text
stringlengths 8
5.74M
| label
stringclasses 3
values | educational_prob
sequencelengths 3
3
|
|---|---|---|
All TFF members may edit this wiki as they wish. You do not need permission to edit anything. IMPORTANT: When editing a page, you MUST write a brief description of what you changed in the "Short description of changes" box below the editing field! If you don't, wargs will eat you. Internal links only need the page name listed, i.e. "/oendir." Link names do not obey capitals (/Oendir will automatically become /oendir). Calaer Estate An estate within the Gondorian city of Pelargir, the hilled property outside of the old wall of Pelargir looks in towards the city and the river beyond the great port. House Calaer having been in Pelargir since the city's infancy, the estate was rebuilt along with all of the other Houses outside of the Old City after Corsairs ravaged and ruined Pelargir in TA 1634. While a prominent household of Gondorian nobility in the city for generations, the past several decades had seen it fall into disfavor after the Lord Belegorn fell ill, and his wife Gwaeldis took it upon herself to attempt to run the family behind his back. The family nearly fell to ruin before Belegorn recovered, and it took the lord and his sons a great while to mend many of the bridges that had been burned. The War claiming the lives of his two eldest sons, Belegorn turned to his ambitious youngest son, Peldirion. Shutting Gwaeldis out of all of the House affairs, the two men worked tirelessly to restore the reputation, which was easier within Pelargir as many of the other lords knew the son as a competent soldier and friend of their sons. Since the war's end, Belegorn and Gwaeldis signed the estate over to Peldirion who has taken over his family's House and business. The house thriving again with it's Lord having been elected by the Council of Lords to be the current Vice Consul, the Calaer Estate is once again on the rise. The manor and grounds are lush, practical, and well cared for, only showing tasteful hints of antiquated opulence. Lord Belegorn having taken the majority of his racing horses with him, Peldirion has instead moved his prized war horses from the garrison to his home stables. Included in the property's assets are the 180 acre estate, 1560 acres of beach and forest, six merchant ships, and two naval ships, a share of a salt mine, and partnerships with other merchants that deal in the trade of spices, wine, lumber and fish (the latter two being long standing contracts from Belegorn's lordship). Some of the current residents include: Current Lord: Peldirion - cohort of ten Current Lady: Lalaith - escort of five | Mid | [
0.59860788863109,
32.25,
21.625
] |
Q: making DLL for JNI in Netbeans problem I am trying to create a DLL to use it with Java JNI. I am using Netbeans C/C++ plugin to create the dll. but after compile i am getting the following error (.o objects already created) any idea? am i missing something? "/usr/bin/make" -f nbproject/Makefile-Debug.mk QMAKE= SUBPROJECTS= .clean-conf make[1]: Entering directory `/c/projects/hdijni' rm -f -r build/Debug rm -f dist/Debug/MinGW-Windows/libhdijni.dll make[1]: Leaving directory `/c/projects/hdijni' CLEAN SUCCESSFUL (total time: 18s) "/usr/bin/make" -f nbproject/Makefile-Debug.mk QMAKE= SUBPROJECTS= .build-conf make[1]: Entering directory `/c/projects/hdijni' "/usr/bin/make" -f nbproject/Makefile-Debug.mk dist/Debug/MinGW-Windows/libhdijni.dll make[2]: Entering directory `/c/projects/hdijni' mkdir -p build/Debug/MinGW-Windows/src rm -f build/Debug/MinGW-Windows/src/ByteJNI.o.d gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -c -g -Isrc/Windows -Isrc -I../../MinGW/jni/include/win32 -I../../MinGW/jni/include -MMD -MP -MF build/Debug/MinGW-Windows/src/ByteJNI.o.d -o build/Debug/MinGW-Windows/src/ByteJNI.o src/ByteJNI.c gcc.exe: --add-stdcall-alias: linker input file unused because linking not done mkdir -p build/Debug/MinGW-Windows/src rm -f build/Debug/MinGW-Windows/src/HDIJNI.o.d gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -c -g -Isrc/Windows -Isrc -I../../MinGW/jni/include/win32 -I../../MinGW/jni/include -MMD -MP -MF build/Debug/MinGW-Windows/src/HDIJNI.o.d -o build/Debug/MinGW-Windows/src/HDIJNI.o src/HDIJNI.c gcc.exe: --add-stdcall-alias: linker input file unused because linking not done mkdir -p build/Debug/MinGW-Windows/src rm -f build/Debug/MinGW-Windows/src/common.o.d gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -c -g -Isrc/Windows -Isrc -I../../MinGW/jni/include/win32 -I../../MinGW/jni/include -MMD -MP -MF build/Debug/MinGW-Windows/src/common.o.d -o build/Debug/MinGW-Windows/src/common.o src/common.c gcc.exe: --add-stdcall-alias: linker input file unused because linking not done mkdir -p build/Debug/MinGW-Windows/src rm -f build/Debug/MinGW-Windows/src/Generic.o.d gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -c -g -Isrc/Windows -Isrc -I../../MinGW/jni/include/win32 -I../../MinGW/jni/include -MMD -MP -MF build/Debug/MinGW-Windows/src/Generic.o.d -o build/Debug/MinGW-Windows/src/Generic.o src/Generic.c gcc.exe: --add-stdcall-alias: linker input file unused because linking not done mkdir -p build/Debug/MinGW-Windows/src/Windows rm -f build/Debug/MinGW-Windows/src/Windows/win.o.d gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -c -g -Isrc/Windows -Isrc -I../../MinGW/jni/include/win32 -I../../MinGW/jni/include -MMD -MP -MF build/Debug/MinGW-Windows/src/Windows/win.o.d -o build/Debug/MinGW-Windows/src/Windows/win.o src/Windows/win.c gcc.exe: --add-stdcall-alias: linker input file unused because linking not done mkdir -p dist/Debug/MinGW-Windows gcc.exe -mno-cygwin -Wl,--add-stdcall-alias -shared -m32 -shared -o dist/Debug/MinGW-Windows/libhdijni.dll build/Debug/MinGW-Windows/src/ByteJNI.o build/Debug/MinGW-Windows/src/HDIJNI.o build/Debug/MinGW-Windows/src/common.o build/Debug/MinGW-Windows/src/Generic.o build/Debug/MinGW-Windows/src/Windows/win.o build/Debug/MinGW-Windows/src/HDIJNI.o: In function `callRuntimePropertiesMethod': C:/projects/hdijni/src/HDIJNI.c:142: multiple definition of `callRuntimePropertiesMethod' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:288: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `closeJVM': C:/projects/hdijni/src/HDIJNI.c:192: multiple definition of `closeJVM' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:402: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getFailedCalls': C:/projects/hdijni/src/HDIJNI.c:251: multiple definition of `getFailedCalls' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:800: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getJNIStatus': C:/projects/hdijni/src/HDIJNI.c:266: multiple definition of `getJNIStatus' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:900: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getStrategyInfo': C:/projects/hdijni/src/HDIJNI.c:282: multiple definition of `getStrategyInfo' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1090: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getSuccessfulCalls': C:/projects/hdijni/src/HDIJNI.c:339: multiple definition of `getSuccessfulCalls' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1154: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getTotalDACalls': C:/projects/hdijni/src/HDIJNI.c:354: multiple definition of `getTotalDACalls' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1169: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `getTotalDACallsFor': C:/projects/hdijni/src/HDIJNI.c:375: multiple definition of `getTotalDACallsFor' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1190: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `initialiseJVM': C:/projects/hdijni/src/HDIJNI.c:464: multiple definition of `initialiseJVM' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1229: first defined here build/Debug/MinGW-Windows/src/HDIJNI.o: In function `loadStrategy': C:/projects/hdijni/src/HDIJNI.c:836: multiple definition of `loadStrategy' build/Debug/MinGW-Windows/src/ByteJNI.o:C:/projects/hdijni/src/ByteJNI.c:1907: first defined heremake[2]: Leaving directory `/c/projects/hdijni' make[1]: Leaving directory `/c/projects/hdijni' collect2: ld returned 1 exit status make[2]: *** [dist/Debug/MinGW-Windows/libhdijni.dll] Error 1 make[1]: *** [.build-conf] Error 2 make: *** [.build-impl] Error 2 BUILD FAILED (exit value 2, total time: 1s) A: sorry guys, it was duplicate methods problem. ;) question closed. | Mid | [
0.5507246376811591,
33.25,
27.125
] |
/* * Copyright 2015 Red Hat, Inc. and/or its affiliates. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.drools.compiler import org.drools.testcoverage.common.model.Person; global java.util.List list1; global java.util.List list2; global java.util.List list3; global java.util.List list4; rule "1. && operator with number range" when $person : Person( age > 30 && < 40, hair == "red" ) then list1.add( $person ); end rule "2. && operator with != and strings" when $person : Person( hair != "blue" && != "purple", age > 30 && < 40 ) then list2.add( $person ); end rule "3. || operator with == and strings" when $person : Person( hair == "blue" || == "purple", age < 30 ) then list3.add( $person ); end rule "4. || and && operator with == and != and strings" when $person : Person( age > 30 && < 40 || > 10 && < 20, hair == "red" || == "blue" ) then list4.add( $person ); end | Low | [
0.518828451882845,
31,
28.75
] |
// // Prefix header for all source files of the 'asfd' target in the 'asfd' project // #ifdef __OBJC__ #import <Cocoa/Cocoa.h> #endif | Low | [
0.446464646464646,
27.625,
34.25
] |
Catalinbread Dirty Little Secret The Dirty Little Secret has earned itself a well-deserved reputation for replicating the sound and feel of a classic era Marshall amplifier, supplying one of the most iconic guitar sounds in music. When the JFETs used as the base for the Dirty Little Secret were discontinued, and as our stock of them began to dwindle we knew we had to find ones still being manufactured. However, rather than simply re-voicing around these new JFETs, we decided to push the envelope and provide an amazingly robust feature-set, from ever evolving listening and circuit skills, and pure power of intention. This isn't just 'a' Marshall in a box, it's the most versatile and dynamic Marshall-style overdrive out there! The "Super Lead" mode expands the range of the DLS MkII with more gain available and more control over your tone sculpting with the addition of the midrange control while still enhancing the touch-sensitive dynamic qualities that make the DLS so great to play.. The gain range now goes from classic plexi all the way to modified JCM800 levels and can get even more raw and open than any previous DLS. The "Super Bass" mode is a new voicing that gives you the tone and gain structure of a Marshall Super Bass (which is very similar to a JTM45 or JTM50/100). This mode was voiced to really hone in on that elusive in-between "not quite clean, not quite dirty" response that old tube amps were so good at getting. And it was specifically voiced to make fuzz pedals sound great. Controls: The tone controls get reconfigured, depending on what mode the pedal is set to. Whether in SL or SB mode, the tone circuit is exactly, part-for-part, the same tone circuit as found in Super Lead and Super Bass Marshalls, and they will behave and interact the same way as on their amp counterparts Full featured bass, middle, and treble tone controls provide precise adjustments for a multitude of tones and to match your amp and guitar. Preamp controls the gain or amount of overdrive. The new DLS was tuned to allow a bit more gain than most plexi Marshalls actually got. Super Bass mode was tuned to have less gain then the Super Lead mode to get more of that early Marshall response. Master knob controls the output volume. For the best response out of your DLS, you should set the Master volume so that the sound with the DLS engaged is a bit louder than your bypassed sound. Consider your guitar's volume knob as part of the Dirty Little Secret's control surface. Even in Super Lead mode with the Pre-Amp cranked, you can get a perfectly clean sound by rolling back your guitar's volume knob. An instrument from Wildwood isn't just an ordinary guitar. It's your guitar. Each and every instrument we sell includes a full, point by point setup, an exhaustive evaluation, and expert shipping procedures, with first class, industry leading standards from start to finish. Why? Because you deserve it. Click Here to learn more about what makes a Wildwood instrument so special... | Mid | [
0.640776699029126,
33,
18.5
] |
Enantioseparation of 1-phenyl-1-propanol by supercritical fluid-simulated moving bed chromatography. The enantioseparation of 1-phenyl-1-propanol through the supercritical fluid-simulated moving bed (SF-SMB) process is studied. Non-linear isotherms were measured on an analytical column, and used together with the triangle theory for SMB design to select operating conditions for the SF-SMB. Experiments were carried out on a pilot-scale SF-SMB plant at conditions that corresponded to the non-linear range of the isotherm. Under conditions of low feed concentration, complete separation (extract purity = 99.5%; raffinate purity = 98.4%) was achieved. Under conditions of larger feed concentration, the best separation corresponded to an extract purity of 98.0% and a raffinate purity of 94.0%, and yielded a productivity of 110 g of racemate per kg stationary phase per day. | High | [
0.674388674388674,
32.75,
15.8125
] |
Q: How to access my facebook contacts to my android app? Hi I am working with android.I had integrate facebook sdk to my android app. Now I want to retrieve my facebook contacts to my android app. Is it possible??? Please help me with some examples , thank you A: Request request = Request.newMyFriendsRequest( Session.getActiveSession(), new Request.GraphUserListCallback() { @Override public void onCompleted(List<GraphUser> users, Response response) { System.out.println("Users: " + users); } }); request.executeAsync(); | High | [
0.679582712369597,
28.5,
13.4375
] |
COMPRESSED OXYGEN AND ELECTRICITY TO WORK. IT'S CALLED THE MECHANICAL VENTILATOR OR AND THE M. A STRANGE UNDIAGNOSED ILLNESSES PLAGUING CHILDREN DURING THIS PANDEMIC AND DOCTORS ARE SCRAMBLING TO DETERMINE IF IT'S CONNECTED TO COVID-19 AND TO FIND A WAY TO SAVE LIVES. CHILDREN IN ITALY, THE U K AND NEW YORK PRESENTED WITH A RARE INFLAMMATION AND HEART COMPLICATIONS. DOCTORS BELIEVE THE CASES ARE COVID-19 RELATED BUT NOT ALL CHILDREN TESTED POSITIVE FOR SARS KOBE TO OR THE ANTIBODIES TO SUGGEST THEY HAD A PRIOR INFECTION WITH THE NOVEL CORONAVIRUS. I WOULD TELL PARENTS NOT TO PANIC. I AH THIS IS A VERY RARE CONDITION THAT WERE SEEN IN A HYPER INFLAMMATORY SYNDROME IS QUITE RARE AND I WOULD EXPECT IF ANYTHING AND CHILDREN TO SEE THEM HAVE VERY MILD CONDITIONS, ESPECIALLY IF THEY DON'T HAVE AN UNDERLYING CONDITION. BUT AGAIN PARENTS NEED TO REMAIN VIGILANT AND IF YOUR CHILD IS SICK AND EXPERIENCES SYMPTOMS THAT ARE WORRISOME TO YOU PLEASE SEE YOUR DOCTOR OR CALL 911 OR COME TO THE EMERGENCY ROOM. THE CDC IS ISSUING AN ALERT TO DOCTORS TO REPORT THESE CASES SO THEY CAN BE STUDIED | High | [
0.6784922394678491,
38.25,
18.125
] |
/* * Copyright (c) 2012-2015, The Linux Foundation. All rights reserved. * * This program is free software; you can redistribute it and/or modify * it under the terms of the GNU General Public License version 2 and * only version 2 as published by the Free Software Foundation. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. */ #include <linux/kernel.h> #include <linux/errno.h> #include <linux/idr.h> #include <linux/slab.h> #include <linux/module.h> #include <linux/of.h> #include <linux/of_device.h> #include <linux/platform_device.h> #include <linux/spmi.h> #include <linux/pm_runtime.h> #include <dt-bindings/spmi/spmi.h> #define CREATE_TRACE_POINTS #include <trace/events/spmi.h> static bool is_registered; static DEFINE_IDA(ctrl_ida); static void spmi_dev_release(struct device *dev) { struct spmi_device *sdev = to_spmi_device(dev); kfree(sdev); } static const struct device_type spmi_dev_type = { .release = spmi_dev_release, }; static void spmi_ctrl_release(struct device *dev) { struct spmi_controller *ctrl = to_spmi_controller(dev); ida_simple_remove(&ctrl_ida, ctrl->nr); kfree(ctrl); } static const struct device_type spmi_ctrl_type = { .release = spmi_ctrl_release, }; static int spmi_device_match(struct device *dev, struct device_driver *drv) { if (of_driver_match_device(dev, drv)) return 1; if (drv->name) return strncmp(dev_name(dev), drv->name, SPMI_NAME_SIZE) == 0; return 0; } /** * spmi_device_add() - add a device previously constructed via spmi_device_alloc() * @sdev: spmi_device to be added */ int spmi_device_add(struct spmi_device *sdev) { struct spmi_controller *ctrl = sdev->ctrl; int err; dev_set_name(&sdev->dev, "%d-%02x", ctrl->nr, sdev->usid); err = device_add(&sdev->dev); if (err < 0) { dev_err(&sdev->dev, "Can't add %s, status %d\n", dev_name(&sdev->dev), err); goto err_device_add; } dev_dbg(&sdev->dev, "device %s registered\n", dev_name(&sdev->dev)); err_device_add: return err; } EXPORT_SYMBOL_GPL(spmi_device_add); /** * spmi_device_remove(): remove an SPMI device * @sdev: spmi_device to be removed */ void spmi_device_remove(struct spmi_device *sdev) { device_unregister(&sdev->dev); } EXPORT_SYMBOL_GPL(spmi_device_remove); static inline int spmi_cmd(struct spmi_controller *ctrl, u8 opcode, u8 sid) { int ret; if (!ctrl || !ctrl->cmd || ctrl->dev.type != &spmi_ctrl_type) return -EINVAL; ret = ctrl->cmd(ctrl, opcode, sid); trace_spmi_cmd(opcode, sid, ret); return ret; } static inline int spmi_read_cmd(struct spmi_controller *ctrl, u8 opcode, u8 sid, u16 addr, u8 *buf, size_t len) { int ret; if (!ctrl || !ctrl->read_cmd || ctrl->dev.type != &spmi_ctrl_type) return -EINVAL; trace_spmi_read_begin(opcode, sid, addr); ret = ctrl->read_cmd(ctrl, opcode, sid, addr, buf, len); trace_spmi_read_end(opcode, sid, addr, ret, len, buf); return ret; } static inline int spmi_write_cmd(struct spmi_controller *ctrl, u8 opcode, u8 sid, u16 addr, const u8 *buf, size_t len) { int ret; if (!ctrl || !ctrl->write_cmd || ctrl->dev.type != &spmi_ctrl_type) return -EINVAL; trace_spmi_write_begin(opcode, sid, addr, len, buf); ret = ctrl->write_cmd(ctrl, opcode, sid, addr, buf, len); trace_spmi_write_end(opcode, sid, addr, ret); return ret; } /** * spmi_register_read() - register read * @sdev: SPMI device. * @addr: slave register address (5-bit address). * @buf: buffer to be populated with data from the Slave. * * Reads 1 byte of data from a Slave device register. */ int spmi_register_read(struct spmi_device *sdev, u8 addr, u8 *buf) { /* 5-bit register address */ if (addr > 0x1F) return -EINVAL; return spmi_read_cmd(sdev->ctrl, SPMI_CMD_READ, sdev->usid, addr, buf, 1); } EXPORT_SYMBOL_GPL(spmi_register_read); /** * spmi_ext_register_read() - extended register read * @sdev: SPMI device. * @addr: slave register address (8-bit address). * @buf: buffer to be populated with data from the Slave. * @len: the request number of bytes to read (up to 16 bytes). * * Reads up to 16 bytes of data from the extended register space on a * Slave device. */ int spmi_ext_register_read(struct spmi_device *sdev, u8 addr, u8 *buf, size_t len) { /* 8-bit register address, up to 16 bytes */ if (len == 0 || len > 16) return -EINVAL; return spmi_read_cmd(sdev->ctrl, SPMI_CMD_EXT_READ, sdev->usid, addr, buf, len); } EXPORT_SYMBOL_GPL(spmi_ext_register_read); /** * spmi_ext_register_readl() - extended register read long * @sdev: SPMI device. * @addr: slave register address (16-bit address). * @buf: buffer to be populated with data from the Slave. * @len: the request number of bytes to read (up to 8 bytes). * * Reads up to 8 bytes of data from the extended register space on a * Slave device using 16-bit address. */ int spmi_ext_register_readl(struct spmi_device *sdev, u16 addr, u8 *buf, size_t len) { /* 16-bit register address, up to 8 bytes */ if (len == 0 || len > 8) return -EINVAL; return spmi_read_cmd(sdev->ctrl, SPMI_CMD_EXT_READL, sdev->usid, addr, buf, len); } EXPORT_SYMBOL_GPL(spmi_ext_register_readl); /** * spmi_register_write() - register write * @sdev: SPMI device * @addr: slave register address (5-bit address). * @data: buffer containing the data to be transferred to the Slave. * * Writes 1 byte of data to a Slave device register. */ int spmi_register_write(struct spmi_device *sdev, u8 addr, u8 data) { /* 5-bit register address */ if (addr > 0x1F) return -EINVAL; return spmi_write_cmd(sdev->ctrl, SPMI_CMD_WRITE, sdev->usid, addr, &data, 1); } EXPORT_SYMBOL_GPL(spmi_register_write); /** * spmi_register_zero_write() - register zero write * @sdev: SPMI device. * @data: the data to be written to register 0 (7-bits). * * Writes data to register 0 of the Slave device. */ int spmi_register_zero_write(struct spmi_device *sdev, u8 data) { return spmi_write_cmd(sdev->ctrl, SPMI_CMD_ZERO_WRITE, sdev->usid, 0, &data, 1); } EXPORT_SYMBOL_GPL(spmi_register_zero_write); /** * spmi_ext_register_write() - extended register write * @sdev: SPMI device. * @addr: slave register address (8-bit address). * @buf: buffer containing the data to be transferred to the Slave. * @len: the request number of bytes to read (up to 16 bytes). * * Writes up to 16 bytes of data to the extended register space of a * Slave device. */ int spmi_ext_register_write(struct spmi_device *sdev, u8 addr, const u8 *buf, size_t len) { /* 8-bit register address, up to 16 bytes */ if (len == 0 || len > 16) return -EINVAL; return spmi_write_cmd(sdev->ctrl, SPMI_CMD_EXT_WRITE, sdev->usid, addr, buf, len); } EXPORT_SYMBOL_GPL(spmi_ext_register_write); /** * spmi_ext_register_writel() - extended register write long * @sdev: SPMI device. * @addr: slave register address (16-bit address). * @buf: buffer containing the data to be transferred to the Slave. * @len: the request number of bytes to read (up to 8 bytes). * * Writes up to 8 bytes of data to the extended register space of a * Slave device using 16-bit address. */ int spmi_ext_register_writel(struct spmi_device *sdev, u16 addr, const u8 *buf, size_t len) { /* 4-bit Slave Identifier, 16-bit register address, up to 8 bytes */ if (len == 0 || len > 8) return -EINVAL; return spmi_write_cmd(sdev->ctrl, SPMI_CMD_EXT_WRITEL, sdev->usid, addr, buf, len); } EXPORT_SYMBOL_GPL(spmi_ext_register_writel); /** * spmi_command_reset() - sends RESET command to the specified slave * @sdev: SPMI device. * * The Reset command initializes the Slave and forces all registers to * their reset values. The Slave shall enter the STARTUP state after * receiving a Reset command. */ int spmi_command_reset(struct spmi_device *sdev) { return spmi_cmd(sdev->ctrl, SPMI_CMD_RESET, sdev->usid); } EXPORT_SYMBOL_GPL(spmi_command_reset); /** * spmi_command_sleep() - sends SLEEP command to the specified SPMI device * @sdev: SPMI device. * * The Sleep command causes the Slave to enter the user defined SLEEP state. */ int spmi_command_sleep(struct spmi_device *sdev) { return spmi_cmd(sdev->ctrl, SPMI_CMD_SLEEP, sdev->usid); } EXPORT_SYMBOL_GPL(spmi_command_sleep); /** * spmi_command_wakeup() - sends WAKEUP command to the specified SPMI device * @sdev: SPMI device. * * The Wakeup command causes the Slave to move from the SLEEP state to * the ACTIVE state. */ int spmi_command_wakeup(struct spmi_device *sdev) { return spmi_cmd(sdev->ctrl, SPMI_CMD_WAKEUP, sdev->usid); } EXPORT_SYMBOL_GPL(spmi_command_wakeup); /** * spmi_command_shutdown() - sends SHUTDOWN command to the specified SPMI device * @sdev: SPMI device. * * The Shutdown command causes the Slave to enter the SHUTDOWN state. */ int spmi_command_shutdown(struct spmi_device *sdev) { return spmi_cmd(sdev->ctrl, SPMI_CMD_SHUTDOWN, sdev->usid); } EXPORT_SYMBOL_GPL(spmi_command_shutdown); static int spmi_drv_probe(struct device *dev) { const struct spmi_driver *sdrv = to_spmi_driver(dev->driver); struct spmi_device *sdev = to_spmi_device(dev); int err; pm_runtime_get_noresume(dev); pm_runtime_set_active(dev); pm_runtime_enable(dev); err = sdrv->probe(sdev); if (err) goto fail_probe; return 0; fail_probe: pm_runtime_disable(dev); pm_runtime_set_suspended(dev); pm_runtime_put_noidle(dev); return err; } static int spmi_drv_remove(struct device *dev) { const struct spmi_driver *sdrv = to_spmi_driver(dev->driver); pm_runtime_get_sync(dev); sdrv->remove(to_spmi_device(dev)); pm_runtime_put_noidle(dev); pm_runtime_disable(dev); pm_runtime_set_suspended(dev); pm_runtime_put_noidle(dev); return 0; } static int spmi_drv_uevent(struct device *dev, struct kobj_uevent_env *env) { int ret; ret = of_device_uevent_modalias(dev, env); if (ret != -ENODEV) return ret; return 0; } static struct bus_type spmi_bus_type = { .name = "spmi", .match = spmi_device_match, .probe = spmi_drv_probe, .remove = spmi_drv_remove, .uevent = spmi_drv_uevent, }; /** * spmi_controller_alloc() - Allocate a new SPMI device * @ctrl: associated controller * * Caller is responsible for either calling spmi_device_add() to add the * newly allocated controller, or calling spmi_device_put() to discard it. */ struct spmi_device *spmi_device_alloc(struct spmi_controller *ctrl) { struct spmi_device *sdev; sdev = kzalloc(sizeof(*sdev), GFP_KERNEL); if (!sdev) return NULL; sdev->ctrl = ctrl; device_initialize(&sdev->dev); sdev->dev.parent = &ctrl->dev; sdev->dev.bus = &spmi_bus_type; sdev->dev.type = &spmi_dev_type; return sdev; } EXPORT_SYMBOL_GPL(spmi_device_alloc); /** * spmi_controller_alloc() - Allocate a new SPMI controller * @parent: parent device * @size: size of private data * * Caller is responsible for either calling spmi_controller_add() to add the * newly allocated controller, or calling spmi_controller_put() to discard it. * The allocated private data region may be accessed via * spmi_controller_get_drvdata() */ struct spmi_controller *spmi_controller_alloc(struct device *parent, size_t size) { struct spmi_controller *ctrl; int id; if (WARN_ON(!parent)) return NULL; ctrl = kzalloc(sizeof(*ctrl) + size, GFP_KERNEL); if (!ctrl) return NULL; device_initialize(&ctrl->dev); ctrl->dev.type = &spmi_ctrl_type; ctrl->dev.bus = &spmi_bus_type; ctrl->dev.parent = parent; ctrl->dev.of_node = parent->of_node; spmi_controller_set_drvdata(ctrl, &ctrl[1]); id = ida_simple_get(&ctrl_ida, 0, 0, GFP_KERNEL); if (id < 0) { dev_err(parent, "unable to allocate SPMI controller identifier.\n"); spmi_controller_put(ctrl); return NULL; } ctrl->nr = id; dev_set_name(&ctrl->dev, "spmi-%d", id); dev_dbg(&ctrl->dev, "allocated controller 0x%p id %d\n", ctrl, id); return ctrl; } EXPORT_SYMBOL_GPL(spmi_controller_alloc); static void of_spmi_register_devices(struct spmi_controller *ctrl) { struct device_node *node; int err; if (!ctrl->dev.of_node) return; for_each_available_child_of_node(ctrl->dev.of_node, node) { struct spmi_device *sdev; u32 reg[2]; dev_dbg(&ctrl->dev, "adding child %pOF\n", node); err = of_property_read_u32_array(node, "reg", reg, 2); if (err) { dev_err(&ctrl->dev, "node %pOF err (%d) does not have 'reg' property\n", node, err); continue; } if (reg[1] != SPMI_USID) { dev_err(&ctrl->dev, "node %pOF contains unsupported 'reg' entry\n", node); continue; } if (reg[0] >= SPMI_MAX_SLAVE_ID) { dev_err(&ctrl->dev, "invalid usid on node %pOF\n", node); continue; } dev_dbg(&ctrl->dev, "read usid %02x\n", reg[0]); sdev = spmi_device_alloc(ctrl); if (!sdev) continue; sdev->dev.of_node = node; sdev->usid = (u8) reg[0]; err = spmi_device_add(sdev); if (err) { dev_err(&sdev->dev, "failure adding device. status %d\n", err); spmi_device_put(sdev); } } } /** * spmi_controller_add() - Add an SPMI controller * @ctrl: controller to be registered. * * Register a controller previously allocated via spmi_controller_alloc() with * the SPMI core. */ int spmi_controller_add(struct spmi_controller *ctrl) { int ret; /* Can't register until after driver model init */ if (WARN_ON(!is_registered)) return -EAGAIN; ret = device_add(&ctrl->dev); if (ret) return ret; if (IS_ENABLED(CONFIG_OF)) of_spmi_register_devices(ctrl); dev_dbg(&ctrl->dev, "spmi-%d registered: dev:%p\n", ctrl->nr, &ctrl->dev); return 0; }; EXPORT_SYMBOL_GPL(spmi_controller_add); /* Remove a device associated with a controller */ static int spmi_ctrl_remove_device(struct device *dev, void *data) { struct spmi_device *spmidev = to_spmi_device(dev); if (dev->type == &spmi_dev_type) spmi_device_remove(spmidev); return 0; } /** * spmi_controller_remove(): remove an SPMI controller * @ctrl: controller to remove * * Remove a SPMI controller. Caller is responsible for calling * spmi_controller_put() to discard the allocated controller. */ void spmi_controller_remove(struct spmi_controller *ctrl) { int dummy; if (!ctrl) return; dummy = device_for_each_child(&ctrl->dev, NULL, spmi_ctrl_remove_device); device_del(&ctrl->dev); } EXPORT_SYMBOL_GPL(spmi_controller_remove); /** * spmi_driver_register() - Register client driver with SPMI core * @sdrv: client driver to be associated with client-device. * * This API will register the client driver with the SPMI framework. * It is typically called from the driver's module-init function. */ int __spmi_driver_register(struct spmi_driver *sdrv, struct module *owner) { sdrv->driver.bus = &spmi_bus_type; sdrv->driver.owner = owner; return driver_register(&sdrv->driver); } EXPORT_SYMBOL_GPL(__spmi_driver_register); static void __exit spmi_exit(void) { bus_unregister(&spmi_bus_type); } module_exit(spmi_exit); static int __init spmi_init(void) { int ret; ret = bus_register(&spmi_bus_type); if (ret) return ret; is_registered = true; return 0; } postcore_initcall(spmi_init); MODULE_LICENSE("GPL v2"); MODULE_DESCRIPTION("SPMI module"); MODULE_ALIAS("platform:spmi"); | Mid | [
0.554027504911591,
35.25,
28.375
] |
This study addresses the issue of how to correlate social meaning with linguistic style through an investigation of the parodic speech genre. The analysis examines two parodies of lifestyle entrepreneur Martha Stewart and compares linguistic strategies used in parodies of Stewart to her own linguistic performance on her talk show. Features considered include phonological characteristics, lexical items, politeness strategies, and voice quality. A comparative quantitative analysis of aspirated and released /t/ as employed by Stewart and her parodist reveals that a variable feature of Stewart's style is rendered categorical in the parody. It is demonstrated that both parodies exploit elements associated with Stewart's ‘Good Woman’ image in order to expose Stewart as a ‘Bad Woman’, a reputation she earned for her 2003 insider trading conviction. This study suggests that parodic performance may serve to strengthen and even iconize indexical connections between stylistic variants and their social meaning in particular contexts. | High | [
0.680306905370844,
33.25,
15.625
] |
Quick Hits I’m referring, of course, to the Canadiens giving up on Matt D’Agostini. A goal (including the third-period D’agger in the CH heart), an assist, four hits, plus-3. And D’Agostini would have looked good at in Max Pacioretty’s spot on the Scott Gomez line. Sadly, no one in a white jersey did. Once again, Benoit Pouliot was a Not Ready for Prime Time player, with a stat line diametrically opposite to D’Agostini’s. In 10:57 of ice time – only 45 seconds of which was in the third period with the game on the line – Benny managed to make errors on the first two St. Louis goals, take a penalty 175 feet from his net and finish the game at minus-2. By the end of the second period, Jacques Martin had seen enough. Ryan White was bumped up to the Gomez line and Andrei Kostitsyn got a copuple shifts. Nothing worked. Jaro Halak made 26 mostly easy saves, surrounded by blue jerseys and safely protected from Canadiens forwards who, with rare exceptions, were disinclined to go to the net in quest of rebounds or second chances. The Canadiens’ popgun attack was reminiscent of what we saw before Max-Pac began coming into his own. The value of a power forward was amply demonstrated by Chris Stewart and, especially, by David Backes. There were rumours that Pierre Gauthier had asked about Backes when the Halak deal was being negotiated. You can see why John Davidson wouldn’t hear of it. Backes had a goal, four hits and was plus-3. He’s a big, high-energy, annoying and highly-skilled guy who against whom no one likes to play. Backes plays to the whistle on every shift, and not many Cnaadiens brought that degree of dedication to the Scottrade Centre tonight. Lars Eller played hard in an effort to win one for the Goater. I thought he and Gomez were the best of the Canadiens forwards, but the industrious centres didn’t get much support from their wings. And it was yet another game in which David Desharnais was reduiced to single-digit minutes on the fourth line. The D had their hands full with swarming Blues. James Wisniewski was a turnover machine and finished minus-3. P.K. Subban crapped the bed on the play that led to the D’Agostini goal that put the game out of reach. To their credit, however, the Dmen did a decent job of clearing what seemed too be an inordinate number of rebounds bouncing off Carey Price. But let’s hear nothing about Halak winning the long-awaited goaltenders’ duel. As was not the case during his playoff heroics last spring, Jaro was playing behind a team that was, at least on this night, much better. Without some big stops by Price, this one would have been an early rout. At a certain point, Pierre Houde said the Canadiens looked like the team that had played last night. They had no jump, no rhythm or flow to their game, no commitment to winning one-on-one battles. In short, they displayed none of the high-octane fuel that powered the winning streak. Maybe it was a psychological hangover after the Pacioretty injury and the media-fuelled circus that ensued. You know the team isn’t mentally ready when its captain is taking brain-dead penalties. (Wait! Saku used to do that … oh, never mind.) Martin and his staff have work to do to prepare the Canadiens for their visit to Pittsburgh. Job 1: Find a linemate with hair on his butt for Gomez and Brian Gionta. Because based on what we saw tonight, number 57 ain’t no number 67. • The Canadiens are still undefeated with Brent Sopel in the lineup. • When the Stanley Cup champions visit the Bell Centre April 5, it will be the Canadiens’ last chance to salvage a win against the Central Division. What I saw tonight was a team that still has their collective heads in Montreal worried about MaxPac, and not focussed on the current game. This needs to be addressed tomorrow by the coaching staff and team leaders in the room. They never played with the heart and desire that was evident in the previous 5 wins, and understandably so after what they witnessed in the game on Tuesday night when Max took the horrific assault into the stanchion. But as Max would probably say, that is in the past and the team needs to get refocussed on the next game. Unless the emotions of the players on the team are addressed and dealt with they will not bounce back right away. My prescription is for Coach Martin to bring in some Post Traumatic Stress de-briefers to sit with the team in lieu of their next practice…what these players saw and experienced on Tuesday was a horrific incident within feet of their bench to one of their team mates…the sound alone was enough to have turned stomachs…This incident followed by the NHL’s lack of action would be enough to make any young player question what might be their own fate if they go near the boards or into the corners in a game…what sort of assurance do they have that their safety is in the least way important and protected in this league. But I don’t want to go there with this post…what I think the players need is some post traumatic stress councelling to help them deal with their sense of violation and the violence done within inches of their faces to one of their own team/family member. I did like Eller again tonight…he seemed to put on a show, but the supporting cast was not there for the team to get the 2 points. But I feel bad for Pouliot. Obviously he is not Patches and to expect him to be Patches is unfair to both players. Patches is a true Power Forward and for some reason the chemistry with Gio and Gomez works. Pouliot seems to be more of a finesse player and it seems to work with DD and White et al. But Patches and Pouliot are obviously not interchangable parts. So it would seem Martin and company will have to go back to the drawing board for a combination that works until Patches returns to take his place on that line. But for now, lets put AK46 back with Moen and Eller…we all know that does work, and while we are at it, re-unite DD, Pouliot and White….again we all know that works. Pleks, Halpern and Cammi will start to click once Cammi regains his timing and stamina…so maybe we can look to Hamilton and give Dawes a spin for a few days. That’s it for me for a week or so…off to Hawaii with my hunnie for a week on Saturday Morning and I am not going to appologize to anyone here on HIO for taking the break on the beach…Aloha baby! Well, the rest of the season will be a roller coaster and the team is set in stone “barring any more injury’s!” At this point with the battered and ageing D and undersized team ,it is what it is. As far as the NHL CHANGING ITS WAYS …fat chance of that happening. We should of had a bigger and tougher team and hopefully Gauthier and Gainey get it now”got to fight fire with fire!” I am looking forward to the Beantown break dance in two weeks and hope we bring all the weapons in the back room! It’s time like this when I’d like to see Hab Fans every where ,with all their different views and thoughts take it easy on each other and try to enjoy the ride….Think of it as our gift to Patches. | Mid | [
0.564625850340136,
31.125,
24
] |
/* This sample file will describe the 2 following functions: * . fabs * . strcmp */ #include <stdio.h> #include <string.h> #include "cspec.h" #include "cspec_output_header.h" #include "cspec_output_verbose.h" #include "cspec_output_unit.h" /* Here is the description of strcmp */ DESCRIBE(strcmp, "int strcmp ( const char * str1, const char * str2 )") IT( "returns 0 only when strings are equal" ) SHOULD_EQUAL( strcmp("hello", "hello"), 0) SHOULD_NOT_BE_NULL( strcmp("hello", "world") ) END_IT IT( "returns a negative integer when str1 is less than str2" ) SHOULD_BE_TRUE( strcmp("hello", "world") < 0 ) SHOULD_BE_TRUE( strcmp("0123", "1321431") < 0 ) END_IT IT( "returns a positive integer if str1 is greater than str2" ) SHOULD_BE_TRUE( strcmp("yellow", "world") > 0 ) SHOULD_BE_TRUE( strcmp("9", "789") > 0 ) END_IT END_DESCRIBE /* Here is the declaration of fabs description defined in an other file (fabs_desc.c in this sample)*/ DEFINE_DESCRIPTION(fabs) int main() { /* Run strcmp description with the header output => it will only output all the description titles, whatever the result of the test */ CSpec_Run( DESCRIPTION( strcmp ), CSpec_NewOutputHeader() ); /* Run the description with verbose output => as much information as possible is output: - descriptions - tests - tests results */ CSpec_Run( DESCRIPTION( fabs ), CSpec_NewOutputVerbose() ); return 0; } | High | [
0.6557377049180321,
40,
21
] |
Overall Survival, Disease-Free Survival, Local Recurrence, and Nipple-Areolar Recurrence in the Setting of Nipple-Sparing Mastectomy: A Meta-Analysis and Systematic Review. Nipple-sparing mastectomy (NSM) is an increasingly common procedure; however, concerns exist regarding its oncological safety due to the potential for residual breast tissue to harbor occult malignancy or future cancer. A systematic literature review was performed. Studies with internal comparison arms evaluating therapeutic NSM versus skin-sparing mastectomy (SSM) and/or modified radical mastectomy (MRM) were included in a meta-analysis of overall survival (OS), disease-free survival (DFS), and local recurrence (LR). Studies lacking comparison arms were only included in the systematic review to evaluate mean OS, DFS, LR, and nipple-areolar recurrence (NAR). The search yielded 851 articles. Twenty studies with 5594 patients met selection criteria. The meta-analysis included eight studies with comparison arms. Seven studies that compared OS found a 3.4% risk difference between NSM and MRM/SSM, five studies that compared DFS found a 9.6% risk difference between NSM and MRM/SSM, and eight studies that compared LR found a 0.4% risk difference between NSM and MRM/SSM. Risk differences for all outcomes were not statistically significant. The systematic review included all 20 studies and evaluated OS, DFS, LR, and NAR. Studies with follow-up intervals of <3 years, 3-5 years, and >5 years had mean OS of 97.2, 97.9, and 86.8%; DFS of 93.1, 92.3, and 76.1%; LR of 5.4, 1.4, and 11.4%; and NAR of 2.1, 1.0, and 3.4%, respectively. This study did not detect adverse oncologic outcomes of NSM in carefully selected women with early-stage breast cancer. Use of prospective data registries, notably the Nipple-Sparing Mastectomy Registry, will add clarity to this important clinical question. | Mid | [
0.6292682926829261,
32.25,
19
] |
This invention relates to electronic systems, and more particularly to the detection of an electronic system being operated at increased voltages associated with operation outside a specified frequency range. Some systems and circuits are designed to operate over a range of frequencies. For example, microprocessors are often designed to operate at frequencies between 200 megahertz and 500 megahertz. However, a microprocessor manufacturer may only test and warrant a microprocessor for operation at frequencies of less than 300 megahertz. To ensure that the microprocessor is not operated above the tested and warranted frequency range, the manufacturer may attempt to design circuits into the microprocessor that directly detect overfrequency operation and disable the microprocessor when the overfrequency operation is detected. Unfortunately, these circuits require at least one bulky off chip component, such as a stable frequency source, and are subject to tampering. In general, to operate a digital system, such as a microprocessor, at a higher frequency, the power supply voltage provided to the digital system is increased. The reason for this is that the transistors that make up the logic circuits in the digital system can switch faster when operated at a higher power supply voltage level. Operating a microprocessor at a higher frequency permits the microprocessor to perform more work in a given amount of time. Since increasing the power supply voltage provided to the microprocessor improves performance, and since the cost of increasing the power supply voltage is low, some system manufacturers design systems that operate microprocessors and other digital and analog systems outside their intended and warranted frequency range by increasing the power supply voltage. For these and other reasons there is a need for the present invention. | Mid | [
0.6216768916155421,
38,
23.125
] |
Ahmadinejad's Controversial VP Pick Quits TEHRAN -- Iranian President Mahmoud Ahmadinejad's choice as first vice president, Esfandiar Rahim Mashaie, has walked away from the job, state media reported on Sunday. Mashaie, a controversial politician and confidant of Ahmadinejad, has "resigned three days after his appointment" as first vice president, state-owned English-language channel Press TV reported. The channel initially sourced its report to the education ministry-funded news agency, Pana. In its news item, Pana said "The content of his resignation letter will be published soon." There was no immediate independent confirmation of Mashaie's resignation. The appointment was strongly opposed by hardliners among Ahmadinejad's own support base. Mashaie, whose daughter is married to Ahmadinejad's son, is an outspoken figure who last year earned the wrath of hardliners, including supreme leader Ayatollah Ali Khamenei, for saying Iran is a "friend of the Israeli people." In his current role as vice president in charge of tourism he sparked ire among MPs for reportedly watching a group of women dance at a congress in Turkey in 2007. His nomination as first vice president had ruffled feathers among hardliners deeply sensitive to any breach of the long-standing taboo on relations of any kind with arch foe Israel. Ahmadinejad himself spearheaded an anti-Israel campaign during his first four-year term, even calling the Holocaust a "myth." Since the announcement of Mashaie's appointment on Friday, there has been a chorus of criticism from hardliners. "It is imperative to terminate the appointment of Mashaie as first vice president in order to respect the wishes of the majority of the people," said Hossein Shariatmadari, managing director of the hardline Kayhan newspaper, whose post is in the gift of supreme leader, Ayatollah Ali Khamenei. "When people found out about the appointment, they viewed this move as one taken not just in bad taste... but as one which shows indifference," he wrote in an editorial. "This appointment has been made in defiance of the members of the Assembly of Experts, the majlis (parliament) and several leading figures who have often mentioned that the post is a sensitive one," the Jam-e Jam newspaper quoted Khatami as saying. "I therefore urge Mr. Ahmadinejad to reconsider his choice before the wave of criticism spreads." The resistance to Mashaie's appointment was a sign of the difficulties Ahmadinejad is likely to face in forming a new cabinet after his hotly contested re-election in a June 12 vote that his main challenger denounced as a "shameful fraud". The incumbent's detractors have made clear that they have no intention of giving up their protest campaign, and only on Friday former president Akbar Hashemi Rafsanjani used the platform of a sermon at the main weekly Muslim payers to say the government had lost people's trust. Reza Akrami, a leading member of the Association of Militant Clergy, a conservative clerical group supporting Ahmadinejad, was quoted by the Fars news agency as disapproving of his choice of Mashaie. "In the past four years I did not see wise behaviour from him... and he did not leave any outstanding report card," he was quoted as saying. But Ahmadinejad had insisted Mashaie was a fine candidate for the job, saying he was a "pious and dedicated" man who believed in the principles of the Islamic revolution. TEHRAN -- Iranian President Mahmoud Ahmadinejad's choice as first vice president, Esfandiar Rahim Mashaie, has walked away from the job, state media reported on Sunday.Mashaie, a controversial politician and confidant of Ahmadinejad, has "resigned three days after his... | Mid | [
0.541984732824427,
35.5,
30
] |
Bidding Farewell to 2013: The Year of the Underdog in College Football Florida State may have emerged as the victors of the 2014 BCS National Championship, but there’s no doubt about who the 2013 college football season really belonged to: the underdogs. In fact, BCS title runner-up Auburn was a mere 1:15 away from adding an exclamation point at the end of that statement. Sure, the Seminoles seemingly restored order, snuffing out the Tigers’ magical season, 34-31, in one of the most thrilling national title matches ever. However, who can honestly say they pegged Auburn to even make it to this point? If you recall, this was a team that was coming off a 3-9 season in 2012—winless in SEC play—and getting acquainted to a new head coach. Next thing you know, the Tigers string together 12 wins, go 5-1 against Top 25 opponents and capture an improbable SEC title. More impressively, the team did it all with pretty much the same cast of characters from a year ago. Somehow, first-year head coach Gus Malzahn took an Auburn offense akin to a busted-up Honda Civic and fixed it up into a Ferrari. Tale of Two Auburn Offenses: 2012 vs. 2013 2012 (Rank) 2013 (Rank) Touchdowns 27 (114) 73 (8) PPG 18.7 (114) 39.5 (12) Total YPG 305.0 (118) 501.3 (11) Pass YPG 156.6 (116) 173.0 (108) Rush YPG 148.4 (80) 328.3 (1) 3rd Down Conv. % 30.8 (120) 46.5 (24) CFBstats.com Typically, such a transformation would be considered mind-boggling. But in 2013, we’ve come to recognize it as the norm. From the opening kickoff to the Tigers’ last-ditch laterals in the final seconds of the BCS title game, underdogs had their handprints all over this college football season. The FCS drew first blood back in Week 1 when two of its schools—North Dakota State and Eastern Washington—escaped with victories. The Bison rallied from a 21-7 deficit to shock 2012 Big 12 champion Kansas State, 24-21, while the Eagles became just the third FCS school to beat a Top 25 opponent, knocking off then-No. 25 Oregon State, 49-46. Georgia Southern would later add its name to the list, embarrassing national powerhouse Florida, 26-20, in Week 13. The kicker: The Gators lost without giving up a single completion. But there were upsets aplenty in the FBS as well. Notable FBS Upsets in 2013 Week Matchup Spread Result 2 Washington State at USC USC (-21) 10-7 WSU 5 Oklahoma State at West Virginia OSU (-21) 30-21 WVU 7 Oklahoma vs. Texas OU (-13.5) 36-20 TEX 8 Auburn at Texas A&M A&M (-14) 45-41 AUB 9 Duke at Virginia Tech VT (-13.5) 13-10 DUKE 13 Oregon at Arizona ORE (-20) 42-16 ARIZ 14 Penn State at Wisconsin WIS (-25) 31-24 PSU Vegasinsider.com It wasn’t all negative, as several programs made significant turnarounds in 2013. Aside from Auburn, Missouri, Duke, Arizona State, Michigan State and Baylor all had renaissance years. The six teams finished with a combined record of 68-15. In comparison, they combined for a mark of 37-39 in 2012. Three of those teams—Auburn, Michigan State and Baylor—emerged as conference champions while the other three made an appearance in their respective conference title games. Furthermore, three mid-major conferences boasted success stories. Bowling Green (MAC), Rice (C-USA) and Fresno State (MWC) captured outright conference titles for the first time in over two decades. In the Owls’ case, it was the program’s first conference crown since 1957. But the underdogs weren’t content with a starring role in the regular season; they wanted the spotlight during the bowl schedule as well. And it’s hard to argue that they didn’t have it. Out of the 35 bowls, the underdogs finished 16-19, via VegasInsider.com. That’s up from the 11-24 mark they had in each of the two previous bowl seasons and the 10-23 record from 2010-11. More impressively, things took quite the turn in 2014: That success only increased during the BCS bowls: While victories from Clemson (+3) and Michigan State (+7) weren’t all that surprising, the same can’t be said about the accomplishments of heavy underdogs UCF (+16.5) and Oklahoma (+17). Both teams were expected to lose by two touchdowns—and that was being generous. Instead, the Knights and the Sooners each played the role of David to perfection, knocking down their respective Goliaths with authority. Although Auburn fell short of its ultimate goal on Monday night, the team’s performance served as the topper to a phenomenal season for underdogs—one that will surely have favorites in future seasons thinking twice before taking opponents lightly. History will look back at the Tigers as the losers of the 2014 BCS National Championship. But to underdogs all across the nation, the 2013 Auburn football team will be forever remembered as hope that anything is possible. All stats and rankings used in this article are courtesy of CFBstats.com. For complete coverage and everything college football, you can reach Sebastian on Facebook, on Twitter and via email at [email protected]. | Mid | [
0.6269315673289181,
35.5,
21.125
] |
The Good: Played my first tournament since I injured my throwing arm in April.The Good: Got my first ever tournament Ace, won the Ace Pool solo w00t!The Bad: Left too many birdies out on the course. I shoulda been better than 4 down for the tournament. But I got the Ace w00t!The Ugly: nuffin!w00t! Well my back has been pretty awful since like the end of may. I shot like 10 rounds over 980 in a row and then my back died. My back has finally slowly been getting better and I have played without pain a few times now and my form is no where near where it was. Well today was the first time in months that I actually played somewhat near the level I was it. I birdied a hole over 400 feet for the first time in months and my putting stroke was back. I am still having a hard time with drivers slipping out early so I think my grip has gotten weaker, but it is getting closer. Today made me feel pretty good about my game again and hopefully I can get back to where I was at pain free. Good: Shot a PB, 971-rated 56 on Crystal Mountain's lower course Sunday. It was a three-way tie going into #18 and I shot the only birdie, to take first. Bad: That round included a missed 10-footer and a double-bogey that would have been an easy 4 with a pitchout. DohUgly: After Saturday's epic 6-hour round on the upper course, my piddly entry into the long-drive competition. Tired arm plus only having my headwind discs with me made for some measly throws. good: tweaked my throw a few days ago. has resulted in "easier" distance and was less strain on my body. creating a lot more leverage and accuracy. also been honing in my thumber skills with my 150g QOLF. Fun thumber disc and I try to make it work on just about any hole possible. really enjoying skip thumbers bad: I am overthrowing my putter drives. off the box or approach, my omegas are cruising and I am barely trying. This might sound good to most people, but this is something I need to figure out before my next tourney in 2 weeks. I can't afford to be over throwing landing points at the Metcenter with OB on every hole. ugly: I think I played about par at Searight(I normally shoot -8), because I was overthrowing everything into the shit. The baskets on this course are only 15-20ft away from the rough, and once you get in there the putts get pretty stupid. | Mid | [
0.5882352941176471,
28.75,
20.125
] |
The ducks are on their way.... Each year thousands of rubber bath ducks migrate south to spend the summer in Guernsey, their arrival coinciding with the Harbour Carnival.Our experts have advised us that this years migration will the biggest ever seen with 75 giant ducks making the journey to Guernseys waters. To get your hands on one of little yellow visitors check out our instructions below. Corporate Ducks The Harbour Carnival Big Duck Race was launched in 2013 and was a resounding success with 50 ducks selling out in a matter of weeks. Any business who wish to buy a duck for the first time can pledge £250 and receive a shiny new duck with their corporate branding.Organisations who wish to re-enter their duck from last year are asked to pledge £200. First time owners also have the opportunity for place their company logo on their feathered friend.This will help distinguish it from all the other ducks that will be taking to the water when they are launched. I'm sure you will agree this is a quacking good deal. | Low | [
0.339425587467362,
16.25,
31.625
] |
Stamp, Christmas Background, 5 1/4" x 4", Quantity in Basket: None Code: 63-0036 Price: $8.99 Your Price: $7.19 Quantity: - 5 1/4" x 4", This quality cling-mount rubber stamp is made from deeply etched, precision trimmed premium grey rubber. With 1/8" thick grey foam for a smooth impression on uneven or textured surfaces, it is backed with a full sized index of the image. The index allows for precise placement of the image when used with a clear acrylic handle. This original design is copyright Ellen Jareckie and House-Mouse Designs. Acrylic handle sold separately., | High | [
0.6566347469220241,
30,
15.6875
] |
Impression techniques for preparations with shoulders. An impression technique useful for both individual or multiple preparations with shoulders is described. This method reproduces the entire maxillary arch in one impression, which facilitates development of satisfactory occlusion for the patient. In addition, an impression technique that simultaneously reproduces the gingival margins of tooth preparations and the edentulous ridges is described. A master cast of the entire maxillary arch can be obtained in one appointment. | High | [
0.704918032786885,
32.25,
13.5
] |
Q: Why not find the element 'a'? Get the 'div' element but same way don't get the 'a' element. import requests from bs4 import BeautifulSoup as bf # link : url = "https://www.imdb.com/search/name/?gender=male,female&ref_=nv_tp_cel" Response = requests.get(url) soup = bf(Response.text,'lxml') div = soup.find_all('div', class_ = "lister-item-content") a_tag = div.find_all('a') print(a_tag) I want to print all 'a' element from 'div' element. A: Iterate through each div element, then iterate through each a child with div.findChildren: import requests from bs4 import BeautifulSoup as bf # link : url = "https://www.imdb.com/search/name/?gender=male,female&ref_=nv_tp_cel" Response = requests.get(url) soup = bf(Response.text,'lxml') divs = soup.find_all('div', class_ = "lister-item-content") for div in divs: a_tags = div.findChildren('a') for a_tag in a_tags: print (a_tag) Which would print something like: ... <a href="/title/tt0356910/"> Mr. & Mrs. Smith </a> <a href="/title/tt0137523">Fight Club</a> <a href="/title/tt1210166">Moneyball</a> <a href="/title/tt0240772">Ocean's Eleven</a> <a href="/name/nm0000522"> Vanessa Marcil </a> <a href="/title/tt0117500/"> The Rock </a> | Low | [
0.534005037783375,
26.5,
23.125
] |
French President Emmanuel Macron’s thinly-veiled shots at President Trump over the weekend won at least one hearty American “oui” — from Ohio Gov. John Kasich. Mr. Kasich, a frequent critic of Mr. Trump, took to Twitter to second Mr. Macron’s attack on “nationalism” at a speech Sunday marking the 100th anniversary of the end of World War I. “@EmmanuelMacron is right,” Mr. Kasich tweeted, going on to quote what the French leader said in front of Mr. Trump, who has taken much criticism as racist for calling himself a “nationalist.” .@EmmanuelMacron is right: “Patriotism is the exact opposite of nationalism..By saying our interests first, who cares about the others, we erase what a nation holds dearest…its moral values.” America was founded as the shining city on the hill. United, we can keep it that way — John Kasich (@JohnKasich) November 11, 2018 “Patriotism is the exact opposite of nationalism,” Mr. Macron said, as quoted in Mr. Kasich’s tweet. “By saying our interests first, who cares about the others, we erase what a nation holds dearest … its moral values.” That won Mr. Kasich’s “amen.” “America was founded as the shining city on the hill. United, we can keep it that way,” Mr. Kasich added. Sign up for Daily Newsletters Manage Newsletters Copyright © 2020 The Washington Times, LLC. Click here for reprint permission. | Low | [
0.505836575875486,
32.5,
31.75
] |
Q: Changing case owner based on created date with respect to organization time zone In Apex, I would like to get the cases created in January 2016 based on organization time zone. E.g. Organization time zone is GMT+8 and a case record has been created in 31/12/15 23:00:00 GMT , Is there any elegant solution to retrieve this record by a query? Moreover, is this query should do the job? I don't feel so because the convertTimeZone is done based on the context user timezone and not organization select ID from case where CALENDAR_MONTH(convertTimezone(createddate)) = 1 Thanks ahead. :) A: You'll want to take into consideration that all data held in the database is stored in GMT or UTC. It's only when it's returned that it's converted for display in the User's Local Time Zone. So without knowing the context in which your query will be run via Apex, I'm not certain anyone can answer your question. If the Apex is run in a system context, you'll get one answer. If it's run in the context of a specific user, you'll get a different answer. Without telling us how you plan to execute the Apex code, no one can answer your question with any degree of certainty. If your desire is to run some kind of report by a user who's located in in the same location as where your Organization is headquartered, then you'd have something more specific that you'd be able to get results from. All you'd need to do then, is run the query from that specific location and you'd obtain the results you're looking for. If you run the query from some other location, then you'll want to calculate the offset between that timezone and the timezone of your Org. Why? Because what's returned at that location will be returned in it's timezone, not the Org's timezone and you'll want to convert those results to the local time of your Organization. It's the offset between the two timezones that will be what's of importance to you. There's a Timezone Class that has methods that can help you with those calculations. With that having been said, I recommend you look at Date-Time methods as there is no method called convertTimezone (there's only getTimezone() or getOffset() and a few others). The things I'm familiar with that would seem to be helpful would be format(DateFormatString, timezone) and formatGMT(DateFormatString, timezone). You can also parse(Date-TimeString) to get a Date-Time in your localtimezone or use something like valueOf(fieldValue). What you'll actually need to do will depend on your specific implementation. Be sure to look at the Date methods too as they may be appropriate as well. There are numerous ways of doing this, all of which are dependant on how you decide to implement this. | Mid | [
0.60048426150121,
31,
20.625
] |
Angolapact Lacks A Key Signatory HUAMBO, ANGOLA — Exhausted by 13 years of war, this crumbling provincial capital warily dares to hope that a peace accord signed by Cuba, Angola and South Africa will allow rebuilding to begin. ``Yes, we are beginning to hope here,`` says Joao Pinto Machado, district director for the Benguela railroad, surveying the remains of what once was the largest railroad repair complex in Africa. But long-suffering residents are concerned that U.S-backed rebels, who are not party to the regional peace agreement, will roll in from the bush as Cuban troops roll out. Last May, for the first time in the long war, guerrillas of Jonas Savimbi`s U.S.-backed Movement for the Total Liberation of Angola (UNITA) shut down the railroad and burned 11 new locomotives. The guerrillas returned in June to place a dozen bombs around the complex, destroying offices and machinery, said Pinto. The repair shops remain in a shambles; logs instead of lumber prop up shaky walls and replace damaged roof beams. During the early 1970s, when the nation was a Portuguese colony, as many as 20 trains a day carried passengers and produce between this town in Angola`s lush central plateau to the Atlantic coast. Now most supplies are brought to Huambo by air. Occasionally, a truck convoy will make its way up a steep, winding highway that is prone to guerrilla attack. A year ago, the guerrillas briefly overran three towns along the route. ``It`s going to get better now,`` insists Armando Augusto, director of the government-owned Hotel Roma, which was bombed Oct. 14 for the second time. He concedes that conditions can`t get much worse, with shortages now rampant. On Dec. 20, guerrillas attacked the city`s brewery, placing bombs beside one of the few freshly painted walls in the city, a huge propaganda mural that declared: ``Angola will be the resolute trench of the revolution in Africa.`` ``The situation is in our favor,`` agrees Deputy District Commissioner Poulo Jimi, who received a group of journalists in the faded gold-brocade ballroom of the former Portugese colonial administration building, now the ``Palace of the People.`` ``With the accords in New York, we hope soon to have peace, not just in Angola but here in Huambo,`` he said, as bulbs flickered dimly in a dusty chandelier. The settlement signed Dec. 22 in New York calls for Cuba to withdraw 55,000 troops from Angola by mid-1991 in return for an agreement by South Africa to grant independence to Namibia this year. South Africa, which supplied about three-quarters of Savimbi`s war materiel, also agreed to stop aiding the rebels. But the treaty did not include Savimbi, whose support comes from Angola`s largest tribe, the Ovimbundu of the central highlands surrounding Huambo. For the moment, Savimbi has been lying low, breaking his past pattern of increasing attacks during the wet season, which is now underway. Cuba began withdrawing the first of its troops on Jan. 10 amid official fanfare. The Angolan government has declared an amnesty for UNITA followers beginning next month, but has categorically refused to talk with Savimbi. President Jose Eduardo dos Santos has rejected a proposal from other African leaders to have Savimbi temporarily step aside while other UNITA leaders join in an interim government. An official tour of Huambo earlier this month that had been designed to discredit UNITA instead made it clear that Savimbi`s guerrillas can strike at will. Savimbi held Huambo as his ``capital`` for six months after the civil war began in 1975. Once home to 80,000 people, it was deserted by its inhabitants and then choked with refugees. A key indication of the residents` suffering is a recent survey by UNICEF that found as many as half of all children in the province die before age 5, one of the highest infant-mortality rates ever measured. ``They are at the limit of normal survival,`` said one official in Luanda, the capital. ``There is a chronic lack of food-a wave of malnutrition between November and March, when the people eat only sweet potatoes.`` Joao Manuel Oliviera De Silva, the manager of a bombed-out food depot, said in response to a question about hunger: ``It is relative. Around here, we think if you go without eating four or five days that`s hunger.`` Almost nothing moves on the baking city streets except an occasional Soviet-built military vehicle and the women carrying bags of charcoal on their heads, fuel for the cooking fires that have sooted the pastel facades of apartment blocks built by the Portugese. When Soviet transport planes take off from the airport, they do so in a tight spiral, dropping bright magnesium flares to divert any heat-seeking missiles. Along the airport road, the rusting wrecks of planes and helicopters testify to the threat. | Low | [
0.450704225352112,
24,
29.25
] |
Can My Dog Eat Smoked Sausage? Maybe not. While smoked sausage is not toxic, it’s not a recommended source of protein for your dog as it contains an unhealthy level of salt and fat. Smoked sausage may also contain seasonings that are toxic to dogs such as onion or garlic powder. If your dog regularly consumes a large amount of smoked sausage, she may experience mild to severe digestive issues, pancreatitis, kidney damage, or salt poisoning. Advertising Symptoms to Watch For If your dog has eat a large amount of smoked sausage, watch for these symptoms: Vomiting Diarrhea Abdominal pain Increased thirst Increased urination For More Information We’ve got tons of articles about which foods are safe or dangerous for your dog, from common snacks to fruits. You might also be interested in “Can My Dog Eat Sausage?” The information provided in this article is not a substitute for professional veterinary help. | Mid | [
0.595744680851063,
35,
23.75
] |
ICF Stem Wall Foundation Shawn McDaniel, of Squamish Prefab Ltd, has been forming concrete using plywood forms for the last 21 years. Shawn was reluctant to use ICFs, but after attending our training seminar in March, he decided to try. In this video Shawn provides his opinion on the Nudura® block. The stem wall foundation was 6' in height with 245' of perimeter distance. The height was achieved with only 4 Nudura blocks as each block has a height of 18". As the blocks are 8' long, each has an area of 12 square feet, greatly increasing the speed of installation. The effective R value of Nudura is R23, very important in the cold winter climate of Whistler. This is a timber frame home with the timbers and panels supplied and installed by Purcell Timberframes. Click on the image to visit the Purcell Timberframes website. Structural engineering was completed by SEL Engineering Ltd. of Port Moody BC. "I'm impressed with the system", said Shawn. "We got delivery of the blocks 9:00 AM Wednesday morning. At noon we had the garage done and two blocks around the rest of the building. At 3:00 o'clock we had finished stacking blocks and were placing the Zont™ bracing." "This system is a dream to work with.. it stacks together real quickly by hand. One of the advantages of the system is that you're not worn out at the end of the day." As the ground was engineered fill, it was close to impossible to drive even a metal stake into the ground. When pouring his footings, Shawn strategically placed blobs of concrete onto which he attached the Zont™ bracing. | Mid | [
0.637795275590551,
30.375,
17.25
] |
Policy Analysis Obama's Visit to Riyadh: Competing Agendas? On June 2, President Barack Obama departs for the Middle East, where he is scheduled to deliver a major speech in Cairo on June 4. But his first stop is Riyadh, where he will meet Saudi king Abdullah. Officially the two men will, in the words of a White House spokesman, "discuss a range of important issues, including Middle East peace, Iran, and terrorism." The U.S. agenda, however, is almost certainly wider: the very fact of the meeting, only announced on May 26, suggests that Obama foresees a major role for Saudi Arabia in his approach to a range of issues -- on which King Abdullah has his own perspectives. Background The upcoming meeting will not be the first encounter between the two men; they met in London at the April gathering of the G20 (Saudi Arabia qualifies as the world's largest oil exporter). On that occasion, President Obama was caught on video bowing to the Saudi monarch, a gesture at odds with proper protocol (heads of state merely shake hands) and regarded as obsequious by the president's detractors and those wary of close U.S. links with the kingdom. The two leaders also met privately in London and have reportedly spoken by telephone several times. A good working relationship appears to be emerging despite the differences in age (Abdullah is eighty-six, Obama forty-seven) and ethical norms (on May 29, according to the official Saudi news agency, a murderer was publicly beheaded in the Saudi capital and the body and head left on display for several hours). Saudi Peace Plan Most speculation is focused on whether Obama will be able to coax Saudi Arabia into a more active diplomatic role in the Middle East peace process. At the center of the discussion is the Arab League-supported 2002 Saudi peace plan, which offers Israel diplomatic recognition by the Arab world in return for Israeli withdrawal to the pre-1967 territorial lines and an agreed resolution to the Palestinian refugee issue. The plan, which helped Riyadh recover from the embarrassing fact that fifteen of the nineteen hijackers in the September 11 attacks were Saudis, has been moribund because of initial Israeli rejection of the plan and U.S. coolness to it. Saudi Arabian unwillingness to engage diplomatically (and publicly) with Israel has also been no small contributor to its stagnation. Riyadh sees the plan as reinforcing Abdullah's personal diplomacy (he authored the initial version) as well as Saudi leadership of the Arab world. But while the king seems to personally advocate some engagement -- he and Israeli president Shimon Peres exchanged greeting messages at a UN interfaith conference in New York in December -- he has been unwilling or unable to go further absent a major Israeli concession such as a settlement freeze. Obama, who is also expected to discuss the Middle East peace process in his Cairo speech, presumably would like to present a Saudi gesture on this issue, such as allowing Israeli airliners to transit Saudi air space, trade relations with Israel (the neighboring United Arab Emirates quietly allows more than $1 billion in trade annually), visas for Israelis, or the appointment of an American Jew as U.S. ambassador in Riyadh (the position is currently vacant and the Obama administration has yet to nominate a candidate). Nuclear Iran Another central issue in the talks will be Iran's nuclear program, which concerns many of the Persian Gulf Arab states as much as it does Israel. Indeed, it is probably Abdullah's number-one priority, which he has consistently told U.S. leaders must be dealt with through force and coercion, not Obama-style engagement. Abdullah is almost certainly not happy with Obama pushing diplomacy with Iran until the end of the year before considering further sanctions. Iraq Since the overthrow of Saddam Hussein, Riyadh has been unhappy about the emergence of a Shiite-dominated administration in Baghdad. This has exacerbated Saudi concerns about the clerical regime in Tehran and its influence on the majority Shiites in Iraq as well as Shiite communities in other parts of the Middle East. For example, Riyadh has worked to blunt Iranian support for Hizballah in Lebanon and was undoubtedly disquieted by recent Shiite disturbances in Bahrain. In 2007, King Abdullah refused to meet Iraqi prime minister Nouri al-Maliki at a conference in Egypt, and the slight is still felt. Last week, in a statement on an Iraqi government website, al-Maliki accused Saudi Arabia of having "negative positions," allowing Saudis to become insurgents in Iraq, and said that more diplomatic reconciliation would be "useless" without a change of heart in Riyadh. This prompted an angry denial by Saudi interior minister Prince Nayef, who urged Baghdad to improve its own border security. Officials in Washington are very conscious that without Saudi cooperation in stopping jihadist fighters, the military situation in Iraq could worsen, causing a delay in a key Obama administration policy of drawing down U.S. forces. Yemen On June 1, Yemeni president Ali Abdullah Salih visited Riyadh for talks with King Abdullah, just three days after CIA deputy director Steven Kappes was in the Yemeni capital discussing al-Qaeda and the fate of approximately a hundred Yemeni detainees locked up at the Guantanamo Bay detention facility (Yemen has the largest national group at the facility, which Obama is intent on closing). The United States reportedly wants to repatriate these Yemeni detainees to Saudi Arabia because it is not satisfied with Yemen's ability to stop them from returning to terrorism. Meanwhile President Salih wants the United States to fund the construction of a detention facility in Yemen for the detainees. Pakistan Washington also considers Saudi Arabia an important influence on Pakistan because of Riyadh's political links with that country's likely future leader, Nawaz Sharif, as well as the kingdom's necessary role in mobilizing an anti-jihadist consensus. There is also concern that if Iran develops nuclear weapons, Saudi Arabia will look to Pakistan for nuclear guarantees to supplement or replace U.S. security promises. Energy This week started with the price of oil at a seven-month high, above $67 per barrel, a reflection of both production cutbacks by the Saudi-led Organization of the Petroleum Exporting Countries (OPEC) and revived hopes for the recovery of the world economy. In an interview with a Kuwaiti newspaper on May 26, King Abdullah stated that "the fair price is $75, maybe $80." But U.S. willingness to challenge Saudi Arabia on this point is uncertain. On May 28, in an interview with the Financial Times, U.S. energy secretary Steven Chu warned that Americans would have to learn to live with higher oil prices. The following day, President Obama, who campaigned on increasing the energy independence of the United States, said he was going to indicate to King Abdullah that "we're not going to be eliminating our need for oil imports in the immediate future . . . that's not our goal." But he did say that "it's [not] in Saudi Arabia's interests to have a situation in which our economy is dependent -- or disrupted constantly -- by huge spike[s] in energy prices." Meanwhile U.S. officials, concerned that oil revenues can be diverted to fund extremism (or, in Iran's case, fund its nuclear program), told the Wall Street Journal on May 29 that the Taliban in Afghanistan "received significant donations from . . . Gulf nations such as Saudi Arabia." Obama's Challenge In his interview with the Kuwaiti newspaper, King Abdullah, asked to comment on Obama's planned speech in Cairo, said, "Perhaps [Obama's] speech will include justice to Arab and Muslim causes." He continued, "We ask nothing from [the United States] other than fairness and justice to the causes of Arabs and the Islamic religion . . . a religion of justice and moderation, a religion of tolerance, love, and brotherhood." In his conversation with the Saudi king, Obama will be seeking more than a list of platitudes. That the visit is taking place at all suggests that Obama is expecting some definitive policy achievements to emerge. The diplomatic reality, however, is that breakthroughs are rare, especially with Saudi Arabia, which prefers to keep its options open. News of the Riyadh meeting may well be quickly overshadowed by Obama's speech in Cairo, but what happens in the Saudi capital will remain of great importance to U.S. interests in the region. Simon Henderson is the Baker fellow and director of the Gulf and Energy Program at the Washington Institute. His new study, After King Abdullah: Succession in Saudi Arabia, will be published this summer. About The Authors Simon Henderson is the Baker fellow and director of the Bernstein Program on Gulf and Energy Policy at The Washington Institute, specializing in energy matters and the conservative Arab states of the Persian Gulf. The Washington Institute seeks to advance a balanced and realistic understanding of American interests in the Middle East and to promote the policies that secure them. | About the Institute The Institute is a 501(c)3 organization; all donations are tax deductible. | Support the Institute | Mid | [
0.638820638820638,
32.5,
18.375
] |
Resistance of Aegilops Species from Israel to Widely Virulent African and Israeli Races of the Wheat Stem Rust Pathogen. Widely virulent races of the stem rust pathogen (Puccinia graminis f. sp. tritici) such as those isolated from Africa (e.g., TTKSK, isolate synonym Ug99) threaten wheat production worldwide. To identify Aegilops accessions with effective resistance to such virulent stem rust races, up to 10 different species from Israel were evaluated against African races TTKSK, TTKST, and TTTSK and the Israeli race TTTTC as seedlings in the greenhouse. A wide diversity of stem rust reactions was observed across the Aegilops spp. and ranged from highly resistant (i.e., infection type 0) to highly susceptible (infection type 4). The frequency of resistance within a species to races TTTTC and TTKSK ranged from 7 and 14%, respectively, in Aegilops searsii to 98 and 100% in AE. speltoides. In all, 346 accessions were found resistant to the three African races and 138 accessions were resistant (or heterogeneous with a resistant component) to all four races. The species with broadly resistant accessions included Ae. longissima (59 accessions), Ae. peregrina (47 accessions), Ae. sharonensis (15 accessions), Ae. geniculata (9 accessions), Ae. kotschyi (5 accessions), and Ae. bicornis (3 accessions). Few geographical trends or correlations with climatic variables were observed with respect to stem rust resistance in the Aegilops spp. The exception was Ae. longissima infected with race TTTTC, where a high frequency of resistance was found in central and northern Israel and a very low frequency in southern Israel (Negev desert region). This geographical trend followed a pattern of annual precipitation in Israel, and a significant correlation was found between this variable and resistance in Ae. longissima. Although difficult, it is feasible to transfer resistance genes from Aegilops spp. into wheat through conventional wide-crossing schemes or, alternatively, a cloning and transformation approach. The broadly resistant accessions identified in this study will be valuable in these research programs. | High | [
0.701134930643127,
34.75,
14.8125
] |
A weak topological insulator state in quasi-one-dimensional bismuth iodide. The major breakthroughs in understanding of topological materials over the past decade were all triggered by the discovery of the Z2-type topological insulator-a type of material that is insulating in its interior but allows electron flow on its surface. In three dimensions, a topological insulator is classified as either 'strong' or 'weak'1,2, and experimental confirmations of the strong topological insulator rapidly followed theoretical predictions3-5. By contrast, the weak topological insulator (WTI) has so far eluded experimental verification, because the topological surface states emerge only on particular side surfaces, which are typically undetectable in real three-dimensional crystals6-10. Here we provide experimental evidence for the WTI state in a bismuth iodide, β-Bi4I4. Notably, the crystal has naturally cleavable top and side planes-stacked via van der Waals forces-which have long been desirable for the experimental realization of the WTI state11,12. As a definitive signature of this state, we find a quasi-one-dimensional Dirac topological surface state at the side surface (the (100) plane), while the top surface (the (001) plane) is topologically dark with an absence of topological surface states. We also find that a crystal transition from the β-phase to the α-phase drives a topological phase transition from a nontrivial WTI to a normal insulator at roughly room temperature. The weak topological phase-viewed as quantum spin Hall insulators stacked three-dimensionally13,14-will lay a foundation for technology that benefits from highly directional, dense spin currents that are protected against backscattering. | High | [
0.6853146853146851,
30.625,
14.0625
] |
Dog Care How to Care for an Alaskan Malamute Despite the similarity in markings, Alaskan malamutes tend to be bigger and much heavier than Siberian huskies. Siberian huskies are not the only working dogs from the very north. The Alaskan malamute, probably originally domesticated by the Inuit as a hunting dog, is similar, also taking the role of sled dog just as huskies do. Unsurprisingly, Alaskan malamutes need a lot of exercise. Although Alaskan malamutes can make excellent family dogs, Pet MD warns that they can be hostile to other pets unless they were raised together, and to strange dogs, although they tend to be fine with people. The other important care consideration before choosing this breed is grooming. Alaskan Malamutes were bred as working dogs in a very cold environment and as a result have thick, heavy coats that require more intensive grooming than your average short-haired dog. Loading... Loading ... Step 1 Begin training and socialization early if you have a young dog or a puppy. Socialization with other dogs is especially important for Alaskan malamutes, which can be aggressive to other members of the same species but usually not humans. Training classes are helpful for this process, as well as for people new to training dogs. Alaskan malamutes can be fairly stubborn and, of course, they are strong, which could lead to -- among other annoyances -- less-than-enjoyable walks with your dog pulling with determination on the leash. Step 2 Walk your dog for at least an hour every day, and ensure that all members of your family spend as much time with her as they can. Being a muscular dog adapted to running long distances, your Alaskan malamute needs quite a lot of exercise. She also needs plenty of interaction with people. If your lifestyle doesn’t permit committing much time to a pet, consider another breed or another type of animal entirely. Step 3 Enclose your yard with a secure fence that's at least 6 feet tall, sinking the base into the ground. Alaskan malamutes need long, daily walks but they also do best when they have access to an exercise yard. This doesn’t mean it is appropriate to keep your dog malamute outside, but she will benefit from being able to exercise as she feels the need. A dog door is a good option if you are certain your yard is secure. Step 4 Feed a high-quality, relatively high-protein dry dog food. Basically, a good-quality dog food that is not exceptionally low in protein should suit this breed. She will also appreciate a plentiful supply of chews. Alaskan malamutes don’t usually need a special diet, unless elderly, a puppy or ill, in which cases you should ask your vet for a diet sheet. Loading ... Step 5 Provide a zinc supplement, but consult your vet first. Read the packaging on your regular dog food and make a note of its zinc content beforehand. Alaskan malamutes may suffer from zinc deficiency and sometimes need more zinc than is provided in a balanced dog food. However, while the minimum required zinc is higher than for other breeds, the maximum dosage is actually less, which is why it is important to obtain professional advice. The ideal amount of zinc per kilogram of food is about 150 milligrams, and the maximum is 300 milligrams, according to Doctors Foster & Smith. Step 6 Brush your dog thoroughly at least twice a week, making sure you brush out any loose fur. Occasionally, you’ll also need to trim long fur around the feet and the dog’s nails. Baths are completely optional unless your malamute gets a sticky substance stuck to her fur. When bathing your malamute, use a dog shampoo and warm -- not hot -- water. Don’t let the dog outside in cold weather until her fur is completely dry, which might take a while with this breed. Loading... Loading... Items You Will Need Dog harness and leash Fencing Dog door Dry dog food Canned dog food Zinc supplement Brush Scissors Pet nail clippers Dog shampoo Tips During the grooming routine, and in general, look out for any changes in your dog’s body, especially the eyes, ears and hip joints, and in her behavior. Make a veterinary appointment if you notice anything amiss. If you are unsure about any aspect of grooming your Alaskan malamute, perhaps trimming the nails or cleaning the ears, ask your vet or a professional dog groomer to show you the procedure. Although regular professional grooming can work out to be rather expensive, one or two visits could be a worthwhile investment. Warnings Please note that this content is intended as an introduction, not a detailed care guide. Aside from books, good places to find more information on looking after the Alaskan malamute or any other breed include the American Society for the Prevention of Cruelty to Animals, the American Kennel Club, your vet and the animal sanctuary or breeder the dog came from. Never buy a puppy from a pet store or online. You might be inadvertently supporting puppy mills – which involve the cruel overbreeding of dogs. Always adopt dogs or puppies from animal sanctuaries or reputable breeders in your area. Note that there are charities that specialize in rehoming particular breeds. Because of the need for an enclosed exercise yard, this breed is not well-suited to apartment living. References Photo Credits About the Author Judith Willson has been writing since 2009, specializing in environmental and scientific topics. She has written content for school websites and worked for a Glasgow newspaper. Willson has a Master of Arts in English from the University of Aberdeen, Scotland. | High | [
0.6820276497695851,
27.75,
12.9375
] |
Bitcoin Bitcoin price has been trading inside a narrow ascending channel on its 1-hour chart, following a quick pullback to a previously broken resistance area. Recall that bitcoin broke above a longer-term symmetrical triangle pattern, indicating that bulls are gaining traction. However, bullish pressure hasn’t been that strong, as bitcoin is torn between dollar strength and improving risk sentiment. Bitcoin price is gradually trading higher inside an ascending channel and might be due to test the resistance near $445. Will the Channel Hold? Technical indicators suggest that bitcoin price might bounce off the top of the range, as RSI is starting to turn down from the overbought zone. Stochastic still seems to be on the move up but has just landed in overbought territory, indicating that buying pressure might fade soon. In addition, the 100 SMA is below the 200 SMA, suggesting tha... | Mid | [
0.572052401746724,
32.75,
24.5
] |
Cell-catalyzed binding of 3H-(-)-trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene to cellular and exogenous DNA and the role of purified human liver epoxide hydrolase. Cultured human monocytes, lymphocytes, Fischer rat liver (TRL-2) cells, and Buffalo rat liver (BRL) cells catalyzed the conversion of 3H(-)-trans-7,8-dihydroxy-7,8-dihydrobenzo[a]pyrene [3H(-)t-7,8-dihydrodiol BP] to r-7,t-8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydrobenzo[a]pyrene (diol epoxide I) and r-7,t-7-8-dihydroxy-c-9,10-oxy-7,8,9,10- tetrahydrobenzo[a]pyrene (diol epoxide II; r-7 indicates that the substituent at the 7-position is the reference, and t and c indicate that the substituents trans and cis, respectively, to the reference substituent). These appear to be the most reactive metabolites of benzo[a]pyrene (BP) and were covalently bound to both exogenous and intact cellular DNA in tissue culture media. The cells induced by benzanthracene (BA) exhibited greater levels of DNA binding than the controls and this binding was linear with increasing cell content in human monocytes, in TRL-2 cells and in Buffalo rat liver cells. The binding to DNA was greater than controls in BA-preinduced lymphocytes, but was not linear. The DNA binding in control cells showed a nonlinear increase with increasing cell concentration in all experiments. The addition of human liver epoxide hydrolase (EC 3.3.2.3) to the incubation medium reduced the amount of reactive metabolites binding to DNA by 12-15% in control and by 23-41% in BA-induced monocytes. Thus, with whole cell systems of either human monocytes or lymphocytes, the addition of purified human liver epoxide hydrolase reduced the binding of 3H(-)t-7,8-dihydrodiol BP metabolites to DNA. Human monocytes and lymphocytes also catalyzed the covalent binding of 3H(-)t-7,8-dihydrodiol BP to intact cellular DNA. The addition of 3H(-)t-7,8-dihydrodiol BA to tissue culture media caused the inhibition of covalent DNA binding in BA-preinduced monocyte by 58% and lymphocytes by 25%. Previous work has shown that BA is metabolized and converted to BA-diol epoxides by microsomes. These results indicate that BA-diol epoxides and BP diol epoxides are competing for the same binding sites on DNA. On the other hand, the addition of 10 nmol of 3H(-)t-7,8-dihydrodiol BP to the incubation of control and BA-preinduced cell homogenate and further incubation at 37 degrees C for 25 min showed that the DNA binding in BA-preinduced cell homogenates was much greater than controls. Homogenates of cells induced by BA exhibited a greater level of DNA binding than controls.(ABSTRACT TRUNCATED AT 400 WORDS) | Mid | [
0.614318706697459,
33.25,
20.875
] |
Q: Is there a way to disable all buttons with a method? This is a lab for school that I'm struggling with, the code is making a game of hangman, and when the "brain" program says the game is over, all of the letter buttons are supposed to be disabled. relevant code sections: the buttons: class ActionButton extends JButton implements ActionListener{ private String name; private char t; public ActionButton(String s){ super(s); name = s; t = name.charAt(0); } @Override public void actionPerformed(ActionEvent e) { ido.newLetter(t); this.setEnabled(false); LovesMePanel.this.update(); } } the update method: public void update(){ answers = ido.getAnswer(); flower.setTriesLeft(ido.getTriesLeft()); progress.setText(answers); if(ido.gameOver()){ // This is where I need to deactivate the buttons if(ido.hasWon()){ } } else if(triesLeft == 0){ } } the buttons are all created in a loop in the LoveMePanel that holds all of the other panels. Is there a way to reference them all or disable them all when the game is over? If not, how should I change my code so that it would be possible to do that? A: If you put your buttons in a Collection, you can iterate through them and disable them all that way. I.e., for (JButton b : myButtons) { b.setEnabled(false) } If not, you have 26 disable statements to write. | Low | [
0.513698630136986,
28.125,
26.625
] |
1. Field of the Invention The present invention relates to a semiconductor processing apparatus and a semiconductor processing method which irradiate energy beams onto a semiconductor film provided on a substrate to crystallize the semiconductor film by a heat treatment. 2. Description of the Related Art Flat type display devices, such as a liquid crystal display device and an organic EL (Electro Luminescence) display device, use thin film transistors (Thin Film Transistors: TFTs) as switching elements for effecting active matrix display of a plurality of pixels. Thin film transistors include a polycrystalline silicon TFT which uses a polysilicon (poly-Si), microcrystalline silicon (μc-Si) or the like in an active region, and an amorphous silicon TFT which uses an amorphous silicon (amorphous Si) in an active region. Of the two types of TFTs, the polysilicon TFT has a feature that the carrier mobility is greater by ten to 100 or so times as compared with the amorphous silicon TFT, and thus has an excellent characteristic as a material for a switching element. Because existing pixel switching elements for driving a liquid crystal do not need such a high carrier mobility, amorphous silicon TFTs are generally used as pixel switches. It is however desirable to use switching elements which have a higher carrier mobility than that of the amorphous silicon TFT in organic EL or high frame usage which is expected to be used in the next generation TFTs. However, the characteristics of the polycrysilicon TFT, such as carrier mobility and threshold voltage, are likely to vary from one device to another due to the presence of both a crystal region and a grain boundary region in a channel region which is the core of the transistor. It is said that the carrier mobility and the device variation have a trade-off relation such that as the carrier mobility becomes greater, the device variation becomes larger. Multiple studies have been done on such a relation originating from the unique grain boundary of the polysilicon TFT. For example, JP-A-2004-87535 (Patent Document 1) discloses a technique of irradiating an excimer laser beam over a diffraction grating mask in addition to a control method for the crystal orientation in repetitive irradiation. That is, positional control on the grain boundary is carried out with the diffraction grating mask in such a way that crystal growth occurs at a point of the intensity-modulated minimum light intensity as the origin, and the position of the grain boundary is set to a point of the maximum light intensity. As another technique, a scheme of crystallization with laser scanning is disclosed. For example, JP-A-2004-87667 (Patent Document 2) discloses SELAX (Selectively Enlarging Laser Crystallization). This method moves (scans) a continuous wave (CW) laser beam or a pseudo CW laser beam with a very high pulse frequency of several tens of MHz or so in one direction in relative to a silicon film deposited on a substrate. The laser scanning causes a crystal to grow in one direction. The grain boundary is formed substantially in parallel to the direction of growth. Therefore, the electric conduction in the direction of crystal growth reduces the density of the grain boundary where carriers cross, thus making it possible to increase the carrier mobility. The closer to a monocrystal the channel portion becomes, the more prominent a difference in in-plane crystal orientation, a slight angular difference in plane orientation, and a difference in internal defect become. It is therefore desirable to form a crystal film of a higher quality of the level of a monocrystalline Si substrate to suppress a device variation. JP-A-2007-281422 (Patent Document 3) discloses a technique of forming a polycrystal with a controlled number of grain boundaries where carriers cross, not making silicon in the channel into a monocrystal. Further, JP-A-2007-281420 (Patent Document 4) discloses a technique of scanning a channel region with a spot laser beam at equal pitches to form grain boundaries. This makes it possible to form a transistor with a smaller device variation while having a relatively high carrier mobility. | Mid | [
0.633587786259541,
31.125,
18
] |
Pressure-control valves are found in practically every pneumatic and hydraulic system. They help in a variety of functions, from keeping system pressures below a desired limit to maintaining a set pressure level in part of a circuit. Different types of pressure control valves include relief, reducing, sequence, counterbalance, safety, and unloading. All of them are […] A mass flow meter, or inertial flow meter, measures the mass flow rate of gases or liquids traveling through a tube. The gas passes by a fixed point within the meter and it measures the mass per unit time, not the volume per unit time. There are many different types of mass flow meters that […] Anesthesia is a term that we are all familiar with. It is a general term that is applied to painkillers and being put under for surgery. It is quite a medical breakthrough that helps not only patients but also doctors. Anesthesia means an insensitivity to pain, especially artificially induced by the administration of gases or […] In the medical device industry, there is an increasing demand for sleeker, smaller designs and speed to the marketplace with the latest and greatest products. Engineers tasked with designing and creating respiratory equipment such as ventilators and anesthesia machines have a host of critical challenges in front of them. End-users demand top performance and compliance […] In the world of mechanics and engineering, there are many different ways to create motion and do work. Two of the oldest, most popular and basic methods are hydraulics and pneumatics. Both rely on similar principles of physics and motion, but they achieve it in different ways. We will take a look at the two […] This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish.AcceptRejectRead More Privacy & Cookies Policy Privacy Overview This website uses cookies to improve your experience while you navigate through the website. Out of these cookies, the cookies that are categorized as necessary are stored on your browser as they are essential for the working of basic functionalities of the website. We also use third-party cookies that help us analyze and understand how you use this website. These cookies will be stored in your browser only with your consent. You also have the option to opt-out of these cookies. But opting out of some of these cookies may have an effect on your browsing experience. | High | [
0.69933774834437,
33,
14.1875
] |
Q: Object reference not set to an instance of an object error I have Default.aspx and Upload.aspx. I'm passing Id through query string to default.aspx(like:http://localhost:3081/default.aspx?Id=1752).In default page i have a link button to open the upload.aspx to upload file.When i use the Request.QueryString["Id"] in upload.aspx,it is showiing error as "Object reference not set to an instance of an object".I'm dealing with RadControls. To open when i click a link(OnClientClick="return ShowAddFeedBackForm()") i have code like: <script> function ShowAddFeedBackForm() { window.radopen("Upload.aspx", "UserListDialog"); return false; } </script> I'm using detailsview in upload page with a textbox and a fileupload control. code to bind when a file upload in upload.aspx protected void DetailsView1_ItemInserting(object sender, DetailsViewInsertEventArgs e) { string qString = Request.QueryString["Id"].ToString(); if (DetailsView1.CurrentMode == DetailsViewMode.Insert) { //string qString = Request.QueryString["Id"].ToString(); //int Projectid = Convert.ToInt32(Session["ProjectId"]); ProTrakEntities objEntity = new ProTrakEntities(); TextBox txtTitle = DetailsView1.FindControl("txtTask") as TextBox; //RadComboBox cmbStatus = DetailsView1.FindControl("cmbStatus") as RadComboBox; //var id = (from project in objEntity.Projects where project.ProjectId == Projectid select project).First(); RadComboBox cmbTaskType = DetailsView1.FindControl("cmbTasktype") as RadComboBox; //RadComboBox cmbTaskPriorty = DetailsView1.FindControl("cmbPriority") as RadComboBox; string Description = (DetailsView1.FindControl("RadEditor1") as RadEditor).Content; var guid = (from g in objEntity.Projects where g.ProjectGuid == qString select g).First(); int pID = Convert.ToInt32(guid.ProjectId); ProjectFeedback objResource = new ProjectFeedback(); objResource.ProjectId = pID; objResource.Subject = txtTitle.Text; objResource.Body = Description; objResource.CreatedDate = Convert.ToDateTime(System.DateTime.Now.ToShortDateString()); objResource.FeedbackType = cmbTaskType.SelectedItem.Text; objEntity.AddToProjectFeedbacks(objResource); objEntity.SaveChanges(); DetailsView1.ChangeMode(DetailsViewMode.ReadOnly); ClientScript.RegisterStartupScript(Page.GetType(), "mykey", "CloseAndRebind('navigateToInserted');", true); } } Getting error at querystring statement-"Object reference not set to an instance of an object" A: The query string is not inherited when you open a new page. You have to include the id in the URL, i.e. Upload.aspx?id=1752. Edit: A simple solution would be to just copy the search part of the page URL: window.radopen("Upload.aspx" + document.location.search, "UserListDialog"); However, typically you would use the id value that you picked up from the query string in the server side code and generate client code to use it. | Low | [
0.5340659340659341,
30.375,
26.5
] |
Is the Ohio House pulling a Mourdock? Friday, May 31st, 2013 by Jenny Brodie The Ohio House Judiciary Committee recently heard testimony on HB 108 and voted the bill out of committee. HB 108 was originally intended to create the Rape Crisis Trust Fund, a fund to aid rape crisis centers throughout the state. While this cause is a worthy one, the committee made changes to the substitute bill which calls into question the true motivation of the bill. According to Gongwer Under the substitute bill, government-based or nonprofit centers that refer rape victims to abortion clinics would be ineligible to receive the funding, except in cases of medical emergency. “Can you tell me why the General Assembly would be inserting itself into rape counseling?” she [Representative Pillich] asked the sponsors, Reps. Nan Baker (R-Westlake) and Kirk Schuring (R-Canton). Adding these provisions seems unnecessary. There are several laws already in place which prevent public dollars from being used to fund abortions In 2010, in Ohio, 3,500 forcible rapes were reported to the police. This only includes rapes that were reported, more likely occurred and went unreported. Does it seem right to limit the treatment options that are available to women who have experienced this type of trauma? Has the Republican party learned nothing from Todd Akin and Richard Mourdock in 2010? Both men came under considerable fire after making incorrect and controversial statements regarding rape. The next thing we know the Ohio Senate will be suggesting, as Mourdock did, that pregnancy from rape is “something that God intended.” | Mid | [
0.5934065934065931,
33.75,
23.125
] |
/*--------------------------------------------------------------------------------------------- * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for license information. *--------------------------------------------------------------------------------------------*/ export interface AzureFunctionsExtensionApi { apiVersion: string; revealTreeItem(resourceId: string): Promise<void>; createFunction(options: ICreateFunctionOptions): Promise<void>; } export type ProjectLanguage = 'JavaScript' | 'TypeScript' | 'C#' | 'Python' | 'PowerShell' | 'Java'; export type ProjectVersion = '~1' | '~2' | '~3'; /** * The options to use when creating a function. If an option is not specified, the default will be used or the user will be prompted */ export interface ICreateFunctionOptions { /** * The folder containing the Azure Functions project */ folderPath?: string; /** * The name of the function */ functionName?: string; /** * The language of the project */ language?: ProjectLanguage; /** * A filter specifying the langauges to display when creating a project (if there's not already a project) */ languageFilter?: RegExp; /** * The version of the project. Defaults to the latest GA version */ version?: ProjectVersion; /** * The id of the template to use. * NOTE: The language part of the id is optional. Aka "HttpTrigger" will work just as well as "HttpTrigger-JavaScript" */ templateId?: string; /** * A case-insensitive object of settings to use for the function */ functionSettings?: { [key: string]: string | undefined } /** * If set to true, it will automatically create a new project without prompting (if there's not already a project). Defaults to false */ suppressCreateProjectPrompt?: boolean; /** * If set to true, it will not try to open the folder after create finishes. Defaults to false */ suppressOpenFolder?: boolean; } | Mid | [
0.62144420131291,
35.5,
21.625
] |
/* ---------------------------------------------------------------------------- * This file was automatically generated by SWIG (http://www.swig.org). * Version 3.0.11 * * Do not make changes to this file unless you know what you are doing--modify * the SWIG interface file instead. * ----------------------------------------------------------------------------- */ package com.badlogic.gdx.physics.bullet.softbody; import com.badlogic.gdx.physics.bullet.BulletBase; import com.badlogic.gdx.physics.bullet.linearmath.*; import com.badlogic.gdx.physics.bullet.collision.*; import com.badlogic.gdx.physics.bullet.dynamics.*; import com.badlogic.gdx.math.Vector3; import com.badlogic.gdx.math.Quaternion; import com.badlogic.gdx.math.Matrix3; import com.badlogic.gdx.math.Matrix4; public class btSoftBodySolverOutput extends BulletBase { private long swigCPtr; protected btSoftBodySolverOutput(final String className, long cPtr, boolean cMemoryOwn) { super(className, cPtr, cMemoryOwn); swigCPtr = cPtr; } /** Construct a new btSoftBodySolverOutput, normally you should not need this constructor it's intended for low-level usage. */ public btSoftBodySolverOutput(long cPtr, boolean cMemoryOwn) { this("btSoftBodySolverOutput", cPtr, cMemoryOwn); construct(); } @Override protected void reset(long cPtr, boolean cMemoryOwn) { if (!destroyed) destroy(); super.reset(swigCPtr = cPtr, cMemoryOwn); } public static long getCPtr(btSoftBodySolverOutput obj) { return (obj == null) ? 0 : obj.swigCPtr; } @Override protected void finalize() throws Throwable { if (!destroyed) destroy(); super.finalize(); } @Override protected synchronized void delete() { if (swigCPtr != 0) { if (swigCMemOwn) { swigCMemOwn = false; SoftbodyJNI.delete_btSoftBodySolverOutput(swigCPtr); } swigCPtr = 0; } super.delete(); } public void copySoftBodyToVertexBuffer(btSoftBody softBody, btVertexBufferDescriptor vertexBuffer) { SoftbodyJNI.btSoftBodySolverOutput_copySoftBodyToVertexBuffer(swigCPtr, this, btSoftBody.getCPtr(softBody), softBody, btVertexBufferDescriptor.getCPtr(vertexBuffer), vertexBuffer); } } | Low | [
0.51,
38.25,
36.75
] |
tag:blogger.com,1999:blog-1169187388039397378.post8614668822526685669..comments2018-11-19T16:17:44.455-06:00Comments on MorganCountyWhistleBlower: Help me - I say somebody help meMorganCountyWhistle [email protected]:blogger.com,1999:blog-1169187388039397378.post-71194347995817680602018-11-08T19:22:13.162-06:002018-11-08T19:22:13.162-06:00Hell NO! Drain Ana and her sidekicks also, get th...Hell NO! Drain Ana and her sidekicks also, get the the hell out of [email protected]:blogger.com,1999:blog-1169187388039397378.post-9185956588641750472018-11-08T17:10:03.167-06:002018-11-08T17:10:03.167-06:00If we want to drain the swamp...NO WAY to Jeff Ses...If we want to drain the swamp...NO WAY to Jeff Sessions for Senate in [email protected] | Low | [
0.47432762836185804,
24.25,
26.875
] |
--- abstract: 'In recent years, substantial progress has been made regarding the application of quasiclassical theory on superconducting hybrid structures. This theoretical framework is reliant on a proper set of boundary conditions in order to describe multilayered systems. With the advent of the field of superconducting spintronics, systems which combine heavy metal layers, in which there is large spin–orbit coupling, with ferromagnets have received a great deal of attention, due to their potential for generating long range triplet superconductivity. In contrast to interfaces of strongly spin polarized materials, which are well understood, a quasiclassical theory for interfaces in systems where there is significant spin–orbit coupling does not yet exist. After reviewing the quasiclassical theory for interfaces, we here solve this problem by deriving a new set of boundary conditions which take spin–orbit coupling explicitly into account. We then go on to apply these boundary conditions to a superconductor-ferromagnet (SF) bilayer and an SFS Josephson weak link, demonstrating the emergence of long range triplet superconductivity in these systems.' author: - Morten Amundsen - Jacob Linder title: 'The quasiclassical theory for interfaces with spin–orbit coupling' --- Introduction ============ The quasiclassical approximation [@serene_pr_1983; @belzig_sm_1999; @rammer_rmp_1986] is a versatile tool with which complex quantum mechanical problems can be simplified to such an extent that they become numerically solvable. The main assumption of this approximation is that the relevant quantities under study vary on length scales which are much larger than the Fermi wavelength so that the computationally challenging shorter length scale oscillations may be integrated out. This makes the quasiclassical approximation particularly well suited for superconductors, in which the superconducting condensate may remain correlated over mesoscopic distances. Indeed, the most general theoretical framework used to describe superconductors, the Green function technique, requires the solution of the Gor’kov equation [@AGD], which is too cumbersome in all but a few select problems. Instead, progress can be achieved with its quasiclassical equivalents, the Eilenberger [@eilenberger_zp_1968] and the Usadel equation [@usadel_prl_1970], which govern quassiclassical Green functions describing only the envelopes of the original propagators, and remain the only viable solution method for many problems of practical interest. When non-superconducting materials are attached to a superconductor to form superconducting hybrid structures, an interesting phenomenon occurs. In such systems, superconducting correlations may leak into the adjoining non-superconducting materials, so that they too attain superconducting properties. This is known as the proximity effect. The study of such systems necessarily involves the proper treatment of interfaces between materials. However, while the bulk properties of superconductors are easily described within quasiclassical theory, interfaces between materials is another matter entirely. In the vicinity of an interface, the governing Hamiltonian changes abruptly, which invalidates the use of the quasiclassical approximation. The consequence of this is that the quasiclassical Green functions feature a discontinuous jump at interfaces, the size of which is impossible to determine within quasiclassical theory—additional information is needed. This jump was first computed for ballistic SN structures using a full microscopic description of the interface [@zaitsev_jetp_1984], thereby giving a set of boundary conditions linking the two materials. These boundary conditions were generalized with the use of a projection operator method [@yip_jltp_1997; @eschrig_prb_2000; @shelankov_prb_2000]. Alternative derivations, where the interface is treated perturbatively via a $T$ matrix approach [@ashauer_jltp_1986; @nagai_jltp_1988; @graser_prb_2007] have also been proposed. In the diffusive limit, boundary conditions may be arrived at by connecting the momentum independent diffusive Green functions far away from the interface to ballistic Green functions present in a region immediately surrounding the interface [@kupriyanov_jetp_1988; @nazarov_sm_1999]. For hybrid structures involving strongly polarized magnetic materials, the interfacial boundary conditions generally become spin active. Such boundary conditions have been formulated heuristically using a tunnelling Hamiltonian [@bergeret_prb_2012]. Another, more fundamental, approach is to connect the two sides of the interface by means of scattering or transfer matrices, in which the spin dependence of the scattering processes are taken into account [@millis_prb_1988; @tokuyasu_prb_1988; @cottet_prb_2009]. Both the projection operator and the $T$ matrix method have also been successfully generalized to handle spin active interfaces in ballistic systems [@cuevas_prb_2001; @eschrig_prl_2003; @kopu_prb_2004; @fogelstrom_prb_2000; @zhao_prb_2004]. The latter method was also applied to diffusive systems in Ref. [@eschrig_njp_2015], in which a completely general theory for boundary conditions in spin polarized hybrid structures was derived. When hybrid structures are made from superconducting and ferromagnetic materials, the proximity effect allows for the coexistence of both magnetic and superconducting correlations. This produces a number of interesting effects. One of the more fascinating effects is perhaps the appearance of triplet superconductivity, due to the Zeeman splitting endowing the Cooper pairs with a net momentum [@buzdin_rmp_2005]. In homogeneous ferromagnets, the triplet Cooper pairs remain in the spinless state, and hence the magnetization has a strong depairing effect. In ferromagnets where the magnetization is inhomogeneous, on the other hand, the triplet Cooper pairs may be converted to an equal spin state [@bergeret_prl_2001; @bergeret_rmp_2005], giving them a net spin. In such a state, the Cooper pairs are insensitive to a parallel magnetization, and may therefore persist for long distances into proximitized ferromagnets, a phenomenon known as long range triplet superconductivity. In addition, since these correlations are spin polarized, they may carry spin currents, a realisation which has strongly contributed to the field of superconducting spintronics [@linder_np_2015; @eschrig_rpp_2015]. Another avenue towards triplet superconductivity is by introducing layers with spin–orbit coupling [@gorkov_prl_01; @annunziata_prb_12; @bergeret_prb_2014]. In such systems, spin polarized supercurrents may be generated even in homogeneous ferromagnets, which is advantageous from an experimental point of view. However, while the boundary conditions for spin polarized systems is well understood, a theory for interfaces in which spin–orbit coupling is prominent does not yet exist. In this paper, we seek to remedy this by deriving a new set of boundary conditions which take spin–orbit coupling into account, using the general framework of Ref. [@eschrig_njp_2015]. This result consequently allows for a proper treatment of spin-orbit coupled interfaces in quasiclassical theory, which is in principle relevant for any heterostructure, since interfaces break inversion symmetry, but particularly so for heterostructures with heavy metal interlayers. We here state our main analytical result and comment briefly on the qualitative physical meaning of each term in the boundary condition. Below, we shall derive this result rigorously and provide a clear description of how the various terms arise, and the meaning of each of the symbols. $$\begin{aligned} &\hat{n}\cdot{\check{g}}_1\nabla{\check{g}}_1 = T\left[{\check{g}}_1\;,\;{\check{g}}_2\right] + T_{\alpha}\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_2\check{{\bm{\sigma}}}_{||}\right] \nonumber \\ &+T_{\alpha}'\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_1\check{{\bm{\sigma}}}_{||}\right]+i\sqrt{T_{\alpha}''T}\left[{\check{g}}_1,\left\{{\check{g}}_2\left[\check{{\bm{\sigma}}}_{||},{\check{g}}_2\right],\check{{\bm{\sigma}}}_{||}\right\}\right]\nonumber \\ &+i\sqrt{T_{\alpha}''T}\left[{\check{g}}_1\,,\,\left\{{\check{g}}_2,\check{{\bm{\sigma}}}_{||}\right\}{\check{g}}_1\check{{\bm{\sigma}}}_{||} + \check{{\bm{\sigma}}}_{||}{\check{g}}_1\left\{{\check{g}}_2,\check{{\bm{\sigma}}}_{||}\right\}\right]. \end{aligned}$$ The usual Kupriyanov-Lukichev term [@kupriyanov_jetp_1988] is the one proportional to $T$. The term proportional to $T_\alpha$ represents a correction to the usual tunneling boundary condition from the spin-orbit coupling part of the tunneling matrix. The term $T_\alpha'$ represents spin-dependent phase-shifts occurring due to spin-orbit coupling at the interface and thus exists even in the absence of any tunnelling. The terms $\sqrt{T_{\alpha}''T}$ are higher order corrections which exist only in the presence of spin-independent tunneling, spin-orbit coupled tunneling, and spin-orbit coupled reflection. The quasiclassical theory for boundary conditions is quite intricate, involving many details, so to ensure complete clarity of the ensuing derivation, we include in \[sec:review\] a review of the treatment of interfaces within quasiclassical theory. In \[sec:soc\] we formulate the boundary conditions in the presence of spin–orbit coupling, and in \[sec:app\] we apply the new boundary conditions to example problems, in order to demonstrate their use. Review of the quasiclassical theory for interfaces {#sec:review} ================================================== In this section, a review of quasiclassical boundary conditions will be given, starting with a brief excursion into general quasiclassical theory. Quasiclassical equations of motion ---------------------------------- All physical observables of interest may be expressed in terms of Green functions, and we use the Keldysh formalism, in which the Green functions take the form of $8\times 8$ matrices in spin$\,\otimes\,$Nambu$\,\otimes\,$Keldysh space, defined as $$\begin{aligned} {\check{G}}= \begin{pmatrix} \hat{G}^R & \hat{G}^K \\ 0 & \hat{G}^A\end{pmatrix} \quad,\quad \hat{G}^R = \begin{pmatrix} G^R & F^R \\ \left(F^R\right)^* & \left(G^R\right)^* \end{pmatrix},\end{aligned}$$ where $\hat{G}^A = -\hat{\rho}_3\left(\hat{G}^R\right)^{\dagger}\hat{\rho}_3$, with $\hat{\rho}_3 = \text{diag}\left(+1,+1,-1,-1\right)$, and $\hat{G}^K = \hat{G}^R\hat{h} - \hat{h}\hat{G}^A$ for a given distribution function $\hat{h}$ [@belzig_sm_1999]. Furthermore, $G^X$ and $F^X$, with $X\in\left\{R, A, K\right\}$ are $2\times 2$ matrices in spin space. We assume time translation invariance, and Fourier transform in the relative time coordinate, so that we may write ${\check{G}}= {\check{G}}({{\bm{r}}}_0,{{\bm{r}}}_n;\varepsilon)\equiv{\check{G}}({{\bm{r}}}_0,{{\bm{r}}}_n)$, where $\varepsilon$ is the quasiparticle energy. The equation of motion may then be written as $$\begin{aligned} \left[\varepsilon\hat{\rho}_3 - \frac{1}{2m}\left(-i\nabla_0\check{I} - \check{{\bm{A}}}({{\bm{r}}}_0)\right)^2 + \mu\check{I} - \check{\Sigma}({{\bm{r}}}_0)\right. \nonumber\\ \left.-\vphantom{\frac{1}{2m}} V_{{\text{imp}}}({{\bm{r}}}_0)\check{I}\right]{\check{G}}({{\bm{r}}}_0,{{\bm{r}}}_n;\varepsilon)=\delta({{\bm{r}}}_0 - {{\bm{r}}}_n)\check{I}, \label{eq:gorkov}\end{aligned}$$ where $\check{I}$ is the $8\times 8$ identity matrix, $\check{{\bm{A}}}({{\bm{r}}}_0)$ is the vector potential, $V_{{\text{imp}}}({{\bm{r}}}_0)$ is the impurity potential, and $\check{\Sigma}({{\bm{r}}}_0)$ encompasses any other local self energies, such as the superconducting gap, or an exchange field. The impurity potential in the conventional way—as a perturbation in momentum space. Towards that end, \[eq:gorkov\] is reformulated as $$\begin{aligned} &{\check{G}}({{\bm{k}}}_0,{{\bm{k}}}_n) = {\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_n) \nonumber\\ &+ \int \frac{d{{\bm{k}}}_1}{(2\pi)^3}\int \frac{d{{\bm{k}}}_2}{(2\pi)^3}\;{\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_1)V_{{\text{imp}}}({{\bm{k}}}_1 - {{\bm{k}}}_2){\check{G}}({{\bm{k}}}_2,{{\bm{k}}}_n), \label{eq:kgorkovint}\end{aligned}$$ where the Fourier transform of the Green function is defined as $$\begin{aligned} {\check{G}}({{\bm{k}}}_0,{{\bm{k}}}_n) = \int d{{\bm{r}}}_0\int d{{\bm{r}}}_n \;{\check{G}}({{\bm{r}}}_0,{{\bm{r}}}_n)e^{-i{{\bm{k}}}_0\cdot{{\bm{r}}}_0 + i{{\bm{k}}}_n\cdot{{\bm{r}}}_n}. \label{eq:FT}\end{aligned}$$ Note that by changing variables to ${{\bm{R}}}= ({{\bm{r}}}_0 + {{\bm{r}}}_n)/2$ and ${{\bm{r}}}= {{\bm{r}}}_0 - {{\bm{r}}}_n$, the Fourier transform may also be written as $$\begin{aligned} {\check{G}}({{\bm{k}}}_0,{{\bm{k}}}_n) = \int d{{\bm{R}}}\;{\check{G}}({{\bm{k}}},{{\bm{R}}})e^{-i\Delta{{\bm{k}}}\cdot{{\bm{R}}}},\end{aligned}$$ with ${{\bm{k}}}= ({{\bm{k}}}_0 + {{\bm{k}}}_n)/2$ and $\Delta{{\bm{k}}}= {{\bm{k}}}_0 - {{\bm{k}}}_n$, and $$\begin{aligned} {\check{G}}({{\bm{k}}},{{\bm{R}}}) = \int d{{\bm{r}}}\;{\check{G}}({{\bm{r}}},{{\bm{R}}}) e^{-i{{\bm{k}}}\cdot{{\bm{R}}}}. \label{eq:mixedrep}\end{aligned}$$ \[eq:mixedrep\] is known as the *mixed representation* of ${\check{G}}$, as it involves both the center of mass position ${{\bm{R}}}$ and the center of mass momentum ${{\bm{k}}}$. The unperturbed Green function ${\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_n)$ satisfies $$\begin{aligned} \int \frac{d{{\bm{k}}}_1}{(2\pi)^3}\;&\left[\left(\varepsilon\rho_3 - \frac{k_0^2}{2m} + \mu\check{I}\right)\delta({{\bm{k}}}_0 - {{\bm{k}}}_1) +\frac{1}{m}{{\bm{k}}}_0\cdot\check{{\bm{A}}}({{\bm{k}}}_0 - {{\bm{k}}}_1)\right.\nonumber\\ &\left. - \frac{1}{2m}\left[\check{{\bm{A}}}({{\bm{k}}}_0 -{{\bm{k}}}_1)\right]^2 - \check{\Sigma}({{\bm{k}}}_0 - {{\bm{k}}}_1)\vphantom{\left(\varepsilon\rho_3 - \frac{k_0^2}{2m} + \mu\check{I}\right)}\right]{\check{G}}_0({{\bm{k}}}_1,{{\bm{k}}}_n)\\ & = \check{I}\delta({{\bm{k}}}_0 - {{\bm{k}}}_n).\end{aligned}$$ By making use of standard techniques for diagram summation [@AGD], taking into consideration that ${\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_n)$ depends on two momentum indices, \[eq:kgorkovint\] can be written as $$\begin{aligned} &{\check{G}}({{\bm{k}}}_0,{{\bm{k}}}_n) = {\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_n) \nonumber\\ &+ \int \frac{d{{\bm{k}}}_1}{(2\pi)^3}\int \frac{d{{\bm{k}}}_2}{(2\pi)^3}\;{\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_1)\check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_1, {{\bm{k}}}_2){\check{G}}({{\bm{k}}}_2,{{\bm{k}}}_n), \label{eq:kgorkovint2}\end{aligned}$$ with the impurity self energy $\check{\Sigma}({{\bm{k}}}_0,{{\bm{k}}}_n)$ defined as $$\begin{aligned} &\check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_0,{{\bm{k}}}_n) = V_{{\text{imp}}}({{\bm{k}}}_0 - {{\bm{k}}}_n) + \nonumber\\ &\int \frac{d{\bm{k}}_1}{(2\pi)^3}\int \frac{d{\bm{k}}_2}{(2\pi)^3}\;V_{{\text{imp}}}({{\bm{k}}}_0 - {{\bm{k}}}_1){\check{G}}_0({{\bm{k}}}_1,{{\bm{k}}}_2)\check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_2,{{\bm{k}}}_n). \label{eq:selfenergy}\end{aligned}$$ It is customary to employ the self-consistent Born approximation, in which \[eq:selfenergy\] is truncated at second order in $V_{{\text{imp}}}$, and the replacement ${\check{G}}_0\to{\check{G}}$ is made on the right hand side. The latter is equivalent to including a much greater number of diagrams in the self energy. The impurity potential is assumed to consist of a large number of randomly distributed identical impurities, so that $V_{{\text{imp}}}({{\bm{r}}}) = \sum_j U({{\bm{r}}}- {{\bm{r}}}_j)$. After impurity averaging, ignoring terms which only depend on $U(0)$ since these simply renormalize the chemical potential, the self energy becomes $$\begin{aligned} \check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_0,{{\bm{k}}}_n) = \int \frac{d{{\bm{q}}}}{(2\pi)^3}\;|U({{\bm{k}}}_0 - {{\bm{q}}})|^2{\check{G}}({{\bm{q}}},{{\bm{q}}}- \Delta{{\bm{k}}}).\end{aligned}$$ In the mixed representation, arrived at by Fourier transforming in the relative momentum $\Delta{{\bm{k}}}$, this expression becomes particularly simple, $$\begin{aligned} \check{\Sigma}_{{\text{imp}}}({{\bm{k}}},{{\bm{R}}}) = \int \frac{d{{\bm{q}}}}{(2\pi)^3}\;|U({{\bm{k}}}- {{\bm{q}}})|^2{\check{G}}({{\bm{q}}},{{\bm{R}}}).\end{aligned}$$ By comparing with the full Fourier transform, given in \[eq:FT\], we may identify ${{\bm{R}}}$ as the center of mass position. \[eq:gorkov\] takes the following form in the mixed representation, $$\begin{aligned} \left[\varepsilon\hat{\rho}_3 - \frac{1}{2m}\left(-i\left(i{{\bm{k}}}+ \frac{1}{2}\nabla_R\right)\check{I} - \check{{\bm{A}}}({{\bm{R}}})\right)^2 + \mu\check{I} - \check{\Sigma}({{\bm{R}}})\right. \nonumber\\ \left.-\vphantom{\frac{1}{2m}} \check{\Sigma}_{{\text{imp}}}({{\bm{k}}},{{\bm{R}}})\right]\otimes{\check{G}}({{\bm{k}}},{{\bm{R}}})=\check{I}, \label{eq:mrgorkov}\end{aligned}$$ where the operator $\otimes$ indicates the Moyal product, which is defined as $A({{\bm{k}}},{{\bm{R}}})\otimes B({{\bm{k}}},{{\bm{R}}}) = e^{i(\nabla^{(A)}_R\cdot\nabla^{(B)}_k - \nabla^{(A)}_k\cdot\nabla^{(B)}_R)/2}A({{\bm{k}}},{{\bm{R}}})B({{\bm{k}}},{{\bm{R}}})$. If the spatial variation of $A({{\bm{k}}},{{\bm{R}}})$ and $B({{\bm{k}}},{{\bm{R}}})$ is slow, one may approximate $A({{\bm{k}}},{{\bm{R}}})\otimes B({{\bm{k}}},{{\bm{R}}}) \simeq A({{\bm{k}}},{{\bm{R}}})B({{\bm{k}}},{{\bm{R}}})$. \[eq:mrgorkov\] may be further simplified by introducing the quasiclassical approximation, wherein the rapid oscillations of the Green function are integrated out [@rammer_rmp_1986], $$\begin{aligned} {\check{g}}({{\bm{k}}}_F,{\bm{R}}) = \frac{i}{\pi}\int d\xi_k\;{\check{G}}({{\bm{k}}},{\bm{R}}), \label{eq:qc}\end{aligned}$$ where $\xi_k = \frac{1}{2m}({{\bm{k}}}^2 - k_F^2)$. In \[eq:qc\] there is an implicit assumption that the Green function ${\check{G}}({{\bm{k}}},{{\bm{R}}})$ is strongly peaked at the Fermi level $k_F$, so that only the angular dependence of the momentum ${{\bm{k}}}$ appears in the quasiclassical Green function ${\check{g}}({{\bm{k}}}_F,{{\bm{R}}})$. This is satisfied as long as the spatial variation of the self-energies appearing in ${\check{G}}$ is sufficiently slow. The quasiclassical approximation may not be applied to \[eq:mrgorkov\] directly, as it contains both constant terms and terms proportional to $\xi_k$. These terms can be removed by employing the so-called “left–right” trick [@eilenberger_zp_1968; @larkin_jetp_1969; @serene_pr_1983], where one instead considers the difference between \[eq:mrgorkov\] and its adjoint, thereby cancelling out the problematic terms. Doing so leads to the Eilenberger equation [@eilenberger_zp_1968], $$\begin{aligned} &i{\bm{v}}_F\cdot\tilde{\nabla}{\check{g}}({{\bm{k}}}_F,{{\bm{r}}}) \nonumber \\ &+ \left[\varepsilon\check{\rho}_3 + \check{\Sigma}({{\bm{k}}}_F,{{\bm{r}}}) - \check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_F,{{\bm{r}}})\;,\;{\check{g}}({{\bm{k}}}_F,{{\bm{r}}})\right] = 0. \label{eq:eilenberger}\end{aligned}$$ \[eq:eilenberger\] is accompanied by a normalization condition on the quasiclassical Green function, ${\check{g}}^2 = \check{I}$. In the limit of large concentrations of impurities, the effect of frequent scatterings may be included by averaging over momentum direction. This defines a diffusive Green function ${\check{g}}_d = \langle{\check{g}}\rangle$, and its governing equation of motion, the Usadel equation [@belzig_sm_1999; @rammer_rmp_1986; @usadel_prl_1970] $$\begin{aligned} D\nabla\cdot{\check{g}}_d\nabla{\check{g}}_d + i\left[\varepsilon\rho_3 - \check{\Sigma}\;,\;{\check{g}}_d\right] = 0, \label{eq:usadel}\end{aligned}$$ where $D$ is the diffusion constant. Distinguished impurities ------------------------ We next consider a case where there is an additional impurity $\check{V}({{\bm{r}}}_0)$ present, which may in some way be distinguished from the averaged impurities described by $\check{\Sigma}_{{\text{imp}}}$. We further assume that this impurity is strongly localized at some position. This means that impurity averaging is not possible. Even so, the quasiclassical formulation of the equation of motion for such a system may be arrived at by perturbation theory [@thuneberg_prb_1984]. Indeed, if any interference between the averaged and the localized impurity is neglected, the integral equation for the Green function once again takes the form of \[eq:kgorkovint\], where $\check{V}$ replaces $V_{{\text{imp}}}$ as the perturbing potential, and ${\check{G}}_0$ is the Green function for a system where $\check{\Sigma}_{{\text{imp}}}$ is included, but where $\check{V} = 0$. By repeated iteration of this equation, it is seen that it may be written in the form $$\begin{aligned} &{\check{G}}({{\bm{k}}}_0,{{\bm{k}}}_n) = {\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_n) \nonumber\\ &+ \int \frac{d{{\bm{k}}}_1}{(2\pi)^3}\int \frac{d{{\bm{k}}}_2}{(2\pi)^3}\;{\check{G}}_0({{\bm{k}}}_0,{{\bm{k}}}_1){\check{T}}({{\bm{k}}}_1,{{\bm{k}}}_2){\check{G}}_0({{\bm{k}}}_2,{{\bm{k}}}_n), \label{eq:ktmat}\end{aligned}$$ with the $T$ matrix defined as $$\begin{aligned} &{\check{T}}({{\bm{k}}}_0,{{\bm{k}}}_n) = \check{V}({{\bm{k}}}_0 - {{\bm{k}}}_n)\nonumber \\ &+\int\frac{d{{\bm{k}}}_1}{(2\pi)^3}\int\frac{d{{\bm{k}}}_2}{(2\pi)^3}\;\check{V}({{\bm{k}}}_0-{{\bm{k}}}_1){\check{G}}_0({{\bm{k}}}_1,{{\bm{k}}}_2){\check{T}}({{\bm{k}}}_2,{{\bm{k}}}_n). \label{eq:tmatrix}\end{aligned}$$ If the distinguished impurity is localized at a position ${{\bm{R}}}_0$, the Fourier transformed of the impurity potential is given as $\check{V}({{\bm{q}}}) = \check{V}_0({{\bm{q}}}) e^{-i{{\bm{q}}}\cdot{{\bm{R}}}_0}$, where $\check{V}_0({{\bm{q}}})$ is a slowly varying function of ${{\bm{q}}}$. By inserting this into \[eq:tmatrix\], it is seen that the $T$ matrix can be written as $$\begin{aligned} {\check{T}}({{\bm{k}}}_0,{{\bm{k}}}_n) = {\check{T}}_0({{\bm{k}}}_0,{{\bm{k}}}_n) e^{-i({{\bm{k}}}_0 - {{\bm{k}}}_n)\cdot{{\bm{R}}}_0}, \label{eq:tt0}\end{aligned}$$ where ${\check{T}}_0({{\bm{k}}}_0,{{\bm{k}}}_n)$ has the exact same form as \[eq:tmatrix\], with the replacements $\check{V}\to\check{V}_0$ and $\check{T}\to\check{T}_0$. It is thus a slowly varying function of ${{\bm{k}}}_0$ and ${{\bm{k}}}_n$, so that we may approximate ${\check{T}}_0({{\bm{k}}}_0,{{\bm{k}}}_n)\simeq{\check{T}}_0({{\bm{k}}},{{\bm{k}}})$, where ${{\bm{k}}}$ is the center of mass momentum. In the mixed representation, the $T$ matrix then becomes $$\begin{aligned} {\check{T}}({{\bm{k}}},{{\bm{R}}}) = {\check{T}}_0({{\bm{k}}},{{\bm{k}}})\delta({{\bm{R}}}- {{\bm{R}}}_0).\end{aligned}$$ The equation of motion in the mixed representation becomes identical to \[eq:mrgorkov\], but with the addition of a term ${\check{T}}({{\bm{k}}},{{\bm{R}}})\otimes{\check{G}}_0({{\bm{k}}},{{\bm{R}}})$, which is once again approximated by a product. Following the same steps used in deriving \[eq:eilenberger\] then gives $$\begin{aligned} &i{\bm{v}}_F\cdot\tilde{\nabla}{\check{g}}({{\bm{k}}}_F,{{\bm{R}}})+ \left[\varepsilon\check{\rho}_3 + \check{\Sigma}({{\bm{k}}}_F,{{\bm{R}}}) - \check{\Sigma}_{{\text{imp}}}({{\bm{k}}}_F,{{\bm{R}}})\;,\;{\check{g}}({{\bm{k}}}_F,{{\bm{R}}})\right] \nonumber \\ &=\left[{\check{t}}_0({{\bm{k}}}_F,{{\bm{R}}})\;,\;{\check{g}}({{\bm{k}}}_F,{{\bm{R}}})\right]\delta({{\bm{R}}}-{{\bm{R}}}_0), \label{eq:teilenberger}\end{aligned}$$ where ${\check{t}}_0({{\bm{k}}}_F, {{\bm{R}}})$ is the quasiclassical version of the $T$ matrix, given as $$\begin{aligned} {\check{t}}_0({{\bm{k}}}_F,{{\bm{R}}}) = \check{V}_0(0) + N_0\int\frac{d\Omega_q}{4\pi}\;\check{V}_0({{\bm{k}}}_F - {{\bm{q}}}_F)\,{\check{g}}({{\bm{q}}}_F,{{\bm{r}}})\,{\check{t}}_0({{\bm{q}}}_F,{{\bm{R}}}).\end{aligned}$$ Interface --------- An interface, which is a plane in three dimensions, may be treated as an impurity that is localized along a specific direction, having translation invariance along the two orthogonal directions. This implies that a similar perturbation expansion as was discussed in the previous section may be applied also in this case. However, the interface may not be constructed from an ensemble of point impurities satisfying \[eq:teilenberger\] [@thuneberg_prb_1984]. This is because i) the pointlike nature of the impurity was explicitly made use of in \[eq:tt0\], and ii) interference between different impurities is neglected. Instead, we follow Ref. [@buchholtz_zp_1979] and consider a model surface of the form $\check{V}({{\bm{r}}}_0) = \check{V}_0\delta[\hat{n}\cdot({{\bm{r}}}_0 - {{\bm{R}}}_n)]$, where $\hat{n}$ is the normal vector of the surface, and ${{\bm{R}}}_n$ is a point on the surface. To simplify the notation, we define $\hat{n}\cdot{{\bm{r}}}_0 = r_{\perp}$, and $\hat{n}\cdot{{\bm{R}}}_n = R_0$. Furthermore, we have that ${{\bm{r}}}_0 = r_{\perp}\hat{n} + {{\bm{r}}}_{||}$. Insertion into \[eq:tmatrix\] allows us to define $$\begin{aligned} {\check{T}}({{\bm{k}}}_0,{{\bm{k}}}_n) = {\check{T}}_s({{\bm{k}}}_{0,||},{{\bm{k}}}_{n,||})e^{-i(k_{0,\perp} - k_{n,\perp})R_0}, \label{eq:TQ}\end{aligned}$$ with $k_{j,\perp}$ and ${{\bm{k}}}_{j,||}$, respectively, the orthogonal and parallel components of momentum $j$, with respect to the surface. Moreover, $$\begin{aligned} {\check{T}}_s({{\bm{k}}}_{0,||},{{\bm{k}}}_{n,||}) &= \check{V}_0\,(2\pi)^2\delta({{\bm{k}}}_{0,||}-{{\bm{k}}}_{n,||}) \nonumber \\ &+ \check{V}_0\int \frac{d{{\bm{q}}}_{||}}{(2\pi)^2}\;\check{Q}({{\bm{k}}}_{0,||},{{\bm{q}}}_{||}){\check{T}}_s({{\bm{q}}}_{||},{{\bm{k}}}_{n,||}),\end{aligned}$$ where $$\begin{aligned} &\check{Q}({{\bm{k}}}_{0,||},{{\bm{q}}}_{||})= \nonumber \\ &\int \frac{dk_{1,\perp}}{2\pi}\int \frac{dk_{2,\perp}}{2\pi} {\check{G}}_0({{\bm{k}}}_{0,||}+k_{1,\perp}\hat{n},{{\bm{q}}}_{||} + k_{2,\perp}\hat{n})e^{i(k_{1,\perp} - k_{2,\perp})R_0} \nonumber\\ &=\int \frac{dq_{\perp}}{2\pi}\;{\check{G}}_0({{\bm{k}}}_{0,||},{{\bm{q}}}_{||};{{\bm{q}}}_{\perp},R_0).\end{aligned}$$ In the mixed represantion, \[eq:TQ\] simply becomes $$\begin{aligned} {\check{T}}({{\bm{k}}},{{\bm{R}}}) = {\check{T}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||})\,\delta(R_{\perp}-R_0),\end{aligned}$$ with $$\begin{aligned} {\check{T}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||}) =& \check{V}_0 + \check{V}_0\,\check{Q}({{\bm{k}}}_{||},{{\bm{R}}}_{||})\otimes{\check{T}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||}) \nonumber \\ \simeq&\check{V}_0 + \check{V}_0\,\check{Q}({{\bm{k}}}_{||},{{\bm{R}}}_{||})\,{\check{T}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||}),\end{aligned}$$ and $$\begin{aligned} \check{Q}({{\bm{k}}}_{||},{{\bm{R}}}_{||}) = \int \frac{dq_{\perp}}{2\pi}\;{\check{G}}_0(q_{\perp}\hat{n} + {{\bm{k}}}_{||},R_0\hat{n}+{{\bm{R}}}_{||}) \label{eq:Q}\end{aligned}$$ To find the quasiclassical version of \[eq:Q\], we insert the inverse of \[eq:qc\], namely ${\check{G}}({{\bm{k}}},{{\bm{R}}}) = -i\pi{\check{g}}({{\bm{k}}}_F,{{\bm{R}}})\,\delta\left(\frac{1}{2m}({{\bm{k}}}^2 - k_F^2)\right)$. Performing the integral over $q_{\perp}$ gives $$\begin{aligned} \check{Q}({{\bm{k}}}_{||},{{\bm{R}}}_{||}) = -\frac{i}{|v_n|}{\check{\bar{g}}}({{\bm{k}}}_{||},{{\bm{R}}}_{||}),\end{aligned}$$ with $v_n = \frac{{{\bm{k}}}_F\cdot\hat{n}}{m}$, $$\begin{aligned} {\check{\bar{g}}}({{\bm{k}}}_{||},{{\bm{R}}}_{||}) = \frac{1}{2}\left[{\check{g}}({{\bm{k}}}_{+},{{\bm{R}}}_{||} + R_0\hat{n}) + {\check{g}}({{\bm{k}}}_{-},{{\bm{R}}}_{||} + R_0\hat{n})\right],\end{aligned}$$ and ${{\bm{k}}}_{\pm} = \pm\sqrt{k_F^2 - {{\bm{k}}}_{||}^2}\hat{n} + {{\bm{k}}}_{||}$. This means that the quasiclassical $T$ matrix for an interface, $$\begin{aligned} {\check{t}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||}) = \check{V}_0 - \frac{i}{|v_n|}\check{V}_0\,{\check{\bar{g}}}({{\bm{k}}}_{||},{{\bm{R}}}_{||})\,{\check{t}}_s({{\bm{k}}}_{||},{{\bm{R}}}_{||}) \label{eq:tmatrixsurf}\end{aligned}$$ only depends on the *average* of Green functions whose normal component of the momentum direction point, respectively toward and away from the interface. The equation of motion, takes the same form as \[eq:teilenberger\], with the replacements ${\check{t}}_0\to{\check{t}}_s$ and $\delta({{\bm{R}}}- {{\bm{R}}}_0)\to\delta(R_{\perp} - R_0)$. Formulation of boundary conditions ---------------------------------- We next want to consider an interface between two different materials. This is done by expanding Hilbert space into two domains, which represent the two sides of the interface. The Green function in this space can be written as $$\begin{aligned} \breve{g} = \begin{pmatrix} {\check{g}}_{11} & {\check{g}}_{12} \\ {\check{g}}_{21} & {\check{g}}_{22} \end{pmatrix}, \label{eq:Gbig}\end{aligned}$$ where the subscripts “1” and “2” indicate the two materials. The matrices ${\check{g}}_{12}$ and ${\check{g}}_{21}$ contain creation and annihilation operators on both sides of the interface. These quantities are drone amplitudes that do not have physical meaning, and since they will be eliminated from the theory, we do not specify them further. The interface itself is described as an infinite surface located at some position, and which mediates tunnelling between its two sides. Such a potential may be described as $$\begin{aligned} \breve{V}_0 = \begin{pmatrix} 0 & \check{V}_{0} \\ \check{V}_{0} & 0\end{pmatrix}.\end{aligned}$$ The surface is treated as a perturbation, and the $T$ matrix is given by \[eq:tmatrixsurf\]. Without the presence of the interface potential, there is no coupling between the two sides. The unperturbed Green function, $\breve{g}_0$, therefore takes the form $$\begin{aligned} \breve{g}_0 = \begin{pmatrix}{\check{g}}_{0,1} & 0 \\ 0 & {\check{g}}_{0,2}\end{pmatrix}. \label{eq:bg0}\end{aligned}$$ Note that \[eq:bg0\] satisfies a generalized version of \[eq:eilenberger\], given as $$\begin{aligned} i{{\bm{k}}}_F\cdot\bar{\nabla}\breve{g}_0 + \left[\breve{\Xi}\;,\;\breve{g}_0\right] = 0, \label{eq:be}\end{aligned}$$ where $$\begin{aligned} \breve{\Xi} = \begin{pmatrix}\varepsilon\check{\rho}_3 + \check{\Sigma}_1 - \check{\Sigma}_{{\text{imp}}} & 0 \\ 0 & \varepsilon\check{\rho}_3 + \check{\Sigma}_2 - \check{\Sigma}_{{\text{imp}}}\end{pmatrix}.\end{aligned}$$ Similarly, $\breve{g}$ satisfies $$\begin{aligned} i{{\bm{k}}}_F\cdot\bar{\nabla}\breve{g} + \left[\breve{\Xi}\;,\;\breve{g}\right] = \left[\breve{t}_s\;,\;\breve{g}_0\right]\delta(R_{\perp} - R_0). \label{eq:bet}\end{aligned}$$ To find a relationship between $\breve{g}$ and $\breve{g}_0$, \[eq:bet\] may be integrated along a small interval surrounding $R_0$. For a trajectory (as determined by ${{\bm{k}}}_F$) crossing the interface, this leads to $$\begin{aligned} \breve{g}(R_0^+) - \breve{g}(R_0^-) = \frac{1}{i{{\bm{k}}}_F\cdot\hat{n}}\left[\breve{t}_s\;,\;\breve{g}_0(R_0)\right], \label{eq:gbjump}\end{aligned}$$ where we henceforth define $\hat{n}$ to be an outwards pointing surface normal. While \[eq:Gbig\] is defined everywhere in space, its diagonal elements, $\check{g}_{11}$ and $\check{g}_{22}$, only make sense physically in, respectively, in material 1 and 2, i.e., on opposite sides of the interface. Without loss of generality, we choose material 1 to be the active material, that is, the material for which we formulate the boundary conditions. This means that $\hat{n}$ points from material 1 to material 2. If $\breve{g}(R_0^-)$ is located in material 1, we thus need to eliminate $\breve{g}(R_0^+)$, which is located in material 2. This can be done by making use of a generalized normalization condition, given by $$\begin{aligned} \left(\breve{g} + \text{sgn}({{\bm{k}}}_F\cdot\hat{n})\right)\left(\breve{g}_{0} - \text{sgn}({{\bm{k}}}_F\cdot\hat{n})\right) =& 0 \label{eq:gg01}\\ \left(\breve{g}_{0} + \text{sgn}({{\bm{k}}}_F\cdot\hat{n})\right)\left(\breve{g} - \text{sgn}({{\bm{k}}}_F\cdot\hat{n})\right) =& 0, \label{eq:gg02}\end{aligned}$$ These conditions are clearly satisfied in the special case of $\breve{g} = \breve{g}_{0}$. That they are valid also in the more general case, can be seen by considering the original derivation of Shelankov [@shelankov_jltp_1985], introducing the interface and taking care to only evaluate points away from the interface, so that $\breve{g}$ and $\breve{g}_{0}$ both satisfy \[eq:be\]—albeit with different boundary conditions [@buchholtz_jltp_2002; @rainer_book_1988]. In material 1 the Green function which describes a particle on a trajectory towards the interface satisfies $\text{sgn}({{\bm{k}}}_F\cdot\hat{n}) = +1$. We label these Green functions as ${\check{g}}_{11}^i$ and ${\check{g}}_{0,1}^i$, indicating that they are incoming with respect to the interface. Similarly, Green functions where $\text{sgn}({{\bm{k}}}_F\cdot\hat{n}) = -1$ are labelled as outgoing; ${\check{g}}_{11}^o$ and ${\check{g}}_{0,1}^o$. By evaluating \[eq:gg01,eq:gg02\] immediately adjacent to, and on opposite sides of the interface, and inserting \[eq:gbjump\], the following boundary conditions may be derived at the interface, $$\begin{aligned} {\check{g}}^i_{11} =& {\check{g}}^i_{0,1} + \frac{1}{2i|v_n|}\left({\check{g}}_{0,1}^{i} - \check{I}\right)\check{t}_{s,11}\left({\check{g}}_{0,1}^{i} + \check{I}\right), \label{eq:bcit1}\\ {\check{g}}^o_{11} =& {\check{g}}^o_{0,1} + \frac{1}{2i|v_n|}\left({\check{g}}_{0,1}^{o} + \check{I}\right)\check{t}_{s,11}\left({\check{g}}_{0,1}^{o} - \check{I}\right). \label{eq:bcit2}\end{aligned}$$ Due to the form of the interface potential $\breve{V}_0$, $\breve{t}_s$ is in general dense in 1–2-space. However, a closed solution for the $\check{t}_{s,11}$ element may be found by iterating \[eq:tmatrixsurf\] once [@cuevas_prb_2001], $$\begin{aligned} \check{t}_{s,11} = -\frac{i}{|v_n|}\check{V}_0\,{\check{\bar{g}}}_{0,2}\check{V}_0 - \frac{1}{v_n^2}\check{V}_0\,{\check{\bar{g}}}_{0,2}\check{V}_0\,{\check{\bar{g}}}_{0,1}{\check{t}}_{s,11}. \label{eq:trec}\end{aligned}$$ Note that ${\check{\bar{g}}}_{0,j} = \frac{1}{2}\left({\check{g}}_{0,j}^i + {\check{g}}_{0,j}^o\right)$, for a given side of the interface $j$. \[eq:trec\] may easily be solved for ${\check{t}}_{s,11}$, giving $$\begin{aligned} \check{t}_{s,11} = \frac{1}{i|v_n|}\left[\check{I} + \frac{1}{v_n^2}\check{V}_0\,{\check{\bar{g}}}_{0,2}\check{V}_0\,{\check{\bar{g}}}_{0,1}\right]^{-1}\,\check{V}_0\,{\check{\bar{g}}}_{0,2}\check{V}_0. \label{eq:tinterface}\end{aligned}$$ To summarize the progress so far, we have found boundary conditions for the quantities ${\check{g}}_{11}^i$ and ${\check{g}}_{11}^o$, given in \[eq:bcit1,eq:bcit2\], expressed entirely in terms of ${\check{g}}_{0,j}^{i/o}$. While these unperturbed Green functions exist everywhere in space, they are only physically valid solutions on their respective sides of the interface. Furthermore, as discussed in Ref. [@eschrig_njp_2015], they can be easily modified to describe a system with an impenetrable interface by having them satisfy the condition $$\begin{aligned} {\check{g}}^o_{0,j} = \check{S}{\check{g}}^i_{0,j}\check{S}^{\dagger} \label{eq:gio}\end{aligned}$$ where $\check{S}$ is a scattering matrix. For spin independent scattering, $\check{S} = \check{I}$. The point is that rather than considering the interface as a perturbation to omnipresent Green functions, we may exploit the fact that we only evaluate ${\check{g}}_{0,j}$ in one region of space to redefine them to represent a system with an impenetrable interface, simply by imposing \[eq:gio\]. This provides significant benefits. Ultimately, the goal is to derive boundary conditions for diffusive systems, which are governed by diffusive Green functions ${\check{g}}_{d,j}$. Even for such a system, there will always be a ballistic zone immediately surrounding an interface, since a particle travelling away from the interface will traverse a distance on the order of the mean free path before encountering its first impurity. Diffusive systems with an interface are therefore governed by ballistic Green functions ${\check{g}}_{0,j}^{i/o}$, with $\check{\Sigma}_{{\text{imp}}} = 0$, close to the interface, and by ${\check{g}}_{d,j}$ far away from the interface. In between is an asymptotic matching region known as the *isotropization zone*, within which the momentum dependence of the ballistic Green functions are averaged out by repeated impurity scatterings. Matching the Green functions of the two regimes is only possible if the following conditions are satisfied [@millis_prb_1988; @nazarov_sm_1999; @cottet_prb_2009], $$\begin{aligned} \left({\check{g}}^i_{0,j} + \check{I}\right)\left({\check{g}}_{d,j} - \check{I}\right) =& 0, \label{eq:iso1}\\ \left({\check{g}}_{d,j} + \check{I}\right)\left({\check{g}}^i_{0,j} - \check{I}\right) =& 0,\label{eq:iso2} \\ \left({\check{g}}^o_{0,j} - \check{I}\right)\left({\check{g}}_{d,j} + \check{I}\right) =& 0,\label{eq:iso3} \\ \left({\check{g}}_{d,j} - \check{I}\right)\left({\check{g}}^o_{0,j} + \check{I}\right) =& 0.\label{eq:iso4}\end{aligned}$$ Using \[eq:iso1,eq:iso2,eq:iso3,eq:iso4\] and \[eq:gio\], the ballistic Green functions at the interface may be expressed in terms of their diffusive counterparts as $$\begin{aligned} {\check{g}}^i_{0,j} = &\left(\check{S}^{\dagger}{\check{g}}_{d,j}\check{S} + {\check{g}}\right)^{-1}\left(2\check{I} + {\check{g}}- \check{S}^{\dagger}{\check{g}}_{d,j}\check{S}\right),\label{eq:bcd1} \\ {\check{g}}^o_{0,j} = &\left(2\check{I} + {\check{g}}- \check{S}{\check{g}}_{d,j}\check{S}^{\dagger}\right)\left(\check{S}{\check{g}}_{d,j}\check{S}^{\dagger} + {\check{g}}\right)^{-1}.\label{eq:bcd2}\end{aligned}$$ The quasiclassical boundary conditions are completed by computing the *matrix current* directed at the interface. In the ballistic zone it is defined as $$\begin{aligned} \check{J}_n = \int \frac{d\Omega}{2\pi} \hat{n}\cdot{\bm{v}}_F\left({\check{g}}^i_{jj} - {\check{g}}^o_{jj}\right), \label{eq:mjb}\end{aligned}$$ where the integration measure is an angular average over a hemisphere. In the diffusive zone the matrix current is given as [@nazarov_sm_1999] $$\begin{aligned} \check{J}_n = \sigma_j\hat{n}\cdot{\check{g}}_{d,j}\nabla{\check{g}}_{d,j}, \label{eq:mjd}\end{aligned}$$ where $\sigma_j$ is the normal state conductivity of material $j$. The matrix current is conserved across the isotropization zone [@cottet_prb_2009], and hence \[eq:mjd\] may be equated with \[eq:mjb\], which in turn is determined from \[eq:bcit1,eq:bcit2\] and \[eq:bcd1,eq:bcd2\], thus giving the complete boundary conditions solely in terms of the diffusive Green functions. For spin independent scattering we have $\check{S} = \check{I}$, which gives ${\check{g}}_{0,j}^i = {\check{g}}_{0,j}^o = {\check{g}}_{d,j}$. This means that the difference between \[eq:bcit1,eq:bcit2\] reduces to ${\check{g}}^{i}_{11} - {\check{g}}^{o}_{11} = \frac{1}{i|v_n|}\left[{\check{t}}_{11} , {\check{g}}_{d,1}\right]$. By using \[eq:tinterface,eq:mjb,eq:mjd\] one may, with some algebra [@kopu_prb_2004], produce Nazarovs boundary conditions [@nazarov_sm_1999], $$\begin{aligned} \sigma_1\hat{n}\cdot{\check{g}}_{d,1}\nabla{\check{g}}_{d,1} =\int^{\frac{\pi}{2}}_0d\theta\; \frac{\sin\theta\,\tau(\theta)\left[{\check{g}}_{d,1}\;,\;{\check{g}}_{d,2}\right]}{4\check{I} + \tau(\theta)\left(\left\{{\check{g}}_{d,1}\;,\;{\check{g}}_{d,2}\right\} - 2\check{I}\right)}, \label{eq:nazarov}\end{aligned}$$ where the coupling constant $\tau(\theta)$ is given as $$\begin{aligned} \tau(\theta) = \frac{4\upsilon^2\cos^2\theta}{(\cos^2\theta + \upsilon^2)^2}, \label{eq:tau}\end{aligned}$$ with $\upsilon = V_0/v_F$, and $\theta$ is the angle of incidence with respect to the interface. $\tau(\theta)$ is shown in \[fig:CC\]a), where it is seen that it attains its maximum value for normal incidence ($\theta = 0$), and goes to zero for trajectories parallel to the interface ($\theta = \frac{\pi}{2}$), which is intuitively reasonable. When $\tau(\theta)$ is small, e.g., in the tunnelling limit, we may neglect its contribution to the denominator of \[eq:nazarov\]. This gives the Kupriyanov–Lukichev boundary conditions [@kupriyanov_jetp_1988], $$\begin{aligned} \hat{n}\cdot{\check{g}}_{d,1}\nabla{\check{g}}_{d,1} = T\left[{\check{g}}_{d,1}\;,\;{\check{g}}_{d,2}\right], \label{eq:KL}\end{aligned}$$ where $T$ is the angular average of the coupling constant, and is given as $$\begin{aligned} T = \frac{\upsilon^2}{2\sigma_1}\left[\frac{1}{\upsilon}\arctan\left(\frac{1}{\upsilon}\right) - \frac{1}{1+\upsilon^2}\right]. \label{eq:KLT}\end{aligned}$$ $T$ is shown for increasing $V_0$ in \[fig:CC\]b). For $V_0 = 0$, there is no coupling between the two sides. The system reduces to its unperturbed state in which the interface is impenetrable, and hence $T = 0$. For large values of $V_0$, $T$ also goes to zero. The reason for this is that when the barrier potential increases, incoming particles are more likely to be reflected than transmitted, which means that the two sides eventually become decoupled also in this limit. +\[mark=none,smooth\] [4\*cos(deg(x))\^2/(1 + cos(deg(x))\^2)\^2]{}; at (axis cs:pi/2-0.2,1) [**a)**]{}; +\[domain=0.001:5,mark=none,smooth\] [0.5\*x\^2\*(rad(atan(1/x))/x - 1/(1+x\^2))]{}; at (axis cs:4.4,0.18) [**b)**]{}; Interfaces with spin–orbit coupling {#sec:soc} =================================== We will now consider an interface to a material within which spin–orbit coupling plays a prominent role, for instance a heavy metal. This means that the transmission probability will depend on both the spin of the incoming particle and its angle of incidence. We model this with a Rashba-like tunnelling coupling, $$\begin{aligned} \label{eq:vsoc} \check{V}_0 = w\check{I} + w_\alpha(\hat{n}_{\alpha}\times\hat{{{\bm{k}}}}_F)\cdot\check{{\bm{\sigma}}},\end{aligned}$$ where $\hat{n}_{\alpha}$ is a unit vector indicating the direction in which the symmetry is broken, and $w$ is a spin independent contribution to the tunnelling between the two sides separated by the interface, while $w_\alpha$ is the strength of the spin–orbit coupling contribution to the tunnelling. As the barrier region increases in width, both $w$ and $w_\alpha$ decrease toward zero. Scattering matrix ----------------- As a step towards formulating the boundary conditions, we need to find the scattering matrix for a system where the interface is impenetrable. However, even though the probability for transmission through the interface is zero, an incoming particle may still penetrate the barrier for some distance before being reflected. While inside the scattering region, the particle will experience the spin–orbit coupling and accumulate a spin dependent phase, the size of which depends on the incoming angle of incidence. To find the scattering matrix for this process, we assume that sufficiently close to the interface, the interface potential is large enough to dominate all other self energies [@millis_prb_1988]. This means that we may follow the procedure of Ref. [@tokuyasu_prb_1988] and describe the interface as a step function potential in a free electron gas. For simplicity, we use a cylindrical coordinate system in which the $z$ axis is aligned with the surface normal. The Hamiltonian for such a system is given as $$\begin{aligned} H = -\frac{1}{2m}\nabla^2 -\mu+ \left(\mu+\varepsilon_g + i\alpha(\hat{z}\times\nabla)\cdot{\bm{\sigma}}\right)\theta(z), \label{eq:SH}\end{aligned}$$ where $\alpha$ expresses the strength of the spin–orbit interaction at the interface, $\mu = \varepsilon_F$ is the chemical potential, and $\theta(z)$ is the Heaviside step function. We consider particles with energies close to the Fermi energy, meaning excitation energies $\varepsilon\simeq 0$, which is the relevant energy regime for quasiclassical theory. The wave function therefore satisfies $H\psi \simeq 0$. The parameter $\varepsilon_g$ expresses an energy gap, and is included to ensure that the wave function is evanescent in the barrier region. Since the interface is assumed to be perfectly smooth, the momentum parallel to the interface, ${{\bm{k}}}_{||}$, is conserved during the scattering process. Hence, we may use the ansatz $\psi({{\bm{r}}}) = e^{i{{\bm{k}}}_{||}\cdot{{\bm{r}}}_{||}}\phi(z)$. \[eq:SH\] then takes the form $$\begin{aligned} &\phi''(z) + \left[2m\varepsilon_F -{{\bm{k}}}_{||}^2\right]\phi(z) = 0,\quad z < 0 \label{eq:phi1}\\ &\phi''(z) - \left[{{\bm{k}}}_{||}^2 + 2m(\varepsilon_g + \alpha(\hat{z}\times{{\bm{k}}}_{||})\cdot{\bm{\sigma}})\right]\phi(z) = 0,\quad z > 0 \label{eq:phi2}\end{aligned}$$ For $z < 0$, the solution of \[eq:phi1\] is given as $$\begin{aligned} \phi(z) = \begin{pmatrix} A_1 \\ A_2\end{pmatrix} e^{ik_{\perp}z} + \begin{pmatrix} B_1 \\ B_2\end{pmatrix} e^{-ik_{\perp}z},\end{aligned}$$ where $k_{\perp} = \sqrt{k_F^2 - {{\bm{k}}}_{||}^2}$. For $z > 0$, we get $$\begin{aligned} \phi(z) = C\begin{pmatrix} 1 \\ -ie^{i\varphi}\end{pmatrix}e^{-q_{+}z} + D\begin{pmatrix}1 \\ ie^{i\varphi}\end{pmatrix}e^{-q_-z},\end{aligned}$$ where $\varphi$ is the azimuthal incidence angle. The momentum $q_{\pm}$ is given as $$\begin{aligned} q_{\pm} = \sqrt{{{\bm{k}}}_{||}^2 + 2m\left(\varepsilon_g \pm \alpha|{{\bm{k}}}_{||}|\right)}.\end{aligned}$$ The scattering matrix is found by relating the coefficients $A_{1,2}$ to $B_{1,2}$ via the matrix equation $B = SA$. This is done by enforcing continuity of $\phi$ and $\phi'$ at $z = 0$, and leads to $$\begin{aligned} S = \frac{1}{(k_{\perp} + iq_+)(k_{\perp} + iq_-)}\begin{pmatrix}k_{\perp}^2 + q_+q_- & e^{-i\varphi}k_{\perp}(q_+ - q_-) \\ e^{i\varphi}k_{\perp}(q_- - q_+) & k_{\perp}^2 + q_+q_- \end{pmatrix}. \label{eq:Smat}\end{aligned}$$ Since the scattering matrix is unitary, $SS^{\dagger} = I$, it may be parametrized as $$\begin{aligned} S = e^{i\beta}e^{i\gamma(\hat{e}\cdot{\bm{\sigma}})} = e^{i\beta}\left(\cos\gamma + i\hat{e}\cdot{\bm{\sigma}}\sin\gamma\right),\end{aligned}$$ where $\gamma$ is a spin mixing angle and $\hat{e}$ is a unit vector. By inspection, we see that we may define ${\hat{e}\cdot{\bm{\sigma}} = -\sigma_x\sin\theta\sin\varphi + \sigma_y\sin\theta\cos\varphi}$. To find an expression for $\gamma$, we define the constants $a = \sqrt{\frac{\varepsilon_g}{\varepsilon_F}}$ and $b = \frac{2m\alpha}{k_F}$. The former expresses the strength of the barrier potential, and the latter the strength of the spin–orbit coupling. Furthermore, we have $|{{\bm{k}}}_{||}| = k_F\sin\theta$, where $\theta \in [0,\pi/2]$ is the polar angle of incidence. We assume that the barrier potential is strong, so that an incoming particle only penetrates a short distance into the scattering region before being reflected, and hence $a \gg b$. From \[eq:Smat\] we may then identify the spin mixing angle as $$\begin{aligned} \label{eq:spinmixingangle} \gamma = \arctan\left(\frac{k_{\perp}(q_+ - q_-)}{\sin\theta \left(k_{\perp}^2 + q_+q_-\right)}\right)\simeq K\cos\theta,\end{aligned}$$ with $K = \frac{b}{a^3}$ when we assume that $a\gg 1$, corresponding to a large band gap in the insulator. The parameter $\beta$ describes an overall phase, which is inconsequential for the boundary conditions, and hence we set $\beta = 0$. In coordinate free form, the scattering matrix therefore takes the form, $$\begin{aligned} S = e^{i\gamma(\hat{n}_{\alpha}\times\hat{k})\cdot{\bm{\sigma}}}.\end{aligned}$$ As before, $\hat{n}_{\alpha}$ is a unit vector that is either parallel or antiparallel to the interface normal, depending on the direction of symmetry breaking. In Nambu-space, the scattering matrix becomes $$\begin{aligned} \hat{S} = \begin{pmatrix} S({{\bm{k}}}) & 0 \\ 0 & S^*(-{{\bm{k}}}) \end{pmatrix} = e^{i\gamma(\hat{n}_{\alpha}\times\hat{k})\cdot\hat{{\bm{\sigma}}}\hat{\rho}_3}, \label{eq:S}\end{aligned}$$ with $\hat{{\bm{\sigma}}} = \text{diag}\left({\bm{\sigma}}\;,\;{\bm{\sigma}}^*\right)$. Note that the spin mixing angle is antisymmetric in ${{\bm{k}}}$, e.g., $\gamma({{\bm{k}}}) = -\gamma(-{{\bm{k}}})$. Finally, the scattering matrix is diagonal in Keldysh space, e.g., $\check{S} = \text{diag}\left(\hat{S}\;,\;\hat{S}\right)$. Boundary conditions ------------------- Finding the correct boundary conditions has now become a matter of identifying the terms in \[eq:mjb\]. To achieve this, we include only the lowest order tunnelling contributions, $$\begin{aligned} {\check{t}}_{s,11}&\simeq \frac{1}{i|v_n|}\check{V}_0{\check{\bar{g}}}_{0,2}\check{V}_0.\nonumber \\ &=\frac{1}{i|v_n|}\left[w^2{\check{\bar{g}}}_{0,2} + w_\alpha w\left\{{\check{\bar{g}}}_{0,2},\check{\zeta}_k\right\} + w_\alpha^2\check{\zeta}_k{\check{\bar{g}}}_{0,2}\check{\zeta}_k\right], \label{eq:tLfirst}\end{aligned}$$ where $\check{\zeta}_k = (\hat{n}_{\alpha}\times\hat{k})\cdot\check{\sigma}\check{\rho}_3$. Furthermore, the spin mixing angle $\gamma$ is assumed to be small, and we therefore keep terms in the scattering matrix only up to second order. This gives $$\begin{aligned} \check{S} \simeq \left(1-\frac{1}{2}\gamma^2\right)\check{I} + i\gamma\check{\zeta}_k. \label{eq:Sapprox}\end{aligned}$$ In addition, we approximate $$\begin{aligned} \left[\check{S}^{\dagger}{\check{g}}_{d,j}\check{S} + {\check{g}}_{d,j}\right]^{-1} &= \frac{1}{2}\left[\check{I} + \frac{1}{2}\left({\check{g}}_{d,j}\check{S}^{\dagger}{\check{g}}_{d,j}\check{S} -\check{I}\right) \right]^{-1}{\check{g}}_{d,j}, \\ &\simeq \frac{1}{2}\left[\check{I} - \frac{1}{2}\left({\check{g}}_{d,j}\check{S}^{\dagger}{\check{g}}_{d,j}\check{S} -\check{I}\right) \right]{\check{g}}_{d,j},\end{aligned}$$ and similarly for $\left[\check{S}{\check{g}}_{d,j}\check{S}^{\dagger} + {\check{g}}_{d,j}\right]^{-1}$, leading to $$\begin{aligned} {\check{g}}_{0,j}^i \simeq& \frac{1}{2}\check{I} + \frac{3}{2}{\check{g}}_{d,j}-\frac{1}{2}{\check{g}}\check{S}^{\dagger}{\check{g}}_{d,j}\check{S} - \frac{1}{2}{\check{g}}_{d,j}\check{S}^{\dagger}{\check{g}}_{d,j}\check{S}{\check{g}}_{d,j}, \\ {\check{g}}_{0,j}^o \simeq& \frac{1}{2}\check{I} + \frac{3}{2}{\check{g}}_{d,j}-\frac{1}{2}\check{S}{\check{g}}_{d,j}\check{S}^{\dagger}{\check{g}}- \frac{1}{2}{\check{g}}_{d,j}\check{S}{\check{g}}_{d,j}\check{S}^{\dagger}{\check{g}}_{d,j}.\end{aligned}$$ By performing the first order expansion in this way, we ensure that in the limit of spin independent scattering, $\check{S} = \check{I}$, we get ${\check{g}}_{0,j}^i = {\check{g}}_{0,j}^o = {\check{g}}_{d,j}$. By inserting \[eq:Sapprox\] we get $$\begin{aligned} {\check{g}}^i_{0,j}\simeq& {\check{g}}_{d,j} -\frac{1}{2}\gamma^2\left({\check{g}}-\check{I}\right)+ \frac{1}{2}i\gamma\left({\check{g}}_{d,j} - \check{I}\right)\left[\check{\zeta}_k\;,\;{\check{g}}_{d,j}\right] \nonumber\\ &-\frac{1}{2}\gamma^2{\check{g}}\check{\zeta}_k{\check{g}}\check{\zeta}_k\left({\check{g}}+ \check{I}\right), \\ {\check{g}}^o_{0,j}\simeq& {\check{g}}_{d,j} -\frac{1}{2}\gamma^2\left({\check{g}}-\check{I}\right)+ \frac{1}{2}i\gamma\left({\check{g}}_{d,j} + \check{I}\right)\left[\check{\zeta}_k\;,\;{\check{g}}_{d,j}\right] \nonumber\\ &-\frac{1}{2}\gamma^2\left({\check{g}}+ \check{I}\right)\check{\zeta}_k{\check{g}}\check{\zeta}_k{\check{g}}.\end{aligned}$$ Finally, we compute the full Green functions from \[eq:bcit1,eq:bcit2\], and find the boundary conditions from \[eq:mjb,eq:mjd\]. Note that due to the angular averaging, all odd terms in $\check{\zeta}_k = (\hat{n}_{\alpha}\times\hat{k})\cdot\check{\sigma}\check{\rho}_3$ cancel, and thus we remove them immediately. Furthermore, the spin–orbit coupling is assumed to stem from the interface, which means that $\hat{n}_{\alpha}$ is parallel to $\hat{n}$. Since only even orders of the former appears, we may set $\hat{n}_{\alpha} = \hat{n}$. The matrix current is then given as $$\begin{aligned} \sigma_1\hat{n}\cdot{\check{g}}_1\nabla{\check{g}}_1 = \int \frac{d\Omega}{2\pi}\;\frac{1}{|v_n|}\left[{\check{g}}_1\;,\;\check{\mathcal{I}}\right], \label{eq:Mcurrent}\end{aligned}$$ with $d\Omega = \sin\theta\;d\theta\;d\phi$, $v_n = v_F\cos\theta$, and $$\begin{aligned} \check{\mathcal{I}} =& w^2{\check{g}}_2 + \check{\zeta}_k\left(w_\alpha^2{\check{g}}_2 +\frac{1}{2}\gamma^2{\check{g}}_1\right)\check{\zeta}_k \nonumber \\ &+ \frac{1}{2}i\gamma w_\alpha w\left\{{\check{g}}_2\left[\check{\zeta}_k,{\check{g}}_2\right],\check{\zeta}_k\right\} \nonumber \\ &+\frac{1}{2}i\gamma w_\alpha w\left(\left\{{\check{g}}_2,\check{\zeta}_k\right\}{\check{g}}_1\check{\zeta}_k + \check{\zeta}_k{\check{g}}_1\left\{{\check{g}}_2,\check{\zeta}_k\right\}\right),\end{aligned}$$ where we have neglected terms of order $w^2\gamma^2$. From the $\phi$ integration we find that, for an arbitrary matrix $\check{M}$, $$\begin{aligned} \check{\zeta}_k\check{M}\check{\zeta}_k = \sin^2\theta\,\check{{\bm{\sigma}}}_{||}\check{M}\check{{\bm{\sigma}}}_{||},\end{aligned}$$ where $\check{{\bm{\sigma}}}_{||} = [\check{{\bm{\sigma}}} - \hat{n}\left(\hat{n}\cdot\check{{\bm{\sigma}}}\right)]\check{\rho}_3$, i.e., only spin directions parallel to the interface contribute to the boundary conditions. The $\theta$ integration of the spin independent term in \[eq:Mcurrent\] diverges. However, when $\alpha = 0$, we know that including all orders of the $T$ matrix, given in \[eq:tinterface\], yields a finite expression—namely, \[eq:nazarov\]. This means that the divergence appears when the $T$ matrix is truncated to give \[eq:tLfirst\]. The interpretation of this is that microscopic analytical expressions for the coupling constants due to $w$, $w_\alpha$, and $\gamma$ cannot be found within the present theory, and they instead become input parameters. After the $\theta$ integration we therefore get $$\begin{aligned} &\hat{n}\cdot{\check{g}}_1\nabla{\check{g}}_1 = T\left[{\check{g}}_1\;,\;{\check{g}}_2\right] + T_{\alpha}\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_2\check{{\bm{\sigma}}}_{||}\right] \nonumber \\ &+T_{\alpha}'\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_1\check{{\bm{\sigma}}}_{||}\right]+i\sqrt{T_{\alpha}''T}\left[{\check{g}}_1,\left\{{\check{g}}_2\left[\check{{\bm{\sigma}}}_{||},{\check{g}}_2\right],\check{{\bm{\sigma}}}_{||}\right\}\right]\nonumber \\ &+i\sqrt{T_{\alpha}''T}\left[{\check{g}}_1\,,\,\left\{{\check{g}}_2,\check{{\bm{\sigma}}}_{||}\right\}{\check{g}}_1\check{{\bm{\sigma}}}_{||} + \check{{\bm{\sigma}}}_{||}{\check{g}}_1\left\{{\check{g}}_2,\check{{\bm{\sigma}}}_{||}\right\}\right], \label{eq:fullbc}\end{aligned}$$ where $T_{\alpha}'' = \frac{1}{2}T_{\alpha}T_{\alpha}'$. The parameter $T$ may be identified by comparing with \[eq:KL\], and is hence given by \[eq:KLT\]. The parameter $T_\alpha$ arises from the spin-orbit coupling part ($w_\alpha)$ of the tunnelling potential in Eq. (\[eq:vsoc\]) whereas $T_\alpha'$ arises from the interfacial spin-orbit coupling ($\alpha$) giving rise to a spin-mixing angle in Eq. (\[eq:spinmixingangle\]). \[eq:fullbc\] is the main result of this paper. A special case is worth commenting on. In the absence of any tunnelling, as is the case for a superconductor interfaced by a spin-orbit coupled insulator, only $T_\alpha'$ is non-zero, whereas all other terms vanish, giving the boundary condition $$\begin{aligned} \hat{n}\cdot{\check{g}}_1\nabla{\check{g}}_1 =T_{\alpha}'\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_1\check{{\bm{\sigma}}}_{||}\right].\end{aligned}$$ This boundary condition could thus be used to look for possible bound states induced at the interface of a superconductor and a spin–orbit coupled insulator. The fact that the $T_\alpha'$ term exists despite the absence of a material to tunnel into on the other side of the interface is clear from the fact that this term only depends on $\check{g}_1$. In this sense, it may be thought of as the spin-orbit coupled equivalent of the spin-dependent phase-shift term $G_\phi$ previously discussed in the context of ferromagnetic insulators [@cottet_prb_2009; @eschrig_njp_2015]. Applications {#sec:app} ============ In the following we will apply the boundary conditions derived in \[eq:fullbc\] to a set of example problems. In particular, we will consider superconducting hybrid structures in which a non-superconducting material is proximitized to a superconductor. The boundary conditions are assumed to represent a thin intermediary layer of a material with strong spin–orbit coupling. We neglect the inverse proximity effect, in which case the superconductors are approximately described by the Bardeen-Cooper-Schrieffer (BCS) bulk Green function, $$\begin{aligned} {\check{g}}_{\text{BCS}} = \begin{pmatrix} \cosh\theta I & e^{i\phi}\sinh\theta i\sigma_y \\ e^{-i\phi}\sinh\theta i\sigma_y & \cosh\theta I\end{pmatrix}, \label{eq:gbcs}\end{aligned}$$ where $\theta = \arctan\frac{\Delta}{\varepsilon}$ for a given quasiparticle energy $\varepsilon$ and gap size $\Delta$, and $\phi$ is the superconducting phase. In other words, we solve the Usadel equation only in the non-superconducting material. We note that $\left[{\check{g}}_{\text{BCS}},\check{{\bm{\sigma}}}_{||}\right] = 0$, and hence the boundary conditions simplify to $$\begin{aligned} &\hat{n}\cdot{\check{g}}_1\nabla{\check{g}}_1 = (T+T_{\alpha})\left[{\check{g}}_1\;,\;{\check{g}}_2\right]+T_{\alpha}'\left[{\check{g}}_1\;,\;\check{{\bm{\sigma}}}_{||}{\check{g}}_1\check{{\bm{\sigma}}}_{||}\right] \nonumber \\ &+i\sqrt{T_{\alpha}''T}\left[{\check{g}}_1\,,\,\check{{\bm{\sigma}}}_{||}\left\{{\check{g}}_1,{\check{g}}_2\right\}\check{{\bm{\sigma}}}_{||}\right]. \label{eq:bcred}\end{aligned}$$ For simplicity we will in the following set $T_{\alpha} = T_{\alpha}'$. SF bilayer ---------- As a first example, we consider a bilayer consisting of a superconductor and a ferromagnet, as shown in \[fig:SF\]. The exchange field in the ferromagnet is directed at an angle $\theta$ from the plane of the interface, with a strength of $|{\bm{h}}| = 2\Delta$. In this case the Usadel equation takes the following form, $$\begin{aligned} D\nabla\cdot{\check{g}}\nabla{\check{g}}+ i\left[\varepsilon\rho_3 - {\bm{h}}\cdot\check{{\bm{\sigma}}}\;,\;{\check{g}}\right] = 0. \label{eq:husadel}\end{aligned}$$ When both spin–orbit coupling and a magnetization is present in the system, this may lead to long range spin triplet superconducting correlations. Indeed, such correlations were found in a previous work which considered a similar system [@jacobsen_prb_2015]. There, a ferromagnet with Rashba spin–orbit coupling was attached to a superconductor via conventional spin independent boundary conditions. Long range spin triplet correlations were then observed as a zero energy peak in the density of states, the size of which depended upon the angle of the exchange field, $\theta$. Here, we seek to explore whether similar results emerge when the sole contribution to the spin–orbit coupling stems from the boundary conditions. ![The investigated bilayer, consisting of a ferromagnet and a superconductor. There is assumed to be significant spin–orbit coupling at the interface between the two materials, as shown in black. The ferromagnet is modelled by an exchange field $|{\bm{h}}| = 2\Delta$, pointing in a direction $\theta$ relative to the interface.[]{data-label="fig:SF"}](SF){width="0.5\columnwidth"} To quantify the presence of long range spin triplet correlations, we compute the density of states, which is given as $$\begin{aligned} \nu({{\bm{R}}},\varepsilon) = \frac{1}{2}N_0\Re \left(g_{\uparrow\uparrow}({{\bm{R}}},\varepsilon) + g_{\downarrow\downarrow}({{\bm{R}}},\varepsilon) \right), \label{eq:dos}\end{aligned}$$ where $N_0$ is the density of states at the Fermi level, and $g_{\sigma\sigma}({{\bm{R}}},\varepsilon)$ are spin components of the normal Green function. The presence of long range spin triplets can be inferred from density of states at $\varepsilon = 0$, at which point \[eq:dos\] may be expressed in terms of the contributions from the anomalous Green function $f = \left(f_s I + {\bm{f}}_t\cdot{\bm{\sigma}}\right)i\sigma_y$. With this particular parametrization, where the scalars $f_s$ and ${\bm{f}}_t$ give the singlet and triplet parts of $f$, respectively, \[eq:dos\] takes the form $$\begin{aligned} \nu({{\bm{R}}}, 0) = 1 - \frac{1}{2}\left|f_s\right|^2 + \frac{1}{2}\left|{\bm{f}}_{||}\right|^2 + \frac{1}{2}\left|{\bm{f}}_{\perp}\right|^2. \label{eq:dos0}\end{aligned}$$ For an exchange field direction indicated by the unit vector $\hat{h}$, the triplet correlation is decomposed into a parallel, ${\bm{f}}_{||} = \left({\bm{f}}_t\cdot\hat{h}\right)\hat{h}$, and an orthogonal, ${\bm{f}}_{\perp} = {\bm{f}}_t - {\bm{f}}_{||}$, component. The motivation for this decomposition is that the spin expectation value of the triplet Cooper pairs is given as $\left\langle {\bm{S}}\right\rangle \propto i {\bm{f}}_t(\varepsilon)\times{\bm{f}}_t^*(-\varepsilon)$ [@leggett_rmp_1975; @linder_np_2015]. The triplet Cooper pairs whose spins are aligned with the exchange field, will not experience a pair breaking effect, in contrast to orthogonal spin alignments, and hence ${\bm{f}}_{||}$ and ${\bm{f}}_{\perp}$ expresses the short and long range triplet correlations, respectively. From \[eq:dos0\] it is clear that while the presence of singlet superconducting correlations causes a suppression of the density of states, triplet correlations lead to an increase, and thus a potential for the formation of a zero energy peak. ![Evidence of long range triplet superconducting correlations. a) The maximum density of states in the ferromagnet at zero energy, $\delta\nu(\theta) \equiv \nu(\varepsilon=0,{{\bm{R}}}_{\text{max}},\theta)-\nu(\varepsilon=0,{{\bm{R}}}_{\text{max}},0)$, as a function of the angle of the exchange field $\theta$ relative to the interface. The strength of the spin–orbit coupling at the interface, $T_{\alpha}$, is indicated on the figure. b) The anomalous Green function components as a function of $\theta$ at $T_{\alpha}=0.5$. $f_s$ is the singlet contribution, and ${\bm{f}}_{||}$ and ${\bm{f}}_{\perp}$ are the parallel and orthogonal parts of the triplet contribution, respectively. []{data-label="fig:SF_dos"}](SF_triplets){width="\columnwidth"} \[fig:SF\_dos\]a) shows the change in the density of states at zero energy as the exchange field is rotated away from the interface, $\delta\nu(\theta) \equiv \nu(\varepsilon=0,{{\bm{R}}}_\text{max},\theta)-\nu(\varepsilon=0,{{\bm{R}}}_{\text{max}},0)$, where ${{\bm{R}}}_{\text{max}}$ is the location at which the maximum density of states is found. A modulation of the zero energy peak is found, similar to the results of Ref. [@jacobsen_prb_2015]. At $\theta = 0$ and $\theta = \pi$, i.e., for an exchange field parallel to the interface, the $T_{\alpha}'$-dependent terms of \[eq:bcred\] do not contribute, and the boundary conditions reduces to a conventional, spin independent tunnelling barrier. As $\theta$ is increased from zero, so too is the zero energy peak of the density of states, indicating the generation of triplet Cooper pairs. However, as $\theta$ approaches $\pi/2$, a dip is found instead. These results are further elucidated in \[fig:SF\_dos\]b), which shows the angular dependence of the singlet and triplet correlations. The largest modulation is clearly seen in the long range triplets, ${\bm{f}}_{\perp}$, which is nonzero only when the exchange field has both an in-plane and an out-of-plane component with respect to the interface. In other words, it vanishes for $\theta\in\left\{0,\frac{\pi}{2},\pi\right\}$, in agreement with Ref. [@jacobsen_prb_2015]. Interestingly, it is not purely sinusoidal, but has maxima that are slightly tilted towards $\theta = \pi/2$. A small angular dependence in the singlet, $f_s$, and the short range triplet, ${\bm{f}}_{||}$, is also observed. At $\theta = \pi/2$, $f_s$ has a slight increase, whereas $|{\bm{f}}_{||}|$ decreases. This explains the reduction in the zero energy peak of the density of states at $\theta = \frac{\pi}{2}$. SFS Josephson weak link ----------------------- When two superconductors are separated by a non-superconducting material, they may form a Josephson weak link. When a phase difference $\Delta\phi$ is induced between the superconductors of such systems, for instance by applying a current bias, dissipationless charge currents will flow between them, mediated by the Cooper pairs present in the nonsuperconducting material due to the proximity effect. It is well known that when the intermediary layer consists of a ferromagnet with an inhomogeneous magnetization, long range triplet Cooper pairs may be generated, which are spin polarized, and hence may carry a dissipationless spin current. It was recently predicted that a spin current may also emerge in homogeneous ferromagnets if thin normal metal layers with strong spin–orbit coupling are added between the ferromagnet and the superconductors [@jacobsen_scirep_2016]. To achieve this, the spin–orbit coupling was introduced in thin separate layers, coupled to the surrounding layers by tunnelling barriers, within which the Usadel equation was solved. While experimental verification of these results has proven elusive [@satchell_prb_2018; @satchell_arxiv_2019], the theoretical predictions provide an excellent benchmark for the new boundary conditions, as similar results should be obtained when the spin–orbit coupling is introduced as an interface effect. To verify this, we consider the system illustrated in \[fig:SFS\]. A homogeneous exchange field is defined in the ferromagnet, with a strength of $|{\bm{h}}|$, pointing in a direction $\theta$ relative to the transversal direction of the weak link. For this system, we compute the spin supercurrent, which in equilibrium is found from the Green function as $$\begin{aligned} {\bm{I}}_s = I_{s,0}\int d\varepsilon\; \Re\text{Tr}\left[\hat{\rho}_3\hat{{\bm{\sigma}}}\left(\hat{g}\partial_x\hat{g}\right)^K\right]\tanh\frac{\beta\varepsilon}{2},\end{aligned}$$ where it has been assumed that junction is aligned along the $x$ axis, and $I_{s,0} = \frac{N_0DW}{8}$, for a given junction width $W$, and $\beta = 1/k_{\text{B}}T$, with $T$ the temperature. ![A Josephson weak link, where a ferromagnet is sandwiched between two superconductors, with spin–orbit coupling present at the interfaces. The exchange field ${\bm{h}}$ is directed at an angle $\theta$ relative to the transverse direction of the junction, and has a strength of $|{\bm{h}}| = 2\Delta$. The distance between the superconductors is assumed to be $L = 2\xi$, where $\xi$ is the superconducting coherence length.[]{data-label="fig:SFS"}](SFS){width="0.75\columnwidth"} The results are given in \[fig:sfs\_dos\], which shows the spin current component aligned parallel to the exchange field, in other words the spin current induced by the long range triplets. In \[fig:sfs\_dos\]a) its dependence on the canting angle $\theta$ is shown. It is noticed that the spin current goes to zero for $\theta = 0$ and for $\theta = \frac{\pi}{2}$. This means that an exchange field with both an in-plane and an out-of-plane component is required in order to observe an effect, similarly to the SF bilayer. In \[fig:sfs\_dos\]b) we show the dependence of the spin current on the phase difference $\Delta\phi$ between the superconductors. It is seen that the current phase relation is approximately sinusoidal, similar to the conventional Josephson effect, indicating that the charge currents have become spin polarized. Finally, we show in \[fig:sfs\_dos\]c) the maximum spin current as a function of the interface spin–orbit coupling $T_{\alpha}$. For low values of the spin–orbit coupling, the spin current has an approximately parabolic form, but reaches a plateau as $T_{\alpha}$ approaches 0.5, the maximum value investigated in this study. A possible interpretation of this is that we are nearing the edge of the domain of validity for the small angle approximation used in the derivation of the boundary conditions, which requires $T_{\alpha}$ to be small. ![The spin current component parallel to the exchange field in the SFS Josephson weak link, scaled by $I_{s,0} = N_0DW/8$. **a)** shows its variation with the canting angle $\theta$, where the strength of the interface spin–orbit coupling $T_{\alpha}$ is indicated on the figure, **b)** shows its dependence on the phase difference between the superconductors, $\Delta\phi$, and **c)** shows the maximum spin current as a function of the interface spin–orbit coupling.[]{data-label="fig:sfs_dos"}](SFS_js){width="\columnwidth"} Conclusion ========== We have derived a new set of boundary conditions for systems in which there is large spin–orbit coupling. This allows the study of, for instance, superconducting hybrid structures with thin heavy metal layers. We demonstrate the use of these boundary conditions by considering an SF bilayer and an SFS Josephson weak link. In both cases we find that whenever the exchange field of the ferromagnet has both an in-plane and an out-of-plane component, long range triplet superconductivity is induced. The findings reported herein are consistent with results found in previous works, where the spin–orbit coupling is approximated by other means. The authors are grateful to M. Eschrig for valuable input. The authors also wish to thank V. Risingg[å]{}rd, J. A. Ouassou, and J. R. Eskilt for useful discussions. J. L. acknowledges funding from the Research Council of Norway Center of Excellence Grant Number 262633, Center for Quantum Spintronics, and from the Research Council of Norway Grant No, 240806. J. L. and M. A. also acknowledge funding from the NV-faculty at the Norwegian University of Science and Technology. [999]{} J. W. Serene, and D. Rainer, Phys. Rep. **101**, 221 (1983). W. Belzig, F. K. Wilhelm, C. Bruder, G. Schön, and A. D. Zaikin, Superlatt. Microstruct. **25**, 1251 (1999). J. Rammer, and H. Smith, Rev. Mod. Phys. **58**, 323 (1986). A. A. Abrikosov, L. P. Gorkov, and I. E. Dzyaloshinski, *Methods of Quantum Field Theory in Statistical Physics* (Dover Publications, Inc. New York, 1975). G. Eilenberger, Z. Physik **214**, 195 (1968). K. D. Usadel, Phys. Rev. Lett. **25**, 507 (1970). A. V. Zaitsev, Sov. Phys. JETP **59**, 1015 (1984). K. Yip, J. Low Temp. Phys. **109**, 547 (1997). M. Eschrig, Phys. Rev. B **61**, 9061 (2000). A. Shelankov, M. Ozana, Phys. Rev. B **61**, 7077 (2000). B. Ashauer, G. Kieselmann, and D. Rainer, J. Low Temp. Phys. **63**, 349 (1986). K. Nagai, and J. Hara, J. Low Temp. Phys. **71**, 351 (1988). S. Graser, and T. Dahm, Phys. Rev. B **75**, 014507 (2007). M. Yu. Kupriyanov, and V. F. Lukichev, Zh. Eksp. Teor. Fiz. **94**, 139 (1988) \[JETP **67**, 1163 (1988)\]. Y. V. Nazarov, Superlatt. Microstruct. **25**, 1221 (1999). F. S. Bergeret, A. Verso, and A. F. Volkov, Phys. Rev. B **86**, 214516 (2012). A. Millis, D. Rainer, and J. A. Sauls, Phys. Rev. B **38**, 4504 (1988). A. Cottet, D. Huertas-Hernando, W. Belzig, and Y. V. Nazarov, Phys. Rev. B **80**, 184511 (2009). T. Tokuyasu, J. A. Sauls, and D. Rainer, Phys. Rev. B **38**, 8823 (1988). M. Eschrig, J. Kopu, J. C. Cuevas, and G. Schön, Phys. Rev. Lett. **90**, 137003 (2003). M. Fogelström, Phys. Rev. B **62**, 11812 (2000). E. Zhao, T. Löfwander, and J. A. Sauls, Phys. Rev. B **70**, 134510 (2004). J. Kopu, M. Eschrig, J. C. Cuevas, and M. Fogelström, Phys. Rev. B **69**, 094501 (2004). J. C. Cuevas, and M. Fogelström, Phys. Rev. B **64**, 104502 (2001). M. Eschrig, A. Cottet, and J. Linder, New J. Phys. **17**, 083037 (2015). A. I. Buzdin, Rev. Mod. Phys. **77**, 935 (2005). F. S. Bergeret, A. F. Volkov, and K. B. Efetov, Phys. Rev. Lett. **86**, 4096 (2001). F. S. Bergeret, A. F. Volkov, and K. B. Efetov, Rev. Mod. Phys. **77**, 1321 (2005). M. Eschrig, Rep. Prog. Phys. **78**, 104501 (2015). J. Linder, and J. W. A. Robinson, Nature Physics **11**, 307 (2015). Lev P. Gor’kov and Emmanuel I. Rashba, Phys. Rev. Lett. **87**, 037004 (2001). G. Annunziata, D. Manske, and J. Linder Phys. Rev. B **86**, 174514 (2012). F. S. Bergeret, and I. V. Tokatly, Phys. Rev. B **89**, 134517 (2014). G. Eilenberger, Z. Physik **190**, 142 (1966). A. I. Larkin, and Yu. N. Ovchinnikov, Sov. Phys. JETP, **28**, 1200 (1969). E. V. Thuneberg, J. Kurkijärvi, and D. Rainer, Phys. Rev. B **29**, 3913 (1984). L. J. Buchholtz, and D. Rainer, Z. Physik **35**, 195 (1979). A. L. Shelankov, J. Low Temp. Phys. **60**, 29 (1985). L. J. Buchholtz, J. Low Temp. Phys. **129**, 195 (2002). D. Rainer, *Recent Progress in Many Body Theories*, Vol 1 (Plenum, New York, 1988). S. H. Jacobsen, J. A. Ouassou, and J. Linder, Phys. Rev. B **92**, 024510 (2015). A. J. Leggett, Rev. Mod. Phys. **47**, 331 (1975). S. H. Jacobsen, I. Kulagina, and J. Linder, Sci. Rep. **6**, 23926 (2016). N. Satchell, and N. O. Birge, Phys. Rev. B **97**, 214509 (2018). N. Satchell, R. Loloee, and N. O. Birge, arXiv:1904.08798. | High | [
0.698162729658792,
33.25,
14.375
] |
Quote: Originally Posted by dmbfan13 Originally Posted by I'm rooted, but still stock recovery. Can I still boot to stock recovery and sideload? Also, how do I adb sideload? Can someone explain? I have somewhat of an idea, but want to make sure before I go ahead and do so. Yeah, so i just got it to start flashing. Yes, you have to be unrooted but this is pretty simple, to unroot:Go to the SuperSU app, go into the 3rd tab with all the settings, in there, there should be an option, something along the lines of "clean unroot", hit that, it should only take a minute or soIf you still see the SuperSU app once thats done, go into the play store and uninstall itYou are unrootedTo flash, plug in your phone and type in "adb reboot recovery"You'll the that little android, once you see this, press the UP volume button, then power button, then releaseScroll down to where it says apply update from adbtype in "adb sideload BLAH BLAH BLAH.zip"It should start applying. Hope this helps!CRAP. I got an error in the installation and now it won't boot. It was something along the lines of how it didn't have the intall-recovery.sh file. Someone please help! | Mid | [
0.5945945945945941,
35.75,
24.375
] |
Fixation of ankle syndesmotic injuries: comparison of tightrope fixation and syndesmotic screw fixation for accuracy of syndesmotic reduction. Ankle syndesmotic injuries are complex and require anatomic reduction and fixation to restore the normal biomechanics of the ankle joint and prevent long-term complications. The aim of this study is to compare the accuracy and maintenance of syndesmotic reduction using TightRope versus syndesmotic screw fixation. Cohort study; Level of evidence, 2. This cohort study included consecutive patients treated for ankle syndesmotic diastases between July 2007 and June 2009. Single slice axial computed tomography (CT) scans of both the ankles together were performed at the level of syndesmosis, 1 cm above the tibial plafond. A greater than 2-mm widening of syndesmosis compared with the untreated contralateral ankle was considered significant malreduction. Clinical outcomes were measured using the American Orthopaedics Foot and Ankle Society (AOFAS) and Foot and Ankle Disability Index (FADI) scores. Forty-six of 55 eligible patients participated in the study; 23 patients were in the TightRope group and 23 in the syndesmotic screw group. The average age was 42 years in the TightRope and 40 years in the syndesmotic screw group, and the mean follow-up time was 2.5 years (range, 1.5-3.5 years). The average width of normal syndesmosis was 4.03 ± 0.89 mm. In the TightRope group, the mean width of syndesmosis was 4.37 mm (SD, ±1.12 mm) (P = .30, t test) compared with 5.16 mm (SD, ±1.92 mm) in the syndesmotic screw group (P = .01, t test). Five of 23 ankles (21.7%) in the syndesmotic screw group had syndesmotic malreduction, whereas none of the TightRope group showed malreduction on CT scans (P = .04, Fisher exact test). Average time to full weightbearing was 8 weeks in the TightRope group and 9.1 weeks in the syndesmotic screw group. There was no significant difference between the TightRope and syndesmotic screw groups in mean postoperative AOFAS score (89.56 and 86.52, respectively) or FADI score (82.42 and 81.22, respectively). Regression analysis confirmed malreduction of syndesmosis as the only independent variable that affected the clinical outcome (regression coefficient, -12.39; t = -2.43; P = .02). The results of this study indicate that fixation with TightRope provides a more accurate method of syndesmotic stabilization compared with screw fixation. Syndesmotic malreduction is the most important independent predictor of clinical outcomes; therefore, care should be taken to reduce the syndesmosis accurately. | High | [
0.693823915900131,
33,
14.5625
] |
Interaction of lysine with iodic acid. A new compound in the Lys-HIO(3)-H(2)O system (where Lys = lysine), lysine-iodic acid (1/3), C(6)H(14)N(2)O(2).3HIO(3), has been discovered. Its crystals display nonlinear optical properties. They were investigated by X-ray analysis, IR spectroscopy and NQR methods. The parameters of the unit cell are a = 8.360 (2), b = 6.330 (1), c = 14.750 (3) Å, beta = 92.86 (3) degrees, D(x) = 2.87 Mg m(-3), space group P2(1), Z = 2. The three iodate groups in the structure have different roles. Interaction of lysine and iodic acid results in a compound containing a doubly protonated lysine cation and two counterions, IO(3)(-) and I(2)O(5)OH(-). | Mid | [
0.644351464435146,
38.5,
21.25
] |
While the functional role of the long head of the biceps tendon is not clearly understood, it is a well-accepted source of shoulder pain.[@bib1], [@bib2], [@bib3] The etiologies of biceps symptoms are varied and include conditions such as tendonitis, tendinosis, partial or full-thickness biceps tears, and subluxation. In addition, biceps-generated symptoms, while occasionally presenting as an isolated condition, more commonly occur concomitantly with other shoulder pathologies such as rotator cuff tears and superior labral tears. Conservative management is the preferred initial treatment for a symptomatic biceps using therapeutic interventions such as rest, activity modification, physical therapy, and nonsteroidal anti-inflammatory medications.[@bib1], [@bib2], [@bib3] Corticosteroid injections within the bicipital tendon sheath can also be used to confirm the diagnosis and as a therapeutic intervention.[@bib1] The preferred surgical treatment for proximal biceps pathology is highly debated and primarily focuses on 2 primary issues: whether or not to tenodese the biceps and, if so, what tenodesis technique to employ. Tenotomy is an accepted intervention in certain clinical situations, but cosmetic deformity, weakness, fatigue, and muscle belly cramping have been reported following tenotomy.[@bib1], [@bib2], [@bib4], [@bib5] While the tendon will frequently remain entrapped within the bicipital groove following tenotomy, the "Popeye sign" has been reported in up to 70% of patients, with fatigue occurring in 38% and biceps cramping in 8%.[@bib1] Many techniques have been described to perform open and arthroscopic biceps tenodesis.[@bib1], [@bib2], [@bib3], [@bib4], [@bib5], [@bib6], [@bib7], [@bib8], [@bib9], [@bib10], [@bib11], [@bib12] Published studies comparing open subpectoral with arthroscopic tenodesis have shown mixed results.[@bib13], [@bib14], [@bib15] However, a recent systematic review[@bib3] demonstrated no significant differences when techniques were compared. Even for surgeons who prefer open subpectoral tenodesis, the described technique for identification and exposure of the proximal biceps tendon can still offer potential benefits as it facilitates both visual assessment of the entire course of the biceps and subsequent externalization of the biceps tendon by allowing for release of biceps adhesions within the groove. Many arthroscopic bony tenodesis techniques require exposure of the extra-articular portion of the biceps tendon within the bicipital groove.[@bib11], [@bib12] Alternatively, an open, subpectoral tenodesis technique can be used.[@bib1], [@bib2], [@bib3], [@bib6], [@bib13], [@bib15] Proponents of the open subpectoral technique argue that it eliminates the risk of residual tenosynovitis by completely removing the tendon from the biceps groove. Reported complications using this open subpectoral technique, however, include infection, nerve injury, and fracture.[@bib2], [@bib13] When arthroscopic visualization of the biceps tendon within the bicipital groove is to be accomplished for either diagnostic or therapeutic purposes, such as when arthroscopic suprapectoral tenodesis is planned, localization of this more distal portion of the biceps tendon can often be difficult to achieve due to the overlying transverse humeral ligament that obscures the anatomic location of the bicipital groove. A reliable, efficient, and reproducible technique that facilitates identification of the bicipital groove and the tendon within it is described. Surgical Technique {#sec1} ================== This technique can be employed in either the beach chair or lateral position. The authors preferred position is beach chair due to the ease at which the arm can be manipulated; no changes in technique are made when this procedure is performed in the lateral position. A standard posterior glenohumeral joint viewing portal is created initially, and a 30° arthroscope is used throughout the case. Next, a standard anterosuperior working portal that is centered within the rotator interval is made. A thorough diagnostic arthroscopy is then completed. The biceps tendon is carefully evaluated by probing the superior labrum and proximal origin of the biceps tendon and by palpating the biceps tendon. Also, as much of the biceps tendon as possible is pulled into the glenohumeral joint using this probe in an effort to assess the tendon for fraying, tearing, synovial reaction, and instability. If the entire proximal biceps tendon requires visualization, either due to concern about pathology within the more distal portion of the biceps tendon that cannot be visualized by pulling the tendon into the glenohumeral joint or when a suprapectoral tenodesis is planned, the authors\' "slit" technique is routinely employed ([Table 1](#tbl1){ref-type="table"}). This technique simply and reliably exposes the location and vertical orientation of the bicipital groove while still allowing the arthroscope to remain within the glenohumeral joint using standard arthroscopic equipment ([Table 2](#tbl2){ref-type="table"}). First, an 18 gauge spinal needle is inserted into the anterior shoulder approximately 3 cm lateral to the previously placed anterosuperior portal cannula and advanced until the spinal needle is arthroscopically identified within the bicipital groove at the location where the biceps exits the glenohumeral joint ([Fig 1](#fig1){ref-type="fig"}). This spinal needle location and trajectory are then used as a guide to allow the surgeon to direct a percutaneously placed standard knife handle loaded with a no. 11 scalpel blade through the skin and then advanced through the anterior soft tissues in a parallel path until the tip of the scalpel blade is identified as it perforates the proximal aspect of the transverse humeral ligament overlying the bicipital groove ([Fig 2](#fig2){ref-type="fig"}). This scalpel blade is then directed distally, while viewing arthroscopically from the posterior portal, following the course of the biceps tendon to create a split or slit in the transverse humeral ligament. In addition, care is taken to avoid damage to the biceps tendon as this slit is created and enlarged. Slight forward flexion of the shoulder can sometimes improve visualization within the biceps groove as the incision proceeds more distally. Typically, 2 to 3 cm of the overlying transverse humeral ligament is easily incised ([Fig 3](#fig3){ref-type="fig"}). Care should be taken to minimize iatrogenic damage to the underlying biceps tendon as the slit is extended. This incision in the transverse humeral ligament will then be easily and reliably identified arthroscopically once the arthroscope is subsequently redirected into the subacromial space.Fig 1An 18 gauge spinal needle (white arrow) is seen percutaneously localizing the biceps tendon (BT) in this left shoulder in the beach chair position as viewed from the posterior portal. This spinal needle penetrates the most proximal aspect of the tissue overlying tendon as it enters the bicipital groove. (HH, humeral head; SS, supraspinatus; SubS, subscapularis.)Fig 2The tip of the no. 11 scalpel blade (white arrow) is advanced through the tissue overlying the proximal aspect of the bicipital groove in a left shoulder in the beach chair position as viewed from the posterior portal. (BT, biceps tendon; HH, humeral head; SS, supraspinatus.)Fig 3The incised tissue or slit (white arrow) in the proximal aspect of the transverse humeral ligament overlying the bicipital groove is seen in a left shoulder in the beach chair position as viewed from the posterior portal. (BT, biceps tendon; RC, rotator cuff.)Table 1Basic Steps of the Slit Technique1.An 18 gauge spinal needle localizes biceps in rotator interval viewing from glenohumeral space.2.A no. 11 blade follows needle trajectory to release the intra-articular portion of sheath and create the initial slit.3.Partial release of biceps tendon with arthroscopic scissors.4.Locate the slit in the subacromial space.5.Release extra-articular portion of biceps sheath with no. 11 blade viewing from lateral portal.6.Now is it possible to further evaluate biceps and address any pathology.Table 2Equipment Necessary for Technique1.An 18 gauge spinal needle any brand2.A no. 11 scalpel blade any brand3.Arthroscopic suture scissors, any brand4.Arthroscopic probe, any brand5.Arthroscopic grasper, any brand6.Suture anchor or alternative biceps tenodesis device (double loaded 4.5 mm Smith and Nephew Healicoil Regenabsorb anchors used in this case) When arthroscopic suprapectoral biceps tenodesis is to be carried out, the authors generally employ suture anchor fixation by impacting a suture anchor into the bicipital groove while viewing from the subacromial space. However, prior to transferring the arthroscope to the subacromial space, the most proximal aspect of the biceps tendon is released from its origin except for a very small, residual portion of the biceps tendon that is left intact ([Fig 4](#fig4){ref-type="fig"}) until the suture anchor sutures are passed through the biceps tendon and tied. Following arthroscopic knot tying, detachment of this small residual intact portion of the biceps tendon is completed, often with a gentle distal tug on the tendon using a standard arthroscopic grasper. These few fibers of the proximal biceps are intentionally left intact by the authors so as to preserve anatomic biceps length until the tenodesis is completed.Fig 4The proximal biceps tendon (BT) is nearly, but not completely, released prior to biceps tenodesis as seen in a left shoulder in the beach chair position viewing from the posterior portal. Leaving a very limited amount of residual tendinous tissue intact (white arrow) ensures that the anatomic length of the biceps is preserved during tenodesis using a suture anchor technique at the bicipital groove. Following completion of the tenodesis, the remaining tendon is then freed usually by simply tugging on the biceps. (GL, glenoid/labrum; HH, humeral head; \*arthroscopic suture scissors.) Following the completion of this partial release of the proximal biceps tendon, the arthroscope is then transferred to the standard posterior subacromial portal site. Next, a lateral subacromial working portal is created and used to accomplish a thorough subacromial bursectomy. The arthroscope is then moved to this lateral subacromial portal site, and, with slight external rotation of the glenohumeral joint, the previously placed slit incision the transverse humeral ligament along with the exposed biceps tendon can be clearly visualized ([Fig 5](#fig5){ref-type="fig"}). The no. 11 blade scalpel ([Fig 6](#fig6){ref-type="fig"}) or an arthroscopic shaver blade can then be used to incise the more distal portion of the transverse humeral ligament and other tissue overlying the biceps tendon so as to expose along the length of the biceps. A probe can then be used to manipulate the biceps and further assess it for synovial reaction, fraying, or partial tearing ([Fig 7](#fig7){ref-type="fig"}).Fig 5The slit (black arrow) is easily located while viewing from the lateral portal in the subacromial space after a standard bursectomy is performed in a left shoulder in the beach chair position. (DF, deltoid fascia; SS, supraspinatus.)Fig 6While viewing from the lateral portal in the subacromial space in a left shoulder in the beach chair position, the no. 11 blade (white arrow) is used to incise the more distal tissue overlying the biceps (\*) until the tendon is completely unroofed and exposed. (DF, deltoid fascia, SS, supraspinatus.)Fig 7Visualizing and probing (\*) the entire biceps tendon (BT) is carried out after the incision of the tissue overlying the biceps is completed. Note the significant fraying (white arrow) of the very distal aspect of the biceps tendon that was not able to be identified when visualized intra-articularly. This image is taken of a left shoulder in the beach chair position while viewing from the lateral portal in the subacromial space. (DF, deltoid fascia.) Once the biceps tendon has been thoroughly evaluated, the surgeon can then proceed with suprapectoral tenodesis using the fixation method of choice. Again, the authors\' preferred tenodesis technique uses a double- or triple-loaded suture anchor (4.5 mm Healicoil Regenesorb; Smith & Nephew, Andover, MD) inserted into the bicipital groove followed by passage of these sutures through the biceps tendon using a locking-loop construct ([Fig 8](#fig8){ref-type="fig"}).Fig 8This image is taken of a left shoulder in the beach chair position while viewing from the lateral portal in the subacromial space. The suture anchor sutures have been passed, but not yet tied, in a locking-loop pattern (\*). Note that biceps tendon (BT) length and tension are maintained during this suture passage phase. (SS, supraspinatus.) Discussion {#sec2} ========== Visualization of the entire biceps is often necessary when biceps tendon pathology is suspected and when an arthroscopic tenodesis is to be carried out. This previously described slit technique for localization and visualization of the biceps tendon along its extra-articular course within the bicipital groove has proved itself reliable, technically easy, reproducible, safe, and efficient. This slit technique does offer several potential advantages compared with other techniques designed to identify the location and orientation of the bicipital groove ([Table 3](#tbl3){ref-type="table"}). While other described techniques, such as using a marking suture (or spinal needle left in place within the bicipital groove) to mark the subacromial location of the bicipital groove, do effectively allow for identification of the most proximal location of the biceps groove, only the slit technique also clearly exposes the orientation and course of the groove. The authors have often found that if a marking suture or spinal needle is employed to localize the most proximal aspect of the biceps groove, unnecessary iatrogenic damage can sometimes be caused as we attempt to find the course of the bicipital groove more distally due to the limited information that this single point of reference provides the surgeon. This necessitates that the surgeon make an "educated guess" and incise tissue distal to this marking suture that he or she hopes will actually be overlying the biceps tendon. If our "best guess" is incorrect, unnecessary iatrogenic injury is created. This best-guess approach to identifying the course of the bicipital groove is obviated by the slit technique since biceps tendon direction and orientation have already been clearly identified under direct arthroscopic visualization at the time that the slit is made. In addition, if biceps tenodesis is planned, the accessory portal incision that was created by percutaneously advancing the knife effectively serves as a valuable viewing and/or suture management access site. Finally, complete exposure of the biceps tendon within its groove may reveal additional tenosynovitis or even partial biceps tendon tearing. Complete exposure of the biceps is important since research has shown that extensive release of the biceps tendon, carried out at the time of tenodesis has been associated with lower revision rates.[@bib14]Table 3Advantages and Disadvantages of Slit TechniqueAdvantagesDisadvantages1. Easily locates biceps tendon in groove while also giving orientation and course using standard equipment.1. Risk of iatrogenic damage to biceps or surrounding structures when percutaneously inserting the no. 11 scalpel blade.2. The percutaneous accessory portal made to perform the slit technique is beneficial for viewing, anchor placement, and suture management if tenodesis is being performed.2. Scalpel blade could potentially become dislodged from the knife handle.3. Allows accurate, nontraumatic release of tendon sheath for evaluation of extra-articular portion of biceps in cases with no obvious intra-articular pathology.4. Has a short learning curve and does not require specialized equipment. The described slit technique has a few potential disadvantages. While the learning curve is relatively short as it uses surgical skills common to arthroscopic surgeons, there is risk of iatrogenic injury to the biceps tendon due to the close proximity of the scalpel blade when incising the tissue overlying the biceps ([Table 4](#tbl4){ref-type="table"}). Furthermore, there is potential risk that the knife could be misdirected during its percutaneous advancement toward the bicipital groove, which could result in inadvertent injury to adjacent soft tissues or even potentially neurovascular structures. Finally, while the authors have not experienced this potential complication, the scalpel blade could become disengaged from the knife handle, resulting in a sharp, foreign object free within the shoulder soft tissues or joint.Table 4Pearls and Pitfalls of Slit TechniquePearlsPitfalls1. Near complete sectioning of the biceps from its attachment on the superior labrum helps keep accurate tension when preforming tenodesis.1. Not accurately following the path of a well-placed spinal needle with the scalpel can cause iatrogenic damage to surrounding structures.2. Accurate trajectory of the spinal needle in all planes is key for both creating a good slit and for having a functioning accessory portal.2. Care should be taken not to overpenetrate with the scalpel when creating the slit to avoid damaging the underlying tendon.3. Slight forward flexion of the arm can help visualization while extending the slit distally when viewing from the joint in the posterior portal. Supplementary Data {#appsec1} ================== ICMJE Author Disclosure FormsVideo 1The video begins in the left shoulder in the beach chair position with a 30° arthroscope viewing the biceps tendon from the posterior portal. The biceps is then evaluated with the probe from the anterior portal to evaluate it for intra-articular pathology and instability. A no. 11 scalpel blade is introduced into the shoulder above the biceps tendon to create a slit in the transverse humeral ligament along the long axis of the biceps tendon, taking care not to damage the tendon. An arthroscopic scissors is used from the anterior portal to release all but a sliver of the biceps tendon from its origin. The video then moves into the subacromial space as viewed from the lateral portal with a 30° arthroscope. The slit is then identified in the subacromial space, and a no. 11 scalpel blade is used to extend the slit along the biceps groove. Further evaluation of the biceps tendon is then performed with a probe revealing the extensive damage to the biceps tendon not able to be appreciated intra-articularly. Next the locking-loop construct is created around the biceps tendon after preparing the groove and placing a suture anchor. An arthroscopic grasper is used to pull free the remaining biceps tendon from its origin. An arthroscopic probe then evaluates the biceps tenodesis after the sutures are tied. The authors report the following potential conflicts of interest or sources of funding: L.D.F. receives support from AANA, Smith and Nephew, Arthrex, and Mitek. Full ICMJE author disclosure forms are available for this article online, as [supplementary material](#appsec1){ref-type="sec"}. | Mid | [
0.563084112149532,
30.125,
23.375
] |
Depression, Wounds & New Beginnings Long time no see loves! How are you all doing? Can you believe that it’s already September? 3 more months to the end of 2018, so make the most of it honey! Since I am trying to make the most of mine, I finally decided to cut the excuses and give the blog a slight but much needed face-lift(mostly on the header & in the menu). Thank you for bearing with me despite my inconsistency. Moving forward, there will be a new post every Wednesday/Friday so stay tuned! 🙂 One of my favorite bloggers happens to be Jackson Biko and I have spent some time reading his blog, particularly after I finished his book, Drunk, which left me with a serious hangover (no pun intended)! I read quite a number of his posts back-to-back but one specific post stood out for me. Not because it is the best of his work but because of the hard truths he talks about from the first hand perspective of his interviewee, a man who has been through IT. A man who hit rock bottom but still managed to rise. Biko’s work and the stories he shares are the kind that make you take a step back, rethink and reassess life. They make you reflect and peel off different layers of yourself, one at a time, to reveal a more grateful you. In that specific post, the interviewee talks about his battle with sex addiction and depression. From being molested as a child to losing his son and wanting to take his own life. He talks about the struggles he fought and how they led him to dig deeper into who he was and what he had become in order for him to understand where those struggles rooted from. He reveals how he uncovered those roots and started chopping them off, one at a time. At 40, he talks about mental illness and how people like him who seem strong and successful suffer in silence because they are too afraid or embarrassed to seek help. You cannot heal what you do not reveal. His story reminded me a lot of someone I know, someone who believes that he must be a “man”, that he must be tough and strong, even when he is eye to eye with loss and pain. That he cannot suffer from depression or addiction and that if he does, then he is weak. A man who battles with his demons everyday but finds means to silence them, and more often than not, the said means are destructive. A man who seems to believe that he is the only one going through it, not knowing that there are more people like him who managed to come out on the other side. Please read that post if you haven’t yet and you can thank me later! 🙂 I gave the blog a face-lift, not just for it to look good and have more content, but also for it to be a platform where we learn to care for ourselves, where we uncover our wounds and clean them up, where we can be our true and authentic selves—living vicariously through no one. I hope you choose to stick around and enjoy this new journey with me. 🙂 | Mid | [
0.6502463054187191,
33,
17.75
] |
Pages Wednesday, March 02, 2016 Super Tuesday, But It's Still "A House Divided" Hillary Clinton and Donald Trump were the big winners of the 11 state "Super Tuesday" primary election yesterday. Ted Cruz won Texas, his home state, and Oklahoma. Votes continued to be counted overnight in 11 states. This is a real time live vote count for each state provided by the New York Times. The Washington Times is reporting nearly all primary election voter turnout records are being shattered. However, America is deeply divided. Perhaps even more so, the Christian church is deeply divided over this election. On June 16, 1858, 1,000 Republican delegates gathered in the Illinois state house. At 5 PM they chose Abraham Lincoln as their candidate for the US Senate. At 8 PM, Lincoln gave a speech titled, "A House Divided Against Itself Cannot Stand." Lincoln's friends felt the speech was a mistake, while opponent Democrat Stephen A. Douglass openly mocked the speech and ultimately won the seat in the Senate. Pastor Dr. Robert Jeffress and well known Christian Author and Pastor Max Lacado are weighing in on the election of 2016---and candidate Trump---with very different views. “A house divided against itself cannot stand. I believe this government cannot endure, permanently half slave and half free. I do not expect the Union to be dissolved — I do not expect the house to fall — but I do expect it will cease to be divided. It will become all one thing or all the other.” Lincoln, of course, was reflecting on the words of Jesus recorded in Matthew, Mark and Luke. However, his closest friends told him the speech was "too radical for the occasion"---his law partner William H. Herndon told him the speech was "courageous" but politically incorrect. Reviewing the speech with Lincoln before he delivered it, Herndon tried to convince Lincoln to modify it---tone it down. Lincoln said, "I can't." Democrat Douglass used the speech to politically batter Lincoln, even suggesting Lincoln didn't favor a united country. Douglass won the Senate seat. Years later, Herndon reflected and said at least the speech awakened some of the people and it probably, ultimately made Lincoln president. Another colleague, Leonard Swett, said it was the "speech" not Lincoln's lack of ability that defeated him in the Senate race. In 1866, Swett wrote a letter to Herndon saying, "Nothing could have been more unfortunate or inappropriate; it was saying first the wrong thing, yet he saw it as an abstract truth, but standing by the speech would ultimately find him in the right place." Lincoln, our 16th President, profoundly led and restored America in regard to slavery---ultimately giving his life because of what he believed to be true. Dr. Robert Jeffress is pastor of mega First Baptist Church in Dallas, Texas. Some consider the 15,000 member church a kind of "mother" church within the Southern Baptist Convention. Pastor and best selling Christian author Max Lucado is well known to most within the Christian community. Both love God. Both influence millions through books and sermons on television. Each have a very different view on the election of 2016. Dr. Robert Jeffress: Jeffress got a lot of attention when he participated in a Trump rally in late January. He has appeared with Trump since, including this past Friday. Monday on the American Family Radio network, Jeffress was asked about it. He said, "Evangelicals are flocking to Trump by the droves" because polls indicate there's not much support nationally for a born again Christian to be elected---obviously referring to Huckabee, Carson, Cruz and probably Rubio. He said electability should now take center stage. On AFR, Jeffress summarized his comments at the Trump rally: "I had been asked to come there and pray. I'm happy to pray. I prayed II Chronicles 7:14 to the crowd there, but then Trump invited me unexpectedly to come up and talk about some things. So I thought, well, here's my opportunity to talk about the values that are important to evangelical voters---and I talked about the importance of the sanctity of life. I said very clearly: 'Now some people may not believe Donald Trump's conversion to pro-life; but even if you believe it, let me remind you that Hillary Clinton doesn't even claim a pro-life conversion---and if she's elected, we'll have the most pro-abortion candidate in history.'" Pastor Jeffress then explained his recent comments on National Public Radio that were taken by many evangelicals to be in support of Trump. He said, "I was trying to explain why so many evangelicals are open to Donald Trump. I'm not saying that's the way I think it should be....I was not agreeing with that position." Pastor Jeffress said, "After the same-sex ruling last June, I think it was such a gut punch to many evangelicals that they pretty much gave up on the idea of depending on government to uphold biblical values and they're saying, 'Okay lets let the church do that and let's just depend upon government to do the other.'" He said, "Let me make it clear. I'm not saying that's what I think; I'm saying that is the explanation of why evangelicals by the droves are going to Donald Trump." The pastor says there's a real difference between the way things are verses the way things should be. And he says he thinks it's important to vote for a candidate who will uphold things that we believe in. He also says that the marriage issue is apparently gone---it's not going to be re-litigated. He says Ted Cruz told donors at a private fund raiser in New York that unfortunately he believes we have lost the marriage issue. Jeffress says we are at war on many levels and we need someone who can win a war---much like George Patton did even though his tone and language was not great. In his opinion, Trump is the most electable of the Republican candidates. Dr. Jeffress says, "Look, I would love to have a born-again Christian who has humbled himself before God and whose faith is part of every area of his life---if he could get elected. I'm saying I don't think that candidate can get elected today." The pastor says, speaking to the church, "disagree with me" if you must---"But nobody has the right to be a Pharisee and try to impose their opinion as an obligation on other people. I think we need to respect the right of other Christians to disagree." Best selling author and Pastor Max Lucado: Max wrote an opinion for The Christian Post a few days ago expressing concern that evangelicals are voting for Donald Trump. He says as he evaluated the guys who would date his daughters, he had certain criteria---none the least was decency. He says, "Decency mattered to me as a dad." And "Decency matters to you." "The leading candidate to be the next leader of the free world not pass my decency test," he says. Lucado says he doesn't know Trump, but he is chagrined at his antics. "He ridicules a war hero. He made mockery of a reporter's menstrual cycle. He made fun of a disabled reporter. He referred to a former First Lady, Barbara Bush, as "mommy" and belittled Jeb Bush for bringing her on the campaign trail. He routinely calls people stupid, loser and dummy. He says these remarks were not back stage, but in front of people." Lucado says these indecencies are completely unacceptable, "And to do so while brandishing a Bible and boasting of Christian faith"...I'm bewildered, both by his behavior and the public's support of it." Lucado says he feels like one man who said, "We are voting with our middle finger." He says, "Anger fueled reactions have caused trouble ever since Cain was angry at Abel." Pastor Max Lucado and Pastor Robert Jeffress disagree as to how Christians should vote in this election. One thing they both agree upon is the need for God's guidance at this crucial time in America. One thing we all agree upon is that our country is deeply divided and we must hear from God---and He must hear from us as we humbly confess our sins and ask Him to heal our land. Abraham Lincoln said, "A house divided against itself cannot stand"...I believe government cannot endure, permanently half slave and half free"... "I do not expect the Union to be dissolved---I do not expect the house to fall---but I do expect it will cease to be divided." He reminded his colleagues of their previous "impulse of resistance to a common danger" ---"Of strange, discordant, and even, hostile elements, we gathered from the four winds, and formed and fought the battle through, under the constant hot fire of a disciplined, proud and pampered enemy." "Did we brave all then to falter now?" he asked. And finally Lincoln may have spoken to us all as he spoke to them: "The result is not doubtful. We shall not fail---if we stand firm, we shall not fail." This is a time in history when Christians must stand firm by kneeling and shout by listening and being led by God's Spirit. The steps of the righteous are ordered of the Lord. He will lead us in this matter. Be Discerning. Be Prayerful. 4 comments: Proverbs 21:1In the Lord’s hand the king’s heart is a stream of water that he channels toward all who please him. No matter who we elect, even a current leader, God can lead that person to do right by us IF we have humbled ourselves and prayed mightily for His help. This seems like complacency. It matters a great deal who we elect. The problem here is the big IF, yes the Bible is a story of God doing amazing things when people humble themselves. Now, how do you propose to get and entire Nation on its knees when saying it doesn't matter who we elect? Complacency can never be part of a Christian's attitude. "G-d can lead that person to do right by us IF we have humbled ourselves and prayed mightily for His help" Mat 17:17 Then Jesus answered and said, O faithless and perverse generation, how long shall I be with you? how long shall I suffer you? bring him hither to me. Isa 55:9 For as the heavens are higher than the earth, so are my ways higher than your ways, and my thoughts than your thoughts. Joh 12:32 And I, if I be lifted up from the earth, will draw all men unto me. 2Pe 3:9 The Lord is not slack concerning his promise, as some men count slackness; but is longsuffering to us-ward, not willing that any should perish, but that all should come to repentance. Mat 6:10 Thy kingdom come. Thy will be done in earth, as it is in heaven. Mat 16:24 Then said Jesus unto his disciples, If any man will come after me, let him deny himself, and take up his cross, and follow me. Luk 12:32 Fear not, little flock; for it is your Father's good pleasure to give you the kingdom. | Mid | [
0.5504587155963301,
30,
24.5
] |
Introduction ============ The death of photoreceptors in retinal degenerative diseases, such as retinitis pigmentosa, results in vision loss and blindness. A new strategy for treating such retinal degeneration morbidity involves restoring light sensitivity in the retina by expression of microbial rhodopsins, such as channelopsin-2 (Chop2), in surviving inner retinal neurons \[[@r1]\]. Channelrhodopsin-2 (ChR2, Chop2 with attached chromophore) is a directly light-gated nonselective cation channel \[[@r2]\]. Viral-based gene transfer is a promising tool for the delivery of transgenes to nondividing mammalian neurons. Following intravitreal injection of recombinant adeno-associated virus serotype 2, ChR2 expression is predominately observed in the retinal ganglion cell and inner plexiform layers, with additional expression in amacrine and horizontal cells, as well as in the optic nerve \[[@r1],[@r3],[@r4]\]. ChR2-mediated light sensitivity in a homozygous rd1 (*rd1/rd1)* mouse, a mouse model of retinal degeneration, has been shown in vitro through electrophysiological recording and in vivo with visual evoked potential recordings \[[@r1],[@r5]\] and visual behavioral testing \[[@r6],[@r7]\]. For further refining this treatment approach, the development of a noninvasive method to detect the ChR2-mediated activity in the retina in vivo would be desirable for correlation of expression patterns of ChR2 and retinal function. At present, the only noninvasive method available for measuring regional retinal ion regulation in vivo is manganese-enhanced magnetic resonance imaging (MEMRI) \[[@r8]--[@r12]\]. In biologic systems manganese is known to behave like calcium ions, which are allowed to enter cells through calcium pathways, such as voltage-gated calcium channels \[[@r13],[@r14]\] and *N*-methyl-D-aspartate receptor \[[@r15]\]. After systemic injection of a modest and nontoxic amount of MnCl~2~, manganese is a surrogate biomarker of normal and diseased retinal function \[[@r8]--[@r12]\]. ChR2 channels have been shown to be permeable for calcium ions \[[@r2]\]. However, the applicability of using MEMRI to investigate ChR2-induced activity has not been examined. In this study we test the hypothesis that in a retinal degeneration model (*rd1/rd1* mouse), inner retinal uptake of manganese, measured noninvasively with MEMRI, is a functional biomarker of ChR2-mediated activity in vivo. Methods ======= Animals and viral injection --------------------------- All of the animal experiments and procedures were approved by the Institutional Animal Care and Use Committee at Wayne State University and were performed in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals. The MEMRI experiments were initially performed using a 4.7T MRI system (Bruker Avance, Billerica, MA) to measure intraretinal signal intensities. When a new 7T system (Bruker Avance) became available, we also performed additional experiments to take advantage of the relatively improved signal-to-noise ratio to measure the spin-lattice relaxation time (T~1~), a parameter whose inverse is more directly related to retinal manganese level than signal intensity \[[@r16]\]. Three-month-old *rd1/rd1* mice (purchased from the Jackson Laboratory, Bar Harbor, ME) received either no intravitreal injection ("uninjected," negative control, n=3 \[dark\], n=3 \[bright blue light\]), an intravitreal injection of saline vehicle ("saline," negative control, n=3 \[dark\], n=3 \[bright blue light\]), or an intravitreal injection of a recombinant adeno-associated virus serotype 2/2 vector carrying a fusion construct of channelopsin-2 (Chop2) and green fluorescent protein (GFP) under a hybrid cytomegalovirus early enhancer and chicken β-actin (CAG) promoter (n=6 \[dark\], n=6 \[bright blue light\]) \[[@r1]\]. These groups were studied on the 4.7T system (see below). A smaller subset of animals (n=4, bright blue light \[one eye Chop2-GFP, the other uninjected\]) were also investigated on the 7T system (see below). Viral vectors were packaged and affinity purified by the Gene Therapy Program at the University of Pennsylvania. The intravitreal injection procedure has been previously described \[[@r2]\]. Briefly, a subset of 3-month-old mice (C3H/HeJ or *rd1/rd1*) was anesthetized by intraperitoneal injection of a mixture of ketamine (120 mg/kg) and xylazine (15 mg/kg). Under a dissecting microscope, a small perforation was made in the temporal sclera region with a needle. The solution (saline or viral vector suspension in saline \[6×10^12^ genome copies (GC)/ml, 1 μl total volume\]) was injected into the intravitreal space through the hole with a Hamilton syringe. In some cases, injections were performed in both eyes. All virus-injected and control (uninjected and saline injected) mice were housed in normal 12-h-cycled laboratory lighting. High-resolution magnetic resonance imaging experiments ------------------------------------------------------ In all cases MEMRI measurements were performed 2 months after intravitreal injection. Before the MEMRI measurement, MnCl~2~ (Sigma, St. Louis, MO) was injected intraperitoneally (ip; 66 mg/kg) on the right side of each awake mouse \[[@r12]\]; mice were maintained in either dark or continuous bright blue light for 4 h. The bright blue light for the first group was generated by high-power light-emitting diodes (LEDs; LXHL-FR5C; Lumileds Lighting, San Jose, CA) with a peak wavelength of 455 nm and light intensity of 1.2×10^16^ photons cm^−2^ s^−1^; these were mounted at the top the animal cage. Before light exposure, atropine (1%; Bausch and Lomb, Tampa, FL) was applied to the cornea of all animals to dilate the pupils. MEMRI examination was performed on a 4.7T Bruker Avance system to assess manganese uptake horizontally around the optic nerve head. The 7T Bruker Clinscan was used to evaluate the vertical distribution of manganese through the retina. Immediately before each MRI experiment, mice were anesthetized using urethane (36% solution, ip, 0.083 ml/20 g animal weight, prepared fresh daily; Aldrich, Milwaukee, WI). To maintain each mouse\'s core temperature, a recirculating warm water blanket was used; rectal temperatures were monitored in the magnet using a fiberoptic thermometer (Luxtron, Santa Clara, CA) \[[@r17]\]. In most mice, left and right eyes were separately examined using a 1.0-cm diameter coil. On the 4.7T, we used an adiabatic pulse sequence \[[@r18]\] to collect a single transverse slice that was positioned in the middle of the lens and middle of the optic nerve (i.e., through the center of the eye). High-resolution images were acquired using an adiabatic spin-echo imaging sequence (repetition time \[TR\] 350 s, echo time \[TE\] 16.7 ms, number of acquisitions \[NA\] 16, matrix size 256×512, slice thickness 620 μm, field of view 12×12 mm^2^, 27 min/image) \[[@r18]\]. These conditions provided 23.4 μm intraretinal resolution near the optic nerve head. On the 7T, a body coil transmission/surface coil reception arrangement was used. After positioning a medial slice (as above), partial saturation T~1~ data were acquired (TE 13, matrix size 160×320, slice thickness 600 μm, field of view 7×7 mm^2^). At each TR, several single images (in parentheses) were acquired in the following order: TR 0.15 s (6), 3.5 s (1), 1.0 s (2), 1.9 s (1), 0.35 s (4), 2.7 s (1), 0.25 s (5), 0.5 s (3). The virus-injected eye was scanned first in two of the four animals studied on the 7T system. Magnetic resonance imaging data analysis ---------------------------------------- ### 4.7T data Retinal and optic nerve (in a small region-of-interest immediately posterior to the retina) signal intensities were normalized to the signal intensity of the same extraocular muscle in each animal to minimize differences in systemic manganese handling. Note that the data collection was optimized for retinal acquisition and not optic nerve acquisition. In some cases, an oblique slice prevented observing and thus prevented analyzing the optic nerve so that the number of eyes used in the optic nerve analysis was somewhat smaller than that for the retinal analysis. The muscle intensities were measured from a fixed-size region-of-interest drawn in the anterior-most aspect of the inferior rectus muscle. For visualization and comparison purposes, in-house written software was used to map the in situ image into a linear representation for each retina. First, the vitreoretinal border and optic nerve were manually defined. A high-order polynomial was fit to the vitreoretinal border. Retinal data was oversampled along lines perpendicular to the polynomial, and reconstructed into the linearized image, with the optic nerve head as its origin \[[@r19]\]. Within each group, linearized retinas were averaged into a composite image. For quantitative analysis, signal intensities were analyzed using the program NIH IMAGE and derived macros. Vertically, retinal signal intensity data were extracted at 3 pixels posterior to the clearly defined vitreoretinal division (approximately at the level of the inner nuclear layer \[INL\]). This location was chosen based on our previous work in nondegenerated retinas, the inner retina of the *rd1/rd1* mice in this study which has normal thickness, and results from 7T vertical mapping. Horizontally, pixels were extracted between 0.4 and 1 mm on either side of the optic nerve (i.e., superior and inferior retina) and were analyzed. Intraretinal signal intensity was analyzed using [IMAGE](http://rsb.info.nih.gov/nih-image/) (a public domain image processing and analysis program) and derived macros. We controlled for changes in receiver gain differences between animals by normalizing the signal intensity of a fixed region of noise in each rat to a fixed value. Other tissues within the sensitive volume of the coil demonstrated enhancement after manganese injection and thus were considered inadequate as internal references. Inner and outer signal intensity data were extracted and analyzed \[[@r12]\]. Initial efforts to compare the 4.7T data of vertical manganese distribution to the distribution of Chop2-GFP expression ex vivo was limited by an apparent homogenous signal from the entire retina (data not shown). Since the combination of higher magnetic field and T~1~ mapping can provide spatial clarity over a signal intensity analysis \[[@r20]\], T~1~ studies were performed on the 7T system using a small subset of conditions in a paired-eye design (see above). ### 7T data Single images acquired with the same TR were registered (rigid body), then averaged. These averaged images were then registered across TRs, and retinas were linearized as before \[[@r19]\]. Using the linearized data, 1/T~1~ maps were generated by fitting a three-parameter T~1~ equation (y=a + b\[exp(-cTR)\], where a, b, and c are fitted parameters) on a pixel-by-pixel basis using R (v.2.9.0, R Development Core Team 2009) scripts developed in-house and the minpack.lm package (v.1.1.1, Timur V. Elzhov and Katharine M. Mullen minpack.lm: R interface to the Levenberg-Marquardt nonlinear least-squares algorithm found in MINPACK. R package version 1.1--1.). The reciprocal (1/T~1~) maps directly reflect manganese levels \[[@r16]\]. Between eyes, linearized maps were aligned using an automated x--y registration (align slices in stack plugin of [ImageJ](http://rsbweb.nih.gov/ij/)), and average virus injected or noninjected parameter maps were derived. Analysis of channelopsin-2 expression ------------------------------------- The expression of Chop2-GFP in the retina was studied in whole mounts (i.e., a horizontal analysis) and in vertical sections following 4 h of bright blue light exposure. Immediately after MRI examination anesthetized mice were decapitated, superior/ inferior eye orientation externally marked, and the eyes were enucleated. The retinas were fixed in the eyecups with 4% paraformaldehyde in 0.1 M phosphate buffer (PB) for 20 min. For the cryostat sections the retinas were cryoprotected with all three solutions starting with 10%, then 20%, and finally 30% weight/volume in PB, which called sucrose gradient and sections were cut at 20 μm. For the whole mounts, the retina was dissected free in PB solution, flat mounted on slides, and coverslipped. GFP fluorescence, without antibody enhancement, was sufficient to visualize most of the GFP expressing cells in whole mounts and retinal sections. For double labeling, retinal sections were blocked for 1 h in a PB solution that contained 5% Chemiblocker (membrane-blocking agent; Chemicon, Temecula, CA), 0.5% Triton X-100, and 0.05% sodium azide. The primary antibodies were diluted in the same solution and applied overnight followed by secondary antibodies for 2 h. All steps were performed at room temperature. The primary antibodies were rabbit anti-GFP antibody conjugated to Alexa488 (1:2,000; Molecular Probes, Eugene, OR) and mouse anti-calbindin antibody (1:5,000; Sigma, Saint Louis, MO). Secondary antibodies for calbindin were donkey antimouse Alexa555 (1:600; Molecular Probes). All images were acquired using a Zeiss Axioplan 2 (Zeiss, Oberkochen, Germany) microscope with the Apotome oscillating grating to reduce out-of-focus stray light. Z-stack images were captured using a Zeiss Apotome microscope with a fixed exposure time. Image projections were made by averaging individual z-stacks of optical sections into a single image, unless otherwise indicated. The brightness and contrast were maximized for each average image using Adobe Photoshop CS4 (Adobe systems incorporated, New York, NY). For comparison, differential interference contrast images were also collected. Statistical analysis -------------------- Comparisons of MEMRI retinal signal intensities within and between groups were performed using a generalized estimating equation approach \[[@r12],[@r21]\]. A generalized estimating equation performs a general linear regression analysis using all of the pixels in each subject and accounts for the within-subject correlation between adjacent pixels. In all cases, p\<0.05 was considered statistically significant. Data are presented as mean±standard error of the mean (SEM) unless otherwise noted. Results ======= Horizontal analysis ------------------- After MEMRI examination, retinal whole mounts were prepared to evaluate the ganglion cell layer expression of Chop2-GFP of all virus-injected eyes. As expected all eyes showed robust expression of GFP in ganglion cell somas, dendrites, and axons, with regions of high expression levels close to the optic nerve head ([Figure 1A](#f1){ref-type="fig"}). In this restricted region GFP fluorescence appeared symmetrically and evenly distributed about the optic nerve ([Figure 1B-H](#f1){ref-type="fig"}; white rectangular) in both dark-adapted ([Figure 1B-D](#f1){ref-type="fig"}) and light-exposed ([Figure 1E-H](#f1){ref-type="fig"}) retinas. {#f1} Similar restricted retinal regions as those described above were analyzed from the MEMRI data (±0.4--1 mm from the optic nerve head in superior--inferior directions; 620 μm slice thickness). Signal intensities of light-exposed, virus-treated eyes were not different (p\>0.05) between superior (mean±SEM 113.4±2.1 arbitrary units \[a.u.\]) and inferior (116.4±2.2 a.u.) retina; these regions were combined for further analysis. Horizontal signal intensities were not different (p\>0.05) between the two control groups (i.e., uninjected and saline-injected groups), regardless of lighting condition ([Figure 2](#f2){ref-type="fig"}); these data were pooled for additional comparison. Also, no difference (p\>0.05) was found between the combined control signal intensity and that in dark-exposed virus-treated eyes ([Figure 2](#f2){ref-type="fig"}). Signal intensities from light-exposed virus-treated eyes were significantly different (p\<0.05) compared to each of the other groups ([Figure 2](#f2){ref-type="fig"}). {#f2} In the retinal optic nerve, no differences (p\>0.05) in retinal manganese accumulation were found between the noninjected and saline-injected eyes regardless of lighting condition ([Figure 3](#f3){ref-type="fig"}), and the data were combined. The combined control intensities (49.1±3.8 a.u., n=7) were similar to that of dark-exposed virus-treated eyes (50.2±5.7 a.u., n=6). For comparison, light-exposed virus-treated eyes had a greater (p\<0.05) optic nerve signal relative to that of the combined control groups as well as that of the combined control groups and dark-exposed Chop2-GFP ([Figure 3](#f3){ref-type="fig"}). {#f3} Vertical analysis ----------------- After MEMRI experiments and subsequent inspection in whole mounts, the Chop2-GFP-expressing retinas were further investigated in cryostat sections. The Chop2-GFP fluorescence was predominantly observed in the inner plexiform layer and in the ganglion cell layer ([Figure 4A](#f4){ref-type="fig"}). In the INL, some AII amacrine cells were also labeled \[[@r3]\]. GFP-positive cells at the outer border of the INL are horizontal cells (based on double labeling with the antibody against calbindin, [Figure 5](#f5){ref-type="fig"}). No glial cells with GFP fluorescence were detected. In the same retina vertical section, differential interference contrast images are consistent with the absence of photoreceptors ([Figure 4B](#f4){ref-type="fig"}). ![Vertical analysis of the retina. **A**: Numerous green fluorescent protein (GFP)-positive ganglion, amacrine, and horizontal cells can be seen in the cryostat section of a retina after a light-exposed magnetic resonance imaging experiment. **B**: Nomarski image of the same region shown in (**A**) reveals the absence of photoreceptors. Abbreviations are as follows: INL represents inner nuclear layer; IPL represents inner plexiform layer; GCL represents ganglion cell layer. The scale bar is equal to 25 μm in **A** and **B**. **C-D**: Pseudocolor linearized average 1/T1 maps of the central retina from uninjected (**C**) and virus injected (**D**) eyes, scaled vertically to approximately match the boundaries of (**A**) and (**B**). The pseudocolor scale was *blue* to *green* to *yellow* to *red*, which represents lowest (0.56 s^−1^) to highest (2.25 s^−1^) 1/T~1~ values. 1/T~1~ is directly proportional to manganese concentration \[[@r16]\]. The vertical scale bar is equal to 130 μm, and the horizontal scale bar is 0.6 mm and applies to **C** and **D**.](mv-v16-1059-f4){#f4} {#f5} For MEMRI we collected the signals in the areas between ±0.4--1 mm on superior and inferior sides of the optic nerve. The signal was averaged over 600 μm retinal thickness ([Figure 4C,D](#f4){ref-type="fig"}) and thus represents more partial volume averaging than that shown in [Figure 4A,B](#f4){ref-type="fig"}. Relative to noninjected eyes ([Figure 4C](#f4){ref-type="fig"}), light-exposed virus-infected eyes ([Figure 4D](#f4){ref-type="fig"}) accumulated more (p\<0.05) manganese in the retinal ganglion cells, inner plexiform, and inner nuclear layers (INLs). Discussion ========== In this study the major findings are that *rd1/rd1* mice with Chop2-GFP expression and exposure to bright blue light had 1) a horizontal distribution of manganese and Chop2-GFP expression that were symmetric about the optic nerve, 2) retinal and optic nerve accumulation of manganese that was greater than that measured in a series of control conditions, and 3) vertical loci of manganese accumulation and Chop2-GFP expression that were largely similar, except possibly in the INL (*vide infra*). These findings demonstrate for the first time the feasibility of using MEMRI to measure regional light responses in Chop2-GFP-expressing retinas in vivo. The *rd1/rd1* mouse \[[@r22],[@r23]\] is a widely used photoreceptor degeneration model that undergoes rapid retinal degeneration due to a defect in the β-subunit of a rod-specific cyclic guanosine monophosphate (cGMP)- phosphodiesterase and lacks the entire photoreceptor layer in adulthood \[[@r22]\]. The rd mutation initially affects rod photoreceptors, followed by a slower degradation of cones. By 4 months of age only approximately 1.3% of cones are left in the central retina \[[@r24],[@r25]\]. In this study, the observed light- and dark-induced changes in the surviving retina measured (at the age of 4--5 months old) could be manifested by remaining cones \[[@r24],[@r25]\], endogenous melanopsin \[[@r26]\], and/or exogenously introduced ChR2 \[[@r1]\]. However, it seems unlikely that melanopsin or the remaining cones are playing a role in the present study. In the two non-virus-injected control groups, no change in manganese uptake between light and dark conditions were found. Also, unlike the newborn retina, in the adult retina of wild-type and *rd1/rd1* mice, melanopsin is normally present in only a relatively small number of specialized ganglion cells \[[@r27],[@r28]\]. With these considerations and given the large ectopic expression of ChR2 in this study ([Figure 1](#f1){ref-type="fig"}), it is reasonable to conclude that ChR2 expression dominates the observed light/dark effect. Previous evidence indicated that the intensity of the bright blue light used herein is sufficient to activate ChR2 in the retina in vivo \[[@r3],[@r6]\]. As shown in [Figure 2](#f2){ref-type="fig"}, such blue light exposure after ChR2 treatment also significantly increased manganese uptake. To the best of our knowledge, it is not yet known if manganese ions directly permeate the ChR2 channel. However, Mn^2+^ can act as a Ca^2+^ surrogate, and calcium ions are reported to permeate the ChR2 channel \[[@r2],[@r29]\]. An alternative and not mutually exclusive possibility is that a light-induced opening of the ChR2 channel causes depolarization of the cell membrane, which activated other membrane conductances, including L-type voltage-gated calcium channels. L-type voltage-gated calcium channels are expressed throughout the rodent retina \[[@r30]\]. Since manganese readily permeates L-type channels, we speculate that this indirect ChR2-mediated route would be, at least in part, involved in the manganese uptake \[[@r11],[@r29]\]. In light-exposed eyes, reasonable agreement was found between retinal and optic nerve manganese accumulation and Chop2-GFP expression and in the inner half of the surviving retina (i.e., the ganglion cell and inner plexiform layers). Although focal detection of Chop2-GFP-positive amacrine and horizontal cells was found in the INL, the 1/T~1~ maps suggested a somewhat greater involvement of the entire outer half of the remaining retina---corresponding to the INL---of the light-exposed virus-injected eyes ([Figure 4D](#f4){ref-type="fig"}). In the light-exposed virus-treated eyes, depolarization of the neurons in the INL with subsequent manganese accumulation might be possible. For example, the Chop2-GFP expressing amacrine cells ([Figure 4A](#f4){ref-type="fig"}), together along with their downstream ON cone bipolar cells could depolarize during light illumination \[[@r31]\]. In addition, with light exposure horizontal cells expressing Chop2-GFP ([Figure 4A](#f4){ref-type="fig"}) may depolarize, releasing gamma-aminobutyric acid (GABA). Rod bipolar cells in *rd1/rd1* mice retain functional dendritic GABA receptors \[[@r32]\]. In wild-type retinas GABA leads to depolarization of ON bipolar cells \[[@r33]\]. Assuming that the chloride gradient in bipolar cells of *rd1/rd1* mice is comparable to that of wild-type mice, ChR2-mediated depolarization of horizontal cells could also lead to depolarization of ON bipolar cells. These considerations support the idea that, in response to light, ChR2-expressing, amacrine, and horizontal cells can lead to depolarization of ON bipolar cells, with the increased possibility of greater manganese entry and accumulation. While the present resolution of the current MEMRI data (23.4 μm) was sufficient in 1/T~1~ maps of uninjected eyes to separate the inner from the outer half of the surviving retina, it may be inadequate for finer discrimination of histological sublamina. Also, while image registration and linearization were reasonably accurate, some subtle reductions in the effective resolution of retinal structure are likely. The distance between AII amacrine cells in the inner portion of the INL and the horizontal cells in the outer portion of the INL is about 20 μm. For these reasons, in the light-exposed virus-injected retinal 1/T~1~ map ([Figure 4D](#f4){ref-type="fig"}), the absence of a "gap" in the space corresponding to mid-INL should not be construed as definitive evidence that bipolar cells show light-dependent depolarization in ChR2-expressing retinas. More work, with higher spatial resolution, is needed to test the reasonableness of these ideas. In summary, first-time evidence is presented that demonstrates the sensitivity of MEMRI to regional light responses in Chop2-GFP-expressing retinas. More work is now needed to analytically evaluate how the spatial distribution and extent of retinal manganese uptake are linked, for example, with light exposure frequency and intensity. Nonetheless, these data raise the possibility that MEMRI will be useful in analytically evaluating the activity of ChR2, or its derivatives, or other microbial rhodopsins in the retina \[[@r34],[@r35]\]. Thus, MEMRI is expected to facilitate the development and evaluation of the ChR2-based gene therapy for treating retinal degenerative diseases. The following support is recognized: NIH EY017130 (Z.H.P.), EY018109 (B.A.B.), and an unrestricted grant from Research to Prevent Blindness (Kresge Eye Institute). Dr. Bruce A. Berkowitz, Ph.D. and Dr. Zhuo-Hua Pan, Ph.D. (313-577-9830; zhpan\@med.wayne.edu) contributed equally to the research leading to this publication and are to be considered as co-corresponding authors. | Mid | [
0.56575682382134,
28.5,
21.875
] |
BUENOS AIRES, Argentina (JTA) — German Chancellor Angela Merkel, speaking at a synagogue in Argentina, said anti-Semitism must be fought “wherever it appears.” She also praised Argentina for receiving Germans who escaped from the Nazis during World War II. In the first hours of her one-day official visit to the South American country, Merkel on Thursday visited the oldest congregation in Argentina, the synagogue of the Israeli Congregation of the Argentine Republic, better known as Libertad Temple, in Buenos Aires. “This synagogue is a symbol of the great Jewish community of Argentina, where many Germans came escaping from the Nazis,” she said. “There was a bridge between Argentina and Germany, and I want to thank you for having welcomed many Germans here in your country.” Merkel recalled the 1992 attack on the Israeli Embassy in Buenos Aires, which left 29 people dead, and the 1994 AMIA Jewish center bombing that killed 85, as “living and painful” examples of anti-Semitism. “We must fight anti-Semitism where it is present, and fight for democracy and the rule of law throughout the world,” said Merkel, who also noted that Germany’s past is a reminder of the need to fight against anti-Semitism and for freedom and democracy. Merkel re-inaugurated the recently restored Walcker pipe organ, built in Germany in 1931 specifically for the synagogue. Germany contributed some $33,000 to the restoration. The executive director of the DAIA Jewish political umbrella in Argentina, Victor Garelik, played a liturgical piece on the organ for the Argentine and German delegations. Merkel entered the synagogue with Buenos Aires Mayor Horacio Rodriguez Larreta and the synagogue’s spiritual leader, Rabbi Simon Moguilevsky, as well as German officials and businessmen who participated in the visit to Argentina. Representatives of the country’s main Jewish institutions and the Israeli ambassador, Ilan Sztulman, also participated in the ceremony. The temple, home to the Byzantine-style Jewish History Museum, was declared a National Historical Monument by the Argentina government in 2000. | High | [
0.7044334975369451,
35.75,
15
] |
Our federal bureaucracy under Barack Obama is so bloated that the number of government workers outnumber the number of manufacturing workers by almost ten million people. In October alone, the U.S. lost 9,000 manufacturing jobs, while gaining 19,000 government jobs, CNSNews is reporting. TRENDING: There Is a Long History of SCOTUS Nominees in an Election Year - And History Is on the GOP's Side Numbers from the Bureau of Labor Statistics show that government employment grew from 22,216,000 in September to 22,235,000 in October, while the number of jobs in manufacturing dropped from 12,267,000 to 12,258,000 – meaning that government employees now outnumber manufacturing workers by 9,977,000 jobs. Over the last year, jobs in manufacturing fell by 53,000. During the same period, government employment rose from 22,027,000 to 22,235,000. The feds have published monthly employment data since 1939. For the first 50 years – until 1988, manufacturing jobs exceeded government jobs. But in 1989, it all changed. Manufacturing employment peaked in June 1979 at 19,553,000. Since then, manufacturing employment has declined by 7,295,000—or 37.3 percent—to its current level of 12,258,000. In June 1979, when manufacturing employment hit its peak, government employment was 16,045,000. Since then, government employment has increased by 6,190,000—or 38.6 percent—to its current level of 22,235,000. The 22,235,000 employed by government exceed the populations of 48 of the 50 states. Only California, which the Census Bureau estimated had a population of 39,144,818 in 2015; and Texas, which the Census Bureau estimated had a population of 27,469,114, had populations that exceeded the number of people in the country who work for government. RELATED: James Woods Demolishes Liberals Definition of "Success" With a Single Tweet The number of government employees is so huge, it is larger than the combined population of Ohio and Michigan. There are a total of 14,297,000 local government employees, 5,123 state government employees and 2,815 federal employees. | Mid | [
0.569819819819819,
31.625,
23.875
] |
5 - 5)*(-u**3 + 0*u**3 + 0*u**3) + (u**3 + 0*u**3 - 2*u**3)*(2*u - 2*u + u) as j*u**2 + v*u + d*u**3 + w + r*u**4 and give r. 7 Rearrange -4*v - 3*v**3 + 80 + 4*v - 71 to the form o*v**3 + s*v + c + m*v**2 and give s. 0 Express 23 + 6*k**4 + 0*k**3 + 4*k**4 + k**3 - 12*k**4 in the form q + n*k**4 + r*k**2 + o*k + x*k**3 and give q. 23 Express (-1 - v + 1)*(-2*v + 3*v**2 + 2*v) + (-5*v**2 + 4*v**2 - v**2)*(-4 + 4 - 4*v) as i + k*v**3 + x*v + n*v**2 and give k. 5 Rearrange (1 - 2*f - 1)*(-f - 7*f + 2*f + 0 + 0 + 2*f - f - f + 0*f + (5 - 4 - 3)*(f - 2*f + 2*f)) to the form h + s*f + j*f**2 and give j. 16 Rearrange (-4*y**2 + 3*y**2 - 5*y**2)*(1 - 2 + 3) to the form x + n*y**2 + q*y and give n. -12 Rearrange (1 - 5 + 6)*(-a + 2*a - 2*a + (3 + 2*a - 3)*(-5 + 0 + 2)*(6 - 1 - 3)) to the form s*a + d and give s. -26 Rearrange (-18 - 12 + 11)*(1 - 2*t**4 - 1) to m*t**3 + k*t**2 + v*t + g + i*t**4 and give i. 38 Rearrange -6*n**2 + 5*n + 5 - 3 + 14*n + 4*n**2 to the form r*n**2 + y*n + k and give r. -2 Express (-u + u - 2*u)*(-8*u + 0*u + 11*u)*(3 - 1 - 1) in the form s + k*u + n*u**2 and give n. -6 Rearrange -j + 146 - 146 + 17*j**3 to k*j + x*j**3 + i*j**2 + v and give x. 17 Rearrange 2*r - 3*r + 10 - r**2 + 2*r**4 - 3*r**3 - 9 to the form a*r**3 + h + f*r**2 + t*r + w*r**4 and give f. -1 Express -l + 5*l - 3*l + (-3*l - l + 3*l)*(4 - 4 - 7) in the form t + x*l and give x. 8 Express x**4 + 2*x**3 - x**2 - 2*x + 2*x**2 + 3*x - 3*x**4 in the form d*x + u*x**4 + k*x**2 + c + j*x**3 and give k. 1 Rearrange -38*o - o - 6*o + 15*o to the form i + q*o and give q. -30 Express (-83*o + 26*o - 56*o)*(0*o + 2*o - 3*o) as r*o + s + a*o**2 and give a. 113 Rearrange (-5 + 5 - 4*d)*(-2 + 3 - 2)*(6 + 1 - 4) to a + c*d and give c. 12 Express 5*l**2 - 30*l + 11*l + 0*l**2 + 17*l in the form i + h*l**2 + y*l and give h. 5 Express (-2 + 2 + 3)*(-7*y - 34*y - 60*y + 15*y) in the form v + c*y and give c. -258 Express (-2 - 4 - 1)*(0 + 2 - 1)*(0*t**3 + 3*t**2 + 4*t**3 - 3*t**3) as z*t**3 + x*t + f*t**2 + l and give l. 0 Rearrange (-3*w + w + w)*(-4*w + 10*w - 1 + 0*w) to the form a*w**2 + x*w + z and give x. 1 Rearrange 2*v**2 - 2*v**2 + 2*v**2 + 2*v**4 - 4*v**4 - 2 to s*v**2 + l*v + k + i*v**4 + y*v**3 and give s. 2 Rearrange (1 - 1 - 1)*(-104 - 19*b**2 - 98 + 207) to the form d*b**2 + c + f*b and give c. -5 Rearrange -6*r + 2*r - 3*r - 2*r to w + n*r and give n. -9 Express -i**2 - 1 - 5*i**2 - i**3 + 0 + 2*i**2 - i in the form q*i**3 + h*i + t + l*i**2 and give q. -1 Express 2*f**2 - 3*f**2 + 0*f**2 + 49*f**3 - 47*f**3 + 24*f in the form w*f**3 + d*f + a + b*f**2 and give b. -1 Rearrange (-4 + 3*c + 4)*(-17 + 7 + 13) to m + j*c and give j. 9 Express (-4 + 4 - 4*o**2)*(-9*o - 4*o - 8*o) in the form s*o**3 + r + y*o**2 + k*o and give s. 84 Express -18*y**3 + 5*y**3 + 14*y**3 - y as u*y + i*y**3 + a*y**2 + f and give u. -1 Express (x - 2 + 2)*(133 - 133 + 76*x) as q + y*x**2 + f*x and give y. 76 Rearrange k**2 + 16*k**2 - k**2 + 0*k**2 to d + j*k + i*k**2 and give i. 16 Express 4 - 4 - a + 4*a + 0*a - 6*a + 0*a + 0*a - 2*a + (-3 - 2 + 4)*(a - 3*a + 3*a) + (11 - 29*a - 11)*(2 + 0 - 1) as m + d*a and give d. -35 Rearrange 12 - 12 - 25*z**3 + (2*z - 3*z + 0*z)*(0 + 0 + z**2) to g + r*z**3 + i*z + y*z**2 and give r. -26 Rearrange 2 + 1 - 4*p**2 + 0 + 0 to the form o*p + i*p**2 + v and give o. 0 Rearrange (6 - 3 - 2)*(-5*b + b + 3*b + (1 + 2 - 5)*(0 + 3*b + 0)) + (2 - 5 + 1)*(-b + 2 - 2) + b - b + 2*b - 10*b + 43*b - 14*b to the form v*b + q and give v. 16 Rearrange -2*l**3 + 11*l**3 - 162*l - 2 + 164*l - 2*l**2 to the form s*l**3 + d + y*l + n*l**2 and give y. 2 Rearrange (4 - 5 - 1 - 2*t)*((-t + 4*t - 6*t)*(3 - 2 - 4) + 2 - t - 3 - 3*t) to the form p*t + d + j*t**2 and give d. 2 Express 52*u + 209 - 209 + (2 - 6 + 2)*(u - 2*u - u) in the form t + l*u and give l. 56 Express 6 + 1 - h**3 - 2*h**4 - 6 as r*h**4 + t*h**3 + v*h + b + a*h**2 and give t. -1 Rearrange 15*u**2 + 2*u**2 + 6*u**2 + (u + u - 6*u)*(3*u - 5*u + 3*u) to the form q*u + p*u**2 + y and give p. 19 Rearrange -5*j**3 + j + 9*j**3 + 0*j + 4*j**2 to l*j + o*j**2 + w + r*j**3 and give l. 1 Express (-f**3 - 4*f**2 + 4*f**2)*(-2*f + 6*f - 2*f + (1 - 1 + 2)*(f - f + f) + 3*f + 8*f - 12*f) as x + n*f**4 + g*f + l*f**2 + j*f**3 and give n. -3 Express -332*r**3 + r**4 - 1 + 334*r**3 - 3*r**2 + r**2 as g*r**4 + t*r + b*r**3 + o*r**2 + k and give g. 1 Rearrange -2*d + d - 4 + 2*d + 2*d to b + v*d and give v. 3 Express (4 - 2 - 3)*(4 - 3 + 0 - 2 - 1 + 1 + (3 - 6 + 1)*(-3 + 0 + 1) + 1 - 1 - 2 + 1 + 0 + 3 + 2 + 2 - 5 + 6 - 3 - 1)*(3*o - 2*o + 5*o) as v*o + h and give v. -36 Express -11*t - 2*t - 9*t + (3*t - 2*t + t)*(3 - 4 + 0) + (-4 + 2 + 0)*(5*t - 3*t - t) in the form n*t + b and give n. -26 Express -o**2 - o - 5 + 2*o**3 + 8*o**4 + 3 + 3*o**2 as t*o**2 + r*o**3 + s + h*o + c*o**4 and give r. 2 Rearrange -16*w**2 - 9*w**3 + 16*w**2 + (3*w - 4*w + 2*w)*(5*w**2 - 2*w**2 - w**2) + w**3 - 3*w**3 + w**3 to x*w + o*w**3 + m + k*w**2 and give o. -8 Express (-l**2 - l**2 + 3*l**2)*(1 - 3 + 0) + (-31*l - 27*l - 37*l)*(3*l - 4*l + 3*l) in the form o*l**2 + p*l + r and give o. -192 Rearrange 2*b + 27*b**3 + 433*b**2 - 433*b**2 + 2 to f*b**3 + z*b**2 + m*b + c and give m. 2 Rearrange -5*x + 9*x + 11*x to f + k*x and give k. 15 Express (3*w - w - w)*(133*w - 181 + 181) as f*w**2 + u + l*w and give u. 0 Express (2 + 1 + 4)*(-4*v**2 - 6*v**2 - 2*v**2) as g*v**2 + z + q*v and give g. -84 Rearrange (-i**3 + 0*i**3 - i**3)*(-43*i - 16*i + 28*i) to the form p*i + a*i**4 + q*i**3 + c + l*i**2 and give a. 62 Express 36*n + 2 - 3 + 1 in the form f*n + q and give f. 36 Rearrange 7*a**2 + 12*a**2 - 66*a**2 - 18*a**2 to q + s*a + v*a**2 and give q. 0 Rearrange -87*t - 42 + 17 + 25 to r + d*t and give d. -87 Rearrange 2 + 31*y**3 - 1 - 16*y**3 to j*y**2 + s*y + f*y**3 + g and give f. 15 Express (-5*c + 2*c + 2*c)*(-2*c**2 + 3*c**2 - 3*c**2 + (c + 3*c - 2*c)*(-2 + c + 2) + 209*c**2 + 214*c**2 - 355*c**2) as l*c + x*c**3 + w + h*c**2 and give x. -68 Rearrange 70 + 37*o - 70 to the form t + g*o and give g. 37 Rearrange 4*g**3 + 3 + 4*g**3 - 9*g**3 - 7*g**4 + g**4 to x*g**4 + b*g + c*g**3 + s*g**2 + y and give x. -6 Express 8*c + 2*c + 3*c as x*c + p and give x. 13 Express (-1 + 1 + 1)*((2*x - x - 4*x)*(-2 + 2 - 5) + 3*x - x + 0*x)*(-x - 6*x + 5*x) as r*x**2 + z + h*x and give r. -34 Express -3*y**3 + 4*y + y - y in the form d*y**2 + f + l*y + r*y**3 and give r. -3 Express -4*h + 38 - 2*h + 7*h + h in the form d + y*h and give d. 38 Express (-2 + 3 + 1)*(18*y**3 - 277 + 277)*(-y + 0*y + 0*y) as n*y**2 + i*y**3 + t + w*y + d*y**4 and give t. 0 Rearrange (-1 - 1 + 1)*(7*g**2 - 6*g**2 - 21*g**2)*(-4 + 4 - g)*(-3 + 2 + 2) to the form x*g + h*g**3 + d + m*g**2 and give h. -20 Rearrange 2*l**2 + 825*l - 11 - 825*l to the form m + w*l + i*l**2 and give i. 2 Rearrange c**3 - 130*c**2 + 2 - 7*c + 131*c**2 + 8*c - c**4 to the form n*c**3 + f*c**2 + v*c**4 + u + d*c and give d. 1 Rearrange (0*l - l**2 + 0*l)*(4*l**2 - 5 + 4 - 947*l + 930*l) to the form f*l**3 + d*l + p + b*l**4 + w*l**2 and give p. 0 Express 94*m**2 + 4*m - 8*m + 4*m as p*m + q + l*m**2 and give l. 94 Express -2*d**4 + 3*d**3 - 3*d**3 + (-2*d + 2*d + 2*d**3)*(-d - 4*d + 6*d)*(4 + 0 - 1) as b + l*d**4 + n*d**3 + i*d + y*d**2 and give l. 4 Express (48*w - 42*w + 1 - 4)*(5 - 4 - 3) in the form c + u*w and give u. -12 Rearrange (0*a + 0*a - a)*(-150 - 112 + 81 - 46) to b*a + f and give b. 227 Express -4*u**2 - u**2 - 4*u**2 + 4*u**2 as r*u + o*u**2 + m and give o. -5 Rearrange -7*y**2 - 3*y**2 + 5*y**2 - 6*y**2 to r + l*y + d*y**2 and give l. 0 Rearrange ((-2*k + 5*k - 5*k)*(-3*k**2 + 4*k**2 + 0*k**2) - 56*k - 20*k**3 + 56*k)*(-k + 0*k + 0*k) to the form a*k + d + t*k**4 + s*k**2 + m*k**3 and give d. 0 Rearrange -7*g**3 + g**3 - 3*g**2 + g**2 - 2*g**4 to l*g**4 + c + u*g**2 + w*g + n*g**3 and give n. -6 Rearrange 0*j**2 - 347 - j**3 + j**2 + 2*j + 343 to the form w*j**2 + y*j + v + k*j**3 and give k. -1 Rearrange (-4 - 4 + 10 - o)*(3*o + 2*o - 4*o)*(1 - 1 + 3*o) to k*o + y*o**2 + h*o**3 + j and give y. 6 Rearrange (-3 - 2*d + 3)*(-10*d + 4*d + 5*d)*(0*d - d - d)*(-4 + 1 + 5) to j*d**2 + m*d**3 + w*d + i and give m. -8 Rearrange -5 - 6*w**3 + 4*w**3 + 9 - 2*w**2 - 8 + 2*w to the form v*w**2 + s*w + | Low | [
0.49189189189189103,
11.375,
11.75
] |
Q: TFS Source file could not be found I know other questions exists about this particular error, however, I'm not seeing an answer. This appears to not be finding only stored procedures. I think what the issue is that the dev updating the .tt file manually, instead of deleting the entries through the .edmx itself. I'm only guessing from what I've read on these issues. I deleted all the entities from the .edmx (checked it in) and then re-added everything and checked that in. My error count was cut in half. All of the tables that it was originally saying were issues went away. However, it appears that my error list now only contains stored procedures. When I was Updating model from Database only Tables and Views were checkable. I could not specifically add any Stored procedures or functions. However, when I open the .tt I see the file mentioned below: Build Error: 4>CSC : error CS2001: Source file 'sp_GetResult_Result.cs' could not be found [C:\B\13\TFSServer\Project.proj.CI\src\Project\proj\proj.Data\proj.Data.csproj] From the data project .csproj file: <Compile Include="sp_GetResult_Result.cs"> <DependentUpon>proj.tt</DependentUpon> </Compile> I've tried commenting out this line (and lines like it), to no avail. The project will not build. I have 186 errors in my Build Log. All of the same type. This is in a VS2015 MVC project using Entity Framework. The project builds fine locally, I just get these errors from the TFS build server. I think if I could add the stored procedures like I could add tables these errors would go away. But maybe there is a totally different issue. A: I kind of did what @KevinRaffay suggested except I wound up blowing away everything under and including the .edmx file. There must of been too many artifacts that it was looking for. Adding a new .edmx file and subsequent updated connection string corrected the issue. I wish I had a cause for why this occurred, but this is how I got past this issue. | High | [
0.6930983847283401,
29.5,
13.0625
] |
Apex > I Solisti Veneti Works: Gioachino Rossini: Sonata a quattro no 1 in G major; Sonata a quattro no 2 in A major; Sonata a quattro no 3 in C major; Sonata a quattro no 4 in B flat major; Sonata a quattro no 5 in E flat major; ... Conductors: Scimone, Claudio Ensemble: I Solisti Veneti | Mid | [
0.6461538461538461,
36.75,
20.125
] |
Decidual CD8+CD28- T cells express CD103 but not perforin. Maternal lymphocytes at the fetal-maternal interface play a key role in the immune acceptance of the allogeneic fetus. Decidual NK cells have shown to contain immune modulatory properties and may facilitate fetal trophoblast invasion into maternal tissue. More recently, CD4+CD25(bright)FOXP3+ Treg cells have been shown to be concentrated in decidual tissue and to be able to suppress both fetus-specific and nonspecific responses. However CD8+ T cells form the largest fraction of T cells at the fetal-maternal interface and are the main candidates to recognize and respond to fetal-maternal HLA differences. So far limited data are available on the phenotype and function of decidual CD8+ T cells during pregnancy. Phenotypic analysis of peripheral blood and decidual CD8+ T cells showed the presence of activated CD8+ T cells as well as a population of CD8+CD103+ T cells in decidual tissue. Unlike peripheral CD8+CD28- T cells, decidual CD8+CD28- T cells do not express the cytolytic molecule perforin. The lack of perforin expression may indicate that decidual CD8+ T cells are not able to elicit a cytotoxic response, and supports the hypothesis that decidual CD8+ T cells play a role in local immune regulation. Defects in decidual CD8+ T-cell regulation or differentiation may lead to placental pathologic conditions whereby placental and fetal growth are impaired. | Mid | [
0.643518518518518,
34.75,
19.25
] |
I. Field of the Invention This invention relates to the field of communications systems and, in particular, to the transmission of spread coded message signals within communications systems. II. Description of the Prior Art It is well known in the art of communications to mix message signals to be transmitted with spreading code vectors. This permits the message signals to be combined, transmitted, and separated from each other after transmission. The most useful feature of a set of code vectors suitable for this purpose is that the spreading code vectors are mutually orthogonal. This permits a theoretical interference of zero between the message signals. The code vectors most commonly used for this purpose are Walsh code vectors. The total number of binary code vectors having a length n is 2n. However, of the total number of binary vectors 2n within the total vector space, only n are mutually orthogonal. For example, when n=8 there are 256 different binary vectors. Only 8 of the 256 vectors are mutually orthogonal. Therefore, in a system wherein n=8 usually only 8 message signals can be combined and separated in this manner and only 8 users can be supported simultaneously. Likewise, if n=128 then 128 users can be supported simultaneously. Some of the vectors can be idle some of the time, thereby permitting more than n users to be serviced. However, the size of the code vectors still places a limitation on the size of the communications system. A set W of code vectors w meeting the orthogonality requirement for a theoretical interference of zero can be represented as follows: w 1 = [ w 1 , 1 w 1 , 2 … w 1 , n ] w 2 = [ w 2 , 1 w 2 , 2 … w 2 , n ] ⋮ w n = [ w n , 1 w n , 2 … w n , n ] wherein each vector wi is a column vector using a 0/1 alphabet or, equivalently, a xe2x88x921/+1 alphabet. Hereinbelow, a set of code vectors using the 0/1 alphabet is expressed as Wb,n and a set using the xe2x88x921/+1 alphabet is expressed as Wn. Since all vectors w in the set W are orthogonal to each other, the dot product of any two vectors in the set must be zero. This can be represented as: (wx, wy)=0 where x and y can have any values between 1 and n, xxe2x89xa0y and (wx, wy) is equal to: ∑ i = 1 n w x , i , w y , i . Equivalently, the above can be expressed as the following matrix product: wxTwy=0. Also: wxTwx=n. Representing the ith data symbol to be transmitted as di and the total number of transmit signals as k, the total transmission signal S transmitted by a base station to a mobile station is: S = ∑ i = 1 k d i w i The mobile station receives the total transmission signal S and tries to eliminate all message signals except its own. In order to eliminate the other messages the mobile station can multiply signal S by the transpose of its own Walsh code vector. An example wherein i=1 is as follows: w 1 T S = w 1 T ∑ i = 1 k d i w i = w 1 T ( d 1 w _ 1 + ∑ i = 2 k d i w _ i ) wherein the first term on the right side represents the wanted signal. The second term in the right side represents the interference from all of the remaining message signals mixed with their individual Walsh codes. Solving this equation yields: w1TS=nd1+0. Thus, the separation of the transmitted message signals at the receiver depends on a zero correlation between the wanted signal and all of the other message signals. In order to utilize communications systems as effectively as possible it is desirable to simultaneously transmit and separate as many message signals as possible. However, it is only possible to mix n message signals and separate them with zero interference because only n orthogonal vectors are available, as previously described. To overcome this limitation it is known to use quasi orthogonal functions. Quasi orthogonal vectors are vectors that are in addition to the n orthogonal vectors. Quasi orthogonal vectors have been selected from the remaining code vectors in the total binary 2n vector space in order to provide as little interference as possible. Specifically, quasi orthogonal vectors are selected to provide a level of interference that is within acceptable limits, even though the level of interference is not zero. In order to select quasi orthogonal vectors a computer search can be performed within the total 2n vector space for binary (+1/xe2x88x921 alphabet) masks. The masks can be applied to the orthogonal vectors to form a new set of vectors that are quasi orthogonal vectors. Applying a total of M masks to a set of Walsh code vectors wn, the number of quasi orthogonal functions produced is: (M+1)n. Applying a mask m to a code vector wxcex5Wn includes a component by component multiplication of the mask m and the orthogonal code vector w to give the new code vector: wm=wxc2x7m The interference resulting from the use of the new code vectors can be tested and the code vectors that provide the lowest correlation can be selected to provide a set of quasi orthogonal vectors. A plurality of such masking functions can be found in order to provide a plurality of sets of quasi orthogonal vectors from a single set of orthogonal vectors. In order to permit message signals mixed with the quasi orthogonal vectors found by the computer search to be separated from each other, the quasi orthogonal vectors should be mutually orthogonal with respect to each other. There is a non-zero correlation between at least one code vector in the orthogonal set and one vector in the quasi orthogonal set. Representing the quasi orthogonal vectors as v it can be shown that: 1 n ∑ j + 1 n ( ( v , w j ) 2 ) = 1 n The goal in picking quasi orthogonal vectors v is to pick the vectors such that 1 ≤ i ≤ n { "LeftBracketingBar" ( v _ , w _ i ) "RightBracketingBar" } max is as small as possible. Since their correlation is a useful measure of the amount of separation between vectors, the normalized correlation between two code vectors x and y can be defined as: ( x _ , y _ ) = 1 n ∑ i = 1 n x 1 y i * The correlation between two orthogonal vectors is zero. A lower absolute value of correlation results in better separation between message signals mixed with the orthogonal vectors and the ones mixed with quasi orthogonal vectors. Better signal separation results in lower interference between the signals at the time of decoding. Better signal separation results in lower interference between the signals at the time of decoding. The mean square correlation between orthogonal vectors and their corresponding quasi orthogonal vectors where n is a power of two is 1/n. The lower bound on the absolute value of correlation can be shown to have the value, 1/{square root over (n)}. This quantity is referred to as the Holtzman lower bound. Masks have been found that meet the lower bound for cases wherein n is an even power of two. However, in cases where n is an odd power of two this bound has not been met with an equality. The lowest correlation found in the latter case is {square root over (2)}/{square root over (n)}. Therefore, the interference of the best quasi orthogonal vectors found in the odd power of two case using the computer search technique is {square root over (2)} times the theoretical limit. Thus it desirable to find additional quasi orthogonal vectors having lower correlation with the orthogonal vectors for the case wherein n is an odd power of two, in order to expand the capacity of communications systems while maintaining acceptably low amounts of interference. A transmission method in a communications system has an orthogonal vector and a quasi orthogonal masking function for obtaining a quasi orthogonal vector from the orthogonal vector. Message signals are transmitted according to the quasi orthogonal vector. The method includes receiving the quasi orthogonal masking function and permuting the quasi orthogonal masking function to provide a further quasi orthogonal masking function. The further quasi orthogonal masking function is applied to the orthogonal vector to provide a further quasi orthogonal vector. The further quasi orthogonal vector is applied to the message signal to provide an encoded message signal for transmitting the encoded message signal within the communications system. | Mid | [
0.6374695863746951,
32.75,
18.625
] |
Ooooh, I really want the Deathlok-san! I wish she is in 1/6 or 1/8 scale that I usually prefer. But I guess she will be 1/3 or 1/4 that Insight loves to make for this kind of “legless” figure. =/ Rider of Black Vol. 2, Rani VIII by TAITO Q posket Cure Rouge &Cure Lemomade, EXQ ~C.C. apron style~ by Banpresto Ichiban Kuji Premium Selection: Girls und Panzer Everybody’s Sensha-do!! by Banpresto Krista Lenz by Fots Japan Centaur, Kaneshiya Sitara by Kotobukiya Chino -Jazz style- by Aquamarine Magical Girl Chino, The Phantom Thief Lapin by Anime University Coop Omnimon Merciful Mode, Black WarGreymon, HG Girls Inuyama Mana by Bandai Android 18 Ver. IV by Megahouse Rem Yukata Ver. by KADOKAWA Deathlok-san by Insight Racing Miku 2018 Ver., Sakura Kyoko by Good Smile Company Nendoroid Kitagawa Yusuke Phantom Thief Ver. by Good Smile Company Nendoroid Niijima Makoto Phantom Thief Ver. by Good Smile Company Nendoroid Virtual Noja Loli Kitsunemusume Youtuber Ojisan by Good Smile Company Nendoroid Saber/Altria Pendragon True Name release Ver. by Good Smile Company This post contains adult material, you need to be 18 or over to view it. Rider of Black Vol. 2 Manufacturer: TAITO TAITO Scale: Non-scale Non-scale Product Type: Prize figure Prize figure Release Date: late September 2018 late September 2018 Price: 2,000 yen (taxed in) *Due to the nature of prize items, the price is for reference only. Rani VIII Manufacturer: TAITO TAITO Scale: Non-scale Non-scale Product Type: Prize figure Prize figure Release Date: late September 2018 late September 2018 Price: 2,000 yen (taxed in) *Due to the nature of prize items, the price is for reference only. Q posket -Cure Rouge- Manufacturer: Banpresto Banpresto Scale: Non-scale, ~140mm tall Non-scale, ~140mm tall Product Type: Prize figure Prize figure Release Date: September 26, 2018 September 26, 2018 Price: 2,000 yen (taxed in) each 2,000 yen (taxed in) each Note: 2 kinds *Due to the nature of prize items, the price is for reference only. Q posket -Cure Lemomade- Manufacturer: Banpresto Banpresto Scale: Non-scale, ~140mm tall Non-scale, ~140mm tall Product Type: Prize figure Prize figure Release Date: September 26, 2018 September 26, 2018 Price: 2,000 yen (taxed in) each 2,000 yen (taxed in) each Note: 2 kinds *Due to the nature of prize items, the price is for reference only. EXQ ~C.C. apron style~ Manufacturer: Banpresto Banpresto Scale: Non-scale, ~230mm tall Non-scale, ~230mm tall Product Type: Prize figure Prize figure Release Date: September 11, 2018 September 11, 2018 Price: 2,000 yen (taxed in) *Due to the nature of prize items, the price is for reference only. Ichiban Kuji Premium Selection: Girls und Panzer Everybody’s Sensha-do!! Manufacturer: Banpresto Banpresto Product Type: Lottery Prize Lottery Prize Release Date: November 17, 2018 November 17, 2018 Price: 900 yen (taxed in) for each ticket 900 yen (taxed in) for each ticket Note: More info HERE Krista Lenz Manufacturer: Fots Japan Fots Japan Scale: Unknown Unknown Product Type: Unknown Unknown Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Centaur Manufacturer: Kotobukiya Kotobukiya Scale: Unknown Unknown Product Type: PVC figure PVC figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Kaneshiya Sitara Manufacturer: Kotobukiya Kotobukiya Scale: Unknown Unknown Product Type: Plastic model kit Plastic model kit Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Yeah!!! Gochiusa is getting a new season OVA in 2019 and 3rd season TV anime in 2020!!!! =D Chino -Jazz style- Manufacturer: Aquamarine Aquamarine Scale: Unknown Unknown Product Type: PVC figure PVC figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Magical Girl Chino Manufacturer: Anime University Coop Anime University Coop Scale: 1/7 scale, ~210mm tall 1/7 scale, ~210mm tall Product Type: PVC figure PVC figure Announcement: September 17, 2018 September 17, 2018 Re-release Date: June 2019 June 2019 Price: 12,800 yen (taxed in) 12,800 yen (taxed in) Note: Anime University Coop exclusive The Phantom Thief Lapin Manufacturer: Anime University Coop Anime University Coop Scale: 1/7 scale, ~210mm tall 1/7 scale, ~210mm tall Product Type: PVC figure PVC figure Announcement: September 16, 2018 September 16, 2018 Re-release Date: July 2019 July 2019 Price: 14,800 yen (taxed in) 14,800 yen (taxed in) Note: Anime University Coop exclusive Omnimon Merciful Mode Manufacturer: Bandai Bandai Scale: Unknown Unknown Product Type: PVC figure PVC figure Announcement: October 2018 October 2018 Release Date: Unknown Unknown Price: Unknown Unknown Note: Premium Bandai exclusive Black WarGreymon Manufacturer: Bandai Bandai Scale: Non-scale Non-scale Product Type: Action figure Action figure Announcement: September 21, 2018 September 21, 2018 Release Date: Unknown Unknown Price: 6,500 yen 6,500 yen Note: Bandai Collectors Shop exclusive HG Girls Inuyama Mana Manufacturer: Bandai Bandai Scale: Non-scale Non-scale Product Type: Gashapon Gashapon Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Unknown Note: Premium Bandai exclusive Android 18 Ver. IV Manufacturer: Megahouse Megahouse Scale: Unknown Unknown Product Type: PVC figure PVC figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Rem Yukata Ver. Manufacturer: KADOKAWA (manufactured by Revolve) KADOKAWA (manufactured by Revolve) Scale: 1/7 scale, ~230mm tall 1/7 scale, ~230mm tall Product Type: PVC figure PVC figure Announcement: Unknown Unknown Release Date: 2019 2019 Price: Unknown Usually I don’t like large breast character but for some reasons I really want this! Maybe it is because sys3.6.3 was one of the best animated GIF series that I watched back in the day. XD Deathlok-san Manufacturer: Insight Insight Scale: Unknown Unknown Product Type: Unknown Unknown Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Racing Miku 2018 Ver. Manufacturer: Good Smile Company Good Smile Company Scale: 1/7 scale 1/7 scale Product Type: PVC figure PVC figure Announcement: September 19, 2018 September 19, 2018 Release Date: Unknown Unknown Price: Unknown Sakura Kyoko Manufacturer: Good Smile Company Good Smile Company Scale: Unknown Unknown Product Type: PVC figure PVC figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Nendoroid Kitagawa Yusuke Phantom Thief Ver. Manufacturer: Good Smile Company Good Smile Company Scale: Non-scale, ~100mm tall Non-scale, ~100mm tall Product Type: Action figure Action figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Nendoroid Niijima Makoto Phantom Thief Ver. Manufacturer: Good Smile Company Good Smile Company Scale: Non-scale, ~100mm tall Non-scale, ~100mm tall Product Type: Action figure Action figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Nendoroid Virtual Noja Loli Kitsunemusume Youtuber Ojisan Manufacturer: Good Smile Company Good Smile Company Scale: Non-scale, ~100mm tall Non-scale, ~100mm tall Product Type: Action figure Action figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown Nendoroid Saber/Altria Pendragon True Name release Ver. Manufacturer: Good Smile Company Good Smile Company Scale: Non-scale, ~100mm tall Non-scale, ~100mm tall Product Type: Action figure Action figure Announcement: Unknown Unknown Release Date: Unknown Unknown Price: Unknown **All information come from the manufacturers’ website, blog, twitter…etc** | Mid | [
0.540284360189573,
28.5,
24.25
] |
Battle Report Eviction Served 200 POINTS Haqqislam Terror VS Nomads wolfpuppet Lt. Yana had them where she wanted them. No more running away now. Her team hadn’t been spotted yet but she had been holding the attack for minutes now. She didn’t want any non-combatants to get in they way. She didn’t want the docking bay number 52 to happen again. It was this specific Nomad force that sabotaged the ship, Nacamara … a ship carrying civilians…. a ship piloted by her close friend. Elaina, who she considered her sister was starting up the corvette when it blew up. She was there and saw it all. The blast came from within tearing the ship outwards with a bright ball of flame. The lieutenant flew back a good three meters knocking the breath out of her as she slammed against a food stall. As she slowly tried to get up, she caught a glimpse of a Mobile brigada and alguacils leaving the scene through a alleyway to the right. She extended her finger towards them, directing the arriving security to the culprits. Just as they were about to direct their attention to the Nomad force, bullets tore through their bodies. Enemy sniper fire coming from the building about 2 blocks away. The Nomad Unit headed by the Mobile Brigada fired as well hitting everything and anything. Lt. Yana dove back down flat into the ground. She could hear the bullets snapping past above her. A body fell on top of her. It was the lady tending the food stall she slammed into. Her dead face frozen in shock. It was a massacre. Massacre was what she was going to serve to these space pirates. But she didn’t want any civilian casualties. All her bullet are meant for them and them only. Maybe after this, she can finally follow orders and pull out from this region…but not before she has evicted… no, eradicated these scum. No one here cares for onza but me. Even the Yu jing guy is fighting at other places. Im one of the two vets in this game here which is only starting to pick up, so i give in to which mission they feel they are comfortable to fight in given that i already requested for Onza before. | Mid | [
0.550827423167848,
29.125,
23.75
] |
1. Field The present invention relates generally to data communication, and more specifically to techniques for time-domain transmit and receive processing with channel eigen-mode decomposition for multiple-input multiple-output (MIMO) communication systems. 2. Background In a wireless communication system, an RF modulated signal from a transmitter may reach a receiver via a number of propagation paths. The characteristics of the propagation paths typically vary over time due to a number of factors such as fading and multipath. To provide diversity against deleterious path effects and improve performance, multiple transmit and receive antennas may be used. If the propagation paths between the transmit and receive antennas are linearly independent (i.e., a transmission on one path is not formed as a linear combination of the transmissions on other paths), which is generally true to at least an extent, then the likelihood of correctly receiving a data transmission increases as the number of antennas increases. Generally, diversity increases and performance improves as the number of transmit and receive antennas increases. A multiple-input multiple-output (MIMO) communication system employs multiple (NT) transmit antennas and multiple (NR) receive antennas for data transmission. A MIMO channel formed by the NT transmit and NR receive antennas may be decomposed into NC independent channels, with NC≦min {NT, NR}. Each of the NC independent channels is also referred to as a spatial subchannel of the MIMO channel and corresponds to a dimension. The MIMO system can provide improved performance (e.g., increased transmission capacity) if the additional dimensionalities created by the multiple transmit and receive antennas are utilized. The spatial subchannels of a wideband MIMO system may experience different channel conditions (e.g., different fading and multipath effects) across its bandwidth and may achieve different signal-to-noise-and-interference ratios (SNRs) at different frequencies (i.e., different frequency bins or subbands) of the overall system bandwidth. Consequently, the number of information bits per modulation symbol (i.e., the data rate) that may be transmitted at different frequency bins of each spatial subchannel for a particular level of performance may be different from bin to bin. Moreover, the channel conditions typically vary with time. As a result, the supported data rates for the bins of the spatial subchannels also vary with time. To combat the frequency selective nature of the wideband channel (i.e., different channel gains for different bins), orthogonal frequency division multiplexing (OFDM) may be used to effectively partition the system bandwidth into a number of (NF) subbands (which may be referred to as frequency bins or subchannels). In OFDM, each frequency subchannel is associated with a respective subcarrier upon which data may be modulated, and thus may also be viewed as an independent transmission channel. A key challenge in a coded communication system is the selection of the appropriate data rates and coding and modulation schemes to be used for a data transmission based on channel conditions. The goal of this selection process is to maximize throughput while meeting quality objectives, which may be quantified by a particular frame error rate (FER), certain latency criteria, and so on. One straightforward technique for selecting data rates and coding and modulation schemes is to “bit load” each frequency bin of each spatial subchannel according to its transmission capability, which may be quantified by the bin's short-term average SNR. However, this technique has several major drawbacks. First, coding and modulating individually for each bin of each spatial subchannel can significantly increase the complexity of the processing at both the transmitter and receiver. Second, coding individually for each bin may greatly increase coding and decoding delay. And third, a high feedback rate may be needed to send channel state information (CSI) indicative of the channel conditions (e.g., the gain, phase and SNR) of each bin. There is therefore a need in the art for achieving high throughput in a coded MIMO system without having to individually code different frequency bins of the spatial subchannels. | Mid | [
0.593258426966292,
33,
22.625
] |
Man U's Alex Ferguson retiring at end of season MANCHESTER, England - Manchester United manager Alex Ferguson is retiring at the end of the season, bringing an end to more than 26 trophy-filled years at the club. "The decision to retire is one that I have thought a great deal about and one that I have not taken lightly," Ferguson said in a statement on Wednesday. "It is the right time." The club did not immediately announce a successor. Since taking charge at Old Trafford in 1986, Ferguson has established himself as the most successful manager in British soccer history, having reversed a previous plan to retire at the end of the 2001-02 season. After the Scotsman secured a 13th Premier League title two weeks ago — extending the club's record English championship haul to 20 — he declared that he had no retirement thoughts. But now he has just two more matches left in charge of the club he has turned into one of the world's biggest sports teams. "It was important to me to leave an organization in the strongest possible shape and I believe I have done so," Ferguson said. "The quality of this league winning squad, and the balance of ages within it, bodes well for continued success at the highest level whilst the structure of the youth setup will ensure that the long-term future of the club remains a bright one." Ferguson will stay at the club as a director and an ambassador. "With these activities, along with my many other interests, I am looking forward to the future," Ferguson said. "I must pay tribute to my family, their love and support has been essential." | Mid | [
0.5961123110151181,
34.5,
23.375
] |
User Fields A user field is a data field associated to a user entity that is formed by processing a raw piece of data from a data stream and resolving it to a user identifier, which make it available for segmentation in the Lytics segment builder. | Low | [
0.42489270386266004,
24.75,
33.5
] |
Selenium-assisted nucleic acid crystallography: use of phosphoroselenoates for MAD phasing of a DNA structure. The combination of synchrotron radiation and a variety of atoms or ions (either covalently attached to the biomolecule prior to crystallization or soaked into crystals) that serve as anomalous scatterers constitutes a powerful tool in the X-ray crystallographer's repertoire of structure determination techniques. Phosphoroselenoates in which one of the nonbridging phosphate oxygens in the backbone is replaced by selenium offer a simplified means for introducing an anomalous scatterer into oligonucleotides by conventional solid-phase synthesis. Unlike other methods that are used to derivatize DNA or RNA by covalent attachment of a heavy atom (i.e., bromine at the C5 position of pyrimidines), tedious synthesis of specialized nucleosides is not required. Introduction of selenium is readily accomplished in solid-phase oligonucleotide synthesis by replacing the standard oxidation agent with a solution of potassium selenocyanide. This results in a diastereomeric mixture of phosphoroselenoates that can be separated by strong anion-exchange HPLC. As a test case, all 10 DNA hexamers of the sequence CGCGCG containing a single phosphoroselenoate linkage (PSe) were prepared. Crystals were grown for a subset of them, and the structure of [d(C(PSe)GCGCG)](2) was determined by the multiwavelength anomalous dispersion technique and refined to 1.1 A resolution. | High | [
0.6799007444168731,
34.25,
16.125
] |
The FUSION Foundation Intelligence (FFI) Conference kicked off at 9:30 am in New York City at the Hilton Hotel. More than 50 team and community members, advisors, highly influential finance executives and media were present. DJ Qian, Visionary and Principal of the the FUSION Foundation, opened proceedings following 3 days of intense and successful participation at Consensus 2018. DJ made some incredible announcements with regards to FUSIONs Mainnet release, adoption of the FUSION blockchain, Academic partnerships and the Testnet release date. The full details of the Technology announcement can be read here. As a summary, the following innovative and revolutionary features will be available on the FUSION Blockchain when the Mainnet is released: Lock-in Lock-out Mechanism Token ‘Time Lock’ Short address notation Cross-chain capability New token issue Token swap Again, please read ‘DJ Qian on FUSION Technology at FFI’ for more information. 2. The full details on the Adoption of the FUSION Blockchain announcement can be read here. Here is a short summary. DJ announced that a very significant amount of assets will be locked-in onto the Fusion blockchain after Mainnnet release, from partnerships with Carnex KuaiLaiCai and FomulA. 3. DJ announced agreements for technology joint research have been signed with Tongji University and Xidian University, and a third is in the making with the Brandeis International Business School for research in distributed economy and cryptofinance. 4. The Fusion Foundation officially established the Foundation Intelligence Team and the Industry Adoption team on May 17th, now adding that they will be headquartered in NY. Here is a picture with the FFI team, from the left Dr Najam Kidwai, Jeff Singer, DJ Qian and Eric Weinstein (FFI Member Daniel Petrozzo was absent from the photo). FUSION Foundation Intelligence team. 5. Testnet will be released on May 31st. Testnet release After an incredible string of announcements delivered by DJ, it was amazing to listen and learn from some of the Finance industries biggest names via speeches and panel discussions. All presenters shared valuable insights into the finance industries perspective on Blockchain, challenges for industry adoption, strategic next moves and much more. Here is a picture of the panel discussion on ‘The Evolution of Trading and Investing Strategies in the Tokenized Cryptofinancial Future’. Panel Discussion at FFI Conference After a long and successful day, the FFI Conference concluded with dinner upstairs at the Hilton where the conversations continued into the late evening. The FFI Conference was the highlight of an incredible week and amazing way to finish off The FUSION Foundation’s trip to NYC for Consensus 18 and the Conference itself. | Mid | [
0.649038461538461,
33.75,
18.25
] |
You’re damn right that deserves to be written in all caps. Doug Gilmour is one of the biggest reasons I became a Leafs fan, although I admit that even when I was still hanging on to my childhood affection for the Canadiens, I already had a crush on Killer. What sane girl didn’t? And for that matter, what sane guy? Because there is no platonic man love like the love of a Leafs fan for Dougie Gilmour. Just ask Don Cherry once you get past the jump. The Kingston, ON native was drafted 134th overall in the 1982 NHL Draft by the St. Louis Blues. But it was in Calgary that Gilmour made his mark, scoring a couple of timely Game 6 goals to help the Flames win the Stanley Cup in 1989 against the Montreal Canadiens (ingrained in my brain forever: the image of the legendary Lanny McDonald shaving his playoff beard). Then it was off to Toronto in the notorious 10-player deal/hosing of Doug Risebrough by Cliff Fletcher in 1992. These were glorious years for Leafs Nation, when the team was a force to be reckoned with in the postseason. Of course, you will recall that they came thisclose to reaching the Stanley Cup Final in 1993 and might have made it had it not been for this infamous non-call by Kerry Fraser: To this day, raise Gretzky’s name to Mr. Bee and he will have nothing good to say about The Great One because of that very moment. Sadly (literally, it was the only hockey trade that ever made me cry), Gilmour was traded to the Devils in 1997 for Steve Sullivan, Alyn MaCauley and Jason Smith. The Leafs would eventually get him back for two more tours of duty between stints in Chicago, Buffalo and Montreal. But his third time as a Leaf was short-lived: during his second shift in his first game back in 2003, he ran into Calgary Flame Dave Lowry and tore his ACL. It was an abrupt and unfortunate end to a great career. Gilmour scored 450 goals and more than 960 assists over the course of his 20 year career. His most productive years were with the Leafs, notably the 1992-93 season in which he scored 127 points. Other notable seasons include hitting the 40 goal plateau with St. Louis in 1986-87, and of course, his performance in his only Stanley Cup winning postseason with the Calgary Flames (11 goals, 11 assists). While he did end up being somewhat of an NHL journeyman as his career declined, Dougie will always be regarded as a Leaf, and specifically, the Leaf with the best hair (for the time). Total Killer here. Dougie was always known for his great hair. The strange thing was, I converted from Habs fan to Leafs fan for Doug Gilmour. And he could always rock the suit. Of course, no one worshipped Dougie more than Don Cherry. Enjoy these highlights (but forgive the suit. Oh, the early 90s.) | Mid | [
0.6271929824561401,
35.75,
21.25
] |
Q: Need some ASP.NET MVC Routing Help I've started with ASP.NET MVC recently, reading blogs, tutorials, trying some routes, etc. Now, i've stumbled on a issue where i need some help. Basically, i have an URL like /products.aspx?categoryid=foo&productid=bar Most tutorials/examples propose to map this to something like: /products/category/foo/bar where "products" is the controller, "category" is the action, etc. But i need to map it to /products/foo/bar. (without "category") Is it possible? Am i missing something? Help will be highly appreciated. Thank you advance :) P.S. Sorry for my bad English. A: (your English is just fine, no need to apologize!) You can define a route like this: routes.MapRoute("productsByCategory", "products/{category}/{productid}", new { controller="products", action="findByCategory" }) This will match products/foo/bar and call an action looking like this: public class ProductsController : Controller { ... public ActionResult FindByCategory(string category, string productid) { .... } } does this help? | High | [
0.71004243281471,
31.375,
12.8125
] |
Inhibition of heme oxygenase-1 protects against tissue injury in carbon tetrachloride exposed livers. During the metabolism of the hepatotoxin carbon tetrachloride (CCl(4)) by cytochrome P450, heme, and free radicals are released. Heme oxygenase (HO-1) is an enzyme that is induced by heme as well as oxidative stress and has been reported to be involved in mediating protection against toxic liver injury. The purpose of the present study was to specify the role of HO-1 in CCl(4)-hepatotoxicity. We could demonstrate an up-regulation of HO-1 protein in CCl(4)-exposed liver tissue that reaches its maximum after 6 to 12 h, along with intrahepatic leukocyte accumulation and tissue injury. When animals were pretreated with hemin for augmentation of HO-1 expression, CCl(4)-exposure was associated with a reduction of intrahepatic leukocyte accumulation, while inhibition of CCl(4)-induced HO-1 expression by tin protoporphyrin-IX (SnPP-IX) enhanced leukocytic response. Of interest, however, liver morphology, transaminases, and bile flow as parameters of hepatocellular integrity and excretory function did not concur with reduced leukocyte numbers in the hepatic microcirculation, and revealed best organ function and tissue preservation in case of HO-1 inhibition by SnPP-IX. In contrast, hemin-treated CCl(4)-exposed livers demonstrated pathologic enzyme release and cholestasis. Taken together, inhibition of HO-1 in CCl(4)-hepatotoxicity protected the liver, while higher HO-1 activity harmed liver tissue, most probably due to interference of the HO-1 pathway with CCl(4)-dependent metabolism via cytochrome P450 and heme overload-associated toxicity. | High | [
0.6632390745501281,
32.25,
16.375
] |
Q: Loop for printing a statement multiple time in excel I'm new here and need your help, I have been assigned a project where I have to model beam calculations on an excel spreadsheet. My problem is that I can't find any command which can help me print a statement 'x' number of times. E.g. I ask the user for the number of spans his beam has, and depending on the input, I want this statement(s) to be displayed: "Enter load for span 1" "Enter load for span 2" "Enter load for span 3" And so on..... Help please. A: Your description is not that detailed, but I took a shot, and from what I understand you might be looking to have something like this: Where you would put a number into B1, and then column C would print out as many statements as requested. Here's the formula to that: C1=IF(ROW()<=B$1,"Enter load for Span " & ROW(),"") If this is not what you were looking for, show some effort and explain your situation more accurate ;) | Mid | [
0.6055979643765901,
29.75,
19.375
] |
Tell us some more! Your answer needs to include more details to help people.You can't post answers that contain an email address.Please enter a valid email address.The email address entered is already associated to an account.Login to postPlease use English characters only. Attachments: Added items Related Questions: Use the Math.Round() function. It takes two arguments, the first is your number or a variable holding your number and the second is the number of decimal places. This will only round to fractions of a whole number though and you need to round to the nearest 10. So divide your number by 10 before you round to shift the decimal place once to the left and multiply by 10 again afterwards to shift it back again. Step 2.Import Kodak video files to Kodak video converter.Step 3.Trim Kodak video lengthClick on the "Clip" button to trim Kodak video length by dragging the start slider and end slider to set the start and finish of the Kodak video clip you want. There are three ways you can do the trimming as shown below.Step 4.Crop Kodak videoClick on the "Crop" tab on the "Edit" interface and you can start to crop Kodak video. This cropping feature is to let you zoom in the part of the video screen you want or remove redundant sides from your Kodak video. From the preview screen on the left, you can see a green crop frame. You can just drag each of the four sides of the frame to do the cropping.Step 5.Edit Kodak video effectsClick on the "Effect" tab on the "Edit" interface and you can drag the sliders to edit Kodak video brightness, contract and saturation, and also select a special effect from Gray, Emboss and Old film to apply to your Kodak video. Kodak Video Converter come with two screens so you can instantly preview what the final video will look like. Step 6.Now you can select the formats you prefer and then convert your Kodak videos. You could assemble a simple Excel spreadsheet and then total, average, find the mean, standard deviation, trend or a host of other answers or information. You can lock the spreadsheet so no one can tamper with it or change the structure. That would be much easier than creating a special program unless there is a specific reason to do so. 1.VARCHARs with length less than 4 become CHARs2.CHARs with length more than 3 become VARCHARs.3.NOT NULL gets added to the columns declared as PRIMARY KEYs4.Default values such as NULL are specified for each column To set1. Push the set button, you will get ------ 2. Push the user3. Push set again the user number will blink 3 times and show 0.04. Get on the scale- when it shows your weight push the set button. This is your start weight5. Then it will automatically take 10% and show your goal.6. Push the set button again this will set the goal To Weigh1. Push the user number that you set up the P-? number will blink 3 times and show 0.02. Get on the scale it will show in this ordera. your weight nowb. your weight since the last time you weighedc. The total loss toward this goald. Total needed to reach your goal Try inserting seperate entry for furture day number and then reference that entry address for program math. You will have to either use same number of days to repeat (automatic) this math or accept that it would be a single shot type math. Depending on which version of excel you are using the alert can be a sound or color change. If 97 or older, there is no alert available. 2000 isn't much better. Easier to set furture date in orginial date block right from the start. Unless you are running the excel program continuously in the background, program will only check date when running. keyboard event are delivered to the component that has "keyboard focus". Looks like somebody is stealing focus from your active x control. It would be the best to find whom and disable it but if not the quickest hack is: 1. set timer in you application say for 100 milliseconds. 2. check if your your active x control has focus (there should be analog of GetFocus in VB). 3. if not - call something similar to Win32.SetFocus with the handle of your control. Let me know if you still have problems. | Low | [
0.5030549898167,
30.875,
30.5
] |
Science benefits tremendously from mutual exchanges of information and pooling of effort and resources. The combination of different skills and diverse knowledge is a powerful capacity, source of new intuitions and creative insights. Therefore multidisciplinary approaches can be a great opportunity to explore novel scientific horizons. Collaboration is not only an opportunity, it is essential when tackling today’s global challenges by exploiting our fast growing wealth of data. In this paper we introduce the concept of Information-Powered Collaborations (IPC) — an abstraction that captures those requirements and opportunities. We propose a conceptual framework that partitions the inherent complexity of such dynamic environments and offers concrete tools and methods to thrive in the data revolution era. Such a framework promotes and enables information sharing from multiple heterogeneous sources that are independently managed. We present the results of assessing our approach as an IPC for solid-Earth sciences: the European Plate Observing System (EPOS). | High | [
0.6729222520107231,
31.375,
15.25
] |
In a Nutshell Customize a silvery bracelet with colorful glass beads or a charm that can be engraved; shipping is included The Fine Print Promotional value expires 90 days after purchase. Amount paid never expires.Limit 3 per person, may buy 2 additional as gifts. Limit 1 per order. Online only. Shipping included.Merchant is solely responsible to purchasers for the care and quality of the advertised goods and services. IRIS Beads & Charms The Deal The bracelet comes with two colorful glass beads and a charm that can be engraved with up to two lines. This deal includes shipping. IRIS Beads & Charms are compatible with other major international bead and charm brands. Joseph Nogucci At first glance, Joseph Nogucci's jewelry seems like most wearable art, albeit wearable art that has appeared in such publications as Elle and InStyle. But there's more to it than meets the eye. | Mid | [
0.59338061465721,
31.375,
21.5
] |
Brexit deal imminent! Wait, no, Brexit deal off due to Theresa May’s inability to convince Dominic Raab/moody backbenchers/every Cabinet minister who aspires to lead the Conservative Party. Brexit deal back on? It depends which paper you read. Almost everyone at Westminster expects that there will be movement on Brexit some point later this week or early the next. By “movement”, of course, what they mean is that the United Kingdom will make a concession that May will desperately try to package as a defeat for the EU27. May’s problem is that she has lost the trust of both the Brexit press and the ultras in her own party, so she has a much smaller chance of selling the next concession as a great British victory. | Low | [
0.48818897637795206,
31,
32.5
] |
The present invention relates to hand held exercise devices, specifically to an improved fillable hand held exercise device. Heretofore, the sole purpose of consumer goods containers and their closures has been to contain,package, store and/or display their original contents, after which they are then promptly thrown out. At most, some have had a static second life use as storage receptacles, decorative decanters, or flower vases. But very seldom do we find containers and their closures specifically designed for a novel, dynamic and functional second life use, more specifically, a fillable hand held exercise device. Although many different types of fillable hand held exercise devices are known to exist, none suggest the transition from, or similarity with, any container and dual sided closure combination, or vice versa, nor does any container and dual sided closure, or fillable hand held exercise device suggest the unique features necessary to effect such a transition or similarity. The most common fillable dumbbell product now known to exist is simply comprised of a one piece cylindrical container with a slightly narrower midsection for gripping, and a closure at the top. This type of fillable dumbbell is characterized by bells/chambers just slightly larger in circumference than its grip area because of the blow molding limitations imposed by that design, and necessitates having bells/chambers too small to adequately weight when filled with water. | Low | [
0.5330578512396691,
32.25,
28.25
] |
CASC Scholarships for SC06 The high performance computing community will be best able to to drive new innovations in development of advanced computing systems, and the use of high performance computing systems to generate new pathbreaking discoveries, if it attracts the best talent from the full spectrum of American society. Historically, the high performance computing community (HPC) has not done well at attracting individuals from traditionally underserved groups (defined by the National Science Foundation as African Americans, Hispanic Americans, Native Americans, and Pacific Islanders). The Coalition for Advance Scientific Computing (www.casc.org) is offering travel support to faculty and IT professionals who would like to attend SC06 but who would have difficulty meeting travel and registration expenses without support from CASC. Apply for support for attendance at SC06 now! For the second year in a row, CASC will provide support for individuals from TUGs to attend SC06 (http://sc06.supercomputing.org/). Priority will be given to faculty and IT professionals. Support will be provided for up to three individuals, and if there are fewer than three requests for faculty and professional IT staff, CASC may support student attendance as well. Interested parties should contact a CASC site representative (list of representatives at http://www.casc.org/members1.html), and submit a letter requesting funding along with a letter of endorsement from a CASC representative to [email protected]. The criteria and requirements for this program are as follows: Priority will be given to faculty or IT professionals who are a member of a traditionally underserved group (as defined by the NSF). Students may also apply. Must be either a US citizen or permanent resident Must be able to attend all MSI-related activities at SC06. Must present what they have learned at the conference to their colleagues at their home institution, and must seek out and serve as a mentor in the area of high performance computing to one other faculty member and one student from TUGs. Must submit a brief but formal report to CASC. Preference for funding will go to those who would otherwise have difficulty finding funds to attend. Deadline for application: 6 October 2006; applicants will receive notification by 11 October 2006. Events ARSC Office has Relocated As of November 3, 2014, the ARSC office has moved to the Elvey Building, suite 508, on the UAF campus. ARSC staff and User Support are available Monday through Friday 8am to 5pm in Elvey 508 . The physical address for the new location is 903 Koyukuk Drive. Phone numbers, email addresses, and all other ARSC services have remained the same. The HPC clusters and archival storage silo will remain in the Butrovich Computing Facility. Connect with ARSC The University of Alaska Fairbanks is an affirmative action/equal opportunity employer and educational institution and is a part of the University of Alaska system. Arctic Region Supercomputing Center (ARSC) |PO Box 756020, Fairbanks, AK 99775 | voice: 907-450-8602 | fax: 907-450-8601 | Supporting high performance computational research in science and engineering with emphasis on high latitudes and the arctic. For questions or comments regarding this website, contact [email protected] | High | [
0.6683544303797461,
33,
16.375
] |
[Accuracy of placenta accreta prenatal diagnosis by ultrasound and MRI in a high-risk population]. Main objective was to compare accuracy of ultrasonography and MRI for antenatal diagnosis of placenta accreta. Secondary objectives were to specify the most common sonographic and RMI signs associated with diagnosis of placenta accreta. This retrospective study used data collected from all potential cases of placenta accreta (patients with an anterior placenta praevia with history of scarred uterus) admitted from 01/2010 to 12/2014 in a level III maternity unit in Strasbourg, France. High-risk patients beneficiated antenatally from ultrasonography and MRI. Sonographic signs registered were: abnormal placental lacunae, increased vascularity on color Doppler, absence of the retroplacental clear space, interrupted bladder line. MRI signs registered were: abnormal uterine bulging, intraplacental bands of low signal intensity on T2-weighted images, increased vascularity, heterogeneous signal of the placenta on T2-weighed, interrupted bladder line, protrusion of the placenta into the cervix. Diagnosis of placenta accreta was confirmed histologically after hysterectomy or clinically in case of successful conservative treatment. Twenty-two potential cases of placenta accreta were referred to our center and underwent both ultrasonography and MRI. All cases of placenta accreta had a placenta praevia associated with history of scarred uterus. Sensibility and specificity for ultrasonography were, respectively, 0.92 and 0.67, for MRI 0.84 and 0.78 without significant difference (p>0.05). The most relevant signs associated with diagnosis of placenta accreta in ultrasonography were increased vascularity on color Doppler (sensibility 0.85/specificity 0.78), abnormal placental lacunae (sensibility 0.92/specificity 0.55) and loss of retroplacental clear space (sensibility 0.76/specificity 1.0). The most relevant signs in MRI were: abnormal uterine bulging (sensitivity 0.92/specificity 0.89), dark intraplacental bands on T2-weighted images (sensitivity 0.83/specificity 0.80) or placental heterogeneity (sensitivity 0.92/specificity 0.89). Association of two sonographic or MRI signs had the best sensitivity/specificity ratio. Ultrasonography and RMI represent two interesting and complementary diagnostic tools for antenatal diagnosis of placenta accreta. Because of its cost and accessibility, ultrasonography remains the first in line to be used for diagnosis. Use of an analytical grid for diagnosis of placenta accreta could be helpful. | High | [
0.680965147453083,
31.75,
14.875
] |
Gluten Free Corned Beef Hash Frittata Recipe There is this place I go to for breakfast – a little hole-in-the-wall that makes really fabulous diner-style breakfasts and I can get a lot gluten free because they use The post Gluten Free Corned Beef Hash Frittata Recipe appeared first on Simply Gluten Free. | Mid | [
0.612529002320185,
33,
20.875
] |
The National Security Agency has been secretly collecting the phone call records of tens of millions of Americans, using data provided by AT&T, Verizon and BellSouth, people with direct knowledge of the arrangement told USA TODAY. The NSA program reaches into homes and businesses across the nation by amassing information about the calls of ordinary Americans — most of whom aren't suspected of any crime. This program does not involve the NSA listening to or recording conversations. But the spy agency is using the data to analyze calling patterns in an effort to detect terrorist activity, sources said in separate interviews. "It's the largest database ever assembled in the world," said one person, who, like the others who agreed to talk about the NSA's activities, declined to be identified by name or affiliation. The agency's goal is "to create a database of every call ever made" within the nation's borders, this person added. For the customers of these companies, it means that the government has detailed records of calls they made — across town or across the country — to family members, co-workers, business contacts and others. And as I noted, Bush lied to us about the program. It's far worse than he promised. The NSA's domestic program, as described by sources, is far more expansive than what the White House has acknowledged. Last year, Bush said he had authorized the NSA to eavesdrop — without warrants — on international calls and international e-mails of people suspected of having links to terrorists when one party to the communication is in the USA. Warrants have also not been used in the NSA's efforts to create a national call database. In defending the previously disclosed program, Bush insisted that the NSA was focused exclusively on international calls. "In other words," Bush explained, "one end of the communication must be outside the United States." As a result, domestic call records — those of calls that originate and terminate within U.S. borders — were believed to be private. Sources, however, say that is not the case. With access to records of billions of domestic calls, the NSA has gained a secret window into the communications habits of millions of Americans. AT&T, Verizon and BellSouth giving the NSA the phone records of tens of millions of innocent Americans. Program goes far beyond what Bush claimed. UPDATE: The phone companies were NOT required to turn over our records - Qwest refused - but AT&T, Verizon and BellSouth gave the Mein Kampf salute. Pigs._________ Remember that little canard about making sure a terrorist was on one end of the line, and making sure it was an international call? Not so much. In fact, the government's goal is to get every phone record in the country - we're talking a record of every phone call you ever make or receive. The National Security Agency has been secretly collecting the phone call records of tens of millions of Americans, using data provided by AT&T, Verizon and BellSouth, people with direct knowledge of the arrangement told USA TODAY. The NSA program reaches into homes and businesses across the nation by amassing information about the calls of ordinary Americans — most of whom aren't suspected of any crime. This program does not involve the NSA listening to or recording conversations. But the spy agency is using the data to analyze calling patterns in an effort to detect terrorist activity, sources said in separate interviews. "It's the largest database ever assembled in the world," said one person, who, like the others who agreed to talk about the NSA's activities, declined to be identified by name or affiliation. The agency's goal is "to create a database of every call ever made" within the nation's borders, this person added. For the customers of these companies, it means that the government has detailed records of calls they made — across town or across the country — to family members, co-workers, business contacts and others. And as I noted, Bush lied to us about the program. It's far worse than he promised. The NSA's domestic program, as described by sources, is far more expansive than what the White House has acknowledged. Last year, Bush said he had authorized the NSA to eavesdrop — without warrants — on international calls and international e-mails of people suspected of having links to terrorists when one party to the communication is in the USA. Warrants have also not been used in the NSA's efforts to create a national call database. In defending the previously disclosed program, Bush insisted that the NSA was focused exclusively on international calls. "In other words," Bush explained, "one end of the communication must be outside the United States." As a result, domestic call records — those of calls that originate and terminate within U.S. borders — were believed to be private. Sources, however, say that is not the case. With access to records of billions of domestic calls, the NSA has gained a secret window into the communications habits of millions of Americans. AMERICABLOG KUDOS Include your pet's photo in our rotating archive by sending it to [email protected]. Make sure you put "pet" in the subject line, and tell us something about your pet (goofy, touching, whatever you like), and we just might write a post about it too! | Mid | [
0.5846867749419951,
31.5,
22.375
] |
{ "name": "@bbc/gel-foundations/prop-types", "private": true, "main": "../dist/prop-types", "module": "../esm/prop-types", "sideEffects": false } | Low | [
0.47454175152749406,
29.125,
32.25
] |
re 12:57 PM? 12:07 PM How many minutes are there between 9:35 PM and 6:03 AM? 508 What is 491 minutes before 3:37 PM? 7:26 AM What is 532 minutes before 3:59 PM? 7:07 AM What is 616 minutes before 3:22 AM? 5:06 PM How many minutes are there between 4:33 PM and 11:31 PM? 418 How many minutes are there between 5:45 PM and 7:21 PM? 96 How many minutes are there between 9:14 AM and 6:56 PM? 582 How many minutes are there between 10:46 AM and 4:03 PM? 317 How many minutes are there between 9:05 AM and 1:25 PM? 260 What is 156 minutes after 10:16 AM? 12:52 PM What is 49 minutes before 10:07 PM? 9:18 PM How many minutes are there between 7:50 PM and 4:02 AM? 492 How many minutes are there between 5:24 AM and 5:49 AM? 25 What is 612 minutes after 6:02 AM? 4:14 PM What is 505 minutes after 4:26 PM? 12:51 AM How many minutes are there between 8:15 AM and 12:25 PM? 250 How many minutes are there between 12:37 AM and 4:49 AM? 252 What is 304 minutes after 10:56 PM? 4:00 AM What is 485 minutes before 11:32 AM? 3:27 AM What is 373 minutes before 10:16 PM? 4:03 PM What is 662 minutes after 8:14 PM? 7:16 AM What is 703 minutes before 10:49 PM? 11:06 AM How many minutes are there between 4:31 AM and 4:19 PM? 708 What is 448 minutes after 7:45 PM? 3:13 AM How many minutes are there between 2:18 PM and 10:46 PM? 508 What is 14 minutes before 3:51 PM? 3:37 PM What is 120 minutes before 6:42 AM? 4:42 AM What is 526 minutes after 8:29 AM? 5:15 PM How many minutes are there between 3:56 PM and 3:33 AM? 697 How many minutes are there between 6:31 AM and 7:06 AM? 35 How many minutes are there between 5:09 AM and 7:17 AM? 128 How many minutes are there between 1:54 PM and 12:54 AM? 660 What is 260 minutes after 1:06 AM? 5:26 AM What is 298 minutes after 4:20 AM? 9:18 AM How many minutes are there between 11:01 PM and 5:00 AM? 359 How many minutes are there between 6:30 AM and 6:40 AM? 10 What is 457 minutes after 6:41 PM? 2:18 AM What is 514 minutes after 3:13 PM? 11:47 PM What is 128 minutes after 10:29 AM? 12:37 PM How many minutes are there between 8:57 AM and 6:04 PM? 547 What is 583 minutes after 8:22 PM? 6:05 AM What is 714 minutes after 10:45 PM? 10:39 AM What is 703 minutes before 7:02 AM? 7:19 PM How many minutes are there between 9:36 PM and 11:27 PM? 111 What is 428 minutes after 1:51 PM? 8:59 PM What is 663 minutes before 4:52 PM? 5:49 AM What is 605 minutes before 2:22 PM? 4:17 AM How many minutes are there between 11:01 PM and 6:10 AM? 429 What is 89 minutes before 10:01 PM? 8:32 PM How many minutes are there between 5:50 AM and 8:25 AM? 155 How many minutes are there between 4:23 AM and 6:35 AM? 132 What is 49 minutes before 4:32 PM? 3:43 PM How many minutes are there between 6:22 AM and 4:34 PM? 612 How many minutes are there between 2:40 AM and 8:40 AM? 360 How many minutes are there between 3:29 AM and 10:10 AM? 401 What is 240 minutes after 5:05 PM? 9:05 PM What is 244 minutes after 9:13 PM? 1:17 AM How many minutes are there between 10:30 PM and 7:37 AM? 547 What is 472 minutes before 12:09 AM? 4:17 PM What is 266 minutes after 3:07 AM? 7:33 AM How many minutes are there between 10:58 PM and 5:23 AM? 385 How many minutes are there between 7:31 AM and 7:33 AM? 2 How many minutes are there between 9:21 AM and 4:05 PM? 404 What is 572 minutes after 2:12 AM? 11:44 AM What is 466 minutes after 4:09 AM? 11:55 AM What is 376 minutes before 2:58 PM? 8:42 AM How many minutes are there between 9:43 PM and 10:52 PM? 69 How many minutes are there between 2:51 AM and 8:45 AM? 354 How many minutes are there between 5:18 AM and 11:52 AM? 394 What is 624 minutes before 10:21 PM? 11:57 AM What is 423 minutes after 6:40 PM? 1:43 AM What is 617 minutes before 1:17 PM? 3:00 AM How many minutes are there between 2:05 AM and 5:56 AM? 231 What is 430 minutes before 7:37 PM? 12:27 PM What is 111 minutes after 6:50 PM? 8:41 PM What is 660 minutes after 4:50 PM? 3:50 AM How many minutes are there between 6:19 PM and 10:23 PM? 244 What is 607 minutes before 2:08 PM? 4:01 AM What is 40 minutes after 7:59 PM? 8:39 PM How many minutes are there between 4:34 PM and 2:26 AM? 592 What is 416 minutes after 4:22 AM? 11:18 AM How many minutes are there between 7:09 PM and 11:48 PM? 279 How many minutes are there between 2:36 PM and 1:54 AM? 678 How many minutes are there between 9:57 AM and 8:54 PM? 657 What is 628 minutes before 12:17 PM? 1:49 AM How many minutes are there between 7:35 AM and 7:47 AM? 12 What is 325 minutes before 12:14 AM? 6:49 PM What is 620 minutes before 12:38 PM? 2:18 AM How many minutes are there between 11:17 AM and 6:07 PM? 410 How many minutes are there between 3:45 PM and 1:44 AM? 599 How many minutes are there between 10:10 AM and 9:59 PM? 709 What is 76 minutes after 9:00 AM? 10:16 AM How many minutes are there between 3:39 AM and 1:28 PM? 589 How many minutes are there between 4:40 AM and 7:12 AM? 152 How many minutes are there between 9:57 AM and 2:43 PM? 286 What is 10 minutes before 7:34 PM? 7:24 PM How many minutes are there between 2:58 AM and 6:15 AM? 197 How many minutes are there between 6:20 PM and 1:29 AM? 429 How many minutes are there between 5:51 PM and 8:55 PM? 184 How many minutes are there between 12:49 AM and 12:53 AM? 4 How many minutes are there between 12:18 PM and 7:22 PM? 424 How many minutes are there between 7:50 AM and 3:37 PM? 467 How many minutes are there between 6:41 AM and 11:06 AM? 265 How many minutes are there between 11:31 PM and 10:51 AM? 680 How many minutes are there between 4:15 AM and 12:15 PM? 480 What is 693 minutes before 4:51 AM? 5:18 PM How many minutes are there between 9:09 PM and 1:19 AM? 250 How many minutes are there between 5:26 PM and 9:36 PM? 250 How many minutes are there between 11:55 PM and 8:35 AM? 520 How many minutes are there between 12:06 AM and 5:11 AM? 305 How many minutes are there between 11:43 PM and 2:15 AM? 152 What is 115 minutes after 5:27 AM? 7:22 AM What is 570 minutes after 6:14 AM? 3:44 PM What is 496 minutes after 10:39 AM? 6:55 PM How many minutes are there between 1:57 PM and 5:11 PM? 194 How many minutes are there between 5:02 PM and 5:40 PM? 38 How many minutes are there between 7:53 AM and 7:23 PM? 690 How many minutes are there between 8:33 PM and 9:49 PM? 76 What is 238 minutes before 12:56 PM? 8:58 AM How many minutes are there between 9:45 AM and 12:30 PM? 165 How many minutes are there between 12:15 PM and 8:27 PM? 492 How many minutes are there between 2:43 PM and 1:22 AM? 639 How many minutes are there between 10:38 PM and 4:09 AM? 331 What is 209 minutes after 6:15 PM? 9:44 PM What is 89 minutes before 2:24 AM? 12:55 AM How many minutes are there between 5:25 AM and 7:49 AM? 144 How many minutes are there between 4:37 AM and 2:24 PM? 587 What is 39 minutes after 12:30 PM? 1:09 PM How many minutes are there between 2:48 AM and 10:11 AM? 443 How many minutes are there between 9:17 PM and 6:05 AM? 528 How many minutes are there between 3:56 PM and 12:07 AM? 491 How many minutes are there between 1:56 PM and 1:50 AM? 714 How many minutes are there between 1:32 AM and 9:05 AM? 453 What is 647 minutes after 3:23 PM? 2:10 AM How many minutes are there between 7:41 PM and 10:31 PM? 170 How many minutes are there between 1:39 PM and 9:41 PM? 482 How many minutes are there between 5:12 PM and 10:15 PM? 303 What is 532 minutes before 2:09 AM? 5:17 PM What is 401 minutes after 12:28 AM? 7:09 AM How many minutes are there between 2:57 PM and 12:44 AM? 587 What is 457 minutes after 4:54 AM? 12:31 PM What is 141 minutes before 4:03 AM? 1:42 AM What is 385 minutes after 5:58 AM? 12:23 PM How many minutes are there between 11:57 AM and 3:20 PM? 203 What is 678 minutes after 9:45 AM? 9:03 PM What is 703 minutes after 8:32 AM? 8:15 PM What is 520 minutes before 7:36 PM? 10:56 AM How many minutes are there between 6:50 AM and 1:50 PM? 420 How many minutes are there between 8:29 AM and 6:20 PM? 591 What is 309 minutes before 11:02 AM? 5:53 AM What is 171 minutes after 11:09 AM? 2:00 PM What is 304 minutes before 3:47 PM? 10:43 AM How many minutes are there between 2:23 AM and 10:11 AM? 468 What is 153 minutes before 3:46 AM? 1:13 AM What is 481 minutes after 6:22 AM? 2:23 PM What is 3 | Low | [
0.5277161862527711,
29.75,
26.625
] |
Pedunculated intraluminal oesophageal fibrolipoma. A case report. Benign tumours of the oesophagus are rare. A patient with a pedunculated intraluminal tumour presented with dysphagia of recent onset and the tumour resected at open operation and histology was confirmed as a benign vascular fibrolipoma. We discuss the management and review the relevant literature. | Mid | [
0.621983914209115,
29,
17.625
] |
SRAM X01 GripShift SRAM X01 GripShift 120.00 Three decades ago, SRAM was founded on a product called Grip Shift, and an idea that shifting a bike should be easier, better and more intuitive. It’s more advanced than the original, but the all-new X01 Eagle™ Grip Shift follows in the same tradition of making shifting easier, better and more intuitive. The new X01 Eagle™ Grip Shift system includes new, robust internals that make it more durable and its shifting performance more precise. But just like the original, it is total control in the palm of your hand. New Grip Shift mechanism takes SRAM’s original invention to an increased level of precision, durability. | High | [
0.6915629322268321,
31.25,
13.9375
] |
Unikernels – Rethinking Cloud Infrastructure - jonbaer http://unikernel.org/ ====== markokrajnc "Unikernels are specialised, single-address-space machine images..." -> I can also imagine a unikernel with virtual memory where core part/kernel would run in one process & memory space and the application part runnning in another process/memory space... | Mid | [
0.6129032258064511,
28.5,
18
] |
using System; using System.Collections.Generic; using System.Linq; using System.Linq.Expressions; using System.Text; using System.Threading.Tasks; using Nessos.GpuLinq.Base; using Nessos.GpuLinq.CSharp; using Nessos.GpuLinq.Core; using FMath = Nessos.GpuLinq.Core.Functions.Math; using System.Runtime.InteropServices; using System.Diagnostics; namespace BlackScholes.CSharp { class Program { [StructLayout(LayoutKind.Sequential)] struct InputData { public float Stock; public float Strike; public float Times; } [StructLayout(LayoutKind.Sequential)] struct OutPutData { public float Call; public float Put; public override string ToString() { return String.Format("C:{0:0.###} P:{1:0.###}", Call, Put); } public bool IsEqual(OutPutData rhs) { return this.Call == rhs.Call && this.Put == rhs.Put; } } struct Results { public OutPutData Cpu; public OutPutData Gpu; public override string ToString() { return String.Format("\nCpu : {0} Gpu : {1}", Cpu, Gpu); } } static OutPutData[] CpuBlackScholes(InputData[] data) { const int optionCount = 1000000; const double riskFreeInterestRate = 0.02; const double volatility = 0.30; const double A1 = 0.31938153; const double A2 = -0.356563782; const double A3 = 1.781477937; const double A4 = -1.821255978; const double A5 = 1.330274429; Func<double, double> k = x => 1.0 / (1.0 + 0.2316419 * Math.Abs(x)); Func<double, double> cnd = x => { var v = k.Invoke(x); return 1.0 - 1.0 / Math.Sqrt(2.0 * Math.PI) * Math.Exp(-(Math.Abs(x)) * (Math.Abs(x)) / 2.0) * (A1 * v + A2 * v * v + A3 * Math.Pow(v, 3) + A4 * Math.Pow(v, 4) + A5 * Math.Pow(v, 5)); }; Func<double, double> cumulativeNormalDistribution = x => (x < 0.0) ? 1.0 - cnd.Invoke(x) : cnd.Invoke(x); Func<double, double, double, double> d1 = (stockPrice, strikePrice, timeToExpirationYears) => Math.Log((stockPrice / strikePrice) + (riskFreeInterestRate + volatility * volatility / 2.0)) * timeToExpirationYears / (volatility * Math.Sqrt(timeToExpirationYears)); Func<double, double, double> d2 = (_d1, timeToExpirationYears) => _d1 - volatility * Math.Sqrt(timeToExpirationYears); Func<double, double, double, double, double, double> blackScholesCallOption = (_d1, _d2, stockPrice, strikePrice, timeToExpirationYears) => (stockPrice * cumulativeNormalDistribution.Invoke(_d1) - strikePrice * Math.Exp(-(riskFreeInterestRate) * timeToExpirationYears) * cumulativeNormalDistribution.Invoke(_d2)); Func<double, double, double, double, double, double> blackScholesPutOption = (_d1, _d2, stockPrice, strikePrice, timeToExpirationYears) => strikePrice * Math.Exp(-riskFreeInterestRate * timeToExpirationYears) * cumulativeNormalDistribution.Invoke(-_d2) - stockPrice * cumulativeNormalDistribution.Invoke(-_d1); return data.Select(d => { var _d1 = d1.Invoke((double)d.Stock, (double)d.Strike, (double)d.Times); var _d2 = d2.Invoke(_d1, (double)d.Times); return new OutPutData { Call = (float)blackScholesCallOption.Invoke(_d1, _d2, d.Stock, d.Strike, d.Times), Put = (float)blackScholesPutOption.Invoke(_d1, _d2, d.Stock, d.Strike, d.Times) }; }).ToArray(); } static void Main(string[] args) { // Based on https://github.com/gsvgit/Brahma.FSharp/tree/master/Source/BlackScholes const int optionCount = 1000000; const float riskFreeInterestRate = 0.02f; const float volatility = 0.30f; const float A1 = 0.31938153f; const float A2 = -0.356563782f; const float A3 = 1.781477937f; const float A4 = -1.821255978f; const float A5 = 1.330274429f; // Helper functions Expression<Func<float, float>> k = x => 1.0f / (1.0f + 0.2316419f * FMath.Abs(x)); Expression<Func<float, float>> cnd = x => 1.0f - 1.0f / FMath.Sqrt(2.0f * FMath.PI) * FMath.Exp(-(FMath.Abs(x)) * (FMath.Abs(x)) / 2.0f) * (A1 * k.Invoke(x) + A2 * k.Invoke(x) * k.Invoke(x) + A3 * FMath.Pow(k.Invoke(x), 3) + A4 * FMath.Pow(k.Invoke(x), 4) + A5 * FMath.Pow(k.Invoke(x), 5)); Expression<Func<float, float>> cumulativeNormalDistribution = x => (x < 0.0f) ? 1.0f - cnd.Invoke(x) : cnd.Invoke(x); Expression<Func<float, float, float, float>> d1 = (stockPrice, strikePrice, timeToExpirationYears) => FMath.Log(stockPrice / strikePrice) + (riskFreeInterestRate + volatility * volatility / 2.0f) * timeToExpirationYears / (volatility * FMath.Sqrt(timeToExpirationYears)); Expression<Func<float, float, float>> d2 = (_d1, timeToExpirationYears) => _d1 - volatility * FMath.Sqrt(timeToExpirationYears); Expression<Func<float, float, float, float, float, float>> blackScholesCallOption = (_d1, _d2, stockPrice, strikePrice, timeToExpirationYears) => stockPrice * cumulativeNormalDistribution.Invoke(_d1) - strikePrice * FMath.Exp(-(riskFreeInterestRate) * timeToExpirationYears) * cumulativeNormalDistribution.Invoke(_d2); Expression<Func<float, float, float, float, float, float>> blackScholesPutOption = (_d1, _d2, stockPrice, strikePrice, timeToExpirationYears) => strikePrice * FMath.Exp(-riskFreeInterestRate * timeToExpirationYears) * cumulativeNormalDistribution.Invoke(-_d2) - stockPrice * cumulativeNormalDistribution.Invoke(-_d1); // Init data var random = new System.Random(); var data = Enumerable.Range(1, optionCount).Select(_ => new InputData { Stock = random.Random(5.0f, 30.0f), Strike = random.Random(1.0f, 100.0f), Times = random.Random(0.25f, 10.0f) }).ToArray(); // Main code Stopwatch timer = new Stopwatch(); timer.Start(); OutPutData[] results; using (GpuContext context = new GpuContext()) { using(var _data = context.CreateGpuArray(data)) { var query = (from d in _data.AsGpuQueryExpr() let _d1 = d1.Invoke(d.Stock, d.Strike, d.Times) let _d2 = d2.Invoke(_d1, d.Times) select new OutPutData { Call = blackScholesCallOption.Invoke(_d1, _d2, d.Stock, d.Strike, d.Times), Put = blackScholesPutOption.Invoke(_d1, _d2, d.Stock, d.Strike, d.Times) }).ToArray(); results = context.Run(query); } } timer.Stop(); var elapsed = timer.ElapsedMilliseconds; Console.WriteLine("Black Scholes computed on Gpu in {0} milliseconds", elapsed); //String.Join<OutPutData>(", ", Enumerable.Range(1,120). // Select(i => results.ElementAtOrDefault(i)).ToArray())); timer.Restart(); var cpuResults = CpuBlackScholes(data); timer.Stop(); elapsed = timer.ElapsedMilliseconds; Console.WriteLine("Black Scholes computed on Cpu in {0} milliseconds", elapsed); var resultsAreEqual = cpuResults.Zip(results, (a,b) => Tuple.Create(a,b)).All(pair => pair.Item1.IsEqual(pair.Item2)); Console.WriteLine("Results calculated by cpu and gpu are {0}", resultsAreEqual ? "equal" : "not equal"); Console.WriteLine("Results = {0}", String.Join<Results>(", ", Enumerable.Range(1,120). Select(i => new Results() { Gpu = results.ElementAtOrDefault(i), Cpu = cpuResults.ElementAtOrDefault(i) } ).ToArray())); Console.ReadLine(); } } #region Helpers public static class RandomExtensions { public static float Random(this Random random, float low, float high) { var lerp = (float)random.NextDouble(); return (1f - lerp) * low + lerp * high; } } #endregion } | Mid | [
0.647342995169082,
33.5,
18.25
] |
Santa Maria Gloriosa, Lecco The Sanctuary of Santa Maria Gloriosa is a Roman Catholic parish church in the neighborhood of Rancio Superiore in the town limits of Lecco, region of Lombardy, Italy. History A church at the site is documented since 1455. In 1640 it became the parish church of Rancio. The present church and bell-tower were refurbished with its present layout and architecture in that century. The interior retains some of its late-baroque decorations, including a wooden statue of the Madonna and child, but also a 16th-century crucifix and a 15th-century icon of the Madonna Odigitria. The main altar with a tempietto and gilded angels, was designed in 1828 by Giuseppe Bovara. In the 20th century, the walls and ceiling were frescoed, along with the altarpiece depicting the blessed Giovanni Battista Mazzucconi. From the church, there is a striking view of the town. References Category:Roman Catholic churches in Lecco Category:15th-century Roman Catholic church buildings | High | [
0.6613756613756611,
31.25,
16
] |
Everton vs Hull City – The Preview At half time on Sunday, with Spurs leading 2-1 against Everton, a statistic popped up on social media. The last time Everton trailed 2-1 at half time and won was in 1994. You’re all aware of the game I’m referring to. Wimbledon at home. Anders Limpar’s questionable decision-making, Barry Horne’s undisputed moment of genius, and what at the time seemed a success but now is seen as the sole saving grace from an interminably awful season. It was a special day. Sunday seemed anything but special. Even at half time, with a greater number of minutes to turn Spurs’ lead around as they took to overhaul ours, it never seemed on. Where do you even get a Barry Horne nowadays? It’s stunning that we’ve gone two decades and change without being able to turn some lot over. Let’s face it, we’ve been behind at the break many times. We’ve been conditioned to such a degree that as the ball was passed lackadaisically around the midfield and defence with very little intent, we weren’t even that surprised. Everton aren’t we. Right at the moment it became clear how far we are from the completion of the Roberto Martinez project. That’s probably a good thing in the long term. Kevin Mirallas is magic. Let’s establish that to begin with. Aside from that there wasn’t much cheer from anyone else. Lukaku looked isolated while Samuel Eto’o was so absent he was replaced by Aiden McGeady. McGeady, imagine. Ross Barkley showed some touches of absolute class but seemed to be running into brick walls at times. Meanwhile, all of a sudden we have a problem in that deep midfield role. Remember when we had defensive midfielders coming out of our ears? Good times. Now, McCarthy is injured, which I’m sure is one of the signs of the Apocalypse, while Gibson is Gibson and thus is crocked. Gareth Barry took us on a nostalgia trip to the 2010 World Cup by looking as if he was running through treacle. Rather than Mesut Özil, it was Harry Kane who embarrassed us. Kane. He probably went home and scrawled “WinningLAD” in the steam on his bathroom mirror. He’s the sort who would’ve told the other LADS that he’s “well gutted” Jimmy Bullard was kicked off I’m A Celebrity, Get Me Out Of Here during the weekly Nando’s trip due to his “top notch banter”. We let him succeed. Awful. Mo Besic is in all senses of the word a rough diamond. On Sunday his ball control and distribution was excellent but the decision-making still isn’t there. Ross Barkley has much of the same problem but as an attacking player mistakes are less likely to be fatal. Playing in a new position in a new league is always going to be tough, which is why Roberto Martinez was cautious about picking him. Well, there’s no choice now. We may even have to partner him with Leon Osman. If that’s not throwing a player in the deep end I don’t know what is. Seeing as our eight-game unbeaten run is now over, the aim is to make the next unbeaten run nine games or longer. Apart from Man City away at the weekend it’s a decent-looking schedule, but that means nothing unless we start to piece good performances together. In fact, putting together a good 90 minutes would be useful. Perhaps the first half from the Arsenal game and the second half from Wolfsburg. In fact, have we had a seriously good second half yet? Last season we led the league in goals scored in the final ten minutes. It would be nice to make a return to that boss Everton who made us dream of all sorts of wonderful things. With some of the dross in front of us there’s always a chance. Nothing says dross more than Hull. The place, the people, the club. Adults wearing tiger face paint. The away end will run orange with sweat and paint. Steve Bruce, he with the face like an old pork chop, desperately needs a win for the Tigers. Just for that grrrrrrreat feeling. In goal will be Allan McGregor, an excellent keeper. Doesn’t dive before the striker shoots or fall backwards under pressure, or anything. Imagine. He’ll have to be top drawer tonight because Chester, Dawson, Davies and Robertson don’t make for an inspiring back line. Of course it’s Everton, so he’ll save everything in sight. Young Andrew Robertson would have been a great signing but we’re all set for left backs, ta. Livermore and Huddlestone clunking in front of them with the mobility of a fridge and a slightly larger fridge. Diame is also a choice. The likes of Brady, Elmohamady and ben Arfa will be in front of them. That Hatem ben Arfa has scored a couple of boss goals. Why’s he out on loan? You may not have noticed but his chip butty addiction has got the better of him. Fair enough. He’s only human. Up front is our old sweetheart, Nikica Jelavic. Our offside trap’s not the best but it shouldn’t be a problem here. Who’s in for us? Hard to tell. Howard’s under no threat at all, which is a pity because he could use the competition. Coleman, Jagielka, Distin, Baines. That’ll do, cheers. I don’t want to hear any injury news that endangers that. Looks like Barry and Besic in front of them, although Osman may have to come in. For want of balance perhaps we’ll see Mirallas and Pienaar or McGeady flanking Barkley. With no Naismith it’s the sane choice too, as Eto’o can have an impact from the bench. Lukaku is now a nailed-on choice up top, which is a plus. He’s slowly edging his way towards the 20 goal mark as well, and without the fanfare of last season. It may well work out well for him, especially now that we have options for if he gets tired. Kone and Oviedo are back playing and on the scoresheet, which is the second sign of the Apocalypse. So you’ve got Everton, who have scored at least two goals in 12 of the last 14 home games. Then you have Hull, on a run of four straight defeats and with one goal in their previous five matches. | Mid | [
0.542857142857142,
30.875,
26
] |
A Troubling Financial Aid Wrinkle Parents are often worried about how their assets will impact their chances for financial aid. Often their fears are overblown because financial aid formulas don’t penalize families for all their assets. But it is true that families are now experiencing a harder time protecting their assets from financial aid calculations because of a horribly flawed federal formula that needs to be changed. I’ll explain the harm that this old formula is causing families, but first some background on the two big aid formulas. Financial Aid Formulas and Assets The reason why assets are often not a deal breaker when seeking financial aid is because of this reality: The nation’s two main financial aid formulas don’t penalize parents or students for the money they have invested in qualified retirement accounts such as Individual Retirement Accounts, SEP-IRAs, 401(k)s, 403(b)s, KEOGHs and pension plans. You could have $1 million dollars parked in an IRA and it wouldn’t hurt your child’s chances for need-based financial aid at the vast majority of schools. Main Financial Aid Applications Anyone hoping for federal and/or state aid or wanting to obtain federal college loans must complete this application. Most colleges also use the FAFSA to determine who will qualify for their in-house grants. The FAFSA is a transparent aid application. You can see just what factors are assessed when the government releases is yearly formula. Here is the current one: What you’ll notice if you take a look at the federal formula is that it also doesn’t inquire about whether you own a primary home. This is another reason why family assets are rarely an aid deal breaker. Most people have the bulk of their wealth in their home and their retirement accounts, which the FAFSA ignores. The PROFILE is the College Board’s financial aid application that is used by roughly 260 colleges and universities that are nearly all private. These schools, including the nation’s most elite institutions, rely on the PROFILE to determine which students will receive need-based financial aid from their schools. These institutions still use the FAFSA, but only to determine their students’ eligibility for any state or federal aid. Schools that use the PROFILE can customize this aid application in endless ways. In fact, the schools can choose from hundreds of optional questions and how they treat the answers can differ significantly. For instance, some schools consider home equity, others don’t while still others link income to home equity. The latter policy is supposed to help families who are house rich and cash poor. What is irritating about the PROFILE is that some of its formula is secret. The College Board doesn’t feel compelled to share its entire proprietary formula. The College Board, however, releases a lengthy publication every year that tries to anticipate many questions that parents would have about its aid formula. I would urge you to take a look at this 54-page PDF: What Aid Formulas Care About Both the PROFILE and the FAFSA do care about the nonretirement assets of parents and children. The PROFILE assesses parent assets at 5% and the FAFSA assesses them at up to 5.64%. Students assets are treated more harshly for aid purposes. The PROFILE assesses a student’s assets at 25% and the FAFSA assesses them at 20%. PROFILE Example In the example below, you’ll see how the PROFILE treats parents’ assets. Nonretirement assets include checking and savings accounts, taxable investment accounts and 529 college savings plans, In this scenario, the parents have $80,000 in nonretirement assets. $80,000 X 5% = $4,000 In this case, the family’s eligibility for financial aid drops by $4,000. Put another way, the family’s Expected Family Contribution increases by $4,000. I’d argue that this powerfully illustrates that it is always good to save for college. A family is in much better shape financially for having saved $80,000 than those who haven’t. And, I should add, that just because a family who didn’t save anything might receive $4,000 in additional aid doesn’t mean they would receive that assistance in grants. It’s likely that the family would simply receive more loans. FAFSA and Parent Assets Now that you know something about the formulas, I want to focus on a flaw in the federal methodology. The FAFSA has traditionally allowed parents to shelter some of their taxable assets, but the amount is shrinking fast. How much a family can shelter depends on a FAFSA table called the Parents’ Education Savings and Asset Protection Allowance. This table depends on the age of the oldest parent on the last day of the year. The older the parent, the more the household can shield because the parents are nearer retirement age. As you’ll notice, a family can protect considerably more if parents are married. Here is the current asset protection table: Example For the 2015-2016 school year, the FAFSA formula automatically excludes $31,800 of taxable assets from the aid calculations for a 50-year-old parent who is married. Here is how the current calculation would impact a 50-year-old married parent with $100,000 in nonretirement assets: $100,000 (nonretirement assets) – $31,800 (asset exclusion) = $68,200 $68,200 x 5.64% = $5,640 Aid eligibility would decline by $5,640 for this family. A Cause for Alarm: Declining Asset Allowance A troubling problem with this allowance is that the amount you can shelter has been steadying declining since 2009-2010 even as the cost of college has continued to climb. You can see the decline by looking at the asset allowance chart for the 2009-2010 year below. In 2009, a 50-year-old could shelter $55,300 from the aid calculations! And It’s Getting Worse If you think that decline is alarming, just wait until you see the protection allowance scheduled for the 2016-2106 school year! The drop is stunning. The new numbers were released recently in the Federal Register: A Bird’s Eye View of How the Asset Allowance Has Shrunk The chart below, which illustrates how the asset allowance has shrunk dramatically since 2009, comes courtesy ofMark Kantrowitz, who is the publisher of Edvisors and a national financial aid expert. At the rate the decline is going, Kantrowitz predicts the allowance may disappear entirely by the 2018-2019 school year! Asset Protection Allowance and Single Parents This formula is even more unfair to single parents. You would assume that the formula would allow a single parent to shield at least half of what a married couple can. But this flawed federal formula is stingier than this. In the current 2015-2016 asset protection formula, for instance, a 55-year-old married parent can shield $36,300, but a single parent of the same age can only shelter $9,500. Months ago, I asked U.S. Department of Education why the asset allowance for single parents isn’t at least half of what married couples can shield and they couldn’t explain. They just said this is how the formula, which started decades ago, works. Origin of the Formula The flawed formula can actually be traced back to the Higher Education Act of 1965 that was passed by Congress and periodically renewed. You can learn more about the formula by reading Kantrowitz’s excellent post on the subject. One way to fix the formula is to start with the 2009-2010 asset allowance table and adjust annually for inflation. Congress need to address this problem, but it is less likely to do so if parents don’t complain. Subscribe Follow Lynn on other social media platforms or subscribe to The College Solution RSS Feed below. 5 Responses to A Troubling Financial Aid Wrinkle Hello Lynn, In regards to this statement “Congress need to address this problem, but it is less likely to do so if parents don’t complain” I completely agree. I am a single parent and would like to complain about this highly unfair policy. How/where can I do that? Or perhaps anything changed in this regard since Aug 2015? And thank you for bringing this problem to our (single parents) attention! Hi Lynn — If a student has two parents who live together but are not married and file taxes separately, does the asset allocation for “two parents” still apply? Or must the parents be married and filing taxes jointly? Thanks! Yes the allocation for both parents applies. The federal government requires that both parents, who are living together and not married, provide their assets and income on the FAFSA. This is a recent development. PROFILE schools will consider non-qualified annuities as assets. Some PROFILE schools will also treat cash value in a life insurance policy as an asset. FAFSA schools will not consider cash value in life insurance or any annuities as assets. | Mid | [
0.637119113573407,
28.75,
16.375
] |
using Microsoft.Diagnostics.Tracing.Parsers; using Microsoft.Diagnostics.Tracing.Parsers.Kernel; using Microsoft.Diagnostics.Tracing.Session; using System.Collections.Generic; using System.Linq; using System.Net; using System.Text; namespace LowLevelDesign.WinTrace.EventHandlers { class NetworkTraceEventHandler : ITraceEventHandler { class NetworkIoSummary { public long Recv; public long Send; public long Total; } private readonly ITraceOutput traceOutput; private readonly int pid; private readonly Dictionary<string, NetworkIoSummary> networkIoSummary = new Dictionary<string, NetworkIoSummary>(); public KernelTraceEventParser.Keywords RequiredKernelFlags => KernelTraceEventParser.Keywords.NetworkTCPIP; public NetworkTraceEventHandler(int pid, ITraceOutput output) { traceOutput = output; this.pid = pid; } public void SubscribeToSession(TraceEventSession session) { var kernel = session.Source.Kernel; kernel.TcpIpAccept += HandleTcpIpConnect; kernel.TcpIpAcceptIPV6 += HandleTcpIpV6Connect; kernel.TcpIpARPCopy += HandleTcpIp; kernel.TcpIpConnect += HandleTcpIpConnect; kernel.TcpIpConnectIPV6 += HandleTcpIpV6Connect; kernel.TcpIpDisconnect += HandleTcpIp; kernel.TcpIpDisconnectIPV6 += HandleTcpIpV6; kernel.TcpIpDupACK += HandleTcpIp; kernel.TcpIpFail += HandleTcpIpFail; kernel.TcpIpFullACK += HandleTcpIp; kernel.TcpIpPartACK += HandleTcpIp; kernel.TcpIpReconnect += HandleTcpIp; kernel.TcpIpReconnectIPV6 += HandleTcpIpV6; kernel.TcpIpRecv += HandleTcpIpRev; kernel.TcpIpRecvIPV6 += HandleTcpIpV6Rev; kernel.TcpIpRetransmit += HandleTcpIp; kernel.TcpIpRetransmitIPV6 += HandleTcpIpV6; kernel.TcpIpSend += HandleTcpIpSend; kernel.TcpIpSendIPV6 += HandleTcpIpV6Send; kernel.TcpIpTCPCopy += HandleTcpIp; kernel.TcpIpTCPCopyIPV6 += HandleTcpIpV6; } public void PrintStatistics(double sessionEndTimeInMs) { if (networkIoSummary.Count == 0) { return; } var buffer = new StringBuilder(); foreach (var summary in networkIoSummary.OrderByDescending(kv => kv.Value.Total)) { if (buffer.Length != 0) { buffer.AppendLine(); } buffer.Append($"{summary.Key} --> S: {summary.Value.Send:0} b / R: {summary.Value.Recv:0} b"); } traceOutput.WriteSummary($"Network ({pid})", buffer.ToString()); } private void HandleTcpIpConnect(TcpIpConnectTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); } } private void HandleTcpIpV6Connect(TcpIpV6ConnectTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); } } private void HandleTcpIp(TcpIpTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); } } private void HandleTcpIpV6(TcpIpV6TraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); } } private void HandleTcpIpRev(TcpIpTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.daddr}:{data.dport} <- {data.saddr}:{data.sport} (0x{data.connid:X})"); UpdateStats(data.saddr, data.daddr, true, data.size); } } private void HandleTcpIpV6Rev(TcpIpV6TraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.daddr}:{data.dport} <- {data.saddr}:{data.sport} (0x{data.connid:X})"); UpdateStats(data.saddr, data.daddr, true, data.size); } } private void HandleTcpIpFail(TcpIpFailTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"0x{data.FailureCode:X}"); } } private void HandleTcpIpSend(TcpIpSendTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); UpdateStats(data.saddr, data.daddr, false, data.size); } } private void HandleTcpIpV6Send(TcpIpV6SendTraceData data) { if (data.ProcessID == pid) { traceOutput.Write(data.TimeStampRelativeMSec, data.ProcessID, data.ThreadID, data.EventName, $"{data.saddr}:{data.sport} -> {data.daddr}:{data.dport} (0x{data.connid:X})"); UpdateStats(data.saddr, data.daddr, false, data.size); } } private void UpdateStats(IPAddress saddr, IPAddress daddr, bool isReceive, int size) { string key = $"{saddr} -> {daddr}"; NetworkIoSummary summary; if (!networkIoSummary.TryGetValue(key, out summary)) { summary = new NetworkIoSummary(); networkIoSummary.Add(key, summary); } if (isReceive) { summary.Recv += size; summary.Total += size; } else { summary.Send += size; summary.Total += size; } } } } | Mid | [
0.626168224299065,
33.5,
20
] |
The Bulls don’t hold a grudge against Carmelo Anthony for remaining with the Knicks rather than signing with them this past summer. In fact, they love their team as constituted. “I think he made the best decision for him and his family, and I’m just excited for my team,” Bulls forward Joakim Noah said after shoot-around at the Garden on Wednesday morning. “I think we’re really deep.” Derrick Rose has gone as far to say this Bulls squad is the best team he has been a part of, after Chicago added free-agent forward Pau Gasol, European import Nikola Mirotic and first-round pick Doug McDermott. That’s not to say Rose didn’t want Anthony to join him. “He made his decision, and like I said at the time, of course who wouldn’t want to play with a talent like that,” Rose said. “But he came back [to the Knicks]. You can’t get mad at him.” Many experts have pegged Chicago as the team to beat in the Eastern Conference, over the LeBron James-led Cavaliers. The preseason only has made Rose more confident about this group. “Everybody’s pushing everyone to get better,” Rose said. “Let’s just say we have a very good team, very deep team, very confident team. I think all the guys this year, from the rookies to the vets, we know why we’re here. That’s to do anything, give up anything, to win a championship.” Anthony was close to joining the Bulls. He visited the Windy City on July 1 as part of the Bulls’ recruiting pitch. Anthony, however, eventually signed a five-year, $124 million deal with the Knicks, a figure larger than what the Bulls could offer. Chicago reportedly was Anthony’s second choice because he viewed them as giving him the best chance to win a championship — over the Mavericks, Rockets and Lakers, the other teams after his services. “Yeah, I thought we had a chance,” Noah said. Gasol spoke to the Knicks star during his whirlwind recruitment, at a time when Anthony was thinking about playing for the Lakers, Gasol’s former team. There was even the thought of Gasol joining Anthony in New York. “We talked, but I think he made his decision after I made mine,” Gasol said. “We talked before, when he was thinking of going to Los Angeles and debated staying. “I wasn’t surprised [when Anthony re-signed with the Knicks]. I was expecting it.” | Mid | [
0.5625,
33.75,
26.25
] |
function foo () { if (true) { const bar = baz(); const bark = eagle(); hawk(); return lion(); } else { const cat = dog(); const elephant = hamster(); parrot(); return bull(); } } | Low | [
0.503416856492027,
27.625,
27.25
] |
Einführung {#sec0005} ========== In der Gesundheitsversorgung und beim Monitoring von Krankheitsentstehung und -entwicklung werden mehr und mehr Daten verfügbar. Dies hat die Forschungslandschaft verändert. Routinemäßig gesammelte Gesundheitsdaten (im weiteren kurz „Routinedaten" genannt) können als Daten definiert werden, die gesammelt werden, ohne dass vor ihrer Verwendung zu Forschungszwecken eine spezifische, a priori festgelegte Forschungsfrage entwickelt wurde [@bib0430]. Solche Daten können von einem breiten Spektrum von Ressourcen stammen im Bereich der Forschung (z. B. Krankheitsregister), des klinischen Managements (z. B*.* Datenbanken zur Grundversorgung), der Planung des Gesundheitssystems (z. B*.* Verwaltungsdaten), Dokumentation der klinischen Versorgung (z. B. Archive von elektronische Patientenakten) oder zur epidemiologischen Überwachung (z. B*.* Krebsregister und Daten der Gesundheitsberichterstattung) gehören. Diese Daten, erhoben in verschiedenen medizinischen Versorgungsbereichen und geografischen Regionen, bieten Möglichkeiten zur innovativen, effizienten und kostenwirksamen Forschung. Sie fließen ein in Entscheidungen in der klinischen Medizin, in der Planung von Gesundheitsdiensten und in Public Health [@bib0435]. Auf internationaler Ebene haben sowohl Regierungen als auch Förderinstitutionen der Nutzung von Routinedaten als Mittel zur Verbesserung der Patientenversorgung, Umgestaltung der Gesundheitsforschung und Steigerung der Effizienz in der Gesundheitsversorgung Priorität eingeräumt [@bib0440]. Während die explosionsartige Zunahme verfügbarer Daten die Möglichkeiten zur Beantwortung drängender Forschungsfragen erheblich verbessert, stellt sie diejenigen, die Forschung selbst durchführen oder sie bewerten sowie für die Umsetzung der Forschungsergebnisse zuständig sind, vor Herausforderungen. Aufgrund des breiten Spektrums der Quellen, aus denen Routinedaten stammen, und der rasanten Erweiterung dieses Feldes, ist es schwierig, die Stärken und Schwächen einzelner Datenquellen sowie mit ihnen einhergehenden Bias (systematische Fehler) zu erkennen. Dies wird durch ein unvollständiges oder inadäquates Berichten von Forschung auf Basis von Routinedaten noch weiter erschwert. Eine systematische Analyse einer Stichprobe von Studien, in denen Routinedaten verwendet wurden, fand in den verschiedensten Bereichen unvollständiges oder unklares Berichten [@bib0445]. Zu den Mängeln in der Berichterstattung gehören inadäquate oder fehlende Informationen zur Codierung von Expositionen bzw. Zielgrößen und zum Anteil an verknüpften Datensätzen („linkage rates") aus den verschiedenen Datenquellen. Zwei jüngst erschienene systematische Reviews dokumentieren ebenfalls, dass Studien zur Validierung von Daten aus Routinedatenquellen schlecht berichtet werden [@bib0450], [@bib0455]. Dies kann dazu führen, dass Ursachen von Bias nicht erkannt, Bemühungen zur Durchführung von Metaanalysen behindert und falsche Schlussfolgerungen gezogen werden. Feld 1. Definitionen der Begriffe Quell-, Datenbank- und Studienpopulation {#sec0010} -------------------------------------------------------------------------- Für Studien, die Routinedaten verwenden, gibt es drei relevante Hierarchieebenen der Bevölkerungsgruppen, auf die in diesem Statement wiederholt Bezug genommen wird: Zu diesen Gruppen gehören (1) die Quellpopulation, worunter die Bevölkerungsgruppe verstanden wird, aus der sich die Datenbankpopulation ableitet und über die Forscher eine Aussage treffen möchten, (2) die Datenbankpopulation, die sich von der Quellpopulation ableitet und Personen mit Angaben in der Datenquelle umfasst, und (3) die Studienpopulation, die von den Forschern mit Hilfe von Codes und Algorithmen aus der Datenbankpopulation heraus definiert wird ([Abb. 1](#fig0005){ref-type="fig"}) [@bib0460]. Beispielhaft sei hier das Projekt „Clinical Practice Research Datalink (CPRD)" genannt, bei dem die Quellpopulation alle Personen umfasst, die im Vereinigten Königreich bei einem Allgemeinmediziner vorstellig werden. Die Datenbankpopulation umfasst diejenigen Personen, die in CPRD erfasst sind, und die Studienpopulation solche, die mit Hilfe von Codes und Algorithmen, die in der jeweiligen Studie beschrieben sind, aus CPRD ausgewählt wurden. Als Hilfestellung für die Berichterstattung wurden für eine Reihe von Studiendesigns und Kontexte Leitlinien entwickelt. Sie gehen oft mit einer verbesserten Qualität von Studienberichten einher [@bib0465], [@bib0470]. Das *Strengthening the Reporting of Observational Studies in Epidemiology* (STROBE)-Statement wurde entwickelt, um die Transparenz beim Berichten von Beobachtungsstudien zu erhöhen [@bib0475], [@bib0480]. Es wird von führenden medizinischen Fachzeitschriften anerkannt und angewendet und verbessert bei Einbindung in den Redaktionsprozess nachweislich die Berichtsqualität von Forschungsergebnissen [@bib0485], [@bib0490]. Studien, die Routinedaten verwenden, haben meistens ein beobachtendes Design, weshalb die STROBE-Leitlinien hier relevant und anwendbar sind. Da das STROBE-Statement jedoch für alle Arten von Beobachtungsstudien ausgelegt ist, werden spezielle Aspekte von Forschung mit Routinedaten nicht berücksichtigt. Im Anschluss an das Primary Care Database Symposium in London im Jahr 2012 hat sich eine Gruppe internationaler Wissenschaftler, die sich insbesondere mit der Verwendung von Routinedaten beschäftigen, mit Vertretern der STROBE-Gruppe getroffen, um STROBE im Zusammenhang mit Studien, die Routinedaten verwenden, zu diskutieren [@bib0495], [@bib0500]. Dabei wurden in STROBE Lücken in Bezug auf die Forschung mit besagten Datenquellen identifiziert, und man ist übereingekommen, dass eine Erweiterung von STROBE vonnöten ist. So wurde die *REporting of studies Conducted using Observational Routinely collected Data* (RECORD)-Initiative als internationale Zusammenarbeit zur Erweiterung von STROBE ins Leben gerufen, um spezielle Berichtsprobleme im Zusammenhang mit Studien, die Routinedaten verwenden, zu erörtern und anzugehen. An der RECORD-Initiative waren bisher mehr als 100 internationale Stakeholder beteiligt, darunter Forscher, Redakteure von Fachzeitschriften und Nutzer von Daten, einschließlich solcher, die auf Routinedaten basierende Forschungsergebnisse in der Entscheidungsfindung gebrauchen. Die Methodik, die zur Entwicklung der RECORD-Leitlinien verwendet wurde, wird anderweitig ausführlich beschrieben [@bib0505] und basiert auf etablierten Verfahren zur Entwicklung von Leitlinien zur Berichterstattung [@bib0510]. Kurz beschrieben, wurden hierfür die Stakeholder zwei Mal befragt, um Themen für das RECORD-Statement festzulegen und zu priorisieren. Im Anschluss traf sich das Working Committee zur Ausarbeitung des Wortlauts der einzelnen Empfehlungen. Dann lasen die Stakeholder die Texte und gaben Rückmeldungen. Die Endversion der Checkliste und der vorliegende erläuternde Artikel wurden (im englischen Original) von Mitgliedern des Steering Committees ausgearbeitet und vom Working Committee überprüft und genehmigt. Mitglieder des STROBE-Leitungsgruppe waren an der Erstellung von RECORD beteiligt. Wie schon bei STROBE, sind auch die RECORD-Leitlinien nicht darauf ausgelegt, Methoden zur Durchführung von Forschung zu empfehlen, sondern sie sollen vielmehr das Berichten über eben diese Forschung verbessern. So soll sichergestellt werden, dass Leser, Peer-Reviewer, Redakteure von Fachzeitschriften und andere Nutzer der Forschung die interne und externe Validität der Studien beurteilen können. Durch eine Verbesserung der Berichtsqualität von Forschung mit Routinedaten wollen wir die Anzahl unklarer Forschungsberichte verringern und so den Grundsätzen des wissenschaftlichen Prozesses gerecht zu werden: Entdeckung, Transparenz und Nachvollziehbarkeit [@bib0515]. Punkte der RECORD-Checkliste {#sec0015} ============================ [Tabelle 1](#tbl0005){ref-type="table"} enthält die vollständige RECORD-Checkliste. Da RECORD eine Erweiterung der bereits vorhandenen STROBE-Punkte ist, werden die einzelnen Empfehlungen, nach den Abschnitten eines Manuskripts geordnet, neben den entsprechenden Punkten der STROBE-Checkliste aufgeführt. Wir empfehlen Autoren, auf jeden Punkt der Checkliste hinreichend einzugehen, aber schreiben keine präzise Reihenfolge oder Position im Manuskript vor. Sortiert nach Manuskriptabschnitt geben wir nachstehend für jeden Punkt der RECORD-Checkliste detaillierte Erklärungen. Wenn kein weiterer Checklisten-Punkt benötigt wurde, um STROBE auch auf Studien mit Routinedaten anwenden zu können, finden sich eventuell eine Erklärung unter dem entsprechenden STROBE-Punkt. Titel und Abstract {#sec0020} ------------------ RECORD-PUNKT 1.1: Der verwendete Datentyp sollte im Titel oder Abstract angegeben werden. Die Namen der verwendeten Datenbanken sollten, sofern möglich, aufgeführt werden. RECORD-PUNKT 1.2: Gegebenenfalls sollte die geografische Region und der Zeitrahmen, in dem die Studie durchgeführt wurde, im Titel oder Abstract angegeben werden. RECORD-PUNKT 1.3: Wurde für die Studie eine Verknüpfung von Datenbanken vorgenommen, sollte dies klar im Titel oder Abstract angegeben werden. ### Beispiele {#sec0025} Zu diesen Punkten sind zwei Beispiele für gutes Berichten in den folgenden Artikeln enthalten:1.„Perforations and Haemorrhages after Colonoscopy in 2010: A Study Based on Comprehensive French Health Insurance Data (SNIIRAM)" [@bib0520].2.„The Dutch Hospital Standardised Mortality Ratio (HSMR) Method and Cardiac Surgery: Benchmarking in a National Cohort Using Hospital Administration Data versus a Clinical Database" [@bib0525]. ### Erläuterung {#sec0030} Da es kein akzeptiertes Stichwort im Medical Subject Heading (MeSH) Thesaurus gibt, um Studien, die Routinedaten verwenden, zu erkennen, ist es wichtig, dass eine Studie, die mit Hilfe dieser Daten durchgeführt wird, als solche identifiziert werden kann. Jedoch reicht es angesichts der Vielzahl unterschiedlicher Datentypen nicht aus, lediglich anzugeben, dass Routinedaten verwendet wurden. Stattdessen sollte der verwendete Typ von Routinedaten im Titel oder Abstract angegeben werden. Dies können etwa gesundheitsbezogene Verwaltungsdaten, andere Verwaltungsdaten (z. B. aus Versicherungen, Geburts-/Sterberegister oder von Arbeitgebern), Krankheitsregister, Datenbanken der Grundversorgung, elektronische Patientenakten und bevölkerungsbasierte Register, sein. Es ist wichtig, den Namen der verwendeten Datenbank(en) anzugeben; dies sollte aber nicht die Angabe des Typs der Datenquelle im Titel oder Abstract ersetzen. Die geografische Region und der Zeitrahmen sind Punkte in der STROBE-Checkliste. Wir schlagen vor, dass diese Information ebenfalls ein erforderlicher Punkt sein sollte im Titel oder Abstract von Manuskripten, welche die RECORD-Checkliste verwenden. Dabei müssen sich Angaben zu Ort und Zeitrahmen natürlich an der zugelassenen Wörterzahl orientieren. Zudem gilt es, die Vertraulichkeit von Informationen zu wahren. Dennoch sollte der Ort zumindest auf der übergeordneten geografischen Ebene berichtet werden, die zur Definition der Studienpopulation verwendet wurde (z. B. Staat, Bundesland, Provinz oder Region). Des Weiteren sollten Verknüpfungen zwischen Datenbanken (sofern diese vorgenommen wurden) im Titel oder Abstract angegeben werden. Ein geeigneter Wortlaut ist zum Beispiel „unter Verwendung mehrerer verknüpfter administrativer Datenbanken" oder „(Name der Datenbank) verknüpft mit (Name der Datenbank)". Die Verwendung des Wortes „verknüpft" (linked) oder „Verknüpfung" (linkage) sind im Titel oder Abstract ausreichend. Weitere Einzelheiten zur Verknüpfungsmethode sollten im Methodenteil des Manuskripts angegeben werden. Einleitung {#sec0035} ---------- Neben den STROBE-Punkten sind keine für die RECORD-Leitlinien spezifischen Punkte erforderlich. Gemäß den STROBE-Leitlinien sind „alle spezifischen Zielsetzungen einschließlich der (vorab festgelegten) Hypothesen" in der Einleitung anzugeben. Für die Replikation und Translation von Beobachtungsstudien ist die Angabe der spezifischen Forschungsziele unerlässlich. Bei Studien, die Routinedaten verwenden, sollten die Autoren ferner präzisieren, ob die Analysen explorativer Natur sind, d.h. zum Aufdecken neuer Beziehungen anhand der Daten (Beispiele: „Data mining"-Studien oder hypothesengenerierende Studien [@bib0530], [@bib0535]) oder konfirmatorischer Natur d.h. zur Prüfung einer oder mehrerer Hypothesen [@bib0540]. Die Autoren sollten überdies angeben, ob ihre Hypothesen vor oder nach der Datenanalyse aufgestellt wurden. Sie sollten eindeutige Angaben darüber machen, ob es ein Studienprotokoll gibt und wie auf dieses zugegriffen werden kann, und ob die Studie in einem öffentlich zugänglichen Studienregister eingetragen ist. Da die Stärken und Schwächen der in der Forschung mit Routinedaten verwendeten Methoden umstritten sein könnten, ist eine klare Beschreibung der Studienziele unerlässlich [@bib0540], [@bib0545]. Es ist nicht ausreichend, eine Studie lediglich als deskriptiv zu bezeichnen, ohne klarzustellen, ob die Studie darauf ausgelegt ist, Hypothesen zu generieren oder zu prüfen. Methoden (Rahmenbedingungen) {#sec0040} ---------------------------- Es sind keine weiteren RECORD-Punkte erforderlich zur Erweiterung der in STROBE enthaltenden folgenden Anforderung: „Beschreiben Sie den Rahmen (Setting) und Ort der Studie und machen Sie relevante zeitliche Angaben, einschließlich der Zeiträume der Rekrutierung, der Exposition, der Nachbeobachtung und der Datensammlung". Autoren sollten beachten, dass zusätzlich zum Typ der Datenbank, der bereits im Titel und/oder Abstract erwähnt wurde, weitere Informationen bereitgestellt werden sollten, damit der Leser den Inhalt und die Validität der Datenbank sowie die ursprünglichen Gründe für die Datenerfassung nachvollziehen kann. So kann beispielsweise eine elektronische Patientenakte von Spezialisten oder Grundversorgern, zur ambulanten oder stationären Versorgung, oder von erfahrenen Ärzten oder Medizinstudenten verwendet werden. Die Benutzer werden möglicherweise gezielt für eine gründliche und reproduzierbare Dateneingabe geschult oder führen diese ohne Schulung aus [@bib0550]. Autoren sollten auch beschreiben, in welchem Zusammenhang die Datenbankpopulation mit der Quellpopulation steht, einschließlich der Auswahlkriterien, damit die Leser nachvollziehen können, ob die Ergebnisse auf die Quellpopulation angewandt werden können. Methoden (Teilnehmer) {#sec0045} --------------------- RECORD-PUNKT 6.1: Die Methoden für die Auswahl der Studienpopulation (wie verwendete Codes oder Algorithmen zur Identifizierung von Teilnehmern) sollten detailliert aufgelistet werden. Ist dies nicht möglich, sollte dies erklärt werden. RECORD-PUNKT 6.2: Für alle Studien zur Validierung der Codes und Algorithmen, die für die Auswahl von Teilnehmern verwendet wurden, sollten Referenzen angegeben werden. Wurde eine Validierung für diese Studie durchgeführt und nicht anderweitig veröffentlicht, sollten die Methoden und Ergebnisse detailliert dargestellt werden. RECORD-PUNKT 6.3: Wurden in der Studie Datenbanken verknüpft, sollte zur Darstellung des Verknüpfungsprozesses die Verwendung eines Flussdiagramms oder einer anderen grafischen Darstellung in Betracht gezogen werden. Dies sollte auch die Anzahl von Personen mit verknüpften Daten in den einzelnen Abschnitten enthalten. ### Beispiele {#sec0050} RECORD-PUNKT 6.1: Der folgende Auszug ist ein Beispiel für gutes Berichten:"Die OCCC \[Ontario Crohn\'s and Colitis Cohort\] verwendet validierte Algorithmen zur Identifizierung von Patienten mit CED (chronisch entzündliche Darmerkrankung) nach Altersgruppe. Jeder dieser Algorithmen wurde in Ontario in der jeweiligen Altersgruppe, auf die er angewandt wurde, in mehreren Kohorten, Arten von Arztpraxen und Regionen validiert. Bei Kindern unter 18 Jahren wurde der Algorithmus je nachdem, ob sich diese einer Koloskopie oder einer Sigmoidoskopie unterzogen, definiert. Für Kinder mit einer Endoskopie waren 4 ambulante Arztkontakte oder 2 CED-bedingte Hospitalisierungen innerhalb von 3 Jahren nötig. Bei Kindern, die keine Endoskopie hatten, waren 7 ambulante Arztkontakte oder 3 CED-bedingte Hospitalisierungen innerhalb von 3 Jahren nötig.... Dieser Algorithmus identifizierte Kinder mit CED richtig mit einer Sensitivität von... [@bib0555]." Dieser Artikel referenziert zwei frühere Validierungsstudien von Algorithmen zur Identifizierung von Patienten mit entzündlicher Darmerkrankung unterschiedlichen Alters einschließlich Messgrößen zur diagnostischen Güte.
RECORD-PUNKT 6.2: 1. In ihrem Artikel beschrieben Ducharme et al. ausführlich die Validierung der Codes zur Identifizierung von Kindern mit Darminvagination und verwendeten anschließend die validierten Codes zur Beschreibung der Epidemiologie. Die Codes der Validierungsstudie sind in [Abbildung 2](#fig0010){ref-type="fig"} des Artikels aufgeführt [@bib0560]. 2\. In ihrem Artikel nannten Benchimol et al. keine Validierung, jedoch wurden bislang durchgeführte Validierungen referenziert. Details der diagnostischen Güte der Codes des Identifizierungsalgorithmus wurden beschrieben [@bib0555]. RECORD-PUNKT 6.3: Einige Möglichkeiten zur Veranschaulichung des Verknüpfungsprozesses werden beispielhaft in den [Abbildung 2](#fig0010){ref-type="fig"}, [Abbildung 3](#fig0015){ref-type="fig"}, [Abbildung 4](#fig0020){ref-type="fig"} gezeigt. ### Erläuterung {#sec0055} RECORD-PUNKTE 6.1 und 6.2: Das Berichten der Validität der Identifizierungscodes/-algorithmen, die benutzt werden, um die Studienpopulation zu ermitteln, ist für eine transparente Berichterstattung von Beobachtungsstudien, die Routinedaten verwenden, unerlässlich. Zudem ermöglicht das Berichten von Codes/Algorithmen anderen Forschern, eine interne oder externe Validierung vorzunehmen. Die verwendeten Methoden zur Identifizierung von Studienteilnehmern sollten klar und deutlich angegeben werden, einschließlich der Angabe, ob die Identifizierung auf einzelnen Codes, Algorithmen (Kombinationen von Datensätzen oder Codes), Verknüpfungen zwischen Datenbanken oder Freitext-Feldern basiert. Das Risiko eines Bias durch falsche Klassifizierung („misclassification bias") kann bei Studien mit Routinedaten, wie in vielen anderen epidemiologischen Studien, die Validität der Studienergebnisse gefährden [@bib0580]. Obgleich das Risiko falscher Klassifizierungen bei Studien, die Datenbanken mit großen Populationen verwenden, grösser ist, bieten diese Studien doch die Möglichkeit, seltene oder ungewöhnliche Krankheiten zu untersuchen [@bib0585]. Die Validierung der Identifizierungsmethoden wird zunehmend als unerlässlich angesehen für Studien, die Routinedaten verwenden. Dies gilt insbesondere für Krankheitscodes in Studien, die zu Abrechnungszwecken erhobene Verwaltungsdaten verwenden [@bib0590]. Externe Validierungsstudien beinhalten üblicherweise einen Vergleich der zur Identifizierung von Studienpopulationen verwendeten Codes oder Algorithmen mit einem Referenzstandard. Die gängigsten Referenzstandards sind Patientenakten, Befragungen von Patienten oder Ärzten sowie klinische Register [@bib0450], [@bib0595]. Zudem kann eine interne Validierung von Datenbanken durchgeführt werden, um sich überschneidende Datenquellen innerhalb einer einzigen Datenbank zu vergleichen [@bib0600]. Die Messgrößen für die Güte sind ähnlich zu denen, die in Studien für diagnostische Tests verwendet werden, und umfassen unter anderem Sensitivität, Spezifität, positive und negative prädiktive Werte oder Kappa-Koeffizienten [@bib0450], [@bib0595]. Wir empfehlen daher, bei Beobachtungsstudien, die Routinedaten verwenden, Details über die externe oder interne Validierung der Identifizierungscodes/-algorithmen in den Methodenteil des Manuskripts aufzunehmen. Wurden bereits zuvor eine oder mehrere Validierungsstudien durchgeführt, sollten diese referenziert werden. Wurden keine solchen Validierungsstudien durchgeführt, sollte dies ausdrücklich angegeben werden. Des Weiteren sollte die Güte der Identifizierungsmethoden (unter Verwendung gängiger Begriffe der diagnostischen Güte) und deren Funktionstüchtigkeit in der untersuchten Subpopulation kurz diskutiert werden. Wurden Validierungen im Rahmen der betreffenden Beobachtungsstudie durchgeführt, empfehlen wir den Autoren, die veröffentlichten Leitlinien für das Berichten von Validierungsstudien zu verwenden [@bib0450]. Es ist wichtig, anzugeben, ob die Validierung in einer anderen Quell- oder Datenbankpopulation als der für die aktuelle Studie ausgewählten erfolgte, da die Codes in verschiedenen Populationen oder Datenbanken unterschiedlich funktionieren können [@bib0605]. Falls darüber hinaus Probleme mit dem verwendeten Referenzstandard wie Unvollständigkeit oder Ungenauigkeit bekannt sind, sollten sie berichtet und überdies als Einschränkung diskutiert werden. Die Autoren sollten diskutieren, welche Auswirkungen die Verwendung ausgewählter Codes/Algorithmen beim Identifizieren von Studienpopulationen und --zielgrößen hat und welche Auswirkungen das Risiko falscher Klassifizierungen auf die Studienergebnisse haben könnte. Besonders wichtig ist es, zu diskutieren, welche Auswirkungen es hat, wenn in einer Validierungsstudie eine andere als die in der Studie untersuchten Studienpopulation verwendet wurde. RECORD-PUNKT 6.3: Ein Flussdiagramm oder andere grafische Darstellung kann nützliche Informationen über den Verknüpfungsprozess vermitteln und eine womöglich langwierige Beschreibung vereinfachen. Solche Darstellungen können die wichtigsten Daten wie Informationen über den Anteil und die Merkmale der verknüpften und nicht verknüpften Einzelpersonen wiedergeben. Die Leser sollten in der Lage sein, den Anteil der erfolgreich verknüpften Datenbankpopulation sowie die Repräsentativität der sich ergebenden Studienpopulation zu ermitteln. Flussdiagramme zu Verknüpfungen können entweder als alleinstehende Diagramme (z. B. Venn- oder Flussdiagramme) oder in Kombination mit einem Teilnehmer-Flussdiagramm verwendet werden, wie es von STROBE empfohlen wird. Solche grafischen Darstellungen können viele verschiedene Formate benützen; wir empfehlen daher kein spezifisches. Methoden (Variablen) {#sec0060} -------------------- RECORD-PUNKT 7.1: Eine vollständige Liste der zur Klassifizierung von Expositionen, Zielgrößen, Confoundern und Effektmodifikatoren verwendeten Codes und Algorithmen sollte wiedergegeben werden. Wenn dies nicht möglich ist, sollte erklärt werden warum. Beispiele {#sec0065} --------- 1.Hardelid et al. gaben alle Codes in der Tabelle S1 im Datensupplement 2 wieder [@bib0610].2.Murray et al. gaben alle Codes für Risiko-Gruppen im Anhang S1 wieder [@bib0615]. ### Erläuterung {#sec0070} Wie bei den Codes/Algorithmen, die zur Identifizierung der Studienpopulation verwendet werden, machen die Codes/Algorithmen zur Klassifizierung von Expositionen, Zielgrößen, Confoundern oder Effektmodifikatoren die Forschung für möglichen Bias durch falsche Klassifizierung anfällig. Damit das Replizieren, Bewerten sowie Vergleichen mit anderen Studien möglich wird, empfehlen wir, dass im Manuskript, in einem Online-Anhang und/oder auf einer externen Website, eine Liste verfügbar gemacht wird, die alle diagnostischen, prozeduralen, medikamentenspezifischen oder sonstigen Codes enthält, die zur Durchführung der Studie verwendet wurden. Für Routinedaten aus Umfragen sollten die den Studienteilnehmern gestellten Fragen mit dem genauen Wortlaut bereitgestellt werden. Angesichts des Risikos von Bias durch falsche Klassifizierung bei jeder Forschung, einschließlich solcher, die Routinedaten verwendet [@bib0580], sollten die Autoren genug Informationen geben, um ihre Forschung reproduzierbar und das Bias-Risiko erkennbar zu machen. Validierungsstudien können im Artikel-Manuskript beschrieben oder eine Referenz zu anderem veröffentlichten oder Online-Material angegeben werden. Wie oben dargelegt, sollte von den Autoren angegeben werden, ob die Validierungsstudie mit einer anderen Quell- oder Datenbankpopulation als der in der vorliegenden Studie untersuchten durchgeführt wurde. Uns ist bewusst, dass Forscher in einigen Fällen die in einer Publikation verwendeten Codelisten und Algorithmen nicht zur Verfügung stellen können, da es sich um durch Eigentums- oder Urheberrechte, Patente oder anderweitige Gesetze geschützte Informationen handelt. Beispielsweise wurden einige Indices für die Adjustierung von Komorbiditäten von gewinnorientierten Unternehmen entwickelt und an Forscher zur Verwendung im akademischen Forschungsumfeld verkauft [@bib0620], [@bib0625]. In diesen Fällen haben sich die Autoren bei der Erfassung, Bereinigung und/oder Verknüpfung von Daten möglicherweise auf Datenlieferanten oder vertrauenswürdige Dritte gestützt. Sie sollten dann jedoch ausführlich begründen, warum es nicht möglich ist, Codelisten oder andere Einzelheiten über die Vorgehensweise bei der Identifizierung von Personen oder Erkrankungen wiederzugeben, und sich bemühen, die Kontaktdaten der Gruppe beizufügen, die an den Listen Eigentumsrechte hat. Des Weiteren sollten die Autoren ansprechen, wie sich das Nichtbereitstellen dieser Informationen auf die Replikation und Evaluierung der Forschung durch den Leser auswirken kann. Im Idealfall sollten diese Dritten detaillierte Informationen über die Erhebung, Bereinigung oder Verknüpfung der Daten bereitstellen. Von einer verbesserten Kommunikation zwischen Datenlieferanten und -nutzern könnten beide Parteien profitieren. Manche haben argumentiert, dass die Codelisten geistiges Eigentum der Forscher sind. Eine Veröffentlichung dieser Listen könnte es anderen Forschern ermöglichen, diese für ihre eigene Forschung zu verwenden und so die Autoren ihres geistigen Eigentums und der Anerkennung für die Erstellung der Codeliste zu berauben. Wir sind der Meinung, dass diese Auffassung nicht dem wissenschaftlichen Standard der Transparenz in Bezug auf die Replizierbarkeit von Forschung entspricht. Daher empfehlen wir, dass die vollständigen Codelisten, mit Ausnahme solcher, die gesetzlich oder vertraglich geschützt sind, veröffentlicht werden. Wir sind uns bewusst, dass eine Veröffentlichung in einem Artikel in Papierformat aufgrund der Wörterzahl- und Platzbeschränkungen vieler Fachzeitschriften und der potenziellen Länge der Codelisten/Algorithmen nicht immer möglich ist. Stattdessen können Detailinformationen als Text, Tabellen oder als Anhang in Form eines Online-Supplements hinterlegt werden. Dies kann auf der Website der Fachzeitschrift, auf Servern, die von den Autoren oder anderen Personen auf Dauer betrieben werden oder im Datenbestand Dritter (z. B. Dryad oder Figshare) erfolgen. Die Text- und Referenzabschnitte des Manuskripts sollten ausführliche Informationen dazu enthalten, wie auf die Codelisten zugegriffen werden kann. Code-Repositorien wie ClinicalCodes.org erscheinen vielversprechend für die Dokumentation und Transparenz von Codes, die in der Forschung mit Gesundheitsdaten verwendet werden [@bib0630]. Werden die Codes in Online-Supplementen auf der Website der Fachzeitschrift oder auf einer externen Website, die von den Autoren bereitgestellt wird, veröffentlicht, sollte der Link im Hauptartikel der Fachzeitschrift erscheinen. Die Veröffentlichung auf der Website einer Fachzeitschrift oder auf PubMed Central (<http://www.ncbi.nlm.nih.gov/pmc/>) erhöht die Wahrscheinlichkeit, dass das Supplement verfügbar bleibt, solange die Fachzeitschrift existiert. Ist die Veröffentlichung auf einer externen privaten oder institutionellen Website die einzige Option, empfehlen wir, diese Listen nach Veröffentlichung des Zeitschriftenartikels mindestens zehn Jahre lang zur Verfügung zu stellen. Wurde die URL-Adresse geändert, ist eine automatische Weiterleitung von der alten Adresse der Website erforderlich. Dank dieser Maßnahmen können so auch zukünftige Leser des Artikels auf die vollständigen Codelisten zugreifen. Neben den Codelisten, die im Artikel (oder einem Online-Anhang) zur Verfügung gestellt werden, sollten die Autoren auch erörtern, ob die Wahl der in der Studie verwendeten Codes/Algorithmen zu Bias führen kann. Dabei kann es sich unter anderem um Bias durch falsche Klassifizierung, „Ascertainment bias" und Bias aufgrund fehlender Daten handeln. Wurden Sensitivitätsanalysen mit verschiedenen Code-/Algorithmus-Sets durchgeführt, sollten diese ebenfalls beschrieben und evaluiert werden. Die Diskussion über möglichen Bias kann auch im Zusammenhang mit anderen Bestandteilen der RECORD- und STROBE-Checklisten erfolgen, wie etwa der Auswahl der Studienteilnehmer und der (ggf. fehlenden) Validierung von Codes. Methoden (Statistische Methoden) {#sec0075} -------------------------------- ### Datenzugriff und Bereinigungsmethoden {#sec0080} RECORD-PUNKT 12.1: Die Autoren sollten beschreiben, inwieweit die Forscher Zugang zur Datenbank hatten, die für die Zusammenstellung der Studienpopulation verwendet wurde. RECORD-PUNKT 12.2: Die Autoren sollten Angaben zu den Methoden zur Datenbereinigung machen, die in der Studie verwendet wurden. ### Verknüpfung {#sec0085} RECORD-PUNKT 12.3: Geben Sie an, ob im Rahmen der Studie eine Verknüpfung auf Personenebene, auf institutioneller Ebene oder andere Datenverknüpfungen zwischen zwei oder mehr Datenbanken durchgeführt wurden. Die Verknüpfungstechniken und Methoden zur Evaluierung der Verknüpfungsqualität sollten angegeben werden. ### Beispiele {#sec0090} RECORD-PUNKT 12.1: Die folgenden Artikel beschreiben den Zugang zu einer Untergruppe der *UK General Practice Research Database* (GPRD).1.„Für Projekte, die über die Lizenzvereinbarung des *Medical Research Council* finanziert werden, beschränkt die GPRD die Datensätze auf 100.000 Personen. Aufgrund dieser Beschränkung ist eher eine Fallkontrollstudie als eine Kohortenstudie erforderlich, um sicherzustellen, dass wir eine ausreichende Anzahl von Krebsfällen für jedes einzelne Symptom identifiziert haben..." [@bib0635].2.„Aus der *General Practice Research Database* wurde mit einer Lizenz des *Medical Research Council* für akademische Einrichtungen eine Zufallsstichprobe ... gezogen [@bib0640]. RECORD-PUNKT 12.2: Beispiel für eine Beschreibung der Methoden zur Datenbereinigung [@bib0645]:"„Die Vollständigkeit der zur Verknüpfung verwendeten gemeinsamen Identifikatoren variierte zwischen den Datensätzen und über die Zeit (die Identifikatoren der letzten Jahre waren vollständiger). Bei LabBase2 variierten die Identifikatoren pro Einheit. Bei PICANet \[Paediatric Intensive Care Audit Network\] waren „Geburtsdatum" und „Krankenhausnummer" zu 100 % und die Mehrzahl der anderen Identifikatoren zu \> 98 % vollständig, mit Ausnahme der Nummer des NHS (National Health Service) (zu 85 % vollständig). Für beide Datensätze wurde eine Datenbereinigung und -aufbereitung durchgeführt: NHS- oder Krankenhausnummern wie „Unbekannt" oder „9999999999" wurden auf Null gesetzt; generische Namen (z. B. „Baby", „Twin 1", „Infant Of") wurden auf Null gesetzt; für mehrteilige Nachnamen und Vornamen wurden verschiedene Variablen erstellt; Postleitzahlen, die mit „ZZ" beginnen (keine Postleitzahl in GB), wurden auf Null gesetzt.""
RECORD-PUNKT 12.3: Die folgenden Auszügen aus Artikeln sind Beispiele für gutes Berichten über die Ebenen der Datenverknüpfung, verwendete Verknüpfungstechniken und -methoden sowie die zur Evaluierung der Verknüpfungsqualität verwendeten Methoden:1.„Wir haben Bescheinigungen über Lebend- und Totgeburten zu einer chronologischen Ereigniskette verknüpft, die - mit Ausnahme von Schwangerschaftsabbrüchen und ektopischen Schwangerschaften - die Fortpflanzungsvorgeschichte der einzelnen Frauen darstellte" [@bib0650].2.Zwei Artikel enthalten ausgezeichnete Beschreibungen von Verknüpfungen, die speziell für die Studie, über die berichtet wird, erstellt wurden [@bib0645], [@bib0650]. In dem Artikel von Harron et al. [@bib0645] wurde eine detaillierte Erläuterung zur Verknüpfung mit grafischer Darstellung des Matching-Prozesses gegeben. Zudem werden die Methoden zur Berechnung der Wahrscheinlichkeit der Verknüpfung beschrieben: „Die Match-Wahrscheinlichkeiten P (M \| Übereinstimmungsmuster) wurden zur Schätzung der Wahrscheinlichkeit eines Matches bei Übereinstimmung eines gemeinsamen Satzes von Identifikatoren berechnet. Dadurch wurde die Annahme der Unabhängigkeit zwischen den Identifikatoren umgangen. Die Wahrscheinlichkeiten wurden abgeleitet, indem die Anzahl der Verknüpfungen durch die Gesamtanzahl der Paare für jedes Übereinstimmungsmuster (basierend auf im Trainingsdatensatz identifizierten wahrscheinlichen Verknüpfungen) geteilt wurde. Wenn beispielsweise bei 378 Vergleichspaaren eine Übereinstimmung hinsichtlich Geburtsdatum und Soundex besteht, jedoch keine Übereinstimmung hinsichtlich des Geschlechts vorliegt, und es sich bei 312 dieser Paare um wahrscheinliche Verknüpfungen handelt, läge die Match-Wahrscheinlichkeit für das Übereinstimmungsmuster \[1,1,0\] bei 312 : 378 = 0,825″ [@bib0645]. Der Artikel von Adams et al. enthält zudem eine detaillierte Erläuterung des Verknüpfungsprozesses: „Die deterministische Verknüpfung umfasste die Phase I mit sechs Verarbeitungsschritten, bei denen Verknüpfungsketten gebildet und einzelne (zuvor unverknüpfte) Datensätze den Ketten hinzugefügt wurden. Daraufhin folgte Phase n, die mehrere Durchläufe der Datei zur Kombination von Ketten mit derselben Mutter umfasste" [@bib0650].3.Sollte eine Studie hingegen auf zuvor verknüpfte Daten verweisen, ist es eventuell sinnvoll, eine frühere Publikation zu referenzieren: „Die Datensätze beider Datenbanken wurden mithilfe von Geburtsdatum, Geschlecht und Postleitzahl mit den kommunalen Melderegistern und anschließend miteinander verknüpft. Die Verknüpfung wurde von *Statistics Netherlands* durchgeführt und in früheren Publikationen beschrieben" [@bib0525].4.Nachfolgend ein Beispiel für gutes Berichten von Merkmalen von verknüpften und nicht verknüpften Personen: „Für die Zwecke dieser Publikation werden nicht gematchte Datensätze der ISC (Inpatient Statistics Collection) als ISC-Reste, nicht gematchte Datensätze der MDC (Midwives Data Collection) als MDC-Reste und verknüpfte Paare als gematchte Datensätze bezeichnet.... Ausgewählte Variablen, die in beiden Datensätzen vorhanden waren, wurden zwischen den drei Gruppen (ISC-Reste, MDC-Reste und gematchte Datensätze) verglichen" [@bib0655]. ### Erläuterung {#sec0095} RECORD-PUNKTE 12.1 und 12.2: Wenn die Erstellung der Studienpopulation von Datenanalysten vorgenommen wird, die nicht mit den Besonderheiten des Aufbaus einer Kohorte oder den Studienzielen vertraut sind, kann es zu Fehlern kommen. Folglich sollte angegeben werden, in welchem Umfang die Autoren Zugriff auf die Datenbank hatten. Die Beschreibung der Methoden zur Datenbereinigung in den verschiedenen Studienabschnitten sollte auch Angaben zu den Methoden für das Suchen nach fehlerhaften oder fehlenden Daten einschließlich Wertebereichsprüfungen, Überprüfungen auf doppelt vorhandene Datensätze und Umgang mit wiederholten Messungen beinhalten [@bib0660], [@bib0665]. Weitere zu berichtende Methoden könnten die Untersuchung von Häufigkeitsverteilungen, Kreuztabellierungen von Daten und grafische Darstellungen oder den Einsatz von statistischen Methoden zur Erkennung von Ausreißern umfassen [@bib0670]. Zudem könnten weitere Informationen zur Fehlerdiagnose einschließlich Definitionen der Plausibilität und der Fehlerbehandlung bei der Analyse angegeben werden. Eine klare und transparente Beschreibung der Methoden zur Datenbereinigung ist wichtig, da die Wahl dieser Methoden die Studienergebnisse, die Wiederholbarkeit der Studie und auch die Nachvollziehbarkeit der Studienergebnisse beeinflussen könnte [@bib0675]. RECORD-PUNKT 12.3: Bei Verknüpfungsstudien schlagen wir vor, den geschätzten Anteil gelungener Verknüpfungen, die Verwendung deterministischer versus probabilistischer Verknüpfungen, die Qualität und den Typ der für die Verknüpfung verwendeten Variablen und die Ergebnisse aller Validierungen von Verknüpfungen anzugeben. Wurde speziell für die Studie eine Verknüpfung von Datensätzen zwischen Datenbanken durchgeführt, sollte über die Methoden der Verknüpfung und die Evaluierung der Qualität der Verknüpfung berichtet werden, und angegeben werden, wer die Verknüpfung vorgenommen hat. Falls vorhanden, sollten Informationen über Blocking-Variablen, die Vollständigkeit von Verknüpfungsvariablen, Regeln der Verknüpfung, Schwellenwerte und über manuelle Überprüfungen bereitgestellt werden [@bib0645]. Wurde die Verknüpfung vor der Studie (d. h. für frühere Studien oder zum allgemeinen Gebrauch) oder von einem externen Anbieter, z. B. von einem Datenverknüpfungszentrum, vorgenommen, so ist eine Referenz erforderlich, welche die Datenquelle und die Verknüpfungsmethoden beschreibt. Damit der Leser die Auswirkungen jeglicher Verknüpfungsfehler und damit verbundenem Bias beurteilen kann, sind Angaben zu den Verknüpfungsmethoden und die Evaluierung ihres Erfolgs von entscheidender Bedeutung [@bib0680]. Insbesondere sollte der Leser erfahren, ob die verwendete Verknüpfungsart deterministisch und/oder probabilistisch war; so kann er beurteilen, ob die Verknüpfung durch fehlerhaftes oder fehlendes Matching beeinträchtigt wurde. Wenn ein eindeutiger Identifikator in den unterschiedlichen Datenquellen verfügbar ist, ist eine deterministische Verknüpfung sinnvoll. Ist ein solcher Identifikator nicht verfügbar, ist eine Beschreibung der angewandten Regeln der Datensatzverknüpfung (oder der statistische Verknüpfungsschlüssel) entscheidend. Im Gegensatz dazu werden bei der probabilistischen Verknüpfung mehrere Identifikatoren mitunter mit verschiedenen Gewichtungen verwendet und über einem bestimmten Schwellenwert wird eine Übereinstimmung angenommen. Es können auch gemischte Methoden zur Anwendung kommen. Zum Beispiel kann für manche Datensätze eine deterministische Verknüpfung verwendet werden, während beim Fehlen von eindeutigen Identifikatoren für andere Datensätze eine probabilistische Verknüpfung angewandt wird. Ein sog. Verknüpfungsbias („Linkage bias") kann vorkommen, wenn die Wahrscheinlichkeit eines Verknüpfungsfehlers (z. B. falsche und fehlende Matches) mit Variablen von Interesse assoziiert sind. Beispielsweise können die Verknüpfungsraten je nach Patientenmerkmalen, z. B. Alter, Geschlecht und gesundheitlicher Zustand, variieren. Selbst geringe Fehler im Verknüpfungsprozess können zu Bias und Ergebnissen führen, die die zu untersuchenden Assoziationen über- oder unterschätzen [@bib0685]. Die Autoren sollten über Verknüpfungsfehler berichten und dabei Standardverfahren wie Vergleiche mit Gold-Standards oder Referenzdatenbeständen, Sensitivitätsanalysen und Vergleiche der Merkmale verknüpfter und nicht verknüpfter Daten verwenden [@bib0690]. Wenn über Verknüpfungsfehler berichtet wird, können Leser die Qualität der Verknüpfung und möglichen Bias aufgrund von Verknüpfungsfehlern bestimmen. Ergebnisse (Teilnehmer) {#sec0100} ----------------------- RECORD-PUNKT 13.1: Beschreiben Sie ausführlich die Auswahl der in die Studie aufgenommenen Personen (d. h. die Auswahl der Studienpopulation) einschließlich des Filterns aufgrund von Datenqualität, Datenverfügbarkeit und Verknüpfung. Die Auswahl der eingeschlossenen Personen kann im Fließtext und/oder mit Hilfe des Studienflussdiagramms beschrieben werden. ### Beispiel {#sec0105} Der folgende Auszug enthält ein Beispiel für gutes Berichten:"„Wir identifizierten 161.401 Medicare-Versicherte, bei denen laut SEER-Registern (Surveillance, Epidemiology, and End Results) zwischen 1998 und 2007 in mindestens einem Fall ein Lungen- und Bronchialkarzinom diagnostiziert wurde. Unter diesen Patienten ermittelten wir 163.379 gesonderte Diagnosen von mehrfachen Lungenkarzinomen. (Einige Patienten hatten zwei primäre Lungenkarzinome, die im Verlauf der Studie in einem Zeitabstand von über einem Jahr auftraten). [Abbildung 5](#fig0025){ref-type="fig"} zeigt eine Abweichung der letzten Kohorte von 46.544 Patienten mit 46.935 nicht-kleinzelligen Lungenkarzinomen (Non-Small Cell Lung Cancer, NSCLC) [@bib0695]."" ### Erläuterung {#sec0110} Die Autoren sollten eine Abweichung der Studienpopulation(en) von den ursprünglichen Datenbanken mit den Routinedaten klar beschreiben. Unterschiede zwischen der Studienpopulation und der Datenbankpopulation müssen dokumentiert werden, damit etwaige Ergebnisse übertragen werden können (siehe auch RECORD-Punkt 6.1). Forscher, die Routinedatenquellen verwenden, beschränken häufig die Studienpopulation aufgrund von Faktoren wie der Qualität der verfügbaren Daten. Wenn beispielsweise die Studiendauer auf einen Zeitraum mit annehmbarer Datenqualität beschränkt wird, kann dies zu einem Ausschluss von möglichen Studienteilnehmern führen. Unter Umständen werden Arztpraxen mit inkonsistenter Eingabe in elektronische Patientenakten ausgeschlossen oder es wird gewartet, bis diese Praxen die Daten konsistent eingeben [@bib0615], [@bib0700]. Eine Studienpopulation kann auch basierend auf der Verfügbarkeit von Daten beschränkt werden. So werden beispielsweise in Studien, die Daten der US-amerikanischen Medicare verwenden, Versicherte, die aktuell bei einer Health Maintenance Organization registriert sind, häufig aufgrund fehlender Aufzeichnungen von klinischen Ereignissen ausgeschlossen [@bib0695], [@bib0705]. Bei der Verwendung von Datenquellen, in denen sich die Aufnahmekriterien („eligibility") über die Zeit verändern kann (z. B. Versicherungsdatenbanken) müssen die Forscher eindeutige Angaben darüber machen, wie die Aufnahmekriterien definiert wurden und entsprechende Änderungen gehandhabt wurden. Wenn eine Studie verknüpfte Routinedaten verwendet, ist die Studienpopulation häufig kleiner, da sie auf Einzelpersonen, für die verknüpfte Daten verfügbar sind, beschränkt ist [@bib0710]. Zudem können aus methodischen Gründen stark eingeschränkte Kohorten verwendet werden, um Ursachen von Confounding auszuschalten. Die für den Erhalt der endgültigen Studienpopulation(en) ergriffenen Massnahmen, Ein- und Ausschlusskriterien und der tatsächliche Ein- und Ausschluss von Studienteilnehmern in den verschiedenen Phasen der Kohortenerstellung und -analyse sollten im Fließtext des Manuskripts oder mit Hilfe eines geeigneten Flussdiagramms definiert werden. Studienpopulationen können unter Verwendung verschiedener Codes und/oder Algorithmen (siehe RECORD-Punkt 6.1) erstellt werden. Dabei können sich Unterschiede in der Verwendung von Codes im Verlauf der Zeit auf die Studienpopulation auswirken [@bib0715], [@bib0720]. Studien verwenden möglicherweise auch mehrere Falldefinitionen, die mehr oder weniger sensitiv/spezifisch sind, was sich auf nachfolgende Analysen auswirken kann. Eine Beschreibung dieser Schritte ist zur Bewertung der externen Validität von Studienergebnissen und, unter bestimmten Umständen, zur Bewertung eines möglichen Selektionsbias wichtig. Um die möglichen Auswirkungen eines Fehlens von Daten auf die Repräsentativität der Studienpopulation zu bewerten, können Sensitivitätsanalysen berichtet werden. Wenn Informationen über die Auswahl der Studienpopulation(en) aus der ursprünglichen Datenbank bereitgestellt werden, hilft dies auch, eine Studie zu replizieren. Möglicherweise wurden auch zusätzliche Analysen für verschiedene Studienpopulationen durchgeführt, die in Online-Anhängen berichtet werden können. Diskussion (Einschränkungen) {#sec0115} ---------------------------- RECORD-PUNKT 19.1: Erörtern Sie, was es bedeutet, Daten zu verwenden, die nicht zur Beantwortung spezifischer Forschungsfragen erhoben bzw. gesammelt wurden. Diskutieren Sie dabei auch Bias durch falsche Klassifizierung, Confounding durch ungemessene Faktoren, fehlende Daten und sich mit der Zeit verändernder Aufnahmekriterien, soweit diese die Studie betreffen, über die berichtet wird. Beispiele {#sec0120} --------- Die folgenden Artikel beschreiben Einschränkungen beim Verwenden von Verwaltungsdaten:1.„Drittens handelte es sich bei dieser Studie um eine retrospektive, auf Rechnungsforderungen basierende Analyse. Es konnten nur Positronen-Emissions-Tomographie (PET) Aufnahmen, die von Medicare bezahlt wurden, in der Analyse ermittelt werden. Um den Anteil von versäumten Rechnungsforderungen zu minimieren, wurden alle Analysen auf Medicare-Versicherte beschränkt, die in den 12 Monaten vor und nach der Diagnose sowohl über Medicare Part A als auch Medicare Part B versichert waren und keinem Managed-Care-Programm angehörten bzw. über Medicare Part C versichert waren. Viertens ist es wahrscheinlicher, dass Patienten im SEER-Register nicht weißer Hautfarbe sind, in Gebieten mit weniger Armut oder in der Stadt leben, wodurch die Generalisierbarkeit der Ergebnisse eingeschränkt sein kann. Fünftens basierte das Krankheitsstadium während der Studiendauer auf SEER-Daten, die über einen Zeitraum von vier Monaten oder bis zum ersten operativen Eingriff erfasst wurden. Im Jahr 2004 wurde die Datenerhebung für SEER auf das gemeinschaftliche Staging-System geändert. Es ist unklar, inwieweit unsere Ergebnisse mit diesem neueren Ansatz abweichen würden" [@bib0695].2.„Trotz mehrerer Stärken der SEER-Medicare-Daten, wie eines vergleichbar großen Stichprobenumfangs, der Generalisierbarkeit auf die US-Population und den detaillierten Informationen über Verschreibungen, war unsere Studie aufgrund fehlender Labordaten zu Cholesterin, Triglyceriden und dem Blutzuckerspiegel eingeschränkt. Diese hätten Informationen über das Ausmaß von Stoffwechselstörungen in der Bevölkerung liefern können ... Mit verfügbaren Labordaten hätte das residuale Confounding durch die Schwere der Stoffwechselstörung verringert werden können. Auch fehlten uns detailliertere Daten zur Progression der Krebserkrankung. Da Patienten mit einer kurzen Lebenserwartung eine Statin-Behandlung möglicherweise vorenthalten bzw. diese bei ihnen abgesetzt wurde, könnte dies ein Confounder in der Assoziation zwischen Gabe von Statinen und Todesfällen gewesen sein" [@bib0725]. Erläuterung {#sec0125} ----------- Routinedaten werden in der Regel nicht aufgrund einer speziellen, a priori formulierten Forschungsfrage gesammelt. Die Gründe für die Datenerfassung können unterschiedlicher Natur sein. Die Schlussfolgerungen der Forscher sind durch zahlreiche Arten von Bias gefährdet. Dazu zählen die üblichen Bias-Quellen im Zusammenhang mit Beobachtungsstudien, aber auch einige, die spezifischer für Beobachtungsstudien sind, die Routinedaten verwenden. Folgende Punkte sollten von den Autoren als mögliche Bias-Quellen erörtert werden: (1) Codes oder Algorithmen zur Ermittlung von Studienpopulationen, Zielgrößen, Confounder oder Effektmodifikatoren (Bias durch falsche Klassifizierung), (2) fehlende Variablen (ungemessene Confounder); (3) fehlende Daten und (4) Änderungen hinsichtlich der Aufnahmekriterien im Verlauf der Zeit. Der ursprüngliche Grund für die Erhebung von Routinedaten kann sich auf die Qualität der Daten und ihre Eignung für die untersuchten Forschungsfragen auswirken. So können zum Beispiel Register, die für retrospektive Analysen verwendet werden, über eine bessere Qualitätskontrolle verfügen als Organisationen, die andere Typen von Routinedaten sammeln, obgleich dies auch anders sein kann. In ähnlicher Weise werden einige Verwaltungsdaten einer gründlichen und andere Daten gar keiner Qualitätskontrolle unterzogen. Verwaltungsdaten sind beim sog. „Upcoding" oder opportunistischen Coding besonders fehleranfällig. Basiert die Krankenhausvergütung beispielsweise auf der Komplexität der Erkrankungen im Patientenkollektiv, maximieren die Krankenhäuser unter Umständen die Erstattung, indem sie den Patientenakten in großzügiger Weise mehr Codes für komplexe Krankheitsbilder hinzufügen [@bib0730]. Des Weiteren können sich Änderungen bei den Coding-Strategien auf die Validität oder Konsistenz der Daten auswirken. Beispielsweise kann die Einführung von Codes als Anreiz für die Verwendung von Abrechnungsdienstleistern die Wahrscheinlichkeit der Verwendung eines Codes über die Zeit ändern [@bib0735], [@bib0740]. Andere Codes werden möglicherweise gemieden, da sie zur Stigmatisierung von Patienten oder Sanktionen für die Anbieter führen [@bib0745]. Zudem können geänderte Versionen von Code-Klassifizierungssystemen (z. B. von der Internationalen Klassifikation der Krankheiten (ICD)-9 auf ICD-10) die Validität von Erhebungen unter Verwendung codierter Daten verändern [@bib0750], [@bib0755]. Abweichungen in der klinischen Praxis zwischen Krankenhäusern und Bevölkerungsgruppen können dazu führen, dass an bestimmten Orten und/oder Arztpraxen Laboruntersuchungen durchgeführt werden, was Auswirkungen auf einen Diagnose-Algorithmus zur Folge haben kann. Sollten irgendwelche dieser potenzielle Quellen von Bias durch falsche Klassifikation vorhanden sein, sollten diese als Einschränkungen der Studie diskutiert werden. Residuales Confounding ist definiert als Confounding in Verbindung mit Variablen, die nicht in den zu untersuchenden Daten eingeschlossen sind, was Bias zur Folge haben kann [@bib0760]. Dies ist eine potenzielle Bias-Quelle in allen Beobachtungsstudien, jedoch insbesondere in Studien, die Routinedaten verwenden. Um sie zu analysieren, sind unter Umständen Variablen erforderlich, die zum Zeitpunkt der Planung der Datenbanken oder der Erfassung der Daten nicht in Betracht gezogen wurden. Es wurden verschiedene Methoden zur Berücksichtigung dieser potenziellen Bias-Quelle vorgeschlagen einschließlich Propensity-Scores [@bib0765], [@bib0770], [@bib0775], [@bib0780]. Jedoch können Propensity-Scores, wie auch die gewöhnliche Regressionsanalyse oder das standardmäßige Matching, nur ein Gleichgewicht zwischen den Studienteilnehmern hinsichtlich der in den Daten verfügbaren Variablen garantieren. Ein besonderer Typ ungemessenen Confoundings ist indikationsbedingtes Confounding („confounding by indication"). Dies stellt häufig ein Problem dar, wenn die Wirkung und Sicherheit (medikamentöser) Behandlungen mit Hilfe von Routinedaten untersucht werden. So kann die Prognose für Patienten, die eine (medikamentöse) Behandlung erhalten, besser oder schlechter ausfallen als die Prognose für Patienten, die keine (medikamentöse) Behandlung erhalten. Angaben zur Prognose und/oder Schwere der zugrundeliegenden Erkrankung stehen jedoch womöglich nicht im Datensatz zur Verfügung [@bib0785]. Probleme dieser Art sollten von den Autoren erörtert werden und die verwendeten Methoden zur Berücksichtigung dieser Probleme sollten (sofern möglich) berichtet werden. Fehlende Daten können bei allen Beobachtungsstudien Schwierigkeiten bereiten; sie werden in der Box 6 des erläuternden STROBE-Artikels behandelt [@bib0475]. Fehlende Daten sind bei Routinedaten besonders problematisch, da die Datenerhebung von den Forschern nicht kontrolliert werden kann [@bib0790]. Fehlende Daten können zu Selektionsbias führen, wenn es fehlende Werte gibt bei Variablen, die zur Definition der Studienkohorte verwendet werden, oder fehlende Identifikatoren, welche die Verknüpfung von Datensätzen verhindern, besonders wenn die fehlenden Daten nicht zufällig verteilt sind. Fehlende Variablen stellen ähnliche Herausforderungen dar. Die Autoren sollten die fehlenden Variablen, von denen angenommen wird, dass sie ungemessenes Confounding erzeugen, den Grund für das Fehlen dieser Variablen, die möglichen Auswirkungen auf die Studienergebnisse sowie die zur Adjustierung für fehlende Variablen verwendeten Methoden präzise schildern. Beispielsweise hat der Raucherstatus eine großen Auswirkung auf die Schwere von Morbus Crohn und wurde mit den Ergebnissen der Behandlung dieser Krankheit in Zusammenhang gebracht. Allerdings ist der Raucherstatus selten in administrativen Gesundheitsdaten enthalten. Bei einer Studie, die die Assoziation zwischen sozioökonomischem Status und den Behandlungsergebnissen bei Morbus Crohn untersuchte, wurde der Raucherstatus als potenzieller ungemessener Confounder diskutiert [@bib0795]. Häufig werden fehlende Daten/Variablen erst nach Beginn der Studie mit Routinedaten entdeckt. Dies macht es erforderlich, dass die Forscher von ihrem ursprünglichen Studienprotokoll abweichen. Es sollten stets die Einzelheiten der Abweichungen vom Studienprotokoll, unabhängig vom Grund für die Abweichung, berichtet werden. Es sollten die Gründe für die Abweichungen sowie die Auswirkungen auf die Studie und die Schlussfolgerungen diskutiert werden. Eine weitere mögliche Einschränkung sind Änderungen der Coding-Verfahren oder Aufnahmekriterien, die sich aufgrund einer Änderung der Zusammensetzung der Datenbankpopulation, Studienpopulation oder beiden über die Zeit ergeben. Die Definition der Datenbankpopulation kann sich aufgrund einer Vielzahl von Umständen ändern, z. B. wenn Arztpraxen, welche Patienten rekrutieren, die Arbeit mit der Datenbank beenden, andere Computer-Software verwendet wird oder die Kriterien zur Aufnahme in die Datenbank, z. B. in ein Register, geändert werden. Die Studienpopulation bei Verwendung administrativer Datenquellen (z. B. Versicherungsdatenbanken) kann sich verändern, wenn die Eignung von Personen aufgrund eines geänderten Arbeitsverhältnisses, Aufenthaltsstatus oder Gesundheitsdienstleisters nicht konstant ist. Auch eine veränderte Vorgehensweise bei der Codierung von Datensätzen (z. B. Upcoding oder Änderungen im Codierungssystem wie oben beschrieben) kann zu einer Veränderung der Studienpopulation führen [@bib0740], [@bib0800], [@bib0805]. Damit der Leser das Verzerrungspotenzial beurteilen kann, sollten die Autoren bei der Erörterung von Beschränkungen erläutern, wie eine Änderung der Aufnahmekriterien in der Analyse gehandhabt wurde. Wie in STROBE erläutert, sollte die Diskussion die Richtung und das Ausmaß möglichen Biases und die ergriffenen Maßnahmen zu seiner Handhabung umfassen. Weitere Informationen {#sec0130} --------------------- RECORD-PUNKT 22.1: Die Autoren sollten darüber informieren, wie auf ergänzende Informationen wie Studienprotokoll, Rohdaten oder Programmcode zugegriffen werden kann. Beispiele {#sec0135} --------- 1.Der Artikel von Taljaard et al. enthält das vollständige Studienprotokoll für eine Studie, die den Canadian Community Health Survey benutzt hat [@bib0810].2.In ihrem Artikel laden Guttmann et al. dazu ein, das Studienprotokoll anzufordern: „Datenaustausch: Der technische Anhang, der Plan bzw. das Protokoll zur Erstellung des Datensatzes und der statistische Code sind vom korrespondierenden Autor über E-Mail \[E-Mail-Adresse\] erhältlich" [@bib0815]. ### Erläuterung {#sec0140} Wir unterstützen nachdrücklich die Verbreitung detaillierter Informationen über Studienmethoden und -ergebnisse. Sofern möglich, unterstützen wir die vor- oder gleichzeitige Veröffentlichung des Studienprotokolls, der Ergebnisse der Rohdaten und ggf. des Programmcodes. Diese Informationen helfen Peer-Reviewern und Lesern, die Validität der Studienergebnissen zu beurteilen. Den Forschern stehen eine Reihe von Möglichkeiten zur freien Veröffentlichung (Open Publication) solcher Daten zur Verfügung. Dazu gehört das ergänzende online verfügbare Material von Zeitschriften, persönliche und institutionelle Websites, wissenschaftliche Social Media-Websites (z. B. ResearchGate.net und Academia.edu), Datenrepositorien (z. B. Dryad oder Figshare) oder Open Data-Websiten von öffentlichen Stellen [@bib0820]. Uns ist bewusst, dass einige Forschungsorganisationen, Körperschaften, Einrichtungen oder Gesetze die freie Verfügbarkeit von Informationen dieser Art unter Umständen verbieten oder einschränken. Obwohl die Diskussion über Eigentumsrechte und die Verwendung dieses geistigen Eigentums außerhalb des Anwendungsbereichs der RECORD-Leitlinien liegt, sollte die Veröffentlichung solcher Daten grundsätzlich innerhalb der rechtlichen und ethischen Richtlinien der Institution der Forscher und unter der Anleitung der Redakteure der Fachzeitschriften erfolgen. Diese Informationen wären auch für andere Forscher hilfreich, die eventuell auf diese Daten zugreifen möchten, um die in dem Manuskript beschriebene Forschung zu replizieren, zu reproduzieren oder zu ergänzen. Ungeachtet des Formats oder Umfangs der verfügbaren ergänzenden Informationen empfehlen wir, im Manuskript eindeutige Angaben zum Speicherort dieser Informationen zu machen. Diskussion {#sec0145} ========== Die RECORD-Leitlinien gelten speziell für Beobachtungsstudien, die Routinedaten verwenden. Sie sollen die STROBE-Leitlinien ergänzen und nicht ersetzen. RECORD wurde entwickelt als Leitfaden für Autoren, Redakteure von Fachzeitschriften, Peer-Reviewer und andere Interessengruppen, um die Transparenz und Vollständigkeit des Berichtens von Studien, die Routinedaten verwenden, zu fördern. Die Checkliste ist zur Verwendung durch alle Forscher gedacht, die solche Daten nutzen, und wir unterstützen die breit angelegte Verbreitung an alle interessierten Parteien. Wir erwarten, dass das Berichten von Studien, die Routinedaten verwenden, transparenter werden wird, wenn RECORD von den Fachzeitschriften angenommen und umgesetzt wird. Einschränkungen {#sec0150} --------------- Sowohl STROBE als auch RECORD sind ausschließlich für die Anwendung auf Beobachtungsstudien ausgelegt. Routinedaten werden jedoch gelegentlich für Forschung mit anderen Studiendesigns verwendet, wie beispielsweise für cluster-randomisierte Studien in der Versorgungsforschung. Außerdem kann es sinnvoll sein, Daten aus randomisierten Studien mit Verwaltungsdaten zu verknüpfen, um Teilnehmer für bestimmte Zielgrössen langfristig nachzubeobachten. Damit verbundene Studien würden nicht als beobachtend erachtet werden. So wie sich das Forschungsfeld weiterentwickelt, werden auch wir voraussichtlich, mit ähnlicher Methodik, RECORD auf andere Forschungsdesigns ausweiten. Mit RECORD versuchen wir, die Interessen und Prioritäten der Stakeholder bestmöglich wiederzugeben. Dabei erkennen wir, dass sich die Methoden für die Durchführung von Forschungsarbeiten mit Routinedaten schnell ändern und eine zunehmende Zahl verschiedener Datentypen für solche Forschung verfügbar wird. So gibt es beispielsweise Mobile Gesundheitsapplikationen (mHealth-Apps) für immer mehr Smartphones und tragbare Technologien. Obwohl diese Datenquellen derzeit nur begrenzt zur Forschung benutzt werden, erwarten wir, dass die Verwendung dieser Daten in naher Zukunft rasch zunehmen wird und dass neue Methoden zum Umgang mit dieser Ressource entwickelt werden. Außerdem hat sich das Working Committee auf Gesundheitsdaten konzentriert, was andere für die Gesundheitsforschung verwendete Datenquellen (z. B. Umweltdaten, Finanzdaten etc.) ausschliesst. Daher enthält die RECORD-Checkliste möglicherweise nicht alle Themen, die in der Zukunft wichtig werden könnten. Zu gegebener Zeit könnte dies eine Überarbeitung erforderlich machen. Wir unternahmen erhebliche Anstrengungen, um möglichst viele Interessengruppen in die Erstellung dieser Leitlinien einzubeziehen. So haben wir mittels öffentlicher Aufrufe und gezielter Einladungen versucht, verschiedene Stakeholder für eine Mitarbeit an diesen Leitlinien zu gewinnen [@bib0505]. Allerdings repräsentieren die meisten Stakeholder Regionen, die Routinedaten für Forschungszwecke verwenden; Vertreter aus Entwicklungsländern und nicht englischsprachigen Ländern sind unterrepräsentiert. Dennoch sind wir der Meinung, dass die Stakeholder-Gruppe repräsentativ für die derzeitigen Forscher und Nutzer der so erworbenen Kenntnisse war. Wir erhielten sehr viele Beiträge in den Umfragen und Rückmeldungen der Stakeholder. Die einzelnen Empfehlungen in den Leitlinien wurden aus Gründen der Machbarkeit von einem kleineren, aus 19 Mitgliedern bestehenden Working Committee formuliert, die sich dazu persönlich getroffen hat, wie in der Literatur vorgeschlagen [@bib0510]. Zukünftig werden technische Neuerungen und soziale Medien eine aktivere Teilnahme größerer Gruppen an den Treffen des Working Committees möglich machen. Zukünftige Ausrichtung und Engagement in der Community {#sec0155} ------------------------------------------------------ Routinedaten aus dem Gesundheitswesen werden zunehmend verfügbar. Daher gehen wir davon aus, dass mehr und mehr auch Forscher aus Regionen, in denen auf solche Art von Daten derzeit noch nicht zugegriffen werden kann, eingebunden werden können. Wir hoffen, dass Interessierte via Webseite record-statement.org und Forum fortlaufend mit Kommentaren und Diskussionspunkten zu RECORD beitragen. Dies kann uns in der Zukunft bei einer formalen Überarbeitungen helfen. Mithilfe dieser Online-Community wird RECORD zu einem dynamischen Dokument, das an die Veränderungen in diesem Forschungsfeld angepasst werden kann. Die Veröffentlichung einer Leitlinie für die Berichterstattung und die Anerkennung durch Fachzeitschriften allein sind nicht ausreichend, um das Berichten von Forschung zu verbessern [@bib0825]. Für einen messbaren Erfolg sind die Art und Weise, wie die Leitlinien von Forschern, Fachzeitschriften und Peer-Reviewern umgesetzt werden, von entscheidender Bedeutung [@bib0830]. Deshalb wird es im Online-Auftritt ein Diskussionsforum zur Umsetzung der Leitlinien geben. Wir würden es befürworten, wenn die Auswirkungen von RECORD auf das Berichten „im Feld" beurteilt würde. So könnte sichergestellt werden, dass die Leitlinien einen messbaren Nutzen liefern. Schlussfolgerungen {#sec0160} ================== Das RECORD-Statement ergänzt die STROBE-Kriterien für Beobachtungsstudien, die Routinedaten aus dem Gesundheitswesen verwenden. Mit Unterstützung der in Forschung und Publikationswesen Aktiven haben wir Leitlinien in Form einer Checkliste und dieses zugehörige erläuternde Dokument entwickelt. Es konnte gezeigt werden, das solche Leitlinien das Berichten von Forschungsergebnissen verbessert, was wiederum den Nutzern der Forschung ermöglicht, die Stärken, Einschränkungen und die Güte der Schlussfolgerungen einschätzen zu können [@bib0485], [@bib0835], [@bib0840], [@bib0845]. Wir gehen davon aus, dass sich RECORD mit der Weiterentwicklung neuer Forschungsmethoden im Feld verändern wird. Gleichwohl hoffen wir, dass es diese Leitlinien in den kommenden Jahren leichter machen werden, Forschung angemessen zu berichten. Wenn Autoren, Redakteure von Fachzeitschriften und Peer-Reviewer RECORD umsetzen, gehen wir davon aus, dass dies zu Transparenz, Reproduzierbarkeit und Vollständigkeit beim Berichten von Forschung mit Routinedaten aus dem Gesundheitswesen führt. Danksagungen {#sec0165} ============ Diese Arbeit wurde von der Ethikkommission des *Children\'s Hospital of Eastern Ontario* genehmigt. Die Autoren danken den Stakeholdern, die an den Umfragen zur Priorisierung von Themen zur Aufnahme in die Checkliste beigetragen haben. Auch danken wir den Mitgliedern der STROBE-Initiative für ihre Anleitung und Unterstützung bei der Entwicklung von RECORD. Die Autoren danken den RECORD-Forschungskoordinatoren Pauline Quach und Danielle Birman herzlich für ihre Beiträge, sowie Andrew Perlmutar, dem Web-Designer und Administrator von record-statement.org. Die Autoren danken auch allen Stakeholdern für ihre Beiträge zur Erstellung dieser Leitlinien. Mitglieder des RECORD Working Committee: Douglas Altman (Centre for Statistics in Medicine, Oxford University), Nicholas de Klerk (University of Western Australia), Lars G. Hemkens (University Hospital Basel), David Henry (University of Toronto and Institute for Clinical Evaluative Sciences, Toronto), Jean-Marie Januel (University of Lausanne), Marie-Annick Le Pogam (Institute of Social and Preventive Medicine, University Hospital of Lausanne), Douglas Manuel (Ottawa Hospital Research Institute, University of Ottawa), Kirsten Patrick (Redakteurin, *Canadian Medical Association Journal* \[CMAJ\]), Pablo Perel (London School of Hygiene and Tropical Medicine), Patrick S. Romano (University of California, Davis, Co-Chefredakteur, Health Services Research), Peter Tugwell (University of Ottawa, Chefredakteur, *Journal of Clinical Epidemiology*), Joan Warren (National Institutes of Health/National Cancer Institute), Wim Weber (Redakteur der europäischen Ausgabe von *BMJ*) und Margaret Winker (ehemals leitende Redakteurin Forschung, *PLOS Medicine*; derzeitige Schriftführerin, World Association of Medical Editors). Übersetzung: Elsevier, Lars G. Hemkens (University Hospital Basel), Erik von Elm (Cochrane Schweiz, Universitätsspital Lausanne). Der ursprüngliche Artikel wurde in englischer Sprache veröffentlicht [@bib0425] und ist unter [[http://journals.plos.org/plosmedicine/article?id=10.1371/journal.pmed.1001885]{.ul}](http://journals.plos.org/plosmedicine/article%3Fid=10.1371/journal.pmed.1001885){#intr0040} verfügbar. Interessenkonflikt {#sec0170} ================== Die Autoren erklären, dass kein Interessenkonflikt besteht. Appendix A. Zusätzliche Daten {#sec0180} ============================= Zusätzliche Daten verbunden mit diesem Artikel finden sich in der Online-Version unter: [doi:10.1016/j.zefq.2016.07.010](10.1016/j.zefq.2016.07.010){#intr0045}. S1 Tabelle. Liste der Stakeholder, die an der Umfrage teilnahmen. {#fig0005} ![Venn-Diagramm zur Darstellung des Verknüpfungsprozesses (reproduziert mit Erlaubnis von Herrett et al. [@bib0565] auf unserer Website: <http://record-statement.org/images/figure2.jpg>).](gr2){#fig0010} ![Kombination aus Flussdiagramm und Venn-Diagramm zur Darstellung des Verknüpfungsprozesses (reproduziert mit Erlaubnis von van Herk-Sukel et al. [@bib0570] auf unserer Website: <http://record-statement.org/images/figure3.jpg>).](gr3){#fig0015} ![Verknüpfungsdiagramm kombiniert mit Teilnehmer-Flussdiagramm (reproduziert mit Erlaubnis von Fosbøl et al. [@bib0575] auf unserer Website: <http://record-statement.org/images/figure4.jpg>).](gr4){#fig0020} ![Beispiel Flussdiagramm Studie Ein- und Ausschlusskriterien mit Genehmigung von Dinan et al. [@bib0695] (Website: <http://record-statement.org/images/figure5.jpg>).](gr5){#fig0025} ###### Das RECORD-Statement: Checkliste von Punkten in Erweiterung des STROBE-Statements, die in Beobachtungsstudien mit Routinedaten berichtet werden sollten. Tabelle 1 ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Nr. STROBE-Punkte RECORD-Punkte ------------------------------------------------------------------- ----- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **Titel und Abstract** 1 \(a\) Machen Sie das Studiendesign im Titel oder Abstract kenntlich, indem Sie dafür einen allgemein gebräuchlichen Begriff verwenden\ RECORD 1.1: Der verwendete Datentyp sollte im Titel oder Abstract angegeben werden. Die Namen der verwendeten Datenbanken sollten, sofern möglich, aufgeführt werden. RECORD 1.2: Gegebenenfalls sollte die geografische Region und der Zeitrahmen, in dem die Studie durchgeführt wurde, im Titel oder Abstract angegeben werden.\ (b) Verfassen Sie für das Abstract eine aussagefähige und ausgewogene Zusammenfassung dessen, was in der Studie gemacht wurde und was herausgefunden wurde RECORD 1.3: Wurde für die Studie eine Verknüpfung von Datenbanken vorgenommen, sollte dies ausdrücklich im Titel oder Abstract angegeben werden. **Einleitung** Hintergrund /Rationale 2 Erläutern Sie den wissenschaftlichen Hintergrund und die Rationale für die vorgestellte Studie Zielsetzungen 3 Geben Sie alle spezifischen Zielsetzungen einschließlich der (vorab festgelegten) Hypothesen an **Methoden** Studiendesign 4 Beschreiben Sie die wichtigsten Elemente des Studiendesigns möglichst früh im Artikel Rahmen 5 Beschreiben Sie den Rahmen (Setting) und Ort der Studie und machen Sie relevante zeitliche Angaben, einschließlich der Zeiträume der Rekrutierung, der Exposition, der Nachbeobachtung und der Datensammlung Studienteilnehmer 6 ***(a)** Kohortenstudie*: Geben Sie die Einschlusskriterien, die Herkunft der Teilnehmer sowie die Methoden ihrer Auswahl an; beschreiben Sie die Methoden der Nachbeobachtung\ RECORD 6.1: Die Methoden für die Auswahl der Studienpopulation (wie verwendete Codes oder Algorithmen zur Identifizierung von Teilnehmern) sollten detailliert aufgelistet werden. Ist dies nicht möglich, sollte dies erklärt werden.\ \ RECORD 6.2: Für alle Studien zur Validierung der Codes und Algorithmen, die für die Auswahl von Teilnehmern verwendet wurden, sollten Referenzen angegeben werden. Wurde eine Validierung für diese Studie durchgeführt und nicht anderweitig veröffentlicht, sollten die Methoden und Ergebnisse detailliert dargestellt werden.\ *Fallkontrollstudie*: Geben Sie die Einschlusskriterien und die Herkunft der Fälle und Kontrollen an sowie die Methoden, mit denen die Fälle erhoben und die Kontrollen ausgewählt wurden. Geben Sie eine Begründung (Rationale) für die Auswahl der Fälle und Kontrollen\ RECORD 6.3: Wurden in der Studie Datenbanken verknüpft, sollte zur Darstellung des Verknüpfungsprozesses die Verwendung eines Flussdiagramms oder einer anderen grafischen Darstellung in Betracht gezogen werden. Dies sollte auch die Anzahl von Personen mit verknüpften Daten in den einzelnen Abschnitten enthalten. \ *Querschnittsstudie*: Geben Sie die Einschlusskriterien, die Herkunft der Teilnehmer sowie die Methoden ihrer Auswahl an\ \ ***(b)** Kohortenstudie*: Geben Sie für Studien, die Matching (Paarbildung) verwenden, die Matchingkriterien und die Anzahl der exponierten und der nicht exponierten Teilnehmer an\ \ *Fallkontrollstudie*: Geben Sie für Studien, die Matching (Paarbildung) verwenden, die Matchingkriterien und die Anzahl der Kontrollen pro Fall an Variablen 7 Definieren Sie eindeutig alle Zielgrößen, Expositionen, Prädiktoren, mögliche Confounder und Effektmodifikatoren; geben Sie gegebenenfalls Diagnosekriterien an RECORD 7.1: Eine vollständige Liste der zur Klassifizierung von Expositionen, Zielgrößen, Confoundern und Effektmodifikatoren verwendeten Codes und Algorithmen sollte wiedergegeben werden. Wenn dies nicht möglich ist, sollte erklärt werden warum. Datenquellen/Messmethoden 8 Geben Sie für jede in der Studie wichtige Variable die Datenquellen an und erläutern Sie die verwendeten Bewertungs- bzw. Messmethoden. Beschreiben Sie die Vergleichbarkeit der Messmethoden, wenn es mehr als eine Gruppe gibt Bias 9 Beschreiben Sie, was unternommen wurde, um möglichen Ursachen von Bias zu begegnen Studiengröße 10 Erklären Sie,wie die Studiengröße ermittelt wurde. Quantitative Variablen 11 Erklären Sie, wie in den Auswertungen mit quantitativen Variablen umgegangen wurde\ Wenn nötig, beschreiben Sie, wie Kategorien (Gruppierungen) gebildet wurden und warum Statistische Methoden 12 \(a\) Beschreiben Sie alle statistischen Methoden, einschließlich der Methoden, die für die Kontrolle von Confounding verwendet wurden\ (b) Beschreiben Sie Verfahren, mit denen Subgruppen und Interaktionen untersucht wurden\ (c) Erklären Sie, wie mit fehlenden Daten umgegangen wurde\ (d) *Kohortenstudie* -- Erklären Sie gegebenenfalls, wie mit dem Problem des vorzeitigen Ausscheidens aus der Studie („loss to follow-up") umgegangen wurde\ *Fallkontrollstudie* -- Beschreiben Sie gegebenenfalls, wie das Matching (Paarbildung) von Fällen und Kontrollen bei der Auswertung berücksichtigt wurde\ *Querschnittsstudie* -- Beschreiben Sie gegebenenfalls die Auswertungsmethoden, die die gewählte Strategie zur Stichprobenauswahl (Sampling strategy) berücksichtigen\ (e) Beschreiben Sie vorgenommene Sensitivitätsanalysen Datenzugriff und Reinigungs-methoden entfällt RECORD 12.1: Die Autoren sollten beschreiben, inwieweit die Forscher Zugang zur Datenbank hatten, die für die Zusammenstellung der Studienpopulation verwendet wurde.\ RECORD 12.2: Die Autoren sollten Angaben zu den Methoden zur Datenbereinigung machen, die in der Studie verwendet wurden. Verknüpfung entfällt RECORD 12.3: Geben Sie an, ob im Rahmen der Studie eine Verknüpfung auf Personenebene, auf institutioneller Ebene oder andere Datenverknüpfungen zwischen zwei oder mehr Datenbanken durchgeführt wurden. Die Verknüpfungstechniken und Methoden zur Evaluierung der Verknüpfungsqualität sollten angegeben werden. **Ergebnisse** Teilnehmer 13 \(a\) Geben Sie die Anzahl der Teilnehmer während jeder Studienphase an, z. B. die Anzahl der Teilnehmer, die potenziell geeignet waren, die auf Eignung untersucht wurden, die als geeignet bestätigt wurden, die tatsächlich an der Studie teilgenommen haben, deren Nachbeobachtung abgeschlossen wurde und deren Daten ausgewertet wurden\ RECORD 13.1: Beschreiben Sie ausführlich die Auswahl der in die Studie aufgenommenen Personen (d. h. die Auswahl der Studienpopulation) einschließlich des Filterns aufgrund von Datenqualität, Datenverfügbarkeit und Verknüpfung. Die Auswahl der eingeschlossenen Personen kann im Fließtext und/oder mit Hilfe des Studienflussdiagramms beschrieben werden. (b) Geben Sie die Gründe für die Nicht-Teilnahme in jeder Studienphase an (c) Erwägen Sie die Darstellung in einem Flussdiagramm Deskriptive Daten 14 \(a\) Beschreiben Sie Charakteristika der Studienteilnehmer (z. B. demographische, klinische und soziale Merkmale) sowie Expositionen und mögliche Confounder\ (b) Geben Sie für jede Variable die Anzahl der Teilnehmer mit fehlenden Daten an\ (c) *Kohortenstudie*: Fassen Sie die Nachbeobachtungszeit zusammen (z. B. Mittelwert und Gesamtzeitraum) Ergebnisdaten („outcome data") 15 *Kohortenstudie:* Berichten Sie über die Anzahl der Zielereignisse oder statistischen Maßzahlen (z. B. Mittelwert und Standardabweichung) im zeitlichen Verlauf\ \ *Fallkontrollstudie*: Berichten Sie über Teilnehmerzahlen in jeder Expositionskategorie oder über statistische Maßzahlen der Exposition (z. B. Mittelwert und Standardabweichung)\ \ *Querschnittstudie:* Berichten Sie über die Anzahl der Zielereignisse oder statistische Maßzahlen (z. B. Mittelwert und Standardabweichung) Hauptergebnisse 16 \(a\) Geben Sie die unadjustierten Schätzwerte an und gegebenenfalls auch die Schätzwerte in denen Adjustierungen für die Confounder vorgenommen wurden sowie deren Präzision (z. B. 95%-Konfidenz-intervall); machen Sie deutlich, für welche Confounder adjustiert wurde und warum diese berücksichtigt wurden\ (b) Wenn stetige Variablen kategorisiert wurden, geben Sie die oberen und unteren Grenzwerte der einzelnen Kategorien an\ (c) Wenn relevant, erwägen Sie, für aussagekräftige Zeiträume Schätzwerte relativer Risiken auch als absolute Risiken auszudrücken Weitere Auswertungen 17 Berichten Sie über weitere vorgenommene Auswertungen, z. B. die Analyse von Subgruppen und Wechselwirkungen (Interaktionen) sowie Sensitivitätsanalysen **Diskussion** Hauptergebnisse 18 Fassen Sie die wichtigsten Ergebnisse in Hinsicht auf die Studienziele zusammen. Einschränkungen 19 Diskutieren Sie die Einschränkungen der Studie und berücksichtigen Sie dabei die Gründe für möglichen Bias oder Impräzision. Diskutieren Sie die Richtung sowie das Ausmaß jedes möglichen Bias RECORD 19.1: Erörtern Sie, was es bedeutet, Daten zu verwenden, die nicht zur Beantwortung spezifischer Forschungsfragen erhoben bzw. gesammelt wurden. Diskutieren Sie dabei auch Bias durch falsche Klassifizierung, Confounding durch ungemessene Faktoren, fehlende Daten und sich mit der Zeit verändernder Aufnahmekriterien, soweit diese die Studie betreffen, über die berichtet wird. Interpretation 20 Nehmen Sie eine vorsichtige übergreifende Interpretation der Resultate vor und berücksichtigen Sie dabei die Ziele und Einschränkungen der Studie, die Multiplizität der Analysen, die Ergebnisse anderer Studien und andere relevante Evidenz Generalisier-barkeit 21 Besprechen Sie die Generalisierbarkeit (externe Validität) der Studienergebnisse. **Zusätzliche Informationen** Finanzierung 22 Geben Sie an, wie die vorliegende Studie finanziert wurde, und erläutern Sie die Rolle der Geldgeber. Machen Sie diese Angaben gegebenenfalls auch für die Originalstudie, auf welcher der vorliegende Artikel basiert Zugänglichkeit des Protokolls, der Rohdaten und des Programmcodes entfällt RECORD 22.1: Die Autoren sollten darüber informieren, wie auf ergänzende Informationen wie Studienprotokoll, Rohdaten oder Programmcode zugegriffen werden kann. ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- [^1]: Die beiden letztgenannten Autoren haben zu gleichen Teilen zu dieser Arbeit beigetragen. [^2]: Die Mitglieder des RECORD Working Committee werden in der Danksagung genannt. | Mid | [
0.5549872122762141,
27.125,
21.75
] |
Introduction {#sec1} ============ Since December 2019, several cases of pneumonia of unknown etiology have been reported in Wuhan, Hubei Province, of China.[@bib1] Those cases have been confirmed as acute respiratory infections caused by a novel coronavirus infection. To date, confirmed cases have been found in many countries worldwide.[@bib2] ^,^ [@bib3] Until now, however, the source of the virus and the pathogenesis of the disease are unknown. Early detection, quarantine, and timely treatment are the keys to better controlling the epidemic and reducing the spread of the disease. Coronaviruses are RNA viruses and can be divided into 4 genera according to the genomic characteristics: α, β, γ, and ξ.[@bib4] Among these, Middle East respiratory syndrome coronavirus and severe acute respiratory syndrome coronavirus are known coronaviruses.[@bib4] ^,^ [@bib5] The new virus recently discovered in China is now recognized to be a novel coronavirus named 2019-nCoV. The coronavirus isolated from patients with this novel pneumonia in Wuhan is a coronavirus of genus β.[@bib5] This sudden infectious disease mainly manifests as fever, fatigue, and cough.[@bib6], [@bib7], [@bib8] Upper respiratory symptoms such as nasal congestion and runny nose are rare. About one half of the patients develop dyspnea after 1 week.[@bib9] In severe cases, patients progress rapidly to acute respiratory distress syndrome (ARDS), sepsis, and coagulopathy. Some patients have mild symptoms with no fever or without pneumonia and usually recover after 1 week. However, some patients may suddenly worsen and develop ARDS.[@bib9] At present, how to stratify high-risk and low-risk patients is an important but unresolved issue. In the present study, the clinical manifestations and clinical outcomes of patients with 2019 novel coronavirus disease (COVID-19) were evaluated. The purpose of this study was to identify the risk factors associated with pneumonia, ARDS, and clinical outcomes. Patients and methods {#sec2} ==================== Patients {#sec2.1} -------- This cross-sectional multicenter clinical study was approved by the institutional ethics board of the Nanfang Hospital, Southern Medical University. All consecutive patients with confirmed 2019-nCoV infections who were diagnosed in the Dongguan People\'s Hospital and Nanfang Hospital, Southern Medical University, from January 2020 to February 2020 were enrolled. The study population comprised hospitalized patients. Because COVID-19 is an infectious disease, all outpatients were required to be quarantined in the hospital if infection with 2019-nCoV was confirmed. The 2019-nCoV infection diagnostic standard was polymerase chain reaction detection of 2 target genes of 2019-nCoV, open reading frame 1 ab (ORF1ab) and nucleocapsid protein. A positive result was determined to be 2019-nCoV infection. Ethics, Consent, and Permissions {#sec2.2} -------------------------------- The Institutional Review Board of Nanfang Hospital, Southern Medical University, approved this study. All procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation and with the 1975 Declaration of Helsinki as revised in 2008. Oral consent was obtained from patients. Data Collection {#sec2.3} --------------- All patients\' clinical, laboratory, and radiologic characteristics, as well as treatment outcome data, were obtained through medical record extraction. Data were reviewed by a team of trained physicians. The recorded information included demographic data, medical history, contact history, potential comorbidities, symptoms, laboratory test results, and chest computed tomography (CT) scans. ARDS was defined as an acute-onset oxygenation index (arterial partial pressure of oxygen/fraction of inspired oxygen) ≤ 300 mm Hg and a chest radiograph showing patchy shadows.[@bib10] Real-Time Polymerase Chain Reaction Assay for 2019-nCoV {#sec2.4} ------------------------------------------------------- All patients had pharyngeal swab samples collected to detect 2019-nCoV. The specific steps were as follows: The throat swab was placed into a collection tube containing 150 μL of virus preservation solution, and a respiratory sample RNA isolation kit (Zhongzhi, Wuhan, China) was used to extract total RNA within 2 h. Forty microliters of cell lysate were transferred to a collection tube and vortexed for 10 s. It was centrifuged after incubation at room temperature for 10 min. Real-time polymerase chain reaction was then performed, and 2 target genes (ORF1ab and nucleocapsid protein) were detected. Target 1 (ORF1ab): forward primer CCTGGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Target 2 (N protein): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; probe 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. The diagnostic criteria were based on the recommendations of the National Institute of Viral Disease Prevention and Control (<http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html>). Statistical Analysis {#sec2.5} -------------------- Continuous data are reported as mean (SD), and categorical data are expressed as percentages. The significance of differences was tested by using either the Student\'s *t* test (for continuous variables) or the χ2 test (for categorical variables). Univariable and multivariable regression analyses were performed by using logistic regression analysis, and the results are expressed as odds ratio (OR) and 95% CIs. All analyses were performed by using SPSS version 13.0 (IBM SPSS Statistics, IBM Corporation, Armonk, New York) with an alpha level of 0.05. Results {#sec3} ======= Characteristics of Patients With COVID-19 {#sec3.1} ----------------------------------------- A total of 95 patients infected with 2019-nCoV were enrolled. Seventy-three had pneumonia based on the CT findings, and 22 did not have pneumonia. Demographic and clinical characteristics are shown in [Table I](#tbl1){ref-type="table"} . Patients with pneumonia were significantly older than the other patients (*p* \< 0.001). The body mass index (BMI) (*p* = 0.001), aspartate aminotransferase levels (*p* = 0.041), and lactate dehydrogenase (LDH) levels (*p* = 0.003) were significantly higher in patients with pneumonia. However, lymphocyte count (*p* = 0.014) and platelet count (*p* \< 0.001) were significantly lower in patients with pneumonia.Table IDemographic and clinical characteristics in patients with coronavirus disease 2019 (COVID-19) with or without pneumonia. Values are givens as mean (SD) unless otherwise indicated.Table ICharacteristicPatients With COVID-19*P*With PneumoniaWithout PneumoniaSample size, n7322--Male sex39 (53.4%)14 (63.6%)0.398Age, y42.66 (17.93)23.86 (13.88)\<0.001SBP, mm Hg126.41 (16.01)120.95 (14.90)0.175DBP, mm Hg83.69 (10.26)79.90 (8.60)0.138BMI, kg/m^2^23.71 (3.41)20.78 (3.15)0.001Serum lactic acid, mmol/L1.51 (0.71)1.61 (0.59)0.608Neutrophil count, × 10^9^3.32 (1.52)3.33 (1.29)0.972Lymphocyte count, × 10^9^1.25 (0.94)1.81 (0.87)0.014Hemoglobin, g/L139.07 (18.07)143.41 (13.01)0.298Platelet count, × 10^9^196.27 (56.67)251.50 (77.46)\<0.001Serum creatinine, μmol/L68.60 (41.11)60.95 (17.97)0.400ALT, U/L21.33 (12.00)22.77 (24.75)0.718AST, U/L23.97 (10.48)18.75 (7.72)0.041LDH, IU/L204.04 (67.44)154.32 (34.88)0.003Tobacco smoking5 (6.8%)3 (13.6%)0.315[^2] Univariate and Multivariate Analyses of Factors Associated With Pneumonia {#sec3.2} ------------------------------------------------------------------------- Univariate and multivariate analyses were conducted to analyze the risk factors associated with 2019-nCoV--infected patients developing pneumonia. Univariate results showed that older age, high BMI, low lymphocyte count, low platelet count, high aspartate aminotransferase level, and high LDH level were risk factors associated with patients developing pneumonia. However, multivariate analysis showed that only older age (OR, 1.078; *p* = 0.008) and high BMI (OR, 1.327; *p* = 0.024) were independent risk factors associated with patients developing pneumonia ([Table II](#tbl2){ref-type="table"} ).Table IIFactors associated with pneumonia in patients with coronavirus disease 2019.Table IIVariableUnivariate AnalysisMultivariate AnalysisOR95% CI*P*OR95% CI*P*Sex0.6550.245--1.7510.400Age1.0731.034--1.112\<0.0011.0781.020--1.1400.008SBP1.0230.990--1.0570.176DBP1.0400.987--1.0950.141BMI1.2981.103--1.5270.0021.3271.038--1.6970.024Serum lactic acid0.8150.376--1.7650.603Neutrophil count0.9940.717--1.3780.972Lymphocyte count0.5480.305--0.9860.045Hemoglobin0.9860.959--1.0130.301Platelet count0.9870.979--0.9950.002Serum creatinine1.0110.986--1.0360.387ALT0.9940.965--1.0250.716AST1.0801.001--1.1650.048LDH1.0231.007--1.0390.004Tobacco smoking0.4660.102--2.1270.324[^3] Differences in Characteristics Between the ARDS Group and the Non-ARDS Group {#sec3.3} ---------------------------------------------------------------------------- Using the ARDS definition, patients were divided into an ARDS group (*n* = 24) and a non-ARDS group (*n* = 71) ([Table III](#tbl3){ref-type="table"} ). Patients with ARDS were older than those without ARDS (*p* = 0.021). Moreover, systolic blood pressure (SBP) (*p* = 0.038), serum creatinine (*p* = 0.025), and LDH (*p* = 0.003) levels were significantly higher in patients with ARDS. However, lymphocyte counts were lower in patients with ARDS than in others (*p* = 0.046).Table IIIThe demographic and clinical characteristics in patients with coronavirus disease 2019 (COVID-19) with and without acute respiratory distress syndrome (ARDS). Values are given as mean (SD) unless otherwise indicated.Table IIICharacteristicPatients With COVID-19*P*With ARDSWithout ARDSSample size, n2471--Male sex14 (58.3%)39 (54.9%)0.772Age, y45.92 (18.44)35.73 (13.32)0.021SBP, mm Hg130.96 (14.62)123.15 (15.87)0.038DBP, mm Hg84.92 (10.42)82.12 (9.93)0.245BMI, kg/m^2^24.26 (3.32)22.64 (3.55)0.053Serum lactic acid, mmol/L1.49 (0.51)1.55 (0.74)0.703Neutrophil count, × 10^9^3.21 (1.34)3.36 (1.51)0.656Lymphocyte count, × 10^9^1.05 (0.48)1.49 (1.04)0.046Hemoglobin, g/L141.46 (12.47)139.61 (18.41)0.648Platelet count, × 10^9^193.67 (67.23)214.27 (65.15)0.187Serum creatinine, μmol/L81.42 (65.91)61.90 (18.02)0.025ALT, U/L23.83 (14.07)20.91 (16.05)0.439AST, U/L25.49 (11.68)21.92 (9.48)0.146LDH, IU/L228.86 (80.21)181.79 (55.17)0.003Tobacco smoking1 (4.2%)7 (9.9%)0.385[^4] Univariate and Multivariate Analyses of Factors Associated With ARDS {#sec3.4} -------------------------------------------------------------------- Logistic regression was used to identify factors that were significantly associated with ARDS in patients with COVID-19. In multivariate analysis, high SBP level (OR, 1.046; *p* = 0.025) and high LDH level (OR, 1.010; *p* = 0.021) were found to be independent risk factors associated with ARDS among patients with COVID-19 ([Table IV](#tbl4){ref-type="table"} ).Table IVFactors associated with acute respiratory distress syndrome in patients with coronavirus disease 2019.Table IVVariableUnivariate AnalysisMultivariate AnalysisOR95% CI*P*OR95% CI*P*Sex1.1490.450--2.9300.772Age1.0311.004--1.0580.025SBP1.0331.001--1.0660.0421.0461.006--1.0890.025DBP1.0290.981--1.0790.244BMI1.1470.996--1.3200.057Serum lactic acid0.8650.416--1.8010.699Neutrophil count0.9270.665--1.2920.652Lymphocyte count0.3590.141--0.9180.032Hemoglobin1.0060.980--1.0340.645Platelet count0.9950.987--1.0030.188Serum creatinine1.0210.995--1.0480.116ALT1.0110.983--1.0400.443AST1.0330.988--1.0800.154LDH1.0111.003--1.0180.0071.0101.001--1.0190.021Tobacco smoker0.3980.046--3.4080.400[^5] Differences in Characteristics Between Patients With Pneumonia Exacerbation and Relief {#sec3.5} -------------------------------------------------------------------------------------- A total of 70 patients underwent CT scanning repeatedly after 1 week of treatment. Based on the findings obtained after comparison with the first CT scan, patients were divided into the pneumonia exacerbation group (*n* = 19) and the pneumonia relief group (*n* = 51). The characteristics were compared, and the results showed that patients with pneumonia exacerbation were significantly older (*p* = 0.021), with a higher BMI (*p* = 0.003) and a higher proportion of tobacco smokers (*p* = 0.006) ([Table V](#tbl5){ref-type="table"} ).Table VDemographic and clinical characteristics in patients with coronavirus disease 2019 (**COVID-19) with pneumonia exacerbation or relief.**Table VCharacteristicPatients with COVID-19*P*Pneumonia ExacerbationPneumonia ReliefSample size, n1951--Male sex11 (57.9%)24 (47.1%)0.420Age, y49.58 (22.16)38.37 (15.80)0.021SBP, mm Hg127.63 (13.11)125.39 (17.43)0.614DBP, mm Hg81.26 (10.95)84.14 (10.58)0.322BMI, kg/m^2^25.38 (2.49)22.95 (3.61)0.003Serum lactic acid, mmol/L1.53 (0.75)1.56 (0.72)0.896Neutrophil count, × 10^9^3.47 (1.62)3.29 (1.58)0.679Lymphocyte count, × 10^9^1.13 (0.58)1.31 (1.05)0.481Hemoglobin, g/L139.68 (13.46)137.92 (19.83)0.722Platelet count, × 10^9^184.95 (50.78)207.19 (60.51)0.159Serum creatinine, μmol/L81.74 (73.92)61.76 (17.34)0.073ALT, U/L19.38 (11.03)21.78 (12.55)0.477AST, U/L23.26 (12.71)23.80 (10.05)0.856LDH, IU/L201.16 (80.15)200.40 (64.92)0.968Tobacco smoking4 (21.1%)1 (2.0%)0.006[^6] Univariate and Multivariate Analyses of Factors Associated With Pneumonia Exacerbation {#sec3.6} -------------------------------------------------------------------------------------- Logistic regression was used to identify factors that were associated with pneumonia exacerbation in patients with COVID-19. Multivariate analysis showed that a high BMI (OR, 1.285; *p* = 0.017) and tobacco smoking (OR, 16.13; *p* = 0.032) were independent risk factors associated with 2019-nCoV--infected patients with pneumonia exacerbation after treatment ([Table VI](#tbl6){ref-type="table"} ).Table VIFactors associated with pneumonia exacerbation in patients with coronavirus disease 2019.Table VIVariableUnivariate AnalysisMultivariate AnalysisOR95% CI*P*OR95% CI*P*Sex1.5470.534--4.4820.422Age1.0371.004--1.0710.026SBP1.0090.976--1.0420.608DBP0.9740.926--1.0250.319BMI1.2531.049--1.4970.0131.2851.045--1.5810.017Serum lactic acid0.9490.440--2.0470.894Neutrophil count1.0720.774--1.4850.674Lymphocyte count0.7460.325--1.7140.490Hemoglobin1.0050.977--1.0340.718Platelet count0.9930.983--1.0030.161Serum creatinine1.0140.990--1.0390.244ALT0.9820.936--1.0310.472AST0.9950.945--1.0480.854LDH1.0000.992--1.0080.967Tobacco smoking6.6671.110--40.040.03816.131.275--204.160.032[^7] Discussion {#sec4} ========== The present study found that older age and high BMI were independent risk factors associated with patients with pneumonia. Furthermore, high SBP level and high LDH level were independent risk factors associated with ARDS among patients with COVID-19. High BMI and tobacco smoking were independent risk factors associated with pneumonia exacerbation after treatment in patients with COVID-19. These results help in the risk stratification of patients with COVID-19. Timely intervention should be initiated in patients with risk factors to avoid disease progression. In addition, the results of this study may have implications for the pathogenesis of COVID-19. Most patients with COVID-19 will develop pneumonia.[@bib11] However, a small proportion of patients have negative radiographic findings. The largest study sample to date showed that among the 3665 confirmed cases, 95.5% (*n* = 3498) of patients were diagnosed with pneumonia.[@bib12] According to the Diagnosis and Treatment Program of 2019 New Coronavirus Pneumonia recommended by The National Health Commission of China, these patients only exhibited low fever and mild fatigue with no pneumonia manifestations, and they usually recovered after 1 week. Our study confirmed these results. We found that some patients had negative CT scan results, although the throat swabs confirmed infection with 2019-nCoV. Most previous studies were conducted in Wuhan Province with patients enrolled from Wuhan, and the symptoms of those first-generation patients were relatively severe. The patients enrolled in the present study were from Guangdong Province, which is not the first generation of infected patients. In our study, the patients' symptoms were relatively mild, which is in line with the results of patients from Zhejiang Province.[@bib13] Symptoms of patients outside Hubei Province are relatively mild. Some 2019-nCoV--infected patients will rapidly become critically ill.[@bib9] ^,^ [@bib14] Previous research reported that the mortality rate of 2019-nCoV--infected patients is 4%--15%.[@bib7] ^,^ [@bib9] In our study, only one patient aged 75 years (BMI, 29.37 kg/m^2^) died (mortality rate, 1.05%). Therefore, early detection of this population is very important. However, this subpopulation of patients who have severe disease may have moderate to low fever in the development of the disease. It is still difficult to screen out these patients. Our research may provide a sign. According to the results of our study, the 2019-nCoV--infected patients who developed ARDS were older and had higher SBP, serum creatinine, and LDH levels. This group of people also had lower lymphocyte counts. However, multivariate analysis suggested that only high SBP level and high LDH level were independent risk factors associated with ARDS among patients with COVID-19. Previous research implied that some patients' conditions will change dramatically in \~1 week.[@bib9] In our study, we performed repeated CT examinations on 70 patients after 1 week of treatment and found that those with imaging findings suggesting exacerbations had clinical baseline data significantly different from patients with reduced disease. Tobacco smoking has been confirmed to be associated with many diseases.[@bib15] ^,^ [@bib16] In our study, multivariate analysis suggests that high BMI and tobacco smoking were independent risk factors associated with disease exacerbation in 2019-nCoV--infected patients after treatment. Until now, there have been no antiviral drugs specifically approved for treating 2019-nCoV--infected patients. Although reports have suggested the potential antiviral effects of lopinavir/ritonavir, it remains controversial.[@bib14] Remdesivir has shown strong potential antiviral effects in previous reports but has not yet been approved by the US Food and Drug Administration, and large clinical research results are lacking to support its application.[@bib2] ^,^ [@bib17] Finding an effective treatment plan is a particularly important clinical problem. The present study discusses the evolution of CT findings for patients with COVID-19. However, CT scans are not frequently used for assessment of patients with complicated pneumonia or ARDS. CT scan findings cannot completely identify exacerbation or relief of the disease. The CT scan results can only reflect some aspects in the development of the disease. The findings from our study may not have clinical relevance across different parts of the world. This study has limitations. First, it involved a cross-sectional investigation. Second, the relative sample size was limited. The potential limitations of the present report could be overcome in future studies by enrolling more patients. In our study, there was no control group, and there was no comparator virus-infected group. Most of these findings are the same as would be seen with influenza, respiratory syncytial virus, and human metapneumovirus. The results from our study may imply that high-risk patients are at high risk of complications because of who they are (their specific characteristics), and not because of the specific nature of the individual pathogen. The airway inflammation coupled with their clinical factors is the real issue. In addition, prognostic outcomes were assessed. In the present study, all patients diagnosed with ARDS were admitted to the intensive care unit to continue further treatment. However, other prognostic outcomes, including length of stay data, in this study are missing because some patients are still in the hospital. Further study is needed to determine mortality and length of stay data. Conclusions {#sec5} =========== Older age and high BMI were independent risk factors associated with pneumonia in patients with COVID-19. High SBP and LDH levels were independent risk factors associated with ARDS, whereas high BMI and tobacco smoking were independent risk factors associated with disease exacerbation after treatment. For such patients, stratification by using independent risk factors could help with the management of their disease. Disclosures =========== The authors have indicated that they have no conflicts of interest regarding the content of this article. This work was supported by grants from the 10.13039/501100013076Major Science and Technology Special Project of China (2017ZX09304016, 2017ZX10302201004008). The authors thank Jian Zhang for his helpful assistance in the study. Drs. S. Cai, Yin, Xu, and Peng designed and guided the study; Drs. S. Cai and Yu wrote the main manuscript text; and Drs. Zheng, Liu, and X. Cai prepared all tables and data analysis. All authors reviewed the manuscript. [^1]: These authors contributed equally to this work. [^2]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; SBP = systolic blood pressure. [^3]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; OR = odds ratio; SBP = systolic blood pressure. [^4]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; SBP = systolic blood pressure. [^5]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; OR = odds ratio; SBP = systolic blood pressure. [^6]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; SBP = systolic blood pressure. [^7]: ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; DBP = diastolic blood pressure; LDH = lactate dehydrogenase; OR = odds ratio; SBP = systolic blood pressure. | Mid | [
0.622327790973871,
32.75,
19.875
] |
The democratisation of dentistry. | Mid | [
0.6186440677966101,
36.5,
22.5
] |
Deacetylation of PS-5, a new beta-lactam compound, I. Microbial deacetylation of PS-5. PS-5 was deacetylated to NS-5 (deacetylated PS-5) by l-amino acid acylase from porcine kidney and D-amino acid acylase from Streptomyces olivaceus but not by l-amino acid acylase from Aspergillus sp. Using PS-5, N-chloroacetyl-l-phenylalanine and N-chloroacetyl-D-valine as substrates, acylase producers were screened among facultative methanol-assimilating bacteria. Most of the microbes tested were active and could be classified into two groups of l-acylase producers and L-& D-acylase producers. Pseudomonas sp. 1158 which deacetylated the three substrates was chosen for further study. Cells of the bacterium entrapped in polyacrylamide gel and its acylase activities immobilized on DEAE-Sephadex were found to be useful for conversion of PS-5 to NS-5. | Mid | [
0.574468085106383,
33.75,
25
] |
568 N.W.2d 860 (1997) Patrick McCLELLAN, Respondent, v. H.L. "Red" GOLDBERG, et al., Appellants. No. C6-97-433. Court of Appeals of Minnesota. September 2, 1997. *861 Brendan W. Randall, Daniel J. Connolly, Faegre & Benson LLP, Minneapolis, for appellants. Patrick McClellan, Bloomington, pro se. Considered and decided by HUSPENI, P.J., and KALITOWSKI and AMUNDSON, JJ. *862 OPINION HUSPENI, Judge. The district court denied appellants' motion to vacate a conciliation court judgment and to remove the case to district court. Because we hold that appellants' untimeliness in filing the motion did not deprive the district court of jurisdiction, we reverse and remand for a determination of whether the untimeliness was excusable neglect. FACTS Following a hearing, the conciliation court awarded judgment against appellants H.L. Goldberg, et al. The notice of judgment, mailed on November 18, 1996, informed the parties that the last date for filing a demand for removal of the case to district court was December 11, 1996. Appellants' demand for removal arrived at conciliation court on December 12, 1996. Apparently, confusion between counsel for appellants and his support staff was responsible for untimely arrival of the papers. Appellants then moved the district court for an order vacating the conciliation court judgment and permitting a late removal to district court. In denying the motion the district court stated: In appeals from district court, probate court and agency decisions, courts have denied appeals filed after the time period designated by rule or statute on the basis of lack of jurisdiction. Jurisdictional time periods are absolute and cannot be extended by discretion of the court under Rule 60.02. * * * The [appellants] incorrectly rely on Percy v. Hof[i]us to contend that this court has jurisdiction. * * * Although the plaintiff in Percy won by default judgment, the [appellants] contend that the holding applies to contested cases based on Mattsen v. Packman * * *. However, * * * the Mattsen court did not specify that Conciliation Court cases which are contested could be re-opened under Rule 60.02. The language is too general to be determinative on this issue. * * * Even if the Court determined that Rule 60.02 does apply, [appellants] would still not prevail * * *. [U]ntimeliness alone does not constitute excusable neglect. * * * [Appellants'] counsel explained to the court that he missed the deadline because he filed via U.S. mail instead of having the papers delivered the day they were due. Although unfortunate for the [appellants], this is not excusable neglect. (Citations omitted.) ISSUE Does the late filing of a demand for removal of a case from conciliation court to district court deprive the district court of jurisdiction? ANALYSIS Whether the district court erred in ruling that it did not have jurisdiction over vacating the judgment is a question of law upon which this court may exercise its independent judgment. Hubred v. Control Data Corp., 442 N.W.2d 308, 310 (Minn.1989). The district court based its holding that it had no jurisdiction on the conclusion that a removal from conciliation court to district court is analogous to an appeal from a district court judgment, citing Arndt v. Minnesota Educ. Ass'n, 270 Minn. 489, 134 N.W.2d 136, 137 (1965), for the principle that it lacked authority to extend the time for an appeal. We conclude, however, that removal from conciliation court to district court is not analogous to an appeal, and failure to comply with the technical requirements of removal does not defeat jurisdiction. See Percy v. Hofius, 370 N.W.2d 490, 491 (Minn.App.1985) (reinstating a demand for removal denied for failure to comply with technical requirements). As the district court noted, the conciliation court judgment in Percy was a default judgment, not the result of a contested hearing. We are not persuaded, however, that Percy must be restricted to default judgments. Our reluctance to limit Percy is supported by Mattsen v. Packman, 358 N.W.2d 48, 50 (Minn.1984), a case relied on in Percy. In Mattsen the court, referring to the conciliation court proceedings, observed that: [W]e really do not know what was litigated. We can infer from the fact that a judgment has been entered that there has *863 been a hearing at which one or more of the parties, probably appearing pro se, has each presented his or her version of the facts. Id. The Mattsen court, clearly unconcerned about whether the judgment was by default, stated: [A] party who is excusably ignorant of the effect of a judgment should have [a] remedy. Relief may be had for cause; the judgment may be reopened through proceedings to vacate pursuant to Rule 60.02 * * *. Id. While this observation in Mattsen was dictum, it clearly formed the basis of this court's Percy decision. We conclude that appellants' failure to comply with the filing deadline did not deprive the district court of jurisdiction to consider appellants' motion for relief under Minn. R. Civ. P. 60.02. Commendably, the district court did not end its memorandum with the decision that jurisdiction was lacking. The court ruled that even if rule 60.02 applied, its requirements were not met. We believe, however, that a question remains on this issue. The district court's conclusion that the attorney's failure to meet the deadline was not excusable neglect must be re-examined in consideration of Minnesota case law that indicates our reluctance to see clients suffer as a result of counsel's neglect. See Nguyen v. State Farm Mut. Auto. Ins. Co., 558 N.W.2d 487, 491 (Minn.1997) ("Our case law reflects a strong policy favoring the granting of relief when judgment is entered through no fault of the client"); Charson v. Temple Israel, 419 N.W.2d 488, 491 (Minn.1988) ("ordinarily courts are loath to `punish' the innocent client for the counsel's neglect"); Duenow v. Lindeman, 223 Minn. 505, 518, 27 N.W.2d 421, 429 (1947) ("Courts will relieve parties from the consequences of the neglect or mistake of their attorney, when it can be done without substantial prejudice to their adversaries."). Charson (quoting Finden v. Klaas, 268 Minn. 268, 271, 128 N.W.2d 748, 750 (1964)) lists the factors a court must consider in exercising its discretion under Minn. R. Civ. P. 60.02 and deciding whether to relieve a client from the consequences of an attorney's neglect: there must have been a reasonable defense on the merits, there must be a reasonable excuse for the failure or neglect to answer, the party must have acted with due diligence after notice of the entry of judgment, and it must be shown that no substantial prejudice will result to the other party. Charson, 419 N.W.2d at 491. We remand to enable the district court to address these factors and to decide whether, in light of these factors, appellant is entitled to relief under Minn. R. Civ. P. 60.02.[1] DECISION The district court was not deprived of jurisdiction by appellants' untimely filing of the notice of removal from conciliation court. The case is remanded for the district court to address the merits of appellants' plea for relief under Minn. R. Civ. P. 60.02. Reversed and remanded. NOTES [1] Respondent argues that he will be prejudiced if the case is removed to district court because he has moved out of state. Respondent did not raise this argument before the district court, and it would be inappropriate for us to address it here for the first time. See Thiele v. Stich, 425 N.W.2d 580, 582 (Minn.1988). We note, however, the qualification stated in Duenow regarding prejudice to adversaries and believe it appropriate that respondent be permitted to raise the issue of prejudice before the district court on remand. | Low | [
0.524838012958963,
30.375,
27.5
] |
A randomized controlled trial of a video module to increase U.S. poison center use by low-income parents. U.S. poison centers decrease medical visits by providing telephone advice for home management of potential poisonings, but are underutilized by low-income African-American and Latino parents, and those with limited English proficiency, due to lack of knowledge and misconceptions about poison centers. To assess the effectiveness of a poison prevention video module in improving knowledge, behavior, and behavioral intention concerning use of poison centers in a population of low-income, language-diverse adults attending parenting courses offered by a community organization. A randomized, blinded, controlled trial was conducted at 16 parenting course sites of a community organization and included 297 participants. The organization's instructors presented the video module (intervention) or the usual class curriculum (control). Participants completed questionnaires at baseline and a telephone interview 2-4 weeks later. Changes from baseline to follow-up were compared between the intervention and control groups using analysis of variance and Chi-square tests. Intervention group participants were stratified by English proficiency and compared to assess baseline and follow-up responses by language. After the intervention, participants in the intervention group had a significantly greater increase in knowledge about the poison center, were more likely to have the correct poison center phone number at home, and had greater behavioral intention to use the poison center compared to control group participants. At baseline, Spanish-primary-language participants with limited English proficiency had less knowledge about the poison center, were less likely to have the poison center number at home, and had lower behavioral intention to use the poison center than English proficient participants, but significantly improved after the intervention. This video module, when presented by a community organization's instructors, was highly effective in improving knowledge, behavior, and behavioral intention concerning use of poison centers within a low-income, language-diverse population. | High | [
0.689308176100628,
34.25,
15.4375
] |
UNION CITY — With a yearlong moratorium to expire in July, city leaders are set to slam the door on medical marijuana dispensaries for the foreseeable future. Today, the City Council will consider a law that would require any permit, authorization or license issued by the city to “be consistent with both state and federal law.” Because federal drug laws prohibit medical marijuana, the city ordinance effectively would outlaw dispensaries — the most common way licensed marijuana users obtain the drug. “It’s not an outright ban, but in the short term it would make it difficult, if not impossible, to operate a dispensary,” Deputy City Manager Tony Acosta said. He said the city does not want dispensaries while cases on medical marijuana issues are pending in state and federal courts. The proposed ordinance is a new legal tactic to outlaw dispensaries, said Kris Hermes, legal campaign director for Americans for Safe Access, which has lawsuits pending against several California cities that prohibit dispensaries. “We would see this as a de facto ban and strongly oppose such action by the city,” he said. Robert Raich, an attorney who represents dispensaries, said the ordinance was “vaguely worded” and effectively would make city permit clerks the arbiters of state and federal law. “Union City is practically buying a lawsuit down the road,” he said. Since state voters passed the Compassionate Use Act of 1996 legalizing medical marijuana, dispensaries in the East Bay have spread from Berkeley south to Hayward but have not been permitted in Union City. In March 2005, the council, after learning that a dispensary had applied for a city permit, passed the first of three moratoriums temporarily outlawing it. Fremont also has a moratorium against dispensaries. The moratoriums, according to Hermes, force many licensed medical marijuana users in the two cities to travel north to obtain the drug legally. About 30 percent of the customers of the Hayward Patients Resource Center are from Union City and Fremont, said Tom Lemos, the dispensary’s owner. | Low | [
0.511627906976744,
33,
31.5
] |
The disclosure relates generally to online systems, and in particular to training a computer model to predict whether a user device is at a location based on context information received from client devices. An online system, such as a social networking system, allows its users to connect to and communicate with other online system users. Users may create profiles on an online system that are tied to their identities and use information about the users, such as interests and demographic information. The users may be individuals or entities such as corporations or charities. Because of the increasing popularity of online systems and increasing amount of user-specific information that they maintain, an online system provides an ideal forum for content providers to increase awareness about products or services by presenting content items to online system users as stories in social networking newsfeeds or via other presentation mechanisms. Content providers may wish to measure the effectiveness of their online system content campaigns by tracking online system users who accessed the content campaign and subsequently visited the content provider's physical location. Traditionally, online systems have relied on user “check-ins” at physical locations in order to gather user location information. However, data is collected slowly using this method and is dependent upon individual users taking an action (i.e., the check-in) at the location and designating the correct physical location. Many users do not regularly, if ever, check-in to locations. Further, there are many locations where users rarely check in (e.g., grocery stores, drug stores, dry cleaners, etc.), rendering the online system's ability to predict when a user is at those locations more difficult. | Mid | [
0.6041131105398451,
29.375,
19.25
] |
1. Technical Field The present invention relates to affixable paper particularly of the kind which after secure attachment to a surface can be easily detached therefrom in substantially original condition. 2. Description of the Prior Art Numerous paper articles exist on the market which allow attachment to a surface: labels, stickers, stamps, flaps of envelopes and the like. For these articles strong and lasting attachment is sought. Occasions exist where removal of the affixed paper sheet is desirable. Recently, removable self stick paper sheets have been introduced by 3M Company in the form of note pads. (P. R. Nayak; J. Ketteringham in Breakthroughs, Rawson Associates; as cited in New Scientist, Mar. 19, page 57 1987). These note sheets are self-sticking and do not require moistening. An important feature of these sheets is that they can be easily affixed to a surface and easily removed. It is the latter feature which can lead to accidental detachment of the sheet and loss of its message. Additionally, cheque books are now available where each individual cheque of the book has attached to its backside an identically sized paper which yields a carbonless copy when the original cheque is written on. The copy sheet is attached and held into position by a row of adhesive dots which is located at the right and the left vertical edge of the backside of the original cheque. The exclusive purpose of the two rows of adhesive dots is to insure accurate transfer of letters and figures from the original cheque to the designated lines of the copy sheet. As it will become evident vide infra, the present invention is quite different because the prior art lacks the essential features of allowing the user to securely attach and then subsequently substantially nondestructively detach the attached paper. | Mid | [
0.563991323210412,
32.5,
25.125
] |
The present invention relates to a display means attractively showing movable ornaments therein, and more particularly to a display means which uses a light string as the power supply to connect a light string AC motor for driving ornaments in the display means to move in different manners before a background. Such display means may be conveniently positioned on a window sill, desk top, or top of a fireplace, or may be hung or mounted on walls. The display means according to the present invention is simple in the whole structure and safe in use. The ornaments displayed in front of the display means can be designed to move lively so as to match different meaningful events. Ornaments are frequently used in holidays or festivals to create happy and joyous air. For Christmas holidays, all kinds of beautiful and cute ornaments and decorations play important roles in show windows. In conventional show windows, ornaments and decorations displayed are usually stationary and motionless, the only means used to give such ornaments and decorations some changes is their different appearances and some light strings attached to them. On the other hand, to use movable ornaments and decorations, additional costs for extra power supply and parts are extremely high. It is therefore tried by the applicant to develop a display means which has movable ornaments and decorations while the entire structure of the display means is simple. | Mid | [
0.6181015452538631,
35,
21.625
] |
Penny Marshall, ‘Laverne & Shirley’ Star Turned Director, Dies at 75 She starred for eight seasons on the ABC ratings hit, created by her late brother Garry Marshall, and directed such films as ‘Big,’ ‘A League of Their Own’ and ‘Awakenings.’ Penny Marshall, the nasally and good-natured Bronx native who starred on the ABC ratings sensation Laverne & Shirley before shattering records as a top-grossing female director in Hollywood, has died. She was 75. The younger sister of the late writer-director-producer Garry Marshall and the first wife of actor-director Rob Reiner, Marshall died from complications from diabetes, her publicist told the New York Daily News. She was diagnosed with brain and lung cancer in 2009. Marshall earned fame — but, incredibly not even one Emmy nomination — for playing the wisecracking Laverne DeFazio on the Happy Days spinoff created by her brother. Laverne & Shirley, which aired for eight seasons from 1976-83, centered on the escapades of two romantically challenged Milwaukee brewery workers, with Cindy Williams co-starring as Marshall’s idealistic roommate, Shirley Feeney. She directed a handful of episodes of the sitcom, then was approached to step in as a last-minute replacement for Howard Zieff to helm the feature comedy Jumpin’ Jack Flash (1986), starring Whoopi Goldberg. | Mid | [
0.619246861924686,
37,
22.75
] |
The funniest thing about Conker's Bad Fur Day isn't the boozing, sexual situations, drug use, or foul language. It's not even the boss fight against a living mound of feces with teeth made of corn kernels. It's the fact that this Nintendo 64 classic started out a kid's game. Bad Fur Day isn't the first game in the Conker series. In 1999 developer Rare first released a title called Conker's Pocket Tales for the Game Boy Color, a cutesy single-player adventure in which our hero has to rescue his girlfriend Berri from the Evil Acorn. It's exactly as boring and derivative as it sounds. And so would have been Twelve Tales: Conker 64, the original title for the Nintendo 64 game introduced at E3 in 1997. Another cute 3D platformer along the same lines as Rare's own Banjo-Kazooie. It had the same look, the same feel, and absolutely no one was looking forward to it. In an all-too-rare burst of self-awareness, the developers realized the game they had would be a failure, so they changed it. In 2000 Rare revealed Conker's Bad Fur Day, a nasty, dirty, filthy piece of video game, littered with video games and animal waste. It was so horrible that many retailers decided not to carry it. Warnings were splash all over the box in case parents, mistaking this for a cute and cuddly animal game, scarred their children for life. | Mid | [
0.5397489539748951,
32.25,
27.5
] |
Deprecated: mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /home/freehos1/public_html/projectus/core/open_close_dbase_connection.php on line 0 Deprecated: Function split() is deprecated in /home/freehos1/public_html/projectus/Speedometer/index.php(0) : eval()'d code on line 22 Deprecated: Function split() is deprecated in /home/freehos1/public_html/projectus/Speedometer/index.php(0) : eval()'d code on line 35 Deprecated: mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /home/freehos1/public_html/projectus/scripts/get_ad_type_position.php on line 0 Deprecated: mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /home/freehos1/public_html/projectus/scripts/load_ads.php on line 0 Deprecated: mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /home/freehos1/public_html/projectus/scripts/sponsor_found.php on line 0 Deprecated: mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /home/freehos1/public_html/projectus/scripts/load_links.php on line 0 Deprecated: Function split() is deprecated in /home/freehos1/public_html/projectus/Speedometer/index.php(0) : eval()'d code on line 161 Deprecated: Function split() is deprecated in /home/freehos1/public_html/projectus/Speedometer/index.php(0) : eval()'d code on line 164 They are used in a wide range of applications, including computer monitors, television, instrument panels, aircraft cockpit displays, signage, etc. They are common in consumer devices such as video players, gaming devices, clocks, watches,calculators, and telephones. LCDs have displaced cathode ray tube (CRT) displays in most applications. They are usually more compact, lightweight, portable, less expensive, more reliable, and easier on the eyes.[citation needed] They are available in a wider range of screen sizes than CRT and plasma displays, and since they do not use phosphors, they cannot suffer image burn-in. LCDs are more energy efficient and offer safer disposal than CRTs. Its low electrical power consumption enables it to be used in battery-powered electronic equipment. It is an electronically-modulated optical device made up of any number ofpixels filled with liquid crystals and arrayed in front of a light source (backlight) or reflector to produce images in colour ormonochrome. The earliest discovery leading to the development of LCD technology, the discovery of liquid crystals, dates from 1888.[1] By 2008, worldwide sales of televisions with LCD screens had surpassed the sale of CRT units. | Low | [
0.5139784946236561,
29.875,
28.25
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.