | High | [
0.677707006369426,
33.25,
15.8125
]
|
Q: Javascript function challenge add(1,2) and add(1)(2) both should return 3 A friend of mine challenged me to write a function that works with both of these scenarios add(2,4) // 6 add(2)(4) // 6 My instinct was the write an add() function that returns itself but I'm not sure I'm heading in the right direction. This failed. function add(num1, num2){ if (num1 && num2){ return num1 + num2; } else { return this; } } alert(add(1)(2)); So I started reading up on functions that return other functions or return themselves. http://davidwalsh.name/javascript-functions JavaScript: self-calling function returns a closure. What is it for? JavaScript: self-calling function returns a closure. What is it for? I am going to keep trying, but if someone out there has a slick solution, I'd love to see it! A: I wrote a function that generates a chain whose valueOf function and context (the this) is continually updated with the new sum, no matter how many arguments are passed each time. /* add function */
function add() {
"use strict";
var args, sum, chain;
args = Array.prototype.slice.call(arguments);
sum = typeof this === 'number' ? this : 0;
sum += args.reduce(function (p, n) { return p + n; }, 0);
chain = add.bind(sum);
chain.valueOf = function () {
return sum;
};
return chain;
}
/* tests */
console.log('add(1, 2) = ' + add(1, 2));
console.log('add(1)(2) = ' + add(1)(2));
/* even cooler stuff */
console.log('add(1, 2)(3) = ' + add(1, 2)(3));
console.log('add(1, 2, 3)(4, 5)(6) = ' + add(1, 2, 3)(4, 5)(6));
/* retains expected state */
var add7 = add(7);
console.log('var add7 = add(7)');
console.log('add7(3) = ' + add7(3));
console.log('add7(8) = ' + add7(8)); The reason why both mechanisms are required is because the next call in the chain cannot access the binded function's custom valueOf, and any script attempting to evaluate the function as a number cannot access its context. The only downside is the requirement of strict mode in order for this to remain a primitive. Here's an edit to support both strict mode and non-strict mode: function add() { var args, sum, chain; args = Array.prototype.slice.call(arguments); // Number object from non-strict mode if (this instanceof Number) { sum = Number(this); // number primitive from strict mode } else if (typeof this === 'number') { sum = this; // initial call to add } else { sum = 0; } sum += args.reduce(function (p, n) { return p + n; }, 0); chain = add.bind(sum); chain.valueOf = function () { return sum; }; return chain; } A: There is an article on Dr.Dobs Journal about "Currying and Partial Functions in JavaScript" which describes exactly this problem. One solution found in this article is: // a curried add // accepts partial list of arguments function add(x, y) { if (typeof y === "undefined") { // partial return function (y) { return x + y; }; } // full application return x + y; } | Mid | [
0.5839080459770111,
31.75,
22.625
]
|
Advertisement Racket for Linux 5.3.2 OS Support: Publisher Update: Download: Description Grow your Program Racket's interactive mode encourages experimentation, and quick scripts easily compose into larger systems. Small scripts and large systems both benefit from native-code JIT compilation. When a system gets too big to keep in your head, you can add static types. Grow your Language Extend Racket whenever you need to. Mold it to better suit your tasks without sacrificing interoperability with existing libraries and without having to modify the tool chain. When less is more, you can remove parts of a language or start over and build a new one. Grow your Skills Whether you're just starting out, want to know more about programming language applications or models, looking to expand your horizons, or ready to dive into research, Racket can help you become a better programmer and system builder. | Mid | [
0.598669623059866,
33.75,
22.625
]
|
Q: Initializing React number input control with blank value? I'd like my controlled input to initialize with no value in the box. The input is a number, so I don't pass in an empty ''. Using defaultProps, I initialize the input with a null. When typing into the input the console reports this message: <MyInput> is changing an uncontrolled input of type number to be controlled. Input elements should not switch from uncontrolled to controlled (or vice versa). To prevent this normally I initialize with an empty string to prevent this "switching" from happening. But with a number (I don't want to show a 0, I want nothing to show) I am not sure how to do it. static defaultProps = { estimatedHours: null, estimatedMinutes: null, } defalut values ^^ <input type="number" onChange={(e) => this.handleChange('Hours', e.target.value)} onKeyDown={this.handleKeyDown} onPaste={this.handlePaste} value={estimatedHours} placeholder={hoursText} className="slds-input th-trailmix-textbox th-time-component__input" /> A: Uncontrolled inputs are simply inputs where you aren't tying value to JavaScript. So if you are rendering: <input value={any} /> That is a controlled input. If you want to render an uncontrolled input with an empty value you could simply write <input type="number" /> or <input type="number" placeholder="" /> or <input type="number" placeholder="please enter a number..." /> Next, if you want to pull the value use a ref. state = { query: '' } handleSubmit = (e) => { e.preventDefault() this.setState({ query: this.search.value }) } render() { return ( <form> <input type="number" ref={input => this.search = input} placeholder="" /> <button type="submit" onClick={this.handleSubmit}>Submit</button> </form> ) } Additionally, you can still perform logic on the return value if you need to. ie: handleSubmit = (e) => { e.preventDefault() this.setState({ query: this.search.value.toExponential(2) }) // square whatever the user inputs and store in this.state.query } | Mid | [
0.6161137440758291,
32.5,
20.25
]
|
Q: Associating user data with session key I have created a session in django1.10 for a user.I want to know how all data generated by my code can be associated with session_key.All these data are stored in mysql tables.So that when many users login simultaneously all data will be associated with the respective users. A: Have a user column in all your tables.when the user logs in store a unique value in the session(can be user ID or email). request.session['USER_ID'] = userId(or email) Now,this id will be there in the request and can be accesses through out your project. When adding a record along with all the data add the userId to the table for the user column.you can access it in your views as request.session.get('USER_ID').Just add this id to all your queries. | Mid | [
0.6554216867469881,
34,
17.875
]
|
Tiffany Diamond Lawsuit Showcases an Unattractive Stock Tiffany (NYSE: TIF) has accused Costco (NASDAQ: COST) of selling counterfeit Tiffany diamonds. It sounds rather shocking, but this isn't the first time either company has run up against the issue of counterfeit merchandise. However, the story also gives plenty of reasons to avoid Tiffany shares right now. Tiffany chose a cute day to file its lawsuit (happy Valentine's Day, Costco), making heavy allegations about knock-off Tiffany engagement rings showing up under the fluorescent lights and warehouse ambience of Costco stores. Tiffany ponied up for one of the rings, and upon examination, found that the rock didn't include the luxury jeweler's microscopic brand it uses to identify its own diamonds, nor did the platinum band include the Tiffany trademark. Although Costco discontinued the rings when Tiffany complained in December, Tiffany has still decided to go forward with the lawsuit, claiming the practice had gone on for many years. It's seeking $2 million in damages, as well as information including the number of fake Tiffany rings the retailer had sold and who supplied them so it can demand triple the profit Costco made on the fakes. There are plenty of reasons for Tiffany to get sensitive right now, and investors should be paying attention to more than where the Tiffany brand may be showing up. The high-end jeweler's all-important holiday quarter recently fell short. That's not Costco's fault, but it should get Tiffany watchers worried. In January, American Express' decision to lay off 5,400 workers implied a chilly prognostication that affects all luxury brands: higher-income consumers have been cutting back. In even more difficult news, Tiffany said in its most recent 10-K that the engagement segment is "particularly and increasingly intense," and its edge is to convey quality. For some, that makes Tiffany look better than companies like Blue Nile (NASDAQ: NILE) , which is a more affordable option for engagement rings. Although Blue Nile also disappointed Wall Street's quarterly expectations in its most recent quarter, its engagement ring sales increased 31%. Maybe some engagement ring shoppers are trading down. As far as Costco's concerned, it's got a reputation for selling high-end merchandise to eager bargain hunters for a relative steal. Other companies have accused Costco of similar violations. Crocs showed up in Costco stores without Crocs' knowledge in 2008, Calvin Klein accused the retailer of stocking fakes, and some companies have cried copyright infringement, too. Tiffany rabidly defends its brand as a matter of course, since that is one of its key differentiators to begin with. The company went after eBay in 2004 to try to convince the online auctioneer to get a handle on counterfeit Tiffany merchandise that showed up on the site. Interestingly, Tiffany actually lost the suit when the court put the onus on the manufacturer to keep an eye out for counterfeits on the market. The precedent in the eBay case, and the fact that Costco has never been materially hurt in similar skirmishes over the years, tells me that Tiffany is barking up the wrong tree -- and that Tiffany investors are, too. The consumer spending environment is nasty, and that overall climate bodes far better for Costco than for Tiffany. Last but not least, when corporations file lawsuits it can be a sign of overall weakness. Regardless of what goes down with Costco, Tiffany shares simply don't have much allure right now. With share prices near all-time highs, is the ride over for Costco investors? To answer that and more, we've compiled a premium research report with in-depth analysis on Costco. Simply click here now to gain instant access to this valuable investor's resource. Alyce Lomax has no position in any stocks mentioned. The Motley Fool recommends American Express, Blue Nile, Costco Wholesale, and eBay. The Motley Fool owns shares of Costco Wholesale, Crocs, and eBay. Try any of our Foolish newsletter services free for 30 days. We Fools may not all hold the same opinions, but we all believe that considering a diverse range of insights makes us better investors. The Motley Fool has a disclosure policy. Comments from our Foolish Readers Help us keep this a respectfully Foolish area! This is a place for our readers to discuss, debate, and learn more about the Foolish investing topic you read about above. Help us keep it clean and safe. If you believe a comment is abusive or otherwise violates our Fool's Rules, please report it via the Report this Comment icon found on every comment. I must admit to being puzzled. Ms Lomax is forever ready to wag a finger at fast food joints' not taking sustainability into account on a fish sandwich, talking darkly about "vice industries", and about "evil" chemical firms (that happened to have improved our lives in many a way) etc, etc ETC. But here, one of her favorite companies is caught red-handed in peddling fraudulent goods-apparently not for the first time-and she blithely calls the exposure "cute timing" and a "rabid" defense of their turf by Tiffany. I believe that's actually called defending a hard-won reputation for quality earned over a century and a half. She points out Costco stopped selling the ersatz Tiffany diamonds when the whistle blew in December. How nice of them! She then yawns that Costco (no mention of the seeming validity of previous charges brought by companies of good repute) "hasn't been materially hurt by similar such skirmishes". Not a hint of the moral judgement, she brings to previous barbs at various companies. Then, allow me. This is, if, as it seems, the goods were demonstrably misrepresented as being Tiffany a clear-cut breach of business ethics. Period. It matters not, the successful business model Costco brings to market. Their customer base was exposed to mis-represented, and possibly shoddy goods. Wow, maybe Alyce might even discover that bird labeled turkey in the poultry case at the super store is really condor <g> Thanks for bringing up a rebuttal to my response to this news. It's a valid one. I didn't specifically mention in the article that I don't believe Costco management would do things like this on purpose, and if a lawsuit brought to light that it does, then that would be a different story. However, the eBay vs. Tiffany judgment is an important aspect to this and seems to be a significant precedent. Unfortunately I think in a lot of cases there is still a "buyer beware" factor to remember. However, it's also legitimate to say that if something like this happens too often at Costco, they will lose brand respect and trust in their merchandise, so I should hope they do their best NOT to allow things like this to happen too frequently. | Low | [
0.44672131147540906,
27.25,
33.75
]
|
The Kansas City Chiefs announced on Wednesday that the club has added OL Jermail Porter to the club's practice squad. Porter originally entered the NFL as a rookie free agent with New England in 2009. An All-America wrestler at Kent State, he posted | Mid | [
0.6019801980198021,
38,
25.125
]
|
Increased serum heme oxygenase-1 levels as a diagnostic marker of oxidative stress in preeclampsia. To evaluate the utility of serum biomarkers in the diagnosis of preeclampsia (PE) and also investigate possible correlation with pathogenesis of PE. Maternal serum concentrations of heme oxygenase-1 (HO1) and N-myc downstream-regulated gene 1 (NDRG1) were measured at 27-34 weeks of gestation in a case-control study of 33 pregnant women diagnosed with PE and in 43 normotensive pregnant women without proteinuria. The Mann-Whitney U test and Spearman's correlation were used for statistical analysis. The median serum HO1 level was found to be significantly higher in the PE group [76.7 ng/ml (23.4-445.7)] than control group [55.9 ng/ml (3.7-354.3)] (p = 0.006). Positive correlation was found between HO1 levels with presence of PE (r = 0.316, p = 0.005). There was no significant difference in NDRG1 values between the two groups (p = 0.226). Serum HO1 levels were found to be increased in patients with PE compared with normotensive pregnant women. | High | [
0.6666666666666661,
32.5,
16.25
]
|
Q: Can vorticity be destroyed? I have a professor that is fond of saying that vorticity cannot be destroyed. I see how this is true for inviscid flows, but is this also true for viscous flow? The vorticity equation is shown below for reference. From this equation, it looks as if vorticity only convects and diffuses. This would suggest that it can't be destroyed. $$\frac{D\boldsymbol{\omega}}{Dt} = (\boldsymbol{\omega}\cdot\nabla)\boldsymbol{V} + \nu\nabla^2\boldsymbol{\omega}$$ However, consider this thought experiment: Suppose we have a closed container filled with water with initial vorticity field $\boldsymbol{\omega}_0$ at time $t_0$. If the container is allowed to sit undisturbed, as $t\to\infty$ the water will become stationary ($\boldsymbol{V}\to 0$) with zero vorticity ($\boldsymbol{\omega}\to 0$). This suggests vorticity can be destroyed. My professor claims the boundary-layer vorticity at the sides of the container is equal and opposite in sign to the bulk vorticity. If this is the case, the vorticity cancels out after a long time resulting in the stationary fluid and vorticity is not destroy (just cancelled out). EDIT: I'm looking for either a proof that the boundary-layer vorticity is equal and opposite to the bulk vorticity or a counter-explanation or proof. (I'm using proof in a very loose hand-wavy sense) A: Your professor is correct, but I agree with you that the statement “vorticity can’t be destroyed or created” seems jarring - I would prefer to think of this as “vorticity is conserved” because the conservation of vorticity derives from the Navier-Stokes Eq and the conservation of angular momentum. I confess this is splitting terminology hairs (don’t push it with your professor) but I think it helped me. So, I think, maybe I can understand this as an analogy with linear momentum, because linear momentum is conserved too. I remember the problem of a car of mass m, traveling toward the right at velocity v, and on the same road an identical car traveling to the left at velocity –v. They collide head-on and smash and stick together. Velocities after the crash – zero. Momentum after the crash – zero and of course, momentum is conserved. The total momentum of the system was zero before and after. Let say your container filled with water is a long annulus with thick steel walls. The flow is initially a circular flow around the axis (i.e. 2D flow.) What is initial total angular momentum of the system? Eventually the fluid stops moving, so the final total angular momentum of the system must be zero. How do we show that the initial angular momentum is zero too? At this point you need to recognize that the vorticity vector in the moving fluid is everywhere parallel to the axis of the container. And you need to use Stokes’ theorem to write an integral equation with a line integral on the LHS (the circulation) and a surface integral on the RHS (vorticity integrated over the container cross section. ) \begin{align*} \oint_{C} v \cdot dl = \int_{S} w \cdot dS\ \end{align*} Take your integration path (the closed path C) entirely inside the steel wall of your container. The velocity inside the container wall is always zero, and so the circulation along the path is always zero, and so the total vorticity across the cross-sectional area (the area S) of the container and fluid is always zero too. You can calculate for yourself that the boundary layer vorticity is equal and opposite to the bulk viscosity using a similar approach. Imagine spinning the container about its axis at a constant angular velocity. Eventually the entire viscous-fluid and container system will be rotating like a rigid body around the axis. Every point has the same angular velocity, and there is now a vortex located at the center. Compute the circulation for any closed path that includes the vortex inside it – this will be the strength of the vortex, and the magnitude and sign of vorticity in the bulk fluid. You can show yourself that the strength of this vortex is the total vorticity. Compute the circulation around any path that does not include the vortex, this will always come out to be zero. Pick a path near the fluid-container boundary, s’, so half of it is in fluid and half is inside the container wall, as long as the container and fluid are still rotating together the circulation around this path will be zero too. Now stop the container’s rotation. The fluid continues to move. Compute the circulation around the path s’ again, it is no longer zero and is the vorticity at the boundary layer. It’s sign is opposite that of the vortex at the center. Every point along the fluid-boundary can be associated with path like s’ and a small amount of boundary layer vorticity. Integrate around the entire boundary and the sum will be equal in magnitude and opposite in sign to the strength of the vortex at the center. Eventually, boundary layer vorticity will diffuse towards the center and annihilate the center vortex. @Isopycnal_Oscillation is correct to point out that in 3D, and particularly near turbulent conditions, vorticity is not conserved. The second term on the RHS of your ‘transport equation’ says that the stretching and tilting of vortex tubes can change vorticity too. However, I expect that in the classes where your professor is fond of saying that “vorticity cannot be destroyed” turbulent flow is seldom if ever encountered. Finally, assuming that the LHS of your ‘transport equation’ equals zero does not necessarily require that the fluid be inviscid or that the problem be 2D – you are assuming that the terms on the RHS happen to cancel exactly and the vorticity is fortuitously ‘steady-state.’ So yes, that is a very strong assumption to accept. A: Vorticity can certainly be destroyed, this is the basis of the energy cascade in 3D turbulence where energy is channeled across wavenumber space from large to small scales all the way down to the Kolmogorov scale at which point it dissipates into heat. Of course in order to do that you need to be looking at the complete equations... this link should answer all your questions. | Mid | [
0.5798319327731091,
25.875,
18.75
]
|
Congress workers cane charged while attempting to gherao CM residence Bhopal: Over a dozen Congressmen workers were injured when police resorted to cane charge to thwart an attempt by party's thousands of workers to gherao residence of chief minister Shivraj Singh Chauhan defying the prohibitory order on Thursday. Chouhan is away in US tour. One of the injured was admitted to a hospital due to serious injuries. Union Minister of State for Commerce and Industries Jyotiraditya Scindia, PCC president Kanti Lal Bhuria, leader of opposition Ajay Singh and former assembly Speaker Shrinivas Tiwari were among senior leaders who joined the protest. Bhuria and Singh courted arrest along with nearly one lakh party workers, claimed the Congress. The protest was to highlight alleged corruption, deteriorating law and order, atrocities against women, malnutrition and illegal favour to mining companies among other issues in the state. Congress workers drawn from all parts of the state marched towards the CM house ignoring pleas of police officials to disperse. When the march did not stop, police resorted to lathi charge. The police also lobbed tear gas shells and used water cannons to disrupt the Congress workers' movements towards the CM house. Slamming the police action, Ajay Singh said they unleashed violence on peacefully demonstrating Congress workers. He pledged to continue the protest against police atrocities in every district headquarters in the state. Congress general secretary in-charge of Madhya Pradesh B K Hariprasad and Jyotiraditya Scindia in their address urged party workers to be prepared to fight for ousting the corrupt BJP government from the state. The also asked them to shun intra-party differences and work in unison to ensure victory of the Congress in the coming assembly elections in the state next year. The Congress had earlier announced to hold protest on September 20. However, it was called off following visit of foreign dignitaries to attend the foundation laying ceremony of international Buddhist University in Sanchi. | Mid | [
0.602409638554216,
37.5,
24.75
]
|
Space Toads Mayhem Dev Update: Mega Death Sun Power-Up :) - spacetoads https://twitter.com/SpaceToadsGame/status/776930628931649540 ====== gus_massa A long blog post is usually more welcome here, specially if it discuss some technical details of the implementation of the game. (Anyway, if you write the blog post, insert the video because it's a nice complement of the technical details.) ~~~ spacetoads Thanks gus_massa, I'll keep this in mind :) | Mid | [
0.641148325358851,
33.5,
18.75
]
|
What We Learned Wednesday – Perserverance What We Learned Wednesday – Perserverance Today’s blog post comes from Mrs. Charleszetta Ford who is the current Physical Education teacher at HOPE Academy. In class Mrs. Ford focuses on health and well being both physically and mentally, but also spiritually. She makes it a point to teach each of her students the importance of perseverance, especially with HOPE Academy’s current unit virtue of perseverance. I PERSEVERED… Sometimes, life throws a curveball that momentarily knocks you off of your feet. Your flesh tells you to stay down, but your spirit reminds you that God’s Word says “to glory in tribulations, knowing that tribulation produces perseverance.” (Romans 5:3). Quitting is not an option because of God’s purpose for your life. Often times, someone else’s life depends on you not giving up when things get hard. This is not an easy concept, but with some skills overcoming obstacles can be possible. The following 5 tips will help you to persevere: 1. Begin your day with prayer asking God for wisdom and direction for your life. 2. Set aside time to read God’s word so that you know His promises for yourself. Knowing God’s Word for you and applying His Word to your life daily is guaranteed to increase your faith. 3. Write down your visions and dreams that you are believing God to bring to pass. Having your thoughts on paper allows you to look back and remember where God has brought you from, giving you the courage to continue the journey God has set before you. 4. Give God praise even during the storm. 5. Always remember that “faith without works is dead” (James 2:26). Numerous times in my life, I have wanted to throw in the towel when things didn’t go my way. Personally, I have used the 5 tips above for years now and I know without a doubt, that these things have been the reason I was able to persevere when all odds were against me. Look at how God favored me by giving me the privilege to teach PE at Hope Academy! If I would have given up on the idea of implementing my PE program at a private or charter school, weekly, because of all of the No’s I received, then I would not be here today. I PERSEVERED! What trials are you facing that you need to overcome? How have you persevered in the past? Please prayerfully consider sharing your story to help inspire others. Admissions At least one prospective parent is required (but both parents are strongly encouraged) to attend an open house prior to applying for admission. Applications are accepted on a first-come, first-served basis, so we advise all prospective families to visit in the fall to increase the chances of obtaining a spot for the following year. Here are the Open Houses scheduled during the 2018-2019 school year for Fall, 2019 admission: | High | [
0.702508960573476,
36.75,
15.5625
]
|
<?xml version="1.0" encoding="utf-8"?> <manifest xmlns:android="http://schemas.android.com/apk/res/android" package="nosql.anew.kotlinmvc"> <application android:allowBackup="true" android:icon="@mipmap/ic_launcher" android:label="@string/app_name" android:roundIcon="@drawable/app_icon" android:supportsRtl="true" android:theme="@style/AppTheme"> <activity android:name="nosql.anew.kotlinmvc.controllers.LoginController"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> <activity android:name="nosql.anew.kotlinmvc.controllers.ChatController" android:theme="@style/chatTheme"/> </application> </manifest> | Low | [
0.405479452054794,
18.5,
27.125
]
|
Bill Seeks To Legalize Sweepstakes Cafes, Games A bill to legalize and tax sweepstakes cafes in North Carolina has been filed by legislators whose campaigns accepted cash from gaming operators. The bill introduced Wednesday would mark a reversal of course for the state legislature. The General Assembly has previously approved three laws to outlaw video poker and electronic sweepstakes. The North Carolina Supreme Court in December upheld the ban, resulting in recent raids and arrests. Collins got $2,500 days before the November election from Chase Burns, an Oklahoma man indicted last month in Florida over accusations he helped operate a fake veteran's charity that received $300 million from illegal gambling, but spent only 2 percent on vets. Online Public Information File Viewers with disabilities can get assistance accessing this station's FCC Public Inspection File by contacting the station with the information listed below. Questions or concerns relating to the accessibility of the FCC's online public file system should be directed to the FCC at 888-225-5322, 888-835-5322 (TTY), or [email protected]. | Low | [
0.5019685039370071,
31.875,
31.625
]
|
Q: TS2741 Property '0' is missing in type '{ label: string; } Javascript Hi I'm writing a code using JS and TS. I've made this interface: > interface IPLTableProps { > Conf: [{ key: string, val: any }], > Values?: [string], > children?: ReactNode // TODO prendere children da React } I defined this interface for create a general component. When I try to use this component in another file, obliviously I have to call is as a general component. But here it comes the error. The general component it's called PLTable <PLTable Conf={CONF}/> CONF is an array, and when I try to run I get this error. TS2741: Property '0' is missing in type '{ label: string; }[]' but required in type '[{ key: string; val: any; }]'. Can someone help me? A: [type] defines a tuple with a single element. You probably want an array which is defined using type[] or Array<type> interface IPLTableProps { Conf: Array<{ key: string, val: any }>, Values?: string[], children?: ReactNode } | Mid | [
0.6423357664233571,
33,
18.375
]
|
DHAKA: A four-year-old Bangladeshi boy suffering from a mysterious illness that makes him look like an old man has been admitted to hospital for tests, doctors and his family said. Doctors at a top hospital in Dhaka have agreed to try to diagnose and treat Bayezid Shikdar, who comes from a poor farming family, for free after learning of his plight on the weekend. Born with excess skin that hangs from his limbs and face causing it to sag, Bayezid also suffers from related heart, vision and hearing problems. Four-year-old Bangladeshi child Bayezid Shikdar sits with his mother Tripti Khatun on a bed at Dhaka Medical College Hospital in Dhaka. ─AFP His father, Lablu Shikdar, said numerous doctors have been at a loss to explain his condition. “We sold our land to treat him at local hospitals. We took him to religious healers and herbal doctors, but his condition did not change. This hospital is our last hope,” Shikdar told AFP at Dhaka Medical College Hospital this week. “We hope they'll make him look like any other normal child.” Doctors initially suspected he suffered from progeria which causes rapid and premature ageing shortly after birth, leading to severe health complications. The extremely rare genetic disorder was the subject of Hollywood movie “The Curious Case of Benjamin Button” starring Brad Pitt. But doctors at the Dhaka hospital expressed caution, saying extensive tests were needed. “In progeria, the ageing process accelerates with time,” Abul Kalam, head of the hospital's burns and plastic surgery unit, told AFP on Monday. "But Bayezid's parents have said the ageing of their boy has been halted recently. He has shown signs of improvement. We're investigating his condition. In addition to loose skin, he has problems in his heart, ear, eyes and penis." Doctors said his genetic condition may also be the result of inbreeding, with marriage among relatives including first cousins common in Bangladesh's rural areas. "He is very fond of fish and rice. He plays football and hide and seek with his cousins." ─AFP Bayezid's mother, Khatun, stressed that her son was just like any other child. “He is very fond of fish and rice. He plays football and hide and seek with his cousins,” she told AFP after her son's case was highlighted in Bangladesh media on the weekend. “When I first saw him he looked like a bundle of skin. We had no idea what he was afflicted with. We thought the condition would go away soon.” “He is an extremely talented boy. There are days he grabs books and wants to go to school. But we thought he's still too young.” Doctors at the same hospital have also been treating a 26-year-old father dubbed “Tree Man” for the rare and massive bark-like growths on his hands and feet. | Mid | [
0.5727923627684961,
30,
22.375
]
|
Q: fadeIn php script with jQuery onClick button I have a PHP script labeled first_page.php. On that page, I currently have a div that looks like this: <div id="status"> <h3>To view a list of all rooms statuses, select the link below.</h3> <a href="response_data.php" class="button">Show Status</a> </div> And links to the correct page, response_data.php. What i'd really like to have instead, is a button that is on the first_page.php, and when that button is clicked, have it load the response_data.php page with .fadeIn(). I've tried to get this jQuery script working, with no luck. Here is what I have tried. I've changed my html to look like this: <button id="button">Click here to show data</button> <div id="data" style="display: none;"> <?php include 'response_data.php' ?> </div> $('#button').click(function() { $('#data').fadeIn(1000); }); Above, I have added a button and a div that I wanted to fadeIn. The div holds the php script, so I wanted the div to fade the php script in. I set the data CSS to display none. When I click the button, nothing happens. It actually works, but the div data fade's in without having had the button clicked. Then the button remains. I'd like it to not auto click, and also somehow hide the button after the first click. A: The jQuery part is just fine. I highly suggest to check that your div#data actually has some text in it. To do so, you can try something like: console.log($('#data').text().length > 0 ? 'Text found' : 'Could not find text'); Also, to hide the button after it was clicked simply use the hide() method: $('#button').on('click', function() { $('#data').fadeIn(1000); $(this).hide(); }); Note: You can also use the fadeOut() method or the remove() method if you wish to remove the button from the DOM. | Mid | [
0.582446808510638,
27.375,
19.625
]
|
Quirmbach defends attacks before primary Local Democratic voters will decide Tuesday whether to give state Sen. Herman Quirmbach, D-Ames, a shot at a fourth term this fall against Republican Jeremy Davis, a former Ames city councilman. Local Democratic voters will decide Tuesday whether to give state Sen. Herman Quirmbach, D-Ames, a shot at a fourth term this fall against Republican Jeremy Davis, a former Ames city councilman. Their alternative is the untested Ames community volunteer Cynthia Oppedal Paschen, who has drawn the support of residents who would like to see more women in the state Legislature, are generally adverse to lengthy incumbencies and believe Quirmbach’s approach to lawmaking has been too abrasive. Both candidates have longstanding ties to the Ames community and largely agree on the issues, but only Quirmbach has a record to run on, as both a state senator and former city councilman. "People have been talking about what’s wrong with Herman Quirmbach since the ’90s," said Paschen, who has been active in Democratic politics for years and said she first encountered the senator during a women’s fundraiser he crashed for one of then-Secretary of State Elaine Baxter’s failed bids for Congress in the early 1990s. Paschen, 53, is Quirmbach’s first primary opponent since 2002, the year he was originally elected to the Senate. She decided to seek public office for the first time, she said, when it became clear to her that no one else was interested in challenging him. "My opponent, having once pledged a campaign of ‘civility,’ has chosen instead to end the campaign with a desperate series of last-minute personal attacks," Quirmbach said in response to the criticism. "My campaign will not follow that road." When he announced his reelection bid in January, Quirmbach, 63, vowed to run a positive campaign centered on raising the minimum wage, expanding access to preschool education and continuing to advocate for the interests of ISU. Quirmbach displayed his wide-ranging knowledge of legislative affairs during a candidate’s forum in May hosted by the Ames League of Women Voters. He rapped off his various accomplishments, delving into details about legislation he’d supported relating to civil rights and the minimum wage; Paschen’s answers were far briefer, and she even deferred a question about the Board of Regents to Quirmbach, admitting she was unfamiliar with the issue. "What I have is institutional knowledge," said Paschen, who acknowledged that she would have a lot to learn at the Capitol. "I know all this stuff about Ames, all this stuff about people who live in Ames." As incumbents often do, Quirmbach has easily outmatched Paschen in fundraising and endorsements, which have come from unions; state lawmakers including Senate President Pam Jochum, D-Dubuque; and retiring Sen. Tom Harkin, D-Iowa. Paschen, who worked for Harkin’s campaign when he was first elected to the Senate in 1984, has objected to the state Democratic Party’s involvement in the primary and suggested Quirmbach’s late endorsements may suggest he is nervous about Tuesday’s outcome. Senate Majority Leader Mike Gronstal, D-Council Bluffs, said he couldn’t think of a time when the state party hadn’t sided with an incumbent in a primary, adding that the party had conducted no internal polling on the race — certainly none that would suggest Quirmbach is vulnerable. "It sounds like you have an aggrieved primary candidate that’s complaining," Gronstal said. "That’s all I hear." In any event, Paschen has scored several notable endorsements too, from four faculty members of ISU’s Economics Department where Quirmbach teaches; former state Rep. Bill Bernau, D-Ames; and Quirmbach’s predecessor, former state Sen. Johnie Hammond, D-Ames. "Most of the time, Herman votes the way that I would have voted, but I believe Cindy would be a much better listener to her constituents," said Hammond, who supported Quirmbach’s primary opponent, Ames resident Karen Bolluyt, in 2002. Hammond’s statement echoed one Paschen made after she announced her campaign in February. They hint at underlying tensions surrounding Quirmbach that Paschen has avoided addressing directly during most of her campaign but that others, such as Ames resident Frances Wilke, are more blunt about. Wilke, who clerked for Quirmbach during part of his second term, said the senator had a "haughty demeanor" and "constantly lectured to his colleagues in the Senate." To Quirmbach’s critics, the most visible example of that came during a Senate floor discussion last year. Quirmbach, who chairs the Senate Education Committee, asked freshman Sen. Amy Sinclair, R-Allerton, to define terms in her amendment to an education bill in a manner Republicans decried as condescending and part of a pattern of poor treatment of female colleagues. Quirmbach and Gronstal subsequently apologized to Sinclair, who has donated $25 to Jeremy Davis’ campaign and said she wouldn’t mind seeing Paschen win the Democratic primary. But Sinclair added that she held no grudges against Quirmbach, noting that the two had worked together this year passing a bill to help dyslexic Iowans. Other colleagues of Quirmbach’s, past and present, said they have enjoyed a positive working relationship with him. They include Judie Hoffman, who served with Quirmbach on the City Council and has commended him for his leadership there in passing the state’s first local smoking ban ordinance. (The ban was eventually overturned by the Iowa Supreme Court, but Quirmbach later helped pass the state’s Smokefree Air Act of 2008.) "Quirmbach has represented the people of his district well and deserves another term," Hoffman said. Ames environmentalist Erv Klaas, a professor emeritus of animal ecology at ISU, agreed, commending Quirmbach for his efforts on the council to establish Ada Hayden Heritage Park and advocacy in the Legislature for economic and education reforms. Klaas, who worked on Quirmbach’s first two state Senate campaigns, said he’d heard rumors about his alleged hectoring attitude, "but I give them no credibility." "I think Cindy will have a harder time defeating Jeremy Davis than Herman because she doesn’t have a record," Klaas said. "I think we would lose that leadership if she would win, and I just don’t think it would be good for the state, or particularly our district." Paschen said she believed either candidate would beat Davis in their Senate District 23, where active Democratic voters outnumber Republicans by more than 2,000 (but where both are outnumbered by the district’s roughly 13,000 independent voters). In the primary, Paschen has also attempted to capitalize on mixed opinions about Quirmbach among his colleagues at ISU. John Beghin, an economics professor and neighbor of Paschen’s, is one of four faculty members in the department publicly supporting Paschen. He criticized so-called continuous improvement legislation to assess student learning that a number of ISU faculty members believe is overburndensome and redundant but that Quirmbach supported. Dr. Hector Avalos, a professor of religious studies, shared Beghin’s sentiments on the issue but is supporting Quirmbach. "Paschen, though I also agree with her on many issues, would not be able to reach (Quirmbach’s) leadership levels right away at a time when it is crucial that our universities have such representation on key committees," Avalos said. Quirmbach represents Ames, Kelley and the townships of Grant, Milford and Washington. | Mid | [
0.5439672801635991,
33.25,
27.875
]
|
"From curbside you won't notice the carports at the foundation's charitable center are topped off with solar panels." What the article doesn't tell you is about the first solar installation that was on the parking structure a couple of years ago. It was a concentrated tracking solar PV array structure. the arrays never did quite track the sun like they were supposed to. Sometimes half of the arrays were pointing East and half were point West. The public didn't like the arrays sticking up off of the top of the parking structures, so they came down. Now there are fixed arrays on the parking structures and it seems the foundation can almost generate their total energy needs. The arrays will come in handy during the summer months for a peak source of power generation is needed on the 100 + degree days. Tell me when this thread is updated: Add your comments below Please note by submitting this form you acknowledge that you have read the Terms of Service and the comment you are posting is in compliance with such terms. Be polite. Inappropriate posts may be removed by the moderator. Send us your feedback. | Low | [
0.500986193293885,
31.75,
31.625
]
|
A wireless reflectance pulse oximeter with digital baseline control for unfiltered photoplethysmograms. Pulse oximeters are central to the move toward wearable health monitoring devices and medical electronics either hosted by, e.g., smart phones or physically embedded in their design. This paper presents a small, low-cost pulse oximeter design appropriate for wearable and surface-based applications that also produces quality, unfiltered photo-plethysmograms (PPGs) ideal for emerging diagnostic algorithms. The design's "filter-free" embodiment, which employs only digital baseline subtraction as a signal compensation mechanism, distinguishes it from conventional pulse oximeters that incorporate filters for signal extraction and noise reduction. This results in high-fidelity PPGs with thousands of peak-to-peak digitization levels that are sampled at 240 Hz to avoid noise aliasing. Electronic feedback controls make these PPGs more resilient in the face of environmental changes (e.g., the device can operate in full room light), and data stream in real time across either a ZigBee wireless link or a wired USB connection to a host. On-board flash memory is available for store-and-forward applications. This sensor has demonstrated an ability to gather high-integrity data at fingertip, wrist, earlobe, palm, and temple locations from a group of 48 subjects (20 to 64 years old). | High | [
0.686605981794538,
33,
15.0625
]
|
Q: How to close video after stop in JavaFX application? I'm creating an JavaFX application with Scene Builder. I added a video at the beginning. So I wanna play video before my application start in fullscreen mode. The Problem is when it is stopped I see only black screeen and nothing happened, I guess it is because video is fullscreen and it is not automatically closed. I also have a bug before the video starts, some blink of my main window .I guess it is because video is placed in the controller that begins after my application starts. How to close video or remove it after finish? How to place video in main class? Main Class public class Main extends Application { public static void main(String[] args) { launch(args); } @Override public void start(Stage primaryStage) throws Exception { try { FXMLLoader loader = new FXMLLoader(getClass().getResource("resources/fxml/card.fxml")); Parent root = loader.load(); Scene scene = new Scene(root, 1600, 600); primaryStage.setScene(scene); scene.getStylesheets().add(getClass().getResource("style.css").toExternalForm()); primaryStage.initStyle(StageStyle.UNDECORATED); primaryStage.setMaximized(true); primaryStage.setResizable(true); primaryStage.getIcons().add(new Image("src/card/resources/logo-icon.png")); primaryStage.show(); //adding resize and drag primary stage ResizeHelper.addResizeListener(primaryStage); //assign ALT+ENTER to maximize window final KeyCombination kb = new KeyCodeCombination(KeyCode.ENTER, KeyCombination.CONTROL_DOWN); scene.addEventHandler(KeyEvent.KEY_PRESSED, new EventHandler<KeyEvent>() { @Override public void handle(KeyEvent event) { if (kb.match(event)) { primaryStage.setMaximized(!primaryStage.isMaximized()); primaryStage.setResizable(true); Controller cont = Context.getInstance().getController(); if (!primaryStage.isMaximized()) { cont.getBtnFont().setPrefWidth(20); cont.getBtnPalette().setPrefWidth(20); cont.getBtnQuestCards().setPrefWidth(20); cont.getBtnNonQuestCards().setPrefWidth(20); cont.getRandomCard().setTopAnchor(cont.getRandomCard(), 80.0); cont.getRandomCard().setBottomAnchor(cont.getRandomCard(), 70.0); cont.getRandomCard().setLeftAnchor(cont.getRandomCard(), 300.0); cont.getRandomCard().setRightAnchor(cont.getRandomCard(), 200.0); cont.getRandomCardBack().setTopAnchor(cont.getRandomCardBack(), 80.0); cont.getRandomCardBack().setBottomAnchor(cont.getRandomCardBack(), 70.0); cont.getRandomCardBack().setLeftAnchor(cont.getRandomCardBack(), 300.0); cont.getRandomCardBack().setRightAnchor(cont.getRandomCardBack(), 200.0); cont.getRectRandom().setWidth(1060); cont.getRectRandom().setHeight(410); cont.getRectRandomBack().setWidth(1060); cont.getRectRandomBack().setHeight(410); cont.getRandomCard().setPrefWidth(800); cont.getRandomCard().setPrefHeight(200); cont.getRandomCardBack().setPrefWidth(800); cont.getRandomCardBack().setPrefHeight(200); } else if (primaryStage.isMaximized()){ cont.getBtnFont().setPrefWidth(50); cont.getBtnPalette().setPrefWidth(50); cont.getBtnQuestCards().setPrefWidth(50); cont.getBtnNonQuestCards().setPrefWidth(50); cont.getRandomCard().setTopAnchor(cont.getRandomCard(), 150.0); cont.getRandomCard().setBottomAnchor(cont.getRandomCard(), 130.0); cont.getRandomCard().setLeftAnchor(cont.getRandomCard(), 450.0); cont.getRandomCard().setRightAnchor(cont.getRandomCard(), 270.0); cont.getRandomCardBack().setTopAnchor(cont.getRandomCardBack(), 150.0); cont.getRandomCardBack().setBottomAnchor(cont.getRandomCardBack(), 130.0); cont.getRandomCardBack().setLeftAnchor(cont.getRandomCardBack(), 450.0); cont.getRandomCardBack().setRightAnchor(cont.getRandomCardBack(), 270.0); cont.getRectRandom().setWidth(1160); cont.getRectRandom().setHeight(760); cont.getRectRandomBack().setWidth(1160); cont.getRectRandomBack().setHeight(760); cont.getRandomCard().setPrefWidth(800); cont.getRandomCard().setPrefHeight(400); cont.getRandomCardBack().setPrefWidth(800); cont.getRandomCardBack().setPrefHeight(400); } } } }); } catch (Exception e) { e.printStackTrace(); } } } Controller CLass: @FXML public void initialize(URL location, ResourceBundle resources) { String path = new File("src/card/resources/intro.mp4").getAbsolutePath(); me = new Media(new File(path).toURI().toString()); mp = new MediaPlayer(me); media.setMediaPlayer(mp); mp.setAutoPlay(true); media.setSmooth(true); } A: SOLUTION FOUND! I made animation to opacity of MediaView: @FXML public void initialize(URL location, ResourceBundle resources) { mp = new MediaPlayer(new Media(this.getClass().getResource(MEDIA_URL).toExternalForm())); media.setMediaPlayer(mp); media.setSmooth(true); mp.setAutoPlay(true); Timeline tm = new Timeline(new KeyFrame(Duration.millis(3000), new KeyValue(media.opacityProperty(), 0.0))); tm.setDelay(Duration.millis(5500)); tm.play(); } | Mid | [
0.5450819672131141,
33.25,
27.75
]
|
Vandenberg air force Base, Calif. – The WorldView-4 satellite, built by Lockheed Martin (NYSE: LMT) for DigitalGlobe, Inc. (NYSE: DGI), has been encapsulated in its protective launch vehicle fairing. It is scheduled to launch Sept. 16 aboard a United Launch Alliance Atlas V rocket. For encapsulation, WorldView-4 was connected to an adapter and then enclosed in the four-meter fairing or “nose cone.” The satellite will now be transported by truck to Vandenberg Air Force Base’s Space Launch Complex 3 East where it will be lifted by crane and mated with the Atlas rocket. “Encapsulation is the last time people will ever lay eyes on this satellite before it launches to space,” said Steve Skladanek, president of Lockheed Martin Commercial Launch Services. “Our Atlas rocket is ready to provide WorldView-4 a smooth ride and precise delivery into orbit.” The Atlas V 401 rocket is provided by Lockheed Martin Commercial Launch Services. WorldView-4 is the latest in a series of imaging and data satellites built by Lockheed Martin for customers around the world. Once launched, the satellite will more than double DigitalGlobe’s coverage of the world’s highest-resolution 30 cm commercial satellite imagery and increase the rate at which it grows its 16-year library of time-lapse, high-resolution imagery. WorldView-4 will orbit Earth every 90 minutes, traveling 17,000 miles per hour and capturing as much as 680,000 square kilometers of the Earth’s surface daily (18 terabytes) – the equivalent of the land area of Texas. Headquartered in Bethesda, Maryland, Lockheed Martin is a global security and aerospace company that employs approximately 98,000 people worldwide and is principally engaged in the research, design, development, manufacture, integration and sustainment of advanced technology systems, products and services. | Mid | [
0.562015503875969,
36.25,
28.25
]
|
Handbook of Research on Ethnic Minority Entrepreneurship A Co-evolutionary View on Resource Manageme... This exhaustive, interdisciplinary Handbook explores the phenomena of immigration and ethnic minority entrepreneurship in light of marked changes since the mid-twentieth century and the advent of easier, more affordable travel, and more open and integrated national economies. The international contributors, key experts in their respective fields, illustrate that myriad ethnic minorities exist across the globe, and that their entrepreneurship can and does significantly influence national economies. This important Handbook seeks to promote our understanding of which factors make for successful entrepreneurship, and, perhaps more importantly, how negative political consequences that members of successful entrepreneurial ethnic minorities might face can be minimized. | High | [
0.6753246753246751,
32.5,
15.625
]
|
Cover all test cases with #permutation When dealing with system which cooperate with many other subsystems in an asynchronous way, you are presented with a challenge. Due to the nature of such systems, messages may not arrive always in the same order. How do you test that your code will react in the same way in all cases? Let me present what I used to be doing and how I changed my approach. The example will be based on a saga but it applies to any solution that you want to test for order independence. specify "postal sent via API" do procs = [ -> { postal . call ( fill_out_customer_data ) }, -> { postal . call ( paid_data ) }, -> { postal . call ( tickets_generated_data ) }, ]. shuffle procs [ 0 ]. call procs [ 1 ]. call expect ( api_adapter ). to receive ( :transmit ) procs [ 2 ]. call end This solution however has major drawbacks It does not test all possibilities Failures are not easily reproducible It will eventually test all possibilites. Given enough runs on CI. And you can reproduce it if you pass the --seed attribute. But generally it does not make our job easier. And it might miss some bugs until it is executed enough times. It was rightfully questioned by Paweł, my coworker. We can do better. #permutation We should strive to test all possible cases. It’s boring to go manually through all 6 of them. With even more possible inputs the number goes high very quickly. And it might be error prone. So let’s generate all of them with the little help of #permutation method. [ fill_out_customer_data , paid_data , tickets_generated_data , ]. permutation . each do | fact1 , fact2 , fact3 | specify "postal sent via API when #{ [ fact1 . class , fact2 . class , fact3 . class ]. to_sentence } " do postal . call ( fact1 ) postal . call ( fact2 ) expect ( api_adapter ). to receive ( :transmit ) postal . call ( fact3 ) end end Caveats The more cases you generate the faster they should run individually There is obviously a certain limit after which doing this does not make sense anymore. Maybe in such case fuzzy testing or moving it outside the main build is a better solution. If you enjoyed this blog post you will like our books as well. | High | [
0.672605790645879,
37.75,
18.375
]
|
Under the agreement, reached Tuesday, the city is to provide voting machines that are accessible to voters who are blind or visually impaired. As of the September primary elections, New Hampshire polling places featured a system for blind and vision-impaired voters called One4All. It involves tablets that voters can use to enlarge the size of the lettering on the ballot. For blind voters, the software reads through all the names, cuing them to hit the enter key when their choice is read. The New Hampshire Supreme Court says a new law that prevents the state's voter database from being subpoenaed as evidence in ongoing lawsuits is valid — which means it can also apply to a case that started before that new prohibition went into effect. | Mid | [
0.630927835051546,
38.25,
22.375
]
|
/** * The MIT License * Copyright (c) 2015 Estonian Information System Authority (RIA), Population Register Centre (VRK) * * Permission is hereby granted, free of charge, to any person obtaining a copy * of this software and associated documentation files (the "Software"), to deal * in the Software without restriction, including without limitation the rights * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell * copies of the Software, and to permit persons to whom the Software is * furnished to do so, subject to the following conditions: * * The above copyright notice and this permission notice shall be included in * all copies or substantial portions of the Software. * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN * THE SOFTWARE. */ package ee.ria.xroad.proxy.serverproxy; import ee.ria.xroad.common.SystemProperties; import ee.ria.xroad.common.conf.globalconf.AuthTrustManager; import ee.ria.xroad.common.conf.serverconf.ServerConf; import ee.ria.xroad.common.db.HibernateUtil; import ee.ria.xroad.common.logging.RequestLogImplFixLogback1052; import ee.ria.xroad.common.opmonitoring.OpMonitoringDaemonHttpClient; import ee.ria.xroad.common.opmonitoring.OpMonitoringSystemProperties; import ee.ria.xroad.common.util.CryptoUtils; import ee.ria.xroad.common.util.StartStop; import ee.ria.xroad.common.util.TimeUtils; import ee.ria.xroad.proxy.antidos.AntiDosConnector; import ee.ria.xroad.proxy.conf.AuthKeyManager; import ch.qos.logback.access.jetty.RequestLogImpl; import lombok.extern.slf4j.Slf4j; import org.apache.http.impl.client.CloseableHttpClient; import org.eclipse.jetty.server.HttpConnectionFactory; import org.eclipse.jetty.server.Server; import org.eclipse.jetty.server.ServerConnector; import org.eclipse.jetty.server.handler.HandlerCollection; import org.eclipse.jetty.server.handler.RequestLogHandler; import org.eclipse.jetty.util.ssl.SslContextFactory; import org.eclipse.jetty.xml.XmlConfiguration; import javax.net.ssl.KeyManager; import javax.net.ssl.SSLContext; import javax.net.ssl.TrustManager; import java.io.InputStream; import java.nio.file.Files; import java.nio.file.Path; import java.nio.file.Paths; import java.security.SecureRandom; /** * Server proxy that handles requests of client proxies. */ @Slf4j public class ServerProxy implements StartStop { private static final int ACCEPTOR_COUNT = 2 * Runtime.getRuntime().availableProcessors(); private static final int IDLE_MONITOR_TIMEOUT = 50; private static final int IDLE_MONITOR_INTERVAL = 100; // SSL session timeout in seconds private static final int SSL_SESSION_TIMEOUT = 600; private static final int CONNECTOR_SO_LINGER_MILLIS = SystemProperties.getServerProxyConnectorSoLinger() * 1000; private static final String CLIENT_PROXY_CONNECTOR_NAME = "ClientProxyConnector"; private Server server = new Server(); private CloseableHttpClient client; private IdleConnectionMonitorThread connMonitor; private String listenAddress; private CloseableHttpClient opMonitorClient; /** * Constructs and configures a new server proxy. * @throws Exception in case of any errors */ public ServerProxy() throws Exception { this(SystemProperties.getServerProxyListenAddress()); } /** * Constructs and configures a new client proxy with the specified listen address. * @param listenAddress the address this server proxy should listen at * @throws Exception in case of any errors */ public ServerProxy(String listenAddress) throws Exception { this.listenAddress = listenAddress; configureServer(); createClient(); createOpMonitorClient(); createConnectors(); createHandlers(); } private void configureServer() throws Exception { log.trace("configureServer()"); Path file = Paths.get(SystemProperties.getJettyServerProxyConfFile()); log.debug("Configuring server from {}", file); try (InputStream in = Files.newInputStream(file)) { new XmlConfiguration(in).configure(server); } } private void createClient() throws Exception { log.trace("createClient()"); HttpClientCreator creator = new HttpClientCreator(); connMonitor = new IdleConnectionMonitorThread(creator.getConnectionManager()); connMonitor.setIntervalMilliseconds(IDLE_MONITOR_INTERVAL); connMonitor.setConnectionIdleTimeMilliseconds(IDLE_MONITOR_TIMEOUT); client = creator.getHttpClient(); } private void createOpMonitorClient() throws Exception { opMonitorClient = OpMonitoringDaemonHttpClient.createHttpClient(ServerConf.getSSLKey(), TimeUtils.secondsToMillis(OpMonitoringSystemProperties.getOpMonitorServiceConnectionTimeoutSeconds()), TimeUtils.secondsToMillis(OpMonitoringSystemProperties.getOpMonitorServiceSocketTimeoutSeconds())); } private void createConnectors() throws Exception { log.trace("createConnectors()"); int port = SystemProperties.getServerProxyListenPort(); ServerConnector connector = SystemProperties.isSslEnabled() ? createClientProxySslConnector(server) : createClientProxyConnector(server); connector.setName(CLIENT_PROXY_CONNECTOR_NAME); connector.setPort(port); connector.setHost(listenAddress); connector.setSoLingerTime(CONNECTOR_SO_LINGER_MILLIS); connector.setIdleTimeout(SystemProperties.getServerProxyConnectorMaxIdleTime()); connector.getConnectionFactories().stream() .filter(cf -> cf instanceof HttpConnectionFactory) .forEach(httpCf -> ((HttpConnectionFactory) httpCf).getHttpConfiguration().setSendServerVersion(false)); server.addConnector(connector); log.info("ClientProxy {} created ({}:{})", connector.getClass().getSimpleName(), listenAddress, port); } private void createHandlers() { log.trace("createHandlers()"); RequestLogHandler logHandler = new RequestLogHandler(); RequestLogImpl reqLog = new RequestLogImplFixLogback1052(); reqLog.setResource("/logback-access-serverproxy.xml"); reqLog.setQuiet(true); logHandler.setRequestLog(reqLog); ServerProxyHandler proxyHandler = new ServerProxyHandler(client, opMonitorClient); HandlerCollection handler = new HandlerCollection(); handler.addHandler(logHandler); handler.addHandler(proxyHandler); server.setHandler(handler); } @Override public void start() throws Exception { log.trace("start()"); server.start(); connMonitor.start(); } @Override public void join() throws InterruptedException { log.trace("join()"); if (server.getThreadPool() != null) { server.join(); } } @Override public void stop() throws Exception { log.trace("stop()"); connMonitor.shutdown(); client.close(); opMonitorClient.close(); server.stop(); HibernateUtil.closeSessionFactories(); } /** * Close idle connections. */ public void closeIdleConnections() { connMonitor.closeNow(); } private static ServerConnector createClientProxyConnector(Server server) { return SystemProperties.isAntiDosEnabled() ? new AntiDosConnector(server, ACCEPTOR_COUNT) : new ServerConnector(server, ACCEPTOR_COUNT, -1); } private static ServerConnector createClientProxySslConnector(Server server) throws Exception { SslContextFactory cf = new SslContextFactory(false); cf.setNeedClientAuth(true); cf.setIncludeCipherSuites(CryptoUtils.getINCLUDED_CIPHER_SUITES()); cf.setSessionCachingEnabled(true); cf.setSslSessionTimeout(SSL_SESSION_TIMEOUT); SSLContext ctx = SSLContext.getInstance(CryptoUtils.SSL_PROTOCOL); ctx.init(new KeyManager[]{AuthKeyManager.getInstance()}, new TrustManager[]{new AuthTrustManager()}, new SecureRandom()); cf.setSslContext(ctx); return SystemProperties.isAntiDosEnabled() ? new AntiDosConnector(server, ACCEPTOR_COUNT, cf) : new ServerConnector(server, ACCEPTOR_COUNT, -1, cf); } } | Mid | [
0.5653021442495121,
36.25,
27.875
]
|
Women’s Ministry Retreat held at Baptist Conference Center Text: TT There were 52 ladies who had a wonderful weekend in Toccoa at the Georgia Baptist Conference Center with the Women’s Ministry Retreat. Karen Dilbeck, wife of a former Tignall Baptist pastor, Rev. Tim Dilbeck, was a very dynamic speaker. Karen is active in teaching and working with the youth at Pike Road Baptist Church in Montgomery, Ala. It was a great reunion with many of the ladies from Tignall Baptist Church. Of course, every time they turned around it was time to eat. When a group of ladies get together, there is going to be lots of food. From Loco Baptist Church in Lincolnton were Fannie Clary and Mary Goldman and Angie Roth; from Victory Baptist was Lisa Bowers; from Crawfordville Baptist, Cheryl Young; from United Baptist, Christina Howell, Lincolnton Baptist, Fran Deason and Martha Barrett; and of course, Karen Dilbeck from Pike Road Baptist in Montgomery, Ala. All these ladies received a blessing from this retreat and enjoyed the fellowship together. | Mid | [
0.5679513184584171,
35,
26.625
]
|
Q: Entity Framework and impersonation I'm incorporating Entity Framework and ASP.NET Dynamic Data into an existing application that is setup to use impersonation="true" in the web.config, however the previous developers chose an approach where they revert back to the app pool identity for each DAL call they made private WindowsImpersonationContext context = null; public void RevertToAppPool() { if (!WindowsIdentity.GetCurrent().IsSystem) { context = WindowsIdentity.Impersonate(System.IntPtr.Zero); } } public void UndoImpersonation() { if (context != null) { context.Undo(); } } I've been asked to preserve this behavior while using Entity Framework ...given that the entity objects are used all over the place (in LINQ to EF queries, manual calls, behind-the-scenes calls by the framework etc.), where would be the appropriate places in the partial classes to make the appropriate calls to RevertToAppPool and UndoImpersonation for every call? A: You would most probably need to create custom Entity framework provider wrapper and in wrapped connection revert impersonation before connection opening and put it back after connection has been openned (hopefully it will be enough). You will have much easier live if you use SQL authentication for database instead. Imperesonation with reverting back for data access looks like pretty odd solution. I wonder what is the point of impersonation in that application? | Mid | [
0.5882352941176471,
30,
21
]
|
Robust chirped mirrors. Optimized chirped mirrors may perform suboptimally, or completely fail to satisfy specifications, when manufacturing errors are encountered. We present a robust optimization method for designing these dispersion-compensating mirror systems that are used in ultrashort pulse lasers. Possible implementation errors in layer thickness are taken into account within an uncertainty set. The algorithm identifies worst-case scenarios with respect to reflectivity as well as group delay. An iterative update improves the robustness and warrants a high manufacturing yield, even when the encountered errors are larger than anticipated. | High | [
0.7191601049868761,
34.25,
13.375
]
|
Oh, Kevin. What have you done now? TVLine has learned that Brian Baumgartner will guest-star on CBS’ recently renewed Criminal Minds, in a role that promises to be even more off-kilter than his onetime Office employee. RELATED | CBS Renews NCIS, Good Wife, Criminal Minds, Mom, Five-0, Blue Bloods and 12 Others Perhaps taking a cue from the Scranton Strangler, Baumgartner will in this season’s 22nd episode, titled “Fatal,” play a man who at an unexpected crossroads in his life goes on a killing spree. Since The Office wrapped its run last May, Baumgartner has guested on such shows as Rake, Mike & Molly and Hot in Cleveland. Want more scoop on Criminal Minds, or for any other show? Email [email protected] and your question may be answered via Matt’s Inside Line. | Low | [
0.524714828897338,
34.5,
31.25
]
|
Tips for Making Your Furnace More Energy-Efficient Posted on Jan 14, 2015 7:45pm PST The winter season is in full swing, and it is important to make sure that your home's HVAC system is able to keep you warm and comfortable without breaking your budget. With routine furnace repair services, you can keep your heating system working efficiently, all winter long. By scheduling preventative maintenance for your heating and cooling system, you can also cut back on your overall repair needs. A company offering heater repair in Bowie can help you get the most out of your furnace this season. Here is a look at some top tips for making your furnace more energy-efficient. Change Your FilterChanging your furnace filter will go a long ways towards maximizing the efficiency of your heating system. Your furnace air filter is designed to trap dirt, dust, and other types of debris. Over time, the filter screen will become clogged, reducing the efficiency of your furnace. By changing your filters once a month, you can keep your furnace in peak working condition. Improve Your InsulationAlong with changing your furnace filter, you can also boost the efficiency of your heating systemby improving the insulation of your house. For example, your windows may be letting heated air escape from your indoor spaces. To boost the efficiency of your furnace, you can cover your windows with energy efficient blinds or curtains. The proper coverings will help keep heat inside, allowing you to get the best efficiency from your furnace. Schedule a Tune UpDuring the winter season, it is a great idea to schedule a tune up for your furnace. During a regularly scheduled maintenance appointment, your HVAC technician will be able to identify any parts of your furnace that are not working to their best efficiency. When you schedule a maintenance appointment for your furnace, you can rest assured that your heating system is working at its best. | High | [
0.689320388349514,
35.5,
16
]
|
Q: Accessing files inside the folder, which is inside config folder in sails js(node js framework) I have to access a file , which is inside a folder which is inside the config folder(/config/schemas/userSchemas.js). How to access this file from anywhere else like from my controllers or services. How to do this? I have tried sails.config.schemas.userSchemas. But it didn't work. What else I can try? A: It is really not recommended that you require configuration files directly. Sails will require them for you, and merge the contents into sails.config, ignoring your directory structure completely. So if, for example, your config/schemas/userSchemas.js file contains: module.exports.userSchemas = { foo: "bar" } Then you'll be able to access that config in your app as sails.config.userSchemas. Note the first line very carefully: if you just do module.exports = {...} then the object will be merged into sails.config, not sails.config.userSchemas -- as I said before, configuration is merged in without regard to directory structure. If you have files that you need to load in which you don't want to be part of sails.config, simply place them in a different folder in your project (e.g. schemas) and use require as specified in the other answers. | Mid | [
0.6526019690576651,
29,
15.4375
]
|
This invention relates to an electronic concentration control system. Closed loop electronic concentration control systems in which an exhaust gas composition sensor (e.g. a lambda sensor) located in an exhaust pipe sends a feedback signal to a calculation unit which generates as an output a concentration correction signal used to calculate the air/gasoline ratio (strength) of the mixture delivered to the engine are known. In particular the correction signal may be used to modify an injection time Tj calculated using an open loop, e.g. by means of an electronic map, calculating a corrected injection time Tjcorr in a closed loop. Systems which use first and second exhaust gas composition sensors located upstream and downstream of a catalytic converter respectively are also in existence. In these systems these first sensors are used in active mode to calculate the concentration correction signal while the second sensors generally perform a passive control function and are used to detect any abnormalities in the functioning of the first sensors. | Mid | [
0.6383928571428571,
35.75,
20.25
]
|
In turbomachines such as steam turbines, stationary gas turbines or aircraft engines, different thermal expansions and the same relative movements may occur between two stator-side components which are in contact with each other, due to vibrations. A known component support between two stator-side components which are in contact with each other is outlined in FIG. 1. The components are outlined therein only as details and in highly simplified form. The one component 1 is a housing ring, which is oriented coaxially to a machine axis X running in the plane of the drawing. The second component is, for example, an intermediate turbine housing, which is also oriented coaxially to machine axis X and is supported on a support ring surface 6 of the first component via a plurality of bearing sections 2, 4 extending radially to the outside. To avoid tilting effects between bearing sections 2, 4 and support ring surface 6, a plurality of recesses 8, 10, 12 are introduced into support ring surface 6, which are overlapped by bearing sections 2, 4 with their side edge areas 14, 16. Recesses 8, 10, 12 are spaced evenly apart in the circumferential direction, and are each spaced apart over an uncontoured support ring surface section 18, 20 which accommodates bearing sections 2, 4. They are oriented radially to machine axis X and thus in the direction of movement of the intermediate turbine housing. Recesses 8, 10, 12 are each groove-like and have two steep side walls 22, 24, which are connected to each other via a flat base 26. Transition areas 28, 30 between side walls 22, 24 and support ring surface sections 18, 20 have a relatively sharp-edged design. Although tilting effects may be at least reduced with the aid of these groove-like recesses, the groove-like recesses nevertheless result in a change in the structural mechanics of the housing ring in the area of the support ring surface. In addition, stresses may be introduced into the housing ring when introducing the recesses. A turbomachine having an annular groove for accommodating a guide blade ring is illustrated in JP 5918213 A. The annular groove has a flat groove base and two steep side walls. Cavities are introduced into the transition areas between the side walls and the groove base. | Mid | [
0.6018518518518511,
32.5,
21.5
]
|
Q: Windows Phone 8 Facebook SDK for .NET Logout I was able to successfully login to Facebook and get required permissions for my Windows Phone 8 application using the tutorial here - http://facebooksdk.net/docs/phone/controls/login-ui-control/ Now, the login button control opens up a browser window and asks the user to login. Then the user logins and grants permissions to my app. Then the user is redirected back to my app on the phone and sees the login button changed to logout button. When the user will click on the logout button, the session data is removed from the loginbutton control. So my app sees the user as logged out. But when the user logs in again, he is not asked for his credentials and is directly logged in to his account - this is because the user actually never logged out of the web browser window in the Windows Phone application. So how do I logout the user from the browser control in my Windows Phone 8 application. All help is greatly appreciated! A: The user is not asked for his credentials because the Facebook authentication cookie is still present in the WebBrowser control. So to completely logout the user from Facebook, you need to clear the WebBrowser cookies. Unfortunately, there is no easy way for erasing cookies on Windows Phone 7. On Windows Phone 8 you just need to call ClearCookiesAsync: await new WebBrowser().ClearCookiesAsync(); Here is a tutorial that makes use of it: http://www.developer.nokia.com/Community/Wiki/Integrate_Facebook_to_Your_Windows_Phone_Application | High | [
0.6776611694152921,
28.25,
13.4375
]
|
Lanercost Lanercost is a village in the northern part of Cumbria, England. The settlement is in the civil parish of Burtholme, in the City of Carlisle local government district. Lanercost is known for the presence of Lanercost Priory and its proximity to Hadrian's Wall. History Lanercost Priory was founded in 1165 as an Augustinian house of Canons. See also Listed buildings in Burtholme References External links Category:Villages in Cumbria Category:City of Carlisle | Low | [
0.48872180451127806,
32.5,
34
]
|
Ether-linked lysophospholipids initiate insulin secretion. Lysophospholipids may mediate effects of phospholipase A2 activation on hormone release. Phospholipase A2 activation may be a pivotal step in glucose-induced insulin secretion; however, recent studies have focused on only one by-product (arachidonic acid). To examine the possible role of the other by-product (lysophospholipids), the lysoderivatives of alkylacyl- (ether linked) or diacylphospholipids were applied to rat islets in static incubations. 1-O-alkyl-2-lyso-sn-glyceryl-3-phosphorylcholine [lyso-PAF, the precursor of platelet-activating factor (PAF)] or lysophosphatidylcholine initiated insulin release at 1.7 mM glucose. Two preparations of PAF itself (0.005-5000 ng/ml) were without effect at 1.7 or 16.7 mM glucose, but PAF was nearly equipotent to lyso-PAF at greater than or equal to 20 micrograms/ml. A precursor-product relationship was suggested because the precursors (alkylacyl- or diacylglyceryl-phosphorylcholine) of all three active metabolites were inactive. The stimulatory effect of lyso-PAF is largely independent of any toxic or lytic effect, being biphasic, reversible, unassociated with impairment of the subsequent physiologic functioning of treated islets, and inhibitable (by Ni2+, La3+, or nordihydroguaiaretic acid but not by other lipoxygenase inhibitors). It also occurred at threshold concentrations at which islet morphology and 51Cr retention were preserved. Furthermore, lyso-PAF-induced insulin secretion was markedly impaired by reduced ambient temperature (16 degrees C) or by the impermeant anion isethionate, further implying initiation of true exocytotic granule release and fission. Lyso-PAF (but not arachidonic acid) also circumvented the inhibition of glucose-induced insulin release caused by phospholipase inhibitors. Generation of endogenous lysophospholipids through exogenous application of phospholipase A2 also initiated insulin release, an effect responding to a panel of potential inhibitors identically to that induced by exogenously provided lysophospholipids. We propose that glucose activates phospholipase A2 in the pancreatic islet, leading to the generation of lysophospholipids; the latter may couple energy production to insulin release, at least in part via the promotion of Ca2+ translocation. | High | [
0.6817576564580561,
32,
14.9375
]
|
I’ve been anticipating this build for over a month. I’ve always felt this would be the most important part of the interior. When in “sleep mode” the bed will take up at least 50% of living space in the van, so a good design is very important. I went through what felt like hundreds of designs. I flip flopped between simple, plywood sheet based beds and eccentric, pulley based beds. I sweated over materials, size, strength, and just about everything else you can think of. Eventually I found exactly what I was looking for when I stumbled on VanDogTraveller’s great sliding bed, which I later found out was inspired by the classic Deep Red build. It had everything I wanted. When it wasn’t a full size bed it doubled as a nearly full-sized couch. It had a huge amount of easy access storage and was also a beautiful piece of furniture compared to most plywood beds I had been considering. So after mocking up the bed in SketchUp (which you can see here), I knew this was the bed for me. After I had finished the shell of the van (insulation, walls, ceiling, floor, etc), the next step was the bed. Because I’m taking a “fly by the seat of my pants” approach to this build out, I wanted to finish the bed before planning the rest of the interior. It would be the largest piece in the van, so everything would need to be built around it. First step was acquiring materials. Here is my material breakdown: 1×3 – Qty 11 2×3 – Qty 6 2×4 – Qty 2 3″ Deck Screws – 1 lb 1″ Screws – 1/2 lb Hinges (w/ 1/4″ screws) – Qty 4 After I had everything, I set-up shop on the grass outside of our apartment. I parked the van on the gravel beside the road. I was lucky I had all this space available to me, as it made the process much easier. Had I been forced to build the bed IN the van, it would have been a frustrating experience. With all this space, it was rather easy. I got my laptop out with my SketchUp design and got to work. I saw right away I forgot to factor in the wheel well. Silly mistake, but luckily it was a rather easy modification to frame around. After taking measurements for the wheel well, I got to work cutting wood for the frame. I got all the pieces cut and assembled them on the grass using 3″ screws (overkill but why not? I already had them). I tried to use at least three screws in each butt joint. Once the pieces were assembled I put them into the van and made sure my measurements were accurate. This was when I really kicked myself. When I set the frame inside the van I realized that even the TOP of my frame didn’t have enough clearance to clear the wheel well. I thought for a few minutes on this one. I knew I didn’t have the clearance to make the frame taller. It would already be tight with the 8″ mattress we planned on using. I could either frame around it like I did on the bottom, or I could piece out so the frame rested on the wheel well. I decided to go with the latter because of how the bed would sit in the cab. The cab of the van isn’t a perfect rectangle (as you probably guessed), it’s more egg shaped. The middle is several inches wider then the front and rear. In order to maximize space, the bed would need to sit at a slight angle so that the back is always touching the wall. Framing around this would be somewhat difficult. So I made the cut, dry fit the frame to the wheel well, cut again, dry fit, then sanded until it was perfect. I’m pretty happy with my decision now, as this doesn’t seem to have affected the stability or comfort of the bed in any way. The detailed picture below is after the first cut. . Once the frame was done, I got to work on the first lid piece. This design required me to create two lid pieces. One would be attached to the frame and act as a lid, the other would slide out freely and only be attached to two legs on the front. Each would consist of two 1×3’s running the length of the frame. The back of the first lid would be attached to the frame with hinges and the back of the second would be floating, while the slates from the first lid would hold it in place. I spaced each slat one inch apart using a square. Then I used a pencil to trace the slat, and then used the square to space another inch past that. That allowed me to finish the first lid and be confident I would have the spacing correct for the second. I also had to keep one slat longer than the rest to act as a handle for opening the lid. Since the first lid would be attached to the frame with hinges, this is where I wanted the handle. Now I would be able to access the storage space underneath the bed. After the first lid was finished I framed out the second lid. Since the long 1×3 in the back acted as a runner board, this had to be done in place. I then created the front legs using two small pieces of 2×4 and a 2×3 running the length of the frame for support. This ended up weighing more then I would like and it’s actually a bit of a struggle to lift. UPDATE: I ended up removing the 2×3. I added a third leg in the middle for support. After both lids were finished I secured the hinges. I used 3″ non-mortise hinges . At first I only used two, but because of the weight of the lids combined with the front legs, I decided to add two more. After that it was just a matter of sanding the whole thing down to make it look nice (including rounding the handle) and waxing the slats and lid pieces so they would slide freely. Later I will add pine paneling to the front and sides to conceal the storage to have a more finished look. This slideshow requires JavaScript. What do you guys think? I’m pretty happy with it how it turned out! Can’t wait to get the mattress and try it out. If you have any questions leave a comment below! | Mid | [
0.594724220623501,
31,
21.125
]
|
Q: My app icon is not showing on some devices I just published my application on play store and I notice that some Samsung device does not display the icon of my application.they assert the default icon of android studio. Have you an idea what can cause that? i'm confused <application android:name=".MyApp" android:allowBackup="true" android:icon="@mipmap/ic_launcher" android:roundIcon="@mipmap/ic_launcher_round" android:label="@string/app_name" android:theme="@style/AppTheme"> .... </application> A: Try This; File -> New -> Image Asset -> Launcher Icons (Adaptive and Legacy) For more information; https://proandroiddev.com/android-adaptive-icons-are-easier-than-you-think-3c66be2dd4dd https://developer.android.com/guide/practices/ui_guidelines/icon_design_adaptive A: Remove this line.. android:roundIcon="@mipmap/ic_launcher_round" A: I thing some device had oreo and pie OS that why device does not show the correct app icon.Now you can delete ic_launcher_round and ic_launcher from mipmap-anydpi-v26 please check this link Launcher Icon is not Shown in Oreo 8.0/8.1 | Mid | [
0.6338383838383831,
31.375,
18.125
]
|
Barriere: a decade later The McLure fires in July 2003 was a devastating, far-reaching event with serious impacts. Photograph By File photo Marking the 10th anniversary of the 2003 Barriere wildfire isn't something to celebrate, like a wedding date or a birthday. It's not a happy occasion to remember; it's not an excuse to revel in memories that provoke smiles and laughs. It was a devastating, far-reaching event with serious impacts. Looking back after a decade has passed gives us a chance to see how a community has proceeded after the fires caused physical destruction and emotional distress; more than 26,000 hectares burned, 72 homes were lost and a mill that provided 180 jobs fell to ash. The summer of 2003 was a scorcher that dried up the fields and forests, leaving them vulnerable to the smallest spark. Near McLure, that spark came in the form of a cigarette recklessly tossed out by Michael Barre. The Daily News is looking at how the community has recovered, lessons learned, help given and promises made. It's a look back at the impact of wildfires that still threaten the region every summer when the sun blazes hot and the rain doesn't fall. BARRIERE RESIDENTS' LIVES WENT ON AFTER FIRES WENT OUT A decade has passed since the air around Barriere was choked with smoke, the hillsides glowed with flame and people were forced to flee their homes. The 2003 wildfire that wiped out the Tolko mill and several homes didn't destroy the community's spirit, and most rebuilt their buildings and their lives after the fire cooled and the smoke cleared. Keith and Ann Willis had already been burned out of their home by a forest fire in 2000 when they were evacuated from their Barriere residence three years later. Their house survived the fire and 10 years later, the couple still lives in Barriere. But they downsized to a smaller house closer to downtown. In the end, the lost a freezer, a fridge and replaced a kitchen floor. The community lost a sawmill and a grocery store, as well as a few other businesses and some homes. Keith Willis worked for Argo Road maintenance and retired last year. He still helps out in winter, but is now free to go fishing in warmer weather. Friends whose house burned at nearby Badger Creek have rebuilt, but probably have him to thank for getting out. Willis said he's not certain what compelled him to call them about the evacuation orders, but he did. The family hadn't been notified. "I called them on the phone and told them to get the hell out of there," he said. "Everything was kind of disorganized. Nobody knew what was going on. When we were in Kamloops, we were being told Barriere was burnt. It wasn't." The fire burned in odd ways. Argo's location wasn't touched, but the trailer next door was gutted. The fire burned around a church and Jehovah's Witness hall. Willis credited the people who stayed to fight the fire with saving Barriere. In the end, it didn't really affect him, he said. "It's past. Can't change anything." Michael Machny was one of the Tolko sawmill workers whose job disappeared in the wildfire. "I couldn't find a job. No one was hiring for eight months. Then I worked for Canfor in Vavenby for a couple of years," he said. Many of his co-workers moved to Salmon Arm or Merritt. "They sold their places and just took off. The ones who stayed for different reasons, took on different jobs. They went to Alberta, they commuted to feed their families," he said. "I think the suicide rate went up and drug consumption. I know several people who committed suicide after. And the crime rate went up." Eventually, Machny shifted into a career in finance. Working at the mill was always supposed to be temporary, but the fire forced him to seek other options. He studied business administration at Thompson Rivers University and now works as a financial adviser in Kamloops. Machny still lives in Barriere, not by choice but because he hasn't found a buyer for his home. "One part is the housing market, the other part is they haven't done much there in the past 10 years. If you look at Barriere today, you have the impression the fire happened yesterday," he said. "You still see some devastation." For him, the attraction was the wilderness around the community. But he would like to move to a rural house closer to his job in Kamloops. Ken MacDougall lost three of his 65 cattle, two or three kilometres of fencing and a lot of timber to the wildfire. He now has 50 head of cattle and Community Futures helped rebuild the fence to keep them contained. At the time of the fire, ranchers were reeling from the economic impacts of mad cow disease. Losing thousands of hectares of grazing land and, in some cases, buildings and livestock, just added to an already bad situation. Those who held out, however, did get back on their feet. MacDougall noticed that once the soil recovered, the forage improved and new growth sprouted where everything was blackened. "After the fire, I went out and thought there would never be anything. Then there was a clay slime on top. Over a couple of years, that breaks down and there's new soil and new plants," he said. "Definitely there was a year where there was nothing. A neighbour let me go up on the range the following year. Now I'm back on it." He has returned to growing alfalfa and orchard grass and sees more deer and other wildlife returning each year. "The actual forage is a little better. That'll change as the trees grow back. So in another 10 years or so, it'll be back to what it was before the fire." While his cattle have lots to eat now that the forage is flourishing, there is one downside. There are no trees to shade his cows. The loss of timber on his land hurt. At the time, prices were high and the extra income helped. Then he lost trees to the flames and prices fell for what little he had left. The Mitchell Cattle Company lost between 10 and 13 cattle and the feed on three grazing ranges. "We were really lucky, nothing burned on our farm but one tree," said Anja Mitchell. Keeping track of 350 cows plus calves and bulls in three different ranges during the wildfires was a daunting task and they even used helicopters to find clusters of cattle standing together. "It's amazing how many survived," she said. Mitchell said they even forged a new friendship with an Alberta farmer who provided hay when the range couldn't. They still keep in touch. The fire coupled with the mad cow scare was a double whammy to the ranch, but they have kept going. "We've lost a lot, at times, as have others. But we've changed our management plan and it's helping," she said. "When bad things happen, opportunities come along with them. You regroup and you make the best of it." MCLURE FIRE DESTROYED, BUT ALSO RENEWED, THE LAND "It could happen again. It really could. You see what happens in the States right now, but it could happen here." Peter Lishman, Kamloops forest district operations manager, saw first-hand what occurred when 26,324 hectares of land went up in flames in the 2003 McLure wildfire. Fire is a natural event in nature, and even the most human-controlled efforts will only stave it off for so long. In 2003, a lengthy bout of parching heat combined with a tossed cigarette butt and the fire was unleashed. Lishman said a natural fire would have burned more in patches if there were regular, smaller flare-ups. But there was so much for the flames to feed on, that the 2003 blaze consumed huge areas and it jumped back and forth across the North Thompson River. The McLure fire, which reached to Barriere and Louis Creek, charred 26,324 hectares of mostly forested or agricultural land and burned 3.6 million cubic metres of wood - 63 per cent of which was in timber harvest land base. About 600 kilometres of agricultural fencing was destroyed, roughly 200 kilometres of it around Barriere. Barriere rancher Ludie Proulx lost some of his 150 head of cattle to the wildfires and half his grazing range burned. When the trees burned, it left parts of the range less protected and more vulnerable to drying out. "It's been a tough 10 years," he said. Greg Tegart, Interior B.C. regional manager for the Ministry of Agriculture, said when the soil is as dry as it was in 2003, fire can get extremely hot, extremely fast. It burns into the root zones of the grasses as well as the trees, and will even turn some of the soil's organic matter to ash. The short-term consequence is dust and erosion, and a change in vegetation. "Mother Nature is pretty resilient in a lot of respects. There is secondary or primary succession. The plant species start over again if they're there," he said. "You will have some species that regrow if the roots have not been completely burnt out." But even under the ashes, by the year following the wildfire, there were sprouts of green pushing through, Tegart said. Often those plants are annual species, which typically grow first on a fire-ravaged site. But there's also a vulnerability for weeds to set in. "If the natural growth is gone, there's an opening for other species to take over. It can take several decades for some species to return, depending on the conditions," he said. "Any of the grass species that come back in will provide some forage for cattle." Irrigated fields would have less chance of fire getting into the plant roots, Tegart said. Those crops could be re-established. "The difference is farmland, you've lost a fair amount of infrastructure through the fire and less quality or loss of crop. But you would be able to redeploy your cultivation to jump into the game next year." After the fire, efforts were made to replace some of the fencing while forage began to flourish. Ranchers, already struggling due to mad cow disease export restrictions, were suspended from using Crown range for a year. They also lost livestock or had animals with health problems to deal with, and those with private land timber saw that burned up, too. But along with the new growth coming from the ground came renewed wildlife to graze on it. Proulx has seen that, estimating he'd spot 15 to 20 deer in the hay fields before the wildfire and now can count up to 120 at a time. Some of the undergrowth has come back too well, he said. "There are places where jack pine and lodgepole pine are so thick you can't get in there," he said. Chris Procter, regional wildlife biologist with the Ministry of Forests, Lands and Natural Resource Operations, said the 2003 wildfire boosted the number of deer and moose, and subsequently wolves, cougars, bears and other wildlife. "In a nutshell, it's been great for forage production, especially some key forage plants for deer and moose," he said. Food has been so abundant that deer are regularly giving birth to two fawns and having a high survival rate. "There's wolves there now. When you have more prey, there's generally more predators," said Procter. Smaller mammals, including rodents, bobcats and foxes, also benefited from the after-fire flourish. So have birds of prey and some other bird species. It hasn't been so good for creatures that rely on older growth, like flammulated owls and Lewis's woodpecker, which was listed as endangered in 2006. Along with the increase in wildlife has come an increase in hunters and poachers. Procter said motor vehicle restrictions have had to be brought in to the burn areas to ensure hunting limits are respected. Eventually, the shrubs will get taller, less palatable and less nutritious for deer and moose and their numbers will drop, but that might not be for another 10 years or so, he said. By that stage, the trees are getting big enough to provide more protective cover. Salvage logging was done for two years following the fires, but there was a move to get tree seedlings into the ground as soon as possible, said Lishman. "We had a fair amount of seedlings ready. We did most of the planting within three months of the fire. The fire started in August, was out by Christmas and we were planting by March," he said. "By planting, you get about a 10-year jump on nature. That fire burned so hot, it affected a lot of seed sources." More than one million trees went into the ground for future logging and for erosion control around creeks, and natural aspens are coming back. There were also areas seeded with forage for cattle and wildlife, he said. Ten years later, most of the land around Barriere is back to its former use. Proulx said he didn't get hit with the emotional impact of the fires until months after the smoke had cleared. Even now, he is not sure how to describe his ambivalence about his post-fire life. "I don't know if I'm any better off or worse. . . . But I talked to a guy who said it probably took three years off his life," he said. | Low | [
0.45965770171149106,
23.5,
27.625
]
|
We build an otherwise-standard business cycle model with housework, calibrated consistently with data on time use, in order to discipline consumption-hours complementarity and relate its strength to the size of fiscal multipliers. We show that if substitutability between home and market goods is calibrated on the empirically relevant range, consumption-hours complementarity is large and the model generates fiscal multipliers that agree with the evidence. Hence, our analysis supports the relevance of consumption-hours complementarity for fiscal multipliers. However, we also find that explicitly modeling the home sector is more appealing than restricting to the consumption-leisure margin and/or to the preferences proposed by Greenwood, Hercowitz and Huffman (1988). A housework model can imply substantial complementarity, without low wealth effects contradicting the microeconomic evidence. | High | [
0.6795366795366791,
33,
15.5625
]
|
Q: Compiling a python script with Pyinstaller via terminal I am using macOS, and Anaconda 3 in order to manage my libraries and write the script. I want to create an executable for my script. I am using Pyinstaller in Terminal to run the command: pyinstaller --onefile /Directory/file.py However, Terminal returns this error: File "/anaconda3/lib/python3.6/site-packages/PyInstaller/hooks/hook-sysconfig.py", line 42, in <module> hiddenimports = [sysconfig._get_sysconfigdata_name()] TypeError: _get_sysconfigdata_name() missing 1 required positional argument: 'check_exists' How can I solve this problem; thank you for your assistance. A: This is a known issue in older versions of Anaconda. You can try to update Anaconda (in the conda terminal): conda update conda You can also try to remove the sysconfig._get_sysconfigdata_name() from the hiddenimports list in your .spec file and instead add import sysconfig in your .py file. The following issue documentation on the pyinstaller github page may be of further help: https://github.com/pyinstaller/pyinstaller/issues/3192 | High | [
0.6666666666666661,
28.375,
14.1875
]
|
Charity concert: Co-organizers: We recommend that you: - Order two newly released organ CD's " 18 Leipzig Chorales " with the recording of the 18 Leipziger Choräle (BWV 651-658 / 659-668) by Johann Sebastian Bach (1685 - 1750), performed by Czech Organist and Composer Irena Kosíková. Recording preview is available here: - Order the newly produced CD of the orchestral live recording " MAKANNA " (Irena Kosíková; Jan Talich - conductor, František Brikcius - cello, Jan Židlický - narrator, Talich Chamber Orchestra), held under the auspices of Sir Tom Stoppard and Václav Havel as part of the 110th anniversary of the birth of the Jewish writer Jiří Weil (1900 - 1959). Concert preview is available here: - Order two newly released organ CD's "" with the recording of the 18 Leipziger Choräle (BWV 651-658 / 659-668) by(1685 - 1750), performed by Czech Organist and Composer. Recording preview is available here: http://www.YouTube.com/IrenaKosikova - Order the newly produced CD of the orchestral live recording "" (- conductor,- cello,- narrator,), held under the auspices ofandas part of the 110th anniversary of the birth of the Jewish writer Jiří Weil (1900 - 1959). Concert preview is available here: http://www.YouTube.com/FrantisekBrikcius - Order the CD with the live concert recording " Prague - Brno: 6 Contemporary Composers for Solo Cello " (Jiří Matys, Petr Hejný, Jan Jirásek, Luboš Fišer, Miloš Štědroň, Irena Kosíková; František Brikcius - cello) introducing six leading composers from Prague and Brno. The programme was released as part of the concert tour both in the Czech Republic and abroad (Austria, Belgium, Bulgaria, France, Italy, Russia and the United Kingdom) under the auspices of Václav Havel. CD "18 Leipzig Chorales" 1/2 - Johann Sebastian Bach: 18 Leipziger Choräle, BWV 651-658 (1/2) Irena Kosíková - Organ CD "18 Leipzig Chorales" 2/2 - Johann Sebastian Bach: 18 Leipziger Choräle, BWV 659-668 (2/2) Irena Kosíková - Organ 19.99 EUR / 2 CD (+ shipping & handling fees) CD "MAKANNA" - Irena Kosíková: MAKANNA Jan Talich - Conductor František Brikcius - Cello Jan Židlický - Narrator & Talich Chamber Orchestra n/a 14.99 EUR (+ shipping & handling fees) CD " Prague - Brno: 6 Contemporary Composers for Solo Cello " - Jiří Matys: Fantasie a Rondo (1982) - Petr Hejný: Metal Sonata (1983) - Jan Jirásek: Dilema (1987) - Luboš Fišer: Sonata (1987) - Miloš Štědroň: Dances of King Lear (1995) - Irena Kosíková: Stopy (2004) František Brikcius - Cello 9.99 EUR (+ shipping & handling fees) Within 48 hours you will receive an email confirming your order and your purchase will be delivered within 2 - 7 working days depending on your location. CDs are available at the festival box office, open cca 90 minutes (from 6 p.m.) before the concert starts (7:30 p.m.) at the venue (entry hall of the Stone Bell House). ♫ Both albums are available online via To order send the number/name of requested CDs and your full address to our email: [email protected] Within 48 hours you will receive an email confirming your order and your purchase will be delivered within 2 - 7 working days depending on your location.CDs are available at the festival box office, open cca 90 minutes (from 6 p.m.) before the concert starts (7:30 p.m.) at the venue (entry hall of the Stone Bell House).♫ Both albums are available online via iTunes and Supraphonline - Order the CD with the live concert recording "" (- cello) introducing six leading composers from Prague and Brno. The programme was released as part of the concert tour both in the Czech Republic and abroad (Austria, Belgium, Bulgaria, France, Italy, Russia and the United Kingdom) under the auspices of | High | [
0.6592797783933511,
29.75,
15.375
]
|
[Factors associated with failure of endoscopic therapy in gastric ulcer bleeding]. Endoscopic therapy is an effective technique in the control of bleeding due to peptic ulcer. However, bleeding persists or recurs in as many as 10-30% of patients. Gastric and duodenal ulcers present different clinical and endoscopic features and consequently the efficacy of endoscopic therapy and the factors associated with its failure should be studied separately. To analyze the efficacy of endoscopic therapy in patients at high risk of persistent or recurrent bleeding due to gastric ulcer and to identify the factors associated with the failure of this technique. We performed a retrospective study based on a clinical intervention protocol. Two hundred eight patients admitted for bleeding secondary to gastric ulcer with active bleeding or stigmas of recent bleeding who received endoscopic therapy between January 1992 and December 2001 were analyzed. Clinical, laboratory and endoscopic variables on admission, as well as the medical treatment and endoscopic procedure applied, were registered. Endoscopy was performed within 12 hours of admission. Patients were classified according to their response to endoscopic therapy: a) patients with limited bleeding, and b) patients with persistent or recurrent bleeding due to therapeutic failure. Intervention in patients with therapeutic failure was performed according to a previously established protocol. Variables that were statistically significant in the univariate analysis were included in a logistic regression model to identify those with an independent predictive value for failure of endoscopic therapy. Definitive hemostasis was achieved after initial therapy in 181 patients (87%). The efficacy of a second procedure increased the percentage of hemostasis to 91% of the patients. In the logistic regression model, the only variables that were independently associated with initial therapeutic failure were: hemodynamic status on admission (p = 0.016; OR = 3.99), the need for transfusion of blood products prior to endoscopy (p = 0.025; OR = 3.48), upper localization of the gastric ulcer (p = 0.050; OR = 3.08) and unsatisfactory endoscopic therapy (p = 0.009; OR = 17.39). These variables could contribute to the early identification of a subgroup of patients, which would enable us to increase medical-surgical surveillance and offer them other therapeutic alternatives. | High | [
0.736070381231671,
31.375,
11.25
]
|
Does gastric banding for morbid obesity reduce or increase gastroesophageal reflux? Conflicting results regarding the influence of laparoscopic adjustable gastric banding (LAGB) on gastroesophageal reflux disease (GERD) have been published. A prospective follow-up study was conducted in 31 patients (male/female 5/26, mean age 44 +/- 11 SD years) with 24-hour pH and manometry recordings, symptom assessment, and upper GI endoscopy. Total number of reflux episodes decreased from a mean value of 44.6 +/- 23.7 SD preoperatively to 22.9 +/- 17.1 postoperatively (P=0.0006), after a median follow-up time of 19 months (range 7-32 months). Total reflux time decreased from 9.5% +/- 6.2% to 3.5% +/- 3.7%, P=0.0009, and DeMeester score decreased from 38.5 +/- 24.9 to 18.6 +/- 20.4, P=0.03. Symptomatic patients decreased from 48.4% preoperatively to 16.1% postoperatively (P=0.01), medication for GERD decreased from 35.5% to 12.9% (P=0.05), and the diagnosis of GERD on 24-hour pH recordings decreased from 77.4% to 37.5% (P=0.01). There were no pouch enlargements seen on upper GI endoscopy. Esophageal motility was unchanged, but 36% of the patients had incomplete relaxation of the lower esophageal sphincter following the operation (P<0.0001). Mean BMI decreased from 46.0 +/- 5.46 to 38.4 +/- 6.45 (P<0.0001), excess weight from 60.0 kg +/- 18.58 kg, 44.9% +/- 6.56% to 38.4 kg +/- 20.27 kg, 28.4% +/- 10.97% (P<0.0001). No association between the postoperative diagnosis of GERD and the amount of weight loss could be found. The correctly placed gastric band is an effective anti-reflux barrier in the short term. Long-term results have to be awaited. | High | [
0.674157303370786,
37.5,
18.125
]
|
Surface-Engineered MXenes: Electric Field Control of Magnetism and Enhanced Magnetic Anisotropy. Controlling magnetism in two-dimensional (2D) materials via electric fields and doping enables robust long-range order by providing an external mechanism to modulate magnetic exchange interactions and anisotropy. In this report, we predict that transition metal carbide and nitride MXenes are promising candidates for controllable magnetic 2D materials. The surface terminations introduced during synthesis act as chemical dopants that influence the electronic structure, enabling controllable magnetic order. We show ground-state magnetic ordering in Janus M2XO xF2- x (M is an early transition metal, X is carbon or nitrogen, and x = 0.5, 1, or 1.5) with asymmetric surface functionalization, where local structural and chemical disorder induces magnetic ordering in some systems that are nonmagnetic or weakly magnetic in their pristine form. The resulting magnetic states of these noncentrosymmetric structures can be robustly switched and stabilized by tuning the interlayer exchange couplings with small applied electric fields. Furthermore, bond directionality is enhanced by Janus functionalization, resulting in improved magnetic anisotropy, which is essential to stable 2D magnetic ordering. The mixed termination-induced anisotropy leads to robust Ising ferromagnetism with an out-of-plane easy axis over the full range of relevant termination compositions for Janus Mn2N. Janus Cr2C, V2C, and Ti2C were found to be robustly antiferromagnetic. Our results provide a strategy for exploiting asymmetric surface functionalization to achieve room-temperature nanoscale magnetism under ambient conditions in MXenes with currently available synthesis techniques. | High | [
0.679045092838196,
32,
15.125
]
|
The humble journals, musings and explorations of the most endlessly intrigued person alive. Staring the honest and modest David 'Pinky-Von-Sox' Tieck Monday, November 2, 2015 If you ask me he'll achieve it too Harry had always wanted to deregulate the beautician industry. He wasn't sure why. But he was sure why he wasn't sure why, because: - he wasn't a beautician - he didn't work in the beautician industry - he didn't know any beauticians - he wasn't interested in meeting any beauticians - he wasn't interested in learning about what beauticians do - he thought the word 'beautician' sounded harsh and unpleasant - like clinical and possibly even medical - if it was medical he didn't want to get what ever disease you'd have to get to require getting beauticianed - and how would they even inform you that you needed it? - 'we've looked at your test results, do you have a will?' - that just sounds horrible - and he found horrible sounding things unpleasant - and feeling unpleasant fed into his bitter distaste of the apple picking 'for fun' movement. - because it often involved whistling, humming, and other mouth noises occasionally associated with enjoyment - which reminded him of the fact that as a small boy his father was whistling when he chopped down the tree that he had once coveted building a tree house in - and in that tree house he was planning on one day cutting open the dead baby hawk that he had found behind the school playground - and was keeping fresh in the home freezer in a tuppaware labeled 'moms casserole' - something no one wanted to eat - because mom had run off with the paperboy seventeen years earlier - so this would have to be REALLY old casserole - plus it wasn't in there for the first sixteen years she was gone - so it might even be a tad moldy - plus the paper boy still delivered the paper with a daily wad of spit on the main headline - he was the one who stole a married women, why was he pissed off? - and so now because of these fucking beauticians Harry didn't acquire tree house building skills, doesn't know what the inside of a baby hawk looks like, and associates even the happiest of news headlines with phlegm - which is another word he finds harsh and unpleasant - because it was a throat full of phlegm that kept him from picking apples for fun that one time - meaning he had to get paid for it instead - a job he's now held for twelve years and finds mildly unpleasant in stormy weather No comments: Post a Comment What smell should I invent next? About Me Hi I'm David Tieck, an author/comedian/artist from Sydney, Australia. This is my blog. I use it as an outlet for my peculiar mind. Come on in and feel free to add to the lovely absurdity in anyway that you are so inspired. | Low | [
0.5149253731343281,
34.5,
32.5
]
|
You all know that I adore anything vintage and bridal themed. I love looking at the different styles of vintage wedding gowns and wedding cakes. The detailing is usually splendid, casting a look at the skills of the old world experts who painstakingly crafted their goods to absolute perfection. Finding modern day versions gives me such joy because I love the thought of the best parts of yesterday being repeated tomorrow; what was great once can always be great again. Amen. Today, I’ve been admiring the different styles of wedding cakes from two separate companies; Zoe Clark Cakes and Dunn’s Bakery. So many of their creations have caught my attention but here are some of my particular favourites: Zoe Clark’s Pink Vintage LaceCake above is breathtaking. The icing looks intricate and pretty, creating the delicate lace effect which could match many a bridal gown in its simplicity and grace. In contrast, Dunn’s Bakery have the even more vintage looking Cameo Cake below, which could rival any Regency decorated wedding venues for a showstopper award! And if you’re lucky enough to serve your wedding meal on Wedgewood china, this cake is a must for you… For a more ‘girlie’ gloriousness, I love the Ivory Ruffle creation below, from Zoe Clark. She gets top marks for evoking my nostalgia for ’50s prom dresses! I desperately want to run my fingers through the ruffles like I would across a frilly prom skirt! Of course, that would completely destroy the stunning visual effect, but I suspect licking the icing from my hands afterwards would more than compensate 😉 You’ll find yet more Hollywood glamour in Zoe Clark’s Bow & Brooch Cake, which is a favourite coupling amongst cake makers. It’s amazing what a bit of bling and ribbon can do to not only jazz up an iced cake but also give it that ever-beautiful vintage appeal: If 1950s ruffles aren’t your thing, and you think brooches are for grandmothers, there’s always the 1970s if you want brighter inspiration. ’70s wedding cakes were famous for their high tiers and colourful accessories – from edible flowers to vibrant ribbons. It may sound kitsch, but these cakes can still look stylish in today’s modern world. All it takes is a little imagination – and it looks like Dunn’s Bakery can probably find a perfect balance of colour and style to suit your tastes. Check out their Rosetrellis design below: Not for you? What about the regal looking Dunstan (pictured below) instead? Not as detailed as the Rosetrellis, you still get the impact of the separate tiers and a very eye-catching cake topper… Alternatively, if they’re not quite vintage enough for you, but you still want something similar, there’s Dunn Bakery’s Cascade cake (below). With it’s pink roses and pipework icing, it may be the perfect compromise! Otherwise, it may be worth speaking to Zoe Clark about a more specific theme. I love what she’s created below – a dress inspired by a wedding gown design! This is her Caroline Castigliano Dress Inspired Cake and it’s beautiful… All this cake talk has made me hugry … it’s time to dig a gateau from the freezer or find a nice tea shop for a slice of Victoria Sponge. Yummy! | Mid | [
0.615711252653927,
36.25,
22.625
]
|
Ferrocene Derived Bifunctional Phosphine-Catalyzed Asymmetric Oxa-[4+2] Cycloaddition of α-Substituted Allenones with Enones. An efficient ferrocene-derived bifunctional phosphine-catalyzed enantioselective oxa-[4+2] cycloaddition of α-substituted allenones with a broad range of enones is investigated for the preparation of stereodefined dihydropyrans in good to excellent yields (up to 99 %) and excellent enantioselectivity (up to 99 % ee). Furthermore, a series of valuable chiral polyheterocyclic frameworks can be efficiently achieved in good yields with excellent enantioselectivities. | Mid | [
0.655462184873949,
29.25,
15.375
]
|
Lakeland Magic Basketball The Lakeland Magic is Lakeland’s very own NBA G League basketball team that will play as an affiliate of the Orlando Magic of the National Basketball Association (NBA). The team will play their home games at the RP Funding Center. Season ticket packages are now available for the 2017-18 season! | Low | [
0.47148288973384006,
31,
34.75
]
|
Simmons Reports First Quarter 2019 Earnings 32 Days ago PINE BLUFF, Ark., April 22, 2019 (GLOBE NEWSWIRE) -- Simmons First National Corporation (NASDAQ: SFNC) today announced net income of $47.7 million for the quarter ended March 31, 2019, compared to $51.3 million for the same period in 2018, a decrease of $3.6 million, or 7.1%. Diluted earnings per share were $0.51, a decrease of $0.04, or 7.3%, from the same period in 2018. Included in first quarter 2019 results was $1.4 million in net after-tax merger-related, early retirement program and branch right-sizing costs. Excluding the impact of these items, core earnings were $49.1 million for the quarter ended March 31, 2019, compared to $52.6 million for the quarter ended March 31, 2018, a decrease of $3.5 million, or 6.7%. Core diluted earnings per share were $0.53, a decrease of $0.04, or 7.0%, from the same period in 2018. “We had solid operating results in the first quarter. Revenue was affected by three significant items compared to the first quarter of 2018. Accretion income was down $4.6 million; debit card interchange income, primarily as a result of the Durbin rate cap, was down $2.8 million; and the gain on sale of securities was up $2.7 million, resulting in a net decrease of $4.7 million from the previous year,” said George A. Makris Jr., Chairman and CEO. Makris continued, “We would also like to welcome our newest customers and associates from the Reliance Bank merger into the Simmons family. We closed the transaction Friday, April 12, 2019, and performed the systems conversion over that weekend. We are excited about our growth opportunities in the St. Louis market due to our increased presence.” Selected Highlights: 1st QTR 2019 4th QTR 2018 1st QTR 2018 Net income $47.7 million $55.6 million $51.3 million Diluted earnings per share $0.51 $0.60 $0.55 Return on avg assets 1.19% 1.35% 1.38% Return on avg common equity 8.60% 9.98% 9.90% Return on tangible common equity 15.34% 17.96% 18.77% Core earnings(1) $49.1 million $56.5 million $52.6 million Diluted core earnings per share(1) $0.53 $0.61 $0.57 Core return on avg assets(1) 1.22% 1.37% 1.41% Core return on avg common equity(1) 8.85% 10.13% 10.15% Core return on tangible common equity(1) 15.76% 18.21% 19.23% Efficiency ratio(2) 56.76% 51.99% 53.24% Core earnings excludes non-core items, and is a non-GAAP measurement. Efficiency ratio is noninterest expense before foreclosed property expense, amortization of intangibles as a percent of net interest income (fully taxable equivalent) and noninterest revenues, excluding gains and losses from securities transactions and non-core items. Loans (In billions) 1st Qtr 2019 4th Qtr 2018 1st Qtr 2018 Total loans $11.7 $11.7 $11.0 Legacy loans (excludes loans acquired) $8.7 $8.4 $6.3 Loans acquired $3.0 $3.3 $4.7 Total loans, including those acquired, were $11.7 billion at March 31, 2019 an increase of $753.4 million, or 6.9%, compared to $11.0 billion at March 31, 2018. On a linked-quarter basis (March 31, 2019 compared to December 31, 2018), total loans remained flat at $11.7 billion. The seasonal decrease in the credit card and agricultural portfolios was $40.4 million. Loans approved and ready to close totaled $473.3 million at March 31, 2019 compared to $277.5 million as of year-end. “Based on our current loan pipeline, we estimate loan growth in the 5% range for 2019,” said Makris. Deposits (In billions) 1st Qtr 2019 4th Qtr 2018 1st Qtr 2018 Total deposits $12.0 $12.4 $11.7 Non-time deposits $9.3 $9.5 $9.5 Time deposits $2.7 $2.9 $2.2 Total deposits were $12.0 billion at March 31, 2019, an increase of $332.6 million, or 2.9%, since March 31, 2018. Total deposits decreased $409.2 million, or 3.3%, compared to December 31, 2018. During the quarter, brokered and public fund deposits decreased $557.2 million while core deposits increased $148.0 million. “Our cash balance was reduced as we eliminated some high cost deposits. We are very pleased with our growth in core deposits as we continue to emphasize relationship banking,” said Makris. The Company’s net interest income for the first quarter of 2019 was $137.0 million, an increase of $2.1 million, or 1.5%, from the same period of 2018. Included in interest income was the yield accretion recognized on loans acquired of $6.7 million and $11.3 million for the first quarters of 2019 and 2018, respectively. Net interest margin was 3.85% for the quarter ended March 31, 2019, a 9 basis point increase from the fourth quarter 2018. The Company’s core net interest margin, excluding the accretion, was 3.67% for the first quarter of 2019, a 1 basis point increase from the fourth quarter of 2018. Cost of interest bearing deposits was 1.31% for the first quarter of 2019, an 11 basis point increase from prior quarter. Non-Interest Income Non-interest income for the first quarter of 2019 was $33.8 million, a decrease of $3.8 million compared to the same period in the previous year. The decrease was primarily due to reductions in debit card fees and mortgage and SBA lending premium income. The interchange rate cap as established by the Durbin amendment became effective for the Company July 1, 2018, resulting in a $2.8 million reduction in debit card fees when compared to the first quarter of last year. Mortgage and SBA lending premium income decreased $1.1 million when compared to the same quarter in 2018. Mortgage lending income during the first quarter of 2019 was lower by $649,000 compared to 2018 and SBA premium income decreased by $476,000 due to fewer loan sales in the current quarter compared to the first quarter of 2018. During the first quarter, the Company sold approximately $197 million in securities which resulted in a gain of $2.7 million, as part of a bond portfolio analysis of expected cash flow changes. Non-Interest Expense Non-interest expense for the first quarter of 2019 was $101.4 million, an increase of $3.3 million compared to the first quarter of 2018. Included in this quarter were $1.9 million of pre-tax merger-related, early retirement program and branch right-sizing costs. Excluding these expenses, core non-interest expense was $99.5 million for the first quarter of 2019, an increase of $3.2 million compared to the same period in 2018. Software and technology costs increased approximately $1.8 million over the same period in the prior year. The Company’s Next Generation Banking technology initiative is progressing on schedule and the incremental IT expenditures during the first quarter were primarily related to this initiative. During the first quarter, the Company offered qualifying associates an early retirement option resulting in $355,000 of non-core expense. The Company projects an additional $2.5 million of expense related to these retirements in the second quarter of 2019 and expects ongoing net savings of approximately $4.4 million beginning in the third quarter of 2019. The efficiency ratio for the first quarter of 2019 was 56.76% compared to 53.24% for the same period in 2018. Asset Quality 1st Qtr 2019 4th Qtr 2018 3rd Qtr 2018 2nd Qtr 2018 1st Qtr 2018 Allowance for loan losses to total loans 0.68% 0.67% 0.68% 0.73% 0.75% Allowance for loan losses to non-performing loans 97% 164% 136% 115% 99% Non-performing loans to total loans 0.70% 0.41% 0.50% 0.63% 0.76% Net charge-off ratio (annualized) 0.20% 0.35% 0.36% 0.17% 0.24% - Net charge-off ratio excluding loan sale 0.12% All loans acquired are recorded at their discounted net present value; therefore, they are excluded from the computations of the asset quality ratios for the legacy loan portfolio, except for their inclusion in total assets. At March 31, 2019, the allowance for loan losses for legacy loans was $59.2 million. The allowance for loan losses for loans acquired was $1.3 million and the acquired loan discount credit mark was $42.4 million. The allowances for loan losses and credit marks provide a total of $103.0 million of coverage, which equates to a total coverage ratio of 0.87% of gross loans. The ratio of credit mark and related allowance to loans acquired was 1.41%. During the quarter, the Company identified loans specific to the acquired portfolio of Bank SNB’s Dallas market which were poorly structured or were poorly managed post-funding, and were primarily linked to an individual lender. As a result, the Company made a provision for acquired loans of $2.0 million related to the Bank SNB acquired pool of loans. Makris stated, “We have carefully reviewed these loans for potential losses and believe we have adequately identified any risk associated with the loans. Unfortunately, based on purchase accounting rules, the credit mark associated with the declining Bank SNB acquired pool is a standalone amount not related to Simmons’ overall allowance for loan losses and must be managed specific to that pool of loans.” Provision for loan losses for the first quarter of 2019 was $9.3 million, essentially flat when compared to March 31, 2018 and $335,000 less than the fourth quarter of 2018. Foreclosed Assets and Other Real Estate Owned At March 31, 2019, foreclosed assets and other real estate owned were $19.0 million, a decrease of $10.2 million, or 35.0%, compared to the same period in 2018 and a decrease of $6.6 million, or 25.9% from December 31, 2018. The composition of these assets is divided into three types: ($ in millions) 1st Qtr 2019 4th Qtr 2018 3rd Qtr 2018 2nd Qtr 2018 1st Qtr 2018 Closed bank branches, branch sites & associate relocation $7.6 $8.0 $9.6 $7.2 $8.1 Foreclosed assets - acquired $6.2 $11.5 $8.0 $13.2 $14.9 Foreclosed assets - legacy $5.2 $6.1 $5.1 $10.1 $6.1 Capital 1st Qtr 2019 4th Qtr 2018 3rd Qtr 2018 2nd Qtr 2018 1st Qtr 2018 Stockholders’ equity to total assets 14.3% 13.6% 13.4% 13.3% 13.5% Tangible common equity to tangible assets 9.0% 8.4% 8.1% 7.9% 7.9% Regulatory tier 1 leverage ratio 9.1% 8.8% 8.7% 8.6% 8.6% Regulatory total risk-based capital ratio 13.6% 13.3% 13.1% 13.7% 14.1% At March 31, 2019, common stockholders' equity was $2.3 billion. Book value per share was $24.87 and tangible book value per share was $14.78 at March 31, 2019, compared to $22.86 and $12.62, respectively, at March 31, 2018. Simmons First National Corporation Simmons First National Corporation is a financial holding company headquartered in Pine Bluff, Arkansas, with total assets of approximately $16.1 billion as of March 31, 2019, conducting financial operations in Arkansas, Colorado, Kansas, Missouri, Oklahoma, Tennessee and Texas. The Company, through its subsidiaries, offers comprehensive financial solutions delivered with a client-centric approach. The Company’s common stock trades on the NASDAQ Market under the symbol “SFNC.” Conference Call Management will conduct a live conference call to review this information beginning at 9:00 a.m. CDT on Tuesday, April 23, 2019. Interested persons can listen to this call by dialing toll-free 1-866-298-7926 (United States and Canada only) and asking for the Simmons First National Corporation conference call, conference ID 4557809. In addition, the call will be available live or in recorded version on the Company’s website at www.simmonsbank.com. Non-GAAP Financial Measures This press release contains financial information determined by methods other than in accordance with generally accepted accounting principles (GAAP). The Company’s management uses these non-GAAP financial measures in their analysis of the Company’s performance. These measures typically adjust GAAP performance measures to include the tax benefit associated with revenue items that are tax-exempt, as well as adjust income available to common shareholders for certain significant non-core activities or nonrecurring transactions. Since the presentation of these GAAP performance measures and their impact differ between companies, management believes presentations of these non-GAAP financial measures provide useful supplemental information that is essential to a proper understanding of the operating results of the Company’s core businesses. These non-GAAP disclosures should not be viewed as a substitute for operating results determined in accordance with GAAP, nor are they necessarily comparable to non-GAAP performance measures that may be presented by other companies. Where non-GAAP financial measures are used, the comparable GAAP financial measure, as well as the reconciliation to the comparable GAAP financial measure, can be found in the tables of this release. Forward-Looking Statements Some of the statements in this news release may not be based on historical facts and should be considered “forward-looking statements” within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements may be identified by reference to future periods or by the use of forward-looking terminology, such as “believe,” “budget,” “expect,” “foresee,” “anticipate,” “intend,” “indicate,” “target,” “estimate,” “plan,” “project,” “continue,” “contemplate,” “positions,” “prospects,” “predict,” or “potential,” by future conditional verbs such as “will,” “would,” “should,” “could,” “might” or “may,” or by variations of such words or by similar expressions. These forward-looking statements include, without limitation, statements relating to Simmons’ future growth, revenue, assets, asset quality, profitability, net interest margin, non-interest revenue, allowance for loan losses, and the effect of certain new accounting standards on Simmons’ financial statements. Any forward-looking statement speaks only as of the date of this news release, and Simmons undertakes no obligation to update these forward-looking statements to reflect events or circumstances that occur after the date of this news release. By nature, forward-looking statements are based on various assumptions and involve inherent risk and uncertainties. Various factors, including, but not limited to, changes in economic conditions, credit quality, interest rates, loan demand, deposit flows, real estate values, the assumptions used in making the forward-looking statements, the securities markets generally or the price of Simmons common stock specifically, information technology affecting the financial industry, and the Company’s ability to manage and successfully integrate its mergers and acquisitions could cause actual results to differ materially from those contemplated by the forward-looking statements. Additional information on factors that might affect Simmons First National Corporation’s financial results is included in its Form 10-K for the year ended December 31, 2018, which has been filed with, and is available from, the Securities and Exchange Commission. FOR MORE INFORMATION CONTACT:Stephen C. MassanelliEVP, Chief Administrative Officer and Investor Relations OfficerSimmons First National [email protected] Simmons First National Corporation SFNC Consolidated End of Period Balance Sheets For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands) ASSETS Cash and non-interest bearing balances due from banks $ 151,112 $ 171,792 $ 125,231 $ 162,567 $ 170,811 Interest bearing balances due from banks and federal funds sold 340,049 661,666 388,573 781,279 688,853 Cash and cash equivalents 491,161 833,458 513,804 943,846 859,664 Interest bearing balances due from banks - time 4,684 4,934 3,954 2,974 3,069 Investment securities - held-to-maturity 61,435 289,194 323,306 333,503 352,756 Investment securities - available-for-sale 2,240,111 2,151,752 1,997,814 1,938,644 1,830,113 Mortgage loans held for sale 18,480 26,799 48,195 39,812 17,708 Other assets held for sale 397 1,790 5,136 14,898 24,784 Loans: Legacy loans 8,684,550 8,430,388 8,123,274 7,133,461 6,290,383 Allowance for loan losses (59,243 ) (56,599 ) (55,358 ) (51,732 ) (47,207 ) Loans acquired, net of discount and allowance 3,056,187 3,292,783 3,734,921 4,232,434 4,696,945 Net loans 11,681,494 11,666,572 11,802,837 11,314,163 10,940,121 Premises and equipment 333,740 295,060 287,246 288,777 289,355 Foreclosed assets and other real estate owned 18,952 25,565 22,664 30,503 29,140 Interest receivable 51,796 49,938 51,509 44,266 42,129 Bank owned life insurance 192,736 193,170 192,680 191,575 186,473 Goodwill 845,687 845,687 845,687 845,687 845,687 Other intangible assets 88,694 91,334 93,975 96,720 99,504 Other assets 62,272 68,084 92,457 80,165 76,806 Total assets $ 16,091,639 $ 16,543,337 $ 16,281,264 $ 16,165,533 $ 15,597,309 LIABILITIES AND STOCKHOLDERS' EQUITY Deposits: Non-interest bearing transaction accounts $ 2,674,034 $ 2,672,405 $ 2,778,670 $ 2,683,489 $ 2,734,287 Interest bearing transaction accounts and savings deposits 6,666,823 6,830,191 6,776,330 6,916,520 6,720,754 Time deposits 2,648,674 2,896,156 2,533,506 2,353,439 2,201,874 Total deposits 11,989,531 12,398,752 12,088,506 11,953,448 11,656,915 Federal funds purchased and securities sold under agreements to repurchase 120,213 95,792 109,213 99,801 120,909 Other borrowings 1,169,989 1,345,450 1,420,917 1,451,811 1,140,986 Subordinated notes and debentures 354,041 353,950 372,934 413,337 468,465 Other liabilities held for sale 162 162 424 1,840 2,781 Accrued interest and other liabilities 155,382 102,797 105,951 98,388 98,202 Total liabilities 13,789,318 14,296,903 14,097,945 14,018,625 13,488,258 Stockholders' equity: Common stock 926 923 923 923 922 Surplus 1,599,566 1,597,944 1,597,261 1,594,342 1,590,086 Undivided profits 707,829 674,941 633,175 591,826 552,105 Accumulated other comprehensive loss: Unrealized depreciation on AFS securities (6,000 ) (27,374 ) (48,040 ) (40,183 ) (34,062 ) Total stockholders' equity 2,302,321 2,246,434 2,183,319 2,146,908 2,109,051 Total liabilities and stockholders' equity $ 16,091,639 $ 16,543,337 $ 16,281,264 $ 16,165,533 $ 15,597,309 Simmons First National Corporation SFNC Consolidated Statements of Income - Quarter-to-Date For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands, except per share data) INTEREST INCOME Loans $ 159,440 $ 159,996 $ 162,438 $ 150,253 $ 143,350 Interest bearing balances due from banks and federal funds sold 2,154 2,168 1,405 1,414 1,009 Investment securities 17,312 15,760 14,640 14,296 12,622 Mortgage loans held for sale 210 372 501 305 158 TOTAL INTEREST INCOME 179,116 178,296 178,984 166,268 157,139 INTEREST EXPENSE Time deposits 12,320 11,273 8,017 6,175 4,842 Other deposits 18,430 17,489 16,373 12,286 10,755 Federal funds purchased and securities sold under agreements to repurchase 136 121 104 88 110 Other borrowings 6,793 7,134 6,240 5,141 5,139 Subordinated notes and debentures 4,411 4,498 5,282 5,741 1,327 TOTAL INTEREST EXPENSE 42,090 40,515 36,016 29,431 22,173 NET INTEREST INCOME 137,026 137,781 142,968 136,837 134,966 Provision for loan losses 9,285 9,620 10,345 9,033 9,150 NET INTEREST INCOME AFTER PROVISION FOR LOAN LOSSES 127,741 128,161 132,623 127,804 125,816 NON-INTEREST INCOME Trust income 5,708 5,980 6,277 5,622 5,249 Service charges on deposit accounts 10,068 11,263 10,837 10,063 10,345 Other service charges and fees 1,289 1,501 1,201 2,017 2,750 Mortgage and SBA lending income 3,320 1,643 1,825 3,130 4,445 Investment banking income 618 829 664 814 834 Debit and credit card fees 6,098 6,547 6,820 10,105 8,796 Bank owned life insurance income 795 1,105 1,105 1,102 1,103 Gain (loss) on sale of securities, net 2,740 8 54 (7 ) 6 Other income 3,125 5,712 4,942 5,202 4,007 TOTAL NON-INTEREST INCOME 33,761 34,588 33,725 38,048 37,535 NON-INTEREST EXPENSE Salaries and employee benefits 56,367 49,193 55,515 55,678 56,357 Occupancy expense, net 7,475 7,016 7,713 7,921 6,960 Furniture and equipment expense 3,358 4,139 3,761 4,020 4,403 Other real estate and foreclosure expense 637 1,540 538 1,382 1,020 Deposit insurance 2,040 2,489 2,248 1,856 2,128 Merger-related costs 1,470 797 804 1,465 1,711 Other operating expenses 30,062 30,222 29,674 26,185 25,494 TOTAL NON-INTEREST EXPENSE 101,409 95,396 100,253 98,507 98,073 NET INCOME BEFORE INCOME TAXES 60,093 67,353 66,095 67,345 65,278 Provision for income taxes 12,398 11,707 10,902 13,783 13,966 NET INCOME $ 47,695 $ 55,646 $ 55,193 $ 53,562 $ 51,312 BASIC EARNINGS PER SHARE $ 0.52 $ 0.60 $ 0.60 $ 0.58 $ 0.56 DILUTED EARNINGS PER SHARE $ 0.51 $ 0.60 $ 0.59 $ 0.58 $ 0.55 Simmons First National Corporation SFNC Consolidated Risk-Based Capital For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands) Tier 1 capital Stockholders' equity $ 2,302,321 $ 2,246,434 $ 2,183,319 $ 2,146,908 $ 2,109,051 Trust preferred securities, net allowable - - - - - Disallowed intangible assets, net of deferred tax (910,122 ) (912,428 ) (914,788 ) (917,050 ) (918,161 ) Unrealized loss on AFS securities 6,000 27,374 48,040 40,183 34,062 Total Tier 1 capital 1,398,199 1,361,380 1,316,571 1,270,041 1,224,952 Tier 2 capital Qualifying unrealized gain on AFS equity securities - - 1 1 8 Trust preferred securities and subordinated debt 354,041 353,950 372,934 413,337 468,466 Qualifying allowance for loan losses and reserve for unfunded commitments 67,771 63,608 63,618 60,691 54,436 Total Tier 2 capital 421,812 417,558 436,553 474,029 522,910 Total risk-based capital $ 1,820,011 $ 1,778,938 $ 1,753,124 $ 1,744,070 $ 1,747,862 Common equity Tier 1 capital $ 1,398,199 $ 1,361,380 $ 1,316,571 $ 1,270,041 $ 1,224,952 Less: Trust preferred securities - - - - - Total common equity $ 1,398,199 $ 1,361,380 $ 1,316,571 $ 1,270,041 $ 1,224,952 Risk weighted assets $ 13,364,636 $ 13,326,832 $ 13,402,910 $ 12,713,093 $ 12,417,233 Adjusted average assets for leverage ratio $ 15,423,961 $ 15,512,042 $ 15,179,889 $ 14,714,205 $ 14,179,390 Ratios at end of quarter Equity to assets 14.31 % 13.58 % 13.41 % 13.28 % 13.52 % Tangible common equity to tangible assets (1) 9.02 % 8.39 % 8.11 % 7.91 % 7.94 % Common equity Tier 1 ratio (CET1) 10.46 % 10.22 % 9.82 % 9.99 % 9.86 % Tier 1 leverage ratio 9.07 % 8.78 % 8.67 % 8.63 % 8.64 % Tier 1 risk-based capital ratio 10.46 % 10.22 % 9.82 % 9.99 % 9.86 % Total risk-based capital ratio 13.62 % 13.35 % 13.08 % 13.72 % 14.08 % (1) Calculations of tangible common equity to tangible assets and the reconciliations to GAAP are included in the schedules accompanying this release. Simmons First National Corporation SFNC Consolidated Loans and Investments For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands) Legacy Loan Portfolio - End of Period (1) Consumer Credit cards $ 181,549 $ 204,173 $ 182,137 $ 180,352 $ 176,602 Other consumer 213,659 201,297 259,581 277,330 284,285 Total consumer 395,208 405,470 441,718 457,682 460,887 Real Estate Construction 1,376,162 1,300,723 1,229,888 967,720 786,077 Single-family residential 1,431,407 1,440,443 1,401,991 1,314,787 1,193,464 Other commercial 3,355,109 3,225,287 3,077,188 2,816,420 2,611,358 Total real estate 6,162,678 5,966,453 5,709,067 5,098,927 4,590,899 Commercial Commercial 1,801,422 1,774,909 1,608,342 1,237,910 971,704 Agricultural 147,216 164,514 218,778 187,006 128,247 Total commercial 1,948,638 1,939,423 1,827,120 1,424,916 1,099,951 Other 178,026 119,042 145,369 151,936 138,646 Total Loans $ 8,684,550 $ 8,430,388 $ 8,123,274 $ 7,133,461 $ 6,290,383 (1) Excludes all acquired loans. Investment Securities - End of Period Held-to-Maturity U.S. Government agencies $ 12,996 $ 16,990 $ 34,983 $ 36,976 $ 46,961 Mortgage-backed securities 12,847 13,346 13,933 14,645 15,404 State and political subdivisions 33,597 256,863 272,396 279,787 286,901 Other securities 1,995 1,995 1,994 2,095 3,490 Total held-to-maturity 61,435 289,194 323,306 333,503 352,756 Available-for-Sale U.S. Government agencies $ 161,577 $ 154,301 $ 141,460 $ 145,767 $ 149,804 Mortgage-backed securities 1,345,677 1,522,900 1,419,626 1,395,231 1,356,179 State and political subdivisions 580,790 314,843 282,439 245,335 185,888 FHLB stock 65,220 73,105 72,579 72,042 58,177 Other securities 86,847 86,603 81,710 80,269 80,065 Total available-for-sale 2,240,111 2,151,752 1,997,814 1,938,644 1,830,113 Total investment securities $ 2,301,546 $ 2,440,946 $ 2,321,120 $ 2,272,147 $ 2,182,869 Fair value - HTM investment securities $ 61,956 $ 290,830 $ 322,838 $ 334,857 $ 354,649 Investment Securities - QTD Average Taxable securities $ 1,880,694 $ 1,815,203 $ 1,775,193 $ 1,750,172 $ 1,618,270 Tax exempt securities 590,941 551,185 539,135 514,838 460,675 Total investment securities - QTD average $ 2,471,635 $ 2,366,388 $ 2,314,328 $ 2,265,010 $ 2,078,945 Simmons First National Corporation SFNC Consolidated Loans and Credit Coverage For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands) LOANS Legacy loans $ 8,684,550 $ 8,430,388 $ 8,123,274 $ 7,133,461 $ 6,290,383 Allowance for loan losses (legacy loans) (59,243 ) (56,599 ) (55,358 ) (51,732 ) (47,207 ) Legacy loans (net of allowance) 8,625,307 8,373,789 8,067,916 7,081,729 6,243,176 Loans acquired 3,099,915 3,342,175 3,790,234 4,302,760 4,776,439 Credit discount (42,416 ) (49,297 ) (53,968 ) (68,282 ) (79,087 ) Allowance for loan losses (loans acquired) (1,312 ) (95 ) (1,345 ) (2,044 ) (407 ) Loans acquired (net of discount and allowance) 3,056,187 3,292,783 3,734,921 4,232,434 4,696,945 Net loans $ 11,681,494 $ 11,666,572 $ 11,802,837 $ 11,314,163 $ 10,940,121 Loan Coverage Ratios Allowance for loan losses to legacy loans 0.68 % 0.67 % 0.68 % 0.73 % 0.75 % Discount for credit losses and allowance on loans acquired to total loans acquired plus discount for credit losses and allowance on loans acquired (non-GAAP) (1) 1.41 % 1.48 % 1.46 % 1.63 % 1.66 % Total allowance and credit coverage (non-GAAP) (1) 0.87 % 0.90 % 0.93 % 1.07 % 1.14 % (1) Calculations of the non-GAAP loan coverage ratios and the reconciliations to GAAP are included in the schedules accompanying this release. Simmons First National Corporation SFNC Consolidated Allowance and Asset Quality For the Quarters Ended Mar 31 Dec 31 Sep 30 Jun 30 Mar 31 (Unaudited) 2019 2018 2018 2018 2018 ($ in thousands) Allowance for Loan Losses (Legacy Loans) Balance, beginning of quarter $ 56,599 $ 55,358 $ 51,732 $ 47,207 $ 41,668 Loans charged off Credit cards 1,142 1,121 919 1,012 999 Other consumer 1,533 2,894 1,321 1,366 1,056 Real estate 374 337 4,952 161 455 Commercial 1,968 3,480 592 790 1,761 Total loans charged off 5,017 7,832 7,784 3,329 4,271 Recoveries of loans previously charged off Credit cards 240 227 229 286 263 Other consumer 300 154 176 133 94 Real estate 142 367 210 112 302 Commercial 158 167 450 59 69 Total recoveries 840 915 1,065 590 728 Net loans charged off 4,177 6,917 6,719 2,739 3,543 Provision for loan losses 6,821 8,158 10,345 7,264 9,082 Balance, end of quarter $ 59,243 $ 56,599 $ 55,358 $ 51,732 $ 47,207 Non-performing assets (1) (2) Non-performing loans Nonaccrual loans $ 60,925 $ 34,201 $ 40,505 $ 44,548 $ 47,395 Loans past due 90 days or more 281 224 281 303 336 Total non-performing loans 61,206 34,425 40,786 44,851 47,731 Other non-performing assets Foreclosed assets and other real estate owned (2) 18,952 25,565 22,664 30,503 29,140 Other non-performing assets 505 553 524 573 794 Total other non-performing assets 19,457 26,118 23,188 31,076 29,934 Total non-performing assets $ 80,663 $ 60,543 $ 63,974 $ 75,927 $ 77,665 Performing TDRs (troubled debt restructurings) $ 6,297 $ 6,369 $ 8,413 $ 6,367 $ 6,459 Ratios (1) (2) Allowance for loan losses to total loans 0.68 % 0.67 % 0.68 % 0.73 % 0.75 % Allowance for loan losses to non-performing loans 97 % 164 % 136 % 115 % 99 % Non-performing loans to total loans 0.70 % 0.41 % 0.50 % 0.63 % 0.76 % Non-performing assets (including performing TDRs) to total assets 0.54 % 0.40 % 0.44 % 0.51 % 0.54 % Non-performing assets to total assets 0.50 % 0.37 % 0.39 % 0.47 % 0.50 % Annualized net charge offs to total loans 0.20 % 0.35 % 0.36 % 0.17 % 0.24 % Annualized net credit card charge offs to total credit card loans 1.92 % 1.86 % 1.47 % 1.60 % 1.63 % (1) Excludes all acquired loans, except for their inclusion in total assets. | Low | [
0.47255369928400903,
24.75,
27.625
]
|
Introduction {#Sec1} ============ The hepatic ischemia-reperfusion injury (IRI) is a leading cause of primary graft dysfunction after liver transplantation and is associated with poor 1-year graft and patient survival rates of only 55% and 68%, respectively, compared with 90% and 93% for the remainder^[@CR1]^. Although some strategies, such as ischemic preconditioning and application of pharmacological agents, seemed to be promising in laboratory experiments, only few of them have been tested in clinical randomized controlled trials^[@CR2]--[@CR4]^, and the results were not satisfactory enough to be acceptable in clinical routine. Current advances in regenerative medicine showed that mesenchymal stem cell (MSC) transplantation seemed to be a promising treatment for IRI^[@CR5]^. MSCs represent a heterogeneous population of adult fibroblast-like multipotent cells which can replicate and differentiate to multiple cell lineage pathways. They are well suitable for cell therapy as they express few HLA class I and no HLA class II molecules^[@CR6]--[@CR8]^, which enable them to evade allogeneic immune response after transplantation. MSC therapy has shown beneficial effects on IRI of heart, intestine, kidney, and brain^[@CR5],[@CR9]--[@CR12]^. Although the exact mechanism is not fully understood, it seems that paracrine of trophic and anti-inflammatory cytokines, including basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), and interleukin(IL)-10, plays an important role in MSC therapy^[@CR10],[@CR13]--[@CR17]^. The effect of MSC therapy for hepatic IRI had been studied by several groups. However, the results were not consistent. While some studies showed that MSC therapy could prevent hepatic IRI by suppressing inflammatory responses, oxidative stress and apoptosis^[@CR18]--[@CR21]^, others failed to reduce hepatic IRI with the same kind of MSCs.22--24 One reason for the failure might be that MSCs were short lived and did not migrate beyond the lungs after intravenous infusion^[@CR22]--[@CR24]^. Another reason might be that MSCs could be either pro-inflammatory or anti-inflammatory depending on the levels of inflammatory cytokines^[@CR25]^, and which receptor was activated^[@CR26]^. Recently, several groups reported that aggregation of MSCs into 3-dimensional (3D) spheroids could greatly enhance their production of trophic and anti-inflammatory properties, such as tumor necrosis factor-alpha stimulated gene/protein 6 (TSG-6), prostaglandin E2, VEGF, and bFGF^[@CR16],[@CR27]--[@CR29]^. Moreover, the 3D culture of MSCs resulted in 75% reduction of individual cell volume, which significantly improved their ability of trafficking through the lung microvasculature^[@CR28]^. 2D cultured MSCs lost their expression of some key receptors, such as C-X-C chemokine receptor type 4, for cell migration. While 3D culture could restore the expression of these receptors, which were critical for MSCs homing to the injury site^[@CR30],[@CR31]^. The 3D MSCs have been reported to be beneficial for liver fibrosis and hepatitis^[@CR32],[@CR33]^, but their effect on hepatic IRI remains largely unknown. Different kind of MSCs exhibits different immunobiological properties, among which umbilical cord lining MSCs (UC-MSCs) have especially low immunogenicity compared with other extraembryonic tissue--derived MSCs^[@CR34]^. UC-MSCs showed the slowest rejection kinetics and lowest activation rate of T cells in an *in vivo* transplantation experiment^[@CR35]^, but their effect on hepatic IRI has not been fully tested. In this study, we aimed to study the benefit of 3D UC-MSCs for treating hepatic IRI compared with 2D UC-MSCs, and the potential mechanisms. Results {#Sec2} ======= **A**ggregation of human UC-MSCs into spheroids caused significant changes in RNA transcription {#Sec3} ----------------------------------------------------------------------------------------------- During the process of cell culture, the time-lapse microscopy demonstrated that UC-MSCs cultured in hanging drops formed a loose network at first, and then, gradually coalesced into a single central spheroid along the lower surface of the drop (Fig. [1a](#Fig1){ref-type="fig"}), The RNA sequencing results showed that among the 19219 screened genes, altogether 831 genes were significantly upregulated and 788 genes were significantly downregulated in 3D UC-MSCs compared with 2D UC-MSCs (probability \>80% and \|log~2~(fold of gene expression change)\|≥1) (Fig. [1b](#Fig1){ref-type="fig"}). The function clustering and gene ontology analysis (Fig. [1c,d](#Fig1){ref-type="fig"}) demonstrated that the significantly up-regulated genes were aggregated in various biological processes, including negative regulation of cell proliferation, inflammatory response, response to hypoxia, positive regulation of apoptotic process, positive regulation of autophagy, cellular response to tumor necrosis factor, and positive regulation of angiogenesis. While, the down-regulated genes in 3D UC-MSCs were mainly topped in the mitotic biological processes, including cell division, sister chromatid cohesion, mitotic nuclear division, DNA replication, G1/S transition of the cell cycle, mitotic cytokinesis, replication initiation, and spindle organization, indicating that 3D culture significantly inhibited cell proliferation. Moreover, the gene ontology analysis using all the differentially regulated genes also revealed that biological processes in cell mitosis, response to hypoxia and angiogenesis were still the top changes in 3D UC-MSCs compared with 2D UC-MSCs (Fig. [1d](#Fig1){ref-type="fig"}).Figure 1The 3D-spheroid culture of human UC-MSCs caused significant changes in gene expression. (**a**) Representative images of 2D- and 3D-cultured UC-MSCs under the phase-contrast microscope. (**b**) The difference of gene expression between 2D and 3DUC-MSCs was analyzed by RNA-sequencing; altogether 831 genes (blue) were significantly upregulated and 788 genes (yellow) were significantly downregulated in 3D UC-MSCs compared with 2D UC-MSCs (probability \>80% and \|log~2~(fold of gene expression change)\|≥1). (**c**) The representative global view of gene expression changes between 2D UC-MSCs (n = 3, samples named 2D-1, 2D-2, 2D-3) and 3D UC-MSCs (n = 3, samples named 3D-1, 3D-2 and 3D-3) by hierarchical clustering analysis. The clusters in black denote no significant difference between 2D and 3D UC-MSCs, while the clusters in red or green denote transcripts which are more or less abundant compared to 2D UC-MSCs. The intensity of the colors is proportional to a log2 ratio of the fold of gene changes. (**d**) The gene ontology analysis showed the list of bioprocess terms most strongly enriched with the differentially regulated genes between 3D and 2D UC-MSCs. Each bar is proportional to the number of genes enriched in the bioprocess. Abbreviations: UC-MSCs, umbilical cord-derived mesenchymal stem cells. We further analyzed the genes enriched in the positive regulation of angiogenesis process and found that altogether 15 genes were significantly upregulated in 3D UC-MSCs (Supplementary Table [1](#MOESM1){ref-type="media"}). These genes included angiopoietin like 4, chitinase 3 like 1, adrenomedullin, and heme oxygenase 1, which were topped in the most differentially regulated genes (probability ≥95%, and \|log~2~(fold of gene expression change)\|\>3.7) of all. Among the genes enriched in the inflammatory response (Supplementary Table [2](#MOESM1){ref-type="media"}), many pro-inflammatory genes were significantly upregulated in 3D UC-MSCs compared with 2D UC-MSCs, these included IL-1A, IL-1B, IL-6, IL-11, IL-24, IL-32, IL-33, chemokine (C-C motif) ligand (CCL) 2, CCL7, CCL20, chemokine (C-X-C motif) ligand (CXCL)3, CXCL5, and CXCL8. However, some anti-inflammatory genes were significantly upregulated in 3D UC-MSCs as well. These genes include the TSG-6, TNF-α-induced protein 8, and prostaglandin-endoperoxide synthase. Furthermore, the zinc finger CCCH-type containing 12A (ZC3H12A), an important anti-inflammatory gene whose product could inhibit inflammation by destabilizing inflammation-related mRNAs, such as IL-1, IL-2, IL-6, CXCL1, CXCL2, and CXCL3, was significantly upregulated in 3D UC-MSCs. 3D UC-MSCs increased the expression of ZC3H12A protein and VEGF secretion, but reduced the production of pro-inflammatory chemokines {#Sec4} ------------------------------------------------------------------------------------------------------------------------------------ To further investigate whether the significant changes in RNA expression of 3D UC-MSCs resulted in a corresponding alteration of ZC3H12A protein and cytokine production, we utilized the Western Blotting and Multiplex-Microbead Immunoassay to analyze the ZC3H12A protein and the cytokines produced by 2D and 3D UC-MSCs. As shown in Fig. [2a](#Fig2){ref-type="fig"}, the ZC3H12A protein level was significantly higher (0.47 ± 0.018 VS 0.26 ± 0.019, *P* \< 0.05) in 3D UC-MSCs compared with 2D UC-MSCs. The results of Multiplex-Microbead Immunoassay (Fig. [2b](#Fig2){ref-type="fig"}) showed that 2D UC-MSCs secreted a lot of cytokines including macrophage migration inhibitory factor (MIF), monocyte chemoattractant protein-1 (MCP-1), interferon-α (IFN-α), leukemia inhibitory factor (LIF), stromal cell-derived factor 1α (SDF-1α), stem cell growth factor-β (SCGF-β), macrophage-colony stimulating factor (M-CSF), stem cell factor (SCF), and granulocyte-colony stimulating factor (G-CSF). Among these cytokines, the levels of SCGF-β (34834.1 ± 3738.2 pg/ml/1 × 10^5^ MSCs/24 h), MCP-1 (8307.2 ± 107.0 pg/ml/1 × 10^5^ MSCs/24 h), and MIF (3157.2 ± 591.3 pg/ml/1 × 10^5^ MSCs/24 h) were the highest in the conditioned medium. The 3D UC-MSCs significantly reduced their secretion of cytokines such as IFN-α, M-CSF, and SDF-1α. The concentrations of SCGF-β (1952.5 ± 578.2 pg/ml/1 × 10^5^ MSCs/24 h), MCP-1 (169.0 ± 3.8 pg/ml/1 × 10^5^ MSCs/24 h), and MIF (425.3 ± 11.3 pg/ml/1 × 10^5^ MSCs/24 h) were also decreased dramatically in 3D UC-MSCs conditioned medium. The secretion of LIF (157.6 ± 26.8 VS 228.3 ± 54.4 pg/ml/1 × 10^5^ MSCs/24 h, respectively) and G-CSF (1554.4 ± 380.5 VS 1684.8 ± 31.9 pg/ml/1 × 10^5^ MSCs/24 h, respectively) was remained similar between 2D and 3D UC-MSCs. In the aspect of trophic factors, both 2D and 3D UC-MSCs barely produced any platelet-derived growth factor-BB. The 2D UC-MSCs produced a high level of HGF (7103.6 ± 732.5 pg/ml/1 × 10^5^ MSCs/24 h) and some bFGF (147.0 ± 5.1, pg/ml/1 × 10^5^ MSCs/24 h), but the VEGF was almost undetectable. The 3D UC-MSCs secreted a large amount of VEGF (245.56 ± 17.87 pg/ml/1 × 10^5^ MSCs/24 h), but the secretion of HGF (367.7 ± 8.9 pg/ml/1 × 10^5^ MSCs/24 h) and bFGF (52.77 ± 16.93 pg/ml/1 × 10^5^ MSCs/24 h) was significantly reduced compared with 2D UC-MSCs.Figure 2The 3D spheroid-culture of human UC-MSCs significant upregulated ZC3H12A protein expression and induced profound changes in cytokine production compared with 2D UC-MSCs. (**a**) The expression of ZC3H12A and actin proteins in 2D- and 3D-cultured UC-MSCs was detected by Western blotting. The representative blots from same gel were cropped and showed in the picture. The Western Blotting experiments were performed twice to verify the result consistency. The full-length gels and blots are included in Supplementary Figure [2](#MOESM1){ref-type="media"}. The expression of ZC3H12A protein was significantly increased in 3D UC-MSCs compared with 2D UC-MSCs. Data are presented as means ± SE (n = 4); ^a^*P* \< 0.05 compared with 2D UC-MSCs. (**b**) The UC-MSCs cultures are as described in materials and methods. The culture medium was collected at 72 h time points, the concentrations of cytokines, as determined by multiplex-microbead immunoassay, are shown. Data are presented as means ± SE (n = 3); ^a^*P* \< 0.05 compared with 2D UC-MSCs. Abbreviations: ZC3H12A, the zinc finger CCCH-type containing 12A; HGF, hepatocyte growth factor; LIF, leukemia inhibitory factor; SCGF-β, stem cell growth factor-β; G-CSF, granulocyte-colony stimulating factor; IFN-α, interferon-α; M-CSF, macrophage-colony stimulating factor; SDF-1α, stromal cell-derived factor 1α; bFGF, basic fibroblast growth factor; MIF, macrophage migration inhibitory factor; SCF, stem cell factor; MCP-1, Monocyte chemoattractant protein-1; VEGF, vascular endothelial growth factor; UC-MSCs, umbilical cord-derived mesenchymal stem cells. 3D UC-MSCS transplantation had a better therapeutic effect than 2D uc-mscs in treating hepatic iri in rats {#Sec5} ---------------------------------------------------------------------------------------------------------- Altogether 3 × 10^6^ 2D UC-MSCs or 3D UC-MSCs were administrated through intraperitoneal injection at the end of surgery. The *in vivo* imaging showed that the fluorescent signal from 2D and 3D UC-MSCs could aggregate into the liver at 6 h after administration (Fig. [3a](#Fig3){ref-type="fig"}). However, there was no statistical difference in hepatic fluorescence intensity between 2D and 3D UC-MSCs treatment groups (2875.25 ± 514.51 A.U. VS 2204.85 ± 368.15 A.U, *P* \> 0.05). To confirm that the live UC-MSCs migrated into the liver, the staining of human nuclear antigen was performed in rat liver tissues. The results showed that the human nuclear antigen in 2D and 3D UC-MSCs could be detected in the liver at 6 hours after hepatic IRI (Fig. [3b](#Fig3){ref-type="fig"}).Figure 32D and 3D cultured UC-MSCs could migrate into the ischemic damaged liver after intraperitoneal injection. (**a**) The *in vivo* imaging showed that both 2D and 3D UC-MSCs could aggregate into the ischemia-damaged liver at 6 h after intraperitoneal injection by observing the fluorescent signal (red) from DiR labeled UC-MSCs. The fluorescence intensity of were not statistically different between 2D and 3D UC-MSCs. Data are presented as means ± SE (n = 3). (**b**) The migration of UC-MSCs into the liver was further confirmed by immunohistochemical staining (x400) of human nuclear antigen (arrows). Abbreviations: DiR, 1,1′-dioctadecyltetramethyl indotricarbocyanine Iodide; UC-MSCs, umbilical cord-derived mesenchymal stem cells. The pathological changes of hepatic IRI were investigated in this study. The results showed that 2D UC-MSCs treatment did not attenuate the hepatic IRI compared with the vehicle group, while 3D UC-MSCs treatment significantly reduced the hepatic necrosis and inflammation both in gross observation (Fig. [4a](#Fig4){ref-type="fig"}) and in microscopic sections (Fig. [4b](#Fig4){ref-type="fig"}). The Suzuki liver injury score (Fig. [4c](#Fig4){ref-type="fig"} left panel) in 3D UC-MSCs treatment group at 24 hours after hepatic IRI was 4.00 ± 0.71, which was significantly lower than the vehicle (8.20 ± 0.84, *P* \< 0.05) and 2D UC-MSCs treatment groups (8.00 ± 1.01, *P* \< 0.05). The chloroacetate esterase staining (Supplementary Figure [1](#MOESM1){ref-type="media"}) also revealed that much less neutrophil infiltration in the 3D UC MUSCs treatment group compared with the vehicle and the 2D UC-MSCs treatment groups (Fig. [4c](#Fig4){ref-type="fig"} right panel).Figure 43D UC-MSCs attenuated the hepatic IRI in rats. (**a**) The representative gross looking of rat livers at 48 h after 70% hepatic IRI. The vehicle (left) and 2D UC-MSCs (middle) treatment groups had significant edema and necrosis (black arrow), while 3D UC-MSCs (right) treatment group only had mild edema. (**b**) The representative photomicrographs (×100) depicting liver damages at 6 h, 24 h, and 48 h after hepatic ischemia in the vehicle (left), 2D UC-MSCs (middle), and 3D UC-MSCs (right) treatment groups. Significant hepatic inflammation (red arrow) and necrosis (black arrow) could be seen in the vehicle and 2D UC-MSCs treatment group, while 3D UC-MSCs treatment group had much less tissue necrosis and inflammation. (**c**) liver injury was evaluated by injury scores and hepatic neutrophil infiltration. The 3D UC-MSCs treatment group had much lower injury score and less neutrophil infiltration compared with vehicle and 2D UC-MSCs treatment group. (**d**) Quantitation of the levels of plasma transaminases and plasma total bilirubin at various time points after hepatic IRI. Data are presented as means ± SE (n = 4--6). ^a^*P* \< 0.05 compared with vehicle treatment group; ^b^*P* \< 0.05 compared with 2D UC-MSCs treatment group. Abbreviations: ALT, alanine aminotransferase; AST, aspartate aminotransferase; UC-MSCs, HPF, high power fields (400×); umbilical cord-derived mesenchymal stem cells. The liver injury was assessed by measuring alanine aminotransferase (ALT), aspartate aminotransferase (AST), and total bilirubin in the rat plasma. The plasma AST and ALT were within normal ranges in the absence of hepatic IRI. Hepatic ischemia for 90 minutes significantly increased AST and ALT levels after surgery. 2D UC-MSCs administration did not significantly alter the AST and ALT levels compared with the vehicle group at all time points; however, the 3D UC-MSCs administration significantly reduced the ALT levels at 6 h (2140.45 ± 416.00 IU/L) and 48 h time points (168.47 ± 62.69 IU/L) compared with the vehicle (3871.08 ± 628.53 IU/L at 6 h and 658.27 ± 79.86IU/L at 48 h) and 2D UC-MSCs (5157.88 ± 749.70 at 6 h and 772.30 ± 49.50 IU/L at 48 h) treatment groups (*P* \< 0.05). The AST levels in the 3D UC-MSCs treatment group were significantly lower than the 2D UC-MSCs treatment group.at 6 h (2477.58 ± 419.48 VS 4980.30 ± 833.86 IU/L, respectively; *P* \< 0.05) and 48 h (224.33 ± 17.21 VS 1077.70 ± 86.82 IU/L, respectively; *P* \< 0.05). Although plasma ALT and AST levels in all groups were significantly decreased at 48 h after hepatic IRI compared with the levels at 6 h and 24 h time points, the total bilirubin levels were significantly higher in the vehicle (4.68 ± 0.60 mg/dL) and 2D UC-MSCs (5.70 ± 0.44 mg/dL) treatment groups compared with the 3D UC-MSCs treatment group (1.80 ± 0.30 mg/dL, *P* \< 0.05) at 48 h (Fig. [4d](#Fig4){ref-type="fig"}). 3D UC-MSCS treatment did not promote hepatic regeneration but significantly inhibited apoptosis {#Sec6} ----------------------------------------------------------------------------------------------- The liver regeneration after hepatic IRI was analyzed by immunostaining of proliferating cell nuclear antigen (PCNA) (Fig. [5a](#Fig5){ref-type="fig"}). In the sham surgery group, few hepatocytes entered cell cycle at all time points. In the vehicle group with IRI, the number of PCNA positive cells increased significantly in the non-necrotic areas, most of which were in the G~1~ phase at 6 h after hepatic IRI, and then, more cells entered S, G~2~ and M phases at 24 h and 48 h time points. 2D and 3D UC-MSCs treatment did not significantly alter the rate of entry into the cell cycle at 6 h and 24 h compared with the vehicle group. Indeed, 3D UC-MSCs treatment significantly reduced the number of hepatocytes remained in proliferation at 48 h after hepatic IRI (Fig. [5b](#Fig5){ref-type="fig"}). For example, there were much more hepatocytes returned to the G~0~ phase (695 ± 95 per 1,000 hepatocytes) in the 3D UC-MSCs group compared with the vehicle (236 ± 54 per 1,000 hepatocytes, *P* \< 0.05) and 2D UC-MSCs groups (161 ± 35 per 1,000 hepatocytes, *P* \< 0.05). While there were much fewer hepatocytes entered G~1~ (144 ± 31 per 1,000 hepatocytes) and S phases (113 ± 28 per 1,000 hepatocytes) in the 3D UC-MSCs group compared with the vehicle (422 ± 51 and 238 ± 44 per 1,000 hepatocytes, respectively, *P* \< 0.05) and 2D UC-MSCs (465 ± 63 and 279 ± 33 per 1,000 hepatocytes, respectively, *P* \< 0.05) groups.Figure 5Evaluation of liver regeneration in non-necrotic areas by PCNA immunostaining. (**a**) Representative photomicrographs (×100) of PCNA staining at 6 h and 48 h after hepatic IRI in Sham surgery (left), vehicle treatment (left middle), 2D UC-MSCs treatment (right middle) and 3D UC-MSCs treatment (right) groups. Few hepatocytes were PCNA positive in the Sham surgery group at 6 and 48 h time points. The hepatic IRI induced a significant proliferation of hepatocytes in the non-necrosis areas of liver. Some inflammatory cells were also PCNA positive as showed in higher magnification (×400). (**b**) Cell cycle progression (per 1,000 hepatocytes) at different time points according to the PCNA staining pattern. At 48 h after hepatic IRI, the vehicle and 2D UC-MSCs treatment group had significantly more hepatocytes entering cell cycle compared with 3D UC-MSCs treatment group, which had much more hepatocytes staying in the G~0~ phase. Abbreviations: PCNA, proliferating cell nuclear antigen; IRI, ischemia-reperfusion injury; UC-MSCs, umbilical cord-derived mesenchymal stem cells. The terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) staining was used to identify the apoptotic hepatic cells. As expected, few hepatocytes were apoptotic in livers of sham surgery group (Fig. [6](#Fig6){ref-type="fig"}), while many hepatocytes were undergoing apoptosis in the vehicle and UC-MSCs treatment groups at 6 hours after IRI. The number of apoptotic hepatocytes was 45.60 ± 9.04 hepatocytes/high power fields in the 3D UC-MSCs treatment group, which was significantly less compared with 69.60 ± 11.91 hepatocytes/high power fields in the vehicle treatment group and 76.40 ± 14.99 hepatocytes/high power fields in the 2D UC-MSCs treatment group (*P* \< 0.05).Figure 63D UC-MSCs attenuated hepatocyte apoptosis after hepatic IRI. (**a**) The apoptotic hepatocytes are shown with TUNEL staining (green) at 6 h after hepatic IRI (×400). The nuclei of hepatocytes were counterstained with DAPI (blue). Merged images of TUNEL and DAPI staining are shown at the bottom row of the panel. (**b**) Few hepatocytes were apoptotic in the Sham group. The hepatic IRI resulted in profound cell apoptosis. At 6 hours after hepatic IRI, the number of apoptotic hepatocytes in the 3D UC-MSCs group was significantly less than vehicle and 2D UC-MSCs treatment groups. The Data are means ± SE (n = 4--6); ^a^*P* \< 0.05 compared Sham group; ^b^*P* \< 0.05 compared with Vehicle group, ^c^*P* \< 0.05 compared 2D UC-MSCs treatment group. Abbreviations: TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; DAPI, 4′,6-diamidino-2-phenylindole; HPF, high power fields (400×). 3D UC-MSCS treatment inhibited tumor necrosis factor-α (tnf-α) mrna expression and increased il-6 mrna expression in iri liver tissues {#Sec7} -------------------------------------------------------------------------------------------------------------------------------------- The expression of key pro-inflammatory and anti-inflammatory cytokines (TNF-α, IL-6, and IL-10) in the liver tissue after hepatic IRI was determined by real-time PCR (Fig. [7](#Fig7){ref-type="fig"}). Hepatic IRI significantly increased the expression of the TNF-α gene in all groups, but with different temporal patterns. 2D and 3D UC-MSCs treatments did not cause a significant difference in hepatic expression of TNF-α gene compared with the vehicle group, but the 3D UC-MSCs group had a lower hepatic expression of TNF-α gene compared with the 2D UC-MSCs group (6.73 ± 0.77 VS 9.65 ± 1.7, respectively; *P* \< 0.05) at 6 h time point. Hepatic IRI caused a slight elevation of the IL-6 gene (1.63 ± 0.17) at 6 h time point in the vehicle treatment group, while the 2D and 3D UC-MSCs caused a dramatic increase in IL-6 gene expression at all time points after hepatic IRI compared with the vehicle group. The expression of IL-6 was significantly higher in the 3D UC-MSCs group compared with the 2D UC-MSCs group (12.81 ± 1.15 VS 7.92 ± 1.14, respectively; *P* \< 0.05) at 6 h after IRI. The IL-10 gene expression did not change significantly in the 3D UC-MSCs treatment group at all time points after hepatic IRI compared with the vehicle treatment group. However, the 2D UC-MSCs group had significantly less IL-10 gene expression (0.54 ± 0.08) at 6 h time points compared with the vehicle treatment group (1.05 ± 0.03, *P* \< 0.05).Figure 7Effect of UC-MSCs treatment on the expression of inflammatory genes after hepatic IRI. Animal treatments and methods are as described in materials and methods. IL-6, IL-10, and TNF-α gene expression at different time points after hepatic IRI, as determined by real-time PCR are shown. Data are means ± SE (*n* = 4--6); ^a^*P* \< 0.05 compared Sham group; ^b^*P* \< 0.05 compared with Vehicle group, ^c^*P* \< 0.05 compared 2D UC-MSCs treatment group. Discussion {#Sec8} ========== Compared with 2D cell culture, 3D cell culture was regarded as more physiological and better preserved the *in vivo* environment and characteristics of MSCs^[@CR36]^. In our study, the RNA sequencing analysis revealed that a lot of genes which participate the angiogenesis, inflammation, and inhibiting cell proliferation, were differentially regulated in 3D spheroid-cultured UC-MSCs compared with 2D-cultured UC-MSCs. This result was consistent with the previous studies of human bone marrow- and adipose tissue-derived MSCs, which showed that spheroid-culture caused a significant upregulation of angiogenetic genes, and enhanced expression of pro-inflammatory and anti-inflammatory genes by the gene microarray analysis^[@CR16],[@CR28],[@CR37],[@CR38]^. Yeh *et al*., also performed a microarray analysis of human UC-MSC spheroids which were formed on chitosan membranes. In their study, the pro-inflammatory genes including IL1A, IL1B, IL33, and TNFSF13B, were upregulated, while some anti-inflammatory genes including TSG-6, and prostaglandin-endoperoxide synthase 2, also had increased expression^[@CR38]^. Our RNA sequencing data, together with previous microarray studies, all proved that spheroid-culture of MSCs indeed induced an upregulation of both pro-inflammatory and anti-inflammatory genes at the transcription level. Furthermore, a very interesting finding in our study is that both the mRNA and protein of ZC3H12A, was significantly upregulated in 3D UC-MSCs compared with 2D UC-MSCs. ZC3H12A encodes a RNase, which destabilizes mRNAs encoding pro-inflammatory cytokines including IL2, IL6, CXCL1, CXCL2, and CXCL3, via its 3′ untranslated regions^[@CR39],[@CR40]^. This finding may suggest an enhanced anti-inflammatory modulation of 3D UC-MSCs at the post-transcription level, which may be a new mechanism that leads 3D UC-MSCs to exhibit a more potent anti-inflammatory effect in *in vitro* and *in vivo* studies. The MSCs could be either pro-inflammatory or anti-inflammatory in immune modulation. Recent studies have shown that in the presence of LPS or low levels of TNF-α and interferon-γ, MSCs may adopt a pro-inflammatory phenotype and secrete chemokines such as MIP-1, MIF-1, and CXCLs, which recruit neutrophils, lymphocytes, and macrophages to enhance inflammation^[@CR25],[@CR26],[@CR41]^. As the chemotaxis plays a critical role in MSC-mediated inflammatory response, the differences in chemokines production between 2D and 3D UC-MSCs were investigated in this study. The results showed that 2D UC-MSCs secreted a lot of chemokines, among which MIF, MCP-1, and SCGF-β were of the highest concentration. 3D culture dramatically reduced the production of these chemokines. These findings indicate that 3D culture may turn UC-MSCs into an anti-inflammatory phenotype by reducing chemokine production, and therefore, may be more suitable for treating inflammation associated diseases. UC-MSCs also produce trophic factors. In this study, the 2D UC-MSCs secreted large amount of HGF, SCGF-β, G-CSF, and M-CSF, but VEGF was almost undetectable. The 3D UC-MSCs secreted a high level of VEGF but other growth factors were significantly reduced compared with 2D UC-MSCs. These results are consistent with our RNA-sequencing results which showed that the 3D culture not only induced an upregulation of genes associated with hypoxia and angiogenesis, but also caused a significantly inhibition of cell proliferation. The increased VEGF production in 3D UC-MSCs may benefit their treatment for ischemic damages. In the animal hepatic IRI model, we administrated 2D and 3D UC-MSCs by intraperitoneal injection, which prevented MSCs from entrapping in lungs through intravenous infusion in previous studies^[@CR22]^. The *in vivo* imaging and immunostaining revealed that both 2D and 3D UC-MSCs could migrate to the liver after administration. The pathological studies showed that 2D UC-MSCs could not prevent hepatic IRI. The plasma transaminase levels of 2D UC-MSCs group were even slightly higher than vehicle group at 6 h time point (*P* \> 0.05). One reason for the failure of 2D UC-MSCs treatment might be that the duration of hepatic ischemic injury was 90 minutes in our model, whereas the models described in many other studies used 30 to max 60 minutes of ischemia^[@CR18]--[@CR21],[@CR24],[@CR42]^. The damage in our study could be too severe to detect the effects of 2D UC-MSCs. Another reason might be that the 2D UC-MSCs secreted much more chemokines compared with 3D UC-MSCs, which could even aggravate the IRI induced hepatic inflammation. A similar finding was reported by Fouraschen, *et al*.^[@CR43]^. The mesenchymal stem cell-derived factors did not attenuate liver injury in a mouse model of 90 min hepatic IRI, but effectively prevented liver injury after 60 minutes of hepatic ischemia with 50% partial hepatectomy^[@CR43]^. The plasma transaminase levels and the pathological studies showed that 3D UC-MSCs could significantly attenuate the IRI injury by reducing the hepatic inflammation and apoptosis compared with vehicle and 2D UC-MSCs. These beneficial results could be explained by the facts that 3D UC-MSCs reduced their secretion of chemokines, enhanced the production of anti-inflammatory properties, and promoted the secretion of angiogenetic factors, such as VEGF. The proliferation of hepatocytes at the none-necrotic areas of the liver was not increased in the 3D treatment group compared with the 2D and vehicle groups according to the PCNA staining. This may be due to that 3D UC-MSCs do not secret other trophic growth factors, such as HGF, as much as 2D UC-MSCs do, or less compensatory regeneration response due to less hepatic damage compared with the vehicle and 2D MSCs treated animals. The hepatic expression of several inflammation-associated genes was investigated in this study. The results showed that hepatic IL-6 mRNA expression was significantly up-regulated in both 2D and 3D UC-MSCs treatment groups at all time points compared with the vehicle group. IL-6 is a multifunctional cytokine with well-defined pro- and anti-inflammatory properties. IL-6 induces anti-inflammatory and regenerative signaling pathways after binding to its membrane-bound receptor, which is only expressed on hepatocytes and certain subpopulations of leukocytes. The pro-inflammatory roles of IL-6 have been attributed to the trans-signaling pathway when IL-6 binds to soluble forms of the IL-6 receptor and interacted with the other cells^[@CR44]^. Previous studies showed that IL-6 reduced the hepatic IRI both in normal and obese rodents^[@CR45],[@CR46]^. Although a similar trend of hepatic IL-6 mRNA expression was found in 2D and 3D UC-MSCs treatment groups, the 2D UC-MSCs treatment group had significantly higher TNF-α mRNA expression compared with the 3D UC-MSCs group and significantly lower hepatic IL-10 mRNA expression compared with the vehicle group at 6 h time point. These findings indicate that 2D UC-MSCs had multiple effects on hepatic IRI, including the negative effects such as promoting inflammation and impairing their therapeutic effects. Taken together, the 3D culture induced profound changes in gene transcription of UC-MSCs. The genes participating angiogenesis were upregulated, while genes promoting proliferative were downregulated in 3D UC-MSCs compared with 2D UC-MSCs. Although both pro-inflammatory and anti-inflammatory genes were upregulated, 3D UC-MSCs significantly reduced their chemokines production in secretome. This could be partially explained by the upregulation an RNases (ZC3H12A), which control the pro-inflammatory cytokine transcript turnover. The 3D UC-MSCs produced more angiogenetic trophic cytokines in the secretome compared with the 2D culture. 3D UC-MSCs could attenuate hepatic IRI in rats by inhibiting hepatic inflammation and apoptosis. Our data show that 3D culture may be a useful strategy for UC-MSCs treatment of hepatic IRI. Methods {#Sec9} ======= Cell culture {#Sec10} ------------ UC-MSCs were obtained from the National Engineering and Research Center of Human Stem Cell, and their isolation and culture were described in the previous study^[@CR47]^. Briefly, UC-MSCs were recovered from liquid nitrogen and cultivated in cell culture dishes with MSCs culture system: DMEM-high glucose (Gibco-BRL, USA) with 10% fetal bovine serum (Gibco-BRL, USA) and 10ng/ml bFGF (Gibco-BRL, USA). The cell culture incubator was set to 37 °C and 5% CO2. The UC-MSCs at passage 3 were used for subsequent experiments. For 2D culture, 2.5 × 10^5^ MSCs were planted in the six-well plates in 2 ml medium. To form the sphere, MSCs were digested with tryptase (Gibco-BRL, USA) and collected. The collected MSCs were resuspended in the culture system with the concentration of 6250 cells/μl. A drop of 40 μl was placed on the inverted lid of a cell culture dish. The lid was then rapidly reinverted onto the culture dish that contained PBS to prevent evaporation of the drop. The cells were collected for transplantation and RNA sequencing after 72 hours. To analyze the secreted cytokines from MSCs, the medium was changed to serum-free DMEM at 48 hours, and the supernatant was collected at 72 hours. Altogether 3 dishes of cells and 3 conditioned media from 2D- and 3D-cultured UC-MSCs, respectively, were collected for RNA sequencing and cytokine immunoassay. Animals {#Sec11} ------- Male Sprague Dawley rats weighing 250--300 g were purchased from the department of animal research, Xiangya Medical College, Central South University, China. Rats were housed in a pathogen-free facility with a 12-hour light-dark cycle. Food and tap water were allowed ad libitum. Animal surgery protocols were approved by the Animal Care and Use Committee of the Central South University, and the animal experiments were performed in adherence to National Institutes of Health guidelines for the use of laboratory animals. All the surgeries were done between 9 to 12 am. Hepatic IRI animal model {#Sec12} ------------------------ A partial hepatic IRI model was induced as described previously with minor changes^[@CR48]^. Briefly, rats were completely anesthetized with isoflurane. After opening the abdomen and dissecting the interlobular ligaments, all structures in the portal triad to the left and median liver lobes were occluded using a microvascular clamp for 90 min. Rats received intraperitoneal injections of vehicle (1 ml saline, n = 6), 2D UC-MSCs (3 × 10^6^ per rat, n = 6), or 3D UC-MSCs (3 × 10^6^ per rat, n = 6) immediately after reperfusion. Sham control rats underwent the same protocol without vascular occlusion. Multiplex-Microbead immunoassay {#Sec13} ------------------------------- A multiplex-biometric immunoassay containing fluorescent microspheres conjugated with specific monoclonal antibodies was performed to analyze cytokine levels in the conditioned culture medium following manufacturer's instruction (Bio-Plex Pro^TM^ Human Cytokine 21-Plex and Bio-Plex Pro^TM^ Human Cytokine 27-plex Panel, Bio-rad, USA). The cytokines selected from 21-plex for testing were as follows: HGF, IFN-α, LIF, M-CSF, MIF, SCF, SCGF-β, and SDF-1α. The cytokines selected from 27-plex for testing were as follows: bFGF, G-CSF, granulocyte-macrophage colony-stimulating factor, MCP-1, platelet-derived growth factor-BB, and VEGF. The data were processed using the Luminex data collection software (vertion6.1). RNA sequencing {#Sec14} -------------- RNA of 2D- and 3D-cultured UC-MSCs were isolated with TRIzol reagent (Thermo Scientific, USA), then quantified with a nanodrop spectrophotometer (Thermo Scientific, USA). RNA sequencing was carried out by the Shenzhen BGI Genomics Institute following standard protocols. Briefly, the total RNA samples were treated with DNase I to degrade any possible DNA contamination. Then, the mRNA was enriched by using the oligo(dT) magnetic beads. After mixing with the fragmentation buffer, the mRNAs were fragmented into short fragments. The first strand of cDNA was synthesized using random hexamer-primers. Buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second strand. The double strand cDNAs were purified with magnetic beads. End reparation and 3′-end single nucleotide A (adenine) addition were then performed. Finally, sequencing adaptors were ligated to the fragments. The fragments were enriched by PCR amplification. Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System were used to qualify the sample library. The library products were sequenced via Illumina HiSeqTM 2000. Standard bioinformatics analysis was performed by the BGI Genomics Institute. Western Blotting {#Sec15} ---------------- Western blotting was performed as described previously^[@CR49]^. In brief, cells were harvested and lysed in 1× RIPA buffer (Sigma, St. Louis, MO) and protein was quantified using the Bradford reagent (BioRad, Marnes-la-Coquette, France). Cell lysates were loaded on SDS-polyacrylamide gels and Western blotting was performed using standard protocols with antibodies against ZC3H12A (GeneTex, CA, USA), and β-ACTIN (Sigma). After reaction with secondary antibodies, the antibody-bound proteins were detected using an ECL Western blotting kit (GE Healthcare Life Sciences, PA). *In vivo* imaging of MSCs {#Sec16} ------------------------- MSCs were labeled with 3.5 μg/mL of 1,1′-dioctadecyltetramethyl indotricarbocyanine Iodide (DiR, PerkinElmer, USA) by addition of the dye into cells suspended in PBS. After 30 min incubation at 37 °C, cells were extensively washed with PBS twice and injected into the rat abdomen after reperfusion. The animals were then imaged after surgery using the FMT 4000™ fluorescence tomography *in vivo* imaging system (PerkinElmer, USA). Biochemical analyses and histology {#Sec17} ---------------------------------- Liver sections (5 μm) were stained with hematoxylin and eosin for histological analysis. The hepatic damage was evaluated using the Suzuki score^[@CR50]^. The cell cycle progression (per 1,000 hepatocytes) was estimated using specific PCNA staining patterns and cell morphology as described previously^[@CR51]^. Serum alanine transaminase levels were determined using standard kits (Thermotrace, Melbourne, Australia). Apoptotic cells were determined by the TUNEL staining *in situ* cell death detection kit (Fluorescein, Roche, Mannheim, Germany). Neutrophil infiltration was assessed by staining tissue sections for chloroacetate esterase using the naphthol AS-D chloroacetate esterase kit (Sigma, St. Louis, MO). RNA isolation and real-time PCR {#Sec18} ------------------------------- RNA extraction and real-time PCR were performed as described previously^[@CR51]^. The PCR primers for TNF-α, IL-6, and IL-10 (Table [1](#Tab1){ref-type="table"}) were designed using Primer 3 (Whitehead Institute for Biomedical Research, Cambridge, MA). Primers were designed to cross exons to ensure that only cDNA and no genomic DNA was amplified. The comparative Ct method was used to determine fold differences between samples and the calibrator gene (β-actin). The comparative Ct method was used to determine the amount of target, normalized to an endogenous reference (β-actin) and relative to a calibrator (2^−ΔΔCt^).Table 1Primer Sequences for IL-6, IL-10, TNF-α, and β-actin.GeneForward primer (5′-3′)Reverse primer (5′-3′)IL-6TTCGGTCCAGTTGCCTTCTGGTGAGTGGCTGTCTGTGTGIL-10TGGGGGAGAACCTGAAGAATGGCTTTGTAGATGCCTTTCTNF-αCTCCTCACCCACACCATCAGGAAGACCCCTCCCAGATAGβ-actinGGCTCCCAGCACCATGAAAGCCACCGATCCACACAGA Statistical analyses {#Sec19} -------------------- 2-tailed Student's t-test or one-way analysis of variance (ANOVA) was used for the determination of statistical significance among treatment groups, as appropriate. Differences were considered significant at *P* \< 0.05. Results were reported as means ± SE (n = 3--6). For RNA sequencing data, gene expression levels were reported as fragments per kilobase million. Differences were considered significant at probability ≥0.8 and \|Log~2~ (fold of gene expression change)\|≥1. The DAVID (database for annotation, visualization and integrated discovery) software was used for gene functional classification and gene ontology analysis. Electronic supplementary material ================================= {#Sec20} Supplementary table and figure **Electronic supplementary material** **Supplementary information** accompanies this paper at 10.1038/s41598-018-20975-0. **Publisher\'s note:** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. We thank Dr Ge Lin (Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China.) for kindly providing us the human UC-MSCs, Dr Liang Hu (Institute of Reproductive and Stem Cell Engineering, School of Basic Medical Science, Central South University, Changsha, China.) for excellent technical assistance with the experiments. Dr Weixiong Zhong (Department of Pathology and Laboratory Medicine, University of Wisconsin-Madison, USA) for advice on writing the paper. This project was supported by The Key Planned Project of Hunan Provincial Science and Technology Department, China, Grant Number 2013FJ2007; National Natural Science Foundation of China, Grant Number: 30801386 and 81200697; and Specialized Research Fund for the Doctoral Program of Higher Education, China, Grant Number: 20120162120093. Y.S. and Y.W. performed the stem cell culture and writing. L.Z. performed the animal surgery, data analysis, and writing. Y.Z. performed the Multiplex-Microbead immunoassay and data analysis. G.H. and X.L. contributed to the immunostaining and real-time PCR analysis. G.G and T.S. performed the immunostaining. X.D. contributed to the concept, study design, animal surgery, data analysis, and writing. Competing Interests {#FPar1} =================== The authors declare that they have no competing interests. | Mid | [
0.624078624078624,
31.75,
19.125
]
|
It is known to pack tea or other goods into bags which are infused with hot water for use. These bags typically are made up of a first ply of a porous material composed of is natural fibers and of a second ply composed of hot-melting polymeric fibers such as for example PP, PE or various interpolymers. This second ply serves to close the bag by heatsealing on high-speed packing machines. This bag material can be produced in known manner by a wet-laid process on a paper machine, by a dry-laid process on a webbing machine or by a melt-blown process by laydown of polymeric fibers on a support layer. The basis weight of the first ply of the material is generally in the range 8-40 g/m2 and preferably in the range 10-20 g/m2, the basis weight of the second polymeric fibrous ply is in the range 1-15 g/m2 and preferably in the range 1.5-10 g/m2. It is known that used filter bags are disposed of on a compost heap or via the biowaste bin. After a certain period, which depends on further parameters such as temperature, moisture, microorganisms, etc, the natural fiber component of the filter bag will have disintegrated and become biodegraded, whereas the thermoplastic polymeric fibrous network remains intact and compromises the quality of the compost. It is not practicable to separate the natural fiber component from the thermoplastic polymeric component; that is, the used filter bag ought to be put into the nonrecyclable waste (Gray Bin). EP-A-0 380 127 describes a heatsealable paper for tea bags which has a basis weight of 10-15 g/m2 and which for heatsealing has been provided with polymers such as PP, PE or an interpolymer and therefore is not biodegradable. is EP-A-0 656 224 describes a filter material especially for producing tea bags and coffee bags or filters having a basis weight between 8 and 40 g/m2, wherein the heatsealable ply consists of polymeric fibers, preferably of polypropylene or polyethylene, which is laid down in the soft state onto the first ply, which consists of natural fibers. JP-A-2001-131826 describes the production of biodegradable monofilaments from poly L lactide and the subsequent production therefrom of wholly synthetic woven tea bags by a dry-laid process. The German patent application DE-A 21 47 321 describes a thermoplastic heatsealable composition which consists of a polyolefin powder (polyethylene or polypropylene) which is embedded in a carrier matrix of vinyl chloride-vinyl acetate copolymer. This material is likewise used for conferring heatsealability on fiber material produced by a papermaking process. DE-A-197 19 807 describes a biodegradable heatsealable filter material of at least one ply of natural fibers and at least one second ply of heatsealable synthetic material which is biodegradable. This filter material is obtained by first applying an aqueous suspension of natural fibers to a paper machine wire and then depositing the heatsealable biodegradable polymeric fibers on the natural fiber layer in such a way that they are able to partly penetrate through the natural fiber layer. A tea filter bag, for example, produced from this filter material has a high particle retention potential. However, this is bought at the expense of reduced air permeability. Yet, high air permeability coupled with good particle retention is the ultimate objective for any good filter material. Prior art filter materials thus suffer from at least one of the following disadvantages: 1. The used filter materials such as for example tea bags, coffee bags or else other filters are frequently disposed of on a compost heap or in the biowaste bin. After a certain period, which depends on further parameters such as temperature, moisture, microorganisms, etc, the natural fiber component of the filter will have disintegrated and become biodegraded, whereas the thermoplastic polymeric fibrous network composed of polymeric fibers which do not biodegrade completely remains intact and is compromises the quality of the compost. And/or 2. The use of fully biodegradable polymeric materials known by prior art for tea bags and similar filter papers leads to the heatseal seams formed on a tea bag not withstanding a temperature of about 90-100° C. This is because the production of heatsealed filled tea bags on high-speed packing machines occurs at a cycle time of about 1 000 bags per minute. So-called heatsealing rolls generally seal the bag at a temperature of 150-230° C. in a cycle time of less than 1 second. In the course of these short cycle times, the heatsealing material has to melt, adhere together and immediately resolidify and crystallize in order that, in further transportation, the bag is already resealed and no contents may escape. As mentioned above, however, prior art materials do not meet the requirements of this operation. | Low | [
0.5361990950226241,
29.625,
25.625
]
|
Over the years, the European Commission’s Framework programmes for scientific research have helped define European science. They have enabled new projects to get off the ground at the continental level and beyond, and they have created a generation of young researchers for whom working in international teams comes naturally. Without a doubt, this has contributed greatly to European competitiveness and to sustaining the impact of European research on the world stage. The latest incarnation of the EU’s science funding programme, Horizon 2020, is the best yet. Its ambition is high, its structures are more streamlined and its impact on European science and competitiveness is potentially transformative. Which is why the Commission’s decision to divert €2.7 billion to an alternative investment plan for Europe is short sighted. The Commission’s aim is to stimulate European economies, and that is laudable. Yet the best way for public sector finance at this level to achieve that ambition is through funding science and scientists: the ultimate drivers of innovation. Commission President Jean-Claude Juncker argues that the money diverted from Horizon 2020 to his new investment plan will benefit European science, which begs the question of why it’s being transferred in the first place. Time may prove Mr Juncker to be right, but in the meantime science will have to fight for previously ring-fenced funds, and I doubt the result will benefit European science as much as keeping Horizon 2020 intact. The investment plan is earmarked to cover everything from transport infrastructure to education and science. It’s a mystery to me why funds should be removed from Europe’s dedicated education and science programmes to fund these activities through a different route. This approach undermines the progress towards efficiency and transparency of funding that have been made in Horizon 2020. Nevertheless, the transfer from Horizon 2020 to the investment plan seems to be a done deal, and it is incumbent on European scientists to ensure that Mr Juncker’s promise of science and education funding through the investment plan is fulfilled. €2.7 billion is a large sum of money, but the true nature of Mr Juncker’s plan only becomes clear when you take a look at the bigger picture. With the Horizon 2020 programme valued at €70 billion over seven years, this sum corresponds to a reduction of about 4%: substantial by any measure. As a contribution to the €21 billion Mr Juncker plans to make available through his investment plan, it is clearly significant. However this needs to be set against the size of the economy to which it is to be applied. Conservative estimates valued Europe’s economy at €12 trillion in 2014. In other words, the funds taken from Horizon 2020 amount to a mere 0.02% of the total for a single year. How much impact can that realistically have? Little, I suspect, and it would be far better to leave the money earmarked for science in an economic ecosystem where it can make a meaningful difference. Over the years, the EU’s Framework programmes have built many bridges between the scientific communities of Europe. My advice today to Mr Juncker is: don’t spend the money on physical bridges. Invest instead on sustaining the intellectual bridges that Europe has painstakingly put in place over the years through the Framework programmes. That is the way to European cohesion, competitiveness and prosperity. To keep up with the Agenda subscribe to our weekly newsletter. Author: Rolf Heuer is the Director-General of the European Organization for Nuclear Research. Image: Molecular Genetics Technical Specialist Jaime Wendt (R) and Mike Tschannen work in the Human and Molecular Genetics Center Sequencing Core at the Medical College of Wisconsin in Milwaukee May 9, 2014. REUTERS/Jim Young. | High | [
0.6996197718631171,
34.5,
14.8125
]
|
AL West News and Rumors All-Star catcher Jason Castro clubbed a pair of home runs to back the starting pitching of Brad Peacock and help the Astros win their first home series in more than two months with an 8-5 victory over the Jays at Minute Maid Park on Saturday night. Astros catcher Max Stassi, who suffered a concussion Wednesday when he was hit by a pitch, felt well enough Saturday to address the media for the first time since he took a Tanner Scheppers fastball to the face. Chicago White Sox left-hander Chris Sale was not in a good mood following his outing against the Texas Rangers on Friday night. And for good reason. In seven innings of work, Sale was tagged for eight runs (all earned) on eight hits (four home runs), in… Your browser does not support iframes. They didn’t call Mitch Williams “Wild Thing” for nothing. It’s a nickname he earned during his 11-year career, six of which were spent as a closer for the Texas Rangers, Chicago Cubs and Philadelphia Phillies. It’s… Every now and then the hidden ball trick will catch a base runner of guard and result in an easy out for the defense. Just ask Juan Uribe of the Los Angeles and Max Stassi of the Houston Astros how that works. Of course, just as frequently, a hidden bal… The turmoil surrounding the Los Angeles reached a new level on Friday when Fox Sports Jon Morosi reported that the team was expected to replace either manager Mike Scioscia or general manager Jerry Dipoto before the 2014 season. Morosi noted that philos… | Low | [
0.47970479704797003,
32.5,
35.25
]
|
64 Cal.Rptr.3d 79 (2007) 153 Cal.App.4th 1385 MANI BROTHERS REAL ESTATE GROUP et al. Plaintiffs and Appellants, v. CITY OF LOS ANGELES et al. Defendants and Appellants. No. B194309. Court of Appeal of California, Second District, Division Two. August 3, 2007. *82 Brown, Winfield & Canzoneri, Thomas F. Winfield, Diana J. Vernazza, Los Angeles, for Plaintiffs and Appellants. Rockard J. Delgadillo, City Attorney, Siegmund Shyu, Deputy City Attorney, for Defendants and Appellants City of Los Angeles and City Council of the City of Los Angeles. Rockard J. Delgadillo, City Attorney, Timothy J. Chung, Miguel A. Dager, Deputy City Attorneys, for Defendant and Appellant Community Redevelopment Agency of the City of Los Angeles. DLA Piper US, Amy G. Nefouse, Whitney Stevens, San Diego, for Real Party in Interest and Appellant IDS Equities, LLC. BOREN, P.J. This case involves changes in the plan for a large real estate development project in downtown Los Angeles and compliance with the requirements of the California Environmental Quality Act (CEQA) (Pub. Resources Code, § 21000 et seq.).[1] The underlying issue is whether the original 1989 environmental impact report (EIR) with an updated 2005 addendum is sufficient, or whether the changes in the plan are such that it constitutes an entirely "new project" requiring a new EIR or, alternatively, whether the changes in the project trigger such new and significant environmental impacts that a supplemental EIR (SEIR) must be prepared. Mani Brothers Real Estate Group and 8th & Francisco, LLC (collectively, Mani Brothers), rival developers and landowners, challenge the project. Mani Brothers contend that the Modified Project is so different as to constitute a new project, and that it will have new or more severe environmental effects than the originally approved project due to an increase in square footage, building height, and a change in use from office to residential. However, we find that the focus on whether the changes amount to a "new project" is not determinative under CEQA. Under the applicable substantial evidence standard of review, but for the issue of police services, the Modified Project's substitution of residential use in place of some office, retail, and cultural uses results in fewer significant impacts compared to the Original Project, even though the overall square footage and floor area are somewhat larger in the Modified Project. *83 We thus affirm the judgment of the trial court denying a peremptory writ of mandate and upholding (except as to the issue of police services) the decision of City of Los Angeles, City Council of the City of Los Angeles, and the Community Redevelopment Agency of Los Angeles (CRA) (collectively referred to as the City) to approve the Modified Project (with the 2005 Addendum) by IDS Equities, LLC, and to require a SEIR on only one issue. The trial court properly granted a peremptory writ of mandate limited to ordering "a SEIR that deals with the necessity for increased police services required by the new, predominately residential project, as opposed to the old, commercial project that was approved by the 1989 EIR." FACTUAL AND PROCEDURAL SUMMARY Overview of the Original Project and the 1989 EIR. The project in question is located on approximately 6.3 acres in downtown Los Angeles, an area generally bounded by the Harbor Freeway, the Ninth Street (renamed James M. Wood Boulevard) northbound freeway off-ramp, Francisco Street, and Eighth Street. The project is in a central business district redevelopment area and is currently vacant land used for parking lots. The Original Project was reviewed under CEQA. In 1989, an EIR was certified by the CRA, a public agency charged with attracting private investment in economically depressed areas (Health & Saf.Code, § 33000 et seq.), which must review and approve all projects in the central business district before a building permit can be issued. The CRA acted as the "lead agency" on the project under CEQA Guidelines (see Cal.Code Regs, tit. 14, §§ 15050, 15051; hereinafter, Guidelines) and was responsible for ensuring compliance with CEQA and for certifying the final EIR (FEIR). The Original Project analyzed in the 1989 EIR consisted of five buildings with approximately 2.7 million square feet of development, including offices, a 550- to 770-room hotel, retail facilities, and an optional cultural center. The structures included three 30-story towers, one 36-story tower, and one 7-story building. The 1989 EIR discussed the environmental impact in numerous areas, such as land use and planning, urban design and historic resources, shadow and wind, transportation, circulation and parking, climate and air quality, noise, energy, hazardous materials, public services and utilities, employment, housing, and fiscal factors. The EIR recommended mitigation measures for certain impacts and examined alternatives, but concluded that even with mitigation measures, the project "would result in unavoidable significant adverse impacts in the areas of traffic generation, air quality, and increased demand for water, sewer capacity, solid waste, and the provision of police and fire services." Approvals for the Original Project, and then delays and changed real estate market conditions. In 1990, the CRA approved the Original Project, including an owner participation agreement (OPA), with a public benefits plan and a transfer of floor area ratio (TFAR) plan, and it adopted CEQA findings. Later in 1990, the Los Angeles City Council reviewed and approved the TFAR plan and ratified the OPA for the project with the developer of the Original Project, City Center Development. In 1992, the City and the developer of the Original Project entered into a development agreement. The Original Project analyzed under CEQA entailed several approvals over the *84 course of time. Some of the CRA and City approvals have occurred, such as approval of the concept master plan, but other approvals have not yet occurred, such as approvals of the concept design drawings and certificates of completion. Full implementation of the project was delayed by litigation (see A Local and Regional Monitor v. City of Los Angeles (1993) 12 Cal.App.4th 1773, 16 Cal.Rptr.2d 358), which left the developer in what was then a weak real estate leasing, market in the early 1990's. Between 1994 and 2003, the project's OPA was refined several times by five implementation agreements, extending the time for the developer's performance. The project was also revised in 2000 to change some of the conditions of approval related to the subsurface of certain streets. The CRA prepared a CEQA addendum (the 2000 Addendum) for the project revisions approved at that time. The 2000 Addendum also updated the FEIR analysis and conclusions by evaluating if "changes in environmental or regulatory conditions have the potential to alter the findings regarding the project's impacts contained in the previously certified FEIR." As part of the fifth and final implementation agreement, the CRA required the project developer to undertake a market study to analyze current market conditions and recommend a possible revised approach to the project. In October of 2003, the market study was completed and submitted to the CRA. The market study indicated, in pertinent part, that there was a strong demand for residential development in the downtown area. The 2005 Addendum. In light of the changed and improved real estate market conditions indicating a transition to a residential and mixed-use environment, in May of 2004, the project developer formally requested that the CRA revise the project to permit residential uses. The CRA, acting as the lead agency, initiated an assessment of whether additional review under CEQA was required for the purposes of a Modified Project. Because the project had already been the subject of a FEIR, pursuant to section 21166 and CEQA Guidelines sections 15162 through 15164, the CRA analyzed whether any conditions required the preparation of a SEIR. The CRA determined, in pertinent part, that because there were no new or more significant environmental impacts than had been previously evaluated in the original EIR, and because the project developer had not refused to implement any appropriate mitigation measures, the changes in the project were such that no major revision to the FEIR (as updated by the 2000 Addendum) was required. Thus, the CRA prepared a 2005 Addendum to the Original Project's FEIR. The 2005 Addendum was an approximately 390-page document (exclusive of lengthy technical appendices) analyzing the impacts of the Modified Project in comparison to the impacts of the previously approved Original Project. The Modified Project would reduce much of the Original Project's office and retail space, and eliminate the optional cultural use component, while maintaining the hotel component and adding residential components. As a result of these changes, the overall size of the project would increase from approximately 2.7 million square feet to a maximum of just over 3.2 million square feet. The additional density would be made possible by a TFAR from the nearby Convention Center, a process authorized by the Los Angeles Municipal Code whereby development rights can be transferred within the central business district. Using a TFAR entails a monetary benefit to the *85 City because, pursuant to the restated OPA approved as a part of the Modified Project, the developer would pay between $5.8 million and $23.3 million, depending upon the amount of increased density used, with the proceeds split between the City and the CRA and used to provide affordable housing. As indicated in the 2005 Addendum, the Modified Project would consist, in pertinent part, of the following: (1) one 360-unit residential building with a maximum height of 350 feet, open space plazas and recreational space; (2) a second residential and retail building with a maximum height of 500 feet, up to 388 units, open spaces and terraces; (3) a third residential and hotel tower with a maximum height of 620 feet, up to 88 residential units and 480 hotel rooms, open space, recreation areas and terraces; and (4) a fourth building with a maximum height to 620 feet and approximately 1 million square feet of office, approximately 11,325 square feet of retail, and additional open space. The Modified Project would encourage pedestrian use of Francisco Street and Eighth Street by providing a plaza, ground level retail space, and pedestrian amenities such as lighting, landscaping and outdoor sculptures. As further indicated in the 2005 Addendum, although the changes in the project would increase the overall size of the project by approximately 18.5 percent, the project's environmental impacts actually would be reduced. Environmental impacts would be reduced because residential development tends to cause fewer impacts compared to retail or office development, primarily because residential development would generate significantly less traffic. By introducing residential features, the Modified Project would reduce vehicular trips by approximately 50 percent in comparison to the Original Project. According to the 2005 Addendum, the changes in the Modified Project would lessen many of the environmental impacts that were deemed significant and unavoidable in the Original Project, such as impacts on traffic, water supply, water and wastewater treatment facilities, and landfill capacity. Police protection services. The 1989 EIR had deemed the impact of the Original Project on the need for police protection services to be "significant and unavoidable." As set forth in the 1989 certified EIR, appropriate mitigation measures would entail (1) consultation with the Los Angeles Police Department (LAPD) crime prevention unit on design and implementation of a security plan, and (2) the proper illumination of elevators, lobbies and parking areas. The 2005 Addendum acknowledged that the Modified Project would result in a "somewhat greater" demand for police protection services because of the residential component of the project with approximately 1,714 new residents, apart from the additional people associated with the commercial component of the project. "This is considered a potentially significant impact." Nonetheless, the 2005 Addendum found that the Modified Project, with its now largely residential character, would have a "less than significant impact" on the need for police services with certain mitigation measures implemented. As explained in the 2005 Addendum, the Modified Project, like the Original Project, would include design features intended to reduce the need for police protection services. For example, the Modified Project would include private security guards, electronic surveillance equipment, and electronic card keys for after-hours access to the buildings and parking structures. The Modified Project also would be located in an area that provides an additional security *86 team, know as the "Purple Patrol," which works in coordination with the LAPD to ensure the safety of the downtown area. Regarding police services, the 2005 Addendum concluded as follows: "With these project features and measures, impacts on police protection services associated with the Modified Project would be less than significant. Additionally, given that future projects would be required to undergo LAPD review on an individual basis, and the reasonable expectation that adequate funding of facility needs would continue to be maintained through the City's budgeting process, including increases in tax revenue through future projects, cumulative impacts on police protection services would be less than significant. This is in contrast to the Certified EIR's findings where project and cumulative impacts on police protection were identified as unavoidable, significant and adverse." The 2005 Addendum only identified two significant and unavoidable impacts of the Modified Project: air quality and construction noise, both of which were impacts previously disclosed in the FEIR and the 2000 Addendum. All other impacts of the Modified Project-including the impact on police services, which was previously found to be significant and unavoidable-were determined to be less than significant. The approval process for the Modified Project. The ensuing approval process for the Modified Project and the 2005 Addendum included several public meetings before the CRA and the City. In October of 2005, the CRA board certified the 2005 Addendum and approved the Modified Project, and then gave the requisite statutory notice of its approval of the Modified Project. Several months later, the owner of the project sold the project to another entity, IDS Equities (real party in interest in the present appeal). Thereafter, pursuant to an assignment and assumption agreement in November of 2005, LA Metropolis became the participant in the restated OPA and is the current owner and developer of the project.[2] After the CRA approved the Modified Project, the CRA sent to the City Council appropriate documentation so that it could review the Modified Project and the 2005 Addendum and approve the restated OPA, as required by law. (See L.A. Admin. Code, § 8.99.04(g), (o) & (p).) The CRA also requested, in pertinent part, that the City direct its share of the TFAR payment into the City's affordable housing trust fund. Beginning in December of 2005, the City Council held public meetings and then approved the Modified Project and directed the filing of a notice of determination on the Modified Project. The superior court upheld the Modified Project and the 2005 Addendum, except as to the analysis of police services. In January of 2006, Mani Brothers filed a petition for a writ of mandate, challenging the 2005 Addendum and the approval of the Modified Project. The trial court denied the writ petition and upheld the 2005 Addendum and the Modified Project in all respects, except as to the analysis of the impacts related to police services. The court entered judgment granting a peremptory writ of mandate ordering "a SEIR that deals with the necessity for *87 increased police services required by the new, predominately residential project," but finding that "the project is in compliance with CEQA, and the petition is denied on all grounds alleged therein other than the alleged failure to provide for the necessity of increased police protection purposes." Mani Brothers appeal, contending essentially that the trial court erred in not granting the petition mandating the preparation of a new EIR or a SEIR on all of the project's environmental impacts. The City cross-appeals on the issue of police services, contending that the Modified Project and the 2005 Addendum complied with CEQA in all respects. DISCUSSION I. Mani Brothers satisfied the requirement of the exhaustion of administrative remedies. The City contends that Mani Brothers failed to establish the jurisdictional prerequisite of exhaustion as to nearly all the issues raised. The City notes that Mani Brothers appeared during the City Council's approval process on the Modified Project by submitting, through their attorneys, four short letters and speaking through their counsel at one City Council committee hearing and at two City Council hearings. According to the City, these communications improperly asserted only in the most general terms that the changes associated with the Modified Project and the changes in circumstances required preparation of a SEIR. The rationale for exhaustion is that the agency "`is entitled to learn the contentions of interested parties before litigation is instituted. If [plaintiffs] have previously sought administrative relief ... the [agency] will have had its opportunity to act and to render litigation unnecessary, if it had chosen to do so.'" (Citizens Assn. for Sensible Development of Bishop Area v. County of Inyo (1985) 172 Cal. App.3d 151, 162-163, 217 Cal.Rptr. 893.) The "exact issue" must have been presented to the administrative agency to satisfy the exhaustion requirement. (Resource Defense Fund v. Local Agency Formation Com. (1987) 191 Cal.App.3d 886, 894, 236 Cal.Rptr. 794.) However, "less specificity is required to preserve an issue for appeal in an administrative proceeding than in a judicial proceeding" because, although not the case here, parties in such proceedings generally are not represented by counsel. (Citizens Assn. for Sensible Development of Bishop Area v. County of Inyo, supra, 172 Cal.App.3d at p. 163, 217 Cal.Rptr. 893.) Pursuant to the CEQA statutory scheme, only parties who object to the agency's approval of the project either orally or in writing may thereafter file a petition. (§ 21177, subd. (b).) In any action or proceeding alleging noncompliance with CEQA, the grounds alleged for noncompliance must first have been "presented to the public agency orally or in writing by any person during the public comment period provided by this division or prior to the close of the public hearing on the project before the issuance of the notice of determination." (§ 21177, subd. (a).) In the present case, when the CRA prepared the 2005 Addendum, it did not provide for a public comment period or provide the public with notice that it was preparing an addendum. Also, neither the CRA nor the City provided a public hearing on the 2005 Addendum under CEQA, and the City acknowledges "there was no formal public comment period on the 2005 *88 Addendum."[3] However, several meetings were held. They were not duly noticed public hearings under CEQA, but were regularly scheduled meetings of the CRA or the City that were open to the public. As the City correctly explains, the exhaustion requirement nonetheless applies because the public meetings held constituted an "other opportunity for members of the public to raise ... objections orally or in writing prior to the approval of the project." (§ 21177, subd. (e), italics added.) Because Mani Brothers repeatedly voiced their objections to the 2005 Addendum at various relevant meetings, the exhaustion requirement was satisfied. Mani Brothers raised their concerns about the use of an addendum to evaluate the changed project at meetings of the City Council and the Housing, Community and Economic Development Committee. In written and oral comments, Mani Brothers raised their concerns regarding the project's impacts on air quality, public services, traffic, congestion, parking, aesthetics, and shade and shadow. For example, in a letter to the City Council dated December 21, 2005, Mani Brothers noted, in pertinent part, "These differences and the others reflected or permitted in the Amended and Restated OPA create new substantial environmental effects and increase the severity of previously identified effects, such as the impact on public services, traffic and shade and shadow." Similarly, in a February 21, 2006, letter to the City Council, Mani Brothers stated: "[T]he Council must prepare a supplemental or subsequent Environmental Impact Report.... [¶] ... These changes will introduce new significant effects on public services, such as fire protection, police protection, schools and parks.... The increased heights, as well as the relocation of the buildings' footprints, will affect the shadows cast on the surrounding properties.... [¶] ... These developments have changed the landscape of the Project area, introduced new significant environmental effects, and increased the severity of previously identified environmental effects, such as traffic, congestion, and parking and the provision of police and fire services." The letters to the City Council also noted that an addendum does not require public notice or public review, objected that certain mitigation measures had been deleted, and objected to the City's approval of a reduced TFAR payment and the sale of the project to the new developer at a profit to the old developer. Accordingly, the objections here were more than merely "a relatively few bland and general references" (Coalition for Student Action v. City of Fullerton (1984) 153 Cal.App.3d 1194, 1198, 200 Cal. Rptr. 855), and the objections thus were adequate to satisfy the exhaustion requirement. (See, e.g., East Peninsula Ed. Council, Inc. v. Palos Verdes Peninsula Unified School Dist. (1989) 210 Cal.App.3d 155, 176, 258 Cal.Rptr. 147 [comment about the absence of any mention of the "`most basic concern'" of residents for "`traffic and safety'" was sufficient notice for exhaustion purposes as to those issues].) The objections by Mani Brothers satisfied the purpose of the exhaustion doctrine, which is to provide the public agency with an "opportunity to receive and respond to articulated factual issues and *89 legal theories before its actions are subjected to judicial review." (Coalition for Student Action v. City of Fullerton, supra, 153 Cal.App.3d at p. 1198, 200 Cal.Rptr. 855, original italics.) II. Standards of review. Because we are reviewing the City's decision against a claim of noncompliance with CEQA, "the scope and standard of the appellate court's review is the same as the trial court's." (Gilroy Citizens for Responsible Planning v. City of Gilroy (2006) 140 Cal.App.4th 911, 918, 45 Cal.Rptr.3d 102.) In any action to attack, review, or set aside the decision of a public agency to approve a project based on grounds of noncompliance with CEQA, where a hearing was required and a public agency exercised its discretion in making factual determinations, we do "not exercise [our] independent judgment on the evidence, but shall only determine whether the act or decision is supported by substantial evidence in the light of the whole record." (§ 21168; see also § 21168.5 [in other situations, "the inquiry shall extend only to whether there was a prejudicial abuse of discretion"].) For CEQA purposes substantial evidence is defined by statute as including "fact, a reasonable assumption predicated upon fact, and expert opinion supported by fact." (§ 21080, subd. (e)(1).) The applicable CEQA Guideline further explains that substantial evidence includes "enough relevant information and reasonable inferences from this information that a fair argument can be made to support a conclusion, even though other conclusions might also be reached. Whether a fair argument can be made that the project may have a significant effect on the environment is to be determined by examining the whole record before the lead agency." (Guidelines, § 15384, subd. (a).) Substantial evidence does not include "[a]rgument, speculation, unsubstantiated opinion or narrative, evidence which is clearly erroneous or inaccurate, or evidence of social or economic impacts which do not contribute to or are not caused by physical impacts on the environment. (Ibid.) To the extent there are questions about whether substantial evidence exists, "[t]he agency is the finder of fact and a court must indulge all reasonable inferences from the evidence that would support the agency's determinations and resolve all conflicts in the evidence in favor of the agency's decision." (Gilroy Citizens for Responsible Planning v. City of Gilroy, supra, 140 Cal.App.4th at p. 918, 45 Cal. Rptr.3d 102; see also Laurel Heights Improvement Assn. v. Regents of University of California (1988) 47 Cal.3d 376, 393, 253 Cal.Rptr. 426, 764 P.2d 278.) Accordingly, Mani Brothers have the burden here to demonstrate that the City's decision to approve the Modified Project with the 2005 Addendum, rather than to require a SEIR, is not supported by substantial evidence and was thus improper. (§ 21168; Guidelines, § 15384, subd. (a).) III. Substantial evidence supports the City's decision that the Modified Project will have no new or more severe impacts than the Original Project, and that therefore a SEIR was not required (except as to the issue of police services). General principles regarding use of a SEIR versus an addendum. A SEIR is a subsequent version of an EIR which revises the earlier EIR to make it adequate for a project's approval after conditions have changed. No subsequent or supplemental EIR is required by the lead agency unless one of several *90 events occur, the relevant event here being that "[substantial changes are proposed in the project which will require major revisions of the [EIR]." (§ 21166, subd. (a).) The CEQA Guidelines implementing section 21166 elaborate upon this triggering event, and explain that a SEIR need not be prepared unless "[substantial changes are proposed in the project which will require major revisions of the previous EIR ... due to the involvement of new significant environmental effects or a substantial increase in the severity of previously identified significant effects." (Guidelines, § 15162, subd. (a)(1).) In contrast to a SEIR, an addendum to a previously certified EIR must be prepared "if some changes or additions are necessary but none of the conditions described in Section 15162 calling for preparation of a subsequent EIR have occurred." (Guidelines, § 15164, subd. (a).) An addendum does not need to be circulated for public review or comment but can be included in, or attached to, the final EIR, and it is then considered by the agency before making its decision on the project. (Guidelines, § 15164, subds.(c) & (d).) An addendum may be appropriate for either an EIR or a negative declaration. (Guidelines, § 15164.) In the context of a negative declarationa declaration that no substantial evidence supports a fair argument that a project may have a significant environmental impact (which was not the case here)an addendum to an adopted negative declaration is appropriate where "only minor technical changes or additions are necessary." (Guidelines, § 15164, subd. (b).) When reviewing an agency's decision not to require a SEIR, the "low threshold" fair argument test "for requiring the preparation of an EIR in the first instance is no longer applicable; instead, agencies are prohibited from requiring further environmental review unless the stated conditions are met." (Friends of Davis v. City of Davis (2000) 83 Cal.App.4th 1004, 1017-1018, 100 Cal.Rptr.2d 413.) Thus, in reviewing decisions made pursuant to section 21166, courts "are not reviewing the record to determine whether it demonstrates a possibility of environmental impact, but are viewing it in a light most favorable to the City's decision in order to determine whether substantial evidence supports the decision not to require additional review." (Id. at p. 1021, 100 Cal.Rptr.2d 413.) The rationale for limiting the circumstances under which a supplemental or subsequent EIR may be prepared is "precisely because in-depth review has already occurred, the time for challenging the sufficiency of the original EIR has long since expired (§ 21167, subd. (c)), and the question is whether circumstances have changed enough to justify repeating a substantial portion of the process." (Bowman v. City of Petaluma (1986) 185 Cal.App.3d 1065, 1073, 230 Cal.Rptr. 413, original italics.) Therefore, section 21166 "provides a balance against the burdens created by the environmental review process and accords a reasonable measure of finality and certainty to the results achieved. [Citation.] At this point, the interests of finality are favored over the policy favoring public comment...." (Friends of Davis v. City of Davis, supra, 83 Cal.App.4th at p. 1018, 100 Cal.Rptr.2d 413.) Applying the above principles, courts have upheld the use of addenda and not required preparation of a SEIR in numerous contexts which are instructive here. Thus, for example, addenda were properly used in cases where many years had elapsed between the original EIR and later project revisions (see Santa Teresa Citizen Action Group v. City of San Jose, *91 supra, 114 Cal.App.4th 689, 7 Cal.Rptr.3d 868 [eight years between certified final EIR and addendum]), and where the project's appearance had changed fairly dramatically (see Fund for Environmental Defense v. County of Orange (1988) 204 Cal.App.3d 1538, 252 Cal.Rptr. 79 [designs changed, square footage increased by 30 percent, number of buildings increased, and project site newly surrounded by wilderness park]; River Valley Preservation Project v. Metropolitan Transit Development Bd. (1995) 37 Cal.App.4th 154, 43 Cal.Rptr.2d 501 [light rail project changed by raising the elevation of a segment of a berm by a factor of two to three times the original height and replacing a golf course with a wetland]). The recent case of Save Our Neighborhood v. Lishman (2006) 140 Cal.App.4th 1288 (Save Our Neighborhood) does not compel a different analysis. The extensive reliance by Mani Brothers on the recent case of Save Our Neighborhood, supra, 140 Cal.App.4th 1288, 45 Cal.Rptr.3d 306, does not persuade us to use an analysis different from that discussed above. In Save Our Neighborhood, the court dealt with substantial proposed changes in a project, with the new project involving the same land and mixes of use (e.g., motel or hotel, gas station, eating facilities, etc.) but with different proponents using completely different drawings, materials and configurations of structures. The city asserted the project involved only minor changes, filed an addendum to the prior project's mitigated negative declaration, and then approved that addendum for the new project. (Id. at pp. 1292-1293, 45 Cal.Rptr.3d 306.) The court in Save Our Neighborhood, supra, 140 Cal.App.4th at page 1301, 45 Cal.Rptr.3d 306, found that the "totality of the circumstances" established that the project in question was not a modified version of a prior project, but rather was a new and different project not subject to the legislative and administrative requirements (§ 21166; Guidelines, § 15162), and that the city violated CEQA in relying on an addendum rather than an independent environmental review. (Save Our Neighborhood, supra, at p. 1301, 45 Cal.Rptr.3d 306.) The court thus reversed and remanded the matter and directed the trial court to grant the petition for a writ of mandate, compelling the defendants to vacate the notice of determination, the approval of the project, and all other matters associated with the project. (Save Our Neighborhood, supra, pp. 1294, 1302, 45 Cal.Rptr.3d 306.) According to Mani Brothers, the present case, like the situation in Save Our Neighborhood, involves an entirely "new project" and mandates not merely a SEIR, but an entirely "new EIR" which "should be subjected to full CEQA review." Save Our Neighborhood, however, involved an addendum to a previously certified negative declaration and not, as here, an addendum to a previously certified EIR. That is significant because an addendum is only appropriate to a previously certified negative declaration where "minor technical changes or additions are necessary" (Guidelines, § 15164, subd. (b)) and, as noted before and contrary to the contention of Mani Brothers, this limitation does not apply where the addendum is to a previously certified EIR. (Guidelines, § 15164, subd. (a).) Because in the present case the 2005 Addendum was to the FEIR previously certified for the project, not a previously certified negative declaration, Save Our Neighborhood is distinguishable and inapplicable. Even if Save Our Neighborhood was not distinguishable on its facts, its fundamental analysis is flawed. The court in Save *92 Our Neighborhood tackled what it perceived to be the "threshold question [of] whether we are dealing with a change to a particular project or a new project altogether," and declared that "section 21166 and Guidelines section 15162 apply to the former but not the latter." (Save Our Neighborhood, supra, 140 Cal.App.4th at p. 1301, 45 Cal.Rptr.3d 306.) This novel "new project" test does not provide an objective or useful framework. Drastic changes to a project might be viewed by some as transforming the project to a new project, while others may characterize the same drastic changes in a project as resulting in a dramatically modified project. Such labeling entails no specific guidelines and simply is not helpful to our analysis. The "new project" test in Save Our Neighborhood, also inappropriately bypassed otherwise applicable statutory and regulatory provisions (i.e., § 21166; Guidelines, § 15162) when it considered it "a question of law for the court" whether the changed project was to be reviewed under section 21166 at all. (Save Our Neighborhood supra, at p. 1297, 45 Cal.Rptr.3d 306.) We disagree with that approach and view the issue of whether an agency proceeded properly in treating a project as subject to section 21166 not as a question of law, but rather as a question of the adequacy of evidence in the record to support the agency's determination. The question of law approach employed in Save Our Neighborhood conflicts with the customary substantial evidence test discussed above and long used in all other cases. The case of Benton v. Board of Supervisors (1991) 226 Cal.App.3d 1467, 277 Cal.Rptr. 481 (ironically cited by Save Our Neighborhood, supra, 140 Cal.App.4th at p. 1297, 45 Cal.Rptr.3d 306, to support the question of law approach used), is instructive. There, the project involved moving a winery to a different site, adding underground storage caves and altering access routes. The appellate court characterized the project as a modification of the prior project, upheld the decision not to prepare an EIR, and found the agency's mitigated negative declaration sufficient. However, the court did so based on an assessment of the environmental effects of the proposed project revisions, not on the magnitude or character of the changes or its treatment of the issue as a question of law. (Benton v. Board of Supervisors, supra, 226 Cal.App.3d at pp. 1483-1484, 277 Cal.Rptr. 481.) Treating the issue as a question of law, as the court did in Save Our Neighborhood, inappropriately undermines the deference due the agency in administrative matters. That principle of deference is otherwise honored by the substantial evidence test's resolution of any "`reasonable doubts in favor of the administrative finding and decision.'" (Laurel Heights Improvement Assn. v. Regents of University of California, supra, 47 Cal.3d at p. 393, 253 Cal.Rptr. 426, 764 P.2d 278.) Most significantly, holding that the court should decide as a matter of law if the later project is a revision of a previously approved project or an entirely new project, without consideration of the environmental impacts of the later project, violates the legislative mandate that "courts ... shall not interpret this division or the state guidelines ... in a manner which imposes procedural or substantive requirements beyond those explicitly stated in this division or in the state guidelines." (§ 21083.1; see Maintain Our Desert Environment v. Town of Apple Valley (2004) 124 Cal.App.4th 430, 445, 15 Cal.Rptr.3d 322.) The focus of CEQA, both procedurally and substantively, is "solely ... the potential environmental impacts of a project." (Maintain Our Desert Environment *93 v. Town of Apple Valley, supra, 124 Cal.App.4th at p. 445, 15 Cal.Rptr.3d 322.) Labeling a project a "new" project, as distinguished from a "modified" project, and finding such a label determinative, as the court did in Save Our Neighborhood, imposes a new analytical factor beyond the framework of CEQA. Particularly here where there is a previously certified EIR, changes in the size, ownership, nature, character, etc., of a project are of no consequence in and of themselves. Such factors are meaningful only to the extent they affect the environmental impacts of a project. Thus, in the present case, we must hark back to section 21166 and the mandate in the Guidelines that a SEIR need not be prepared unless "[substantial changes are proposed in the project which will require major revisions of the previous EIR ... due to the involvement of new significant environmental effects or a substantial increase in the severity of previously identified significant effects." (Guidelines, § 15162, subd. (a)(1), italics added.) Whether substantial evidence establishes that a SEIR was required. Mani Brothers contend that if no new EIR is required, then at least a SEIR is required. Although Mani Brothers discuss at some length the facts in other cases, they cite no evidence whatsoever to support the bulk of their conclusory assertions. There is thus no support for most of the claims that the Modified Project's increased size, density, or changes in use will introduce "new significant environmental effects or a substantial increase in the severity of previously identified significant effects." (Guidelines, § 15162, subd. (a)(1).) As with all substantial evidence issues, an appellant challenging the evidence must lay out the evidence favorable to the other side and show why it is lacking. A reviewing court need not independently review the record to make up for an appellant's failure to carry this burden. (Defend the Bay v. City of Irvine (2004) 119 Cal. App.4th 1261, 1266, 15 Cal.Rptr.3d 176; see also Markley v. City Council (1982) 131 Cal.App.3d 656, 673, 182 Cal.Rptr. 659.) It is thus unnecessary to review the facts in detail regarding the impact of the Modified Project on such factors as traffic, air quality, construction noise, fire protection services, and the visuals of shade, shadow and view. It is sufficient to note, however, that the City cites to substantial evidence in the administrative record that the Modified Project will not have any new or more severe environmental impacts than previously disclosed (with the exception of police services). Indeed, the substitution in the Modified Project of residential uses in place of some office, retail, and cultural center uses would result in about the same or substantially fewer significant impacts (e.g., traffic) compared to the Original Project, even with an overall increase in square footage and floor area ratio. Mani Brothers also assert that since the certification of the EIR in 1989, the area surrounding the Modified Project has changed dramatically. Specifically, they note the development of the Staples Center in 1999, the Disney Concert Hall in 2003, some office and residential developments, the L.A. Live project adjacent to Staples Center and the Grand Avenue project. Even assuming all of those developments are in sufficiently meaningful proximity to the Modified Projecta highly questionable assumptionthere is no evidentiary support cited for the notion that those developments will necessarily alter the baseline upon which previously identified impacts should be evaluated. *94 In fact, the 2005 Addendum specifically noted a list of cumulative related projects, took into consideration "the current environmental setting ... as the baseline," and analyzed the Original Project and the Modified Project "under the same contemporary baseline conditions." Thus, a SEIR was not required due to cumulative impacts caused by the Modified Project when considered in conjunction with new development in the area. (See § 21166; Guidelines, § 15162.) Nor does the City's decision to delete or revise certain mitigation measures warrant a SEIR. Mitigation measures adopted when a project is approved may be changed or deleted if the agency states a legitimate reason for making the changes and the reason is supported by substantial evidence. (Napa Citizens for Honest Government v. Napa County Bd. of Supervisors (2001) 91 Cal.App.4th 342, 359, 110 Cal.Rptr.2d 579.) Here, substantial evidence supports deleting the measures because they are no longer necessary. For example, the 2005 Addendum explains that the downtown urban core has expanded so that low-rise and mid-rise structures have been replaced with midrise and high-rise structures, rendering the height limitation of 30 stories a mitigation that is no longer necessary. Similarly, the Modified Project will have no significant traffic impact on local streets and now provides for on-site parking in excess of City requirements, making participation in the peripheral parking program no longer necessary. The deletion of other mitigation measures, such as a freeway off-ramp improvement measure, a water treatment capacity mitigation measure, and a waste removal mitigation measure, were likewise explained in terms of the recent lack of any significant impact requiring mitigation or the existence of recent external factors obviating the need for the mitigation. Thus, substantial evidence in the record supports the reasons for the changes in the Modified Project's mitigation measures, and no new or more severe impacts are caused by the deletions or changes to the mitigation measures. Hence, no SEIR was required. The impact of the Modified Project on police services. In its cross-appeal, the City alleges that the use of an addendum to analyze the Modified Project's impacts on police services complied with CEQA and should be upheld.[4] However, we find the trial court properly granted a peremptory writ of mandate limited to ordering "a SEIR that deals with the necessity for increased police services required by the new, predominately residential project, as *95 opposed to the old, commercial project that was approved by the 1989 EIR." The City complains about the trial court's observation that it was "obvious" that "a project that has people living in the downtown area rather than just working in the downtown area, coming in to work and then leaving at night, ... makes a substantial impact on the amount of police protection." Specifically, the City asserts that the trial court's reliance on such a conclusion as "obvious" amounted to the court's improper application of its own independent judgment of the evidence, rather than using the substantial evidence test and viewing the evidence "in a light most favorable to the City's decision in order to determine whether substantial evidence supports the decision not to require additional review." (Friends of Davis v. City of Davis, supra, 83 Cal.App.4th at p. 1021, 100 Cal.Rptr.2d 413.) We acknowledge that it is improper for a court to "judge the wisdom of the agency's action in approving the Project or' pass upon the correctness of the EIR's environmental conclusions." (River Valley Preservation Project v. Metropolitan Transit Development Bd., supra, 37 Cal. App.4th 154, 168, 43 Cal.Rptr.2d 501.) Rather, the function of a court, whether at the trial or appellate level, is to determine whether the agency followed proper procedures and whether "substantial evidence" supports the agency's determination that changes in the project, or its circumstances, were not sufficient to require a SEIR. (Ibid.) However, the City fails to appreciate that a court may find substantial evidence not only in clearly stated facts, but also from "reasonable assumptions predicated upon facts." (§ 21080, subd. (e)(1).) The Guidelines further explain that substantial evidence includes "enough relevant information and reasonable inferences from this information that a fair argument can be made to support a conclusion, even though other conclusions might also be reached. Whether a fair argument can be made that the project may have a significant effect on the environment is to be determined by examining the whole record before the lead agency." (Guidelines, § 15304.) Viewed accordingly, we find, as did the trial court, that the conclusory assertion in the 2005 Addendum that the Modified Project will have an insignificant impact on the provision of police services is not supported by substantial evidence. The 2005 Addendum also stated that both the Original Project and the Modified Project would have an insignificant impact on police services, although the 1989 EIR found that the Original Project would have a significant and unavoidable impact on the provision of police services. Additionally, the 2005 Addendum concluded that the Original Project's design featuresthe same design features considered in the 1989 EIRwould decrease the Original Project's impacts on the provision of police sei-vices to a less than significant level. However, the 2005 Addendum fails to provide evidence as to why the same mitigation measures that the 1989 EIR found would not reduce the Original Project's impacts to less than a significant level somehow do just that. There is also no evidence in the 2005 Addendum as to why it disregarded the LAPD's statement in the 1989 EIR that the Original Project would indeed have a significant impact on the provision of police sendees. Regarding mitigation measures, in a similarly conclusory fashion, the 2005 Addendum notes that the Modified Project would increase the demand on the LAPD for police services, but that the mitigation measures would reduce the Modified Project's impacts on police services to less *96 than significant. However, that conclusion is inexplicable because the mitigation measures envisioned are the same mitigation measures considered in the 1989 EIR, which found that such mitigation measures would not reduce the Original Project's impacts on the provision of police services to less than significant. Thus, the 2005 Addendum fails to explain how the mitigation measures, found unable to mitigate the Original Project's impacts in the 1989 EIR, are now magically able to mitigate the impacts of the larger and mostly residential Modified Project. Accordingly, substantial evidence and reasonable inferences therefromspecifically, the increased size of the project, the addition of over 800 residential units, and the features designed to encourage pedestrian use of the areaestablish that the changes in the Modified Project will increase the Original Project's impact on the provision of police services. The trial court properly found that the City erred in failing to prepare a SEIR to evaluate the Modified Project's impacts as to police services. DISPOSITION The judgment is affirmed. Each party is to bear its own costs on appeal. We concur: DOI TODD and CHAVEZ, JJ. NOTES [1] Unless otherwise indicated, all further statutory references are to the Public Resources Code. [2] Apparently, the parties never formally sought to substitute LA Metropolis for IDS Equities. [3] Pursuant to the CEQA statutory scheme, an addendum, unlike an EIR or a SEIR, "need not be circulated for public review but can be included in or attached to the final EIR." (Guidelines, § 15164, subd. (c).) Since, as discussed below, the addendum process was properly used in the present case, there is no merit to the contention by Mani Brothers that the City violated CEQA by excluding the public from the environmental review process. [4] In its effort to establish that the Modified Project will purportedly have an insignificant impact on the provision of police services, the City requests that we take judicial notice of several items. The City requests judicial notice of a 1997 City Ordinance and a 2002 City Ordinance with an attached 2002 Management Plan for property based in the business improvement district in the downtown center district of Los Angeles. Although under certain circumstances it is appropriate to take judicial notice of legislation by local governments (Evid.Code, § 452, subd. (b); see Evans v. City of Berkeley (2006) 38 Cal.4th 1, 7, 40 Cal.Rptr.3d 205, 129 P.3d 394), it is well settled that in a CEQA action challenging the sufficiency of the evidence the court can only review evidence that was actually before the decision-making body at the time of its decision. (Western States Petroleum Assn. v. Superior Court (1995) 9 Cal.4th 559, 573, fn. 4, 38 Cal.Rptr.2d 139, 888 P.2d 1268.) Because here the requested materials were not brought before the decision-making body and considered by it at the time of the approval of the 2005 Addendum and the Modified Project, we deny the City's request for judicial notice. | Mid | [
0.5995203836930451,
31.25,
20.875
]
|
205 Kan. 755 (1970) 473 P.2d 48 PACIFIC INDEMNITY COMPANY and AVIATION INSURANCE MANAGER, INC., Appellants, v. PAUL VANDEN BERGE, Appellee. No. 45,778 Supreme Court of Kansas. Opinion filed July 17, 1970. F.C. McMaster, of Smith, Stinson, McMaster, Lasswell and Smith, of Wichita, argued the cause, and Gerald D. Lasswell, of the same firm, and F.D. Covell, of Cox, Anderson and Covell, of Mission, were with him on the briefs for the appellants. Harry E. Robbins, Jr., of Gamelson, Hiebsch, Robbins and Tinker, of Wichita, argued the cause and was on the brief for the appellee. The opinion of the court was delivered by KAUL, J.: Plaintiffs-appellants issued a policy of "Aircraft Hull and Liability" insurance on an aircraft which defendant-appellee had purchased from Yingling Aircraft, Inc., on April 8, 1965. In *756 order to finance the purchase of the aircraft, defendant gave Yingling a conditional sales contract and promissory note. The policy of insurance, together with a breach of warranty endorsement for the protection of Yingling, was purchased by defendant from Don Flower Associates, Inc., an agent of plaintiffs. On June 21, 1965, the aircraft crashed and was destroyed, except for salvage in the amount of $1,100.00. Defendant failed to make a payment due Yingling on August 15, 1965, following which Yingling made demand on plaintiffs for the balance due on the conditional sales contract and promissory note. Thereafter plaintiffs paid Yingling $7,085.40, the balance due and received from Yingling an assignment of the promissory note. Plaintiffs also took possession of the damaged aircraft and salvaged it for $1,100.00. Thereafter, on March 10, 1967, plaintiffs, as assignees of the promissory note, filed this action thereon against defendant for the balance due, which they had paid to Yingling. Plaintiffs also claimed interest and delinquency charges on the future installments, as provided for by the terms of the note. Defendant answered alleging that plaintiffs were obligated to pay Yingling under the policy of insurance and that the payment made was in full satisfaction of defendant's obligation to Yingling and, therefore, Yingling held no rights against defendant which could be assigned by plaintiffs. Defendant also filed a counterclaim against plaintiffs in which he alleged that his aircraft had been destroyed; that it was insured by plaintiffs for its value for the benefit of Yingling and defendant as their interests might appear. Defendant further alleged that he had demanded that plaintiffs pay his indebtedness to Yingling and the balance of the value of the aircraft to him, but that plaintiffs had without reason refused to do so. The policy of insurance, together with all endorsements, was incorporated by reference in defendant's counterclaim. Defendant prayed that plaintiffs take nothing by their cause of action and that he have judgment on his counterclaim against plaintiffs in the amount of $10,000.00. In their answer to defendant's counterclaim, plaintiffs admitted the aircraft was insured, but alleged that it was not insured against the loss (in this case) under any one of the exclusions of the policy. *757 Following plaintiffs' answer to defendant's counterclaim, defendant submitted interrogatories to plaintiffs, which were filed on September 27, 1967. Defendant served additional interrogatories upon plaintiffs on October 12, 1967. On December 4, 1967, the case was placed upon the nonjury trial docket by the administrative judge of the district court. On December 14, 1967, plaintiffs having failed to answer interrogatories served upon them, defendant filed a motion asking for an order compelling plaintiffs to complete discovery by answering the interrogatories. Plaintiffs filed their answer to the interrogatories last mentioned on December 29, 1967. The case was then set for trial on February 23, 1968. Apparently, the trial was postponed at the request of plaintiffs' counsel and a pretrial conference was had, at the conclusion of which the case was reset for trial on April 5, 1968. Plaintiffs' attorneys requested a continuance which was overruled and the case was tried to the court. At the conclusion of the trial, the court found that the destruction of the aircraft did not fall within policy exclusions, as claimed by plaintiffs; that the aircraft was covered by the policy; and that at the time of its destruction the value of the aircraft was $8,000. The court found that plaintiffs were entitled to judgment on the promissory note, and that defendant was entitled to judgment on his counterclaim. The court then offset plaintiffs' judgment on the promissory note, against defendant's judgment on his counterclaim, and calculated the sums as follows: "9. The defendant is entitled to receive credit for the rebated unearned interest in the sum of $1,183.35. "10. Plaintiffs are entitled to judgment in the sum of $5,986.40, and defendant is entitled to judgment in the sum of $8,000.00. "11. Judgment of the defendant in the sum of $8,000.00 should be offset by plaintiffs' judgment in the sum of $5,985.40. "12. Judgment should be entered in favor of the defendant and against the plaintiffs in the sum of $2,014.60, together with interest thereon at the rate of six percent (6%) per annum from the date this Journal Entry is filed." Plaintiffs' motion for a new trial was overruled and they perfected this appeal. The principal grounds for reversal urged by plaintiffs concern alleged abuse of discretion by the trial court in denying plaintiffs' request for a continuance and various rulings excluding evidence which are claimed to be erroneous. Plaintiffs first assert the trial court abused its discretion in denying *758 them a continuance of the trial set for April 5, 1968, on the grounds that plaintiffs were unable to obtain material evidence prior to the trial. In their brief on appeal, plaintiffs' counsel recite a chronology of events which they claim show that substantial justice was denied by the trial court's action. They claim that plaintiffs' counsel, at the time of filing the action, was misled by correspondence with the trial court. This series of events is described in their brief as follows: "Plaintiffs' counsel, shortly after filing the instant action, wrote a letter to the Clerk of the Court of Sedgwick County requesting certain information regarding trial dates; this request was answered by the Honorable William C. Kandt, Judge of Division No. 1, which letter advised counsel that trial would normally commence some two or three months after a pre-trial conference. Counsel then, in reliance upon such letter and the rules of the 18th Judicial District which were sent him, concluded, rightly or wrongly, that he would be notified of a pre-trial setting and that the questions presented by Defendant's answer (which he did not think pertinent to the Plaintiffs' cause of action) would be determined as a matter of law, whether they would be allowed as a defense to Plaintiffs' action. Counsel then concluded that he would, after pre-trial, have two months minimum time within which to obtain and marshal evidence on behalf of the Plaintiffs. The rules relating to the 18th Judicial District were changed on July 1st, 1967, and all cases in the Sedgwick County District Court became subject to central assignment. Without any notice to Plaintiffs' counsel of the change of the rules, the case was set for trial on February 23, 1968 by the assignment judge for the 18th Judicial District. Approximately one week's notice of the trial was given to Plaintiffs' counsel by Defendant's counsel. However, the court, at the time of the appearance by Plaintiffs' counsel on February 23, 1968, evidently recognizing the impossibility of the situation of the short notice of trial, held a pre-trial conference; the conclusion of the pre-trial conference resulted in an order directing the case for trial on April 5, 1968, approximately six weeks later...." We first observe that we see no possibility of prejudice stemming from the change in local rules of the district court on July 1, 1967, more than seven months prior to the first trial setting on February 23, 1968. Plaintiffs' counsel claim that after the pretrial conference, a diligent effort was made to obtain necessary evidence but that they were unsuccessful even though an interval of six weeks elapsed between the pretrial conference on February 23 and the trial on April 5. Plaintiffs' counsel further state that on April 4, at 11 p.m., Mr. *759 Covell called Mr. Frank McMaster, a member of the Wichita Bar, and engaged him as co-counsel for plaintiffs. Mr. McMaster states that prior to 9 a.m., the morning of April 5, by telephone he requested from both the assigned trial judge and the administrative judge of the district court a continuance in order that he, McMaster, might procure instruments necessary to support plaintiffs' motion for continuance. Plaintiffs strenuously argue that under the circumstances recited, the trial court's refusal to grant a continuance was an abuse of discretion which resulted in a denial of justice to plaintiffs. Plaintiffs' counsel emphatically assert that given a continuance, plaintiffs would have been able to produce substantial competent evidence showing the destruction of the aircraft to have been under circumstances excluded by the terms of the policy that would have foreclosed the possibility of a judgment such as that rendered by the trial court on the evidence admitted. On the other hand, defendant's counsel claims just as emphatically that the evidence of plaintiffs, which was later set forth in posttrial affidavits, even though produced, would still not establish a defense to defendant's counterclaim on the policy of insurance. In any event, we are not confronted with an issue as to the force and effect of plaintiffs' evidence or whether plaintiffs could have produced it. The issue before us is whether the trial court's refusal to grant a continuance, under the attending circumstances, on April 5, 1968, the date of trial, amounted to an abuse of discretion which entitles plaintiffs to a new trial. The assignment of cases for trial and continuance thereof are governed by K.S.A. 60-240. Subsection (b) authorizes the granting of a continuance for good cause shown at any stage of the proceedings. Subsection (c) deals with an affidavit in support of a motion for continuance. It provides that the court need not entertain a motion for continuance based on the absence of a material witness unless supported by an affidavit setting forth certain essentials required by the statute, including a statement of the witness's expected testimony; the basis of such expectation, and also the efforts which have been made to procure the attendance of the witness or to take his deposition. The same requirements are specified with necessary changes, "when the motion is grounded on the want of any material document, thing or other evidence." *760 The foregoing language of subsection (c) is substantially the same as the former statute (G.S. 1949, 60-2934) which made mandatory the filing of an affidavit in support of a motion for continuance. In enacting subsection (c) an additional sentence was added: "... In all cases, the grant or denial of a continuance shall be discretionary whether the foregoing provisions have been complied with or not." The effect of the additional sentence is that in the absence of a supporting affidavit a court need not entertain a motion for a continuance, but may do so in its discretion and if a motion is supported by an affidavit the granting or denial of the motion remains discretionary in the court, all of which is generally in harmony with the long-standing case law of this state. (Scott v. Keyse, 200 Kan. 625, 438 P.2d 112; State v. Zimmer, 198 Kan. 479, 426 P.2d 267, cert. den. 389 U.S. 933, 19 L.Ed.2d 286, 88 S.Ct. 298; Konitz v. Board of County Commissioners, 180 Kan. 230, 303 P.2d 180.) In the instant case none of the motions or requests, made to the assigned trial judge or to the administrative judge, was supported by an affidavit. On the morning of the trial, plaintiffs' attorneys did attempt to orally state what the expected testimony of the absent witnesses would be but a showing of due diligence in the efforts made to procure their attendance or depositions was decidedly lacking. The latter is also an essential requirement of 60-240 (c). The record shows the issues in this case were essentially framed when defendant filed his answer and counterclaim on April 14, 1967, almost a year prior to the trial date. Plaintiffs filed their answer to defendant's counterclaim on May 1, 1967. During the period, August 3, 1967, to December 29, 1967, two sets of interrogatories were served on plaintiffs and answered by them. The case was first set for trial on February 23, 1968. However, the trial was continued and a pretrial conference was held which extended over a period of one-half day. The pretrial order reflected a comprehensive hearing at which all issues were defined and discussed. On February 23, 1968, a trial day was set for April 5, 1968, which gave plaintiffs an additional six weeks to prepare for trial. On September 27, 1967, in their answer to defendant's interrogatories, plaintiffs clearly indicated they knew the name and address of Arch V. Doughty, Sheriff of East Feliciana Parish, Louisiana, *761 who was an eyewitness to the aircraft crash and took part in the investigation. Under the facts and circumstances related it cannot be said that the denial of a continuance amounted to an abuse of discretion. Plaintiffs further complain of the trial court's refusal on the day of the trial to permit them to proffer and make a record of the material evidence which was missing. Under the plain language of 60-240 (c) the trial court need not entertain any motion for continuance unless supported by an affidavit meeting the requirements of the statute. Plaintiffs next contend the trial court should have continued the case at their request at the close of defendant's evidence. Plaintiffs cite the case of Roberts v. Sinkey, 136 Kan. 292, 15 P.2d 427, in support of their contention. In the Roberts case the defendant's serious illness precluded him from attending the trial. This court held that since there was nothing to discredit or discount the statements made under oath by the defendant's wife, his attorney and his physician it amounted to an abuse of discretion to deny the motion for continuance, at least for enough time to permit the taking of defendant's deposition. Obviously, the case is clearly distinguishable from the case at bar. In view of what has already been said concerning the pleadings, interrogatories and pretrial conference, there was nothing in defendant's evidence which came as a surprise to plaintiffs. For the same reasons related in connection with plaintiffs' first claim of error, we are unable to find abuse of discretion by the trial court in its ruling at this stage of the trial. Plaintiffs next contend the trial court erred when it refused to admit certain documentary evidence offered by plaintiffs. Consideration of this point requires a brief resume of the trial proceedings as presented in the record. Following the court's denial of their motion for a continuance, plaintiffs submitted into evidence the conditional sales contract, the promissory note and their check to Yingling. Next in the record we find this statement: "Thereafter, Mr. Covell, as counsel for the plaintiff, did rest the Plaintiff's case on the exhibits that had been introduced and the findings and stipulations heretofore entered by the Court in a pre-trial conference. Counsel for the defendant then made his opening statement to the Court." Defendant then proceeded to make an opening statement and submit evidence. Defendant's evidence consisted of his testimony *762 and the insurance policy. Defendant testified that he paid $8,350 for his aircraft and in his opinion it was of the value of $8,000 when destroyed; that he purchased the insurance from Don Flower Associates, Inc.; that they were notified of the aircraft loss; and that he had not been paid the value of his aircraft by plaintiffs. On cross-examination defendant testified that he had no personal knowledge of the aircraft crash; that Don Flower, or one of his associates, had advised him that the insurance company was refusing to pay for the loss; that he had received a letter from the insurer to the effect that the aircraft was being operated "in a situation that excluded it from insurance coverage, something to that extent," but that nothing was specified in the letter as to "what manner it was being operated contrary to." When handed the sheriff's report, defendant testified that it looked like a report he had received at one time. Admission of the sheriff's report was objected to "as a hearsay document out of court, unsworn statement by a third party." The objection was sustained. Defendant further testified that papers which were on the aircraft concerning registration, weight and balance data were not in his possession and that he believed they were removed from the aircraft by the insurance company. He testified that he had an "Owner's Manual," but it was not carried on the aircraft. Objection was made and sustained to the introduction of the "Owner's Manual" on the ground that it was immaterial. Plaintiffs then attempted to have defendant identify a number of the Exhibits, including those in the form of a multi-page document which appears to be a Federal Aviation Accident Report. Objections to the admission of the documents were sustained on the ground that the subject matter was beyond scope of direct-examination. The court commented: "I think you have material for rebuttal. This is cross examination. The objection is sustained at this point." Following cross-examination of defendant, plaintiffs asked the court to take judicial notice of the Federal Air Regulations to which defendant's counsel objected: "In respect to the FAA Regulations Exhibit 3 says that if that airplane was operated in violation of FAA Regulations the coverage is excluded, but the burden is upon the insurance company to prove it by facts to bring it within the exclusion. And until they prove any facts as to what happened, I don't see the materiality of the FAA Regulations. It clutters the record." The court sustained defendant's objection. *763 Plaintiffs offered no rebuttal evidence but again offered the sheriff's report. In short, the competent evidence received by the court did not establish any facts surrounding the aircraft crash or related circumstances, other than that it was totally destroyed except for salvage. The evidence which plaintiffs claim was erroneously excluded consisted of plaintiffs' Exhibits numbered 4 through 31, inclusive, and Exhibit 33. The Exhibits are described and their admissibility urged by plaintiffs as follows: "These Exhibits were copies of the Federal Aviation Agency reports made in the ordinary course of business both as to matters surrounding the accident and as to collateral matters which had previously been promulgated with regard to the particular type of aircraft, which had a relation to the incident out of which the aircraft loss arose. An examination of the proffered documents would disclose that the parties responsible for the making of such documents had no `chips in the game.' The information that was contained in such documents were made by the parties whose signatures were ascribed to them in the ordinary course of business and would be available for admission under the provisions of K.S.A. 60-460. Such statute contains the exceptions to the hearsay rule. Under such exceptions the Exhibits would be admissible under sub-sections (d) Contemporaneous statements and statements admissible on a grounds of necessity generally; (g) Admissions by parties; (m) Business entries and the like; and (o) Content of official record. Since the Appellants are limited on the length of their brief by the rules of this court, counsel will not attempt to delineate in detail each particular Exhibit and why same could be admitted under the exceptions. Appellants do wish to call to the attention of this court the fact that Exhibit 8 was the statement of the pilot of the aircraft and it appears he was unavailable as a witness at the time of trial and his testimony or statement would certainly be pertinent; Exhibit 4 was the statement of the Sheriff who arrived at the scene and talked to the pilot; Exhibit 17 which was the report made in the ordinary course of business by FAA Investigator Nolden and further, that all of such records would be contents of the official record of the Federal Aviation Agency." Many of the Exhibits referred to are portions of a report of the accident made by Federal Aviation Agency Investigators. Examination of the documents discloses that they closely resemble a police report of an investigation of a traffic accident and, therefore, for the same reasons are inadmissible to prove the truth of the statements and conclusions contained therein. In McGrath v. Mance, 194 Kan. 640, 400 P.2d 1013, it was held: "A police report of an accident investigation which contains statements of a hearsay character and conclusions on the part of the officer preparing the report, is not admissible as substantive evidence." (Syl. ¶ 1.) *764 See, also, State v. Taylor, 198 Kan. 290, 424 P.2d 612; State v. Foster, 198 Kan. 52, 422 P.2d 964; and Letcher v. Derricott, 191 Kan. 596, 383 P.2d 533. In their brief plaintiffs cited generally the exceptions to the hearsay rule set out in K.S.A. 60-460 (d), (g), (m) and (o), as supporting the admissibility of the evidence in question. Plaintiffs do not relate specific subsections to particular documents. Subsection (d) covers contemporaneous statements and statements admissible on the ground of necessity generally. Plaintiffs mention Exhibit 8, a statement of the aircraft pilot, and Exhibit 4, the sheriff's statement, as falling within the purview of subsection (d). The trouble is that there is no evidence establishing how or under what circumstances the statements were made, nor is the unavailability of the witnesses established. None of the conditions required by subsection (d), to make contemporaneous statements admissible, is shown to have been met. With respect to the admissibility of any of the Exhibits, as business entries under subsection (m), there is no evidence in the record to identify the Exhibits or qualify them as business records within the requirements of subsection (m). Foundation facts were not established. (State v. Foster, 198 Kan. 52, 422 P.2d 964; and Gard, Kansas Code of Civil Procedure Annotated, § 60-460 [m], p. 482.) Regarding the admissibility of the Exhibits as contents of official records under subsection (o), admissibility is made subject to K.S.A. 60-461 which requires delivery to each adverse party a reasonable time before trial, unless the judge finds that such adverse party has not been unfairly surprised. Admissibility of a document under subsection (o) is further qualified by the necessity of meeting the requirements of authentication prescribed in K.S.A. 60-465. As we have previously indicated, none of the Exhibits was served on defendant's attorney prior to trial, nor were the requirements of authentication complied with. In summary, none of the Exhibits mentioned was delivered to defendant's attorney before March 20, 1968, as directed by the pretrial order (or before trial); none was authenticated in compliance with the requirements of K.S.A. 60-464 and 60-465; and those claimed to be official records were not sent to opposing counsel as required by K.S.A. 60-461. The trial proceedings show the Exhibits were offered during the *765 cross-examination of defendant who testified he had no personal knowledge of the aircraft crash. Moreover, as shown by the trial record, most of the cross-examination of defendant concerning the documents was beyond the scope of direct-examination and subject to objection on that ground. Under the circumstances related it cannot be said the trial court abused its discretion in refusing to admit the Exhibits into evidence. Plaintiffs contend the trial court erred in not taking judicial notice of the regulations published by the Federal Aviation Agency. In our discussion of this subject we shall refer to the Federal Aviation Agency as FAA and the Regulations as FAR. Plaintiffs urge the importance of the regulations because of their connection with certain exclusions contained in the policy of insurance in which plaintiffs seek to avoid liability, particularly exclusionary provisions 1 (c), which provides that the policy does not apply if the loss occurs when the aircraft is in flight in violation of any applicable aircraft operations limitations, and 2 (b), if piloted by a pilot not properly certified, and 2 (c), if the aircraft's Airworthiness Certificate is not in full force and effect. Without conceding that the FAR are entitled to judicial notice, defendant maintains that in any event the evidence does not establish that the operation of the aircraft fell within an exclusion of the policy and, therefore, it is immaterial whether the trial court took judicial notice of FAR. Plaintiffs claim that 1 (c) was violated in that regulations require the presence of an "Owner's Manual" in the craft. Defendant answers that the pertinent regulation FAR 91.31 (b) requires the presence of an FAA approved "aircraft flight manual for that aircraft of placards, listings, instrument markings, or any combination thereof, containing each operating limitation prescribed for that aircraft by the Administrator," the regulation then specifies nine items which should be included. Defendant says he was only asked about an "Owner's Manual" on cross-examination and not the items specified in the regulation. In any event there was no competent evidence before the trial court showing precisely what was or was not aboard the aircraft. With respect to other violations of 1 (c) pertaining to weight of the loaded aircraft and of gasoline used asserted by plaintiffs, defendant points out there was no evidence properly submitted or received by the court which established either claim. There was *766 some inconclusive evidence touching upon these matters shown in the investigation report proffered but not admitted. In regard to plaintiffs' claim of a violation of 2 (c), defendant explains in his brief that the Airworthiness Certificate of the aircraft was in full force and effect and present in the aircraft, or it could not have been abstracted (as it was) in plaintiffs' Exhibit 15, a part of the FAA report. Plaintiffs claim the pilot was not properly certified as required by 2 (b). Defendant correctly states that there was no evidence to support such claim and further that under the pertinent FAR the pilot's medical certificate, on which plaintiffs base their claims, did not expire until June 30, 1965, nine days after the crash. The controversy between the parties on this point demonstrates the necessity of determining what regulations are applicable and effective on the date of the crash. Plaintiffs claim the pilot's medical certificate was issued on June 10, 1964, and expired twelve months later on June 10, 1965. Defendant cites FAR § 61.43, shown as amended April 3, 1965, and found in Vol. 1A, CCH, Aviation Law Reporter, p. 2991, which shows expiration of the medical certificate to be twelve months after the month in which it is issued and as applied in this case, June 30, 1965. Plaintiffs cite authority to the effect that a state court should take judicial notice of FAR. (8 Am.Jur.2d, Aviation, § 116, p. 746.) Defendant points out on the other hand that our statute (K.S.A. 60-409), does not list federal agency publications or even regulations as a subject for judicial notice. Defendant further points out that the trial court and defendant were furnished no information with respect to said regulations as required by 60-409. On this point we do not believe that either the trial court or defendant should have been surprised by the appearance of the regulations during the course of the trial since the question, whether the aircraft was operating in violation of the FAR when the crash occurred, was identified as an issue in the pretrial order. Even though this court has held a departmental regulation of the Federal Government is not subject to judicial notice but must be pleaded by quoting its language or stating the substance of its provisions (Jukes v. North American Van Lines, Inc., 181 Kan. 12, 309 P.2d 692) in view of the references made in the pretrial order, we do not say in this case that the regulations would not have been subject to judicial notice if they had been properly identified and *767 authenticated when presented to the court. It was pointed out, and not disputed, that the FAR are subject to frequent amendments and that the regulations, shown in the record here, contain some amendments which were not in effect when the crash occurred. Since there is no showing by certificate or otherwise as to what the effective regulations were at the time of the aircraft crash, we cannot say the refusal to take judicial notice of the regulations amounted to prejudicial error. Moreover, as we have previously indicated, the surrounding facts and related circumstances pertaining to the aircraft crash were not established by plaintiffs' evidence, thus the FAR were immaterial as the trial court ruled. The Kansas law is clear that when an insurer seeks to avoid liability under its policy on the ground that the circumstances fall within an exception, set out in the policy, the burden is on the insurer to establish the facts which bring the case within the specified exception. (Southards v. Central Plains Ins. Co., 201 Kan. 499, 441 P.2d 808; Smith v. Allied Mutual Casualty Co., 184 Kan. 814, 339 P.2d 19; and Braly v. Commercial Casualty Ins. Co., 170 Kan. 531, 227 P.2d 571.) Without discussing in further detail the evidence before the court, it will suffice to say that an examination of the record discloses that plaintiffs failed to prove that the casualty occurred within any policy exclusion. Plaintiffs claim defendant failed to file proof of loss within sixty days after the aircraft crashed, as required by the provisions of the insurance policy. In their answers to interrogatories plaintiffs admit that the letter was sent to defendant, dated July 29, 1965, in which liability on the policy was denied. Defendant also testified that he notified Don Flower Associates, Inc., agent of plaintiffs, of the destruction of the aircraft. In its letter to defendant denying liability no mention was made of plaintiffs' failure to make verified proof of loss within sixty days as one of the grounds for denying liability. When this ground for denying liability was waived then it was not good thereafter, either in the trial court or in this court. Where an insurer bases its refusal to pay a loss upon a forfeiture or failure to comply with particular condition it cannot thereafter maintain a defense based upon another condition not referred to in such refusal to pay and of which it then had knowledge. (Reser v. Southern Kansas Mutual Ins. Co., 150 Kan. 58, 91 P.2d 25; Winchel v. National Fire *768 Ins. Co., 129 Kan. 225, 282 Pac. 571; and Insurance Co. v. Ferguson, 78 Kan. 791, 98 Pac. 231.) Plaintiffs claim they were entitled to interest subsequent to the date of the aircraft loss which should have been added to their judgment prior to the setoff of defendant's judgment imposed by the court. Plaintiffs were only assignees of the promissory note, not holders in due course. They were liable to defendant on the policy of insurance for the loss of his aircraft in excess of the amount paid Yingling. Under such circumstances, plaintiffs have never actually been owed any money by defendant, although their obligation to defendant was reduced by the amount paid to Yingling. The trial court did not err in refusing to credit plaintiffs with unearned interest. Two further matters mentioned in plaintiffs' brief require brief attention. Plaintiffs claim a breach of the provision of the conditional sales contract prohibiting leasing of the aircraft without prior written consent of the seller. There is no prohibition in the policy against leasing the aircraft. Plaintiffs also complain that the trial court did not consider a deductible provision of the policy for loss sustained to the aircraft while taxiing or in flight. No findings or rulings were made by the trial court concerning either matter for the simple reason that the record discloses no mention of either was made in the pleadings, in the pretrial conference or in plaintiffs' motion for a new trial. Since these questions were not presented to the trial court they cannot be considered by this court on appeal. Where it does not affirmatively appear that a question raised on appeal was presented to and determined by the trial court this court will not consider it on review. (Schneider v. Washington National Ins. Co., 200 Kan. 380, 437 P.2d 798; Hoppe v. Hoppe, 181 Kan. 428, 312 P.2d 215; and Holton v. Holton, 172 Kan. 681, 243 P.2d 222.) The plaintiffs having failed to affirmatively show that the trial court abused its discretion or committed reversible error, the judgment is affirmed. FONTRON, J., dissenting: While I recognize, as an imperative, the right of a court to control its docket, such authority should not be exercised without a proper regard for principles of fairness and requirements of justice. In the instant case, I believe, the plaintiffs have been unfairly deprived of their day in court. *769 Granted that plaintiffs' out-of-town counsel had known of the trial date for a number of weeks, he appeared in court on the date set for trial woefully unprepared to proceed to trial on the defendant's counterclaim. In recognition of this fact, he sought the assistance of local counsel, both to secure a further continuance and to assist him in trying the action. Not only was plaintiffs' request for a continuance denied, but the court refused to delay commencement of the trial until local counsel could be in attendance. The court's refusal to grant a continuance of any length or kind and as we read the record, counsel was prevented from even making a record of the reasons for the request left the plaintiffs completely without evidence to dispute defendant's counterclaim. Although an attempt was made by plaintiffs' counsel, on cross-examination of the defendant, to identify certain exhibits and to elicit certain testimony deemed relevant by counsel, the trial court rigidly restricted cross-examination, sustaining defense objections practically in toto and going so far as to interject an objection or two of its own. At the conclusion of all the evidence the defendant himself being the only witness a continuance was again requested so that depositions might be taken. This was summarily denied. In my view, this final request, at the very least, should have been granted in the interest of fairness, and the refusal thereof can hardly be said to accord with the exercise of sound judicial discretion. In conclusion I would observe it is my opinion the trial court, had it granted a continuance, might well have limited the time within which depositions were to be taken as well as assessing costs of taking the same to plaintiffs or their counsel, together with other costs attributable to their delay. The imposition of conditions of this sort would be consistent, I believe, with the inherent power possessed by courts to speed the flow of litigation, as well as to see that justice is done. (Osborne v. Fakes, 178 Kan. 373, 286 P.2d 156.) For reasons expressed, I must respectfully dissent. | Low | [
0.5275590551181101,
33.5,
30
]
|
Currently, the rise in use of VoIP (Voice Over Internet Protocol) telephones has outpaced the ability of emergency telephone systems, such as 9-1-1, to handle these types of calls. First, because VoIP telephone calls do not originate from fixed physical locations in the same manner as landline telephone calls, it is difficult to ensure that the emergency call is sent to the appropriate local PSAP (Public Safety Access Point) responding to the location of the 9-1-1 call, such as the local police, local fire or local 9-1-1 emergency call center. Secondly, once a call is handled by a PSAP the use of VoIP telephone has further complicated the ability to detect the location of a caller when an emergency call is placed. For example, when a caller uses a VoIP telephone, the call is generally placed though the internet or other such packet switched network. Thus, when a dial string such as 9-1-1 is placed, the devices/routers handling the call do not have the capacity to properly determine the location of the caller to route the calls to a local PSAP through the internet. Although PSAP's may be able to handle incoming VoIP internet calls, the outgoing VoIP routers would not know which local PSAP to send them to, since the location of the VoIP caller is unknown. Furthermore, in standard landline telephone calls made to 9-1-1 or other similar emergency telephone numbers, the 9-1-1 call center is able to trace the physical location of the caller through a standard call trace since the location of the line is fixed. This is particularly useful when a caller is not able to give their location either because they do not know their location or they are physically unable to verbalize their location. Also, with cellular callers, GPS (Global Positioning System), other location systems, or cell tower triangulation can be used to physically locate an emergency caller. However, with VoIP telephones the call is connected to the destination telephone via the internet. This makes it difficult and/or impossible to easily trace the physical location of caller if they are unable to give the location on their own. This presents an added difficulty in directing emergency personal in the case of a 9-1-1 or other emergency call that is placed from a VoIP phone. | High | [
0.6682027649769581,
36.25,
18
]
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.