text
stringlengths 0
1.67M
|
|---|
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 shows a hose clamp according to a first embodiment in the open condition; FIG. 2 is a somewhat enlarged cross-section through the tongue and the outer band portion of the hose clamp according to FIG. 1 in the tightened condition; FIG. 3 shows an earless hose clamp according to a second embodiment in the closed, not yet tightened condition; FIG. 4 is a somewhat enlarged partial view of the hose clamp according to FIG. 3 , viewed from the inside; FIG. 5 represents a hose clamp having an Oetiker ear according to a third embodiment of the invention in the closed, not yet tightened condition; and FIG. 6 is an enlarged partial view of the hose clamp according to FIG. 5 , viewed from the inside. detailed-description description="Detailed Description" end="lead"? |
Production of genetically modified plants with puroindolines |
A new method for increasing expression of a puroindoline protein in a plant, said puroindoline protein modifying grain hardness, notably breadmaking quality, said method comprising the steps of: (e) preparing a DNA construct which will allow the expression of a puroindoline protein, (f) introducing said DNA construct into plant cell, plant tissue, or plant, (g) selecting the plant cell, or plant tissue, or plant which stably maintain the puroindoline expression, (h) and optionally regenerating fertile stable transformed plant. |
1-16. (Cancelled). 17. A method of producing a plant with modified grain hardness, said method comprising introducing into at least one plant cell, at least one nucleic acid sequence which encodes a puroindoline protein or which prevents the expression of a puroindoline protein, wherein said puroindoline protein is selected from the group consisting of a puroindoline-a protein and a puroindoline-b protein, and cultivating such transformed cell in conditions for regenerating a fertile stable transformed plant. 18. The method of claim 17, wherein said puroindoline protein is puroindoline-a protein. 19. The method of claim 17, wherein said puroindoline protein is puroindoline-b protein. 20. The method of claim 17, wherein said grain hardness modification consists of increasing grain hardness, and wherein said nucleic acid sequence encodes a puroindoline-a protein. 21. The method of claim 17, wherein said grain hardness modification consists of decreasing grain hardness, and wherein said nucleic acid sequence encodes a puroindoline-b protein. 22. The method of claim 17, wherein said grain hardness modification consists of decreasing grain hardness and wherein said nucleic acid sequence prevents the expression of a puroindoline-a protein. 23. The method of claim 17, wherein said grain hardness modification consists of increasing grain hardness and wherein said nucleic acid sequence prevents the expression of a puroindoline-b rotein. 24. The method of claim 17, wherein said nucleic sequence is part of a DNA construct which is an expression cassette comprising a DNA of interest included between a promoter and a terminator. 25. The method of claim 17, wherein said promoter is the Hight Molecular Weight Glutenin of wheat. 26. The method of claim 17, comprising: a) preparing a DNA construct which will stimulate or inhibit the expression of a puroindoline-a protein or a puroindoline-b protein, b) introducing said DNA construct into a plant cell, or a plant tissue, or a plant, c) selecting said plant cell, or plant tissue, or plant which stably maintains the puroindoline expression, and d) optionally regenerating a fertile stable transformed plant. 27. A transgenic plant transformed with an expression cassette as recited in claim 24, so that the puroindoline-a protein is expressed in said transgenic plant, said transgenic plant exhibiting an increased grain hardness compared to a progenitor plant which does not contain said expression cassette when said transgenic plant and said progenitor plant are cultivated under the same conditions 28. A transgenic plant transformed with an expression cassette as recited in claim 24, so that the puroindoline-b protein is expressed in said transgenic plant, said transgenic plant exhibiting a decreased grain hardness compared to a progenitor plant which does not contain said expression cassette when said transgenic plant and said progenitor plant are cultivated under the same conditions. 29. The transgenic plant and progeny of claim 27 wherein said transgenic plant is selected from the group consisting of wheat, maize, potato, barley and rice. 30. The transgenic plant and progeny of claim 28 wherein said transgenic plant is selected from the group consisting of wheat, maize, potato, barley and rice. 31. The transgenic plant and progeny of claim 27 wherein said transgenic plant is wheat. 32. The transgenic plant and progeny of claim 28 wherein said transgenic plant is wheat. 33. A seed, a progeny, a clone, a cell line or a cell of the transgenic plant of claim 29. 34. A seed, a progeny, a clone, a cell line or a cell of the transgenic plant of claim 30. 35. A method for preparing an alimentary product or an alimentary ingredient comprising: a) obtaining a transgenic plant according to claim 27, and b) preparing said alimentary product or said alimentary ingredient from said transgenic plant, or from a part thereof or from a product thereof. 36. A method for preparing an alimentary product or an alimentary ingredient comprising: a) obtaining a transgenic plant according to claim 28, and b) preparing said alimentary product or said alimentary ingredient from said transgenic plant, or from a part thereof or from a product thereof. 37. A method for preparing an alimentary product or an alimentary ingredient comprising: a) obtaining seeds according to claim 33, and b) preparing said alimentary product or said alimentary ingredient from said seeds. 38. A method for preparing an alimentary product or an alimentary ingredient comprising: a) obtaining seeds according to claim 34, and b) preparing said alimentary product or said alimentary ingredient from said seeds. 39. The method of claim 35, wherein said alimentary product or said alimentary ingredient is flour. 40. The method of claim 36, wherein said alimentary product or said alimentary ingredient is flour. 41. The method of claim 37, wherein said alimentary product or said alimentary ingredient is flour. 42. The method of claim 38, wherein said alimentary product or said alimentary ingredient is flour. 43, An alimentary product or an alimentary ingredient obtained by a method according to claim 35. 44. An alimentary product or an alimentary ingredient obtained by a method according to claim 36. 45. An alimentary product or an alimentary ingredient obtained by a method according to claim 37. 46. An alimentary product or an alimentary ingredient obtained by a method according to claim 38. 47. A flour obtained by a method of claim 39. 48. A flour obtained by a method of claim 40. 49. A flour obtained by a method of claim 41. 50. A flour obtained by a method of claim 42. |
Apparatus for processing waste with distribution/mixing chamber for oxidising fluid |
A waste processing apparatus for processing a column of waste in a processing chamber having one or more gas outlets at an upper part thereof and one or more plasma torches an output end thereof extending into a lower part of the chamber. The apparatus is characterised in having one or more oxidising fluid distribution and mixing chambers and one or more oxidising fluid inlet associated therewith for providing oxidising fluid to said distribution and mixing chamber from a suitable source, wherein each oxidizing and mixing chamber has a peripheral opening in substantially continuous peripheral fluid communication with a column of waste accommodated in the lower part of the chamber and in fluid communication with the oxidising fluid inlets, and further, the outer peripheral wall of the distribution and mixing chamber is formed by a lateral outward displacement of an inwardly-facing wall of the lower part of the processing chamber with respect to an inwardly-facing wall of the upper part of the processing chamber. The oxidising fluid inlets are separate from and associated with the plasma torches such that during operation of apparatus oxidising fluid flowing from the oxidising fluid inlets into said distribution and mixing chamber is directed at a high temperature zone provided by the plasma torches that are associated with the oxidising fluid inlets. |
1. A waste processing apparatus having a waste processing chamber adapted for accommodating a column of waste, at least one gas outlet means at an upper longitudinal part of the chamber, at least one plasma torch means having an output end thereof extending into a lower part of said waste processing chamber for providing sufficient heat to said lower part at least for enabling organic waste accommodated therein to be converted into fuel gases, the apparatus characterised in comprising at least one oxidising fluid distribution and mixing chamber and at least one oxidising fluid inlet associated therewith for providing oxidising fluid to said distribution and mixing chamber from a suitable source, wherein said oxidizing and mixing chamber comprises:— a peripheral opening in substantially continuous peripheral fluid communication with a lower part of a said column of waste when said column of waste is accommodated in said lower part and in fluid communication with at least one said oxidising fluid inlet; and an outer peripheral wall of said distribution and mixing chamber is formed by a lateral outward displacement of an inwardly-facing wall of said lower part of said processing chamber with respect to an inwardly-facing wall of said upper part of the processing chamber wherein at least one said oxidising fluid inlet is separate from and associated with said at least one plasma torch means such that during operation of said apparatus oxidising fluid flowing from the said at least one oxidising fluid inlet into said distribution and mixing chamber is directed at a high temperature zone provided by the at least one plasma torch means that is associated with said at least one oxidising fluid inlet. 2. A waste processing apparatus as claimed in claim 1, wherein said laterally displaced inwardly facing wall is made from a suitable refractory material. 3. A waste processing apparatus as claimed in claim 2, wherein an inner-facing part of said lower part of said processing chamber is made from a suitable refractory material. 4. A waste processing apparatus as claimed in claim 3, wherein said laterally displaced inwardly facing wall is laterally displaced from said inwardly-facing wall of said upper part by a first displacement that is about constant along said inwardly facing wall. 5. A waste processing apparatus as claimed in claim 3, wherein said laterally displaced inwardly facing wall is laterally displaced from said inwardly-facing wall of said upper part by a first displacement that is relatively greater at a location where said at least one oxidising fluid inlet is comprised than an average said displacement taken along said inwardly facing wall. 6. A waste processing apparatus as claimed in claim 5, wherein said first displacement at about 180° from said at least one oxidising fluid inlet is relatively less than an average said displacement taken along said inwardly facing wall. 7. A waste processing apparatus as claimed in claim 1, wherein an upper part of said distribution and mixing chamber is bound by an upper substantially annular wall radially extending towards the center thereof from said laterally displaced inwardly facing wall by a second displacement. 8. A waste processing apparatus as claimed in claim 7, wherein said second displacement is similar in magnitude to that of said first displacement. 9. A waste processing apparatus as claimed in claim 1, wherein said at least one oxidising fluid inlet is comprised on said laterally displaced inwardly facing wall. 10. A waste processing apparatus as claimed in claim 7, wherein at least one said oxidising fluid inlet is comprised on said upper annular wall. 11. A waste processing apparatus as claimed in claim 1, wherein at least said inwardly facing wall of said lower part of said processing chamber is substantially frustoconical in form having a larger conical half-angle than that of an inwardly facing wall of said upper part of the processing chamber. 12. A waste processing apparatus as claimed in claim 11, wherein said upper part is substantially cylindrical, having a conical half-angle of about 0°. 13. A waste processing apparatus as claimed in claim 1, wherein at least said inwardly facing wall of said lower part of said processing chamber is substantially cylindrical in form having a larger internal radius than that of said upper part of the processing chamber. 14. A waste processing apparatus as claimed in claim 13, wherein said upper part is substantially cylindrical. 15. A waste processing apparatus as claimed in claim 1, wherein said inwardly facing wall of said lower part of said processing chamber is substantially frustro-pyramidal in form having substantially polygonal cross-sections at planes substantially perpendicular to the longitudinal axis of the said processing chamber. 16. A waste processing apparatus as claimed in claim 15, wherein an inwardly facing wall of said upper part of said processing chamber is substantially frustro-pyramidal in form having substantially polygonal cross-sections at planes substantially perpendicular to the longitudinal axis of the said processing chamber. 17. A waste processing apparatus as claimed in claim 16, wherein said polygonal cross-sections of said upper part and of said lower part are substantially rectangular. 18. A waste processing apparatus as claimed in claim 1, wherein a lower part of said distribution and mixing chamber is in open communication with a bottom part of said lower part of said processing chamber downwardly extending from said laterally displaced inwardly facing wall. 19. A waste processing apparatus as claimed in claim 1, wherein a lower part of said distribution and mixing chamber is bound by a lower annular wall radially extending towards the center thereof from said laterally displaced inwardly facing wall by a third displacement. 20. A waste processing apparatus as claimed in claim 19, wherein said third displacement is smaller in magnitude to that of said second displacement. 21. A waste processing apparatus as claimed in claim 20, wherein a surface area of the said lower annular wall is less than a surface area of the said upper annular wall by an amount S which may range from about 1% to about 99% of the said surface area of the said upper annular wall. 22. A waste processing apparatus as claimed in claim 21, further comprising a second oxidising fluid distribution and mixing chamber vertically displaced downwardly with respect to said distribution and mixing chamber. 23. A waste processing apparatus as claimed in claim 22, wherein for said second oxidising fluid distribution and mixing chamber, a surface area of the lower annular wall thereof is less than a surface area of the upper annular wall thereof by an amount S′ which may range from about 1% to about 99% of the said surface area of the said upper annular wall of the said second oxidising fluid distribution and mixing chamber. 24. A waste processing apparatus as claimed in claim 1, wherein said at least one plasma torch means is comprised in a suitable niche formed in the said bottom part of said processing chamber, such that the output end of said at least one plasma torch is displaced from a said column of waste accommodated in said processing chamber. 25. A waste processing apparatus as claimed in claim 1, wherein said at least one plasma torch means is comprised in a suitable auxiliary chamber laterally disposed with respect to the processing chamber and in communication therewith via a suitable portal, such that the output end of said at least one plasma torch means is displaced from a said column of waste accommodated in said processing chamber. 26. A waste processing chamber as claimed in claim 25, further comprising a plurality of said auxiliary chambers, wherein each said additional auxiliary chamber is laterally disposed with respect to the processing chamber and in communication therewith via a suitable portal, such that the output end of said at least one plasma torch means comprised therein is displaced from a said column of waste accommodated in said processing chamber. 27. A waste processing apparatus as claimed in claim 25, wherein at least one said auxiliary chamber further comprises at least one said oxidising fluid inlet. 28. A waste processing apparatus as claimed in claim 1, wherein a discontinuity in the internal profile of the processing chamber is formed between said upper part and said lower part thereof. 29. A waste processing apparatus as claimed in claim 28, wherein the transverse cross-sectional area of said processing chamber taken along planes perpendicular to the longitudinal axis at least between the longitudinal position of the center of an uppermost said oxidising fluid inlet to the longitudinal position of the center of the output end of a lowermost said plasma torch means is substantially greater than the transverse cross-sectional area of said upper part just above said discontinuity. 30. A waste processing apparatus as claimed in claim 28, wherein at least one said oxidising fluid inlet may be provided at a location in said distribution and mixing chamber such that the angle φ between the longitudinal axis of the processing chamber and an imaginary line connecting the center of said oxidising fluid inlet to the said discontinuity, taken along a plane including said axis and said center, is in the range of between about 0.5° and about 120°. 31. A waste processing apparatus as claimed in claim 1, wherein at least one said oxidising fluid inlet is disposed at a location such that the angle β between the plane including the longitudinal axis of the processing chamber and the center of said oxidising fluid inlet, and the plane including the said longitudinal axis and the center of the end of a said plasma torch, is less than or equal to about ±170°. 32. A waste processing apparatus as claimed in claim 31, wherein said angle β is about ±20°. 33. A waste processing apparatus as claimed in claim 1, further comprising a cylindrical wall downwardly depending from said upper part and laterally displaced inwardly with respect to said laterally displaced inwardly facing wall. 34. A method for distributing and mixing oxidizing fluid along and into a periphery of a waste column accommodated in a waste processing apparatus having a waste processing chamber adapted for processing such a waste column and comprising at least one plasma torch means having an output end thereof extending into a lower part of said waste processing chamber for providing sufficient heat to said lower part at least for enabling organic waste accommodated therein to be converted into fuel gases, said method comprising (a) providing a distribution and mixing chamber as claimed in claim 1; (b) during operation of said processing chamber causing oxidising fluid to flow from the said at least one oxidising fluid inlet and into said distribution and mixing chamber and around the periphery of the column of waste accommodated in said processing chamber, such that said oxidizing fluid is directed at a high temperature zone provided by the at least one plasma torch means that is associated with said at least one oxidising fluid inlet. |
<SOH> BACKGROUND <EOH>The processing of waste including municipal waste, medical waste, toxic and radioactive waste by means of plasma-torch based waste processing plants is well known. Referring to FIG. 1 , a typical prior art plasma-based processing plant ( 1 ) comprises a processing chamber ( 10 ) typically in the form of a vertical shaft, in which typically solid, and also mixed (i.e., generally, solid plus liquid and/or semiliquid), waste ( 20 ) is introduced at the upper end thereof via a waste inlet means comprising an air lock arrangement ( 30 ). One or a plurality of plasma torches ( 40 ) at the lower end of the chamber ( 10 ) heats the column ( 35 ) of waste in the chamber ( 10 ), converting the waste into gases that are channeled off via outlet ( 50 ), and a liquid material ( 38 ) (typically molten metals and/or slag) which is periodically or continuously collected at the lower end of the chamber ( 10 ) via reservoir ( 60 ). Oxidising gases or fluids, such as air, oxygen or steam ( 70 ) may be provided at the lower end of the chamber ( 10 ) to convert char residues comprising carbon, produced in the processing of organic waste, into useful product gases such as CO and H 2 , for example. A similar arrangement for dealing with solid waste is described in U.S. Pat. No. 5,143,000, the contents of which are incorporated herein by reference thereto. At least two problems are commonly encountered relating to the provision of oxidising fluids to the chamber that prevent smooth operation of such processing plants or furnaces. As waste is processed and proceeds to the lower, hotter parts of the chamber, inorganic waste in the form of molten or semi-molten material (including metal, oxides, salts and so on) may be deposited on the chamber walls, at times obstructing or at least partially obstructing the oxidising gas or fluid outlets into the chamber, as well as the plasma torch outlets. Once this happens, the deposited material can only be removed manually, i.e., by shutting down the plant, and after it cools down mechanically or otherwise removing the obstruction, or, by increasing the temperature in the chamber so that the deposited material (metal, oxides, salts and so on) melts and flows away from the oxidising gas outlet. The first solution results in plant down-time, with the ensuing economic penalties. The second solution is not always feasible, and requires more power to be provided to the chamber, which reduces the thermal and economic efficiency of the plant. The second problem is in providing oxidising fluid or gases to the waste thoroughly and rapidly, so that all of the char in the waste may be converted into useful gases effectively and efficiently. In many prior art processing plants, oxidising gases are directed towards the axis of the chamber, and while penetrating the waste column to some extent, homogenous distribution is not achieved. In U.S. Pat. No. 5,143,000, steam is introduced tangentially into a lower part of the processing chamber, about half-way between the longitudinal axis of the chamber and the wall thereof. This configuration is also not very effective in distributing the oxidising fluid, since the amorphous and dense composition of the waste at this part of the chamber prevents the oxidising fluid from reaching all parts of the waste effectively. SU 1715107 describes a waste processing plant having a lower double-walled water cooled metal crucible, in which an inductor is used for providing heat to the waste, and an upper part made from refractory material, and having the same internal diameter as the lower crucible. Oxidising gas is provided at a location between the upper part and the crucible via a plurality of circumferentially placed openings therein, serviced by an external annular air pipe arrangement made from metal. This arrangement is specifically described with respect to a plant based on induction heating, and would not be suitable for a plasma-based plant, where the operating temperatures are much higher and refractory materials are usually necessary for the crucible part thereof, since the metal pipe would melt. In fact, the annular pipe configuration, while providing a multitude of oxidising fluid entry ports into the chamber, is not readily adaptable to processing plants in which the lower part of the processing chamber is made from a refractory material rather than metal, as such refractory material does not easily lend itself to having a plurality of bores drilled therein, since, for example, the mechanical strength of the furnace wall is substantially weakened. Further, providing a plurality of individual and separate locations along the circumference for injecting the oxidising gases is not fully effective in enabling the gases to penetrate into the waste column, in particular discrete inlets tend to get blocked during operation of the chamber, as mentioned hereinbefore, and the water cooling provided to the crucible results in some solidification and material deposition thereon, which exacerbates the blocking of the inlets. Thus, none of the above patents, the contents of which are incorporated herein by reference thereto, provide adequate distribution of oxidising gases to the waste column, particularly in a plant in which the lower hotter part of the processing chamber is made from refractory material. Further, none of these patents disclose or suggest how to avoid obstruction of the oxidising gas inlet ports or plasma torches due to deposition of melted or semi-molten inorganic waste thereon. It is therefore an aim of the present invention to provide an oxidising gas inlet system for enabling efficient and rapid introduction of oxidising gasses to the waste which overcomes the limitations of prior art plants. It is another aim of the present invention to provide such a system that will allow the mixing of the relatively cold oxidising gases or fluid with the hot plasma gases generated by the plasma torches such as to enable the uniform and rapid reaction of preheated oxidising gases or fluid and char in the gasification zone. It is another aim of the present invention to provide such a system that may be incorporated into a solid waste processing apparatus. It is another aim of the present invention to provide a system for substantially avoiding the blocking of oxidising gas inlet ports and/or plasma torches in a plasma-torch type processing apparatus. It is another aim of the present invention to provide such a device that is relatively simple mechanically and thus economic to incorporate into a processing chamber design. It is another aim of the present invention to provide such a system incorporated as an integral part of a plasma-torch based type mixed waste converter. It is also an aim of the present invention to provide such a system that is readily retrofittable with respect to at least some existing plasma-based waste converters. The present invention achieves these and other aims by providing an oxidising fluid distribution channel or chamber incorporated into the design of the processing chamber, the channel having at least one oxidising fluid entry port or inlet associated therewith for introducing oxidising fluid therein from a suitable supply. The channel is recessed with respect to the waste column so that the oxidising fluids are initially separated from the waste column, enabling the oxidising fluids to be distributed circumferentially or at least peripherally around the waste column, thereby enabling the oxidising fluids to then penetrate into the waste column from all directions. Such a channel may be formed as an integral part of the chamber using refractory material. The plasma torches may be similarly located in a recess-type feature also incorporated in the refractory material, to minimise obstruction by deposited inorganic material. While some plasma-based processing plants may have a recess or channel between part of the waste column and part of the wall of processing chamber, such recesses are not functional in the sense of the present invention. In other words, they are not directed to provide circumferential distribution of oxidising fluid to a part of the waste column in which char is being converted to product gases, and indeed are not adapted for so doing. Indeed, as exemplified by U.S. Pat. No. 4,831,944, some such prior art plants neither disclose nor suggest any facilities at all for providing oxidising fluid to the waste, much less for the circumferential distribution thereof, and are neither directed to solving the problems addressed by the present invention nor provide a similar solution. Japanese Patent Nos. JP 10110917 and JP 10089645 each describe a vertical melting furnace having a bulging mid-section in which are provided a plurality of combustion gas supply ports to form an annular combustion chamber. No plasma torches are used in these furnaces. Combustion gases are thereby provided to the annular combustion space provided in the mid-section in order to burn waste in the thermal decomposition zone and thus prevent or reduce bridging thereat. Air is provided to the furnace by means of a plurality of inlet ports at the lower end of the furnace, where the furnace cross-section returns to the original unbulged size. Such a system is not readily suitable for a plasma torch based processing plant. For example, some cooling of the melted inorganic materials at the lower end of the processing chamber would result due to the cooling effect of the air provided thereat, which could in turn cause blockage of the fluid inlet ports by solidifying inorganic material. Furthermore, while combustion gases are provided in the bulging section for burning product gases, there is no suggestion of supplying oxidising fluid thereat exclusively for the purpose of converting organic waste such as char into product gases. On the contrary, the aim of these patents is to reduce bridging and requires the addition of combustion gases within the bulging section to do so, oxidising air being provided to the furnace rather than the bulging section via the lower inlet ports, as described above. Such a system is thus not readily suitable for preheating oxidising gases and char inside the combustion chamber without the combustion of fuel therein. U.S. Pat. No. 5,657,706 relates to an apparatus for processing waste, which is separated into three vertical sections. Waste is input via the middle section, the gasification chamber, and combustion air is delivered thereto via lateral openings level with the soleplates (not shown in the Figure). However, there appears to be no disclosure or suggestion of a distribution and mixing chamber for distributing and mixing oxidizing fluid around a column of waste. In particular, no mixing and distribution chamber is described nor hinted at having a peripheral opening in continuous peripheral fluid communication with a column of waste, nor having an outer peripheral wall which is formed as in the present invention. EP 850,885 relates to a melt treatment apparatus which comprises a passage which is laterally displaced from the main chamber, and which comprises an inlet for a gas such as air. The passage is provided for melt discharging and is not for distributing oxidising fluid around any waste—the location of the gas inlet is substantially downstream of the lower end of the waste. No distribution and mixing chamber for oxidizing fluids is disclosed or hinted at, less so one having a peripheral opening in continuous peripheral fluid communication with a column of waste, nor having an outer peripheral wall which is formed as in the present invention. EP 837,041 relates to a plasma treatment of ashes, in which a number of tiltable electrodes are provided in a plasma-based apparatus. While the wall of the lower part of the apparatus is laterally displaced with respect to an upper part thereof, the lances which are used to provide air and steam are located in the upper part of the apparatus, and are thus not directly associated with the displaced wall of the lower part. Furthermore, there is a lack of fluid communication between the upper part of the chamber comprising these lances, and the lower wider part of the chamber, due to a blocking plug of waste in the upper part that is present during operation of the chamber. There is no disclosure or hint of a mixing and distribution chamber for distributing oxidizing fluids from the lances around a lower part of the column of waste, less so as in the present invention. EP 625,869 relates to a plasma arc apparatus that may be used for treatment of waste. A melter shell is provided having a smaller diameter than the outer melter hood, providing an annular gap to allow ingression of air into the plasma arc furnace. Thus, as illustrated in the figures, an inner facing wall of the upper part (including the hood) is actually outwardly displaced with respect to the lower part of the apparatus (the melter shell), which is the reverse of the arrangement of the present invention, as will become evident hereinbelow. Furthermore, the only oxidising inlet to the chamber is the upper central port, which lies in the middle of the upper part of the column of waste. Thus, in such a configuration, there is no fluid communication between the upper part of the chamber comprising this inlet, and the lower part of the chamber, due to a blocking plug of waste that is present therein during operation of the chamber. There is no disclosure or hint of a mixing and distribution chamber for distributing oxidizing fluids from the lances around a lower part of the column of waste, less so as in the present invention. These references fail to disclose or suggest a distribution and mixing chamber having:— a peripheral opening in substantially continuous peripheral fluid communication with a lower part of a said column of waste when said column of waste is accommodated in said lower part and in fluid communication with at least one said oxidising fluid inlet; an outer peripheral wall thereof formed by a lateral outward displacement of an inwardly-facing wall of said lower part of said processing chamber with respect to an inwardly-facing wall of said upper part of the processing chamber; and wherein at least one said oxidising fluid inlet is separate from and associated with said at least one plasma torch means such that during operation of said apparatus oxidising fluid flowing from the said at least one oxidising fluid inlet into said distribution and mixing chamber is directed at a high temperature zone provided by the at least one plasma torch means that is associated with said at least one oxidising fluid inlet. Thus, not only are these references are not directed towards providing a mixing and distribution chamber as in the present invention, but they describe features of processing chambers which are different in structure and function to the mixing and distribution chamber of the present invention. In general, plasma-based processing plants which only provide oxidizing agents via the plasma torches are also limited in that if more oxidising fluid is needed for processing the char, this results in a corresponding lowering of the temperature produced by the plasma torches. This in turn results in greater inorganic material deposits, which in turn cause the congestion problems discussed above. On the other hand, if it is desired to increase the temperature of the plasma torches, the oxidising fluid provided thereto must be reduced, which results in char in the waste column not being fully oxidised into product gases or alternatively the power that needs to be provided to the plasma torches has to be raised, which reduces the efficiency of the process. Thus, providing an oxidising fluid inlet, independent from the plasma torches, allows additional freedom in the way in which the processing plant may be used, as this enables both the temperature of the plasma jets and the volume flow rate of oxidising fluid to be increased simultaneously as required. However, plasma torch based furnaces which employ oxidising fluid inlets independent from the plasma torches are not necessarily without problems. Such furnaces need to be designed such a manner that the oxidising fluid inlets, which provide relatively cool oxidising gases or fluids, are sufficiently spaced from the inorganic melted products, and in particular from the discharging outlets thereof. Otherwise, congestion of these discharging outlets may occur due to the cooling of the melt (and solidification thereof) by the action of the relatively cool oxidising fluids on the melt. |
<SOH> SUMMARY OF INVENTION <EOH>The present invention relates to a waste processing apparatus having a waste processing chamber adapted for accommodating a column of waste, at least one gas outlet means at an upper longitudinal part of the chamber, at least one plasma torch means having an output end thereof extending into a lower part of said waste processing chamber for providing sufficient heat to said lower part at least for enabling organic waste accommodated therein to be converted into fuel gases, said processing chamber having a bottom end, the apparatus characterised in comprising at least one oxidising fluid distribution and mixing chamber and at least one oxidising fluid inlet associated therewith for providing oxidising fluid to said distribution and mixing chamber from a suitable source, wherein said oxidizing and mixing chamber comprises:— a peripheral opening in substantially continuous peripheral fluid communication with a lower part of a said column of waste when said column of waste is accommodated in said lower part and in fluid communication with at least one said oxidising fluid inlet; and an outer peripheral wall thereof formed by a lateral outward displacement of an inwardly-facing wall of said lower part of said processing chamber with respect to an inwardly-facing wall of said upper part of the processing chamber; wherein at least one said oxidising fluid inlet is separate from and associated with said at least one plasma torch means such that during operation of said apparatus oxidising fluid flowing from the said at least one oxidising fluid inlet into said distribution and mixing chamber is directed at a high temperature zone provided by the at least one plasma torch means that is associated with said at least one oxidising fluid inlet. Thus, typically, at least a part of an inwardly facing wall of said lower part of said processing chamber is laterally displaced outwardly with respect to an inwardly-facing wall of said upper part of the processing chamber such as to provide said at least one distribution and mixing chamber between said outwardly laterally displaced inwardly facing wall and a circumferential periphery of part of the column of waste that may be accommodated in said processing chamber downstream of said upper part, said at least one distribution and mixing chamber being adapted to provide fluid communication between said periphery of a waste column accommodated in said lower part and said at least one oxidising fluid inlet. The laterally displaced inwardly facing wall and the inner-facing part of said lower part of said processing chamber are typically made from a suitable refractory material. The laterally displaced inwardly facing wall may be laterally displaced from said inwardly-facing wall of said upper part by a first displacement that is about constant along said inwardly facing wall. Alternatively, the laterally displaced inwardly facing wall is laterally displaced from said inwardly-facing wall of said upper part by a first displacement that is relatively greater at a location where said at least one oxidising fluid inlet is comprised than an average said displacement taken along said inwardly facing wall. Such a first displacement at about 180° from said at least one oxidising fluid inlet may be relatively less than an average said displacement taken along said inwardly facing wall. An upper part of said distribution and mixing chamber may be bound by an upper substantially annular wall laterally or radially extending towards the center thereof from said laterally displaced inwardly facing wall by a second displacement. Typically, the second displacement is similar in magnitude to that of said first displacement. At least one oxidising fluid inlet may be comprised on said laterally displaced inwardly facing wall and/or on said upper annular wall. At least the inwardly facing wall of said lower part of said processing chamber may be substantially frustoconical in form having a larger conical half-angle than that of an inwardly facing wall of said upper part of the processing chamber, and the upper part may be substantially cylindrical, having a conical half-angle of about 0°. Alternatively, at least said inwardly facing wall of said lower part of said processing chamber is substantially cylindrical in form having a larger internal radius than that of said upper part of the processing chamber, the upper part being substantially cylindrical. Alternatively, the inwardly facing wall of said lower part of said processing chamber may be substantially frustro-pyramidal in form having substantially polygonal cross-sections at planes substantially perpendicular to the longitudinal axis of the said processing chamber. The inwardly facing wall of said upper part of said processing chamber may be substantially frustro-pyramidal in form having substantially polygonal cross-sections at planes substantially perpendicular to the longitudinal axis of the said processing chamber. The polygonal cross-sections of said upper part and of said lower part are optionally substantially rectangular. Optionally, a lower part of said distribution and mixing chamber is in open communication with a bottom part of said lower part of said processing chamber downwardly extending from said laterally displaced inwardly facing wall. Further optionally, a lower part of said distribution and mixing chamber is bound by a lower annular wall laterally or radially extending towards the center thereof from said laterally displaced inwardly facing wall by a third displacement. Typically, the third displacement is smaller in magnitude to that of said second displacement. The surface area of the said lower annular wall is preferably less than a surface area of the said upper annular wall by an amount S which may range from about 1% to about 99% of the said surface area of the said upper annular wall. Optionally, the waste processing apparatus further comprises a second oxidising fluid distribution and mixing chamber vertically displaced downwardly with respect to said distribution and mixing chamber. Preferably, the surface area of the lower annular wall thereof is less than a surface area of the upper annular wall thereof by an amount S′ which may range from about 1% to about 99% of the said surface area of the said upper annular wall of the said second oxidising fluid distribution and mixing chamber. Optionally, at least one plasma torch means is comprised in a suitable niche formed in the said bottom part of said processing chamber, such that the output end of said at least one plasma torch is displaced from a said column of waste accommodated in said processing chamber. Further optionally, at least one plasma torch means is comprised in a suitable auxiliary chamber laterally disposed with respect to the processing chamber and in communication therewith via a suitable portal, such that the output end of said at least one plasma torch means is displaced from a said column of waste accommodated in said processing chamber. Alternatively, the waste processing chamber may further comprise a plurality of said auxiliary chambers, wherein each said additional auxiliary chamber is laterally disposed with respect to the processing chamber and in communication therewith via a suitable portal, such that the output end of said at least one plasma torch means comprised therein is displaced from a said column of waste accommodated in said processing chamber. At least one said auxiliary chamber further comprises at least one said oxidising fluid inlet. Optionally, a discontinuity in the internal profile of the processing chamber is formed between said upper part and said lower part thereof. In particular, the transverse cross-sectional area of said processing chamber taken along planes perpendicular to the longitudinal axis at least between the longitudinal position of the center of an uppermost said oxidising fluid inlet to the longitudinal position of the center of the output end of a lowermost said plasma torch means is substantially greater than the transverse cross-sectional area of said upper part just above said discontinuity. Optionally, at least one said oxidising fluid inlet may be provided at a location in said distribution and mixing chamber such that the angle φ between the longitudinal axis of the processing chamber and an imaginary line connecting the center of said oxidising fluid inlet to the said discontinuity, taken along a plane including said axis and said center, is in the range of between about 0.5° and about 120°. Further optionally, at least one said oxidising fluid inlet is disposed at a location such that the angle β between the plane including the longitudinal axis of the processing chamber and the center of said oxidising fluid inlet, and the plane including the said longitudinal axis and the center of the end of a said plasma torch, is less than or equal to about ±170°, and preferably about ±20°. Optionally, the said discontinuity is in the form of a cylindrical wall downwardly depending from said upper part and laterally displaced inwardly with respect to said laterally displaced inwardly facing wall. The present invention is also directed to a method for distributing and mixing oxidizing fluid along and into a periphery of a waste column accommodated in a waste processing apparatus having a waste processing chamber adapted for processing such a waste column and comprising at least one plasma torch means having an output end thereof extending into a lower part of said waste processing chamber for providing sufficient heat to said lower part at least for enabling organic waste accommodated therein to be converted into fuel gases, said method comprising (a) providing a distribution and mixing chamber as described; and (b) during operation of said processing chamber causing oxidising fluid to flow from the said at least one oxidising fluid inlet and into said distribution and mixing chamber and around the periphery of the column of waste accommodated in said processing chamber, such that said oxidizing fluid is directed at a high temperature zone provided by the at least one plasma torch means that is associated with said at least one oxidising fluid inlet. |
Gene panel participating in liver regeneration |
A gene panel comprising a group of genes of which expression levels change in hepatocytes during liver regeneration as compared with those in a normal state is produced by the following steps: (a) the step of measuring expression levels of various genes in hepatocytes of a model animal in a normal state and expression levels of the genes during liver regeneration; (b) the step of comparing the expression levels, respectively; and (c) the step of identifying a group of genes of which expression levels change during liver regeneration. |
1. A gene panel comprising names of genes of which expression levels change in hepatocytes during liver regeneration as compared with those in a normal state and expression profiles of the genes. 2. The gene panel according to claim 1, wherein the changes of the gene expression levels are changes in the expression levels in a model animal after partial hepatectomy as compared with the expression levels in a normal state in the model animal. 3. The gene panel according to claim 1 or 2, wherein the expression profiles include expression profiles over time during liver regeneration. 4. The gene panel according to any one of claims 1 to 3, which includes sequence information of a group of PCR primers for analyzing the expression profiles of the genes. 5. The gene panel according to any one of claims 2 to 4, wherein the model animal is a rat. 6. The gene panel according to any one of claims 1 to 5, which includes expression profiles of at least 6 types of genes among 166 types of the genes represented by the numbers 1 to 166 in Tables 1, 6 and 7. 7. The gene panel according to claim 6, wherein the at least 6 types of genes are selected from 151 types of the genes represented by numbers 1 to 151 in Tables 1 and 6. 8. The gene panel according to claim 6, wherein the at least 6 types of genes are selected from 137 types of the genes represented by the numbers 1 to 137 in Tables 1 and 6. 9. The gene panel according to any one of claims 6 to 8, wherein the at least 6 types of genes are the genes represented by the numbers 5, 17, 36, 46, 67 and 68 in Table 1. 10. A method for producing a gene panel comprising expression profiles of genes of which expression levels change in hepatocytes during liver regeneration as compared with those in a normal state, which comprises the steps of: (a) measuring expression levels of various genes in hepatocytes of a model animal in a normal state and expression levels of the genes during liver regeneration; (b) comparing the expression levels, respectively; and (c) identifying a group of genes of which expression levels change during liver regeneration and producing expression profiles from information about gene names and changes in the expression levels. 11. The method according to claim 10, wherein, in the step (a), the expression levels of the gene are analyzed over time during liver regeneration. 12. The method according to claim 11, wherein a liver regeneration accelerating substance is administered before, during or after liver regeneration. 13. The method according to claim 12, wherein the liver regeneration accelerating substance is L-alanine. 14. The method according to any one of claims 10 to 13, wherein the gene expression levels are analyzed by one or more kinds of methods selected from the gene chip method, the ATAC-PCR method and the Taqman PCR (SYBR Green) method. 15. The method according to claim 14, wherein the gene expression levels are analyzed by the gene chip method and the ATAC-PCR method. 16. The method according to claim 14, wherein the gene expression levels are analyzed by the Taqman PCR (SYBR Green) method. 17. A method for screening for a drug involved in liver regeneration, which comprises administering a drug to a model animal or liver tissue or cells and profiling expressions of genes constituting the gene panel according to claim 1. 18. A method for evaluating a condition of liver, which comprises profiling expressions of genes constituting the gene panel according to claim 1 for liver of a subject. 19. A group of primers used in the method for producing a gene panel according to claim 10, the screening method according to claim 17 or the evaluation method according to claim 18, which comprises all or a part of the oligonucleotides of SEQ ID NOS: 1 to 127 and 135 to 192. |
<SOH> BACKGROUND ART <EOH>After partial hepatectomy in liver cancer treatment or transplantation of partially resected liver in liver disease treatment, rapid regeneration of the remaining liver or transplanted liver is important. However, poor liver regeneration is observed in not a few cases. Further, adults often have fatty livers, and fatty livers often lead to poor regeneration, which causes problems after partial hepatectomy. Furthermore, in order to compensate for damaged liver in hepatitis, it is important to accelerate liver regeneration. Delay in the regeneration worsens hepatitis and can lead to fulminant hepatitis, of which prognosis is poor. Accordingly, medical care that accelerates liver regeneration is being required, and it can be said that screening for drugs accelerating liver regeneration is important. However, in spite of such requirement, no effective therapeutic agent that accelerates liver regeneration has been found, and no method for efficiently screening for drugs that accelerate liver regeneration has been known. It is known that, when partial hepatectomy is performed in a rat, liver regeneration is quickly started, and that the hepatocyte population size comes back to the size before the hepatectomy in about 1 week. While it is considered that liver regeneration is accelerated by interactions of two or more kinds of associated genes, the overall picture of liver regeneration process remains unknown for what kinds of genes function at what kinds of timings. Since it is considered that many genes are involved in liver regeneration, it is considered that it is important to examine a large number of important genes involved in liver regeneration to grasp the overall picture of liver regeneration. However, although attempts have been made so far to reproduce liver regeneration in a culture system including a combination of genes and proteins considered to be involved in liver regeneration, no one has succeeded yet. Further, gene screenings utilizing changes in expression observed during liver regeneration as index have been reported (Xu W et al., Biochem. Biophys. Represents. Commun., 278(2): 318-25, 2000; Kar S and Carr B I, Biochem. Biophys. Represents. Commun., 212(1): 21-6, 1995; Mohn K L, et al., Mol. Cell Biol., 11(1): 381-90, 1991; Sobczak J et al., Exp. Cell Res., 169(1): 47-56, 1987; Huber B E et al., Hepatology, 6(2): 209-19, 1986). However, in these screenings, expressions of only a few types of genes have been examined. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 shows a structure of adaptor. FIGS. 2 to 4 show relative expression levels of genes involved in L-alanine metabolism, of which expressions change during liver regeneration after administration of L-alanine (relative expression levels based on the expression level of β-actin, which is taken as 1000). detailed-description description="Detailed Description" end="lead"? |
TARGET VISIBILITY ENHANCEMENT SYSTEM |
A method and apparatus (10) for enhancing target visibility comprises producing pulse returns in response to a sequence of received pulses. The pulse returns are processed to produce primary returns which vary from pulse to pulse unlike unmodulated clutter returns. The pulse returns are also processed to produce one or more secondary returns which model clutter artifacts whose amplitude vary with range in a manner related to the amplitude variation of the estimated clutter, and whose phase varies in a manner related to the phase of the primary returns. This is followed by removal from primary returns of a contribution thereto varying with range in the same way as the secondary returns. The result is that contributions to radar returns associated with moving targets are enhanced relative to clutter. |
1. An electronic signal processing system for processing signals received from a scene, including: a) means for producing from the received signals a set of main returns representative of the scene and distributed between a plurality of range cells; b) means for estimating a clutter component of the main returns; and c) means for producing a set of primary returns comprising of residuals derived by removing the estimated clutter component from the main returns; characterised in that the system is arranged to produce a set of modified primary returns by further including: d) means for estimating a component representative of clutter artifacts manifesting as a similarity between the primary returns and either the clutter component or the main returns, and e) means for removing the clutter artifact component from the primary returns to produce the modified primary returns having reduced clutter artifacts. 2. A signal processing system as claimed in claim 1 wherein the received signas take the form of pulses. 3. A system as claimed in claim 2 wherein the means for estimating the component representative of clutter artifacts includes a means for identifying a first set of range cells over which the primary return amplitudes vary in a manner related to the clutter returns, and further including means for processing over a second set of range cells the main returns to produce secondary returns representative of the clutter artifacts in the primary returns. 4. A system as claimed in claim 3 wherein the system further includes means for removing from the primary returns a contribution thereto varying with range in a substantially similar way as the secondary returns and thereby generating modified primary returns with reduction in clutter artifacts. 5. A system as claimed in claim 3 wherein the means for processing the main returns to generate the secondary returns includes means for combining the amplitude of the clutter-like returns in each range cell with the phase of the primary returns in corresponding range cells. 6. A system according to claim 4 wherein the means for removing from the primary returns the contribution varying in the same manner as the secondary returns includes: a) means that, for each pulse, calculates over the second set of range cells a projection coefficient comprising a summation of the product of: the primary returns, a complex conjugate of their associated normalised secondary returns and a pulse and range dependent weighting factor; b) means to multiply the projection coefficient by the normalised secondary return to form a product and to subtract that product from the primary return to produce the modified primary returns. 7. A system as claimed in claim 6 arranged to identify those range cells within the first set of range cells wherein the ratio of the amplitudeof the primary return to the clutter return in a given range cell is below a predetermined threshold, and limiting the summation in point a) of claim 6 to the identified range cells. 8. A system as claimed in claim 1 wherein the system is arranged to process the modified primary returns using a moving target filter before passing the processed modified primary returns to a target detection system. 9. A system according to claim 1 wherein the signals received from the scene have been arranged to vary in frequency with time in such a way that the signals are compressible by filtering. 10. A method of processing signals received from a scene, comprising the) steps of: a) producing from the received signals a set of main returns representative of the scene and distributed between a plurality of range cells; and b) estimating a clutter component of the main returns; and c) producing a set of primary returns comprising of residuals derived by reffiefing the estimated clutter component from the main returns; characterised in that a set of modified primary returns is produced by: c) estimating a component representative of clutter artifacts manifesting as a similarity between the primary returns and either the clutter component or the main returns, and d) removing the clutter artifact component from the primary returns to produce the modified primary returns having reduced clutter artifacts. 11. A method as claimed in claim 10 wherein the received signals take the form of pulses. 12. A method as claimed in claim 11 wherein the estimation of the component representative of clutter artifacts is done by identifying a first set of range cells over which the primary return amplitudes vary in a manner related to the clutter returns, and processing over a second set of range cells the main returns to produce secondary returns representative of the clutter artifacts in the primary returns. 13. A method as claimed in claim 12 wherein a contribution thereto varying with range in the same way as the secondary returns is removed from the primary returns, thereby generating modified primary returns with reduced clutter artifacts. 14. A method as claimed in claim 12 wherein the processing of the main returns to generate the secondary returns includes combining the amplitude of the clutter-like returns in each range cell with the phase of the primary returns in corresponding range cells. 15. A method as claimed in claim 13 wherein the contribution varying in the same manner as the secondary returns is removed from the primary returns by: a) for each pulse, calculating over the second set of range clels a projection coefficient comprising a summation of the product of: the primary returns, a complex conjugate of their associated normalised secondary returns and a pulse and range dependent weighting factor; and b) multiplying the projection coefficient by the normalised secondary return to form a product and to subtract that product from the primary return to produce the modified primary returns. 16. A method as claimed in claim 15 in which those range cells within the first set of range cells wherein the ratio of the amplitude of the primary return to the clutter return in a given range cell is below a predetermined threshold are identified, and the summatio in point a) of claim 15 is limited to the identified range cells. 17. A method as claimed in claim 10 wherein the modified primary returns are processed using a moving target filter before passing the processed modified primary returns to a target detection system. 18. A method according to claim 10 wherein the signals received from the scene vary in frequency with time in such a way that the signas are compressible by filtering. 19. A computer program designed to run on a computer system and arranged thereon to implement a signal processing system, the system being arranged to: a) receive signals representative of a scene that comprise a set of main returns distributed between a plurality of range cells; and b) estimate a component of the main returns caused by clutter, and to produce a set of primary returns comprising of residuals derived by removing the estimated clutter component from the main returns; characterised in that the system includes: c) means for estimating a component representative of clutter artifacts manifesting as a similarity between the primary returns and either the clutter component or the main returns, and d) means for removing the clutter artifact component from the primary returns to produce the modified primary returns having reduced clutter artifacts. 20. A computer program as claimed in claim 19 wherein the received signals are derived from a plurality of pulses. 21. A computer program as claimed in claim 20 wherein the means for estimating the component representative of clutter artifacts includes a means for identifying a first set of range cells over which the primary return amplitudes vary in a manner related to the clutter returns, and further includes means for processing over a second set of range clels the main returns to produce secondary returns representative of the clutter artifacts in the primary returns. 22. A computer program as claimed in claim 21 wherein the system further inclues means for removing from the primary returns a contribution thereto varying with range in a substantially similar way as the secondary returns and thereby generating modified primary returns with reduction in clutter artifacts. 23. A computer program as claimed in claim 21 wherein th means for processing the main returns to generate the secondary returns includes means for combining the amplitude of the clutter-like returns in each range cell with the phase of the primary return in corresponding range cells. 24. A computer program according to claim 22 wherein the means for removing from the primary returns the contribution varying in the same manner as the secondary returns includes: a) means that, for each pulse, calculates over the second set of range cells a projection coefficient comprising a summation of the product of: the primary returns, a complex conjugate of their associated normalised secondary returns and a pulse and range dependent weighting factor; b) means to multiply the projection coefficient by the normalised secondary return to form a product and to subtract that product from the primary return to produce the modified primary returns. 25. A computer program as claimed in claim 24 arranged to identify those range cells within the first set of range cells wherein the ratio of the amplitude of the primary return to the clutter return in a given range cell is below a predetermined threshold, and limiting the summation in point a) of claim 24 to the identified range cells. |
Furniture with screen |
In order to achieve a reduction in weight and convenience in terms of handling, a piece of furniture with a screen according to the present invention comprises a main body and a drawer provided therein. A screen is rolled up and stored in the interior of the drawer. Corner supporting members constituted with a smaller front-back dimension than the front-back dimension of the main body are connected respectively to the left and right end portions on the rear side of the main body in order to support the main body, and base portions which contact the ground frontward of the screen are provided on the left/right pair of supporting members. |
1. A piece of furniture with a screen comprising: a main body is provided with a drawer which is freely movable between a pulled-out position in which said drawer is pulled-out frontward and a storage position in which said drawer is stored inside said main body; a screen is rolled up and stored in the interior of said drawer; wherein: the piece of furniture is constituted to be freely modifiable in attitude between a usage attitude in which said screen stored in side said drawer is raised upward when said drawer is pulled out and a storage attitude in which said screen is rolled up and stored inside said drawer; corner supporting members having a smaller front-back dimension than the front-back dimension of said main body are connected to the respective left and right end portions on the rear side of said main body to support said main body; and support legs comprising a base portion which contacts the ground frontward of at least said screen in the storage attitude are provided on the left/right pair of supporting members. 2. The piece of furniture with a screen according to claim 1, wherein said supporting member is constituted by a plate-form member formed in a substantially L-shaped form when seen from above which is connected to said main body so as to contact the rear face of said main body on the left and right corner portions thereof and the adjacent side face thereto on either the left or right side. 3. The piece of furniture with a screen according to claim 1, wherein said main body is constituted in a box shape with an open front face comprising a single space in which the drawer storing said screen can be stored, and the height of the upper end of said supporting member is set to be substantially equal to the height of the upper end of said main body. 4. The piece of furniture with a screen according to claim 1, wherein: said main body is constituted in a box shape with an open front face comprising a single space in which the drawer storing said screen can be stored; the upper end of said supporting member is set higher than the upper end of said main body so as to be positioned thereabove; and a fitting portion for fitting a back board is provided on the end portion of the respective rear plate portions of said two corner supporting members. 5. The piece of furniture with a screen according to claim 1, wherein a protruding portion which protrudes outward or inward is formed in said supporting member to form an interior space over the entirety of the vertical direction thereof. 6. The piece of furniture with a screen according to claim 1, wherein an attachment portion to which a speaker can be attached is provided on the front end portion of said supporting member. 7. The piece of furniture with a screen according to claim 1, wherein a space into which a movable tray for carrying audio equipment can be inserted and stored is formed in the lower portion of said main body. 8. The piece of furniture with a screen according to claim 1, wherein tray spaces into which two movable trays for carrying audio equipment can be inserted and stored and a speaker space in which a center speaker can be disposed between the two trays are formed in the lower portion of said main body. 9. The piece of furniture with a screen according to claim 7 or claim 8, wherein said tray is constituted by a carrying portion for carrying audio equipment and a left/right pair of vertical wall portions which rise upward from the left and right end portions of said carrying portion, and is provided with a concave portion formed on the rear face of said carrying portion into which a power outlet for the audio equipment carried on said carrying portion is embedded. |
<SOH> BACKGROUND ART <EOH>In recent years projection screens for projecting images, or simply screens, have come to be used in homes so that larger images may be enjoyed. Accordingly, a large variety of cabinets, pieces of furniture, and the like provided with such a screen have been proposed. Typical of these cabinets and pieces of furniture provided with a screen are large, heavy pieces such as those having upper and lower storage portions with doors, those having storage portions with doors on the left and right sides, and so on, and hence a great deal of labor is required during transportation and movement thereof. Further, in furniture comprising storage portions with doors, a casing or the like in which the screen is rolled and stored is typically provided on the upper end, and since the screen is provided on the upper end, the lower space must be preserved when the screen is in use. Hence the overall size and height of the piece of furniture increases, causing a further increase in weight. Moreover, the part in which the screen is housed must be caused to protrude forward from the constitutional members of the cabinet (or furniture) so that these constitutional members do not contact the screen when in use. As a result, care must be taken during transportation and installation that the storage part does not contact other objects, which is extremely troublesome in terms of handling. The present invention has been designed in consideration of the situation described above, and it is an object thereof to provide a piece of furniture with a screen in which a reduction in weight can be achieved and which is favorable in terms of handling. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 illustrates a piece of furniture with a screen in a storage attitude, (a) being a front view thereof, and (b) being a rear view thereof; FIG. 2 is a side view of the piece of furniture with the screen in the storage attitude; FIG. 3 is a plan view of the piece of furniture with the screen in the storage attitude; FIG. 4 is a front view of the piece of furniture with the screen in a usage attitude; FIG. 5 is a side view of the piece of furniture with the screen in the usage attitude; FIG. 6 is a rear view of the piece of furniture with the screen in the usage attitude; FIG. 7 is a perspective view showing the shape of a main body and a carrying member; FIG. 8 illustrates a tray, (a) being a perspective view thereof and (b) being a rear view thereof; FIG. 9 illustrates the tray, (a) being a bottom view thereof and (b) being a longitudinal sectional side view thereof; FIG. 10 is a perspective view of a corner supporting member; FIG. 11 is a plan view showing the main parts of the corner supporting member when provided with a speaker; FIG. 12 is a front view showing another piece of furniture comprising a back board; FIG. 13 is a rear view showing the other piece of furniture comprising the back board; FIG. 14 is a side view showing the other piece of furniture comprising the back board; FIG. 15 is a front view showing a screen provided on the piece of furniture shown in FIG. 12 in a usage attitude; FIG. 16 is a plan view showing an attachment portion of the back board and the supporting member; and FIG. 17 is a front view showing a plasma display attached to the back board of the piece of furniture shown in FIG. 13 . detailed-description description="Detailed Description" end="lead"? |
Method for identification isolation and production of antigens to a specific pathogen |
Described is a method for identification, isolation and production of hyperimmune serum-reactive antigens from a specific pathogen, a tumor, an allergen or a tissue or host prone to autoimmunity, said antigens being suited for use in a vaccine for a given type of animal or for humans, which is characterized by the following steps:—providing an antibody preparation from a plasma pool of said given type of animal or from a human plasma pool or individual sera with antibodies against said specific pathogen, tumor, allergen or tissue or host prone to auto-immunity,—providing at least one expression library of said specific pathogen, tumor, allergen or tissue or host prone to auto-immunity,—screening said at least one expression library with said antibody preparation,—identifying antigens which bind in said screening to antibodies in said antibody preparation,—screening the identified antigens with individual antibody preparations from individual sera from individuals with antibodies against said specific pathogen, tumor, allergen or tissue or host prone to auto-immunity,—identifying the hyperimmune serum-reactive antigen portion of said identified antigens and which hyperimmune serum-reactive antigens bind to a relevant portion of said individual antibody preparations from said individual sera and—optionally isolating said hyperimmune serum-reactive antigens and producing said hyperimmune serum-reactive antigens by chemical or recombinant methods. |
1-34. canceled. 35. A hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof. 36. The hyperimmune serum-reactive antigen of claim 35, further defined as comprising a hhyperimmune fragment of at least 6 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 37. The hyperimmune fragment of claim 36, further defined as comprising a fragment of at least 8 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 38. The hyperimmune fragment of claim 37, further defined as comprising a fragment of at least 10 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 39. The hyperimmune fragment of claim 36, is further defined as comprising a fragment from: amino acids 5-39, 111-117, 125-132, 134-141, 167-191, 196-202, 214-232, 236-241, 244-249, 292-297, 319-328, 336-341, 365-380, 385-391, 407-416, 420-429, 435-441, 452-461, 477-488, 491-498, 518-532, 545-556, 569-576, 581-587, 595-602, 604-609, 617-640, 643-651, 702-715, 723-731, 786-793, 805-811, 826-839, 874-889, 37-49, 63-77, or 274-334, of SEQ ID NO:56; or amino acids 9-33, 56-62, 75-84, 99-105, 122-127, 163-180, 186-192, 206-228, 233-240, 254-262, 275-283, 289-296, 322-330, 348-355, 416-424, 426-438, 441-452, 484-491, 541-549, 563-569, 578-584, or 624-641 of SEQ ID NO:414. 40. A helper epitope of a hyperimmune serum-reactive antigen or antigen or fragment thereof comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414. 41. The helper epitope of claim 40, further defined having an amino acid sequence of amino acids 6-40, 583-598, 620-646, or 871-896 of SEQ ID NO:56 and being a T-cell epitope. 42. A method of preparing a vaccine against Staphylococcus aureus or Staphylococcus epidermidis comprising: obtaining a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof; and formulating that hyperimmune serum-reactive antigen in a vaccine composition. 43. A vaccine comprising a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof. 44. The vaccine of claim 43, further comprising an immunostimulatory substance 45. The vaccine of claim 44, wherein the immunostimulatory compound is a polycationic substance, an immunostimulatory deoxynucleotide, alumn, Freund's complete adjuvant, Freund's incomplete adjuvant, or a neuroactive compound. 46. The vaccine of claim 46, wherein the immunostimulatory compound is a polycationic substance further defined as a polycationic peptide. 47. The vaccine of claim 46, wherein the immunostimulatory compound is a neuroactive compound further defined as human growth hormone. 48. An antibody against a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof. 49. The antibody of claim 48, further defined as a monoclonal antibody. 50. A method of producing an antibody comprising: initiating an immune response in a non-human animal by administering a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof to said animal; removing the spleen or spleen cells from said animal; producing hybridoma cells of said spleen or spleen cells; selecting and cloning hybridoma cells specific for said antigen; and producing the antibody by cultivation of said cloned hybridoma cells. 51. A method of producing an antibody comprising: initiating an immune response in a no- human animal by administering a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof to said animal; removing an antibody containing body fluid from said animal; and producing the antibody preparation by subjecting said antibody containing body fluid to purification steps. 52. A method of treating or preventing infection or colonization by a Staphylococcus bacteria comprising: obtaining a composition comprising a hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof or an antibody against such a hyperimmune serum-reactive antigen; and administering the composition to a subject to be treated or protected from infection or colonization by the Staphylococcus bacteria. 53. The method of claim 52, wherein the hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof is further defined as a hyperimmune fragment comprising at least 6 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 54. The method of claim 53, wherein the hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof is further defined as a hyperimmune fragment comprising at least 8 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 55. The method of claim 54, wherein the hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof is further defined as a hyperimmune fragment comprising at least 10 amino acids of SEQ ID NO:56 or SEQ ID NO:414. 56. The method of claim 52, wherein the hyperimmune serum-reactive antigen comprising a sequence of SEQ ID NO:56 or SEQ ID NO:414 or a hyperimmune fragment thereof is defined as comprising a fragment from: amino acids 5-39, 111-117, 125-132, 134-141, 167-191, 196-202, 214-232, 236-241, 244-249, 292-297, 319-328, 336-341, 365-380, 385-391, 407-416, 420-429, 435-441, 452-461, 477-488, 491-498, 518-532, 545-556, 569-576, 581-587, 595-602, 604-609, 617-640, 643-651, 702-715, 723-731, 786-793, 805-811, 826-839, 874-889, 37-49, 63-77, or 274-334, of SEQ ID NO:56; or amino acids 9-33, 56-62, 75-84, 99-105, 122-127, 163-180, 186-192, 206-228, 233-240, 254-262, 275-283, 289-296, 322-330, 348-355, 416-424, 426-438, 441-452, 484-491, 541-549, 563-569, 578-584, or 624-641 of SEQ ID NO:414. 57. The method of claim 52, further defined as a method of vaccinating the subject against infection or colonization by the Staphylococcus bacteria. 58. The method of claim 52, further defined as a method of treating Staphylococcus infection or colonization in the subject. 59. The method of claim 52, wherein the Staphylococcus bacteria is further defined as a Staphylococcus aureus. 60. The method of claim 52, wherein the Staphylococcus bacteria is further defined as a Staphylococcus epidermidis. 61. A method comprising: providing an antibody preparation from a plasma pool of a given type of animal or from a human plasma pool or individual sera with antibodies against a specific pathogen, tumor, allergen or tissue or host prone to auto-immunity; providing at least one expression library of said specific pathogen, tumor, allergen, or tissue or host prone to auto-immunity; screening said at least one expression library with said antibody preparation; identifying antigens which bind in said screening to antibodies in said antibody preparation; screening the identified antigens with individual antibody preparations from individual sera from individuals with antibodies against said specific pathogen, tumor, allergen or tissue or host prone to auto-immunity; and identifying a hyperimmune serum-reactive antigen portion of said identified antigens and which hyperimmune serum-reactive antigens bind to a relevant portion of said individual antibody preparations from said individual sera. 62. The method of claim 61, where in said least one expression library is a ribosomal display library, a bacterial surface library, or a proteome. 63. The method of claim 61, further defined as comprising: providing an antibody preparation from a plasma pool of said given type of animal or from a human plasma pool or individual sera with antibodies against said specific pathogen, providing at least three different expression libraries of said specific pathogen, screening said at least three different expression libraries with said antibody preparation, identifying antigens which bind in at least one of said at least three screenings to antibodies in said antibody preparation, screening the identified antigens with individual antibody preparations from individual sera from individuals with antibodies against said specific pathogen, identifying the hyperimmune serum-reactive antigen portion of said identified antigens which hyperimmune serum-reactive antigens bind to a relevant portion of said individual antibody preparations from said individual sera, repeating said screening and identification steps at least once, comparing the hyperimmune serum-reactive antigens identified in the repeated screening and identification steps with the hyperimmune serum-reactive antigens identified in the initial screening and identification steps, further repeating said screening and identification steps, if at least 5% of the hyperimmune serum-reactive antigens have been identified in the repeated screening and identification steps only, until less than 5% of the hyperimmune serum-reactive antigens are identified in a further repeating step only to obtain a complete set of hyperimmune serum-reactive antigens of a specific pathogen. 64. The method of claim 63, wherein said at least three different expression libraries are at least a ribosomal display library, a bacterial surface library and a proteome. 65. The method of claim 61, wherein said plasma pool is a human plasma pool taken from at least one individual having experienced or are experiencing an infection with said pathogen. 66. The method of claim 61, wherein said at least one expression library is a genomic expression library of said pathogen. 67. The method of claim 66, wherein said at least one expression library is a genomic expression library of said pathogen with a redundancy of at least 5×. 68. The method of claim 61, further defined as comprising screening at least a ribosomal display library, a bacterial surface display library and a proteome with said antibody preparation and identifying antigens which bind in at least two of said screenings to antibodies in said antibody preparation. 69. The method of claim 61, wherein said pathogen is a bacterial, viral, fungal or protozoan pathogen. 70. The method of claim 61, wherein said pathogen is a Staphylococcus pathogen. 71. The method of claim 61, wherein said at least one expression library is a ribosomal display library or a bacterial surface display library and said hyperimmune serum-reactive antigens are produced by expression of the coding sequences of said hyperimmune serum-reactive antigens contained in said library. 72. The method of claim 61, further comprising isolating identified hyperimmune serum-reactive antigens. 73. The method of claim 61, further comprising producing isolated hyperimmune serum-reactive antigens by chemical or recombinant methods. 74. The method of claim 73, further comprising formulating the produced hyperimmune serum-reactive antigens in a pharmaceutical preparation. 75. The method of claim 74, wherein said pharmaceutical preparation is a vaccine. 76. The method of claim 61, wherein said antibody preparation is derived from at least one patient with acute infection with said pathogen. 77. The method of claim 76, wherein said at least one patient has an antibody titer to said pathogen of higher than 80%. 78. The method of claim 61, wherein at least 10 individual antibody preparations are used in identifying said hyperimmune serum-reactive antigens. 79. The method of claim 61, wherein said relevant portion of said individual antibody preparations from said individual sera are at least 10 of all individual antibody preparations used in said screening. 80. The method of claim 61, wherein said relevant portion of said individual antibody preparations from said individual sera are at least 20% of all individual antibody preparations used in said screening. 81. The method of claim 61, wherein individual sera are selected which have an IgA titer against a lysate, cell wall components, or recombinant proteins of said pathogen above 4000 U and/or have an IgG titer above 10000 U. |
Device for ducting electrical lines through the wall of a fuel tank |
The invention relates to a device for ducting electrical lines through the wall of a fuel tank (1), whereby a steel support (3) is materially connected to the wall of the fuel tank (1). Contacts (4) are introduced though the support (3). The contacts (4) have a sleeving (5) made from glass or ceramic. A leakage of fuel vapours from the fuel tank (1) is thus almost completely excluded. |
1. A device for ducting electrical lines through a wall of a fuel tank, comprising: a carrier inserted into an opening in the fuel tank and closed off in a sealing fashion; and contacts which lead through the carrier to outside of the fuel tank, wherein the carrier has at least one sheath which is fabricated from glass or ceramic, for the contacts, wherein the height of the at least one sheath is less than or equal to the thickness of the carrier. 2. The device as claimed in claim 1, wherein the carrier is fabricated from metal and is connected to the sheath of the contacts in a gastight fashion. 3. The device as claimed in claim 1, wherein the contacts have a bushing made of steel in a region of the sheath. 4. A device for ducting electrical lines through a wall of a fuel tank, comprising: a carrier inserted into an opening in the fuel tank and closed off in a sealing fashion; and contacts which lead through the carrier to outside of the fuel tank, wherein the carrier has at least one sheath, which is fabricated from glass or ceramic, for the contacts, and when a plurality of contacts exist, at least one of the contacts has a sheath which is fabricated from a different material of the carrier. 5. The device according to claim 4, wherein a region of the carrier which adjoins the sheath has a rough surface. 6. The device according to claim 4, wherein a region of the carrier which adjoins the sheath has at least one groove-like recess, and in that part of the sheath is arranged within the groove-like recess. 7. The device according to claim 4, wherein the contacts have a circular, oval or rectangular-shaped cross section. 8. The device according to claim 4, further comprising a connecting element for a plug, which is configured to be plugged onto the contacts is attached to the carrier in the region of the contacts. 9. The device according to claim 8, wherein the connecting element which is configured to be arranged on an outside of the fuel tank has an elastomer seal which bears against the carrier. 10. The device according to claim 9, wherein the connecting element which is configured to be arranged on the outside of the fuel tank has a circumferential bead and is prestressed with respect to the carrier by means of the bead. 11. The device according to claim 8, wherein the connecting element is connected with the carrier in a materially joined fashion. 12. The device according to claim 4, wherein the carrier is welded or soldered to the fuel tank in a gas-tight fashion. 13. (canceled). 14. The device according to claim 4, wherein the carrier is plate-=shaped and has a centering device which projects into the opening in the fuel tank. 15. The device according to claim 1, further comprising a connecting element for a plug, which is configured to be plugged onto the contacts, is attached to the carrier in the region of the contacts. 16. The device as claimed in claim 1, wherein the contacts have a bushing made of steel in a region of the sheath. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Devices for ducting electrical lines are used, for example, for a fuel pump and a level indicator and are known from practice. As a rule, a carrier is fabricated from plastic. The contacts are pressed into the carrier until one end of the contacts protrudes on each side of the carrier, or the contacts are encapsulated by injecting molding when the carrier is manufactured and are thus embedded in a materially joined fashion in the carrier material. Then, electrical lines can be connected to the contacts on both sides of the carrier. The carrier is clipped, for example, onto the opening of the fuel tank. In addition, an elastomer seal is arranged between the fuel tank and the carrier. A disadvantage of the known device is that fuel vapors can diffuse through the carrier and regions adjoining the contacts. As a result, fuel can escape from the fuel tank and enter the environment. |
<SOH> SUMMARY OF THE INVENTION <EOH>The invention discloses a device for ducting electrical lines through the wall of a fuel tank such that it ensures a particularly high seal of the carrier and of the contacts. This is accomplished in one embodiment according to the invention in that the carrier has at least one sheath, which is fabricated from glass or ceramic, for the contacts. This configuration permits the escape of fuel through the carrier to be kept particularly small as glass or ceramic virtually completely prevents the diffusion of fuel vapors. In addition, the sheath ensures sufficient isolation of the contacts. As the contacts which are usually fabricated from metal can be connected particularly reliably to glass and ceramic, gaps in the region of the contacts are avoided as a result of the invention. The carrier therefore has a particularly good seal with respect to fuel vapors. At the same time, the contacts have a wide variety of cross sections, for example circular, oval or rectangular. The carrier could be fabricated completely from ceramic, for example. According to one advantageous embodiment of the invention, the carrier is of more particularly cost-effective design if it is fabricated from metal and connected to the sheath of the contacts in a gastight fashion. In particular, when the carrier is connected to a fuel tank by a wall made of metal, emissions of fuel from the fuel tank can be reduced to virtually zero as a result of the invention. In the case of contacts which are fabricated from metal with a low melting point, according to another advantageous embodiment of the invention it is possible to prevent the contacts melting when the sheath is cast with glass if the contacts have a bushing made of steel in the region of their sheath. The connection between the bushing made of steel and the contacts can easily be configured in a gastight fashion by pressing or soldering, for example. A plurality of contacts could have a common sheath made of glass or ceramic. However, according to another advantageous embodiment of the invention, the carrier has a particularly high degree of mechanical stability if, when there are a plurality of contacts, at least one of the contacts has a sheath which is separated from the other contacts by the material of the carrier. The connection of the carrier to the sheath is structurally simple if a region of the carrier which adjoins the sheath has a rough surface. The contacts or the bushings made of steel may also have a rough surface. According to another advantageous embodiment of the invention, the connection between the sheath and the carrier can be reliably sealed if the region of the carrier which adjoins the sheath has at least one groove-like recess and if part of the sheath is arranged inside the groove-like recess. The contacts or the bushings made of steel can also be connected to the sheath in a similar fashion. According to another advantageous embodiment of the invention, pull relief for the contacts is structurally simple if a connecting element for a plug which is to be plugged onto the contacts is attached to the carrier in the region of the contacts. The contacting element is preferably fabricated from plastic. The ingress of spray water underneath the connecting element could lead to creepage currents between the contacts. According to another advantageous embodiment of the invention, the ingress of spray water can be avoided if the connecting element which is to be arranged on the outside of the fuel tank has an elastomer seal which bears against the carrier. The device according to the invention requires a particularly small number of components to be mounted if the connecting element which is to be arranged on the outside of the fuel tank has a circumferential bead and is prestressed with respect to the carrier by means of the bead. The device according to the invention is structurally simple if the connecting element is connected to the carrier in a materially joined fashion. With the carrier fabricated from metal and the connecting element fabricated from plastic it is possible to produce the materially joined connection easily using an injecting molding method when the connecting element is fabricated. In order to close off a mounting opening in the fuel tank, the carrier can be embodied in the form of a closure lid, or welded into such a closure lid. A seal is arranged between the closure lid and the fuel tank. The closure lid is screwed to the fuel tank. The seal of the fuel tank is improved if the carrier is welded or soldered to the fuel tank in a gastight fashion. According to another advantageous development of the invention, the carrier has particularly small radial dimensions if the carrier is of sleeve-shaped design and has an external diameter corresponding to the opening of the fuel tank. In order to reduce the fabrication costs of the device according to the invention further, it helps if the carrier is configured in a plate shape and has a centering device which projects into the opening in the fuel tank. |
Method for evolving a cell having desired phenotype and evolved cells |
The present invention relates to evolution of a cell or a composition of cells having a desired property or functionally. The principle behind the evolution of cells according to the invention is to produce a great diversity of genes in each cell subjected to evolution and a great diversity of genes among the cells in a composition according to the invention and to exchange the genes between the cells from time to time. In preferred embodiments the genes are arranged in expression cassettes in concatemers in the cells, as well as in artificial chromosomes. Said methods comprising the steps of a) obtaining a composition of cells, at least one cell of said composition comprising a1) at least two expressible nucleotide sequences, at least one of said sequences being incorporated into an artificial chromosome in the cell and/or a2) at least two expression cassettes of the following formula: [rs2-SP-PR-X-TR-SP-rs11 wherein rs1 and rs2 together denotes a restriction site, SP individually denotes a spacer, PR denotes a promoter, capable of functionning in the first cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, and/or a3) at least two expressible nucleotide sequences, said sequences being heterologous to the cell, determining at least one screening functionality. The genes are preferably co-ordinately controllable for increasing diversity. The desired property of functionality is preferably a compound, or a series of compounds synergistically acting to each other. |
1. A method for evolving a cell having a desired functionality, said method comprising the steps of a) obtaining a composition of cells, at least one cell of said composition comprising a1) in the range of 10 to 1000 heterologous expressible nucleotide sequences, at least one of said sequences being incorporated into an artificial chromosome in the cell, and/or a2) at least two expression cassettes of the following formula: [rs2-SP-PR-X-TR-SP-rs1] wherein rs1 and rs2 together denotes a restriction site, SP individually denotes a spacer, PR denotes a promoter, capable of functioning in the first cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, b) determining at least one screening functionality, c) screening the cells of the composition with respect to at least one screening criterion related to the determined screening functionality, d) selecting cells meeting the at least one screening criterion related to the determined screening functionality, e) combining the expressible nucleotide sequences of the selected cells with expressible nucleotide sequences from another composition of cells, and f) repeating steps b) to e) as required until at least one cell has acquired the desired functionality. 2. The method according to claim 1, wherein step c) comprises screening with respect to at least two different screening criteria before selecting cells meeting the at least one screening criterion related to the determined screening functionality. 3. The method according to claim 1, wherein the step c) comprises one step of combination before obtaining the further modified composition. 4. (canceled) 5. The method according to claim 1, wherein at least one the screening criterion is a media based criterion selected from the group consisting of using unusual media substrates, growing cells on toxin comprising media and growing cells on inhibitor comprising media, wherein cells are being selected on the basis of survival, superior growth, deviating morphology, stickiness, spectral properties and/or modulation of enzyme activity. 6. The method according to claim 1, wherein at least one screening criterion is a physical criteria selected from the group consisting of temperature, osmolarity, light, and electricity, wherein cells are selected on the basis of survival, superior growth, deviating morphology, stickiness, spectral properties and/or modulation of enzyme activity. 7. The method according to claim 1, wherein the expressible nucleotide sequences originate from at least two different species. 8-10. (canceled) 11. The method according claim 1, wherein the strength of the screening criterion/criteria is increased for each repeat and/or the type of screening criterion/criteria is changed for each repeat. 12-13. (canceled) 14. The method according to claim 1, wherein the combination of expressible sequences is a combination of chromosomes in the cells. 15. (canceled) 16. The method according to claim 1, wherein the combination of expressible sequences is conducted by removing the expressible sequences from at least two different cells, combining the individual expressible sequences in vitro, and introducing at least two combined expressible sequences into at least two cells. 17. The method according to claim 1, wherein the desired functionality is a capability of the cell of producing non-native secondary metabolites. 18-37. (canceled) 38. The method according to claim 1, wherein at least one cell of the composition comprises at least one concatemer of individual oligonucleotide cassettes, each concatemer comprising oligonucleotide of the following formula in 5′→3′ direction [rs2-SP-PR-X-TR-SP-rs1]n wherein rs1 and rs2 together denote a restriction site, SP individually denotes a spacer of at least two nucleotide bases, PR denotes a promoter, capable of functioning in The method, X denotes an expressible nucleotide sequence, TR denotes a terminator, and wherein n≧2, and wherein at least two expressible nucleotide sequences are from different expression states. 39. (canceled) 40. The method according to claim 1, wherein substantially all rs1-rs2 sequences are recognised by the same restriction enzyme. 41-46. (canceled) 47. The method according to claim 1, wherein the cell is a yeast cell selected from the group consisting of baker's yeast, Kluyveromyces marxianus, K. lactis, Candida utilis, Phaffia rhodozyma, Saccharomyces boulardii, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Candida paraffinica, Schwanniomyces castellii, Pichia stipitis, Candida shehatae, Rhodotorula glutinis, Lipomyces lipofer, Cryptococcos curvatus, Candida spp. (e.g. C. palmioleophila), Yarrowia lipolytica, Candida guilliermondii, Candida, Rhodotorula spp., Saccharomycopsis spp., Aureobasidium pullulans, Candida brumptii, Candida hydrocarbofumarica, Torulopsis, Candida tropicalis, Saccharomyces cerevisiae, Rhodotorula rubra, Candida flayeri, Eremothecium ashbyii, Pichia spp., Kluyveromyces, Hansenula, Kloeckera, Pichia, Pachysolen spp., and Torulopsis bombicola. 48-56. (canceled) |
<SOH> BACKGROUND OF THE INVENTION <EOH>Recombination of cells in order to optimise or produce heterologous proteins is a well-established practice in molecular biology. The traditional approach to engineered molecular evolution relates to optimisation of an individual gene having a specific phenotype. The strategy is to clone a gene, identify a function for the gene and an assay for selecting the gene, mutate selected positions in the gene and select variants of the gene for improvement in the known function of the gene. A variant having a desired function may then be expressed in a suitable host cell. However, the traditional approach has several drawbacks when it comes to evolution of cells having new properties, since the approach only relates to discrete genes. Multiple genes that cooperatively confer a single phenotype cannot be optimised in this manner. Furthermore, the traditional approach only leads to a very limited number of combinations or permutations in or cell or even for a single gene. Evolution of cells having new properties have been described in for example WO 98/31837 wherein a method of evolving cells towards acquisition of new properties employing iterative cycles of recombination and selection/screening for evolution is discussed. In WO 97/35966 a process of recursive sequence recombination in order to evolve new metabolic pathways are discussed, and in WO 00/04190 a process of recursive sequence recombination in order to evolve whole cells and organisms having desired properties. Whether using the traditional approach of optimising individual genes or conducting iterative cycles of recombination, the individual genes in the cells in question are recombined, i.e. changed with foreign genetic material evolving new genes. A major drawback when evolving new genes in this manner is, that each cycle of recombination may as well result in a failure leading to a nonsense gene as a success leading to an optimised gene. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is an aim by the present invention to evolve a cell or a composition of cells having a desired property or functionality. The principle behind the evolution of cells according to the invention is to produce a great diversity of genes in each cell subjected to evolution and a great diversity of genes among the cells in a composition according to the invention and to exchange the genes between the cells from time to time. Accordingly the invention relates to a method for evolving a cell having a desired functionality, a method wherein at least some of the cells to be evolved comprises an artificial chromosome, said method comprising the steps of a) obtaining a composition of cells, at least one cell of said composition comprising at least two expressible nucleotide sequences, at least one of said sequences being incorporated into an artificial chromosome in the cell, b) determining at least one screening functionality, c) screening the cells of the composition with respect to at least one screening criterion related to the determined screening functionality, d) selecting cells meeting the at least one screening criterion related to the determined screening functionality, e) combining the expressible sequences of the expression cassettes of the selected cells with expressible sequences from another composition of cells, and f) optionally repeating steps b) to e) as required until at least one cell has acquired the desired functionality. In another aspect of the invention the cells are defined as in the following method for evolving a cell having a desired functionality, said method comprising the steps of a) obtaining a composition of cells, each cell of said composition comprising at least two expression cassettes of the following formula: in-line-formulae description="In-line Formulae" end="lead"? [rs 2 -SP-PR-X-TR-SP-rs 1 ] in-line-formulae description="In-line Formulae" end="tail"? wherein rs 1 and rs 2 together denotes a restriction site, SP individually denotes a spacer, PR denotes a promoter, capable of functioning in the first cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, and b) determining at least one screening functionality, c) screening the cells of the composition with respect to at least one screening criterion related to the determined screening functionality, d) selecting cells meeting the at least one screening criterion related to the determined screening functionality, e) combining at least one of the expressible sequences of the selected cells with at least one expressible sequence from another composition of cells, and f) optionally repeating steps b) to e) as required until at least one cell has acquired the desired functionality. In a further aspect the invention relates to a method comprising the steps of a) obtaining a composition of cells, each cell of said composition comprising at least two expressible nucleotide sequences, said sequences being heterologous to the cell b) determining at least one screening functionality, c) screening the cells of the composition with respect to at least one screening criterion related to the determined screening functionality, d) selecting cells meeting the at least one screening criterion related to the determined screening functionality, e) combining at least one of the expressible sequences of the selected cells with at least one expressible sequence from another composition of cells, the combination of expressible sequences being changing full-length genes and/or changing expression cassettes and/or changing chromosomes, obtaining a further modified composition, and f) optionally repeating steps b) to e) as required until at least one cell has acquired the desired functionality In other words the invention relates to a method for evolving a cell having a desired functionality, said method comprising the steps of a) obtaining a composition of cells, at least one cell of said composition comprising a1) at least two expressible nucleotide sequences, at least one of said sequences being incorporated into an artificial chromosome in the cell, and/or a2) at least two expression cassettes of the following formula: in-line-formulae description="In-line Formulae" end="lead"? [rs 2 -SP-PR-X-TR-SP-rs 1 ] in-line-formulae description="In-line Formulae" end="tail"? wherein rs 1 and rs 2 together denotes a restriction site, SP individually denotes a spacer, PR denotes a promoter, capable of functioning in the first cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, and/or a3) at least two expressible nucleotide sequences, said sequences being heterologous to the cell, b) determining at least one screening functionality, c) screening the cells of the composition with respect to at least one screening criterion related to the determined screening functionality, d) selecting cells meeting the at least one screening criterion related to the determined screening functionality, e) combining the expressible sequences of the expression cassettes of the selected cells with expressible sequences from another composition of cells, with the proviso that the combination of expressible sequences being changing full-length genes and/or changing expression cassettes and/or changing chromosomes, when the cells are as defined as in a3) only, and f) optionally repeating steps b) to e) as required until at least one cell has acquired the desired functionality. The term “expressible sequence” is used with its normal meaning, i.e. a sequence capable of being expressed in the host cells in question. In step c) the cells may be screened for more than one screening criterion related to the determined functionality, for example the cells may be screened sequentially for first one screening criteria and subsequently another screening criteria, before the cells having the determined screening functionality are selected. In another embodiment the two or more screening criteria are applied to the cells at the same time. Also in step d) the combination of expressible sequences may be combined in a one-step process, or by a process of several steps of mixing or combining the expressible sequences, independent of whether the combination relates to combination of expressible sequences as such or combination of expression cassettes or combination of chromosomes. Step f) may be repeated until cells having the desired functionality are obtained. Thereby step f) may be repeated from 0 to at least 200 times, preferably from 0 to 150 times, such as from 0 to 100 times, such as from 0 to 80 times, such as from 0 to 60 times, such as from 0 to 20 times. In the present context the desired functionality is the functionality of the cell(s) when having been evolved to for example produce a desired compound, wherein the compound may be known, but not previously produced by the cell or the compound may be novel. Furthermore, the desired functionality may be production of a series of compounds, such as compounds having a synergistic effect, for example intermediates and metabolites in a pathway. The screening functionality is the functionality during the screening rounds. The screening functionality is normally different from the desired functionality, but in some embodiments the screening functionality is identical with the desired functionality. The screening functionality is also referred to as the predetermined functionality in the present context. Yet a further aspect of the invention relates to the cells evolved by the methods according to the present invention. Accordingly, the invention also relates to a cell comprising at least one concatemer of individual oligonucleotide cassettes, each concatemer individually comprising an oligonucleotide sequence of the following formula in 5′→3′ direction: in-line-formulae description="In-line Formulae" end="lead"? [rs 2 -SP-PR-X-TR-SP-rs 1 ] n in-line-formulae description="In-line Formulae" end="tail"? wherein rs 1 and rs 2 together denote a restriction site, SP individually denotes a spacer of at least two nucleotide bases, PR denotes a promoter, capable of functioning in the cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, and wherein n≧2, wherein rs 1 -rs 2 in at least two cassettes is recognised by the same restriction enzyme, and said cell being capable of producing at least one substance, which is heterologous to the cell. In another aspect the invention relates to an evolved cell comprising at least one artificial chromosome comprising at least a first and a second expressible nucleotide sequence under the control of a controllable promoter, the promoter of the first expressible nucleotide sequence being controllable independently from the promoter of the other expressible nucleotide sequence, said cell being capable of producing at least one substance, which is heterologous to the cell. By the term substance is meant any substance produced by the cell, intracellularly as well as extracellularly located substances, such as primary and secondary metabolites, proteins, polypeptides, enzymes, carbohydrates, lipids, proteoglycans, poly- and oligosaccharides and ribonucleic acids. Furthermore, the cell evolved according to the invention may also be defined in relation to a functionality of the cell, such as a cell comprising at least one concatemer of individual oligonucleotide cassettes, each concatemer individually comprising an oligonucleotide sequence of the following formula in 5′→3′ direction: in-line-formulae description="In-line Formulae" end="lead"? [rs 2 -SP-PR-X-TR-SP-rs 1 ] n . in-line-formulae description="In-line Formulae" end="tail"? wherein rs 1 and rs 2 together denote a restriction site, SP denotes a spacer of at least two nucleotide bases, PR denotes a promoter, capable of functioning in the cell, X denotes an expressible nucleotide sequence, TR denotes a terminator, and wherein n≧2, wherein rs 1 -rs 2 in at least two cassettes is recognised by the same restriction enzyme, and said cell being capable of metabolising at least one compound, which is not metabolisable by the native cell. In another aspect the cell may be defined as a cell comprising at least one artificial chromosome comprising at least a first and a second expressible nucleotide sequence under the control of a controllable promoter, the promoter of the first expressible nucleotide sequence being controllable independently from the promoter of the other expressible nucleotide sequence, said cell being capable of metabolising at least one compound, which is not metabolisable by the native cell. Due to the evolutionary pressure placed on the cells by means of subjecting the cells to a series of selection rounds or cycles, progressively selecting for the screening functionality, it is possible to evolve cells having the desired property or functionality. |
Method and apparatus for managing publication and sharing of data |
A first user is generally designated as being eligible to operate as a publisher of data publications. The first user specifically defines a first data publication. A second user is generally designated as being eligible to operate as a contributor of data to data publications. The first user specifically authorizes the second user to contribute data to the first data publication. The first and/or the second user contribute data to the first data publication. A third user is generally designated as being eligible to operate as a subscriber of data publications. The first data publication is generally offered to a plurality of users including the third user. The third user specifically subscribes the first data publication, thereby sharing data of the first and/or second user. The users may be of the same or different organizations, thereby allowing the data sharing to be intra as well as extra-organization |
1. In an apparatus, a machine implemented method of operation to facilitate data sharing, the method comprising: facilitating general designation of a first user as being eligible to operate as a publisher of data publications; facilitating creation of a first data publication by the first user; facilitating general designation of a second user as being eligible to operate as a contributor of data to data publications; facilitating said first user authorizing said second user to contribute data to said first data publication; facilitating contribution of data to said first data publication by at least one of said first and said second user; facilitating general designation of a third user as being eligible to operate as a subscriber of data publications; facilitating offering of said first data publication for subscription to a plurality of users including said third user; and facilitating subscription of said first data publication by said third user. 2. The machine implemented method of claim 1, wherein said facilitating of general designation of the first user to be eligible to operate as a publisher comprises faciliating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 3. The machine implemented method of claim 1, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a frequency of publication of said first publicaiton. 4. The machine implemented method of claim 1, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a topic of said first publicaiton for use to limit types of data that may be contributed to said first publication. 5. The machine implemented method of claim 1, wherein said facilitating of general designation of the second user to be eligible to operate as a contributor of data to data publications comprises faciliating an administrator having administrative authority over said second user in making said general contributor designation of said second user. 6. The machine implemented method of claim 1, wherein said facilitating of contributing of data to said first data publication by at least one of said first and said second user comprises facilitating at least one of said first and said second user in tagging data of said first/second user as being associated with said data publication. 7. The machine implemented method of claim 1, wherein said facilitating of general designation of the third user to be eligible to operate as a subscriber of data publications comprises faciliating an administrator having administrative authority over said third user in making said general subscriber designation of said third user. 8. The machine implemented method of claim 1, wherein said facilitating of offering said first data publication for subscription to a plurality of users including said third user comprises faciliating an administrator having administrative authority over said plurality of users including said third user in making said offer to said plurality of users including said third user. 9. The machine implemented method of claim 1, wherein said machine implemented method further comprises determining data said third user is authorized to access when initialing a session environment for said third user, including resolving said third user's subscription of said first data publication. 10. The machine implemented method of claim 1, wherein said third user is a user of a service consumer organization; said first user is a user of a first organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service; and said second user is a user of a second organization selected from said organization group. 11. The machine implemented method of claim 10, wherein at least two of said first, second and service consumer organizations are the same organization. 12. The machine implemented method of claim 11, wherein said second organization and said service consumer organization are the same organization, and said second and third user are the same user. 13. In an apparatus, a machine implemented method of operation to facilitate data sharing, the method comprising: facilitating general designation of a first user as being eligible to operate as a publisher of data publications; facilitating creation of a first data publication by the first user; facilitating general designation of a second user as being eligible to operate as a contributor of data to data publications; facilitating said first user authorizing said second user to contribute data to said first data publication; and facilitating contribution of data to said first data publication by at least one of said first and said second user. 14. The machine implemented method of claim 13, wherein said facilitating of general designation of the first user to be eligible to operate as a publisher comprises faciliating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 15. The machine implemented method of claim 14, wherein said administrator having administrative authority over said first user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said first user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 16. The machine implemented method of claim 13, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a frequency of publication of said first publication. 17. The machine implemented method of claim 13, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a topic of said first publication for use to limit types of data that may be contributed to said first publication. 18. The machine implemented method of claim 13, wherein said facilitating of general designation of the second user to be eligible to operate as a contributor of data to data publications comprises faciliating an administrator having administrative authority over said second user in making said general contributor designation of said second user. 19. The machine implemented method of claim 18, wherein said administrator having administrative authority over said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 20. The machine implemented method of claim 13, wherein said facilitating of contributing of data to said first data publication by at least one of said first and said second user comprises facilitating at least one of said first and said second user in tagging data of said first/second user as being associated with said data publication. 21. The machine implemented method of claim 13 wherein said first user is a user of a first organization selected from an organization group comprising at least a service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service; and said second user is a user of a second organization selected from said organization group. 22. The machine implemented method of claim 21, wherein said first and second organizations are the same organization. 23. In an apparatus, a machine implemented method of operation to facilitate data sharing, the method comprising: facilitating general designation of a first user as being eligible to operate as a publisher of data publications; facilitating creation of a first data publication by the first user; facilitating general designation of a second user as being eligible to operate as a subscriber of data publications; facilitating offering of said first data publication for subscription to a plurality of users including said second user; and facilitating subscription of said first data publication by said second user. 24. The machine implemented method of claim 23, wherein said facilitating of general designation of the first user to be eligible to operate as a publisher comprises facilitating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 25. The machine implemented method of claim 24, wherein said administrator having administrative authority over said first user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said first user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 26. The machine implemented method of claim 23, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a frequency of publication of said first publication. 27. The machine implemented method of claim 23, wherein said facilitating of said first user in creating said first data publication comprises facilitating said first user in defining a topic of said first publication for use to limit types of data that may be contributed to said first publication. 28. The machine implemented method of claim 23, wherein said facilitating of general designation of the second user to be eligible to operate as a subscriber of data publications comprises facilitating an administrator having administrative authority over said second user in making said general subscriber designation of said second user. 29. The machine implemented method of claim 28, wherein said administrator having administrative authority over said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 30. The machine implemented method of claim 23, wherein said facilitating of offering said first data publication for subscription to a plurality of users including said second user comprises faciliating an administrator having administrative authority over said plurality of users including said second user in making said offer to said plurality of users including said second user. 31. The machine implemented method of claim 23, wherein said administrator having administrative authority over said plurality of users including said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said plurality of users including said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 32. The machine implemented method of claim 23, wherein said machine implemented method further comprises determining data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 33. The machine implemented method of claim 23, wherein said machine implemented method further comprises determining data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 34. The machine implemented method of claim 23 wherein said second user is a user of a service consumer organization; and said first user is a user of an organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service. 35. In an apparatus, a machine implemented method of operation to facilitate data sharing, the method comprising: facilitating general designation of a first user as being eligible to operate as a contributor of data to data publications; facilitating contribution of data to a first data publication by at said first user; facilitating general designation of a second user as being eligible to operate as a subscriber of data publications; facilitating offering of said first data publication for subscription to a plurality of users including said second user; and facilitating subscription of said first data publication by said second user. 36. The machine implemented method of claim 35, wherein said facilitating of general designation of the first user to be eligible to operate as a contributor of data to data publications comprises facilitating an administrator having administrative authority over said first user in making said general contributor designation of said second user. 37. The machine implemented method of claim 36, wherein said administrator having administrative authority over said first user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said first user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 38. The machine implemented method of claim 35, wherein said facilitating of contributing of data to said first data publication by said first user comprises facilitating said first user in tagging data of said first user as being associated with said data publication. 39. The machine implemented method of claim 35, wherein said facilitating of general designation of the second user to be eligible to operate as a subscriber of data publications comprises facilitating an administrator having administrative authority over said second user in making said general subscriber designation of said second user. 40. The machine implemented method of claim 39, wherein said administrator having administrative authority over said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 41. The machine implemented method of claim 35, wherein said facilitating of offering said first data publication for subscription to a plurality of users including said second user comprises faciliating an administrator having administrative authority over said plurality of users including said second user in making said offer to said plurality of users including said second user. 42. The machine implemented method of claim 41, wherein said administrator having administrative authority over said plurality of users including said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said plurality of users including said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 43. The machine implemented method of claim 35, wherein said machine implemented method further comprises determining data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 44. The machine implemented method of claim 35 wherein said second user is a user of a service consumer organization; and said first user is a user of an organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service. 45. The machine implemented method of claim 44, wherein said first user's organization and said service consumer organization are the same organization, and said first and second users are the same user. 46. In an apparatus, a machine implemented method of operation to facilitate data sharing, the method comprising: facilitating definition of a replication item, by a first user, including identification of constituting data objects of the replication item; facilitating submission of a replication request, from the first user, to replicate the replication item for one or more second users; offering corresponding replicated copies of the replication item for the one or more second users; and providing corresponding replicated copies of the replication item, as the replication item stood at the time the offer was made, for the one or more second users who accept the offer. 47. The machine implemented method of claim 46, wherein the method further comprises serializing instances of the constituting data objects. 48. The machine implemented method of claim 46, wherein the method further comprises tracking a number of times offers of the replication item were accepted. 49. The machine implemented method of claim 46, wherein the method further comprises tracking a number of times offers of the replication item were rejected. 50. The machine implemented method of claim 46, wherein said first user is a user of a service provider organization, and said one or more second users are users of one or more service consumer organizations licensing application services from said service provider organization. 51. An apparatus comprising: storage medium having stored therein a plurality of programming instructions designed to enable the apparatus to facilitate general designation of a first user as being eligible to operate as a publisher of data publications; facilitate creation of a first data publication by the first user; facilitate general designation of a second user as being eligible to operate as a contributor of data to data publications; facilitate said first user authorizing said second user to contribute data to said first data publication; facilitate contribution of data to said first data publication by at least one of said first and said second user; facilitate general designation of a third user as being eligible to operate as a subscriber of data publications; facilitate offering of said first data publication for subscription to a plurality of users including said third user; and facilitate subscription of said first data publication by said third user; and at least one processor coupled to the storage medium to execute said programming instructions. 52. The apparatus of claim 51, wherein said programming instructions enable the apparatus to perform said facilitating of general designation of the first user to be eligible to operate as a publisher by faciliating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 53. The apparatus of claim 51, wherein said programming instructions enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a frequency of publication of said first publicaiton. 54. The apparatus of claim 51, wherein said programming instructions enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a topic of said first publicaiton for use to limit types of data that may be contributed to said first publication. 55. The apparatus of claim 51, wherein said programming instructions enable the apparatus to perform said facilitating of general designation of the second user to be eligible to operate as a contributor of data to data publications by faciliating an administrator having administrative authority over said second user in making said general contributor designation of said second user. 56. The apparatus of claim 51, wherein said programming instructions enable the apparatus to perform said facilitating of contributing of data to said first data publication by at least one of said first and said second user by facilitating at least one of said first and said second user in tagging data of said first/second user as being associated with said data publication. 57. The apparatus of claim 51, wherein said facilitating of general designation of the third user to be eligible to operate as a subscriber of data publications by faciliating an administrator having administrative authority over said third user in making said general subscriber designation of said third user. 58. The apparatus of claim 51, wherein said facilitating of offering said first data publication for subscription to a plurality of users including said third user by faciliating an administrator having administrative authority over said plurality of users including said third user in making said offer to said plurality of users including said third user. 59. The apparatus of claim 51, wherein said programming instructions further enable the apparatus to determine data said third user is authorized to access when initialing a session environment for said third user, including resolving said third user's subscription of said first data publication. 60. The apparatus of claim 1, wherein said third user is a user of a service consumer organization; said first user is a user of a first organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service; and said second user is a user of a second organization selected from said organization group. 61. An apparatus comprising: storage medium having stored therein a plurality of programming instructions designed to enable the apparatus to facilitate general designation of a first user as being eligible to operate as a publisher of data publications; facilitate creation of a first data publication by the first user; facilitate general designation of a second user as being eligible to operate as a contributor of data to data publications; facilitate said first user authorizing said second user to contribute data to said first data publication; and facilitate contribution of data to said first data publication by at least one of said first and said second user; and at least one processor coupled to the storage medium to execute said programming instructions. 62. The apparatus of claim 61, wherein said programming instructions enable the apparatus to perform said facilitating of general designation of the first user to be eligible to operate as a publisher by faciliating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 63. The apparatus of claim 61, wherein said programming instructions enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a frequency of publication of said first publication. 64. The apparatus of claim 61, wherein said programming instructions enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a topic of said first publication for use to limit types of data that may be contributed to said first publication. 65. The apparatus of claim 61, wherein said programming instructions enable the apparatus to perform said facilitating of general designation of the second user to be eligible to operate as a contributor of data to data publications by faciliating an administrator having administrative authority over said second user in making said general contributor designation of said second user. 66. The apparatus of claim 61, wherein said programming instructions enable the apparatus to perform said facilitating of contributing of data to said first data publication by at least one of said first and said second user by facilitating at least one of said first and said second user in tagging data of said first/second user as being associated with said data publication. 67. The apparatus of claim 13 wherein said first user is a user of a first organization selected from an organization group comprising at least a service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service; and said second user is a user of a second organization selected from said organization group. 68. An apparatus comprising: storage medium having stored therein programming instructions designed to enable the apparatus to facilitate general designation of a first user as being eligible to operate as a publisher of data publications; facilitate creation of a first data publication by the first user; facilitate general designation of a second user as being eligible to operate as a subscriber of data publications; facilitate offering of said first data publication for subscription to a plurality of users including said second user; and facilitate subscription of said first data publication by said second user; and at least one processor coupled to the storage medium to exeucte said programming instructions. 69. The apparatus of claim 68, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of general designation of the first user to be eligible to operate as a publisher by facilitating an administrator having administrative authority over said first user in making said general publisher designation of said first user. 70. The apparatus of claim 68, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a frequency of publication of said first publication. 71. The apparatus of claim 68, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of said first user in creating said first data publication by facilitating said first user in defining a topic of said first publication for use to limit types of data that may be contributed to said first publication. 72. The apparatus of claim 68, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of general designation of the second user to be eligible to operate as a subscriber of data publications by facilitating an administrator having administrative authority over said second user in making said general subscriber designation of said second user. 73. The apparatus of claim 68, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of offering said first data publication for subscription to a plurality of users including said second user by faciliating an administrator having administrative authority over said plurality of users including said second user in making said offer to said plurality of users including said second user. 74. The apparatus of claim 68, wherein said administrator having administrative authority over said plurality of users including said second user is an administrator of an organization selected from a group of organizations comprising at least a service consumer organization of which said plurality of users including said second user is a member, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware hosting said application service provided by said service provider organization. 75. The apparatus of claim 68, wherein said programming instructions are further designed to enable the apparatus to determine data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 76. The apparatus of claim 68, wherein said programming instructions are further designed to enable the apparatus to determine data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 77. The apparatus of claim 68 wherein said second user is a user of a service consumer organization; and said first user is a user of an organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service. 78. An apparatus comprising: storage medium having stored therein a plurality of programming instructions designed to enable the apparatus to facilitate general designation of a first user as being eligible to operate as a contributor of data to data publications; facilitate contribution of data to a first data publication by at said first user; facilitate general designation of a second user as being eligible to operate as a subscriber of data publications; facilitate offering of said first data publication for subscription to a plurality of users including said second user; and facilitate subscription of said first data publication by said second user; and at least one processor coupled to the storage medium to execute said programming instructions. 79. The apparatus of claim 78, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of general designation of the first user to be eligible to operate as a contributor of data to data publications by facilitating an administrator having administrative authority over said first user in making said general contributor designation of said second user. 80. The apparatus of claim 78, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of contributing of data to said first data publication by said first user by facilitating said first user in tagging data of said first user as being associated with said data publication. 81. The apparatus of claim 78, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of general designation of the second user to be eligible to operate as a subscriber of data publications by facilitating an administrator having administrative authority over said second user in making said general subscriber designation of said second user. 82. The apparatus of claim 78, wherein said programming instructions are designed to enable the apparatus to perform said facilitating of offering said first data publication for subscription to a plurality of users including said second user by faciliating an administrator having administrative authority over said plurality of users including said second user in making said offer to said plurality of users including said second user. 83. The apparatus of claim 78, wherein said programming instructions are designed to enable the apparatus to determine data said second user is authorized to access when initialing a session environment for said second user, including resolving said second user's subscription of said first data publication. 84. The apparatus of claim 78 wherein said second user is a user of a service consumer organization; and said first user is a user of an organization selected from an organization group comprising at least said service consumer organization, a service provider organization providing application service to said service consumer organization, and a service operator organization operating hardware that hosts said application service. 85. An apparatus comprising: a storage medium having stored therein a plurality of programming instructions designed to enable the apparatus to facilitate definition of a replication item, by a first user, including identification of constituting data objects of the replication item; facilitate submission of a replication request, from the first user, to replicate the replication item for one or more second users; offer corresponding replicated copies of the replication item for the one or more second users; and provide corresponding replicated copies of the replication item, as the replication item stood at the time the offer was made, for the one or more second users who accept the offer; and at least one processor coupled to the storage medium to execute the programming instructions. 86. The apparatus of claim 85, wherein said programming instructions are further designed to enable the apparatus to serialize instances of the constituting data objects. 87. The apparatus of claim 85, wherein said programming instructions are further designed to enable the apparatus to track a number of times offers of the replication item were accepted. 88. The apparatus of claim 85, wherein said programming instructions are further designed to enable the apparatus to track a number of times offers of the replication item were rejected. 89. The apparatus of claim 85, wherein said first user is a user of a service provider organization, and said one or more second users are users of one or more service consumer organizations licensing application services from said service provider organization. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The present invention relates to the field of electronic data/information processing. More specifically, the present invention relates to methods and apparatuses for managing contribution to and usage of shared data. 2. Background Information Typically, user access to applications and data are controlled through user logons and user profiles administered by system administrators. Users are required to logon to individual application and/or file servers. Once logged on to an application/file server, a user's access authority to applications and/or data on the server is governed by the user's profile created and maintained by a system administrator. For example, if a system administrator has classified the user as a privileged user, as opposed to an unprivileged user, the control software of the server (e.g. the file subsystem, or the operating system itself) allows the user certain creation or deletion authority otherwise not available to other users classified as unprivileged users. On file servers, individual users may exercise further control or protection by e.g. password protecting or encrypting their own data, and controlling effective access and/or usage of these further protected data by controlling the distribution and sharing of the passwords and/or decryption keys. With the advance of telecommunication and networking technology, and the availability of public data networks, such as the Internet, increasingly users are “interconnected” together, and applications as well as data need to be shared in a controlled manner among a very large set of user population with very different access needs. These earlier described log-on and system administrator administered user profile based prior art approaches are no longer able to provide the control with the desired flexibility and ease of administration. The problem is further compounded with function rich applications or hosted applications (commonly known as application services), such as the financial applications or application services available from FinancialCAD of Surrey, Canada, assignee of the present application, where user accesses and licensing are flexibly administered at a function offering or service level. Thus, a new approach to managing and administering contribution to and usage of shared data is desired. |
<SOH> BRIEF DESCRIPTION OF DRAWINGS <EOH>The present invention will be described by way of exemplary embodiments, but not limitations, illustrated in the accompanying drawings in which like references denote similar elements, and in which: FIG. 1 illustrates an overview of the present invention, in accordance with one embodiment; FIGS. 2 a - 2 d illustrate the relationships between the various entities of the present invention, including the relationships between the different types of organizations, the account creation and administration method of the present invention, and data sharing through publications and subscriptions, and data replication, in accordance with one embodiment; FIGS. 3 a - 3 b illustrate a data organization of the administrator/user account creation and management tool, in accordance with one embodiment; FIGS. 3 c - 3 d illustrate properties and methods of a component object under the present invention, in particular, the security attribute, in accordance with one embodiment; FIGS. 3 e - 3 f illustrate an alternative approach to data organization and security, in accordance with one embodiment; FIG. 4 illustrates an end user interface of the account creation and management tool, in accordance with one embodiment; FIG. 5 illustrates the relevant operational flow of the account creation and management tool, in accordance with one embodiment; FIG. 6 illustrates a function offering/service creation and authorizing method of the present invention, in accordance with one embodiment; FIGS. 7 a - 7 b illustrate a data organization of the function offering/service creation and management tool, in accordance with one embodiment; FIGS. 8 a - 8 d illustrate an end user interface of the function offering/service creation and management tool, in accordance with one embodiment; FIGS. 9 a - 9 d illustrate the relevant operational flows of the function offering/service creation and management tool, in accordance with one embodiment; FIG. 10 illustrates an overview of the function offering/service execution method of the present invention, in accordance with one embodiment; FIG. 11 illustrates the relevant operational flow of the runtime controller of FIG. 10 , in accordance with one embodiment; FIG. 12 illustrates a network environment suitable for practicing the present invention, in accordance with one embodiment; and FIG. 13 illustrates an example computer system suitable for use as one of the administrator/user computer of FIG. 12 to practice the present invention, in accordance with one embodiment. detailed-description description="Detailed Description" end="lead"? |
Interactive system for enabling tv shopping |
An improved interactive system for enabling TV shopping and similar purposes from a central provider by remote customers without the customers having to leave their remote locations. The system has a complex interactive network of co-operating elements, comprising two network distribution means enabling video and audio communications to be established between the customers and the central provider further including video network exchanges, advisors computers and presentation computers at the central provider, extensions to the web-server of the video-enabled network, and gateway processors/computers. The system provides significant performance improvements over known systems, for example in making the advisor's job in giving a presentation easy, offering different connection methods, allowing for multiple advisors/merchants to be connected to a particular customer, allowing multiple networks to be connected to each advisor/merchant and dealing with unexpected closing the calls. The system is not limited in its application to TV home shopping, for example it finds utility for various applications where the management of customer-advisor relationships is involved. |
1. An interactive system for enabling TV shopping from a central provider to remote customers, said system comprising: two network distribution means enabling video and audio communications to be established between the remote customers and the central provider: (a) one enabling customer telephone communications with the central provider to be routed to particular advisor workstations of the central provider, there being a plurality of such workstations, and (b) one enabling outgoing audio and video communications from the plurality of advisor workstations to be routed to the respective customers from whom the incoming telephone communications are received; means enabling advisors working at said workstations to communicate interactively with the customers and provide images including images of said advisors to the customers to be viewed on the customers' VDUs; means enabling the advisors and the customers to effect transactions; and means enabling any one of said customers to initiate a video connection further comprising transmitting means for sending a video-link request signal via interactive input system means allowing the VDU's video session data of a particular customer telephone caller to be communicated to the central provider. 2. An interactive system as claimed in claim 1, wherein said interactive input system means comprises an on-screen menu system. 3. An interactive system as claimed in claim 1, wherein said interactive input system means comprises a computer keyboard. 4. An interactive system as claimed in claim 1, wherein said interactive input system means comprises control keypad means, a remote control keypad for example. 5. An interactive system as claimed in claim 1, further comprising video-enabled network means for enabling said outgoing audio and video communications to be routed to said remote customers. 6. An interactive system as claimed in claim 1, wherein said video session data are communicated to the central provider by means of any one of said customers providing a predetermined code to one of the advisors at the central provider. 7. An interactive system as claimed in claim 6, wherein said code is generated by the particular customer's VDU screen and/or relayed to customers as an audio signal. 8. An interactive system as claimed in claim 7, wherein the communications associated with said code comprise audio communications between said particular customer and said one of the advisors. 9. An interactive system as claimed in claim 7, wherein said video session data are communicated to the central provider by means of the particular customer telephone caller providing a predetermined code into the telephone input means, the telephone keypad for example. 10. An interactive system as claimed in claim 9, wherein said code is provided for transmission to automated system means at the central provider. 11. An interactive system as claimed in claim 9, wherein said images comprise live video images of the advisors at the central provider. 12. An interactive system as claimed in claim 9, wherein said customers' VDUs are provided with decoder means at the respective remote customers' locations. 13. An interactive system as claimed in claim 12, wherein said decoder means is an addressable set-top box. 14. An interactive system as claimed in claim 12, wherein said decoder means is arranged to selectively unencrypt encrypted data transmissions which are intended for viewing only on said customers' VDUs. 15. An interactive system as claimed in claim 12, further comprising computer network means at the central provider having video/audio data presentation means and data compression and/or encryption means associated therewith. 16. An interactive system as claimed in claim 15, wherein said computer network means comprises an interactive network of a multiplicity of computers, personal computers (PCs) for example, at the central provider including (a) controllable computer means for the advisors, advisor personal computers (APCs) for example, (b) presentation computer means, presentation PCs for example, providing video/audio data presentation on a local network and (c) compression means enabling the data to be compressed for transmission to the remote customers. 17. An interactive system as claimed in claim 16, wherein the presentation PCs are operable in dependence upon the operation of the advisor personal computers (APCs). 18. An interactive system as claimed in claim 16, wherein any one of said presentation PCs is controllable by any one of said advisor personal computers (APCs). 19. An interactive system as claimed in claim 16, wherein the advisor personal computers (APCs) are adapted and arranged to provide live video and audio feed connection from said particular advisor workstations to said presentation PCs in the network. 20. An interactive system as claimed in claim 19, wherein said connection is established via video/audio switch network means, thereby enabling a transfer of video sessions between the advisors. 21. An interactive system as claimed in claim 16, wherein the advisor PCs and/or presentation PCs are provided with control software means enabling the manipulation by advisors and the processing of data for transmission to the remote customers. 22. An interactive system as claimed in claim 16, further comprising feedback screen means provided at a window on a particular advisor personal computer (APC), enabling image representations presented to a customer to be presented to a particular advisor. 23. An interactive system as claimed in claim 16, further comprising gateway processing means for communicating data between the local network at the central provider and the customers. 24. An interactive system as claimed in claim 23, wherein the data communicated between the advisors and the customers are indicative of the operational status of said network distribution means including the operational status of said interactive input system means when in use. 25. An interactive system as claimed in claim 23, wherein said gateway processing means are arranged to be connected to video network exchange means permitting one or more video networks to be connected to one or more of the advisors workstations of the central provider. 26. An interactive system as claimed in claim 25, wherein said advisor workstations are positioned at various locations in one or more call center subsystems of said central provider. 27. An interactive system as claimed in claim 23, further comprising communication means for providing a facility for maintaining a heartbeat of communications between said gateway processing means and the customer's VDUs enabling connection failures in the system to be detected. 28. An interactive system as claimed in claim 23, further comprising two-way communication means with associated server computer means enabling data to be provided to the remote customers. 29. An interactive system as claimed in claim 28, wherein the two-way communication facility is provided by the interactive input system means, for example by provision of VDU on-screen menu system means. 30. An interactive system as claimed in claim 28, wherein the data are provided to the customers in a web-page format. 31. An interactive system as claimed in claim 28, further comprising transfer means permitting interactive interrogation of any one of said customers by said server computer means upon completion of an interactive communication session between the particular customer and one of the advisors. 32. An interactive system as claimed in claim 28, further comprising means enabling any one of the customers to view particular video representations on a customer's VDU, via video-enabled network means, for example upon completion of an interactive communication session between the particular customer and one of said advisors. 33. An interactive system as claimed in claim 28, further comprising means for providing a phone-back facility whereupon any one of the customers is able to provide telephone number-related information to the central provider and any one of said advisors is subsequently enabled to phone back the particular customer. 34. An interactive system as claimed in claim 28, further comprising automated means for providing interactive communications between the advisors and the customers. 35. An interactive system as claimed in claim 34, wherein said automated means is operable in dependence upon the input of information by any one of said customers enabling information input by a particular customer, into the telephone key pad for example, to be conveyed back to said particular customer in audio-form. 36. (Cancelled) |
<SOH> BACKGROUND OF THE INVENTION <EOH>Many organisation today operate ‘call centres’ for sales and other purposes. These are real or virtual sales centres to which customer telephone calls are routed. After accessing a manned or automated ‘front office’ function customers are connected to the next available advisor appropriate to their problem. A powerful addition to this trading concept is a call centre which has the additional capacity to present images (‘video’) to the customer via a television or computer display screen. As the skilled man in the art is aware, the ‘visual display unit’ or ‘video display unit’, VDU for short, is applied to both television and computer display screens. A call centre with a video capability is dubbed a ‘video call centre’ or just ‘video centre’. A video centre must be connected to the customer via a network, which may include both cable and radio-wave signals and has an enhanced capability relative to the telephone network; this might be dubbed a ‘video-enabled network’. The customer's VDU typically comprises a television set linked to a ‘set-top box’ which converts data from a cable or radio-wave signal into a television video format, or may comprise a computer with a ‘modem’ which converts data from a cable or radio-wave signal into a computer format. Note however that many VDUs incorporate integrally a ‘set-top box’ function and that many computers incorporate integrally a modem function. A remote control keypad unit linked to the set-top box or a computer keyboard allows the customer to communicate commands to the network. A customer typically activates the connection with the video-enabled network by pressing a button on the VDU remote control or operating a mouse or cursor control on an on-screen menu, this action sending a ‘video link request’ command to the video centre. UK Patent Application No. 9817829.6 (Nisaba Group Ltd.), see FIG. 1 for example, describes a video call centre system with co-operating video-enabled and telephone networks which allow a plurality of sales advisors each to communicate with their customer via that customer's telephone and that customer's VDU. In such systems, 2-way audio communication and a one-way video link (a ‘video session’) is established between customer and an advisor at the video centre who can send video and audio data to the customer, including a live video image of their advisor. Known systems in the relevant field are, however, subject to various drawbacks. First, in known systems there are sometimes problems in relating a customer's telephone call to that customer's video session. The switching of the advisor onto the customer's video line can be uncertain and transfer of calls between agents can also present difficulties. The identification of the customer's set-top box is not always possible and in some networks it is difficult to reconcile customer's phone numbers and STB numbers. Second, while known systems make mention of the fact that communications can be initiated by the customer sending a request, for example via the on-screen menu, such systems do not describe different detailed methods for initiating a video session. Third, in known video centre systems, the advisor is essentially conducting a live multimedia presentation to the customer, which is a difficult process using standard presentation software on a personal computer (PC). Known systems also do not make sophisticated provision for correct handling of uncontrolled shut-down of a session, due for example to a customer closing the link unexpectedly. Further, known systems do not provide for phone-back services, where the customer types his/her phone number into the remote control, computer keyboard or telephone keypad and then the merchant calls back on that telephone number. The present invention aims to overcome or substantially reduce at least some of the above discussed drawbacks. |
<SOH> OBJECTS AND SUMMARY OF THE INVENTION <EOH>It is the principal object of the invention to provide an interactive system for home shopping and similar purposes which is versatile and considerably improved in terms of practical capability over the system of UK Patent Application No. 9817829.6 (Nisaba Group Ltd.) and over other known systems. In broad terms, the present invention resides in the concept of providing an improved interactive system having a complex interactive network of co-operating elements, including video network exchanges, advisors computers and presentation computers at the video centre, extensions to the web-server of the video-enabled network, and gateway processors/computers. The system of the present invention provides significant performance improvements over known systems when used for home shopping, for example, by making the sales advisor's job in giving a presentation easy, in offering different connection methods, in allowing for multiple merchants to be connected to a customer, in allowing multiple networks to be connected to each merchant and in dealing with unexpected closing of calls. According to the present invention there is provided an interactive system for enabling TV shopping from a central provider to remote customers, said system comprising: two network distribution means enabling video and audio communications to be established between the remote customers and the central provider: (a) one enabling customer telephone communications with the central provider to be routed to particular advisor workstations of the central provider, there being a plurality of such workstations, and (b) one enabling outgoing audio and video communications from the plurality of advisor workstations to be routed to the respective customers from whom the incoming telephone communications are received; means enabling advisors working at said workstations to communicate interactively with the customers and provide images including images of said advisors to the customers to be viewed on the customers' VDUs; means enabling the advisors and the customers to effect transactions; and means enabling any one of said customers to initiate a video connection further comprising transmitting means for sending a video-link request signal via interactive input system means allowing the VDU's video session data of a particular customer telephone caller to be communicated to the central provider. The system of the invention conveniently allows a home shopping function to be implemented on an interactive cable TV (CATV) network designed for video on demand (VOD) and other interactive TV services, increasing the network loading and increasing its commercial viability. Further, in accordance with an exemplary embodiment of the invention, the interactive input system means of the interactive system may be embodied as an on-screen menu system, computer keyboard and/or remote control keypad. Advantageously, the interactive system may employ a video-enabled network to transmit both audio and video from advisor to customer. The video-enabled network may utilise any of the established standard protocols (IP, ATM, DVB, MPEG, ADSL, etc.) so as to transfer data. Conveniently, the sales advisor in a video centre is equipped with a personal computer (PC) (advisor PC or APC) which is connected by a network to another PC (presentation PC or PPC) which produces a multimedia presentation to the customer, the video centre being connected to a gateway processor/computer which communicates with a web-server which serves the set-top boxes of a video-enabled network. In this connection, the gateway processor/computer component serves to communicate data between the advisors/merchants and the customers including for example the kind of data indicative of which on-screen menu icon/input key is to be operated by the customer, and which set-up box number (STB#) from customer to particular merchant/advisor video call centre is to be communicated with. Therefore, by virtue of such means for communicating with the STB to obtain STB# and merchant/advisor identity, it is possible to correctly route call through to head end and to the particular merchant/advisor video call centre. In one embodiment, the correct connection of the advisor to the customer's telephone and the advisor to the correct presentation PC is achieved by means of the customer reading aloud or otherwise relaying an on-screen video or audible identifier generated by the PPC to the advisor or a front office advisor or a front office IVR system. In another embodiment, the correct telephone connection of the advisor to the customer's telephone and the advisor to the correct presentation PC is set up automatically, the PPC sending an image including a telephone number and identifier which the customer can dial on his or her telephone, the telephone number connecting the customer to the video centre and the identifier forwarding the customer's call to an advisor who can be connected to the correct PPC. Conveniently, the correct telephone connection of the advisor to the customer's telephone is achieved by the customer dialling a telephone number with extra digits which operates a direct dial in (DDI) function in the video centre branch telephone exchange (PABX). Note also that images sent to customers may advantageously include live video images of advisors. Preferably, the audio and video communications from the plurality of advisor workstations are enabled to be routed to the customers' VDUs by means of set-top boxes or equivalent which are addressable. Also, the audio and video communications from the plurality of advisor workstations may be conveniently enabled to be routed to the customers' VDUs by means of set-top boxes or equivalent which are adapted only to unencrypt transmissions which are encrypted and intended for viewing only on those particular set-top boxes. Note, however that while it is preferred to use separate APCs and PPCs in the system of the invention it is possible to instead use just a single APC for each advisor, each APC having a built-in PPC function. According to another embodiment, the advisor is able to control the presentation to the customer with his own APC, with the presentation actually being outputted in final form by the PPC, this expediting the potentially difficult process of offering a live multimedia presentation (including a live advisor image) to the customer because additional control and cursor features may appear on the advisor's display screen which do not appear as distractions on the customer's screen. In another embodiment a number of APCs and PPCs are advantageously connected together via two parallel local networks, one for advisor live video/audio and one for control data, at the video centre in the system of the invention (as shown for example in FIG. 2 hereinafter), allowing arbitrary connection of advisors to customers, and allowing simple transfer of video calls between advisors. In another embodiment, there is control software on the APC and software on the PPC which together allow the manipulation of data by advisors and the processing of data for transmission to the customer, and more particularly, allows the advisor to ‘drag and drop’ images including live images and audio and present graphical and alphanumeric data to the customer's VDU ergonomically. In another embodiment of the invention the web-server of the CATV network communicates with a gateway processor/computer which controls a routing of video communications from the video centres to the head end of the CATV network via the ATM switch, and sends session data like the STB number to the correct merchant's video centre. In another embodiment, a video centre network exchange is attached to each network gateway computer allowing the connection of multiple networks to multiple merchants, networks with different transmission standards (IP, AIM, MPEG, ADSL etc.) being capable of being connected to a particular video centre. In another embodiment, data coming from the video centre network exchange as described hereinafter is handled by a video centre exchange and passed on to the local network of APCs and PPCs, this video centre exchange also optionally communicating with a PABX in the video centre. In another embodiment, a ‘heartbeat’ of regular communications is advantageously maintained between gateway processing means (computer) and the customers VDU set-top box, allowing the rapid automatic detection of any unexpected session closure, such as a network failure or sudden customer log-off. In another embodiment, the customer's set-top box or equivalent communicates with a web-server on the CATV network which can give initial information, such as a merchant's web-page, before connection of the customer to a merchant's video centre, this immediate communication reassuring the customer of correct connection, and allowing initial information to be communicated to the customer. In another embodiment, after the live video session with a sales advisor has ended, a video advertisement may be offered, or alternatively a questionnaire session may be provided to the customer. Advantageously, the system of the invention may include a phone-back facility in which the customer may leave a telephone number, using his telephone keypad to transmit the data, and enabling an advisor or other person at the video centre to call him back on. Also, the system of the invention may conveniently include equipment providing automation of some or all elements of the front office function using the customer's telephone keypad and audio feed back of instructions to the customer, such equipment being a version of interactive voice response (IVR) equipment. In another embodiment, routing of phone calls for people with a video connection is arranged down a different trunk to those ringing the standard call centre telephone number (e.g. a national contact number); this conveniently avoids leaving customers with a video connection not being able to secure an audio link to the advisor due to traffic congestion on the telephone network. Further it is to be appreciated that multiple set-top boxes (or equivalent) may be enabled to receive the video from the advisor's PPC, and multiple advisors' APCs may be patched into 1 PPC and a ‘conference call’ mode may be initiated with the telephone system, allowing situations like video auctions and video education to be accommodated. The system of the invention therefore provides a considerably improved interactive process for TV shopping by way of interactive communication between remote customers and advisor workstations (staffed by advisors) of the central provider. The system can be implemented at reasonable cost and finds utility for various applications where the management of customer-advisor/merchant relationships is involved. |
Polynucleotides for use as tags and tag complements, manufacture and use thereof |
A family of minimally cross-hybridizing nucleotide sequences, methods of use, etc. A specific family of 1168 24mers is described. |
1. A composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a following group of sequences, 1 1 1 3 2 3 2 3 2 1 2 1 2 3 2 2 1 3 1 1 1 3 2 1 1 2 2 1 1 3 2 2 1 2 3 2 3 2 2 2 1 2 3 2 3 2 2 3 2 2 2 3 1 1 3 1 1 3 2 3 2 2 2 3 2 1 2 2 1 2 3 2 2 3 2 2 1 1 3 1 1 3 2 2 2 1 3 2 2 1 1 1 3 2 2 3 2 2 2 1 1 3 2 1 2 1 1 3 1 2 2 3 2 3 2 3 1 3 1 2 1 3 1 2 1 2 2 2 3 1 2 1 3 1 2 1 3 1 1 3 1 1 1 3 1 2 2 2 1 3 1 3 2 2 3 2 1 1 3 1 1 3 1 2 1 2 2 3 3 1 3 1 1 1 2 2 3 2 1 1 2 2 3 2 2 1 3 1 3 2 1 2 3 1 1 3 2 1 2 1 2 3 2 2 1 1 3 1 2 3 2 1 1 2 1 3 1 1 2 1 2 2 3 1 1 3 1 2 3 2 1 3 2 3 1 3 2 2 1 2 3 1 3 2 2 2 1 3 1 1 1 2 3 1 2 1 1 1 3 1 1 2 2 3 2 1 1 3 1 1 1 2 3 1 3 2 2 1 2 1 2 3 2 2 3 1 3 1 2 2 3 1 2 1 2 1 1 3 1 1 3 2 2 3 2 3 1 2 1 1 3 2 1 1 3 2 3 2 2 2 1 1 2 3 2 1 1 3 1 3 1 1 2 3 1 1 3 2 2 3 2 3 1 3 1 1 2 2 1 3 1 1 1 2 1 3 2 1 2 1 2 2 2 1 3 2 2 2 3 1 2 3 2 3 2 2 2 1 2 3 1 3 1 2 3 2 1 1 2 2 3 1 1 1 3 2 1 2 3 1 3 2 1 3 2 1 1 2 2 1 3 2 2 3 1 1 2 1 1 3 1 2 2 3 1 3 1 3 1 1 1 2 2 2 1 1 3 2 3 1 1 3 2 3 2 2 3 2 2 2 1 2 2 3 1 1 1 2 2 3 1 2 2 2 3 2 2 3 1 1 1 2 1 1 3 2 3 2 2 3 2 3 1 1 2 2 3 2 2 3 1 2 1 1 3 2 2 1 2 3 1 1 3 1 3 2 2 2 3 2 2 1 2 2 3 1 3 2 1 1 3 2 2 3 1 1 2 2 2 3 1 2 2 2 1 3 2 1 2 3 2 1 2 2 1 3 1 3 2 2 3 1 2 1 1 1 2 1 3 1 3 1 2 3 1 3 1 1 2 1 1 3 1 1 1 3 1 3 1 1 2 3 2 2 1 2 1 2 3 2 1 3 1 3 1 1 1 2 2 3 1 2 2 2 1 2 3 2 1 3 2 2 3 1 3 1 3 2 3 1 2 1 1 1 3 2 1 1 1 3 1 2 1 3 2 2 2 3 1 3 2 1 1 2 2 2 3 1 3 1 1 1 2 1 3 2 1 2 1 1 2 3 2 2 1 1 3 2 3 1 3 1 1 2 2 3 2 1 2 1 2 2 3 2 3 2 2 3 1 1 3 1 1 1 3 2 3 1 3 2 2 1 1 3 2 3 2 1 1 1 2 3 1 1 1 2 3 2 1 1 1 2 1 3 1 2 2 3 2 3 2 3 1 1 1 3 1 1 1 3 1 1 2 2 2 2 1 1 2 1 3 1 1 3 2 2 2 3 2 1 3 2 1 2 3 1 2 3 2 2 3 2 1 2 3 2 3 1 3 1 1 2 1 1 1 3 2 2 2 1 3 2 3 2 3 1 2 2 1 3 1 2 1 2 3 1 2 3 1 2 1 2 3 1 1 2 2 3 1 1 3 1 1 3 1 1 2 2 2 1 3 1 2 2 2 3 2 1 1 3 2 3 2 1 2 3 1 2 2 1 2 2 3 1 2 2 1 3 2 3 2 3 2 2 2 3 2 3 1 1 1 3 1 3 1 1 2 3 1 2 1 3 1 2 1 2 2 2 1 1 2 2 3 1 1 1 2 3 1 3 2 3 2 3 2 2 2 1 1 3 1 1 1 2 2 1 2 1 3 1 3 2 2 1 3 2 2 2 1 3 1 1 2 3 1 3 1 1 1 3 1 2 1 3 1 1 1 2 2 3 1 3 2 3 2 1 2 3 1 2 3 2 1 3 2 2 2 3 2 2 1 1 2 3 2 2 3 2 1 2 1 1 2 3 1 3 1 3 1 2 1 2 2 1 3 1 1 2 3 2 1 1 3 1 1 2 1 3 1 3 1 1 3 2 2 2 3 1 1 1 2 1 2 3 1 2 1 3 1 1 2 3 2 1 3 1 1 2 3 2 1 1 1 3 2 2 2 1 3 2 1 2 1 3 1 3 1 3 2 1 3 1 2 3 2 1 2 3 2 2 1 1 2 3 2 3 1 1 2 1 2 3 1 1 1 3 2 3 1 1 1 2 1 2 3 1 1 1 2 3 2 2 3 2 1 2 1 3 2 1 2 1 2 2 3 1 3 2 2 2 3 2 1 2 3 1 1 3 3 1 1 3 1 1 1 2 3 2 2 2 3 2 1 3 1 1 2 1 1 3 2 1 1 1 2 3 1 3 2 1 2 2 3 1 1 3 1 1 1 2 3 2 1 2 1 3 3 2 3 1 2 1 3 1 1 2 2 2 3 2 3 2 2 2 1 1 2 3 1 1 2 3 2 1 3 2 1 2 3 1 1 3 1 1 2 1 1 2 3 1 1 1 2 3 1 2 1 3 1 1 3 2 2 1 1 2 3 1 2 1 1 2 2 3 2 3 2 3 3 2 3 1 2 2 3 2 1 1 3 2 1 1 3 2 1 1 1 3 1 2 1 1 2 1 2 3 2 1 3 2 2 2 3 2 3 2 2 1 2 2 2 3 1 1 3 1 2 3 1 3 2 1 1 3 2 2 2 3 2 1 2 3 2 2 2 1 1 3 2 1 2 1 1 1 2 3 2 1 2 3 1 3 2 3 2 3 2 1 1 1 3 1 1 1 3 2 1 1 3 1 3 2 1 2 2 3 1 1 1 2 2 1 3 2 1 1 3 1 3 2 2 3 1 3 2 3 2 1 1 1 3 1 2 2 1 2 2 3 1 2 1 1 1 3 2 1 2 3 1 3 2 2 1 2 2 1 3 1 2 1 1 1 3 2 3 1 1 2 2 2 3 2 2 1 2 1 3 1 3 2 2 3 2 3 2 2 3 2 1 2 2 1 1 2 2 1 3 2 1 3 2 3 2 3 2 2 3 1 1 1 2 2 2 3 2 3 2 1 2 2 3 1 3 1 2 2 3 2 2 1 2 2 3 2 1 2 2 3 3 2 2 1 2 2 1 3 1 1 3 1 3 1 2 1 1 2 2 3 1 3 2 2 2 2 3 1 3 2 2 3 2 3 1 2 2 1 1 3 2 1 3 2 1 2 1 2 3 1 2 1 3 2 1 2 1 1 2 3 1 2 2 3 1 1 3 2 1 1 2 3 3 2 3 1 1 1 3 1 2 1 2 2 2 3 1 3 1 3 1 2 1 1 1 2 1 3 2 2 1 2 3 1 2 2 2 3 1 1 3 1 1 1 2 2 3 2 2 3 3 2 1 1 3 2 1 2 2 2 3 1 1 2 2 2 3 1 2 3 1 3 2 2 2 1 1 2 1 3 2 3 2 2 1 2 1 1 3 2 3 1 1 1 3 1 3 2 1 1 1 2 3 1 1 2 2 3 1 2 3 2 3 2 1 2 1 2 3 1 1 3 1 3 1 1 1 3 2 3 1 3 2 2 3 2 2 1 1 3 2 1 2 2 2 1 2 2 2 1 2 3 2 3 2 3 1 1 2 2 3 2 3 2 1 2 1 2 1 3 3 2 1 1 2 1 2 3 1 2 1 3 1 1 1 2 3 2 1 1 1 3 1 3 3 1 3 1 1 2 2 3 2 2 2 1 1 1 3 1 2 1 3 2 2 3 2 1 3 1 1 2 2 2 3 2 2 1 1 3 1 1 2 3 1 3 2 2 2 3 1 2 1 2 1 3 2 3 1 2 3 1 2 2 1 1 1 3 1 3 1 1 2 2 2 3 1 2 1 3 1 2 3 2 2 2 1 3 2 2 3 1 3 1 2 2 1 2 2 3 1 1 3 1 3 2 3 2 1 1 1 2 1 3 1 1 1 3 2 3 1 2 1 2 2 3 2 3 2 1 2 2 3 1 2 2 3 2 2 3 1 3 1 2 1 1 1 2 2 1 3 2 1 2 1 3 2 3 1 3 1 1 1 3 1 3 2 2 1 1 1 2 1 1 1 3 1 2 1 1 3 1 1 1 3 1 3 1 2 3 1 2 3 2 2 2 3 1 1 3 2 2 1 2 2 3 1 1 1 2 1 3 1 3 1 1 3 2 1 2 1 2 3 2 1 2 3 2 1 2 1 3 1 1 1 3 1 3 2 1 1 1 2 3 3 1 2 3 2 2 2 3 2 1 1 1 3 1 2 2 3 1 1 1 2 2 3 1 1 1 2 2 2 1 3 1 3 1 3 2 1 2 2 2 3 2 3 2 2 3 2 1 1 1 2 2 2 3 2 2 2 3 1 1 1 3 1 1 1 3 2 1 1 3 2 3 1 1 1 3 1 3 2 1 3 2 3 2 2 1 2 2 3 2 2 1 3 1 2 1 3 2 1 2 3 2 2 3 2 1 2 1 2 3 2 2 3 2 2 3 1 2 1 2 3 2 1 3 1 1 2 2 2 3 2 2 3 1 3 2 1 2 2 2 3 2 1 1 1 2 3 1 1 2 2 2 1 3 2 2 1 3 2 3 2 1 1 3 1 1 1 3 1 2 3 1 2 1 1 3 1 1 1 2 3 2 2 3 1 2 3 1 1 3 2 1 2 2 3 1 2 3 1 2 3 1 1 3 1 2 1 1 2 3 2 1 3 1 2 1 1 3 1 2 3 1 2 1 2 3 1 2 1 2 1 3 1 2 2 1 3 1 2 3 2 2 3 1 1 1 3 2 2 1 3 1 1 1 3 1 2 1 3 1 2 3 2 2 3 2 2 2 1 1 2 3 2 2 1 3 2 2 1 3 1 1 1 3 2 1 1 3 3 1 3 1 2 2 2 1 1 3 2 2 2 3 1 1 3 2 3 1 1 1 2 1 2 2 2 3 2 2 1 3 2 1 3 2 2 3 2 2 1 2 1 1 3 1 3 1 2 1 2 3 1 3 1 1 2 1 3 2 2 2 3 2 2 1 3 2 3 1 1 2 2 2 3 1 1 1 3 2 2 2 1 1 1 3 1 1 3 1 3 1 2 1 1 3 1 1 3 2 3 1 3 2 2 3 1 1 1 2 3 1 1 1 2 1 2 3 2 2 3 2 2 1 3 1 1 1 2 3 1 1 1 2 3 1 3 2 1 3 2 2 1 2 2 1 1 3 2 1 2 2 3 2 1 2 2 2 3 2 3 2 3 2 3 2 1 2 2 3 2 1 2 2 1 3 2 1 1 1 3 1 1 3 1 3 1 3 1 1 2 1 3 1 3 1 1 3 1 3 1 1 1 2 1 1 3 2 2 3 1 1 1 2 1 1 3 2 1 1 1 3 2 1 3 1 1 1 2 1 3 1 1 2 2 3 1 3 2 2 3 2 3 2 3 2 2 1 2 2 2 3 2 2 2 3 2 1 1 1 3 2 1 2 2 2 2 3 1 2 3 2 1 2 3 1 1 2 1 2 1 3 2 1 2 3 1 3 1 1 3 1 2 2 3 2 3 2 3 1 1 2 1 3 2 2 3 1 1 1 2 2 2 1 2 1 1 1 3 2 2 2 3 1 1 3 1 2 3 1 3 2 3 1 2 1 1 3 1 2 1 1 1 3 1 3 1 2 2 2 1 1 3 1 2 3 2 1 2 3 3 1 1 3 1 1 2 2 1 1 3 2 2 3 1 3 1 1 2 2 1 1 3 1 2 1 3 1 3 1 1 1 2 2 2 3 1 2 1 1 1 3 1 1 1 3 1 3 1 1 1 3 2 2 2 1 2 3 1 1 3 2 2 1 2 2 3 1 3 2 1 3 1 1 1 2 1 3 2 3 2 1 1 3 2 1 1 1 3 1 3 1 2 3 1 2 2 1 2 3 1 2 3 1 2 2 2 1 3 2 2 1 2 1 1 3 1 3 2 3 2 1 3 1 2 1 1 1 2 3 2 2 1 2 3 1 2 3 1 3 2 1 1 3 1 3 1 2 2 3 1 2 2 3 2 3 1 2 3 1 2 2 2 3 2 1 2 1 2 2 1 1 3 1 1 3 1 1 2 2 3 2 1 2 1 2 3 1 3 1 3 2 3 2 1 3 1 1 2 3 2 2 2 1 3 1 3 2 2 3 1 1 2 1 2 1 3 1 3 1 1 1 2 1 3 2 1 1 3 1 1 3 2 1 1 1 2 1 3 1 1 2 2 3 1 1 3 2 2 3 2 2 1 2 3 2 3 1 1 3 1 2 2 2 2 1 1 1 2 3 2 2 3 2 3 2 1 3 1 3 2 1 1 2 2 1 3 1 1 1 1 2 1 1 3 1 3 2 2 2 3 1 3 1 1 3 2 2 3 2 2 2 1 3 2 2 3 2 1 1 2 1 1 3 1 1 3 2 3 1 2 2 2 1 1 3 3 2 2 1 3 1 1 2 3 2 1 2 1 2 1 3 1 3 2 2 1 3 1 2 2 2 3 1 2 1 2 2 3 1 1 1 3 1 3 1 1 1 3 2 2 1 2 3 2 2 1 1 1 3 1 3 1 3 1 1 1 2 3 2 2 2 3 1 2 2 1 3 2 3 2 3 1 1 2 2 2 3 1 3 2 1 2 2 1 3 2 1 1 3 1 1 2 1 1 2 2 2 3 1 1 2 3 2 3 1 1 1 3 2 2 3 2 2 1 3 1 2 3 2 3 2 2 2 3 1 1 1 3 1 2 3 1 2 3 1 2 2 2 1 1 1 3 2 2 1 2 3 2 2 3 1 2 1 2 2 3 1 3 2 3 1 1 1 2 1 3 1 2 1 1 1 3 1 1 3 1 2 1 3 1 3 1 2 2 2 1 3 3 1 2 3 1 1 2 3 2 1 3 1 2 1 2 1 2 3 2 1 1 2 3 1 3 1 1 3 1 1 2 1 3 2 2 2 1 2 3 2 1 1 1 2 3 1 2 3 3 2 1 3 2 1 2 1 2 1 3 2 2 1 1 1 3 1 2 3 1 3 2 2 3 2 2 1 2 2 2 3 2 3 2 1 2 3 1 2 2 1 2 3 1 2 2 3 1 3 1 3 1 2 2 1 3 1 1 1 2 2 3 1 3 1 3 1 1 2 2 1 3 2 1 2 3 1 2 1 3 1 3 2 2 2 1 2 1 3 2 3 1 2 1 1 3 2 2 1 3 1 1 1 3 1 1 2 3 1 1 1 2 2 3 1 1 3 2 1 1 1 3 1 1 2 3 1 3 1 1 2 1 2 1 3 1 3 1 2 3 1 1 2 1 1 1 3 1 3 1 1 2 1 3 2 3 2 2 2 1 1 3 1 1 3 1 2 3 1 2 3 2 3 2 2 1 2 2 3 1 2 1 3 1 1 1 2 2 1 3 1 2 1 3 1 3 2 2 1 2 1 3 1 3 1 2 1 2 2 3 2 1 2 3 1 3 1 3 1 3 2 2 3 1 1 2 1 1 3 2 2 1 1 1 3 1 2 1 2 1 3 1 2 1 2 3 1 1 1 2 1 3 1 2 2 3 2 2 1 3 1 3 1 3 1 3 2 3 1 1 2 1 3 1 1 1 3 1 2 1 2 3 2 2 1 1 2 1 1 1 3 1 3 1 2 1 2 2 3 1 1 3 1 3 1 1 2 1 1 1 3 3 2 2 1 2 1 3 1 1 2 1 1 3 2 2 3 2 1 1 1 3 2 3 2 2 3 1 2 1 3 2 1 2 3 1 2 1 1 2 3 2 3 2 2 2 1 2 3 2 2 2 3 2 2 3 2 2 1 1 3 2 1 2 3 2 3 1 2 2 2 1 3 2 1 1 1 3 2 3 2 2 3 2 3 2 2 1 1 1 3 1 2 2 1 1 3 2 3 2 3 2 2 2 3 1 2 2 3 1 2 2 1 1 2 3 2 2 1 2 3 1 2 2 1 1 2 3 1 1 2 3 1 3 2 3 2 2 3 2 1 1 2 3 2 2 1 3 1 2 3 2 2 2 3 2 3 1 3 2 2 2 3 1 2 1 2 2 1 3 1 1 2 3 1 1 2 1 3 2 1 1 2 1 3 1 2 3 1 2 2 2 3 1 1 2 1 3 2 3 2 3 2 2 3 2 2 1 2 1 2 3 1 2 2 1 3 2 1 3 1 2 2 1 3 1 1 3 1 2 3 2 2 3 2 3 2 1 2 2 1 1 1 2 3 2 3 2 3 2 3 2 2 1 1 1 2 3 1 1 2 2 2 3 2 3 1 1 2 2 1 1 3 2 1 2 1 2 3 1 3 2 3 2 1 3 1 1 1 2 2 1 2 2 3 2 3 2 3 2 1 1 3 2 1 3 2 3 2 1 1 1 2 3 2 1 3 2 1 1 1 3 1 3 1 1 2 2 3 2 2 2 1 3 2 1 2 1 1 3 2 2 2 3 2 1 1 3 1 1 3 2 1 3 2 2 3 1 1 2 1 1 3 2 2 1 2 1 3 2 1 2 1 3 2 1 3 2 1 2 1 3 1 3 1 3 1 1 1 3 1 1 1 2 3 2 3 2 1 2 1 3 2 2 2 1 1 2 3 2 2 3 2 3 1 3 2 1 1 2 3 1 1 2 3 1 2 3 2 1 2 2 1 3 2 1 3 1 3 2 2 3 2 1 1 1 2 1 3 1 3 1 1 2 1 1 1 1 2 2 1 1 2 3 2 1 3 1 2 2 3 2 1 1 3 1 3 1 2 1 3 2 2 1 3 2 3 2 3 2 2 2 3 2 1 3 1 2 1 3 1 1 2 2 1 1 3 1 3 1 3 2 2 2 3 2 3 2 1 2 1 2 3 2 1 2 1 1 1 2 2 1 1 3 2 2 2 1 3 2 3 1 3 1 2 2 2 3 2 2 1 1 3 1 2 3 1 1 3 2 2 2 1 2 2 3 1 1 2 1 3 2 1 3 2 3 1 1 2 1 2 2 2 3 2 3 2 2 3 2 1 2 3 2 2 2 3 2 3 1 1 1 1 1 3 2 3 2 2 2 1 2 1 3 1 1 3 1 2 2 2 3 1 2 3 1 1 3 1 3 1 2 1 2 3 1 2 2 2 3 2 2 1 3 2 2 3 2 1 1 1 3 1 1 3 1 1 1 2 3 1 3 2 3 1 2 1 1 2 3 2 1 1 2 1 3 2 3 2 2 2 3 1 2 1 2 3 2 2 1 1 3 1 1 3 2 2 3 2 1 3 1 1 1 3 2 3 1 2 1 3 1 2 2 1 3 2 1 1 2 1 3 1 2 1 1 1 2 3 2 2 1 1 3 2 2 1 3 2 1 2 3 1 2 3 1 3 1 2 2 1 3 1 1 3 1 1 2 2 3 2 2 2 1 3 1 1 2 3 1 2 1 2 2 2 3 1 3 1 1 3 2 3 2 3 1 1 1 2 3 1 1 2 2 3 1 3 2 1 1 1 2 1 3 2 2 2 1 2 3 1 3 2 1 3 2 1 2 2 1 3 1 3 1 3 2 1 3 1 2 1 1 1 3 1 2 2 2 3 1 2 1 2 2 3 2 2 2 1 1 3 2 2 3 2 2 3 1 2 1 1 3 1 2 3 3 2 2 3 2 1 1 1 3 2 2 1 1 1 3 2 3 2 3 1 1 2 2 2 1 2 1 3 1 2 2 3 2 3 2 3 2 2 2 3 2 2 1 2 1 3 2 1 3 2 1 1 3 2 2 1 2 2 3 1 3 1 1 2 3 1 2 1 1 2 1 3 2 1 3 1 2 2 1 3 2 2 3 1 2 1 1 3 2 3 2 3 2 1 1 2 1 1 1 2 3 2 1 1 1 2 3 1 1 3 1 3 2 3 2 2 2 3 2 2 3 1 2 1 3 1 1 3 1 1 1 2 3 2 1 2 1 2 1 3 2 3 1 2 2 1 2 1 3 1 3 2 3 2 1 2 3 2 2 1 2 3 1 2 1 1 1 3 2 1 2 3 1 1 3 2 3 1 2 1 1 3 1 2 3 1 1 3 1 1 2 2 2 3 2 2 3 1 3 1 1 2 1 3 2 1 1 3 1 3 1 1 2 2 2 1 2 1 3 1 2 1 1 2 3 2 3 1 1 3 2 1 1 2 1 1 3 2 3 1 3 2 1 2 2 1 2 3 1 2 3 1 2 1 3 2 1 3 2 1 1 3 2 1 1 3 1 2 1 2 3 1 2 2 2 1 3 2 1 2 2 3 1 1 2 3 2 3 1 1 2 2 1 1 3 2 2 2 3 2 1 3 1 3 2 3 1 2 2 2 3 1 1 1 3 1 1 1 2 1 3 1 2 3 2 1 3 2 1 1 3 1 2 3 2 2 2 2 3 1 3 1 1 3 2 2 3 2 2 3 2 1 1 2 1 1 3 1 1 2 1 3 2 3 2 3 1 1 1 2 1 3 2 3 1 1 1 3 2 2 2 1 1 1 2 2 2 1 2 3 2 1 3 2 1 3 1 2 2 2 1 2 3 2 3 1 1 3 1 2 2 1 1 2 3 1 3 1 1 1 2 2 1 3 2 3 2 3 2 2 1 3 1 2 3 2 2 1 1 2 1 3 2 3 1 2 1 3 2 1 1 1 3 2 3 1 2 1 2 3 2 2 3 1 2 1 1 1 2 3 1 2 2 1 2 3 1 3 2 3 2 2 1 2 2 1 3 1 3 2 2 3 2 3 2 3 2 3 1 2 1 2 1 2 2 3 2 2 3 2 2 1 2 3 1 2 2 3 1 3 2 2 1 3 1 1 2 1 1 1 2 2 2 3 1 3 2 2 1 1 3 1 1 3 1 1 3 2 3 2 1 1 1 1 1 3 1 2 1 1 1 3 2 2 1 1 3 2 3 2 2 2 3 2 1 3 2 3 2 2 3 1 3 1 2 3 1 2 1 2 2 3 2 1 2 1 1 3 2 2 2 1 1 1 2 1 3 2 3 1 1 2 3 1 3 2 2 1 2 1 3 1 3 2 1 2 1 3 1 2 3 2 2 1 2 3 1 2 1 3 2 2 1 3 2 2 1 3 3 2 2 1 1 3 2 3 1 1 3 1 2 1 2 3 2 1 2 2 3 2 2 1 2 1 1 3 1 1 1 3 2 1 1 1 3 2 2 2 3 2 1 3 1 2 3 2 1 1 3 1 3 1 1 1 3 2 2 2 3 1 2 2 3 1 1 2 1 1 1 3 1 2 1 2 2 1 3 1 2 3 2 3 1 3 2 2 1 2 1 2 3 2 3 2 1 3 2 2 2 3 1 3 2 2 2 1 3 2 1 2 2 3 2 3 1 1 2 1 1 2 3 2 2 1 1 1 2 3 1 3 1 3 1 2 2 3 2 3 2 1 2 1 2 1 1 1 2 3 2 2 3 2 3 1 2 2 1 2 2 3 2 3 1 3 1 2 2 1 1 3 1 1 2 2 3 1 1 3 2 1 1 3 1 3 2 2 1 2 2 3 1 3 1 3 1 2 1 3 1 1 2 2 1 1 3 2 2 2 3 2 2 3 1 2 3 1 1 3 1 1 2 3 2 2 1 1 3 1 1 1 2 1 2 3 2 1 1 3 2 1 2 2 2 3 2 3 1 2 2 1 1 3 1 1 3 2 2 3 1 3 1 1 1 3 2 2 1 3 1 1 2 2 2 3 2 3 2 1 3 2 1 3 1 1 2 2 1 1 3 2 2 2 1 2 2 3 2 2 3 1 2 3 2 2 3 2 1 2 2 3 3 1 1 2 3 1 3 2 2 2 1 1 3 1 3 2 2 2 1 2 1 3 2 1 1 3 2 3 1 1 3 1 2 2 3 2 1 2 3 2 1 3 2 1 2 1 1 1 1 3 2 2 3 1 1 1 2 3 1 3 2 1 2 2 1 1 3 2 1 1 2 3 1 2 3 2 3 2 2 1 2 2 2 3 1 3 1 2 3 1 3 2 1 1 2 2 1 1 1 2 1 3 2 3 2 2 3 2 2 3 1 1 3 2 2 3 2 2 1 2 3 2 1 3 1 3 1 1 1 3 1 2 1 2 1 2 3 2 1 3 2 2 2 1 3 1 3 1 3 2 1 2 2 2 3 1 2 3 1 1 2 3 1 2 2 1 2 1 3 1 3 2 1 2 1 1 3 2 2 2 1 3 2 3 2 1 2 1 2 2 3 1 1 2 1 1 2 3 2 3 1 2 2 1 2 2 3 1 2 2 3 1 3 1 3 1 2 2 1 3 2 2 3 2 2 1 2 3 2 3 1 3 1 3 2 1 1 2 1 1 1 1 1 2 3 1 3 2 1 2 1 2 2 3 1 1 2 2 3 2 3 1 2 3 1 1 2 2 1 3 1 1 3 2 1 1 3 2 1 3 1 3 2 2 2 1 1 3 2 3 2 1 1 3 2 2 2 1 1 1 3 2 1 1 3 1 1 1 2 3 2 3 3 1 1 1 2 3 1 2 1 1 3 2 2 3 1 2 1 2 1 1 3 1 1 3 1 1 2 3 1 3 2 1 3 2 2 2 3 2 1 2 2 2 3 1 3 2 2 2 1 3 2 3 1 1 2 3 2 1 1 3 1 2 2 1 2 3 2 1 2 2 2 3 3 2 1 1 2 2 3 1 1 2 2 3 1 1 1 3 1 2 1 1 3 2 3 2 2 1 2 3 2 2 2 1 1 3 2 1 3 2 3 1 1 1 2 1 3 1 3 2 3 2 1 2 2 3 1 1 1 2 2 3 1 1 2 2 1 3 1 1 3 2 1 3 1 1 2 1 2 3 2 1 1 2 3 2 1 3 2 2 3 1 1 1 3 2 3 1 2 3 1 1 2 1 2 2 3 1 3 1 1 2 2 1 2 3 1 3 1 3 2 2 2 1 3 2 3 2 1 1 1 2 3 1 2 3 1 1 3 1 1 1 3 2 1 2 3 2 1 2 3 2 3 2 1 1 1 3 1 1 1 2 2 2 3 1 2 3 2 1 1 1 2 2 3 2 2 2 3 1 1 1 3 2 2 2 3 2 2 3 1 3 1 1 1 1 2 2 3 2 2 2 3 1 3 2 1 3 2 1 2 2 1 3 2 1 3 2 2 1 1 2 2 3 1 3 2 2 2 3 1 1 2 1 1 3 1 3 1 3 2 2 2 3 2 2 3 1 2 2 3 2 1 1 3 2 3 2 2 2 1 2 2 3 2 2 3 1 1 1 2 2 2 3 2 3 1 3 2 1 2 3 2 1 2 2 2 3 1 1 2 1 1 3 1 1 2 3 1 1 2 3 2 3 1 1 3 2 3 1 1 2 1 2 2 1 1 2 3 2 3 1 1 3 2 2 2 3 2 3 1 1 1 3 1 2 1 2 2 2 3 2 1 2 1 2 3 1 1 1 3 2 1 1 3 1 1 3 1 1 3 2 2 1 3 1 3 1 3 1 1 3 1 1 3 1 1 1 2 1 1 3 1 1 2 1 1 2 2 2 3 1 1 1 2 3 2 2 1 1 2 3 1 3 1 3 1 3 1 2 2 2 3 2 3 2 3 2 1 2 1 2 1 3 2 1 2 2 1 3 1 1 2 3 1 2 2 3 2 2 1 3 2 1 2 2 3 1 2 3 2 3 1 1 3 2 2 1 2 3 2 2 2 3 2 1 2 2 2 3 1 1 2 3 1 1 1 2 3 1 1 3 2 3 2 2 1 3 1 2 2 3 2 3 2 2 1 1 1 2 3 2 1 3 2 2 2 1 2 1 3 1 3 2 1 2 2 3 2 1 2 1 3 1 3 1 3 1 1 1 1 1 1 2 1 3 2 1 1 3 1 1 2 3 2 1 3 2 2 3 2 2 3 1 2 3 1 3 2 3 2 3 1 2 2 2 1 2 3 1 2 2 1 1 3 2 2 1 1 3 1 1 2 2 2 3 2 2 3 2 1 3 2 3 2 2 1 2 3 1 2 2 3 1 2 2 3 1 1 3 1 1 1 3 1 1 1 2 1 3 2 2 2 3 1 1 3 1 2 1 1 2 1 3 1 3 1 1 2 1 3 2 1 3 1 3 2 2 1 1 3 1 2 2 3 1 1 1 2 2 2 3 2 1 3 2 2 1 2 1 3 2 3 1 3 1 2 2 2 1 1 3 1 1 3 1 2 3 1 1 2 1 1 2 3 2 1 3 2 2 2 3 1 3 1 3 1 1 1 3 2 1 3 1 1 2 1 1 3 1 2 1 3 1 2 2 1 1 3 1 3 2 1 1 1 2 3 1 3 2 1 2 1 1 3 1 2 2 2 3 1 2 1 3 1 1 2 2 3 1 1 1 2 2 2 3 1 3 1 3 2 3 1 1 3 1 1 3 1 3 2 3 2 2 1 2 1 1 3 1 2 2 2 1 3 2 3 1 1 1 2 3 1 2 2 2 1 3 1 3 2 1 1 2 1 1 3 2 1 1 1 2 1 1 3 1 1 2 1 3 1 3 1 3 1 3 1 1 1 3 2 2 3 2 2 3 2 1 1 1 3 2 1 1 2 1 3 1 3 1 1 1 2 2 1 3 1 3 2 3 1 2 2 2 1 3 1 2 2 1 2 3 2 3 1 2 3 1 2 2 1 3 1 3 2 1 2 1 3 2 2 2 1 3 1 2 2 2 1 2 3 2 1 3 1 2 3 1 2 2 1 3 1 2 1 3 2 3 1 1 1 2 2 3 2 2 1 3 1 2 3 1 1 1 2 3 2 1 2 2 1 3 2 2 2 1 3 1 3 2 2 3 1 2 1 2 2 3 1 3 2 3 1 3 1 3 2 2 1 2 2 3 2 2 1 1 1 3 1 2 3 2 3 2 1 2 2 3 1 1 2 2 1 1 3 1 1 3 2 2 2 1 1 2 3 2 3 2 2 3 1 2 1 3 1 1 2 1 3 1 3 1 2 1 1 1 1 2 2 1 3 2 2 3 1 1 1 3 2 1 2 3 1 3 1 1 1 3 2 2 2 1 3 1 3 2 2 3 1 1 3 1 1 1 2 3 2 2 1 1 2 3 3 1 2 2 3 2 2 3 1 2 2 1 2 2 3 1 2 3 1 1 2 2 2 3 2 3 2 2 3 2 2 3 2 2 3 1 1 2 2 3 1 1 3 1 1 2 2 1 1 2 2 1 1 3 2 1 1 3 1 1 2 2 3 1 3 1 3 2 2 2 3 1 3 2 1 2 3 2 2 3 2 1 1 2 3 2 1 2 2 1 1 3 1 1 1 3 2 1 3 2 2 3 2 3 1 2 2 2 1 2 3 2 1 1 2 3 1 2 2 3 2 3 1 2 1 1 2 3 1 1 1 3 2 2 2 1 2 1 3 1 3 1 3 1 3 2 1 1 3 1 2 2 3 2 2 2 3 2 1 2 3 1 2 1 1 3 1 2 2 2 3 1 1 2 2 1 1 3 1 3 2 1 1 3 1 2 3 2 2 2 1 3 1 1 3 2 3 2 2 2 3 2 2 2 1 3 1 3 2 1 1 1 3 1 2 1 1 3 1 3 1 3 1 2 1 1 1 3 2 1 2 1 3 1 1 3 2 2 1 1 1 2 2 1 2 3 1 1 2 1 3 2 2 1 3 1 1 1 3 1 3 1 3 2 2 2 3 2 2 3 1 2 1 2 2 1 3 1 3 1 1 2 3 2 3 2 2 2 2 2 2 1 2 2 3 1 3 1 3 2 2 2 3 2 2 1 2 2 2 3 2 3 1 3 2 3 2 2 1 1 3 1 1 3 2 2 3 1 2 2 1 2 2 3 1 2 3 1 3 1 1 1 2 3 1 2 2 3 1 1 2 3 2 2 3 1 2 1 1 2 3 1 2 1 1 3 2 1 2 2 1 3 2 1 2 3 1 3 2 3 2 1 1 2 2 2 2 3 1 2 2 2 1 1 3 1 3 2 3 2 2 3 1 1 2 3 2 1 1 1 3 2 2 1 3 2 1 1 1 2 1 3 1 3 2 1 3 1 1 1 3 1 3 2 1 1 1 3 2 1 2 3 1 1 2 1 2 3 2 3 1 1 1 2 3 2 2 1 1 2 1 1 3 2 3 2 3 2 2 3 2 3 1 1 2 3 2 1 1 2 1 1 1 3 1 2 2 2 1 3 1 3 2 1 3 1 1 1 3 1 3 1 1 2 2 2 1 3 2 2 2 3 1 3 2 2 3 1 1 1 2 1 3 2 1 1 1 3 2 1 1 2 1 3 2 1 2 3 1 3 2 1 1 3 1 2 2 3 1 1 1 3 3 1 1 3 1 2 2 1 3 1 2 2 3 1 2 3 2 2 1 3 2 2 1 1 2 1 1 1 3 1 3 1 3 1 1 3 2 2 1 3 2 1 1 2 1 3 1 1 2 1 1 3 2 1 2 3 1 3 1 1 1 2 3 1 2 3 2 3 2 2 1 2 3 1 3 2 2 2 3 2 2 2 3 2 2 1 3 2 2 1 2 2 3 1 2 1 1 1 3 2 1 1 1 3 1 1 1 2 3 2 2 1 1 3 1 3 2 1 3 2 1 2 3 1 3 1 1 2 2 3 2 2 3 2 2 3 1 1 1 2 3 2 1 1 2 2 1 3 1 2 2 1 3 1 3 2 1 3 2 1 3 1 1 3 1 1 2 1 2 1 3 2 3 1 2 3 1 1 3 1 1 3 2 2 1 3 1 1 1 2 2 1 2 1 1 2 3 2 1 3 2 1 1 2 3 2 3 1 2 3 1 2 1 1 3 2 2 2 3 1 3 1 1 1 3 1 1 2 1 1 3 2 1 3 2 3 2 1 1 1 2 1 1 2 3 1 3 2 3 1 3 1 2 2 1 2 1 3 1 2 2 3 2 2 3 2 1 2 1 1 3 1 1 1 2 3 2 3 2 3 2 2 2 3 1 2 2 1 3 2 3 1 1 2 3 2 3 2 2 1 1 2 3 1 1 3 1 2 1 2 1 2 3 1 1 1 3 2 2 1 2 2 1 3 2 1 3 2 2 1 1 1 3 1 2 3 2 1 3 1 1 2 2 3 2 3 2 2 2 3 1 2 1 1 3 2 3 1 2 1 2 3 1 2 2 2 1 3 1 2 2 3 1 3 1 3 2 2 1 1 1 2 3 1 1 2 2 1 2 2 3 1 3 2 2 2 3 1 1 2 3 2 2 3 1 2 1 3 1 2 1 3 2 1 3 2 2 1 2 3 2 2 2 3 1 2 2 2 1 3 2 3 1 2 1 3 1 1 3 1 1 3 1 1 2 1 1 1 3 2 2 1 3 1 3 1 3 1 2 3 2 2 3 1 1 1 3 2 1 1 2 3 1 1 2 2 2 3 2 1 3 1 3 1 2 2 3 1 2 1 3 2 1 3 1 1 1 2 3 1 2 1 1 1 2 3 1 3 1 3 1 1 2 1 1 1 3 2 1 2 3 1 1 2 2 2 3 1 2 1 2 1 1 1 3 1 2 3 1 2 3 2 3 1 1 2 2 1 3 2 1 3 2 2 1 2 3 2 1 1 3 1 1 2 3 2 2 2 3 1 3 1 3 1 1 1 1 3 2 1 1 1 2 3 1 2 3 1 1 2 3 1 2 1 2 3 1 2 3 1 3 1 1 1 2 2 2 3 2 3 2 2 1 1 1 3 2 2 3 1 1 2 3 1 3 1 2 3 1 1 2 3 1 2 2 3 2 3 2 2 2 1 1 3 2 1 2 1 3 1 1 1 2 1 1 3 2 3 1 3 1 3 2 2 1 1 2 3 1 1 1 2 2 3 2 2 3 1 1 1 2 1 3 2 2 1 2 2 1 3 2 2 2 3 2 3 2 2 2 3 1 3 1 3 2 1 2 1 2 2 3 1 2 1 2 3 1 3 1 1 1 2 2 3 2 3 2 3 2 1 1 1 3 2 1 1 3 1 2 2 2 1 1 3 2 1 2 1 3 2 2 2 3 1 1 3 2 3 2 3 1 2 3 2 1 2 2 2 3 2 3 1 1 3 2 2 1 2 1 3 2 3 2 1 2 1 1 1 3 1 1 2 3 2 1 2 3 2 2 3 1 1 2 1 3 2 1 1 1 2 1 3 1 2 2 3 2 2 1 3 1 1 1 3 2 3 2 3 1 2 2 2 3 2 3 2 1 2 2 2 2 2 2 1 3 2 1 1 2 1 2 3 2 1 1 3 1 3 1 2 3 2 3 1 1 3 2 1 2 3 2 1 2 1 3 1 2 3 1 2 3 2 2 2 3 2 2 2 1 2 2 2 1 1 3 2 1 1 1 3 2 3 2 1 3 1 3 1 2 1 1 3 1 2 2 2 3 2 3 2 2 3 1 1 2 2 3 2 1 1 1 3 2 3 1 1 1 2 3 2 2 1 2 2 1 3 1 2 2 3 2 3 1 2 3 1 1 2 3 1 2 1 3 2 1 3 2 1 3 1 1 2 1 2 3 1 1 1 2 2 1 3 1 3 2 2 2 1 1 2 3 1 3 1 1 3 1 3 2 2 1 3 1 3 2 1 2 1 1 1 1 3 2 2 2 1 3 2 1 3 1 3 2 3 2 1 2 3 2 1 1 1 1 2 1 2 1 2 3 1 2 1 3 2 1 3 1 3 2 1 3 1 2 2 1 3 2 3 1 3 1 1 3 2 2 1 1 2 2 3 2 1 2 1 3 1 2 2 3 1 2 1 2 1 3 1 3 1 2 3 2 2 1 2 1 2 3 1 1 3 2 2 3 2 1 1 1 2 2 2 3 2 2 1 1 3 2 2 3 2 2 3 2 2 3 2 2 3 2 2 3 2 2 3 1 1 3 1 2 3 1 1 1 3 2 1 3 1 1 2 2 1 1 1 3 1 3 1 2 1 1 3 2 1 3 2 3 2 2 2 1 2 3 2 2 2 1 1 2 1 1 3 1 1 3 1 1 3 2 3 1 1 1 3 1 2 2 3 1 2 2 1 1 3 2 2 1 1 1 3 2 2 3 1 2 3 1 2 2 3 1 2 1 3 1 2 1 2 1 1 3 1 2 1 1 3 1 3 2 3 2 1 1 3 2 3 1 2 3 2 2 1 1 1 2 3 2 2 3 2 2 3 2 2 2 1 1 3 2 3 1 2 3 1 3 2 2 1 1 3 2 2 1 2 2 1 3 2 2 1 1 3 1 1 3 2 2 1 2 2 1 3 1 3 2 2 2 3 1 3 1 1 2 1 1 3 2 1 3 2 2 1 1 2 3 2 2 3 2 2 1 2 3 2 3 2 2 1 3 1 2 3 2 2 3 1 1 1 3 2 2 3 1 2 1 3 1 1 2 3 2 1 1 2 3 2 2 2 2 3 1 2 1 3 1 2 3 1 1 2 2 3 1 2 2 3 1 2 2 1 3 2 1 2 3 1 2 1 3 1 3 2 1 1 1 3 1 1 2 1 1 3 2 2 3 2 1 3 2 1 1 3 2 3 2 2 1 3 1 2 1 3 2 1 2 2 3 1 1 2 1 2 3 2 1 3 1 2 2 1 1 1 3 2 1 3 2 3 2 1 2 3 2 2 2 2 1 2 2 3 1 2 1 1 2 3 1 3 1 3 1 3 2 2 1 1 1 3 1 2 2 2 3 2 2 1 2 3 1 2 1 1 1 2 3 2 3 2 1 3 2 3 2 2 3 1 1 3 1 1 1 2 1 1 3 1 3 2 1 1 2 1 1 3 1 3 2 3 2 3 2 1 1 2 1 1 3 2 1 3 2 1 1 3 1 2 2 1 3 1 1 2 3 1 1 1 3 2 2 1 3 1 3 2 2 2 1 2 3 1 2 1 1 3 1 2 2 1 3 2 2 1 1 3 1 3 1 3 2 2 2 3 2 1 3 1 2 2 2 3 2 1 3 2 1 2 2 3 2 1 2 3 1 2 2 1 1 1 3 2 3 2 1 3 2 2 3 1 2 1 1 1 3 1 1 3 1 1 3 1 3 2 1 2 1 2 3 2 1 1 2 3 1 3 1 2 1 1 1 3 1 3 1 3 1 2 1 1 2 2 2 3 2 3 2 2 3 1 1 3 1 2 1 1 1 3 2 2 2 1 2 3 1 2 1 1 3 1 1 3 1 3 2 1 3 2 2 1 3 1 1 2 2 3 1 2 2 1 3 1 1 2 3 1 1 3 1 2 3 1 1 3 2 2 2 3 2 2 1 1 2 1 1 1 1 2 2 3 2 2 3 1 3 1 2 1 1 3 1 2 1 3 2 3 1 2 2 3 1 2 2 3 2 2 2 1 1 2 3 1 2 3 2 3 2 3 1 2 2 1 1 2 3 1 1 3 2 1 2 2 3 2 2 3 1 3 2 3 1 2 2 2 1 1 3 2 3 2 1 1 1 2 3 2 2 2 3 1 3 1 2 3 2 1 2 1 2 2 1 1 2 2 3 1 2 3 1 3 2 2 2 1 1 1 3 1 3 2 2 3 1 2 2 2 2 3 2 3 2 1 1 2 1 2 3 1 2 2 3 1 3 1 3 2 2 2 3 2 1 3 2 1 3 1 2 3 1 2 2 1 1 3 1 1 3 1 2 1 1 1 2 2 2 1 1 2 3 2 3 1 1 1 2 2 2 3 2 2 3 2 3 1 3 2 3 2 1 1 1 3 1 1 2 2 1 3 1 2 1 1 1 3 1 3 2 3 1 2 1 1 2 1 3 2 2 1 1 3 2 2 2 1 1 3 1 3 2 2 3 2 3 2 3 2 3 2 3 1 2 3 2 2 2 1 2 1 3 1 2 2 2 3 2 2 1 2 3 2 1 2 1 3 2 3 2 3 1 2 2 1 3 1 2 2 2 3 2 1 1 1 3 2 2 3 2 1 1 3 1 1 1 3 1 2 1 2 3 2 1 1 3 1 1 1 1 2 1 2 2 1 3 1 2 2 3 2 1 1 1 3 1 3 1 3 2 3 1 1 3 1 3 2 3 1 2 1 2 2 3 1 1 1 2 2 1 3 1 2 2 3 2 1 2 1 1 3 1 1 3 2 2 1 1 1 3 1 1 3 1 3 1 3 2 2 2 1 3 1 2 3 2 2 1 3 1 2 1 1 1 3 2 2 2 1 1 3 2 1 3 2 3 2 3 1 2 2 3 2 1 2 3 1 3 1 1 1 2 3 2 2 1 1 1 2 2 3 1 2 2 1 2 2 3 2 1 1 3 1 1 1 3 1 2 2 3 1 3 1 1 1 3 1 1 2 2 3 2 3 2 1 1 3 2 2 2 1 2 3 1 3 2 1 2 2 3 2 1 2 2 2 1 3 1 1 3 1 2 2 2 3 2 1 3 1 2 3 2 1 2 1 2 3 2 2 2 3 2 3 2 1 1 3 1 1 3 1 1 1 2 3 3 1 2 1 1 2 3 2 3 2 3 1 1 2 2 2 3 2 3 1 1 2 1 1 2 2 1 3 1 1 1 2 3 2 3 1 3 1 2 2 2 1 1 3 1 3 2 2 1 3 2 3 2 1 3 1 1 2 2 2 3 2 1 2 2 2 1 3 2 2 3 2 2 1 3 2 2 1 1 3 1 2 1 3 1 3 2 1 1 1 2 3 1 2 1 3 3 1 1 3 2 3 1 2 1 2 2 3 2 1 1 1 2 2 3 1 2 1 1 3 3 2 1 1 2 2 3 2 3 2 2 1 3 1 2 2 2 1 1 3 1 1 3 2 2 3 1 2 1 2 2 2 3 2 3 1 1 2 2 3 1 2 1 3 2 1 2 3 1 1 3 2 1 1 1 3 1 3 1 2 1 2 1 3 2 2 1 1 3 2 2 3 1 2 2 1 3 2 2 1 1 3 2 2 1 2 2 2 3 2 3 1 3 2 3 1 1 3 1 2 3 1 1 3 2 1 3 2 2 2 1 2 3 1 1 2 2 1 3 1 2 3 1 3 2 2 1 3 2 2 1 1 3 2 3 1 2 1 3 2 2 1 1 1 2 2 1 2 2 3 2 1 3 1 2 2 2 1 3 1 3 1 1 3 1 2 3 1 2 1 2 2 2 3 2 3 2 2 2 3 2 2 3 1 2 2 1 3 1 2 1 3 3 2 1 2 1 1 2 3 2 3 2 3 2 3 1 1 1 3 2 2 1 2 1 1 2 1 2 1 2 3 2 2 3 1 3 2 1 2 1 1 1 3 1 3 1 3 1 1 2 2 1 3 2 2 1 3 2 2 2 1 1 1 3 1 2 2 3 2 3 1 3 2 2 2 2 1 3 1 1 2 1 1 3 2 3 1 2 3 2 3 1 2 3 1 1 1 1 3 1 3 2 1 1 2 3 2 3 2 1 1 1 2 1 3 2 2 1 3 1 2 2 3 2 3 1 2 1 1 1 3 1 3 1 1 1 2 2 1 3 2 2 3 2 2 3 1 1 2 2 2 1 3 2 3 1 1 2 3 2 2 2 3 1 3 1 2 2 1 2 3 2 3 1 2 3 2 3 2 1 1 3 2 1 2 1 2 3 1 1 1 2 2 2 2 3 2 3 1 1 2 3 1 2 2 1 1 2 3 1 1 2 1 3 1 1 3 1 1 2 3 2 2 3 2 2 2 1 3 1 2 2 3 1 3 1 1 1 3 2 2 1 3 1 2 2 3 2 3 2 2 1 3 2 1 2 2 1 3 2 1 2 1 1 3 2 2 3 1 2 3 2 1 2 2 1 3 1 1 1 3 2 2 2 1 2 3 2 3 2 1 2 3 1 2 2 3 2 3 2 3 2 2 1 3 1 3 1 1 2 2 2 1 2 1 3 2 3 2 1 3 1 2 1 2 2 2 3 1 2 1 3 2 2 1 2 3 1 3 2 2 2 1 1 2 3 2 3 2 2 2 1 3 2 2 3 2 2 1 2 3 2 3 2 3 2 1 1 1 3 2 1 3 1 1 1 3 2 1 1 1 3 1 2 2 3 2 2 1 2 3 1 2 1 2 1 3 2 3 1 3 2 2 3 2 2 1 2 2 2 2 2 3 1 2 2 3 1 1 2 3 2 2 1 1 2 1 3 2 3 2 3 2 1 3 1 3 2 1 2 2 1 3 2 1 3 2 2 1 2 2 3 2 1 1 3 2 2 1 1 3 2 1 3 1 1 1 3 1 1 3 1 1 3 1 2 1 2 2 2 3 1 3 1 1 1 3 1 3 1 1 2 2 1 2 3 2 1 1 2 3 1 1 1 3 2 2 1 3 1 2 2 2 3 2 2 1 3 2 3 2 3 1 2 2 2 1 1 3 3 1 2 3 1 2 2 1 1 3 1 2 1 2 1 3 1 3 1 2 1 3 2 2 1 2 1 2 2 2 3 1 3 2 3 1 2 2 1 1 3 1 3 2 1 1 2 3 2 3 2 1 2 2 3 2 3 1 3 2 2 1 1 3 2 1 2 1 1 3 2 2 1 1 2 2 2 1 3 2 1 3 1 1 1 3 2 3 2 2 3 2 3 2 2 2 3 2 2 1 3 1 1 3 1 2 2 1 1 3 2 2 3 1 1 2 1 1 2 3 2 1 1 1 3 2 1 2 3 2 3 1 3 1 2 3 1 2 2 2 1 2 3 2 2 3 1 1 1 2 3 1 2 2 1 1 1 3 1 2 3 1 1 3 1 2 3 1 2 2 1 2 2 1 3 1 2 3 2 2 3 1 3 2 3 2 2 2 3 2 2 2 2 1 3 2 3 2 2 2 1 1 1 3 1 3 2 1 3 2 1 2 1 2 3 1 1 3 2 2 1 2 1 1 3 2 1 1 1 2 3 1 2 3 2 2 3 1 2 3 2 2 1 1 3 1 3 1 3 1 1 1 2 1 1 3 2 3 2 1 2 2 3 2 3 1 2 1 2 2 3 1 1 1 2 3 2 3 2 1 1 1 2 3 1 2 3 1 1 2 3 1 2 3 1 1 2 2 1 1 3 1 1 1 3 1 1 1 3 1 3 1 3 1 1 2 1 3 2 2 2 3 1 2 2 2 3 2 3 2 2 2 3 2 2 1 1 3 2 2 3 2 2 2 1 3 1 2 2 2 3 1 2 2 2 3 2 1 1 3 3 2 1 2 3 1 3 1 2 2 2 3 1 2 1 2 1 1 3 1 2 2 1 3 2 2 2 1 2 1 3 2 3 1 3 2 1 2 1 3 2 3 1 2 3 1 2 2 2 1 2 1 2 3 2 3 1 1 3 1 2 1 2 1 1 3 2 3 2 2 2 3 1 2 2 3 1 2 1 3 1 2 3 1 2 1 3 2 1 1 2 2 3 1 3 2 2 3 1 2 1 3 1 2 3 2 3 1 1 3 1 1 2 2 2 3 1 2 2 2 3 1 1 3 1 2 1 2 2 3 1 1 1 3 1 1 2 2 2 3 1 2 3 2 3 1 2 3 2 2 2 1 3 2 3 2 1 3 1 2 1 2 1 3 1 2 2 2 3 1 1 2 1 2 2 3 1 3 2 2 1 2 1 1 3 2 1 3 2 1 3 2 1 1 1 2 2 3 2 3 1 1 1 3 1 2 2 3 2 2 2 3 2 3 2 1 3 2 2 1 3 1 3 2 2 1 1 2 2 3 2 1 2 2 2 3 1 2 3 1 1 2 3 2 2 1 1 1 3 2 1 1 3 2 3 2 2 3 1 1 1 2 3 2 2 3 1 2 3 2 2 1 3 1 1 3 2 1 2 1 2 2 3 2 3 1 1 2 2 2 2 3 2 3 2 1 3 1 1 2 1 2 3 2 3 2 2 3 2 2 1 1 1 2 1 1 3 2 3 2 1 1 3 2 3 1 1 1 2 1 1 3 1 1 3 1 1 1 3 1 3 2 1 2 2 2 3 2 2 3 2 3 1 3 2 2 1 1 1 2 3 2 3 2 2 2 1 2 3 2 2 1 2 1 2 3 2 3 1 1 3 2 2 2 1 1 1 3 1 3 1 1 2 1 3 1 1 2 1 2 3 2 3 2 1 1 3 2 2 1 2 3 1 1 1 3 1 3 2 3 1 3 1 2 1 1 2 3 2 2 2 1 1 2 3 1 3 1 1 1 2 1 2 3 2 2 1 3 1 1 2 3 2 3 1 2 2 2 1 3 2 2 3 2 2 3 1 2 3 2 2 2 1 3 2 1 3 2 2 2 3 2 1 1 1 3 1 3 2 1 2 1 1 3 2 2 2 3 1 2 3 1 2 1 1 1 1 3 2 1 1 3 1 1 2 3 1 2 3 2 1 1 2 1 1 3 2 3 3 2 1 3 1 1 1 2 1 3 2 2 2 1 2 2 3 1 2 3 1 2 2 3 2 3 2 1 1 3 2 3 1 1 1 2 1 3 2 3 1 3 2 2 1 2 2 2 1 1 1 2 1 3 1 2 3 1 2 1 2 1 1 3 2 3 1 3 1 1 2 3 1 2 1 1 3 2 2 1 2 1 1 3 2 3 2 2 1 2 3 2 3 1 3 2 2 1 2 1 3 1 2 1 1 1 3 1 3 1 2 3 1 2 2 2 3 2 2 3 1 3 1 3 2 2 3 1 3 1 1 2 3 2 1 2 1 3 2 1 2 2 1 2 1 1 3 2 1 3 2 2 2 3 2 1 1 3 1 1 2 3 1 2 2 3 2 1 2 2 1 2 3 1 1 1 2 2 3 1 3 2 3 1 1 3 1 2 2 3 1 2 3 2 1 2 1 2 3 2 1 1 1 2 2 3 2 2 1 2 3 2 2 3 1 3 3 1 1 2 2 3 2 1 2 1 1 1 3 2 1 2 2 1 3 1 2 3 2 3 2 1 3 1 2 3 1 3 1 2 2 1 1 3 2 3 2 2 1 2 2 2 3 1 3 2 2 1 1 3 2 2 2 3 2 2 2 1 2 3 2 1 2 1 3 1 1 3 3 1 3 2 1 2 2 1 3 2 1 1 1 3 2 3 1 2 1 2 3 1 2 1 3 2 3 1 1 2 3 1 2 2 2 1 3 2 1 1 1 2 3 1 2 2 3 1 3 1 2 2 3 1 1 3 2 2 1 2 1 3 1 1 1 2 3 1 2 2 1 3 1 3 2 3 1 2 1 1 1 2 3 2 2 1 3 2 2 3 1 1 2 2 3 2 2 1 2 1 2 1 3 2 1 1 1 2 3 2 2 2 3 2 3 2 3 2 2 3 2 2 1 1 3 2 3 2 2 1 3 2 2 1 2 2 2 3 2 2 3 2 1 3 3 2 1 3 2 1 1 2 1 2 3 1 1 3 2 3 1 3 1 1 2 1 2 1 2 1 3 2 3 2 1 2 1 3 1 1 2 3 2 1 3 1 2 2 2 1 3 2 2 2 3 2 1 3 1 2 2 1 3 1 2 3 2 3 2 2 2 3 2 1 1 1 2 1 3 2 1 2 1 3 1 3 2 1 3 1 3 1 2 3 1 2 1 2 2 2 1 2 2 3 2 3 1 1 1 3 1 1 1 3 1 3 1 1 3 1 1 1 2 2 2 3 2 3 1 3 1 1 2 2 1 1 3 1 2 2 1 1 3 1 1 2 3 2 1 3 2 3 1 3 2 1 1 3 2 1 1 2 1 3 1 1 1 3 1 2 2 2 3 2 1 3 1 1 2 1 1 3 2 1 1 2 2 2 3 2 3 1 3 1 2 1 3 1 3 2 2 1 2 2 2 3 1 3 1 2 2 2 1 3 1 2 3 2 2 2 3 1 1 1 2 3 1 2 3 1 2 2 3 1 1 2 2 2 1 3 1 3 1 2 1 1 1 2 1 3 2 3 2 3 1 3 1 1 2 1 3 2 2 1 1 3 2 1 1 2 3 2 3 2 2 1 1 3 2 2 3 2 1 3 1 1 3 1 1 2 1 1 1 2 1 1 2 3 1 3 2 2 1 1 2 1 3 2 3 2 1 1 3 1 1 3 1 2 1 1 3 1 3 1 2 3 2 2 2 1 1 3 2 2 1 3 1 1 1 3 2 3 2 2 1 3 2 3 2 2 1 3 1 1 1 2 1 2 3 1 1 1 3 1 2 2 2 1 3 1 1 3 1 2 2 3 2 2 1 3 1 2 1 1 3 2 2 3 3 2 3 2 1 1 2 3 2 1 2 1 1 3 1 2 1 3 2 2 1 1 3 2 2 1 2 2 1 3 1 3 1 3 1 1 1 2 2 3 2 1 3 1 3 1 2 2 2 1 3 2 3 1 3 1 2 1 1 1 3 2 1 1 1 3 2 2 2 1 2 3 2 2 3 2 3 1 1 1 3 2 2 1 1 3 2 1 1 3 2 2 1 3 2 2 1 1 1 3 2 3 2 1 1 3 2 2 3 1 1 3 1 1 2 1 2 2 3 1 3 1 1 2 1 3 1 3 2 3 2 2 1 2 2 2 3 1 1 1 2 1 3 1 2 1 2 1 1 3 1 3 1 3 1 3 1 2 1 1 3 2 1 1 2 1 1 3 2 3 1 3 2 3 1 1 1 2 2 3 1 2 1 3 1 3 2 1 1 1 2 2 3 1 2 3 1 1 2 1 1 3 2 2 2 1 1 3 2 3 1 3 1 1 1 2 3 2 3 2 3 1 2 1 2 3 2 2 2 1 2 2 3 1 2 2 1 1 3 2 2 1 1 1 3 2 3 1 3 2 3 2 1 1 1 2 3 1 2 1 1 2 3 1 3 2 1 3 1 3 2 2 2 3 1 2 2 2 3 1 1 1 3 1 1 2 1 2 3 1 1 2 1 2 2 3 2 2 1 2 3 2 2 2 3 2 2 1 2 3 1 3 3 2 3 2 1 1 2 1 1 3 1 2 3 2 1 2 2 3 2 2 3 2 2 2 2 1 1 1 2 2 3 1 2 2 3 2 3 1 3 2 2 3 1 1 3 1 1 2 2 3 1 3 1 2 1 3 2 2 1 2 1 3 2 2 1 1 3 2 2 2 1 3 1 3 2 2 2 3 2 2 1 1 3 1 2 2 1 2 3 2 1 3 1 1 1 3 3 1 1 2 3 2 3 2 1 3 1 1 2 1 1 3 1 3 1 2 2 1 1 1 3 2 1 2 2 1 2 3 1 1 1 3 1 1 3 2 2 3 2 2 3 2 2 2 3 2 3 2 2 1 2 1 3 1 1 3 2 2 1 1 1 2 3 2 2 1 1 3 2 2 1 1 3 1 3 2 1 3 2 3 1 1 2 1 2 3 1 2 1 3 2 1 1 1 2 3 2 2 1 2 1 1 3 1 2 3 1 3 1 3 2 2 2 1 3 2 1 2 1 2 1 1 3 1 2 2 2 3 1 2 3 2 1 3 2 3 2 1 3 2 2 1 2 3 2 2 2 3 2 2 3 2 2 3 2 2 1 1 3 2 2 2 3 1 3 1 2 1 3 2 2 2 1 3 2 1 2 1 3 1 1 3 1 2 1 1 1 3 3 2 2 3 1 1 2 1 2 1 3 1 3 1 2 1 3 2 1 1 1 2 1 3 1 3 1 3 1 1 3 1 2 2 2 1 3 2 1 1 3 1 1 2 3 1 2 1 2 3 1 1 2 3 1 3 1 1 1 3 1 2 1 2 2 3 1 3 2 1 2 2 2 3 1 1 3 1 2 2 1 2 1 3 2 1 3 2 2 3 2 1 2 1 3 1 3 1 2 2 1 3 2 1 3 2 1 2 2 3 1 1 3 1 2 2 1 2 3 2 2 3 1 1 1 2 3 2 3 2 1 2 2 2 3 2 1 2 3 2 2 2 1 3 1 2 2 1 1 1 3 2 2 3 1 2 1 2 3 1 1 1 3 1 1 3 2 3 1 1 2 3 2 1 3 1 3 1 2 2 3 2 1 3 2 3 1 1 2 1 2 2 2 2 1 2 2 2 3 2 2 3 1 3 2 3 2 1 1 1 2 3 2 3 1 2 1 2 3 2 1 1 2 2 3 2 3 1 1 2 1 1 2 3 2 1 2 3 2 3 3 1 2 2 2 3 2 1 2 1 3 1 3 1 2 2 1 3 2 1 1 3 2 1 1 1 2 1 2 2 3 2 2 3 2 2 2 1 3 1 3 1 1 1 3 1 1 3 1 2 3 1 2 3 1 2 3 2 1 2 2 2 3 2 1 1 1 3 1 3 2 1 1 1 2 3 2 1 2 2 2 3 2 3 2 3 1 2 2 3 2 3 2 1 1 1 1 3 2 3 2 2 1 2 3 1 1 3 1 1 2 1 3 2 1 1 3 1 1 2 3 2 2 1 2 3 2 1 3 1 3 1 2 3 1 1 1 3 1 1 1 2 2 1 3 2 2 2 3 2 1 2 2 1 3 1 2 1 1 1 2 3 1 3 2 2 3 2 2 3 1 2 2 2 1 2 3 1 3 1 2 2 1 1 3 1 3 1 1 1 3 1 2 2 2 3 2 3 2 3 2 2 1 2 2 3 2 1 1 2 2 3 1 3 1 2 3 1 2 3 2 3 2 3 1 2 1 2 3 1 2 2 1 1 1 3 1 1 1 2 1 3 1 2 2 1 2 1 3 1 2 2 2 3 2 1 3 1 3 1 1 1 3 2 3 1 1 3 1 3 2 1 2 3 2 1 1 2 1 3 2 1 2 2 3 2 1 2 2 2 2 3 2 1 1 2 3 2 2 3 2 2 3 1 3 2 2 2 1 1 3 1 1 3 2 1 1 1 2 1 3 2 1 3 2 1 2 3 1 1 2 1 1 3 1 3 3 1 1 2 3 2 2 3 1 1 2 2 3 1 1 1 2 1 2 3 1 3 2 2 1 3 2 1 3 2 2 1 1 2 2 3 1 2 1 3 2 1 1 3 2 2 2 3 1 3 2 3 2 1 1 1 3 1 1 1 2 3 1 1 2 3 1 1 2 1 1 3 2 3 2 2 1 3 1 2 1 2 2 2 3 2 3 1 1 1 2 3 2 3 1 1 2 3 2 1 2 3 2 2 3 1 3 2 2 2 3 1 1 2 2 3 2 2 1 2 2 3 1 3 2 3 1 1 2 2 1 3 2 2 1 2 3 2 2 3 2 2 1 2 3 1 1 3 1 1 1 3 1 1 1 2 3 1 3 1 1 1 3 1 2 2 1 2 2 2 1 1 3 2 1 1 3 2 2 3 2 3 2 2 3 1 2 1 2 2 1 3 1 2 3 1 2 3 2 3 2 2 2 3 1 2 2 2 3 1 1 2 2 3 1 1 1 1 3 2 1 1 3 2 3 1 1 1 2 2 3 2 2 3 2 2 2 3 1 1 1 2 3 1 1 3 2 3 2 1 1 1 3 2 2 2 3 1 1 1 3 1 1 1 1 3 1 3 1 3 2 1 1 3 1 2 1 1 2 2 3 2 1 2 1 3 2 1 2 2 2 1 2 3 1 3 1 2 1 3 1 2 3 1 1 1 2 1 1 3 2 3 1 3 1 1 1 2 2 1 3 2 1 3 2 1 1 2 3 1 2 2 2 3 2 3 3 1 2 2 2 3 1 3 1 2 2 3 1 1 2 3 1 3 1 1 2 1 2 1 3 1 2 2 1 3 1 1 1 3 1 2 3 1 1 2 1 1 1 3 1 2 3 1 2 1 3 1 2 1 3 1 1 1 3 2 1 2 1 2 3 2 2 3 2 1 3 2 3 1 1 3 1 2 1 3 2 1 1 1 3 2 1 1 1 3 2 1 1 3 2 2 1 1 1 2 3 2 3 2 3 2 2 2 1 3 2 1 3 2 2 3 2 1 1 1 2 2 3 2 2 3 1 1 3 2 1 1 3 1 3 1 2 3 1 1 2 1 1 1 2 1 2 2 2 3 1 3 1 3 1 1 1 3 1 1 1 3 1 3 2 2 2 1 2 1 2 2 2 1 3 2 3 1 2 3 1 1 2 2 2 3 2 3 1 2 3 2 2 2 1 2 1 3 2 3 1 2 3 1 2 3 1 2 1 1 3 2 2 3 1 2 2 1 1 1 3 1 2 1 1 2 2 3 2 1 3 1 1 1 3 2 1 3 2 3 3 2 2 2 1 3 2 1 2 2 3 1 2 1 2 2 3 2 3 2 3 2 1 1 3 2 3 2 2 3 2 3 1 1 2 1 1 3 1 2 2 3 1 1 1 2 1 2 1 1 1 3 1 1 1 3 2 1 2 1 1 1 3 2 3 1 3 1 2 1 3 1 2 1 2 2 2 3 2 1 1 3 1 1 3 2 3 2 1 3 1 2 1 2 2 3 2 1 3 1 1 3 1 2 3 1 1 1 2 2 3 2 3 1 2 2 2 3 2 2 1 2 1 1 2 1 3 2 1 1 3 2 3 1 1 2 3 1 2 3 1 3 1 2 1 1 2 3 2 3 1 1 2 1 1 3 1 2 1 1 1 3 2 3 2 3 2 1 1 2 2 3 1 1 3 1 2 1 1 1 3 1 2 3 2 2 3 2 2 2 1 3 2 3 1 1 1 2 1 3 1 1 3 2 3 1 3 1 2 2 1 2 1 3 2 1 1 3 2 2 1 2 2 3 2 3 1 1 1 3 1 3 2 2 2 1 2 3 1 2 1 1 1 2 1 3 2 1 3 2 3 1 2 1 3 1 3 1 1 3 1 2 2 2 1 3 2 3 2 1 2 3 1 1 3 2 3 2 1 1 2 1 1 3 1 2 2 1 2 3 1 2 2 1 1 3 1 2 2 3 2 3 2 1 3 2 3 2 2 1 2 1 1 3 2 2 2 1 2 3 1 2 1 2 2 2 3 2 1 3 1 2 3 1 3 2 2 1 2 3 2 3 2 1 2 3 1 1 3 1 2 2 1 2 1 3 2 2 1 3 3 1 1 1 2 2 3 2 2 3 2 1 2 1 3 1 3 2 3 1 2 1 2 1 2 1 3 1 1 1 2 1 3 2 2 2 1 1 3 2 1 2 1 3 2 3 2 3 2 3 1 2 2 2 1 3 1 2 3 2 2 2 1 2 2 3 2 3 1 3 1 1 1 1 3 2 2 3 1 2 1 2 2 2 3 2 2 3 2 2 1 3 1 2 3 1 2 3 1 2 3 2 3 1 2 1 1 2 3 1 3 1 1 2 1 1 1 3 1 1 1 1 1 3 2 2 2 1 3 2 2 2 3 2 1 2 2 1 3 2 1 3 1 3 1 3 2 2 2 3 1 2 3 2 3 1 2 1 3 2 1 1 1 2 1 3 1 1 1 1 3 2 3 2 2 1 2 2 3 1 1 2 3 2 3 1 2 3 2 2 1 2 1 1 1 2 2 3 1 1 3 2 3 2 3 1 2 1 1 2 3 2 2 2 3 2 3 2 2 2 1 3 2 3 1 2 2 1 1 1 3 1 2 1 3 1 2 2 1 3 1 2 1 1 3 2 3 2 1 2 1 1 3 1 3 1 1 3 2 3 2 2 1 1 1 2 3 1 1 2 2 2 3 2 2 2 3 2 3 1 2 3 1 1 3 2 2 1 1 1 1 3 1 1 2 2 3 1 3 1 1 1 2 3 1 1 1 3 2 2 1 3 1 3 2 3 2 1 1 3 1 3 2 1 2 1 1 1 3 2 1 2 2 2 3 1 3 1 1 2 2 1 1 3 1 2 2 3 2 2 1 2 1 2 3 2 3 1 3 2 2 1 2 3 1 1 1 3 2 3 2 2 3 2 2 2 1 1 3 2 1 1 3 1 2 1 1 1 3 2 1 1 1 2 3 2 2 1 2 3 2 3 1 3 1 3 1 1 1 1 1 3 1 2 1 2 2 3 1 2 2 3 1 3 1 2 1 3 1 3 2 2 1 1 3 2 3 1 2 1 2 3 1 1 2 1 2 3 2 3 1 3 1 1 1 2 1 1 1 2 1 3 1 3 2 2 2 3 2 2 1 1 2 3 2 1 1 3 2 3 3 1 2 2 2 1 3 1 2 3 1 3 2 2 1 1 3 1 1 2 2 2 1 3 2 2 3 2 1 1 1 2 3 1 3 2 3 2 3 1 1 2 1 2 2 3 2 1 1 3 2 1 3 2 3 2 1 2 2 2 3 1 3 1 2 1 1 2 1 3 1 1 2 3 1 3 2 2 1 1 1 3 1 3 2 2 3 2 2 3 1 2 1 2 2 2 1 1 1 3 1 3 2 3 2 1 2 2 1 3 1 1 1 2 1 3 2 2 2 3 3 2 2 2 1 3 2 2 1 2 2 2 3 1 2 3 1 3 1 2 1 1 2 3 1 1 3 2 3 2 1 1 1 2 3 1 1 2 1 1 1 3 1 3 2 2 3 2 1 1 2 1 1 1 3 2 3 1 3 2 1 3 1 1 3 2 3 2 1 1 2 2 2 1 2 2 3 1 3 2 2 2 3 2 3 2 1 1 1 3 1 1 3 1 2 1 2 2 2 1 2 1 3 2 2 3 2 2 3 2 3 2 2 3 1 1 1 3 2 2 1 2 3 1 1 1 2 1 2 3 1 2 2 3 2 3 2 2 2 3 2 2 3 2 1 1 1 3 1 3 1 2 3 2 1 1 1 3 2 3 1 3 2 2 1 2 2 1 2 2 3 1 1 3 1 1 1 3 2 2 1 3 1 2 3 1 2 3 1 1 2 2 1 2 3 2 2 1 2 2 2 3 2 2 2 1 3 2 2 2 3 2 3 2 3 1 1 1 1 2 1 2 3 1 1 2 2 2 3 1 1 3 1 3 1 1 3 2 3 1 3 1 2 2 1 3 1 2 1 2 1 3 1 1 2 1 2 2 3 1 1 3 1 3 2 2 1 3 1 1 2 1 1 3 1 3 1 1 1 2 3 2 1 2 3 2 3 2 2 2 2 1 2 3 1 1 1 3 1 3 1 1 3 2 3 2 1 2 2 1 2 3 3 2 1 1 3 2 1 2 2 1 1 3 2 3 2 3 1 2 2 2 1 3 2 1 1 2 1 1 1 3 1 3 1 1 3 2 1 1 1 3 1 3 2 1 1 1 3 2 1 2 2 3 2 2 1 1 2 2 3 1 1 3 2 3 2 1 2 3 1 1 1 3 2 1 2 1 2 1 3 2 2 3 1 3 2 2 3 1 3 2 1 1 3 1 2 2 2 1 3 1 2 3 1 3 1 2 1 2 1 2 3 1 1 1 3 1 2 1 3 2 1 2 1 1 3 1 1 3 1 2 3 1 2 2 2 3 2 3 2 1 1 1 2 3 2 2 1 3 2 1 1 2 1 1 3 1 1 1 3 1 2 3 1 1 3 1 3 1 3 1 2 2 2 3 2 3 1 3 2 1 1 1 3 2 1 1 1 2 1 3 1 1 1 1 1 2 1 3 1 2 3 2 1 3 1 1 2 2 2 3 2 3 2 3 2 2 3 1 1 1 2 2 1 3 2 3 2 2 2 3 2 3 2 3 2 1 2 2 1 2 1 2 2 2 3 1 3 2 1 2 3 1 2 1 3 1 1 3 1 2 2 3 2 2 1 2 1 3 1 3 2 2 3 1 1 3 2 1 2 3 2 1 1 1 3 2 2 2 2 1 1 2 2 2 3 2 3 1 1 2 3 2 2 3 2 2 1 2 2 3 2 3 2 2 1 3 2 2 2 1 2 3 1 3 1 3 2 3 1 3 1 2 2 2 1 1 3 2 2 3 2 2 1 3 1 3 2 3 2 2 2 1 2 3 1 1 1 2 2 2 2 2 2 1 2 2 3 2 3 1 2 3 2 3 1 1 1 2 1 1 3 1 3 1 3 2 1 1 3 2 1 1 2 1 2 3 1 2 1 3 2 3 1 2 2 1 1 3 2 3 1 3 1 2 3 1 2 3 2 1 2 1 2 3 2 1 3 2 1 1 2 1 1 1 2 2 3 1 3 1 1 1 3 1 3 1 2 1 1 1 2 3 1 2 1 3 2 2 2 3 1 1 3 2 3 1 2 3 2 2 1 3 1 1 2 3 2 2 2 1 1 3 2 2 3 2 2 3 2 3 2 1 1 2 2 3 2 2 1 3 2 1 1 1 1 2 1 3 2 3 1 3 1 1 3 2 3 1 2 1 1 3 1 2 1 2 2 2 3 2 3 2 3 1 2 1 1 3 2 1 1 2 2 3 1 3 2 2 1 1 1 2 2 1 3 2 2 1 2 2 3 2 2 2 3 2 3 1 1 2 2 2 3 1 3 1 1 2 1 3 2 2 3 1 1 2 1 3 2 1 1 2 2 2 3 1 1 3 1 3 1 2 3 2 2 2 3 2 3 2 2 2 3 1 1 2 1 3 1 3 1 1 2 1 2 3 1 2 1 1 1 3 1 2 1 2 3 1 3 1 3 1 2 2 3 2 1 1 2 1 1 1 3 1 2 3 1 3 1 2 3 2 2 3 2 2 1 1 1 3 2 2 1 1 3 2 3 1 1 1 2 2 2 3 2 1 1 3 1 1 2 2 1 3 2 3 3 1 1 1 2 3 1 3 1 3 2 2 1 2 2 3 1 2 1 3 2 2 2 1 2 2 2 3 2 1 1 1 2 3 1 3 1 2 1 2 1 3 2 3 2 2 1 3 3 2 2 1 1 2 2 3 2 3 1 2 1 2 2 2 3 1 2 2 1 3 2 3 1 3 1 3 2 3 2 2 3 1 2 1 1 1 3 1 2 3 2 2 2 1 2 1 1 1 2 2 3 2 3 1 3 1 1 1 2 2 3 1 2 1 1 3 1 1 3 1 2 2 1 1 1 3 1 3 1 1 2 2 3 1 3 1 1 3 1 3 1 1 1 2 2 2 3 2 2 1 3 1 1 3 1 1 2 2 3 1 1 2 3 2 1 2 3 2 1 3 2 2 1 1 3 1 2 1 2 3 2 3 2 3 1 2 3 2 2 2 1 1 2 3 1 3 2 2 1 2 3 2 2 3 2 1 1 2 1 3 1 1 1 2 2 3 2 2 1 3 1 2 1 1 3 2 2 2 1 3 1 3 1 2 2 3 1 3 1 1 1 2 3 1 3 2 1 1 2 1 1 3 1 3 2 1 2 2 2 3 1 1 3 2 2 3 2 2 2 1 1 3 2 3 2 1 1 2 3 1 2 2 2 3 2 2 1 3 2 2 3 1 1 3 1 1 3 1 2 2 3 2 2 1 2 2 3 2 2 3 1 1 2 1 2 1 3 1 1 1 3 1 2 2 1 1 1 3 1 3 2 3 1 1 2 3 2 1 1 1 2 2 3 2 2 1 3 1 1 1 2 2 2 3 1 3 2 3 2 3 1 2 2 3 2 2 1 3 2 3 2 3 2 2 1 2 2 3 1 2 2 1 2 3 3 1 3 1 1 2 2 1 2 3 2 3 2 3 1 1 2 1 2 1 3 1 1 1 2 2 3 1 2 2 3 1 2 1 1 1 3 2 1 1 1 3 1 3 2 3 2 1 3 2 3 2 3 2 1 1 1 2 2 3 1 1 2 1 2 3 2 2 1 1 2 3 1 1 1 3 2 1 1 1 3 1 1 1 3 1 1 3 2 2 2 3 1 1 1 3 2 2 2 1 3 2 2 3 1 1 3 1 1 2 1 3 1 1 1 3 1 1 1 3 3 2 3 2 1 1 2 1 1 3 1 3 2 3 1 1 2 1 3 2 1 1 2 2 2 1 2 2 3 1 1 1 2 1 1 3 1 3 1 3 1 2 2 2 3 2 3 1 1 2 3 1 3 1 1 1 3 1 1 3 1 1 3 2 2 1 1 3 1 2 2 2 1 1 3 1 3 2 3 1 3 2 1 2 1 2 2 3 2 2 1 1 1 3 1 1 2 2 2 3 2 1 1 1 3 2 3 1 2 3 1 2 3 2 1 1 3 1 2 1 3 1 2 3 2 2 1 2 3 2 3 1 2 3 1 1 1 2 1 2 3 2 1 2 3 2 1 3 1 1 2 1 1 1 3 2 3 2 2 1 1 1 3 2 3 2 2 1 1 1 1 3 1 3 2 1 2 3 2 3 2 3 2 1 2 3 1 2 1 2 2 2 1 1 1 3 1 2 1 1 3 1 3 2 2 1 3 2 1 1 1 2 2 3 2 3 1 1 3 1 1 2 2 1 3 1 3 1 1 2 1 1 3 2 3 2 3 1 2 1 3 1 2 1 1 3 1 1 1 3 2 3 1 1 1 2 3 2 1 1 1 2 2 3 3 1 2 3 1 1 1 3 1 2 3 2 2 2 1 1 1 3 2 2 2 3 2 2 1 3 2 3 2 1 1 3 2 1 1 2 1 1 3 2 2 2 3 1 3 1 1 1 3 2 2 3 1 3 1 1 2 2 1 3 1 1 2 2 2 3 1 2 1 1 1 3 2 2 1 1 3 1 1 1 2 2 2 3 2 1 2 3 2 3 2 2 3 2 2 3 1 3 1 1 3 1 2 2 2 1 3 1 2 3 1 1 1 2 3 1 3 2 2 2 2 1 1 3 2 2 2 3 1 3 1 2 1 1 1 3 1 2 3 1 2 1 2 3 2 3 1 3 1 2 1 3 2 2 2 3 2 1 1 2 1 2 3 2 2 2 3 2 1 3 2 2 2 3 1 1 1 2 2 3 2 1 1 3 2 2 2 3 1 2 3 1 2 1 3 1 1 2 2 3 1 2 2 1 1 2 3 1 2 3 1 3 2 1 3 2 1 3 1 3 1 2 2 2 3 2 1 1 2 1 1 3 2 1 2 2 3 1 1 3 1 2 1 1 2 3 1 2 3 2 1 1 2 3 2 1 1 3 2 1 3 2 3 2 2 3 1 1 1 2 2 2 3 1 2 3 1 3 1 3 1 2 1 2 3 2 2 1 2 3 2 3 2 1 1 1 3 2 1 2 1 3 2 2 2 1 2 3 2 2 1 3 2 3 1 1 2 1 1 3 2 3 1 1 1 2 1 3 1 1 2 3 1 1 2 3 1 1 1 3 1 1 1 3 1 2 2 3 2 1 1 2 1 1 3 2 1 3 1 3 1 1 2 3 1 1 1 2 1 3 2 3 2 2 1 1 1 2 3 1 3 2 3 2 3 2 1 3 1 2 1 1 1 3 1 2 3 2 3 1 1 2 2 1 2 3 1 2 3 1 2 1 3 2 1 2 1 2 3 2 3 2 3 2 1 2 2 2 3 2 2 2 1 2 3 2 2 2 3 2 1 3 1 1 1 2 3 2 2 2 3 1 1 3 1 2 1 1 1 2 2 2 3 2 1 3 1 3 1 3 1 1 1 2 2 2 3 2 2 3 2 1 3 1 1 2 1 1 3 1 2 2 1 3 2 1 1 3 2 3 2 1 3 1 2 3 1 2 2 2 1 3 1 3 1 1 1 2 1 2 3 1 3 2 1 3 1 1 1 1 2 1 3 1 3 2 1 2 3 2 2 3 2 2 2 1 2 3 1 3 1 1 3 1 2 3 1 2 3 1 1 3 1 3 2 2 2 1 2 2 3 2 1 1 1 2 1 1 3 2 1 1 1 3 1 1 3 1 1 3 1 1 1 2 3 2 3 2 2 1 2 2 3 1 1 3 1 1 2 2 1 1 3 2 3 2 2 2 1 3 2 3 2 1 1 3 1 1 1 3 1 1 2 3 2 2 3 1 2 2 2 1 2 3 1 2 3 2 3 1 2 2 1 1 1 3 1 3 1 2 3 2 2 3 1 2 2 3 1 1 1 2 1 1 2 3 1 2 1 1 2 2 3 2 2 3 1 3 1 3 1 3 2 1 1 2 3 2 2 2 3 2 2 3 1 1 1 3 2 3 2 1 1 1 3 2 1 2 1 2 2 3 1 3 2 2 1 2 1 2 3 1 3 1 1 1 3 2 3 2 1 1 2 2 2 2 3 2 3 1 3 1 1 1 3 1 1 3 2 1 2 1 2 1 3 1 1 2 3 2 1 1 3 2 2 2 1 3 1 3 2 2 1 2 1 3 1 3 2 2 2 1 3 1 2 1 3 1 2 1 3 1 2 1 1 3 2 2 1 1 2 2 3 1 1 3 1 3 1 3 1 2 3 1 2 2 3 2 2 2 1 2 3 2 1 2 2 1 2 3 1 1 1 3 2 2 1 1 3 1 1 1 2 2 3 2 1 3 2 3 1 2 1 3 2 2 2 3 1 2 1 2 2 3 2 2 2 3 2 3 1 3 2 3 2 1 2 1 1 2 2 2 3 2 1 3 1 1 1 3 2 2 3 2 2 1 2 3 1 3 2 2 3 1 2 2 2 3 1 3 2 1 1 3 2 2 2 1 2 1 3 1 2 3 1 1 1 1 3 1 2 1 1 1 3 2 3 1 3 2 2 3 1 2 2 2 1 3 1 2 3 1 2 1 2 2 3 2 1 1 3 1 2 1 2 3 2 2 3 2 1 1 1 3 3 2 1 1 3 1 3 2 3 2 1 2 2 3 2 1 1 3 2 2 1 1 2 2 3 2 3 2 3 1 2 2 1 3 2 1 1 2 3 1 1 3 2 1 2 2 2 1 3 2 1 1 3 1 1 1 3 1 2 2 1 1 3 2 3 2 2 1 3 2 1 1 1 3 2 1 3 1 1 1 3 2 2 3 1 1 1 2 2 3 1 2 2 1 2 3 2 1 1 3 1 3 1 1 3 2 2 3 1 3 2 1 1 2 3 2 1 2 2 2 3 2 2 1 1 3 1 1 1 2 1 3 2 1 3 1 2 1 1 3 2 3 1 1 2 1 1 3 2 1 1 1 2 2 3 1 1 1 3 2 3 2 1 2 1 3 2 3 1 1 3 1 2 3 2 1 2 3 2 2 2 1 2 2 3 2 2 3 2 3 2 1 1 2 2 2 1 3 1 1 2 1 2 1 3 2 3 1 1 3 1 3 1 2 1 3 3 2 2 1 2 3 1 1 1 3 1 3 2 1 2 3 2 3 2 2 1 1 1 2 2 1 2 2 1 2 3 2 3 1 1 3 1 1 3 1 1 2 3 1 2 2 1 3 2 1 1 2 1 1 3 2 2 3 1 1 3 1 3 1 1 2 2 3 2 2 3 2 2 3 1 2 3 2 2 2 3 1 2 3 2 1 1 2 2 3 2 2 1 1 1 3 3 2 3 1 1 1 3 1 2 2 2 3 1 3 2 2 2 3 2 1 2 1 1 2 1 3 1 3 1 1 2 1 2 1 3 1 2 2 3 1 3 1 2 2 2 3 2 2 2 2 2 3 1 3 1 2 3 2 3 1 2 3 1 2 1 1 1 3 2 2 1 1 3 2 2 3 2 1 1 1 2 2 3 2 1 3 2 1 1 1 3 1 1 3 2 1 3 2 3 2 2 1 2 3 1 2 3 2 2 3 2 2 2 3 2 1 2 2 1 2 1 2 2 1 2 2 3 2 3 2 1 3 1 2 3 2 1 2 2 1 1 3 1 3 3 2 2 1 3 1 1 1 3 1 2 2 2 1 3 1 1 3 2 2 1 3 2 2 2 2 3 2 3 2 1 2 2 1 1 3 1 3 1 3 2 3 1 1 1 2 1 2 3 2 2 2 1 1 3 1 2 1 3 1 1 1 3 1 3 2 3 1 2 2 2 1 1 1 2 3 1 3 1 1 1 2 1 3 1 2 1 3 2 2 1 2 2 3 2 3 2 3 1 1 2 2 3 1 1 2 1 1 3 1 1 2 2 2 3 2 2 3 2 3 1 1 2 1 1 3 1 2 2 3 1 1 2 2 1 3 2 3 1 3 2 1 1 3 1 1 2 3 2 2 2 3 1 3 1 3 1 2 2 2 1 3 2 1 1 1 3 1 1 3 2 2 2 1 3 1 1 2 1 3 1 1 1 2 3 2 3 2 2 2 3 1 2 1 2 1 1 3 2 1 1 3 2 3 2 2 1 1 3 1 2 2 2 3 1 3 3 2 1 3 2 3 1 1 2 1 1 3 2 2 1 3 2 3 2 2 1 1 2 1 1 1 3 2 3 2 3 2 2 1 1 1 3 2 1 1 1 2 3 2 1 3 1 2 1 3 1 3 1 2 3 2 2 2 1 2 3 2 2 3 2 3 1 1 2 2 1 1 1 3 2 2 3 1 1 2 1 2 2 3 1 2 3 1 2 1 1 3 1 1 3 1 2 3 1 1 2 3 2 3 1 3 1 2 3 2 2 2 1 3 1 1 2 1 1 2 1 1 2 1 1 2 3 1 2 3 2 1 1 3 2 2 2 3 1 3 2 2 2 3 1 1 1 3 1 3 2 3 1 1 2 1 3 1 1 1 2 1 1 3 1 3 1 1 1 1 2 1 1 1 3 2 2 1 2 2 3 1 3 1 3 1 3 2 2 2 1 3 1 3 2 1 3 2 3 2 2 3 2 1 3 2 2 2 1 3 2 1 2 1 2 1 3 2 1 1 3 1 1 2 3 2 1 2 2 1 3 1 2 1 2 2 2 3 2 3 3 1 2 1 1 1 2 3 2 2 2 3 1 2 1 1 1 3 2 1 3 2 2 3 1 2 1 3 2 1 2 3 2 1 2 3 2 3 2 3 1 1 3 1 2 2 2 1 1 2 3 1 1 2 3 2 1 3 1 3 2 3 1 2 2 1 3 2 2 2 1 1 3 2 1 3 2 1 2 2 2 1 3 2 3 1 2 3 2 1 1 3 1 1 2 1 1 3 1 1 2 2 3 2 1 2 2 3 1 1 3 1 1 3 1 1 2 1 2 3 2 2 2 1 2 1 3 1 1 2 2 3 1 3 1 3 1 1 3 2 2 1 1 3 1 1 1 3 2 1 3 2 1 3 1 3 1 2 2 2 3 1 3 1 1 2 2 1 2 2 2 1 1 1 3 1 1 1 3 2 1 2 2 3 2 1 1 3 1 3 2 3 1 1 1 2 2 3 1 3 1 1 1 3 2 3 1 1 2 3 1 1 3 2 2 2 1 1 3 1 1 1 2 1 1 3 2 1 2 3 1 2 1 3 2 1 3 2 1 3 1 2 2 2 3 1 1 2 2 3 2 1 2 2 3 2 1 3 2 2 2 3 2 3 1 1 3 1 3 1 1 2 1 1 2 3 2 1 3 1 3 1 2 1 2 1 1 3 2 3 2 3 2 1 1 2 1 3 2 2 3 2 2 1 1 2 3 1 3 2 1 1 2 1 2 1 3 2 2 3 2 1 3 2 2 2 1 3 1 2 3 1 1 2 3 2 1 2 2 3 2 3 2 2 1 3 1 1 2 3 1 2 3 2 2 1 1 2 1 3 3 2 2 2 3 2 1 2 1 3 2 1 2 2 2 3 1 2 2 3 1 2 3 2 1 3 1 3 2 1 1 1 3 2 1 2 3 1 3 2 2 1 2 3 1 1 2 1 3 1 1 1 3 2 2 2 1 1 3 2 3 1 2 3 2 1 2 1 2 2 3 2 2 2 1 1 1 2 3 1 2 1 1 1 3 1 3 2 1 3 2 3 1 1 3 2 2 2 1 1 1 2 3 2 3 2 3 1 3 1 1 3 1 2 3 1 1 2 1 1 1 2 2 2 3 2 1 2 1 1 1 3 2 3 1 1 3 1 1 3 1 3 1 1 2 3 1 2 2 1 3 2 1 2 2 2 3 2 3 1 1 3 1 3 1 2 2 2 2 2 2 3 1 1 2 3 1 1 1 2 2 3 1 2 3 1 2 1 3 1 2 3 1 3 1 3 2 1 1 3 1 2 2 1 1 3 1 1 2 1 1 3 1 1 1 3 1 2 2 3 1 1 2 2 3 1 3 1 1 3 2 3 1 1 3 2 1 1 1 2 2 2 2 1 3 1 3 1 1 3 2 1 2 2 3 2 2 2 3 1 1 1 3 1 2 1 1 1 3 2 3 1 1 1 3 1 2 2 2 3 1 1 1 2 3 1 2 3 3 1 1 1 3 2 2 1 3 1 3 1 1 1 2 3 2 1 3 1 1 1 2 2 3 2 3 1 1 2 1 1 2 3 1 1 3 1 1 3 2 2 1 2 3 2 2 1 2 2 3 2 3 1 1 2 1 1 1 3 2 1 3 1 2 3 2 3 2 2 1 2 2 2 1 2 1 2 3 1 2 1 2 3 1 3 2 2 2 3 2 3 2 2 3 1 2 2 3 1 2 2 2 3 2 3 2 3 1 3 2 1 2 2 1 3 2 2 1 2 1 1 1 3 2 3 1 2 2 1 1 3 2 2 1 3 2 2 2 3 1 3 1 2 2 2 3 2 1 2 2 2 3 2 1 2 1 1 2 3 2 2 3 1 1 3 1 3 3 2 2 2 3 1 1 1 2 2 1 3 2 3 2 3 1 3 1 1 1 2 1 2 1 1 2 3 2 2 3 1 3 1 2 2 3 1 2 1 1 2 3 2 2 3 1 1 2 1 3 2 1 3 2 1 3 2 1 2 2 3 2 2 3 2 1 1 2 1 1 3 3 2 2 3 2 1 1 2 2 2 3 1 3 2 3 2 2 1 3 2 2 1 2 2 2 3 1 1 2 1 2 3 1 2 1 3 2 2 1 3 2 1 1 2 2 3 2 3 2 3 1 2 1 3 2 1 2 3 2 2 2 3 2 3 1 2 2 1 1 1 3 1 3 1 2 3 2 1 2 1 1 1 3 1 3 2 1 2 3 2 2 1 2 1 1 3 1 3 2 3 1 3 1 2 2 2 1 3 1 1 3 1 2 3 2 2 1 2 2 1 1 2 3 1 3 1 1 2 2 2 3 2 2 1 1 1 3 1 3 1 1 1 3 2 1 1 1 3 1 1 2 2 1 3 2 1 2 3 1 2 1 3 1 2 3 1 3 1 2 1 3 1 3 2 2 3 2 1 2 1 3 2 2 2 1 2 1 3 2 2 3 1 3 2 1 3 1 1 2 3 1 2 2 3 2 2 2 1 3 1 1 3 1 2 2 2 3 2 2 2 1 2 3 2 2 2 3 1 3 1 1 3 1 3 2 2 1 2 2 2 2 1 3 1 1 3 2 2 2 3 1 1 1 3 2 2 1 2 2 3 1 2 2 3 3 1 2 3 1 1 3 1 3 2 1 2 2 2 3 2 2 1 2 1 2 3 2 1 3 1 2 3 1 1 2 1 2 1 3 2 1 1 3 2 1 2 2 3 1 3 2 1 2 1 3 2 3 1 2 3 1 1 1 2 2 2 3 1 3 1 2 1 3 1 2 1 3 1 1 1 3 1 1 1 2 2 3 1 1 3 1 3 2 2 2 3 1 2 1 2 1 2 2 2 3 1 3 2 1 2 2 2 3 2 3 2 1 2 2 3 1 1 2 3 1 2 3 1 3 2 2 3 1 1 1 2 2 2 3 1 1 3 2 1 2 2 3 2 2 2 1 1 2 1 3 2 3 1 3 1 3 1 3 2 1 2 1 2 3 2 1 1 1 2 2 1 1 3 1 3 1 3 2 3 1 3 2 1 1 1 2 3 2 1 1 1 1 1 3 1 1 2 1 3 1 2 3 1 3 1 2 2 1 3 1 1 1 2 1 3 1 3 2 2 2 1 1 1 3 1 3 2 2 1 3 1 1 2 2 3 1 1 1 3 3 2 1 1 3 1 2 2 2 3 2 2 3 1 1 2 1 1 1 3 1 1 3 1 1 3 1 3 1 1 1 3 1 1 3 2 2 1 1 1 3 2 3 1 2 1 2 2 2 1 1 2 1 3 1 3 1 1 3 1 3 1 2 3 2 1 2 3 1 1 2 1 2 2 1 2 2 1 3 2 3 1 2 1 1 3 2 3 1 1 3 2 2 2 1 3 1 2 1 1 2 3 2 1 1 1 3 1 2 3 1 3 2 2 2 1 2 3 1 3 2 2 3 1 2 2 2 3 1 3 1 3 2 2 3 1 2 1 1 3 1 2 2 2 1 2 3 1 2 2 1 2 2 3 2 3 2 3 2 1 3 1 1 2 2 1 3 1 2 1 2 1 1 1 3 1 2 1 2 1 3 2 1 3 1 2 3 1 2 3 2 3 2 2 2 1 3 2 2 3 1 3 1 2 3 1 1 3 2 2 1 2 2 1 3 1 1 2 2 3 1 1 2 2 3 1 2 1 2 1 3 2 3 2 1 1 1 3 2 3 3 1 1 3 1 1 1 3 1 2 2 1 2 2 3 2 1 2 2 3 1 3 2 2 1 2 2 3 1 3 2 3 2 1 3 2 3 1 2 2 2 1 3 1 1 1 2 1 1 1 2 1 1 1 3 2 3 2 2 2 1 1 3 1 3 2 1 3 1 3 2 1 3 2 1 3 1 3 1 2 1 1 2 2 3 1 2 3 2 3 2 1 1 2 2 2 1 2 1 2 2 1 3 2 2 1 1 3 1 1 1 3 1 1 3 1 3 2 2 3 2 2 3 2 1 3 2 2 3 1 3 1 1 1 2 1 2 3 2 1 3 2 2 2 2 1 3 1 3 2 2 3 2 2 1 1 1 3 1 3 2 3 2 1 1 1 2 1 3 2 2 1 2 3 1 2 3 2 3 2 1 2 1 1 3 2 1 1 2 1 2 3 2 2 2 3 2 2 1 3 1 1 2 3 1 3 1 1 3 1 2 2 2 1 2 3 1 3 2 1 2 1 3 2 2 2 1 1 1 3 1 1 3 2 1 3 2 1 3 1 3 2 3 1 3 1 2 1 2 1 3 1 2 2 2 1 3 1 1 1 3 2 1 1 2 2 3 2 2 2 1 2 1 3 2 3 1 1 3 2 3 1 1 2 1 3 2 1 1 1 3 2 1 1 3 2 1 3 2 1 1 2 1 3 2 3 2 3 2 2 1 1 1 2 2 2 3 2 3 1 3 2 2 1 2 3 1 1 1 3 1 2 1 1 3 1 3 1 1 1 3 2 1 3 1 3 1 1 2 1 1 1 3 1 2 1 1 3 1 1 1 2 2 2 1 1 3 1 2 2 3 2 2 1 1 3 1 3 2 1 3 1 1 3 3 2 2 2 1 1 1 3 1 2 2 3 2 1 1 3 1 1 2 3 2 3 2 1 2 2 2 3 2 3 1 1 3 1 2 3 1 1 3 2 1 2 2 2 3 2 1 2 2 3 2 3 2 2 2 1 3 1 1 2 2 2 1 3 2 1 2 3 2 3 2 1 3 1 2 1 1 2 3 1 2 2 1 2 1 3 1 1 1 3 2 3 2 2 2 3 3 2 2 1 2 2 2 3 2 1 1 3 2 2 1 1 3 1 2 1 3 2 1 3 1 3 2 2 2 1 2 2 3 1 1 1 3 1 3 2 2 2 3 1 1 2 1 3 2 2 3 2 3 2 2 2 1 2 2 3 2 3 2 1 3 2 2 2 1 1 1 3 1 2 2 3 2 3 1 3 1 1 3 1 2 1 2 3 1 1 1 3 2 2 1 2 2 3 1 3 1 1 2 3 2 1 1 1 3 1 1 2 3 2 2 2 1 2 2 3 1 2 3 2 3 1 1 1 3 2 2 1 2 3 1 2 3 2 2 1 1 2 2 3 3 2 2 2 1 3 2 1 2 2 1 3 2 2 3 2 2 1 1 3 1 2 2 3 3 1 2 2 3 1 2 1 2 2 2 3 1 1 2 3 2 2 2 3 2 2 2 3 2 3 1 1 2 2 3 1 1 1 3 2 3 2 1 1 2 3 2 2 3 2 1 2 3 1 2 2 3 2 1 2 2 3 2 2 3 1 3 1 1 2 1 3 1 1 2 1 1 1 1 2 2 2 3 1 3 1 2 2 2 3 2 3 1 2 1 3 1 3 2 1 3 2 1 1 2 2 1 3 1 2 2 2 3 2 2 2 3 2 2 3 2 2 3 2 3 2 2 2 3 2 1 2 2 3 2 2 1 3 2 3 1 1 2 1 2 1 3 2 1 2 3 2 1 3 2 1 3 2 1 3 1 2 3 2 2 2 1 2 3 1 1 2 2 3 2 2 2 1 1 1 3 1 2 3 1 2 2 3 1 1 3 1 1 1 2 3 2 3 2 3 1 2 1 1 2 3 1 2 3 2 2 1 2 2 2 3 2 3 2 1 1 2 1 3 2 2 3 2 3 1 3 1 1 2 2 2 3 2 1 1 2 2 1 3 1 2 1 3 1 2 3 2 1 1 3 1 3 1 1 1 2 2 3 2 3 1 1 1 1 3 1 2 2 1 1 3 1 3 1 1 3 2 2 1 1 2 1 3 1 3 2 1 3 1 1 3 2 1 1 1 2 2 3 2 3 1 1 2 3 1 1 1 3 1 1 1 1 1 2 3 2 1 1 3 1 1 1 3 1 1 3 1 2 2 3 2 2 3 2 1 2 2 2 3 1 2 2 2 1 2 3 2 3 2 2 1 2 3 2 2 3 1 3 2 3 2 1 2 2 3 1 3 1 1 1 2 2 2 3 1 1 3 1 1 2 3 1 1 3 1 1 2 2 3 2 1 2 3 1 1 1 2 3 1 1 2 2 3 2 1 1 3 2 1 2 2 3 2 1 3 1 1 3 2 1 1 1 3 2 2 1 3 1 1 3 2 2 2 2 1 2 3 2 1 1 2 3 1 2 1 1 3 2 3 2 1 3 2 2 3 1 2 1 2 1 3 2 2 3 1 1 1 2 2 3 2 3 1 2 1 3 2 3 2 1 2 1 1 3 1 1 1 2 2 1 3 1 3 1 3 2 2 3 2 1 1 1 3 3 1 1 2 2 3 2 3 1 1 1 2 3 2 3 1 2 2 3 1 2 1 2 1 1 1 1 2 1 1 3 2 1 3 2 2 2 1 1 2 3 1 3 1 3 1 1 3 3 1 2 2 1 1 1 3 1 1 3 2 1 1 3 2 3 1 1 2 3 2 2 2 2 1 2 3 2 3 2 3 2 2 3 2 2 2 1 3 2 3 2 2 1 2 2 1 3 1 3 2 2 1 2 1 2 3 2 1 3 2 2 1 3 1 3 2 2 1 2 1 3 1 1 1 3 1 1 1 3 1 1 3 2 3 2 2 1 1 3 2 2 1 1 1 2 1 3 2 1 2 2 1 3 2 1 1 3 2 1 2 3 2 3 1 2 2 3 2 2 2 3 2 3 2 3 1 2 2 3 1 1 2 1 2 2 3 2 3 1 1 1 2 1 2 3 2 3 1 1 1 3 1 3 2 2 1 1 3 2 3 1 2 2 1 1 1 3 1 2 2 3 1 1 2 3 1 2 2 3 1 3 1 2 1 2 3 2 1 1 1 1 1 3 1 2 3 1 2 1 3 2 2 1 1 3 2 3 2 1 1 3 2 2 1 2 1 3 2 2 3 2 2 1 2 2 3 1 3 1 1 2 2 2 1 3 1 1 3 2 2 2 1 2 1 3 2 3 1 1 2 2 1 2 3 1 3 2 3 1 1 1 3 3 1 2 1 3 1 2 2 2 1 3 1 1 2 3 1 1 2 2 1 1 3 2 3 2 2 2 3 1 1 3 1 1 3 1 3 1 2 2 2 3 1 1 1 2 2 3 1 1 2 3 1 1 2 1 1 3 1 3 2 2 3 1 2 1 1 1 2 3 2 3 1 2 3 2 2 2 1 2 3 2 1 3 2 3 2 1 3 1 2 2 3 1 1 2 2 2 2 2 1 1 3 2 3 1 3 2 2 1 2 1 3 1 1 3 2 1 3 2 1 3 1 2 2 2 1 2 3 2 3 2 2 2 3 1 1 3 2 2 1 1 3 1 2 2 1 3 2 2 1 3 1 3 1 1 1 3 2 3 1 2 1 1 1 3 2 2 1 3 2 1 1 2 3 1 2 1 1 2 3 1 1 3 2 3 2 1 2 1 2 1 3 1 1 2 3 1 1 3 2 3 2 2 1 3 2 1 2 1 3 1 2 1 3 2 1 2 1 1 1 2 2 3 1 3 2 2 2 3 2 2 2 3 1 2 2 3 2 1 3 2 1 1 2 3 1 1 3 1 1 2 1 1 3 2 1 2 3 1 3 2 3 2 2 1 1 1 2 3 2 1 1 2 1 3 2 3 2 2 3 2 2 1 3 2 2 1 3 1 3 1 3 2 2 1 3 2 3 1 1 1 2 3 2 2 3 2 2 1 1 1 2 3 1 1 1 2 1 3 1 1 1 2 3 2 1 2 2 3 2 2 2 3 2 3 1 1 3 2 2 1 2 1 1 3 2 2 2 3 2 3 1 3 1 1 2 2 1 1 3 3 1 3 2 2 2 1 2 1 3 2 2 1 3 1 1 2 1 2 3 2 2 3 2 1 3 1 3 2 2 1 2 2 1 3 1 1 3 1 1 3 1 2 2 2 1 1 3 3 1 3 2 2 1 1 2 3 1 1 1 2 1 1 3 2 1 2 2 2 3 2 3 1 2 3 1 2 3 1 1 2 1 3 2 2 3 1 1 3 2 1 2 1 2 1 3 1 2 1 3 1 2 1 2 3 1 3 1 2 3 1 1 1 3 2 2 1 3 2 1 2 1 2 3 2 1 1 1 3 1 1 1 3 2 3 1 1 1 3 1 1 3 1 1 2 3 1 1 2 3 2 1 3 1 1 1 2 3 1 1 2 3 2 2 3 1 1 1 1 1 2 2 3 1 1 2 1 3 2 3 2 3 2 3 1 3 2 2 2 1 1 2 1 3 1 2 1 2 2 3 2 2 2 3 1 2 2 1 1 2 3 1 1 3 1 3 1 1 1 3 2 2 3 2 1 1 1 3 2 2 3 1 1 3 1 2 1 1 1 3 3 2 2 1 1 3 1 3 1 2 2 1 2 3 1 3 1 2 3 2 1 2 2 1 1 3 1 1 3 1 2 1 2 1 1 3 1 1 3 1 2 2 3 1 1 2 2 3 3 2 1 3 1 1 1 2 2 2 3 1 1 2 2 3 1 2 3 2 3 1 1 1 1 1 3 1 3 2 1 3 1 2 2 3 1 2 1 1 3 2 1 2 1 2 3 1 2 3 1 2 1 2 1 3 2 1 3 2 3 1 1 3 1 1 1 2 1 1 3 2 1 3 1 2 1 1 2 3 1 2 3 1 3 1 1 1 2 3 1 1 3 1 2 1 1 2 3 2 3 1 1 1 3 2 1 2 2 2 3 2 3 1 2 1 2 1 3 2 1 1 2 1 1 3 1 3 1 1 2 2 3 1 2 1 2 3 1 1 3 1 2 3 2 1 1 3 2 3 2 1 2 2 2 1 3 2 1 3 1 1 2 3 1 1 3 2 2 1 2 3 2 2 1 3 1 2 2 2 3 2 2 3 1 3 1 2 2 3 1 2 1 3 2 2 2 3 2 1 2 3 1 1 3 1 3 1 2 1 3 2 1 2 2 2 3 1 3 1 1 1 2 3 2 2 1 2 3 2 1 2 2 2 1 3 2 1 3 2 2 1 2 3 2 3 1 3 1 1 2 3 2 3 2 2 2 3 1 2 2 2 1 1 3 2 1 2 3 2 2 2 3 2 2 2 1 2 1 3 1 1 2 3 2 1 2 3 3 1 3 2 1 2 1 2 1 3 1 1 3 1 1 1 3 1 1 1 2 2 2 3 1 2 3 1 3 2 3 1 1 3 2 1 1 1 2 3 2 1 3 2 2 1 2 2 2 2 1 1 3 1 1 3 2 3 1 3 2 2 1 2 2 3 2 3 1 2 1 2 1 2 3 1 1 1 2 3 1 3 1 1 2 1 2 2 3 2 2 3 2 2 2 3 3 1 2 2 1 1 2 3 1 2 2 1 2 3 2 3 1 1 2 2 3 1 2 3 3 1 1 1 2 3 2 2 1 1 1 3 1 2 1 2 3 1 1 1 3 2 1 3 2 1 2 2 3 2 2 3 1 2 2 2 3 1 2 1 2 2 1 3 2 3 2 3 2 2 2 1 2 3 2 2 2 3 2 3 2 1 2 3 2 1 1 3 2 1 3 2 1 1 2 2 3 1 1 1 3 1 1 2 2 3 2 3 2 3 1 1 2 2 3 1 2 3 1 3 2 2 2 3 1 1 2 2 2 3 2 2 2 3 1 3 2 1 1 2 3 1 2 3 2 1 2 1 1 2 3 1 2 3 2 3 2 3 2 1 1 1 2 2 1 2 3 2 3 1 3 1 3 1 1 3 1 1 2 2 2 3 2 2 2 1 2 2 3 2 3 1 2 1 1 1 3 2 1 2 2 3 2 2 3 1 2 1 3 1 1 1 3 1 1 3 2 1 3 1 1 2 1 3 1 1 1 3 2 2 1 1 2 1 3 1 2 2 3 2 3 2 1 3 2 2 1 1 3 1 3 2 2 3 2 2 2 1 1 2 2 1 3 2 1 3 2 1 1 3 2 2 3 2 2 1 3 1 1 2 1 3 2 2 1 1 2 2 2 3 1 1 3 2 1 2 1 1 2 3 1 1 2 3 2 3 2 3 2 1 3 1 1 1 2 2 3 2 1 3 2 1 2 2 2 3 1 3 1 3 1 1 2 3 2 1 2 1 2 3 2 2 1 1 2 3 1 3 1 2 3 2 2 3 2 1 2 1 2 2 2 3 1 2 1 1 3 1 3 1 1 2 3 1 1 3 1 1 3 2 2 2 3 1 1 2 1 3 2 3 2 1 1 2 3 1 1 2 1 2 3 1 2 3 3 2 1 3 2 2 2 3 2 3 1 1 2 1 3 1 1 2 2 1 3 2 2 2 1 1 1 3 1 2 3 1 2 2 3 2 1 1 2 2 2 3 2 3 2 3 1 1 3 1 1 3 1 2 2 3 2 2 3 1 3 2 2 1 1 2 1 3 1 2 1 1 1 3 1 2 2 1 2 3 2 1 3 2 3 1 2 3 2 1 1 1 2 3 2 2 3 1 1 2 2 2 1 3 1 2 3 2 1 3 1 2 1 2 3 1 1 2 3 2 3 1 2 1 3 1 1 3 2 3 2 1 2 2 1 1 3 2 1 1 3 2 2 1 2 1 2 3 1 1 2 2 1 2 3 1 3 1 1 3 1 1 2 1 3 1 3 2 2 2 2 3 2 2 1 2 3 1 1 3 2 3 1 2 2 2 3 2 2 2 3 2 3 2 1 1 1 3 1 2 2 3 2 3 2 2 1 2 1 2 3 1 1 1 2 3 2 2 3 2 3 1 2 1 3 2 1 3 2 2 1 3 1 2 1 2 2 2 3 2 3 1 1 2 2 1 1 3 1 2 1 1 1 3 1 1 3 1 3 1 1 3 2 1 3 1 2 2 3 2 1 3 1 1 2 3 1 1 2 2 2 3 2 1 3 2 1 2 1 1 1 2 1 1 3 1 3 1 3 1 3 1 1 2 3 1 2 2 2 1 3 2 1 1 2 2 1 2 3 2 3 1 1 2 1 3 1 2 2 3 2 2 3 1 1 3 2 2 1 1 3 1 2 2 2 1 2 3 2 3 1 2 1 3 2 1 3 1 3 2 2 2 1 1 1 3 1 2 1 3 2 3 2 2 2 3 2 2 3 2 3 2 2 1 2 1 2 2 3 1 2 2 2 1 2 3 1 1 3 1 3 2 1 2 1 3 2 3 1 1 1 2 2 2 3 1 2 3 1 3 2 1 3 2 2 2 1 1 3 1 3 1 1 2 1 1 1 3 2 2 3 2 2 2 3 1 2 3 2 2 2 3 1 1 2 3 3 1 2 2 3 2 3 1 2 3 1 1 2 1 1 2 3 2 2 1 2 2 3 1 3 1 2 3 1 1 3 1 1 1 2 1 2 3 1 2 1 2 3 1 1 2 1 3 2 2 1 1 1 3 2 2 1 2 2 3 1 1 3 2 3 1 1 3 2 2 3 1 2 2 3 2 1 1 3 1 1 1 2 1 3 1 3 1 2 2 2 3 2 3 2 2 3 1 3 1 2 2 3 1 3 2 2 2 1 1 3 2 1 2 2 1 3 1 2 2 1 3 2 3 1 2 1 1 2 1 3 1 1 2 3 1 2 1 1 1 2 3 2 3 3 1 2 1 1 2 1 3 2 3 1 1 2 2 2 3 1 3 2 2 3 2 1 2 1 3 1 2 1 2 2 2 3 2 1 3 2 1 3 1 1 1 3 2 1 2 3 2 3 2 2 1 2 3 1 1 2 3 2 2 3 1 1 2 2 2 3 1 1 2 3 2 1 2 3 1 1 1 3 1 2 2 2 1 3 2 2 3 2 3 1 3 1 2 1 2 1 1 1 2 1 3 1 3 1 1 3 2 2 1 2 3 1 2 3 2 3 1 2 1 2 2 1 3 2 3 1 3 1 1 1 2 3 2 2 2 1 1 2 3 2 3 1 2 2 3 1 1 3 1 1 2 1 2 3 2 3 1 1 1 2 2 1 3 2 2 2 3 3 2 2 2 3 1 2 1 3 2 2 2 1 1 2 3 1 3 2 1 2 2 3 1 3 2 2 3 2 1 1 3 2 1 1 2 3 1 2 1 1 1 3 2 1 2 3 1 2 1 1 3 1 3 2 1 3 2 1 1 2 2 3 2 2 3 2 2 2 1 3 1 2 2 2 3 1 3 1 3 1 3 2 1 2 3 2 1 2 3 1 2 2 1 2 2 1 2 2 3 1 2 2 3 2 3 1 1 2 2 1 3 1 2 1 3 1 1 3 1 3 1 2 2 1 3 2 1 2 2 2 1 3 2 1 3 2 1 1 2 1 3 1 3 2 1 2 3 2 1 2 2 1 3 1 3 1 2 1 2 2 3 1 1 1 3 2 3 2 1 2 3 2 3 1 1 1 3 2 1 1 2 3 1 2 1 1 1 2 3 1 3 3 2 1 1 2 2 1 3 2 1 1 2 3 1 2 2 2 3 1 1 2 3 1 3 3 2 2 2 1 2 2 3 2 1 1 1 3 1 2 3 2 1 1 3 2 3 1 1 2 1 3 2 1 3 1 1 2 2 3 2 2 3 2 2 1 1 1 3 1 1 2 3 2 1 2 2 3 2 2 1 3 2 2 1 2 3 2 1 3 2 3 2 3 2 1 1 3 1 3 2 3 1 1 1 3 2 2 1 2 1 2 3 1 1 1 3 2 1 2 1 1 2 1 2 1 3 1 1 3 2 2 3 1 2 3 1 3 2 2 2 1 2 3 1 2 2 2 1 3 1 1 3 2 1 1 3 1 1 2 1 1 3 2 3 1 3 2 1 2 3 2 3 2 1 2 1 1 3 1 2 1 2 2 2 3 2 1 1 3 1 1 3 2 1 3 1 1 3 1 3 2 2 3 2 1 2 2 3 2 2 1 2 1 1 3 2 3 2 3 2 2 1 2 2 1 3 2 2 2 1 1 3 2 2 1 3 1 3 2 1 1 1 2 1 2 1 3 2 3 1 2 3 2 3 1 1 1 2 2 3 1 1 2 3 2 2 1 3 1 3 1 1 2 1 3 1 3 2 3 1 2 2 1 2 1 3 2 2 3 1 1 3 2 3 1 3 2 2 1 1 2 3 1 2 2 2 3 2 1 1 1 2 1 1 2 3 2 1 1 1 3 2 1 1 1 3 1 1 1 3 2 3 1 2 3 1 3 2 2 1 3 2 2 1 2 3 1 2 3 1 1 2 1 2 2 3 2 3 2 1 1 1 1 2 3 1 3 2 2 1 3 1 3 2 1 3 1 1 2 2 1 2 3 2 3 1 2 1 2 1 3 1 1 3 1 2 2 1 3 2 2 1 3 2 3 1 2 1 1 2 1 3 2 2 2 3 2 2 3 1 3 1 2 2 2 1 2 3 1 3 2 1 2 1 3 1 1 2 1 3 2 2 1 3 2 1 3 2 1 1 3 1 3 2 1 2 3 1 1 2 2 2 3 2 1 2 2 3 2 3 1 1 3 2 2 2 1 3 2 1 3 2 1 3 2 1 1 3 1 1 3 1 3 1 1 2 2 1 3 1 2 2 1 1 1 1 2 3 2 3 2 2 1 2 3 2 1 2 3 2 1 1 1 2 1 3 2 3 3 1 1 2 2 1 3 2 2 1 3 1 3 2 1 1 1 2 2 3 2 2 2 3 3 1 1 1 2 2 3 1 1 3 1 2 1 3 2 1 1 3 1 1 1 2 3 1 3 2 3 2 1 2 2 1 2 3 2 3 1 2 2 2 1 2 3 1 2 1 3 1 2 1 2 2 1 2 3 1 3 1 1 1 3 2 2 3 1 1 2 1 3 2 1 3 2 1 2 3 2 1 2 2 3 2 1 2 2 3 1 3 2 1 3 1 2 3 1 1 3 2 3 1 2 2 3 1 1 2 1 3 2 1 3 1 2 2 3 2 2 2 1 1 1 3 2 1 1 3 2 2 3 2 2 2 3 1 2 2 3 1 1 1 2 2 2 3 3 1 1 3 2 2 2 3 1 2 2 2 1 1 3 2 2 2 1 1 3 1 1 3 3 1 3 1 1 3 1 2 1 1 1 2 3 1 2 1 2 2 3 2 2 1 2 3 1 2 3 1 2 3 1 3 2 2 3 2 2 1 1 2 1 3 2 2 1 3 2 2 2 1 2 3 1 2 1 2 2 2 3 1 1 3 1 3 2 3 2 2 1 1 3 1 3 1 3 1 2 3 1 2 2 1 1 1 3 2 3 1 2 2 2 1 2 3 1 1 1 2 1 3 2 2 1 1 3 1 3 2 3 1 2 3 1 3 1 1 2 1 1 1 2 2 2 1 2 2 3 2 2 1 3 1 2 1 1 1 3 1 3 2 2 3 1 3 1 3 1 1 2 1 2 2 3 1 2 1 3 2 2 3 1 1 3 2 2 3 1 1 2 1 3 2 3 2 1 1 1 3 2 3 2 1 3 1 2 2 3 2 1 1 1 2 1 3 2 1 3 2 3 1 2 1 2 3 1 2 2 2 3 1 1 2 1 2 2 3 2 3 2 1 2 2 3 1 1 2 2 1 3 1 1 2 1 3 2 3 1 3 1 1 2 3 1 2 1 2 3 1 3 1 2 1 3 1 1 3 2 2 2 1 1 2 3 2 3 1 1 3 1 1 3 2 1 1 3 2 1 2 1 1 1 3 2 1 1 1 2 3 2 2 2 1 1 3 2 3 2 3 1 2 1 1 3 1 1 1 3 1 2 1 3 1 2 1 2 2 3 2 2 3 1 1 2 3 2 3 2 2 2 1 1 1 3 1 3 1 3 1 1 2 1 1 2 3 1 2 3 1 3 1 2 3 1 2 2 1 2 2 3 1 2 1 3 1 3 1 1 1 3 1 3 1 3 1 1 2 2 3 2 1 2 2 1 1 1 2 3 2 1 2 1 1 2 3 1 3 1 2 1 2 3 2 2 2 3 2 3 1 1 1 2 1 3 1 2 1 1 3 1 2 2 3 1 2 2 3 2 3 2 2 2 3 2 2 2 3 1 2 3 1 2 1 1 2 1 3 1 1 3 1 3 1 1 2 3 1 1 3 1 2 3 1 1 2 1 1 3 2 2 3 2 3 1 1 2 3 2 2 2 1 1 3 1 2 3 1 1 1 3 1 1 1 3 2 3 2 1 3 1 1 2 1 2 2 2 3 2 2 1 1 1 2 3 2 1 2 3 2 1 3 2 1 1 2 2 3 1 3 2 1 3 2 1 3 2 3 2 3 1 1 3 2 2 1 2 2 2 3 2 2 1 2 1 3 2 3 1 1 2 3 2 2 2 3 2 1 1 1 3 1 3 2 2 2 1 1 3 1 2 1 1 1 2 3 1 3 1 1 2 2 3 1 3 2 1 1 2 2 3 2 2 3 1 2 3 1 3 1 1 1 2 2 3 2 2 2 1 1 3 2 3 2 2 2 1 1 1 2 1 1 3 2 1 3 2 3 2 3 1 3 2 1 1 2 1 3 2 1 2 1 2 3 1 1 1 2 1 2 3 2 3 1 2 1 3 2 1 1 3 1 3 1 1 2 2 3 2 1 1 3 1 3 2 3 1 2 2 1 2 1 3 1 2 3 1 2 1 3 1 3 2 1 1 3 1 1 2 3 1 1 1 3 1 3 1 2 1 1 2 1 2 1 1 3 2 1 1 3 2 1 3 1 2 3 2 2 1 1 1 3 1 3 1 2 1 1 1 2 1 3 1 1 1 3 1 1 2 2 3 2 1 3 1 3 2 1 3 2 1 2 1 3 1 2 2 2 1 1 3 2 3 1 1 3 1 3 1 3 2 2 1 2 3 1 1 2 3 2 2 2 3 2 1 1 1 2 3 2 1 2 1 3 1 2 1 3 1 1 1 2 1 3 1 1 2 3 1 3 2 1 3 2 3 1 1 1 2 1 2 3 2 2 3 1 1 2 2 1 2 3 2 1 3 1 3 1 1 1 3 2 1 1 1 3 2 1 3 2 1 1 1 2 2 3 1 3 1 3 2 1 3 2 2 3 1 1 2 2 2 3 2 1 1 1 3 2 3 2 2 2 1 2 1 3 2 3 2 3 2 1 1 2 1 2 1 2 3 1 2 2 2 3 1 3 1 2 3 1 3 1 1 2 3 2 1 1 1 1 2 1 2 2 3 1 2 1 2 3 2 3 2 2 3 2 3 1 1 3 2 1 1 3 2 3 1 3 1 2 2 1 2 3 1 3 2 1 2 2 3 1 2 2 2 1 2 2 3 2 1 2 2 2 1 3 1 2 1 3 2 3 1 3 1 2 2 1 2 3 1 2 1 3 1 1 1 2 3 1 1 1 3 1 2 1 3 1 2 1 3 1 1 3 3 1 2 2 3 2 1 2 1 2 3 2 1 1 1 3 2 1 3 2 2 2 1 3 2 1 2 3 1 1 2 3 2 2 1 2 2 3 2 3 2 3 2 2 3 1 2 2 3 1 2 1 2 2 1 3 2 1 3 1 3 2 1 1 3 2 1 2 1 2 2 3 2 3 1 3 1 2 3 1 1 2 2 2 3 2 3 2 2 1 2 3 1 2 1 2 2 1 2 3 1 1 2 3 1 1 3 2 1 1 1 3 1 3 1 2 3 2 1 1 3 1 3 2 3 1 1 2 2 2 3 2 2 3 2 1 1 2 2 2 3 2 2 2 1 3 1 1 1 2 2 3 2 1 3 1 3 2 2 1 1 2 2 3 2 3 2 1 3 2 3 2 2 1 1 2 3 1 1 1 3 2 2 3 2 3 1 1 2 1 1 2 2 3 2 3 1 2 2 2 3 2 2 1 1 3 1 1 3 1 2 2 1 1 2 3 1 3 2 1 3 2 1 2 2 3 2 1 1 1 3 2 1 2 1 1 1 3 1 3 2 3 1 2 2 3 2 2 3 2 1 2 1 3 2 2 1 2 2 3 2 3 2 1 3 1 2 2 3 2 1 3 2 2 2 1 1 2 3 2 2 1 1 3 1 1 2 3 1 2 3 1 1 1 2 1 1 3 1 1 1 2 2 3 1 3 2 1 3 1 3 1 2 1 2 3 1 2 3 1 2 1 2 2 2 3 2 2 3 2 1 2 3 2 3 2 2 2 2 1 3 1 3 2 2 2 3 1 2 2 1 3 2 1 2 3 2 2 2 3 1 1 2 1 1 3 1 3 1 2 2 3 2 3 1 2 3 1 3 1 1 1 2 1 1 1 2 3 1 1 2 1 3 1 1 2 1 3 1 3 1 1 2 3 2 1 3 1 3 2 1 3 2 1 3 2 1 1 2 2 2 3 1 1 2 3 2 2 2 3 1 1 1 3 2 3 1 3 2 1 1 2 2 3 1 2 2 3 1 2 2 3 2 2 1 1 3 1 1 2 1 1 2 3 2 2 2 1 3 2 3 2 3 2 2 2 3 1 1 1 1 2 1 2 3 1 1 1 3 2 1 3 1 3 1 1 1 3 2 3 2 2 1 2 2 3 1 3 2 2 1 2 2 3 2 1 2 2 2 1 3 2 2 2 3 1 1 3 2 1 3 2 2 3 1 3 2 2 2 1 1 1 3 2 2 3 1 1 1 3 1 1 2 1 1 1 3 1 3 2 3 1 2 3 2 1 1 1 2 1 3 1 1 3 2 2 2 3 2 1 3 2 3 2 2 2 1 3 1 3 2 1 1 3 2 2 1 2 2 1 1 3 1 3 1 2 2 1 1 2 3 2 3 2 2 3 1 1 1 3 1 2 2 1 3 2 1 1 2 1 1 3 2 2 3 2 3 1 1 1 3 1 1 3 1 2 2 1 3 1 3 1 2 3 2 2 1 2 1 3 1 2 1 1 2 3 1 1 1 3 1 1 2 2 2 1 3 2 2 3 1 2 2 3 2 2 3 1 1 2 1 3 1 3 2 1 1 2 2 1 2 2 3 1 1 1 3 2 1 3 1 2 3 2 2 1 3 1 2 3 2 2 2 1 2 3 2 3 2 3 1 2 2 3 1 3 2 3 2 2 2 1 1 2 2 1 2 2 2 1 3 2 2 1 3 1 2 1 3 1 2 1 3 1 3 1 3 2 1 2 3 2 3 2 2 2 1 2 3 2 3 1 1 1 3 1 2 2 2 3 2 1 1 2 1 3 2 1 1 2 2 1 3 1 1 3 1 3 1 1 3 1 1 2 3 2 2 1 2 3 1 3 2 3 1 2 2 1 3 1 1 2 2 3 2 1 2 2 2 3 2 2 1 1 2 3 2 1 2 2 3 2 2 2 1 1 1 3 1 3 2 3 2 3 1 2 1 3 1 3 1 1 2 2 1 1 3 1 1 2 2 3 2 2 2 3 1 3 3 2 2 1 2 1 1 3 2 1 3 1 1 1 2 3 2 1 2 1 3 1 1 3 1 3 2 1 1 2 2 1 3 2 2 2 3 1 1 1 2 3 2 3 2 1 3 2 3 1 1 1 3 1 2 2 1 2 3 1 2 2 3 2 1 1 1 3 2 3 1 2 3 2 1 1 3 1 2 2 1 3 1 1 3 2 2 1 1 2 3 1 1 3 1 1 3 1 3 1 1 2 3 2 2 3 1 1 2 1 1 3 1 1 3 2 1 1 2 2 2 2 1 1 3 1 3 2 3 2 2 2 3 1 1 2 1 3 2 3 2 2 2 1 1 2 1 1 1 3 1 1 1 3 1 3 2 1 2 3 1 3 1 2 2 1 2 3 1 3 2 2 1 2 2 3 1 2 2 3 1 1 3 1 2 3 1 3 1 1 1 2 3 2 2 2 3 2 3 2 2 2 3 2 1 2 1 1 3 2 2 3 2 2 1 1 2 2 3 2 1 2 3 2 3 1 3 2 2 2 1 3 1 2 2 1 1 2 3 1 2 1 3 2 2 1 1 1 3 2 1 2 1 3 2 2 3 2 2 2 3 1 3 2 1 1 1 2 2 2 3 2 3 2 2 3 1 3 1 2 2 2 3 2 1 2 1 3 2 1 2 2 1 3 2 3 2 2 1 2 3 1 2 1 1 1 3 1 3 1 1 3 2 1 2 1 1 3 1 1 3 2 1 1 2 2 2 3 1 3 1 1 3 1 3 2 2 1 1 3 2 2 3 1 3 1 2 3 2 2 2 3 2 2 2 3 1 2 1 1 3 2 3 2 1 3 1 2 2 2 1 2 3 1 1 2 2 3 1 3 2 1 1 2 2 1 2 1 3 1 3 1 1 3 2 3 2 2 2 1 3 2 2 3 2 1 2 1 1 2 1 1 1 3 1 1 3 1 1 2 1 3 2 2 3 2 2 3 2 3 2 1 1 3 1 2 2 3 1 1 1 2 1 3 1 2 2 1 3 1 1 1 3 2 2 3 3 2 2 3 2 2 1 2 1 1 3 1 1 1 2 1 3 2 2 2 3 2 2 3 1 3 1 1 1 2 1 3 1 3 2 1 1 3 1 3 2 3 2 2 2 1 1 1 1 3 1 3 1 2 1 3 2 1 3 2 1 1 1 2 1 3 2 2 1 2 2 3 1 1 1 2 3 1 2 2 3 2 3 2 1 1 3 2 2 1 2 3 2 1 2 3 1 1 3 1 1 3 2 1 1 3 1 3 1 3 1 1 1 2 2 2 3 1 1 2 3 2 3 2 3 2 1 2 2 2 1 3 2 2 3 1 2 1 1 2 2 3 1 2 1 2 2 3 2 2 3 2 2 3 2 2 3 1 3 1 1 1 2 3 2 1 2 2 1 3 1 2 1 1 3 2 2 1 1 1 3 2 1 1 1 3 1 3 1 1 2 3 2 1 3 2 2 3 1 1 3 2 2 1 3 2 2 2 1 1 3 2 3 2 2 1 1 3 2 1 1 3 1 1 2 3 2 1 1 2 1 2 3 1 2 3 1 2 1 3 1 2 3 1 3 1 2 2 3 1 1 1 3 1 2 2 2 1 2 3 1 1 2 3 2 3 1 2 2 3 1 1 2 2 1 3 1 3 1 3 1 1 2 3 2 1 2 1 1 3 2 2 1 3 2 1 1 3 1 3 1 1 2 1 2 1 3 2 3 1 1 2 1 2 2 1 1 3 1 2 2 3 2 1 2 1 3 2 2 1 3 2 3 1 2 3 3 1 3 1 2 1 1 1 3 1 1 2 2 3 1 1 1 2 1 3 1 1 3 1 1 3 1 3 2 1 1 1 2 3 2 2 1 1 3 1 1 1 3 1 1 3 2 2 1 1 1 3 2 2 2 3 2 2 1 2 3 2 3 2 3 1 1 3 1 1 2 2 1 2 2 3 2 3 2 2 2 1 1 3 1 1 1 2 1 2 3 1 2 3 1 3 2 1 2 2 3 1 1 1 2 3 1 3 1 2 3 2 1 2 3 2 1 3 2 2 1 2 2 2 3 2 3 2 3 1 2 3 2 2 2 3 1 1 1 2 1 2 3 1 2 1 1 3 1 2 1 1 2 1 3 2 3 1 3 1 3 1 1 1 2 2 3 1 1 2 2 2 1 2 3 1 2 2 1 3 2 3 2 1 1 3 2 3 2 2 3 2 3 1 2 2 1 1 3 1 1 2 1 1 1 3 2 3 2 3 1 1 3 1 1 2 3 2 1 1 2 2 3 1 2 3 1 1 3 1 3 2 2 1 3 2 2 2 1 2 2 3 2 3 2 2 1 2 3 2 2 1 2 1 1 3 1 1 3 2 3 1 2 1 1 3 1 3 1 1 1 2 2 3 1 1 2 2 2 1 3 1 1 1 2 3 2 3 2 2 1 2 2 3 1 1 2 3 2 3 1 3 1 1 1 3 2 1 2 2 2 3 2 3 2 2 1 1 2 3 1 3 1 1 3 1 2 1 1 2 3 1 2 1 3 2 3 1 1 1 3 2 1 2 2 2 3 2 2 3 1 2 2 1 2 2 3 2 2 3 2 1 3 2 2 2 1 2 3 2 1 3 2 2 1 1 2 2 3 2 2 3 1 3 3 2 2 3 1 1 1 3 1 2 1 3 2 2 2 3 1 2 1 2 3 2 1 2 2 2 1 3 1 1 3 1 2 1 3 1 2 2 1 2 2 3 1 3 1 1 1 3 1 1 2 1 1 2 3 2 2 3 2 3 1 1 1 2 1 3 1 2 3 2 3 1 1 3 2 1 1 3 1 1 1 3 2 2 2 1 3 2 2 2 1 3 2 2 1 3 2 1 3 2 2 2 1 1 2 3 1 3 1 2 3 2 2 2 3 1 2 1 2 3 2 2 1 1 1 3 1 2 3 2 2 1 1 1 3 1 1 2 3 1 3 2 3 1 wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦16, M2≦13, M3≦20, M4≦16, and M5≦19, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; wherein: the score of an alignment is determined according to the equation (A×m)−(B×mm)−(C×(og+eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). 2. A composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences having the numeric pattern of sequences set out in claim 1, wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦19, M2≦17, M3≦21, M4≦18, and M5≦20, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; wherein the score of an alignment is determined according to the equation (A×m)−(B×mm) −(C×(og +eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1,and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). 3. A composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences having the numeric patterns set out in claim 1, wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦19, M17, M3≦21, M4≦18, and M5≦20, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score, wherein: the score of an alignment is determined according to the equation 3A−B−3C−D, wherein: A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignments. 4. A composition according to claim 1, wherein for the group of 24mer sequences in which 1=A, 2=T and 3=G, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all said oligonucleotides of the composition, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the composition does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement, and wherein when said maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10 more preferably between 1 and up to 9, more preferably between 1 and up to 8 more preferably between 1 and up to 7 more preferably between 1 and up to 6. and more preferably between 1 and up to 5. 5. The composition of claim 2, wherein for the group of 24mer sequences in which 1=A, 2=T and 3=G under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement for all said oligonucleotides of the composition the maximum degree of hybridization between an oliponucleotide and a complement of any other oliponucleotide of the composition does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement, and wherein when said maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10, more preferably between 1 and up to 9, more preferably between 1 and up to 8, more preferably between 1 and up to 7, more preferably between I and up to 6, and more preferably between 1 and up to 5. 6. The composition of claim 4 or 5, wherein the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 25%, more preferably does not exceed 20%, more preferably does not exceed 15%, more preferably does not exceed 10%, more preferably does not exceed 5%. 7. The composition of any of claim 4 or 5, wherein said defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. 8. The composition of claim 4 or 5, wherein said defined set of conditions includes the group of 24mer sequences being covalently linked to beads. 9. The composition of claim 4 or 5, wherein, for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement. 10. The composition of claim 4 or 5, wherein: each 1 is one of A, T/U, G and C; each 2 is one of A, T/U, G and C; and each 3 is one of A, T/U, G and C; and each of 1, 2 and 3 is selected so as to be different from all of the others of 1, 2 and 3. 11. The composition of claim 10, wherein 1 is A or T/U, 2 is A or T/U and 3 is G or C. 12. The composition of claim 11, wherein 1 is A, 2 is T/U and 3 is G. 13. The composition of claim 1 or 2, wherein each said oligonucleotide is from twenty-two to twenty-six bases in length, or from twenty-three to twenty-five. 14. The composition of claim 1 or 2, wherein each said oligonucleotide is of the same length as every other said oligonucleotide. 15. The composition of claim 14, wherein each said oligonucleotide is twenty-four bases in length. 16. The composition of claim 1 or 2, wherein no said oligonucleotide contains more than four contiguous bases that are identical to each other. 17. The composition of claim 1 or 2, wherein the number of G's in each said oligonucleotide does not exceed L/4 where L is the number of bases in said sequence. 18. The composition of claim 1 or 2, wherein the number of G's in each said oligonucleotide does not vary from the average number of G's in all of the said oligonucleotides by more than one. 19. The composition of claim 1 or 2, wherein the number of G's in each said oligonucleotide is the same as every other said oligonucleotide. 20. The composition of claim 19, wherein each said oligonucleotide is twenty-four bases in length and each said oligonucleotide contains 6 G's. 21. The composition of claim 1 or 2, wherein, for each said nucleotide, there is at most six bases other than G between every pair of neighboring pairs of G's. 22. The composition of claim 1 or 2, wherein at the 5′-end of each said oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonculeotide is a G. 23. The composition of claim 1 or 2, wherein at the 3′-end of each said oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonucleotide is a G. 24. The composition of claim 22, wherein at the 3′-end of each said oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonucleotide is a G. 25. The composition of claim 1 or 2, comprising ten, or twenty, or thirty, or forty, or fifty, or sixty, or seventy, or eighty, or ninety, or one hundred, or one hundred and ten, or one hundred and twenty, or one hundred and thirty, or one hundred and forty, or one hundred and fifty, or one hundred and sixty said molecules, or comprising one hundred and seventy said molecules, or comprising one hundred and eighty said molecules, or comprising one hundred and ninety said molecules, or comprising two hundred said molecules, or comprising two hundred and twenty said molecules, or comprising two hundred and forty said molecules, or comprising two hundred and sixty said molecules, or comprising two hundred and eighty said molecules, or comprising three hundred said molecules, or comprising four hundred said molecules, or comprising five hundred said molecules, or comprising six hundred said molecules, or comprising seven hundred said molecules, or comprising eight hundred said molecules, or comprising nine hundred said molecules, or comprising one thousand said molecules, or comprising eleven hundred said molecules. 26. A composition of claim 1 or 2, wherein each said molecule is linked to a solid phase support so as to be distinguishable from a mixture of other said molecules by hybridization to its complement. 27. The composition of claim 26, wherein each molecule is linked to a defined location on a said solid phase support, the defined location for each said molecule being different than the defined location for different other said molecules. 28. The composition of claim 27, wherein each said solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule. 29. A composition comprising a set of 150 molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1≦19/24×L1, M2≦17/24×L1, M3≦21/24×L1, M4≦18/24×L1, M5≦20/24×L1, where L1 is the length of the shortest sequence of the pair, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of an alignment is determined according to the equation (A×m)−(B×mm)−(C×(og+eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). 30. A composition comprising a set of 150 molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1≦19, M2≦17, M3≦21, M4≦18, and M5≦20, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of a said alignment is determined according to the equation 3A−B−3C−D, wherein: A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment. 31. The composition of claim 29 or 30, wherein each said sequence has up to fifty bases. 32. The composition of claim 31, wherein each said sequence is between sixteen and forty bases in length, or between sixteen and thirty-five bases in length, or between eighteen and thirty bases in length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between twenty-two and twenty-six bases in length. 33. The composition of claim 29 or 30, wherein each said sequence is of the same length as every other said sequence. 34. The composition of claim 33, wherein each said sequence is twenty-four bases in length. 35. The composition of claim 29 or 30, wherein no said sequence contains more than four contiguous bases that are identical to each other. 36. The composition of claim 29 or 30, wherein the number of G's in each said sequence does not exceed L/4 where L is the number of bases in said sequence. 37. The composition of claim 36, wherein the number of G's in each said sequence does not vary from the average number of G's in all of the sequences of the set by more than one. 38. The composition of claim 37, wherein the number of G's in each said sequence is the same as every other sequence of the set. 39. The composition of claim 37, wherein each said sequence is twenty-four bases in length and each said sequence contains 6 G's. 40. The composition of claim 29 or 30, wherein, for each said sequence, there is at most six bases other than G between every pair of neighboring pairs of G's. 41. The composition of claim 29 or 30, wherein at the 5′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 42. The composition of claim 29 or 30, wherein at the 3′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 43. The composition of claim 41, wherein at the 3′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 44. The composition of claim 29 or 30, wherein under a defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 30% of the degree of hybridization between said oligonucleotide and its complement, more preferably 20%, more preferably 15%, more preferably 10%, more preferably 6%. 45. The composition of claim 44, wherein said set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles. 46. The composition of claim 45, wherein under said defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. 47. The composition of claim 29 or 30, comprising one hundred and sixty said molecules, or comprising one hundred and seventy said molecules, or comprising one hundred and eighty said molecules, or comprising one hundred and ninety said molecules, or comprising two hundred said molecules, or comprising two hundred and twenty said molecules, or comprising two hundred and forty said molecules, or comprising two hundred and sixty said molecules, or comprising two hundred and eighty said molecules, or comprising three hundred said molecules, or comprising four hundred said molecules, or comprising five hundred said molecules, or comprising six hundred said molecules, or comprising seven hundred said molecules, or comprising eight hundred said molecules, or comprising nine hundred said molecules, or comprising one thousand said molecules. 48. A composition of claim 29 or 30, wherein each said molecule is linked to a solid phase support so as to be distinguishable from a mixture of other said molecules by hybridization to its complement. 49. The composition of claim 48, wherein each molecule is linked to a defined location on a said solid phase support, the defined location for each said molecule being different than the defined location for different other said molecules. 50. The composition of claim 49, wherein each said solid phase support is a microparticle and each said molecule is covalently to a different microparticle than each other different said molecule. 51. A composition comprising one hundred and fifty minimally cross-hybridizing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide comprising a sequence of nucleotide bases for which, under a defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide does not exceed about 20% of the degree of hybridization between said oligonucleotide and its complement. 52. The composition of claim 51, wherein each said sequence has between ten and fifty bases. 53. The composition of claim 52, wherein each said sequence is between sixteen and forty bases in length, or between sixteen and thirty-five bases in length, or between eighteen and thirty bases in length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between twenty-two and twenty-six bases in length. 54. The composition of claim 51, wherein each said sequence is of the same length as every other said sequence. 55. The composition of claim 54, wherein each said sequence is twenty-four bases in length. 56. The composition of claim 51, wherein no said sequence contains more than four contiguous bases that are identical to each other. 57. The composition of claim 51 wherein the number of G's in each said sequence does not exceed L/4 where L is the number of bases in said sequence. 58. The composition of claim 57, wherein the number of G's in each said sequence does not vary from the average number of G's in all of the sequences of the set by more than one. 59. The composition of claim 58, wherein the number of G's in each said sequence is the same as every other sequence of the set. 60. The composition of claim 58, wherein each said sequence is twenty-four bases in length and each said sequence contains 6 G's. 61. The composition of claim 51, wherein, for each said sequence, there is at most six bases other than G between every pair of neighboring pairs of G's. 62. The composition of claim 51, wherein at the 5′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 63. The composition of claim 51, wherein at the 3′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 64. The composition of claim 62, wherein at the 3′-end of each said sequence at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence is a G. 65. The composition of claim 51, wherein under a said defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 15%, more preferably 10%, more preferably 6%. 66. The composition of claim 65, wherein said set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles. 67. The composition of claim 66, wherein under said defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. 68. The composition of claim 51, comprising one hundred and sixty said molecules, or comprising one hundred and seventy said molecules, or comprising one hundred and eighty said molecules, or comprising one hundred and ninety said molecules, or comprising two hundred said molecules, or comprising two hundred and twenty said molecules, or comprising two hundred and forty said molecules, or comprising two hundred and sixty said molecules, or comprising two hundred and eighty said molecules, or comprising three hundred said molecules, or comprising four hundred said molecules, or comprising five hundred said molecules, or comprising six hundred said molecules, or comprising seven hundred said molecules, or comprising eight hundred said molecules, or comprising nine hundred said molecules, or comprising one thousand said molecules. 69. A composition of claim 51, wherein each said molecule is linked to a solid phase support so as to be distinguishable from a mixture of other said molecules by hybridization to its complement. 70. The composition of claim 69, wherein each molecule is linked to a defined location on a said solid phase support, the defined location for each said molecule being different than the defined location for different other said molecules. 71. The composition of claim 70, wherein each said solid phase support is a microparticle and each said molecule is covalently to a different microparticle than each other different said molecule. 72. (canceled) 73. A composition according to claim 2, wherein any base is substituted by an analogue thereof. 74. A composition according to claim 2, wherein each said molecule comprises a tag complement. 75. A kit for sorting and identifying polynucleotides, the kit comprising one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached, and the tag complements each being selected from the set of oligonucleotides as defined in claim 1. 76. A kit according to claim 75, wherein there is a tag complement for each said oligonucleotide of a said composition. 77. A kit according to claim 75 or 76 wherein said one or more solid phase supports is a planar substrate and wherein said one or more spatially discrete regions is a plurality of spatially addressable regions. 78. A kit according to claim 75, wherein said one or more solid phase supports is a plurality of microparticles. 79. A kit according to claim 78, wherein said microparticles each have a diameter in the range of from 5 to 40 μm. 80. A kit according to claim 78 or 79, wherein each microparticle is spectrophotometrically unique from each other microparticle having a different oligonucleotide attached thereto. 81. A method of analyzing a biological sample comprising a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid, the method comprising: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 74 to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, with the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid. 82. A method of analyzing a biological sample comprising a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 74 to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid; wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. 83. A method of analyzing a biological sample comprising a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (A) amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 74 to form amplified molecules with 5′-ends with a sequence complementary to the sequence of the tag; (B) extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5′-end complementary a 3′-end of the amplified sequence, the 3′-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other; (C) specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus; wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. 84. A method of analyzing a biological sample comprising a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (a) hybridizing the molecule and a primer, the primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 74 and a 3′-end extending to immediately adjacent the locus; (b) enzymatically extending the 3′-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3′-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus; (c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and (d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule; wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other. 85. The method of claim 82, wherein each said derivative is a dideoxy nucleoside triphosphate. 86. The method of claim 84, wherein each respective complement is attached as a uniform population of substantially identical complements in a spacially discrete region on one or more said solid phase supports. 87. The method of claim 86, each said tag complement comprises a label, each such label being different for respective complements, and step (d) includes detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements. 88. The hybridized molecule and primer of step (A) of claim 84. 89. A method of determining the presence of a target suspected of being contained in a mixture, the method comprising the steps of: (i) labelling the target with a first label; (ii) providing a first detection moiety capable of specific binding to the target and including a first tag; (iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target; (iv) providing a family of tag complements as defined in claim 74 wherein the family contains a first tag complement having a sequence complementary to that of the first tag; (v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement; (vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence said target in the mixture. 90. The method of claim 89, wherein said first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence the first label at said specified location. 91. The method of claim 89, wherein said first tag complement comprises a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement. 92. The method of claim 89, wherein said target is selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. 93. The method of claim 92, wherein said target is an antigen and said first molecule is an antibody specific for said antigen. 94. The method of claim 93, wherein the antigen is a polypeptide or protein and the labelling step includes conjugation of fluorescent molecules, digoxigenin, biotinylation and the like. 95. The method of claim 94, wherein said target is a nucleic acid and the labelling step includes incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like. 96. A composition comprising a set of molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1≦19/24×L1, M2≦17/24×L1, M3≦21/24×L1, M4≦18/24×L1, M5≦20/24×L1, where L1 is the length of the shortest sequence of the pair, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of an alignment is determined according to the equation (A×m)−(B×mm)−(C×(og+eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). 97. A composition comprising a set of molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1≦19, M2≦17, M3≦21, M4≦18, and M5≦20, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of a said alignment is determined according to the equation 3A−B−3C−D, wherein: A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Specific hybridization of oligonucleotides and their analogs is a fundamental process that is employed in a wide variety of research, medical, and industrial applications, including the identification of disease-related polynucleotides in diagnostic assays, screening for clones of novel target polynucleotides, identification of specific polynucleotides in blots of mixtures of polynucleotides, therapeutic blocking of inappropriately expressed genes and DNA sequencing. Sequence specific hybridization is critical in the development of high throughput multiplexed nucleic acid assays. As formats for these assays expand to encompass larger amounts of sequence information acquired through projects such as the Human Genome project, the challenge of sequence specific hybridization with high fidelity is becoming increasingly difficult to achieve. In large part, the success of hybridization using oligonucleotides depends on minimizing the number of false positives and false negatives. Such problems have made the simultaneous use of multiple hybridization probes in a single experiment i.e. multiplexing, particularly in the analysis of multiple gene sequences on a gene microarray, very difficult. For example, in certain binding assays, a number of nucleic acid molecules are bound to a chip with the desire that a given “target” sequence will bind selectively to its complement attached to the chip. Approaches have been developed that involve the use of oligonucleotide tags attached to a solid support that can be used to specifically hybridize to the tag complements that are coupled to probe sequences. Chetverin et al. (WO 93/17126) uses sectioned, binary oligonucleotide arrays to sort and survey nucleic acids. These arrays have a constant nucleotide sequence attached to an adjacent variable nucleotide sequence, both bound to a solid support by a covalent linking moiety. These binary arrays have advantages compared with ordinary arrays in that they can be used to sort strands according to their terminal sequences so that each strand binds to a fixed location on an array. The design of the terminal sequences in this approach comprises the use of constant and variable sequences. U.S. Pat. Nos. 6,103,463 and 6,322,971 issued to Chetverin et al. on Aug. 15, 2000 and Nov. 27, 2001, respectively. This concept of using molecular tags to sort a mixture of molecules is analogous to molecular tags developed for bacterial and yeast genetics (Hensel et al., Science; 269, 400-403: 1995 and Schoemaker et al., Nature Genetics; 14, 450-456: 1996). Here, a method termed “signature tagged” mutagenesis in which each mutant is tagged with a different DNA sequence is used to recover mutant genes from a complex mixture of approximately 10,000 bacterial colonies. In the tagging approach of Barany et al. (WO 9731256), known as the “zip chip”, a family of nucleic acid molecules, the “zip-code addresses”, each different from each other, are set out on a grid. Target molecules are attached to oligonucleotide sequences complementary to the “zipcode addresses,” referred to as “zipcodes,” which are used to specifically hybridize to the address locations on the grid. While the selection of these families of polynucleotide sequences used as addresses is critical for correct performance of the assay, the performance has not been described. Working in a highly parallel hybridization environment requiring specific hybridization imposes very rigorous selection criteria for the design of families of oligonucleotides that are to be used. The success of these approaches is dependent on the specific hybridization of a probe and its complement. Problems arise as the family of nucleic acid molecules cross-hybridize or hybridize incorrectly to the target sequences. While it is common to obtain incorrect hybridization resulting in false positives or an inability to form hybrids resulting in false negatives, the frequency of such results must be minimized. In order to achieve this goal certain thermodynamic properties of forming nucleic acid hybrids must be considered. The temperature at which oligonucleotides form duplexes with their complementary sequences known as the T m (the temperature at which 50% of the nucleic acid duplex is dissociated) varies according to a number of sequence dependent properties including the hydrogen bonding energies of the canonical pairs A-T and G-C (reflected in GC or base composition), stacking free energy and, to a lesser extent, nearest neighbour interactions. These energies vary widely among oligonucleotides that are typically used in hybridization assays. For example, hybridization of two probe sequences composed of 24 nucleotides, one with a 40% GC content and the other with a 60% GC content, with its complementary target under standard conditions theoretically may have a 10° C. difference in melting temperature (Mueller et al., Current Protocols in Mol. Biol.; 15, 5:1993). Problems in hybridization occur when the hybrids are allowed to form under hybridization conditions that include a single hybridization temperature that is not optimal for correct hybridization of all oligonucleotide sequences of a set. Mismatch hybridization of non-complementary probes can occur forming duplexes with measurable mismatch stability (Santalucia et al., Biochemistry; 38: 3468-77, 1999). Mismatching of duplexes in a particular set of oligonucleotides can occur under hybridization conditions where the mismatch results in a decrease in duplex stability that results in a higher T m than the least stable correct duplex of that particular set. For example, if hybridization is carried out under conditions that favor the AT-rich perfect match duplex sequence, the possibility exists for hybridizing a GC-rich duplex sequence that contains a mismatched base having a melting temperature that is still above the correctly formed AT-rich duplex. Therefore, design of families of oligonucleotide sequences that can be used in multiplexed hybridization reactions must include consideration for the thermodynamic properties of oligonucleotides and duplex formation that will reduce or eliminate cross hybridization behavior within the designed oligonucleotide set. The development of such families of tags has been attempted over the years with varying degrees of success. There are a number of different approaches for selecting sequences for use in multiplexed hybridization assays. The selection of sequences that can be used as zipcodes or tags in an addressable array has been described in the patent literature in an approach taken by Brenner and co-workers. U.S. Pat. No. 5,654,413 describes a population of oligonucleotide tags (and corresponding tag complements) in which each oligonucleotide tag includes a plurality of subunits, each subunit consisting of an oligonucleotide having a length of from three to six nucleotides and each subunit being selected from a minimally cross hybridizing set, wherein a subunit of the set would have at least two mismatches with any other sequence of the set. Table II of the Brenner patent specification describes exemplary groups of 4mer subunits that are minimally cross hybridizing according to the aforementioned criteria. In the approach taken by Brenner, constructing non cross-hybridizing oligonucleotides, relies on the use of subunits that form a duplex having at least two mismatches with the complement of any other subunit of the same set. The ordering of subunits in the construction of oligonucleotide tags is not specifically defined. Parameters used in the design of tags based on subunits are discussed in Barany et al. (WO 9731256). For example, in the design of polynucleotide sequences that are for example 24 nucleotides in length (24mer) derived from a set of four possible tetramers in which each 24mer “address” differs from its nearest 24mer neighbour by 3 tetramers. They discuss further that, if each tetramer differs from each other by at least two nucleotides, then each 24mer will differ from the next by at least six nucleotides. This is determined without consideration for insertions or deletions when forming the alignment between any two sequences of the set. In this way a unique “zip code” sequence is generated. The zip code is ligated to a label in a target dependent manner, resulting in a unique “zip code” which is then allowed to hybridize to its address on the chip. To minimize cross-hybridization of a “zip code” to other “addresses”, the hybridization reaction is carried out at temperatures of 75-80° C. Due to the high temperature conditions for hybridization, 24mers that have partial homology hybridize to a lesser extent than sequences with perfect complementarity and represent ‘dead zones’. This approach of implementing stringent hybridization conditions for example, involving high temperature hybridization, is also practiced by Brenner et. al. The current state of technology for designing non-cross hybridizing tags based on subunits does not provide sufficient guidance to construct a family of relatively large numbers of sequences with practical value in assays that require stringent non-cross hybridizing behavior. A multiplex sequencing method has been described in U.S. Pat. No. 4,942,124, which issued to Church on Jul. 17, 1990. The method requires at least two vectors which differ from each other at a tag sequence. It is stated that a tag sequence in one vector will not hybridize under stringent hybridization conditions to a tag sequence (i.e., complementary probes do not cross-hybridize) in another vector. Exemplary stringent hybridization conditions are given as 42° C. in 500-1000 mM sodium phosphate buffer. A set of 42 20-mer tag sequences, all of which lack G residues, is given in FIG. 3 of the specification. Details of how the sequences were obtained are not provided, although Church states that initially 92 were chosen on the basis of their having sufficient sequence diversity to insure uniqueness. So while it is possible for a person knowledgeable in the field to design a small number of non-cross hybridizing tags, it is difficult to design a larger number such tags. A co-pending application of the owner of this patent application describes such a set of 210 non-cross hybridizing tags that have a practical value. A method described in international patent application No. PCT/CA 01/00141 published under WO 01/59151 on Aug. 16, 2001. Little guidance is provided, however, for the provision of a larger set, say 1000 or so, of non-cross hybridizing tags. Since having sets of approximately 1000 non-cross hybridizing tags, or more, would be of considerable practical value, it would be useful to develop such a set. Thus, while it is desirable with such arrays to have, at once, a large number of address molecules, the address molecules should each be highly selective for its own complement sequence: While such an array provides the advantage that the family of molecules making up the grid is entirely of design, and does not rely on sequences as they occur in nature, the provision of a family of molecules., which is sufficiently large and where each individual member is sufficiently selective for its complement over all the other zipcode molecules (i.e., where there is sufficiently low cross-hybridization, or cross-talk) continues to elude researchers. |
<SOH> SUMMARY OF INVENTION <EOH>A family of 1168 sequences was obtained using a computer algorithm to have desirable hybridization properties for use in nucleic acid detection assays. The sequence set of 1168 oligonucleotides was partially characterized in hybridization assays, demonstrating the ability of family members to correctly hybridize to their complementary sequences with minimal cross hybridization. These are the sequences having SEQ ID NOs:1 to 1168 of Table I. Variant families of sequences (seen as tags or tag complements) of a family of sequences taken from Table I are also part of the invention. For the purposes of discussion, a family or set of oligonucleotides will often be described as a family of tag complements, but it will be understood that such a set could just easily be a family of tags. A family of complements is obtained from a set of oligonucleotides based on a family of oligonucleotides such as those of Table I. To simplify discussion, providing a family of complements based on the oligonucleotides of Table I will be described. Firstly, the groups of sequences based on the oligonucleotides of Table I can be represented as shown in Table IA. TABLE IA Numeric sequences corresponding to nucleotide base patterns of a set of oligonucleotides Sequence Numeric Pattern Identifier 1 1 1 2 2 3 2 3 1 1 1 3 1 2 2 3 2 2 2 3 2 3 2 1 1 3 2 2 1 3 1 3 2 2 1 1 2 2 3 2 1 2 2 2 3 1 2 3 1 2 1 2 3 2 2 1 1 1 3 2 1 1 3 2 3 2 2 3 1 1 1 2 3 2 3 2 3 1 2 3 2 2 1 3 1 1 3 2 1 2 1 2 2 3 2 3 1 1 2 4 2 2 2 3 2 3 2 1 3 1 1 2 1 2 3 1 2 1 1 3 2 3 2 1 5 1 3 2 3 1 1 1 3 1 3 2 1 2 2 2 3 2 2 3 3 2 3 2 2 6 2 1 2 3 2 2 1 2 1 1 1 1 3 1 3 1 1 2 1 3 1 1 2 1 7 3 2 3 2 2 2 1 2 3 2 2 1 2 1 2 3 2 3 1 1 3 2 2 2 8 2 3 2 3 2 1 1 3 2 1 3 2 1 3 2 1 3 2 3 3 2 1 2 3 9 2 1 2 3 1 1 1 3 1 3 2 3 1 3 1 1 2 3 1 3 1 1 1 2 10 1 2 3 2 2 1 2 2 1 3 2 2 3 2 2 3 1 2 3 2 2 2 1 3 11 2 2 1 3 2 2 3 2 2 3 1 2 3 2 2 2 1 3 2 1 3 2 2 2 12 3 2 1 1 1 3 1 3 2 1 2 1 1 1 3 2 1 1 3 1 1 2 3 1 13 2 3 3 2 1 3 1 1 1 2 1 3 2 2 2 1 2 2 3 2 1 1 3 2 14 3 2 1 3 1 1 1 2 1 3 2 2 2 1 2 2 3 1 2 3 1 2 2 3 15 2 3 2 1 1 3 2 3 1 1 1 2 1 3 2 3 1 3 2 2 1 2 2 2 16 1 1 1 2 1 3 1 2 3 1 2 1 2 1 1 3 2 3 1 3 1 1 2 3 17 1 2 1 1 3 2 2 1 2 1 1 3 2 3 2 2 1 2 3 2 3 1 3 2 18 2 1 2 1 3 1 2 1 1 1 3 1 3 1 2 3 1 2 2 2 3 2 2 3 19 1 3 1 3 2 2 3 1 3 1 1 2 3 2 1 2 1 3 2 1 2 2 1 2 20 1 1 3 2 1 3 2 2 2 3 2 1 1 3 1 1 2 3 1 2 2 3 2 1 21 2 2 1 2 3 1 1 1 2 2 3 1 3 2 3 1 1 3 1 2 2 3 1 2 22 3 2 1 2 1 2 3 2 1 1 1 2 2 3 2 2 1 2 3 2 2 3 1 3 23 3 1 1 2 2 3 2 1 2 1 1 1 3 2 1 2 2 1 3 1 2 3 2 3 24 2 1 3 1 2 3 1 3 1 2 2 1 1 3 2 3 2 2 1 2 2 2 3 1 25 3 2 2 1 1 3 2 2 2 3 2 2 2 1 2 3 2 1 2 1 3 1 1 3 26 3 1 3 2 1 2 2 1 3 2 1 1 1 3 2 3 1 2 1 2 3 1 2 1 27 3 2 3 1 1 2 3 1 2 2 2 1 3 2 1 1 1 2 3 1 2 2 3 1 28 3 1 2 2 3 1 1 3 2 2 1 2 1 3 1 1 1 2 3 1 2 2 1 3 29 1 3 2 3 1 2 1 1 1 2 3 2 2 1 3 2 2 3 1 1 2 2 3 2 30 2 1 2 1 2 1 3 2 1 1 1 2 3 2 2 2 3 2 3 2 3 2 2 3 31 2 2 1 1 3 2 3 2 2 1 3 2 2 1 2 2 2 3 2 2 3 2 1 3 32 3 2 1 3 2 1 1 2 1 2 3 1 1 3 2 3 1 3 1 1 2 1 2 1 33 2 1 3 2 3 2 1 2 1 3 1 1 2 3 2 1 3 1 2 2 2 1 3 2 34 2 2 3 2 1 3 1 2 2 1 3 1 2 3 2 3 2 2 2 3 2 1 1 1 35 2 1 3 2 1 2 1 3 1 3 2 1 3 1 3 1 2 3 1 2 1 2 2 2 36 1 2 2 3 2 3 1 1 1 3 1 1 1 3 1 3 1 1 3 1 1 1 2 2 37 2 3 2 3 1 3 1 1 2 2 1 1 3 1 2 2 1 1 3 1 1 2 3 2 38 1 2 1 2 2 1 3 2 2 1 1 3 1 1 3 1 1 3 1 3 2 2 3 3 39 2 2 3 2 1 3 2 2 3 1 3 1 1 1 2 1 2 3 2 1 3 2 2 2 40 2 1 3 1 3 2 2 3 2 2 1 1 1 3 1 3 2 3 2 1 1 1 2 1 41 3 2 2 1 2 3 1 2 3 2 3 2 1 2 1 1 3 2 1 1 2 1 2 3 42 2 2 2 3 2 2 1 3 1 1 2 3 1 3 1 1 3 1 2 2 2 1 2 3 43 1 3 2 1 2 1 3 2 2 2 1 1 1 3 1 1 3 2 1 3 2 1 3 1 44 3 2 3 1 3 1 2 1 2 1 3 1 2 2 2 1 3 1 1 1 3 2 1 1 45 2 2 3 2 2 2 1 2 1 3 2 3 1 1 3 2 3 1 1 2 1 3 2 1 46 1 1 3 2 1 1 3 2 1 3 2 1 1 2 1 3 2 3 2 3 2 2 1 1 47 1 2 2 2 3 2 3 1 3 2 2 1 2 3 1 1 1 3 1 2 1 1 3 1 48 3 1 1 1 3 2 1 3 1 3 1 1 2 1 1 1 3 1 2 1 1 3 1 1 49 1 2 2 2 1 1 3 1 2 2 3 2 2 1 1 3 1 3 2 1 3 1 1 3 50 3 2 2 2 1 1 1 3 1 2 2 3 2 1 1 3 1 1 2 3 2 3 2 1 51 2 2 2 3 2 3 1 1 3 1 2 3 1 1 3 2 1 2 2 2 3 2 1 2 52 2 3 2 3 2 2 2 1 3 1 1 2 2 2 1 3 2 1 2 3 2 3 2 1 53 3 1 2 1 1 2 3 1 2 2 1 2 1 3 1 1 1 3 2 3 2 2 2 3 54 3 2 2 1 2 2 2 3 2 1 1 3 2 2 1 1 3 1 2 1 3 2 1 3 55 1 3 2 2 2 1 2 2 3 1 1 1 3 1 3 2 2 2 3 1 1 2 1 3 56 2 2 3 2 3 2 2 2 1 2 2 3 2 3 2 1 3 2 2 2 1 1 1 3 57 1 2 2 3 2 3 1 3 1 1 3 1 2 1 2 3 1 1 1 3 2 2 1 2 58 2 3 1 3 1 1 2 3 2 1 1 1 3 1 1 2 3 2 2 2 1 2 2 3 59 1 2 3 2 3 1 1 1 3 2 2 1 2 3 1 2 3 2 2 1 1 2 2 3 60 3 2 2 2 1 3 2 1 2 2 1 3 2 2 3 2 2 1 1 3 1 2 2 3 61 3 1 2 2 3 1 2 1 2 2 2 3 1 1 2 3 2 2 2 3 2 2 2 3 62 2 3 1 1 2 2 3 1 1 1 3 2 3 2 1 1 2 3 2 2 3 2 1 2 63 3 1 2 2 3 2 1 2 2 3 2 2 3 1 3 1 1 2 1 3 1 1 2 1 64 1 1 1 2 2 2 3 1 3 1 2 2 2 3 2 3 1 2 1 3 1 3 2 1 65 3 2 1 1 2 2 1 3 1 2 2 2 3 2 2 2 3 2 2 3 2 2 3 2 66 3 2 2 2 3 2 1 2 2 3 2 2 1 3 2 3 1 1 2 1 2 1 3 2 67 1 2 3 2 1 3 2 1 3 2 1 3 1 2 3 2 2 2 1 2 3 1 1 2 68 2 3 2 2 2 1 1 1 3 1 2 3 1 2 2 3 1 1 3 1 1 1 2 3 69 2 3 2 3 1 2 1 1 2 3 1 2 3 2 2 1 2 2 2 3 2 3 2 1 70 1 2 1 3 2 2 3 2 3 1 3 1 1 2 2 2 3 2 1 1 2 2 1 3 71 1 2 1 3 1 2 3 2 1 1 3 1 3 1 1 1 2 2 3 2 3 1 1 1 72 1 3 1 2 2 1 1 3 1 3 1 1 3 2 2 1 1 2 1 3 1 3 2 1 73 3 1 1 3 2 1 1 1 2 2 3 2 3 1 1 2 3 1 1 1 3 1 1 1 74 1 1 2 3 2 1 1 3 1 1 1 3 1 1 3 1 2 2 3 2 2 3 2 1 75 2 2 2 3 1 2 2 2 1 2 3 2 3 2 2 1 2 3 2 2 3 1 3 2 76 3 2 1 2 2 3 1 3 1 1 1 2 2 2 3 1 1 3 1 1 2 3 1 1 77 3 1 1 2 2 3 2 1 2 3 1 1 1 2 3 1 1 2 2 3 2 1 1 3 78 2 1 2 2 3 2 1 3 1 1 3 2 1 1 1 3 2 2 1 3 1 1 3 2 79 2 2 2 1 2 3 2 1 1 2 3 1 2 1 1 3 2 3 2 1 3 2 2 3 80 1 2 1 2 1 3 2 2 3 1 1 1 2 2 3 2 3 1 2 1 3 2 3 2 81 1 2 1 1 3 1 1 1 2 2 1 3 1 3 1 3 2 2 3 2 1 1 1 3 82 3 1 1 2 2 3 2 3 1 1 1 2 3 2 3 1 2 2 3 1 2 1 2 1 83 1 1 1 2 1 1 3 2 1 3 2 2 2 1 1 2 3 1 3 1 3 1 1 3 84 3 1 2 2 1 1 1 3 1 1 3 2 1 1 3 2 3 1 1 2 3 2 2 2 85 2 1 2 3 2 3 2 3 2 2 3 2 2 2 1 3 2 3 2 2 1 2 2 1 86 3 1 3 2 2 1 2 1 2 3 2 1 3 2 2 1 3 1 3 2 2 1 2 1 87 3 1 1 1 3 1 1 1 3 1 1 3 2 3 2 2 1 1 3 2 2 1 1 1 88 2 1 3 2 1 2 2 1 3 2 1 1 3 2 1 2 3 2 3 1 2 2 3 2 89 2 2 3 2 3 2 3 1 2 2 3 1 1 2 1 2 2 3 2 3 1 1 1 2 90 1 2 3 2 3 1 1 1 3 1 3 2 2 1 1 3 2 3 1 2 2 1 1 1 91 3 1 2 2 3 1 1 2 3 1 2 2 3 1 3 1 2 1 2 3 2 1 1 1 92 1 1 3 1 2 3 1 2 1 3 2 2 1 1 3 2 3 2 1 1 3 2 2 1 93 2 1 3 2 2 3 2 2 1 2 2 3 1 3 1 1 2 2 2 1 3 1 1 3 94 2 2 2 1 2 1 3 2 3 1 1 2 2 1 2 3 1 3 2 3 1 1 1 3 95 3 1 2 1 3 1 2 2 2 1 3 1 1 2 3 1 1 2 2 1 1 3 2 3 96 2 2 2 3 1 1 3 1 1 3 1 3 1 2 2 2 3 1 1 1 2 2 3 1 97 1 2 3 1 1 2 1 1 3 1 3 2 2 3 1 2 1 1 1 2 3 2 3 1 98 2 3 2 2 2 1 2 3 2 1 3 2 3 2 1 3 1 2 2 3 1 1 2 2 99 2 2 2 1 1 3 2 3 1 3 2 2 1 2 1 3 1 1 3 2 1 3 2 1 100 3 1 2 2 2 1 2 3 2 3 2 2 2 3 1 1 3 2 2 1 1 3 1 2 101 2 1 3 2 2 1 3 1 3 1 1 1 3 2 3 1 2 1 1 1 3 2 2 1 102 3 2 1 1 2 3 1 2 1 1 2 3 1 1 3 2 3 2 1 2 1 2 1 3 103 1 1 2 3 1 1 3 2 3 2 2 1 3 2 1 2 1 3 1 2 1 3 2 1 104 2 1 1 1 2 2 3 1 3 2 2 2 3 2 2 2 3 1 2 2 3 2 1 3 105 2 1 1 2 3 1 1 3 1 1 2 1 1 3 2 1 2 3 1 3 2 3 2 2 106 1 1 1 2 3 2 1 1 2 1 3 2 3 2 2 3 2 2 1 3 2 2 1 3 107 1 3 1 3 2 2 1 3 2 3 1 1 1 2 3 2 2 3 2 2 1 1 1 2 108 3 1 1 1 2 1 3 1 i 1 2 3 2 1 2 2 3 2 2 2 3 2 3 1 109 1 3 2 2 1 2 1 1 3 2 2 2 3 2 3 1 3 1 1 2 2 1 1 3 110 3 1 3 2 2 2 1 2 1 3 2 2 1 3 1 1 2 1 2 3 2 2 3 2 111 1 3 1 3 2 2 1 2 2 1 3 1 1 3 1 1 3 1 2 2 2 1 1 3 112 3 1 3 2 2 1 1 2 3 1 1 1 2 1 1 3 2 1 2 2 2 3 2 3 113 1 2 3 1 2 3 1 1 2 1 3 2 2 3 1 1 3 2 1 2 1 2 1 3 114 1 2 1 3 1 2 1 2 3 1 3 1 2 3 1 1 1 3 2 2 1 3 2 1 115 2 1 2 3 2 1 1 1 3 1 1 1 3 2 3 1 1 1 3 1 1 3 1 1 116 2 3 1 1 2 3 2 1 3 1 1 1 2 3 1 1 2 3 2 2 3 1 1 1 117 1 1 2 2 3 1 1 2 1 3 2 3 2 3 2 3 1 3 2 2 2 1 1 2 118 1 3 1 2 1 2 2 3 2 2 2 3 1 2 2 1 1 2 3 1 1 3 1 3 119 1 1 1 3 2 2 3 2 1 1 1 3 2 2 3 1 1 3 1 2 1 1 1 3 120 3 2 2 1 1 3 1 3 1 2 2 1 2 3 1 3 1 2 3 2 1 2 2 1 121 1 3 1 1 3 1 2 1 2 1 1 3 1 1 3 1 2 2 3 1 1 2 2 3 122 3 2 1 3 1 1 1 2 2 2 3 1 1 2 2 3 1 2 3 2 3 1 1 1 123 1 1 3 1 3 2 1 3 1 2 2 3 1 2 1 1 3 2 1 2 1 2 3 1 124 2 3 1 2 1 2 1 3 2 1 3 2 3 1 1 3 1 1 1 2 1 1 3 2 125 1 3 1 2 1 1 2 3 1 2 3 1 3 1 1 1 2 3 1 1 3 1 2 1 126 1 2 3 2 3 1 1 1 3 2 1 2 2 2 3 2 3 1 2 1 2 1 3 2 127 1 1 2 1 1 3 1 3 1 1 2 2 3 1 2 1 2 3 1 1 3 1 2 3 128 2 1 1 3 2 3 2 1 2 2 2 1 3 2 1 3 1 1 2 3 1 1 3 2 129 2 1 2 3 2 2 1 3 1 2 2 2 3 2 2 3 1 3 1 2 2 3 1 2 130 1 3 2 2 2 3 2 1 2 3 1 1 3 1 3 1 2 1 3 2 1 2 2 2 131 3 1 3 1 1 1 2 3 2 2 1 2 3 2 1 2 2 2 1 3 2 1 3 2 132 2 1 2 3 2 3 1 3 1 1 2 3 2 3 2 2 2 3 1 2 2 2 1 1 133 3 2 1 2 3 2 2 2 3 2 2 2 1 2 1 3 1 1 2 3 2 1 2 3 134 3 1 3 2 1 2 1 2 1 3 1 1 3 1 1 1 3 1 1 1 2 2 2 3 135 1 2 3 1 3 2 3 1 1 3 2 1 1 1 2 3 2 1 3 2 2 1 2 2 136 2 2 1 1 3 1 1 3 2 3 1 3 2 2 1 2 2 3 2 3 1 2 1 2 137 1 2 3 1 1 1 2 3 1 3 1 1 2 1 2 2 3 2 2 3 2 2 2 3 138 3 1 2 2 1 1 2 3 1 2 2 1 2 3 2 3 1 1 2 2 3 1 2 3 139 3 1 1 1 2 3 2 2 1 1 1 3 1 2 1 2 3 1 1 1 3 2 1 3 140 2 1 2 2 3 2 2 3 1 2 2 2 3 1 2 1 2 2 1 3 2 3 2 3 141 2 2 2 1 2 3 2 2 2 3 2 3 2 1 2 3 2 1 1 3 2 1 3 2 142 1 1 2 2 3 1 1 1 3 1 1 2 2 3 2 3 2 3 1 1 2 2 3 1 143 2 3 1 3 2 2 2 3 1 1 2 2 2 3 2 2 2 3 1 3 2 1 1 2 144 3 1 2 3 2 1 2 1 1 2 3 1 2 3 2 3 2 3 2 1 1 1 2 2 145 1 2 3 2 3 1 3 1 3 1 1 3 1 1 2 2 2 3 2 2 2 1 2 2 146 3 2 3 1 2 1 1 1 3 2 1 2 2 3 2 2 3 1 2 1 3 1 1 1 147 3 1 1 3 2 1 3 1 1 2 1 3 1 1 1 3 2 2 1 1 2 1 3 1 148 2 2 3 2 3 2 1 3 2 2 1 1 3 1 3 2 2 3 2 2 2 1 1 2 149 2 1 3 2 1 3 2 1 1 3 2 2 3 2 2 1 3 1 1 2 1 3 2 2 150 1 1 2 2 2 3 1 1 3 2 1 2 1 1 2 3 1 1 2 3 2 3 2 3 151 2 1 3 1 1 1 2 2 3 2 1 3 2 1 2 2 2 3 1 3 1 3 1 1 152 2 3 2 1 2 1 2 3 2 2 1 1 2 3 1 3 1 2 3 2 2 3 2 1 153 2 1 2 2 2 3 1 2 1 1 3 1 3 1 1 2 3 1 1 3 1 1 3 2 154 2 2 3 1 1 2 1 3 2 3 2 1 1 2 3 1 1 2 1 2 3 1 2 3 155 3 2 1 3 2 2 2 3 2 3 1 1 2 1 3 1 1 2 2 1 3 2 2 2 156 1 1 1 3 1 2 3 1 2 2 3 2 1 1 2 2 2 3 2 3 2 3 1 1 157 3 1 1 3 1 2 2 3 2 2 3 1 3 2 2 1 1 2 1 3 1 2 1 1 158 1 3 1 2 2 1 2 3 2 1 3 2 3 1 2 3 2 1 1 1 2 3 2 2 159 3 1 1 2 2 2 1 3 1 2 3 2 1 3 1 2 1 2 3 1 1 2 3 2 160 3 1 2 1 3 1 1 3 2 3 2 1 2 2 1 1 3 2 1 1 3 2 2 1 161 2 1 2 3 1 1 2 2 1 2 3 1 3 1 1 3 1 1 2 1 3 1 3 2 162 2 2 2 3 2 2 1 2 3 1 1 3 2 3 1 2 2 2 3 2 2 2 3 2 163 3 2 1 1 1 3 1 2 2 3 2 3 2 2 1 2 1 2 3 1 1 1 2 3 164 2 2 3 2 3 1 2 1 3 2 1 3 2 2 1 3 1 2 1 2 2 2 3 2 165 3 1 1 2 2 1 1 3 1 2 1 1 1 3 1 1 3 1 3 1 1 3 2 1 166 3 1 2 2 3 2 1 3 1 1 2 3 1 1 2 2 2 3 2 1 3 2 1 2 167 1 1 1 2 1 1 3 1 3 1 3 1 3 1 1 2 3 1 2 2 2 1 3 2 168 1 1 2 2 1 2 3 2 3 1 1 2 1 3 1 2 2 3 2 2 3 1 1 3 169 2 2 1 1 3 1 2 2 2 1 2 3 2 3 1 2 1 3 2 1 3 1 3 2 170 2 2 1 1 1 3 1 2 1 3 2 3 2 2 2 3 2 2 3 2 3 2 2 1 171 2 1 2 2 3 1 2 2 2 1 2 3 1 1 3 1 3 2 1 2 1 3 2 3 172 1 1 1 2 2 2 3 1 2 3 1 3 2 1 3 2 2 2 1 1 3 1 3 1 173 1 2 1 1 1 3 2 2 3 2 2 2 3 1 2 3 2 2 2 3 1 1 2 3 174 3 1 2 2 3 2 3 1 2 3 1 1 2 1 1 2 3 2 2 1 2 2 3 1 175 3 1 2 3 1 1 3 1 1 1 2 1 2 3 1 2 1 2 3 1 1 2 1 3 176 2 2 1 1 1 3 2 2 1 2 2 3 1 1 3 2 3 1 1 3 2 2 3 1 177 2 2 3 2 1 1 3 1 1 1 2 1 3 1 3 1 2 2 2 3 2 3 2 2 178 3 1 3 1 2 2 3 1 3 2 2 2 1 1 3 2 1 2 2 1 3 1 2 2 179 1 3 2 3 1 2 1 1 2 1 3 1 1 2 3 1 2 1 1 1 2 3 2 3 180 3 1 2 1 1 2 1 3 2 3 1 1 2 2 2 3 1 3 2 2 3 2 1 2 181 1 3 1 2 1 2 2 2 3 2 1 3 2 1 3 1 1 1 3 2 1 2 3 2 182 3 2 2 1 2 3 1 1 2 3 2 2 3 1 1 2 2 2 3 1 1 2 3 2 183 1 2 3 1 1 1 3 1 2 2 2 1 3 2 2 3 2 3 1 3 1 2 1 2 184 1 1 1 2 1 3 1 3 1 1 3 2 2 1 2 3 1 2 3 2 3 1 2 1 185 2 2 1 3 2 3 1 3 1 1 1 2 3 2 2 2 1 1 2 3 2 3 1 2 186 2 3 1 1 3 1 1 2 1 2 3 2 3 1 1 1 2 2 1 3 2 2 2 3 187 3 2 2 2 3 1 2 1 3 2 2 2 1 1 2 3 1 3 2 1 2 2 3 1 188 3 2 2 3 2 1 1 3 2 1 1 2 3 1 2 1 1 1 3 2 1 2 3 1 189 2 1 1 3 1 3 2 1 3 2 1 1 2 2 3 2 2 3 2 2 2 1 3 1 190 2 2 2 3 1 3 1 3 1 3 2 1 2 3 2 1 2 3 1 2 2 1 2 2 191 1 2 2 3 1 2 2 3 2 3 1 2 1 2 1 3 1 2 1 3 1 1 3 1 192 3 1 2 2 1 3 2 1 2 2 2 1 3 2 1 3 2 1 1 2 1 3 1 3 193 2 1 2 3 2 1 2 2 1 3 1 3 1 2 1 2 2 3 1 1 1 3 2 3 194 2 1 2 3 2 3 1 1 1 3 2 1 1 2 3 1 2 1 1 1 2 3 1 3 195 3 2 1 1 2 2 1 3 2 1 1 2 3 1 2 2 2 3 1 1 2 3 1 3 196 3 2 2 2 1 2 2 3 2 1 1 1 3 1 2 3 2 1 1 3 2 3 1 1 197 2 1 3 2 1 3 1 1 2 2 3 2 2 3 2 2 1 1 1 3 1 1 2 3 198 2 1 2 2 3 2 2 1 3 2 2 1 2 3 2 1 3 2 3 2 3 2 1 1 199 3 1 3 2 3 1 1 1 3 2 2 1 2 1 2 3 1 1 1 3 2 1 2 1 200 1 2 1 2 1 3 1 1 3 2 2 3 1 2 3 1 3 2 2 2 1 2 3 1 201 2 2 2 1 3 1 1 3 2 1 1 3 2 1 1 2 1 3 2 3 1 3 2 1 202 2 3 2 3 2 1 2 1 1 3 1 2 1 2 2 2 3 2 1 1 3 1 1 3 203 2 1 3 1 1 3 1 3 2 2 3 2 1 2 2 3 2 2 1 2 1 1 3 2 204 3 2 3 2 2 1 2 2 1 3 2 2 2 1 1 3 2 2 1 3 1 3 2 1 205 1 1 2 1 2 1 3 2 3 1 2 3 2 3 1 1 1 2 2 3 1 1 2 3 206 2 2 1 3 1 3 1 1 2 1 3 1 3 2 3 1 2 2 1 2 1 3 2 2 207 3 1 1 3 2 3 1 3 2 2 1 1 2 3 1 2 2 2 3 2 1 1 1 2 208 1 1 2 3 2 1 1 1 3 2 1 1 1 3 1 1 1 3 2 3 1 2 3 1 209 3 2 2 1 3 2 2 1 2 3 1 2 3 1 1 2 1 2 2 3 2 3 2 1 210 1 1 1 2 3 1 3 2 2 1 3 1 3 2 1 3 1 1 2 2 1 2 3 2 211 3 1 2 1 2 1 3 1 1 3 1 2 2 1 3 2 2 1 3 2 3 1 2 1 212 1 2 1 3 2 2 2 3 2 2 3 1 3 1 2 2 2 1 2 3 1 3 2 1 213 2 1 3 1 1 2 1 3 2 2 1 3 2 1 3 2 1 1 3 1 3 2 1 2 214 3 1 1 2 2 2 3 2 1 2 2 3 2 3 1 1 3 2 2 2 1 3 2 1 215 3 2 1 3 2 1 1 3 1 1 3 1 3 1 1 2 2 1 3 1 2 2 1 1 216 1 1 2 3 2 3 2 2 1 2 3 2 1 2 3 2 1 1 1 2 1 3 2 3 217 3 1 1 2 2 1 3 2 2 1 3 1 3 2 1 1 1 2 2 3 2 2 2 3 218 3 1 1 1 2 2 3 1 1 3 1 2 1 3 2 1 1 3 1 1 1 2 3 2 219 3 2 3 2 1 2 2 1 2 3 2 3 1 2 2 2 1 2 3 1 2 1 3 1 220 2 1 2 2 1 2 3 1 3 1 1 1 3 2 2 3 1 1 2 1 3 2 1 3 221 2 1 2 3 2 1 2 2 3 2 1 2 2 3 1 3 2 1 3 1 2 3 1 1 222 3 2 3 1 2 2 3 1 1 2 1 3 2 1 3 1 2 2 3 2 2 2 1 1 223 1 3 2 1 1 3 2 2 3 2 2 2 3 1 2 2 3 1 2 1 2 2 2 3 224 3 1 1 3 2 2 2 3 1 2 2 2 1 1 3 2 2 2 1 1 3 1 1 3 225 3 1 3 1 1 3 1 2 1 1 1 2 3 1 2 1 2 2 3 2 2 1 2 3 226 1 2 3 1 2 3 1 3 2 2 3 2 2 1 1 2 1 3 2 2 1 3 2 2 227 2 1 2 3 1 2 1 2 2 2 3 1 1 3 1 3 2 3 2 2 1 1 3 1 228 3 1 3 1 2 3 1 2 2 1 1 1 3 2 3 1 2 2 2 1 2 3 1 2 229 1 2 1 3 2 2 1 1 3 1 3 2 3 1 2 3 1 3 1 1 2 1 1 1 230 2 2 2 2 2 2 3 2 2 1 3 1 2 1 1 1 3 1 3 2 2 3 1 3 231 1 3 1 1 2 1 2 2 3 1 2 1 3 2 2 3 1 1 3 2 2 3 1 1 232 2 1 3 2 3 2 1 1 1 3 2 3 2 1 3 1 2 2 3 2 1 1 1 2 233 1 3 2 1 3 2 3 1 2 1 2 3 1 2 2 2 3 1 1 2 1 2 2 3 234 2 3 2 1 2 2 3 1 1 2 2 1 3 1 1 2 1 3 2 3 1 3 1 1 235 2 3 1 2 1 2 3 1 3 1 2 1 3 1 1 3 2 2 2 1 1 2 3 2 236 3 1 1 3 1 1 3 2 1 1 3 2 1 2 1 1 1 3 2 1 1 1 2 3 237 2 2 2 1 1 3 2 3 2 3 1 2 1 1 3 1 1 1 3 1 2 1 3 1 238 2 1 2 2 3 2 2 3 1 1.2 3 2 3 2 2 2 1 1 1 3 1 3 1 239 3 1 1 2 1 1 2 3 1 2 3 1 3 1 2 3 1 2 2 1 2 2 3 1 240 2 1 3 1 3 1 1 1 3 1 3 1 3 1 1 2 2 3 2 1 2 2 1 1 241 1 2 3 2 1 2 1 1 2 1 3 1 3 2 1 2 3 2 2 2 3 2 3 1 242 1 1 2 1 3 1 2 1 1 3 1 2 2 3 1 2 2 3 2 3 2 2 2 3 243 2 2 2 3 1 2 3 1 2 1 1 2 1 3 1 1 3 1 3 1 1 2 3 1 244 1 3 1 2 3 1 1 2 1 1 3 2 2 3 2 3 1 1 2 3 2 2 2 1 245 1 3 1 2 3 1 1 1 3 1 1 1 3 2 3 2 1 3 1 1 2 1 2 2 246 2 3 2 2 1 1 1 2 3 2 1 2 3 2 1 3 2 1 1 2 2 3 1 3 247 2 1 3 2 1 3 2 3 2 3 1 1 3 2 2 1 2 2 2 3 2 2 1 2 248 1 3 2 3 1 1 2 3 2 2 2 3 2 1 1 1 3 1 3 2 2 2 1 1 249 3 1 2 1 1 1 2 3 1 3 1 1 2 2 3 1 3 2 1 1 2 2 3 2 250 2 3 1 2 3 1 3 1 1 1 2 2 3 2 2 2 1 1 3 2 3 2 2 2 251 1 1 1 2 1 1 3 2 1 3 2 3 2 3 1 3 2 1 1 2 1 3 2 1 252 2 1 2 3 1 1 1 2 1 2 3 2 3 1 2 1 3 2 1 1 3 1 3 1 253 1 2 2 3 2 1 1 3 1 3 2 3 1 2 2 1 2 1 3 1 2 3 1 2 254 1 3 1 3 2 1 1 3 1 1 2 3 1 1 1 3 1 3 1 2 1 1 2 1 255 2 1 1 3 2 1 1 3 2 1 3 1 2 3 2 2 1 1 1 3 1 3 1 2 256 1 1 1 2 1 3 1 1 1 3 1 1 2 2 3 2 1 3 1 3 2 1 3 2 257 1 2 1 3 1 2 2 2 1 1 3 2 3 1 1 3 1 3 1 3 2 2 1 2 258 3 1 1 2 3 2 2 2 3 2 1 1 1 2 3 2 1 2 1 3 1 2 1 3 259 1 1 1 2 1 3 1 1 2 3 1 3 2 1 3 2 3 1 1 1 2 1 2 3 260 2 2 3 1 1 2 2 1 2 3 2 1 3 1 3 1 1 1 3 2 1 1 1 3 261 2 1 3 2 1 1 1 2 2 3 1 3 1 3 2 1 3 2 2 3 1 1 2 2 262 2 3 2 1 1 1 3 2 3 2 2 2 1 2 1 3 2 3 2 3 2 1 1 2 263 1 2 1 2 3 1 2 2 2 3 1 3 1 2 3 1 3 1 1 2 3 2 1 1 264 1 1 2 1 2 2 3 1 2 1 2 3 2 3 2 2 3 2 3 1 1 3 2 1 265 1 3 2 3 1 3 1 2 2 1 2 3 1 3 2 1 2 2 3 1 2 2 2 1 266 2 2 3 2 1 2 2 2 1 3 1 2 1 3 2 3 1 3 1 2 2 1 2 3 267 1 2 1 3 1 1 1 2 3 1 1 1 3 1 2 1 3 1 2 1 3 1 1 3 268 3 1 2 2 3 2 1 2 1 2 3 2 1 1 1 3 2 1 3 2 2 2 1 3 269 2 1 2 3 1 1 2 3 2 2 1 2 2 3 2 3 2 3 2 2 3 1 2 2 270 3 1 2 1 2 2 1 3 2 1 3 1 3 2 1 1 3 2 1 2 1 2 2 3 271 2 3 1 3 1 2 3 1 1 2 2 2 3 2 3 2 2 1 2 3 1 2 1 2 272 2 1 2 3 1 1 2 3 1 1 3 2 1 1 1 3 1 3 1 2 3 2 1 1 273 3 1 3 2 3 1 1 2 2 2 3 2 2 3 2 1 1 2 2 2 3 2 2 2 274 1 3 1 1 1 2 2 3 2 1 3 1 3 2 2 1 1 2 2 3 2 3 2 1 275 3 2 3 2 2 1 1 2 3 1 1 1 3 2 2 3 2 3 1 1 2 1 1 2 276 2 3 2 3 1 2 2 2 3 2 2 1 1 3 1 1 3 1 2 2 1 1 2 3 277 1 3 2 1 3 2 1 2 2 3 2 1 1 1 3 2 1 2 1 1 1 3 1 3 278 2 3 1 2 2 3 2 2 3 2 1 2 1 3 2 2 1 2 2 3 2 3 2 1 279 3 1 2 2 3 2 1 3 2 2 2 1 1 2 3 2 2 1 1 3 1 1 2 3 280 1 2 3 1 1 1 2 1 1 3 1 1 1 2 2 3 1 3 2 1 3 1 3 1 281 2 1 2 3 1 2 3 1 2 1 2 2 2 3 2 2 3 2 1 2 3 2 3 2 282 2 2 2 1 3 1 3 2 2 2 3 1 2 2 1 3 2 1 2 3 2 2 2 3 283 1 1 2 1 1 3 1 3 1 2 2 3 2 3 1 2 3 1 3 1 1 1 2 1 284 1 1 2 3 1 1 2 1 3 1 1 2 1 3 1 3 1 1 2 3 2 1 3 1 285 3 2 1 3 2 1 3 2 1 1 2 2 2 3 1 1 2 3 2 2 2 3 1 1 286 1 3 2 3 1 3 2 1 1 2 2 3 1 2 2 3 1 2 2 3 2 2 1 1 287 3 1 1 2 1 1 2 3 2 2 2 1 3 2 3 2 3 2 2 2 3 1 1 1 288 1 2 1 2 3 1 1 1 3 2 1 3 1 3 1 1 1 3 2 3 2 2 1 2 289 2 3 1 3 2 2 1 2 2 3 2 1 2 2 2 1 3 2 2 2 3 1 1 3 290 2 1 3 2 2 3 1 3 2 2 2 1 1 1 3 2 2 3 1 1 1 3 1 1 291 2 1 1 1 3 1 3 2 3 1 2 3 2 1 1 1 2 1 3 1 1 3 2 2 292 2 3 2 1 3 2 3 2 2 2 1 3 1 3 2 1 1 3 2 2 1 2 2 1 293 1 3 1 3 1 2 2 1 1 2 3 2 3 2 2 3 1 1 1 3 1 2 2 1 294 3 2 1 1 2 1 1 3 2 2 3 2 3 1 1 1 3 1 1 3 1 2 2 1 295 3 1 3 1 2 3 2 2 1 2 1 3 1 2 1 1 2 3 1 1 1 3 1 1 296 2 2 2 1 3 2 2 3 1 2 2 3 2 2 3 1 1 2 1 3 1 3 2 1 297 1 2 2 1 2 2 3 1 1 1 3 2 1 3 1 2 3 2 2 1 3 1 2 3 298 2 2 2 1 2 3 2 3 2 3 1 2 2 3 1 3 2 3 2 2 2 1 1 2 299 2 1 2 2 2 1 3 2 2 1 3 1 2 1 3 1 2 1 3 1 3 1 3 2 300 1 2 3 2 3 2 2 2 1 2 3 2 3 1 1 1 3 1 2 2 2 3 2 1 301 1 2 1 3 2 1 1 2 2 1 3 1 1 3 1 3 1 1 3 1 1 2 3 2 302 2 1 2 3 1 3 2 3 1 2 2 1 3 1 1 2 2 3 2 1 2 2 2 3 303 2 2 1 1 2 3 2 1 2 2 3 2 2 2 1 1 1 3 1 3 2 3 2 3 304 1 2 1 3 1 3 1 1 2 2 1 1 3 1 1 2 2 3 2 2 2 3 1 3 305 3 2 2 1 2 1 1 3 2 1 3 1 1 1 2 3 2 1 2 1 3 1 1 3 306 1 3 2 1 1 2 2 1 3 2 2 2 3 1 1 1 2 3 2 3 2 1 3 2 307 3 1 1 1 3 1 2 2 1 2 3 1 2 2 3 2 1 1 1 3 2 3 1 2 308 3 2 1 1 3 1 2 2 1 3 1 1 3 2 2 1 1 2 3 1 1 3 1 1 309 3 1 3 1 1 2 3 2 2 3 1 1 2 1 1 3 1 1 3 2 1 1 2 2 310 2 2 1 1 3 1 3 2 3 2 2 2 3 1 1 2 1 3 2 3 2 2 2 1 311 1 2 1 1 1 3 1 1 1 3 1 3 2 1 2 3 1 3 1 2 2 1 2 3 312 1 3 2 2 1 2 2 3 1 2 2 3 1 1 3 1 2 3 1 3 1 1 1 2 313 3 2 2 2 3 2 3 2 2 2 3 2 1 2 1 1 3 2 2 3 2 2 1 1 314 2 2 3 2 1 2 3 2 3 1 3 2 2 2 1 3 1 2 2 1 1 2 3 1 315 2 1 3 2 2 1 1 1 3 2 1 2 1 3 2 2 3 2 2 2 3 1 3 2 316 1 1 1 2 2 2 3 2 3 2 2 3 1 3 1 2 2 2 3 2 1 2 1 3 317 2 1 2 2 1 3 2 3 2 2 1 2 3 1 2 1 1 1 3 1 3 1 1 3 318 2 1 2 1 1 3 1 1 3 2 1 1 2 2 2 3 1 3 1 1 3 1 3 2 319 2 1 1 3 2 2 3 1 3 1 2 3 2 2 2 3 2 2 2 3 1 2 1 1 320 3 2 3 2 1 3 1 2 2 2 1 2 3 1 1 2 2 3 1 3 2 1 1 2 321 2 1 2 1 3 1 3 1 1 3 2 3 2 2 2 1 3 2 2 3 2 1 2 1 322 1 2 1 1 1 3 1 1 3 1 1 2 1 3 2 2 3 2 2 3 2 3 2 1 323 1 3 1 2 2 3 1 1 1 2 1 3 1 2 2 1 3 1 1 1 3 2 2 3 324 3 2 2 3 2 2 1 2 1 1 3 1 1 1 2 1 3 2 2 2 3 2 2 3 325 1 3 1 1 1 2 1 3 1 3 2 1 1 3 1 3 2 3 2 2 2 1 1 1 326 1 3 1 3 1 2 1 3 2 1 3 2 1 1 1 2 1 3 2 2 1 2 2 3 327 1 1 1 2 3 1 2 2 3 2 3 2 1 1 3 2 2 1 2 3 2 1 2 3 328 1 1 3 1 1 3 2 1 1 3 1 3 1 3 1 1 1 2 2 2 3 1 1 2 329 3 2 3 2 3 2 1 2 2 2 1 3 2 2 3 1 2 1 1 2 2 3 1 2 330 1 2 2 3 2 2 3 2 2 3 2 2 3 1 3 1 1 1 2 3 2 1 2 2 331 1 3 1 2 1 1 3 2 2 1 1 1 3 2 1 1 1 3 1 3 1 1 2 3 332 2 1 3 2 2 3 1 1 3 2 2 1 3 2 2 2 1 1 3 2 3 2 2 1 333 1 3 2 1 1 3 1 1 2 3 2 1 1 2 1 2 3 1 2 3 1 2 1 3 334 1 2 3 1 3 1 2 2 3 1 1 1 3 1 2 2 2 1 2 3 1 1 2 3 335 2 3 1 2 2 3 1 1 2 2 1 3 1 3 1 3 1 1 2 3 2 1 2 1 336 1 3 2 2 1 3 2 1 1 3 1 3 1 1 2 1 2 1 3 2 3 1 1 2 337 1 2 2 1 1 3 1 2 2 3 2 1 2 1 3 2 2 1 3 2 3 1 2 3 338 3 1 3 1 2 1 1 1 3 1 1 2 2 3 1 1 1 2 1 3 1 1 3 1 339 1 3 1 3 2 1 1 1 2 3 2 2 1 1 3 1 1 1 3 1 1 3 2 2 340 1 1 1 3 2 2 2 3 2 2 1 2 3 2 3 2 3 1 1 3 1 1 2 2 341 1 2 2 3 2 3 2 2 2 1 1 3 1 1 1 2 1 2 3 1 2 3 1 3 342 2 1 2 2 3 1 1 1 2 3 1 3 1 2 3 2 1 2 3 2 1 3 2 2 343 1 2 2 2 3 2 3 2 3 1 2 3 2 2 2 3 1 1 1 2 1 2 3 1 344 2 1 1 3 1 2 1 1 2 1 3 2 3 1 3 1 3 1 1 1 2 2 3 1 345 1 2 2 2 1 2 3 1 2 2 1 3 2 3 2 1 1 3 2 3 2 2 3 2 346 3 1 2 2 1 1 3 1 1 2 1 1 1 3 2 3 2 3 1 1 3 1 1 2 347 3 2 1 1 2 2 3 1 2 3 1 1 3 1 3 2 2 1 3 2 2 2 1 2 348 2 3 2 3 2 2 1 2 3 2 2 1 2 1 1 3 1 1 3 2 3 1 2 1 349 1 3 1 3 1 1 1 2 2 3 1 1 2 2 2 1 3 1 1 1 2 3 2 3 350 2 2 1 2 2 3 1 1 2 3 2 3 1 3 1 1 1 3 2 1 2 2 2 3 351 2 3 2 2 1 1 2 3 1 3 1 1 3 1 2 1 1 2 3 1 2 1 3 2 352 3 1 1 1 3 2 1 2 2 2 3 2 2 3 1 2 2 1 2 2 3 2 2 3 353 2 1 3 2 2 2 1 2 3 2 1 3 2 2 1 1 2 2 3 2 2 3 1 3 354 3 2 2 3 1 1 1 3 1 2 1 3 2 2 2 3 1 2 1 2 3 2 1 2 355 2 2 1 3 1 1 3 1 2 1 3 1 2 2 1 2 2 3 1 3 1 1 1 3 356 1 1 2 1 1 2 3 2 2 3 2 3 1 1 1 2 1 3 1 2 3 2 3 1 357 1 3 2 1 1 3 1 1 1 3 2 2 2 1 3 2 2 2 1 3 2 2 1 3 358 2 1 3 2 2 2 1 1 2 3 1 3 1 2 3 2 2 2 3 1 2 1 2 3 359 2 2 1 1 1 3 1 2 3 2 2 1 1 1 3 1 1 2 3 1 3 2 3 1 360 1 1 1 3 2 3 2 3 2 1 2 1 2 3 2 2 1 3 1 1 1 3 2 1 361 1 2 2 1 1 3 2 2 1 2 3 2 3 2 2 2 1 2 3 2 3 2 2 3 362 2 2 2 3 1 1 3 1 1 3 2 3 2 2 2 3 2 1 2 2 1 2 3 2 363 2 3 2 2 1 1 3 1 1 3 2 2 2 1 3 2 2 1 1 1 3 2 2 3 364 2 2 2 1 1 3 2 1 2 1 1 3 1 2 2 3 2 3 2 3 1 3 1 2 365 1 3 1 2 1 2 2 2 3 1 2 1 3 1 2 1 3 1 1 3 1 1 1 3 366 1 2 2 2 1 3 1 3 2 2 3 2 1 1 3 1 1 3 1 2 1 2 2 3 367 3 1 3 1 1 1 2 2 3 2 1 1 2 2 3 2 2 1 3 1 3 2 1 2 368 3 1 1 3 2 1 2 1 2 3 2 2 1 1 3 1 2 3 2 1 1 2 1 3 369 1 1 2 1 2 2 3 1 1 3 1 2 3 2 1 3 2 3 1 3 2 2 1 2 370 3 1 3 2 2 2 1 3 1 1 1 2 3 1 2 1 1 1 3 1 1 2 2 3 371 2 1 1 3 1 1 1 2 3 1 3 2 2 1 2 1 2 3 2 2 3 1 3 1 372 2 2 3 1 2 1 2 1 1 3 1 1 3 2 2 3 2 3 1 2 1 1 3 2 373 1 1 3 2 3 2 2 2 1 1 2 3 2 1 1 3 1 3 1 1 2 3 1 1 374 3 2 2 3 2 3 1 3 1 1 2 2 1 3 1 1 1 2 1 3 2 1 2 1 375 2 2 2 1 3 2 2 2 3 1 2 3 2 3 2 2 2 1 2 3 1 3 1 2 376 3 2 1 1 2 2 3 1 1 1 3 2 1 2 3 1 3 2 1 3 2 1 1 2 377 2 1 3 2 2 3 1 1 2 1 1 3 1 2 2 3 1 3 1 3 1 1 1 2 378 2 2 1 1 3 2 3 1 1 3 2 3 2 2 3 2 2 2 1 2 2 3 1 1 379 1 2 2 3 1 2 2 2 3 2 2 3 1 1 1 2 1 1 3 2 3 2 2 3 380 2 3 1 1 2 2 3 2 2 3 1 2 1 1 3 2 2 1 2 3 1 1 3 1 381 3 2 2 2 3 2 2 1 2 2 3 1 3 2 1 1 3 2 2 3 1 1 2 2 382 2 3 1 2 2 2 1 3 2 1 2 3 2 1 2 2 1 3 1 3 2 2 3 1 383 2 1 1 1 2 1 3 1 3 1 2 3 1 3 1 1 2 1 1 3 1 1 1 3 384 1 3 1 1 2 3 2 2 1 2 1 2 3 2 1 3 1 3 1 1 1 2 2 3 385 1 2 2 2 1 2 3 2 1 3 2 2 3 1 3 1 3 2 3 1 2 1 1 1 386 3 2 1 1 1 3 1 2 1 3 2 2 2 3 1 3 2 1 1 2 2 2 3 1 387 3 1 1 1 2 1 3 2 1 2 1 1 2 3 2 2 1 1 3 2 3 1 3 1 388 1 2 2 3 2 1 2 1 2 2 3 2 3 2 2 3 1 1 3 1 1 1 3 2 389 3 1 3 2 2 1 1 3 2 3 2 1 1 1 2 3 1 1 1 2 3 2 1 1 390 1 2 1 3 1 2 2 3 2 3 2 3 1 1 1 3 1 1 1 3 1 1 2 2 391 2 2 1 1 2 1 3 1 1 3 2 2 2 3 2 1 3 2 1 2 3 1 2 3 392 2 2 3 2 1 2 3 2 3 1 3 1 1 2 1 1 1 3 2 2 2 1 3 2 393 3 2 3 1 2 2 1 3 1 2 1 2 3 1 2 3 1 2 1 2 3 1 1 2 394 2 3 1 1 3 1 1 3 1 1 2 2 2 1 3 1 2 2 2 3 2 1 1 3 395 2 3 2 1 2 3 1 2 2 1 2 2 3 1 2 2 1 3 2 3 2 3 2 2 396 2 3 2 3 1 1 1 3 1 3 1 1 2 3 1 2 1 3 1 2 1 2 2 2 397 1 1 2 2 3 1 1 1 2 3 1 3 2 3 2 3 2 2 2 1 1 3 1 1 398 1 2 2 1 2 1 3 1 3 2 2 1 3 2 2 2 1 3 1 1 2 3 1 3 399 1 1 1 3 1 2 1 3 1 1 1 2 2 3 1 3 2 3 2 1 2 3 1 2 400 3 2 1 3 2 2 2 3 2 2 1 1 2 3 2 2 3 2 1 2 1 1 2 3 401 1 3 1 3 1 2 1 2 2 1 3 1 1 2 3 2 1 1 3 1 1 2 1 3 402 1 3 1 1 3 2 2 2 3 1 1 1 2 1 2 3 1 2 1 3 1 1 2 3 403 2 1 3 1 1 2 3 2 1 1 1 3 2 2 2 1 3 2 1 2 1 3 1 3 404 1 3 2 1 3 1 2 3 2 1 2 3 2 2 1 1 2 3 2 3 1 1 2 1 405 2 3 1 1 1 3 2 3 1 1 1 2 1 2 3 1 1 1 2 3 2 2 3 2 406 1 2 1 3 2 1 2 1 2 2 3 1 3 2 2 2 3 2 1 2 3 1 1 3 407 3 1 1 3 1 1 1 2 3 2 2 2 3 2 1 3 1 1 2 1 1 3 2 1 408 1 1 2 3 1 3 2 1 2 2 3 1 1 3 1 1 1 2 3 2 1 2 1 3 409 3 2 3 1 2 1 3 1 1 2 2 2 3 2 3 2 2 2 1 1 2 3 1 1 410 2 3 2 1 3 2 1 2 3 1 1 3 1 1 2 1 1 2 3 1 1 1 2 3 411 1 2 1 3 1 1 3 2 2 1 1 2 3 1 2 1 1 2 2 3 2 3 2 3 412 3 2 3 1 2 2 3 2 1 1 3 2 1 1 3 2 1 1 1 3 1 2 1 1 413 2 1 2 3 2 1 3 2 2 2 3 2 3 2 2 1 2 2 2 3 1 1 3 1 414 2 3 1 3 2 1 1 3 2 2 2 3 2 1 2 3 2 2 2 1 1 3 2 1 415 2 1 1 1 2 3 2 1 2 3 1 3 2 3 2 3 2 1 1 1 3 1 1 1 416 3 2 1 1 3 1 3 2 1 2 2 3 1 1 1 2 2 1 3 2 1 1 3 1 417 3 2 2 3 1 3 2 3 2 1 1 1 3 1 2 2 1 2 2 3 1 2 1 1 418 1 3 2 1 2 3 1 3 2 2 1 2 2 1 3 1 2 1 1 1 3 2 3 1 419 1 2 2 2 3 2 1 2 1 3 1 3 2 2 2 3 2 3 2 2 3 2 1 2 420 2 1 1 2 2 1 3 2 1 3 2 3 2 3 2 2 3 1 1 1 2 2 2 3 421 2 3 2 1 2 2 3 1 3 1 2 2 3 2 2 1 2 2 3 2 1 2 2 3 422 3 2 2 1 2 2 1 3 1 1 3 1 3 1 2 1 1 2 2 3 1 3 2 2 423 2 2 3 1 3 2 2 3 2 3 1 2 2 1 1 3 2 1 3 2 1 2 1 2 424 3 1 2 1 3 2 1 2 1 1 2 3 1 2 2 3 1 1 3 2 1 1 2 3 425 3 2 3 1 1 1 3 1 2 1 2 2 2 3 1 3 1 3 1 2 1 1 1 2 426 1 3 2 2 1 2 3 1 2 2 2 3 1 1 3 1 1 1 2 2 3 2 2 3 427 3 2 1 1 3 2 1 2 2 2 3 1 1 2 2 2 3 1 2 3 1 3 2 2 428 2 1 1 2 1 3 2 3 2 2 1 2 1 1 3 2 3 1 1 1 3 1 3 2 429 1 1 1 2 3 1 1 2 2 3 1 2 3 2 3 2 1 2 1 2 3 1 1 3 430 1 3 1 1 1 3 2 3 1 3 2 2 3 2 2 1 1 3 2 1 2 2 2 1 431 2 2 2 1 2 3 2 3 2 3 1 1 2 2 3 2 3 2 1 2 1 2 1 3 432 3 2 1 1 2 1 2 3 1 2 1 3 1 1 1 2 3 2 1 1 1 3 1 3 433 3 1 3 1 1 2 2 3 2 2 2 1 1 1 3 1 2 1 3 2 2 3 2 1 434 3 1 1 2 2 2 3 2 2 1 1 3 1 1 2 3 1 3 2 2 2 3 1 2 435 1 2 1 3 2 3 1 2 3 1 2 2 1 1 1 3 1 3 1 1 2 2 2 3 436 1 2 1 3 1 2 3 2 2 2 1 3 2 2 3 1 3 1 2 2 1 2 2 3 437 1 1 3 1 3 2 3 2 1 1 1 2 1 3 1 1 1 3 2 3 1 2 1 2 438 2 3 2 3 2 1 2 2 3 1 2 2 3 2 2 3 1 3 1 2 1 1 1 2 439 2 1 3 2 1 2 1 3 2 3 1 3 1 1 1 3 1 3 2 2 1 1 1 2 440 1 1 1 3 1 2 1 1 3 1 1 1 3 1 3 1 2 3 1 2 3 2 2 2 441 3 1 1 3 2 2 1 2 2 3 1 1 1 2 1 3 1 3 1 1 3 2 1 2 442 1 2 3 2 1 2 3 2 1 2 1 3 1 1 1 3 1 3 2 1 1 1 2 3 443 3 1 2 3 2 2 2 3 2 1 1 1 3 1 2 2 3 1 1 1 2 2 3 1 444 1 1 2 2 2 1 3 1 3 1 3 2 1 2 2 2 3 2 3 2 2 3 2 1 445 1 1 2 2 2 3 2 2 2 3 1 1 1 3 1 1 1 3 2 1 1 3 2 3 446 1 1 1 3 1 3 2 1 3 2 3 2 2 1 2 2 3 2 2 1 3 1 2 1 447 3 2 1 2 3 2 2 3 2 1 2 1 2 3 2 2 3 2 2 3 1 2 1 2 448 3 2 1 3 1 1 2 2 2 3 2 2 3 1 3 2 1 2 2 2 3 2 1 1 449 1 2 3 1 1 2 2 2 1 3 2 2 1 3 2 3 2 1 1 3 1 1 1 3 450 1 2 3 1 2 1 1 3 1 1 1 2 3 2 2 3 1 2 3 1 1 3 2 1 451 2 2 3 1 2 3 1 2 3 1 1 3 1 2 1 1 2 3 2 1 3 1 2 1 452 1 3 1 2 3 1 2 1 2 3 1 2 1 2 1 3 1 2 2 1 3 1 2 3 453 2 2 3 1 1 1 3 2 2 1 3 1 1 1 3 1 2 1 3 1 2 3 2 2 454 3 2 2 2 1 1 2 3 2 2 1 3 2 2 1 3 1 1 1 3 2 1 1 3 455 3 1 3 1 2 2 2 1 1 3 2 2 2 3 1 1 3 2 3 1 1 1 2 1 456 2 2 2 3 2 2 1 3 2 1 3 2 2 3 2 2 1 2 1 1 3 1 3 1 457 2 1 2 3 1 3 1 1 2 1 3 2 2 2 3 2 2 1 3 2 3 1 1 2 458 2 2 3 1 1 1 3 2 2 2 1 1 1 3 1 1 3 1 3 1 2 1 1 3 459 1 1 3 2 3 1 3 2 2 3 1 1 1 2 3 1 1 1 2 1 2 3 2 2 460 3 2 2 1 3 1 1 1 2 3 1 1 1 2 3 1 3 2 1 3 2 2 1 2 461 2 1 1 3 2 1 2 2 3 2 1 2 2 2 3 2 3 2 3 2 3 2 1 2 462 2 3 2 1 2 2 1 3 2 1 1 1 3 1 1 3 1 3 1 3 1 1 2 1 463 3 1 3 1 1 3 1 3 1 1 1 2 1 1 3 2 2 3 1 1 1 2 1 1 464 3 2 1 1 1 3 2 1 3 1 1 1 2 1 3 1 1 2 2 3 1 3 2 2 465 3 2 3 2 3 2 2 1 2 2 2 3 2 2 2 3 2 1 1 1 3 2 1 2 466 2 2 2 3 1 2 3 2 1 2 3 1 1 2 1 2 1 3 2 1 2 3 1 3 467 1 1 3 1 2 2 3 2 3 2 3 1 1 2 1 3 2 2 3 1 1 1 2 2 468 2 1 2 1 1 1 3 2 2 2 3 1 1 3 1 2 3 1 3 2 3 1 2 1 469 1 3 1 2 1 1 1 3 1 3 1 2 2 2 1 1 3 1 2 3 2 1 2 3 470 3 1 1 3 1 1 2 2 1 1 3 2 2 3 1 3 1 1 2 2 1 1 3 1 471 2 1 3 1 3 1 1 1 2 2 2 3 1 2 1 1 1 3 1 1 1 3 1 3 472 1 1 1 3 2 2 2 1 2 3 1 1 3 2 2 1 2 2 3 1 3 2 1 3 473 1 1 1 2 1 3 2 3 2 1 1 3 2 1 1 1 3 1 3 1 2 3 1 2 474 2 1 2 3 1 2 3 1 2 2 2 1 3 2 2 1 2 1 1 3 1 3 2 3 475 2 1 3 1 2 1 1 1 2 3 2 2 1 2 3 1 2 3 1 3 2 1 1 3 476 1 3 1 2 2 3 1 2 2 3 2 3 1 2 3 1 2 2 2 3 2 1 2 1 477 2 2 1 1 3 1 1 3 1 1 2 2 3 2 1 2 1 2 3 1 3 1 3 2 478 3 2 1 3 1 1 2 3 2 2 2 1 3 1 3 2 2 3 1 1 2 1 2 1 479 3 1 3 1 1 1 2 1 3 2 1 1 3 1 1 3 2 1 1 1 2 1 3 1 480 1 2 2 3 1 1 3 2 2 3 2 2 1 2 3 2 3 1 1 3 1 2 2 2 481 2 1 1 1 2 3 2 2 3 2 3 2 1 3 1 3 2 1 1 2 2 1 3 1 482 1 1 1 2 1 1 3 1 3 2 2 2 3 1 3 1 1 3 2 2 3 2 2 2 483 1 3 2 2 3 2 1 1 2 1 1 3 1 1 3 2 3 1 2 2 2 1 1 3 484 3 2 2 1 3 1 1 2 3 2 1 2 1 2 1 3 1 3 2 2 1 3 1 2 485 2 2 3 1 2 1 2 2 3 1 1 1 3 1 3 1 1 1 3 2 2 1 2 3 486 2 2 1 1 1 3 1 3 1 3 1 1 1 2 3 2 2 2 3 1 2 2 1 3 487 2 3 2 3 1 1 2 2 2 3 1 3 2 1 2 2 1 3 2 1 1 3 1 1 488 2 1 1 2 2 2 3 1 1 2 3 2 3 1 1 1 3 2 2 3 2 2 1 3 489 1 2 3 2 3 2 2 2 3 1 1 1 3 1 2 3 1 2 3 1 2 2 2 1 490 1 1 3 2 2 1 2 3 2 2 3 1 2 1 2 2 3 1 3 2 3 1 1 1 491 2 1 3 1 2 1 1 1 3 1 1 3 1 2 1 3 1 3 1 2 2 2 1 3 492 3 1 2 3 1 1 2 3 2 1 3 1 2 1 2 1 2 3 2 1 1 2 3 1 493 3 1 1 3 1 1 2 1 3 2 2 2 1 2 3 2 1 1 1 2 3 1 2 3 494 3 2 1 3 2 1 2 1 2 1 3 2 2 1 1 1 3 1 2 3 1 3 2 2 495 3 2 2 1 2 2 2 3 2 3 2 1 2 3 1 2 2 1 2 3 1 2 2 3 496 1 3 1 3 1 2 2 1 3 1 1 1 2 2 3 1 3 1 3 1 1 2 2 1 497 3 2 1 2 3 1 2 1 3 1 3 2 2 2 1 2 1 3 2 3 1 2 1 1 498 3 2 2 1 3 1 1 1 3 1 1 2 3 1 1 1 2 2 3 1 1 3 2 1 499 1 1 3 1 1 2 3 1 3 1 1 2 1 2 1 3 1 3 1 2 3 1 1 2 500 1 1 1 3 1 3 1 1 2 1 3 2 3 2 2 2 1 1 3 1 1 3 1 2 501 3 1 2 3 2 3 2 2 1 2 2 3 1 2 1 3 1 1 1 2 2 1 3 1 502 2 1 3 1 3 2 2 1 2 1 3 1 3 1 2 1 2 2 3 2 1 2 3 1 503 3 1 3 1 3 2 2 3 1 1 2 1 1 3 2 2 1 1 1 3 1 2 1 2 504 1 3 1 2 1 2 3 1 1 1 2 1 3 1 2 2 3 2 2 1 3 1 3 1 505 3 1 3 2 3 1 1 2 1 3 1 1 1 3 1 2 1 2 3 2 2 1 1 2 506 1 1 1 3 1 3 1 2 1 2 2 3 1 1 3 1 3 1 1 2 1 1 1 3 507 3 2 2 1 2 1 3 1 1 2 1 1 3 2 2 3 2 1 1 1 3 2 3 2 508 2 3 1 2 1 3 2 1 2 3 1 2 1 1 2 3 2 3 2 2 2 1 2 3 509 2 2 2 3 2 2 3 2 2 1 1 3 2 1 2 3 2 3 1 2 2 2 1 3 510 2 1 1 1 3 2 3 2 2 3 2 3 2 2 1 1 1 3 1 2 2 1 1 3 511 2 3 2 3 2 2 2 3 1 2 2 3 1 2 2 1 1 2 3 2 2 1 2 3 512 1 2 2 1 1 2 3 1 1 2 3 1 3 2 3 2 2 3 2 1 1 2 3 2 513 2 1 3 1 2 3 2 2 2 3 2 3 1 3 2 2 2 3 1 2 1 2 2 1 514 3 1 1 2 3 1 1 2 1 3 2 1 1 2 1 3 1 2 3 1 2 2 2 3 515 1 1 2 1 3 2 3 2 3 2 2 3 2 2 1 2 1 2 3 1 2 2 1 3 516 2 1 3 1 2 2 1 3 1 1 3 1 2 3 2 2 3 2 3 2 1 2 2 1 517 1 1 2 3 2 3 2 3 2 3 2 2 1 1 1 2 3 1 1 2 2 2 3 2 518 3 1 1 2 2 1 1 3 2 1 2 1 2 3 1 3 2 3 2 1 3 1 1 1 519 2 2 1 2 2 3 2 3 2 3 2 1 1 3 2 1 3 2 3 2 1 1 1 2 520 3 2 1 3 2 1 1 1 3 1 3 1 1 2 2 3 2 2 2 1 3 2 1 2 521 1 1 3 2 2 2 3 2 1 1 3 1 1 3 2 1 3 2 2 3 1 1 2 1 522 1 3 2 2 1 2 1 3 2 1 2 1 3 2 1 3 2 1 2 1 3 1 3 1 523 3 1 1 1 3 1 1 1 2 3 2 3 2 1 2 1 3 2 2 2 1 1 2 3 524 2 2 3 2 3 1 3 2 1 1 2 3 1 1 2 3 1 2 3 2 1 2 2 1 525 3 2 1 3 1 3 2 2 3 2 1 1 1 2 1 3 1 3 1 1 2 1 1 1 526 1 2 2 1 1 2 3 2 1 3 1 2 2 3 2 1 1 3 1 3 1 2 1 3 527 2 2 1 3 2 3 2 3 2 2 2 3 2 1 3 1 2 1 3 1 1 2 2 1 528 1 3 1 3 1 3 2 2 2 3 2 3 2 1 2 1 2 3 2 1 2 1 1 1 529 2 2 1 1 3 2 2 2 1 3 2 3 1 3 1 2 2 2 3 2 2 1 1 3 530 1 2 3 1 1 3 2 2 2 1 2 2 3 1 1 2 1 3 2 1 3 2 3 1 531 1 2 1 2 2 2 3 2 3 2 2 3 2 1 2 3 2 2 2 3 2 3 1 1 532 1 1 1 3 2 3 2 2 2 1 2 1 3 1 1 3 1 2 2 2 3 1 2 3 533 1 1 3 1 3 1 2 1 2 3 1 2 2 2 3 2 2 1 3 2 2 3 2 1 534 1 1 3 1 1 3 1 1 1 2 3 1 3 2 3 1 2 1 1 2 3 2 1 1 535 2 1 3 2 3 2 2 2 3 1 2 1 2 3 2 2 1 1 3 1 1 3 2 2 536 3 2 1 3 1 1 1 3 2 3 1 2 1 3 1 2 2 1 3 2 1 1 2 1 537 3 1 2 1 1 1 2 3 2 2 1 1 3 2 2 1 3 2 1 2 3 1 2 3 538 1 3 1 2 2 1 3 1 1 3 1 1 2 2 3 2 2 2 1 3 1 1 2 3 539 1 2 1 2 2 2 3 1 3 1 1 3 2 3 2 3 1 1 1 2 3 1 1 2 540 2 3 1 3 2 1 1 1 2 1 3 2 2 2 1 2 3 1 3 2 1 3 2 1 541 2 2 1 3 1 3 1 3 2 1 3 1 2 1 1 1 3 1 2 2 2 3 1 2 542 1 2 2 3 2 2 2 1 1 3 2 2 3 2 2 3 1 2 1 1 3 1 2 3 543 3 2 2 3 2 1 1 1 3 2 2 1 1 1 3 2 3 2 3 1 1 2 2 2 544 1 2 1 3 1 2 2 3 2 3 2 3 2 2 2 3 2 2 1 2 1 3 2 1 545 3 2 1 1 3 2 2 1 2 2 3 1 3 1 1 2 3 1 2 1 1 2 1 3 546 2 1 3 1 2 2 1 3 2 2 3 1 2 1 1 3 2 3 2 3 2 1 1 2 547 1 1 1 2 3 2 1 1 1 2 3 1 1 3 1 3 2 3 2 2 2 3 2 2 548 3 1 2 1 3 1 1 3 1 1 1 2 3 2 1 2 1 2 1 3 2 3 1 2 549 2 1 2 1 3 1 3 2 3 2 1 2 3 2 2 1 2 3 1 2 1 1 1 3 550 2 1 2 3 1 1 3 2 3 1 2 1 1 3 1 2 3 1 1 3 1 1 2 2 551 2 3 2 2 3 1 3 1 1 2 1 3 2 1 1 3 1 3 1 1 2 2 2 1 552 2 1 3 1 2 1 1 2 3 2 3 1 1 3 2 1 1 2 1 1 3 2 3 1 553 3 2 1 2 2 1 2 3 1 2 3 1 2 1 3 2 1 3 2 1 1 3 2 1 554 1 3 1 2 1 2 3 1 2 2 2 1 3 2 1 2 2 3 1 1 2 3 2 3 555 1 1 2 2 1 1 3 2 2 2 3 2 1 3 1 3 2 3 1 2 2 2 3 1 556 1 1 3 1 1 1 2 1 3 1 2 3 2 1 3 2 1 1 3 1 2 3 2 2 557 2 2 3 1 3 1 1 3 2 2 3 2 2 3 2 1 1 2 1 1 3 1 1 2 558 1 3 2 3 2 3 1 1 1 2 1 3 2 3 1 1 1 3 2 2 2 1 1 1 559 2 2 2 1 2 3 2 1 3 2 1 3 1 2 2 2 1 2 3 2 3 1 1 3 560 1 2 2 1 1 2 3 1 3 1 1 1 2 2 1 3 2 3 2 3 2 2 1 3 561 1 2 3 2 2 1 1 2 1 3 2 3 1 2 1 3 2 1 1 1 3 2 3 1 562 2 1 2 3 2 2 3 1 2 1 1 1 2 3 1 2 2 1 2 3 1 3 2 3 563 2 2 1 2 2 1 3 1 3 2 2 3 2 3 2 3 2 3 1 2 1 2 1 2 564 2 3 2 2 3 2 2 1 2 3 1 2 2 3 1 3 2 2 1 3 1 1 2 1 565 1 1 2 2 2 3 1 3 2 2 1 1 3 1 1 3 1 1 3 2 3 2 1 1 566 1 1 1 3 1 2 1 1 1 3 2 2 1 1 3 2 3 2 2 2 3 2 1 3 567 2 3 2 2 3 1 3 1 2 3 1 2 1 2 2 3 2 1 2 1 1 3 2 2 568 2 1 1 1 2 1 3 2 3 1 1 2 3 1 3 2 2 1 2 1 3 1 3 2 569 1 2 1 3 1 2 3 2 2 1 2 3 1 2 1 3 2 2 1 3 2 2 1 3 570 3 2 2 1 1 3 2 3 1 1 3 1 2 1 2 3 2 1 2 2 3 2 2 1 571 2 1 1 3 1 1 1 3 2 1 1 1 3 2 2 2 3 2 1 3 1 2 3 2 572 1 1 3 1 3 1 1 1 3 2 2 2 3 1 2 2 3 1 1 2 1 1 1 3 573 1 2 1 2 2 1 3 1 2 3 2 3 1 3 2 2 1 2 1 2 3 2 3 2 574 1 3 2 2 2 3 1 3 2 2 2 1 3 2 1 2 2 3 2 3 1 1 2 1 575 1 2 3 2 2 1 1 1 2 3 1 3 1 3 1 2 2 3 2 3 2 1 2 1 576 2 1 1 1 2 3 2 2 3 2 3 1 2 2 1 2 2 3 2 3 1 3 1 2 577 2 1 1 3 1 1 2 2 3 1 1 3 2 1 1 3 1 3 2 2 1 2 2 3 578 1 3 1 3 1 2 1 3 1 1 2 2 1 1 3 2 2 2 3 2 2 3 1 2 579 3 1 1 3 2 1 2 3 2 2 1 1 3 1 1 1 2 1 2 3 2 1 1 3 580 2 1 2 2 2 3 2 3 1 2 2 1 1 3 1 1 3 2 2 3 1 3 1 1 581 1 3 2 2 1 3 1 1 2 2 2 3 2 3 2 1 3 2 1 3 1 1 2 2 582 1 1 3 2 2 2 1 2 2 3 2 2 3 1 2 3 2 2 3 2 1 2 2 3 583 3 1 1 2 3 1 3 2 2 2 1 1 3 1 3 2 2 2 1 2 1 3 2 1 584 1 3 2 3 1 1 3 1 2 2 3 2 2 2 3 2 1 3 2 1 2 1 1 1 585 1 3 2 2 3 1 1 1 2 3 1 3 2 1 2 2 1 1 3 2 1 1 2 3 586 1 2 3 2 3 2 2 1 2 2 2 3 1 3 1 2 3 1 3 2 1 1 2 2 587 1 1 1 2 1 3 2 3 2 2 3 2 2 3 1 1 3 2 2 3 2 2 1 2 588 3 2 1 3 1 3 1 1 1 3 1 2 1 2 1 2 3 2 1 3 2 2 2 1 589 3 1 3 1 3 2 1 2 2 2 3 1 2 3 1 2 2 3 1 2 2 1 2 2 590 3 1 3 2 1 2 1 1 3 2 2 2 1 3 2 3 2 1 2 1 2 2 3 1 591 1 2 1 1 2 3 2 3 1 2 2 1 2 2 3 1 2 2 3 1 3 1 3 1 592 2 2 1 3 2 2 3 2 2 1 2 3 2 3 1 3 1 3 2 1 1 2 1 1 593 1 1 1 2 3 1 3 2 1 2 1 2 2 3 1 1 2 2 3 2 3 1 2 3 594 1 1 2 2 1 3 1 1 3 2 1 1 3 2 1 3 1 3 2 2 2 1 1 3 595 2 3 2 1 1 3 2 2 2 1 1 1 3 2 1 1 3 1 1 1 2 3 2 3 596 3 1 1 1 2 3 1 2 1 1 3 2 2 3 1 2 1 2 1 1 3 1 1 3 597 1 1 2 3 1 3 2 1 3 2 2 2 3 2 1 2 2 2 3 1 3 2 2 2 598 1 3 2 3 1 1 2 3 2 1 1 3 1 2 2 1 2 3 2 1 2 2 2 3 599 3 2 1 1 2 2 3 1 1 2 2 3 1 1 1 3 1 2 1 1 3 2 3 2 600 2 1 2 3 2 2 2 1 1 3 2 1 3 2 3 1 1 1 2 1 3 1 3 2 601 3 2 1 2 2 3 1 1 1 2 2 3 1 1 2 2 1 3 1 1 3 2 1 3 602 1 1 2 1 2 3 2 1 1 2 3 2 1 3 2 2 3 1 1 1 3 2 3 1 603 2 3 1 1 2 1 2 2 3 1 3 1 1 2 2 1 2 3 1 3 1 3 2 2 604 2 1 3 2 3 2 1 1 1 2 3 1 2 3 1 1 3 1 1 1 3 2 1 2 605 3 2 1 2 3 2 3 2 1 1 1 3 1 1 1 2 2 2 3 1 2 3 2 1 606 1 1 2 2 3 2 2 2 3 1 1 1 3 2 2 2 3 2 2 3 1 3 1 1 607 1 1 2 2 3 2 2 2 3 1 3 2 1 3 2 1 2 2 1 3 2 1 3 2 608 2 1 1 2 2 3 1 3 2 2 2 3 1 1 2 1 1 3 1 3 1 3 2 2 609 2 3 2 2 3 1 2 2 3 2 1 1 3 2 3 2 2 2 1 2 2 3 2 2 610 3 1 1 1 2 2 2 3 2 3 1 3 2 1 2 3 2 1 2 2 2 3 1 1 611 2 1 1 3 1 1 2 3 1 1 2 3 2 3 1 1 3 2 3 1 1 2 1 2 612 2 1 1 2 3 2 3 1 1 3 2 2 2 3 2 3 1 1 1 3 1 2 1 2 613 2 2 3 2 1 2 1 2 3 1 1 1 3 2 1 1 3 1 1 3 1 1 3 2 614 2 1 3 1 3 1 3 1 1 3 1 1 3 1 1 1 2 1 1 3 1 1 2 1 615 1 2 2 2 3 1 1 1 2 3 2 2 1 1 2 3 1 3 1 3 1 3 1 2 616 2 2 3 2 3 2 3 2 1 2 1 2 1 3 2 1 2 2 1 3 1 1 2 3 617 1 2 2 3 2 2 1 3 2 1 2 2 3 1 2 3 2 3 1 1 3 2 2 1 618 2 3 2 2 2 3 2 1 2 2 2 3 1 1 2 3 1 1 1 2 3 1 1 3 619 2 3 2 2 1 3 1 2 2 3 2 3 2 2 1 1 1 2 3 2 1 3 2 2 620 2 1 2 1 3 1 3 2 1 2 2 3 2 1 2 1 3 1 3 1 3 1 1 1 621 1 1 1 2 1 3 2 1 1 3 1 2 2 3 2 1 3 2 2 3 2 2 3 1 622 2 3 1 3 2 3 2 3 1 2 2 2 1 2 3 1 2 2 1 1 3 2 2 1 623 1 3 1 1 2 2 2 3 2 2 3 2 1 3 2 3 2 2 1 2 3 1 2 2 624 3 1 2 2 3 1 1 3 1 1 1 3 1 1 1 2 1 3 2 2 2 3 1 1 625 3 1 2 1 1 2 1 3 1 3 1 1 2 1 3 2 1 3 1 3 2 2 1 1 626 3 1 2 2 3 1 1 1 2 2 2 3 2 1 3 2 2 1 2 1 3 2 3 1 627 3 1 2 2 2 1 1 3 1 1 3 1 2 3 1 1 2 1 1 2 3 2 1 3 628 2 2 2 3 1 3 1 3 1 1 1 3 2 1 3 1 1 2 1 1 3 1 2 1 629 3 1 2 2 1 1 3 1 3 2 1 1 1 2 3 1 3 2 1 2 1 1 3 1 630 2 2 2 3 1 2 1 3 1 1 2 2 3 1 1 1 2 2 2 3 1 3 1 3 631 2 3 1 1 3 1 1 3 1 3 2 3 2 2 1 2 1 1 3 1 2 2 2 1 632 3 2 3 1 1 1 2 3 1 2 2 2 1 3 1 3 2 1 1 2 1 1 3 2 633 1 1 1 2 1 1 3 1 1 2 1 3 1 3 1 3 1 3 1 1 1 3 2 2 634 3 2 2 3 2 1 1 1 3 2 1 1 2 1 3 1 3 1 1 1 2 2 1 2 635 1 3 2 3 1 2 2 2 1 3 1 2 2 1 2 3 2 3 1 2 3 1 2 2 636 1 3 1 3 2 1 2 1 3 2 2 2 1 3 1 2 2 2 1 2 3 2 1 3 637 1 2 3 1 2 2 1 3 1 2 1 3 2 3 1 1 1 2 2 3 2 2 1 3 638 1 2 3 1 1 1 2 3 2 1 2 2 1 3 2 2 2 1 3 1 3 2 2 3 639 1 2 1 2 2 3 1 3 2 3 1 3 1 3 2 2 1 2 2 3 2 2 1 1 640 1 3 1 2 3 2 3 2 1 2 2 3 1 1 2 2 1 1 3 1 1 3 2 2 641 2 1 1 2 3 2 3 2 2 3 1 2 1 3 1 1 2 1 3 1 3 1 2 1 642 1 1 1 2 2 1 3 2 2 3 1 1 1 3 2 1 2 3 1 3 1 1 1 3 643 2 2 2 1 3 1 3 2 2 3 1 1 3 1 1 1 2 3 2 2 1 1 2 3 644 3 1 2 2 3 2 2 3 1 2 2 1 2 2 3 1 2 3 1 1 2 2 2 3 645 2 3 2 2 3 2 2 3 2 2 3 1 1 2 2 3 1 1 3 1 1 2 2 1 646 1 2 2 1 1 3 2 1 1 3 1 1 2 2 3 1 3 1 3 2 2 2 3 1 647 3 2 1 2 3 2 2 3 2 1 1 2 3 2 1 2 2 1 1 3 1 1 1 3 648 2 1 3 2 2 3 2 3 1 2 2 2 1 2 3 2 1 1 2 3 1 2 2 3 649 2 3 1 2 1 1 2 3 1 1 1 3 2 2 2 1 2 1 3 1 3 1 3 1 650 3 2 1 1 3 1 2 2 3 2 2 2 3 2 1 2 3 1 2 1 1 3 1 2 651 2 2 3 1 1 2 2 1 1 3 1 3 2 1 1 3 1 2 3 2 2 2 1 3 652 1 1 3 2 3 2 2 2 3 2 2 2 1 3 1 3 2 1 1 1 3 1 2 1 653 1 3 1 3 1 3 1 2 1 1 1 3 2 1 2 1 3 1 1 3 2 2 1 1 654 1 2 2 1 2 3 1 1 2 1 3 2 2 1 3 1 1 1 3 1 3 1 3 2 655 2 2 3 2 2 3 1 2 1 2 2 1 3 1 3 1 1 2 3 2 3 2 2 2 656 2 2 2 1 2 2 3 1 3 1 3 2 2 2 3 2 2 1 2 2 2 3 2 3 657 1 3 2 3 2 2 1 1 3 1 1 3 2 2 3 1 2 2 1 2 2 3 1 2 658 3 1 3 1 1 2 3 1 2 2 3 1 1 2 3 2 2 3 1 2 1 1 2 1 659 3 1 2 1 1 3 2 1 2 2 1 3 2 1 2 3 1 3 2 3 2 1 1 2 660 2 2 2 3 1 2 2 2 1 1 3 1 3 2 3 2 2 3 1 1 2 3 2 1 661 1 1 3 2 2 1 3 2 1 1 1 2 1 3 1 3 2 1 3 1 1 1 3 1 662 3 2 1 1 1 3 2 1 2 3 1 1 2 1 2 3 2 3 1 1 1 2 3 2 663 2 1 1 2 1 1 3 2 3 2 3 2 2 3 2 3 1 1 2 3 2 1 1 2 664 1 1 1 3 1 2 2 2 1 3 1 3 2 1 3 1 1 1 3 1 3 1 1 2 665 2 2 1 3 2 2 2 3 1 3 2 2 3 1 1 1 2 1 3 2 1 1 1 3 666 2 1 1 2 1 3 2 1 2 3 1 3 2 1 1 3 1 2 2 3 1 1 1 3 667 3 1 1 3 1 2 2 1 3 1 2 2 3 1 2 3 2 2 1 3 2 2 1 1 668 2 1 1 1 3 1 3 1 3 1 1 3 2 2 1 3 2 1 1 2 1 3 1 1 669 2 1 1 3 2 1 2 3 1 3 1 1 1 2 3 1 2 3 2 3 2 2 1 2 670 3 1 3 2 2 2 3 2 2 2 3 2 2 1 3 2 2 1 2 2 3 1 2 1 671 1 1 3 2 1 1 1 3 1 1 1 2 3 2 2 1 1 3 1 3 2 1 3 2 672 1 2 3 1 3 1 1 2 2 3 2 2 3 2 2 3 1 1 1 2 3 2 1 1 673 2 2 1 3 1 2 2 1 3 1 3 2 1 3 2 1 3 1 1 3 1 1 2 1 674 2 1 3 2 3 1 2 3 1 1 3 1 1 3 2 2 1 3 1 1 1 2 2 1 675 2 1 1 2 3 2 1 3 2 1 1 2 3 2 3 1 2 3 1 2 1 1 3 2 676 2 2 3 1 3 1 1 1 3 1 1 2 1 1 3 2 1 3 2 3 2 1 1 1 677 2 1 1 2 3 1 3 2 3 1 3 1 2 2 1 2 1 3 1 2 2 3 2 2 678 3 2 1 2 1 1 3 1 1 1 2 3 2 3 2 3 2 2 2 3 1 2 2 1 679 3 2 3 1 1 2 3 2 3 2 2 1 1 2 3 1 1 3 1 2 1 2 1 2 680 3 1 1 1 3 2 2 1 2 2 1 3 2 1 3 2 2 1 1 1 3 1 2 3 681 2 1 3 1 1 2 2 3 2 3 2 2 2 3 1 2 1 1 3 2 3 1 2 1 682 2 3 1 2 2 2 1 3 1 2 2 3 2 3 1 3 2 2 1 1 1 2 3 1 683 1 2 2 1 2 2 3 1 3 2 2 2 3 1 1 2 3 2 2 3 1 2 1 3 684 1 2 1 3 2 1 3 2 2 1 2 3 2 2 2 3 1 2 2 2 1 3 2 3 685 1 2 1 3 1 1 3 1 1 3 1 1 2 1 1 1 3 2 2 1 3 1 3 1 686 3 1 2 3 2 2 3 1 1 1 3 2 1 1 2 3 1 1 2 2 2 3 2 1 687 3 1 3 1 2 2 3 1 2 1 3 2 1 3 1 1 1 2 3 1 2 1 1 1 688 2 3 1 3 1 3 1 1 2 1 1 1 3 2 1 2 3 1 1 2 2 2 3 1 689 2 1 2 1 1 1 3 1 2 3 1 2 3 2 3 1 1 2 2 1 3 2 1 3 690 2 2 1 2 3 2 1 1 3 1 1 2 3 2 2 2 3 1 3 1 3 1 1 1 691 1 3 2 1 1 1 2 3 1 2 3 1 1 2 3 1 2 1 2 3 1 2 3 1 692 3 1 1 1 2 2 2 3 2 3 2 2 1 1 1 3 2 2 3 1 1 2 3 1 693 3 1 2 3 1 1 2 3 1 2 2 3 2 3 2 2 2 1 1 3 2 1 2 1 694 3 1 1 1 2 1 1 3 2 3 1 3 1 3 2 2 1 1 2 3 1 1 1 2 695 2 3 2 2 3 1 1 1 2 1 3 2 2 1 2 2 1 3 2 2 2 3 2 3 696 2 2 2 3 1 3 1 3 2 1 2 1 2 2 3 1 2 1 2 3 1 3 1 1 697 1 2 2 3 2 3 2 3 2 1 1 1 3 2 1 1 3 1 2 2 2 1 1 3 698 2 1 2 1 3 2 2 2 3 1 1 3 2 3 2 3 1 2 3 2 1 2 2 2 699 3 2 3 1 1 3 2 2 1 2 1 3 2 3 2 1 2 1 1 1 3 1 1 2 700 3 2 1 2 3 2 2 3 1 1 2 1 3 2 1 1 1 2 1 3 1 2 2 3 701 2 2 1 3 1 1 1 3 2 3 2 3 1 2 2 2 3 2 3 2 1 2 2 2 702 2 2 2 1 3 2 1 1 2 1 2 3 2 1 1 3 1 3 1 2 3 2 3 1 703 1 3 2 1 2 3 2 1 2 1 3 1 2 3 1 2 3 2 2 2 3 2 2 2 704 1 2 2 2 1 1 3 2 1 1 1 3 2 3 2 1 3 1 3 1 2 1 1 3 705 1 2 2 2 3 2 3 2 2 3 1 1 2 2 3 2 1 1 1 3 2 3 1 1 706 1 2 3 2 2 1 2 2 1 3 1 2 2 3 2 3 1 2 3 1 1 2 3 1 707 2 1 3 2 1 3 2 1 3 1 1 2 1 2 3 1 1 1 2 2 1 3 1 3 708 2 2 2 1 1 2 3 1 3 1 1 3 1 3 2 2 1 3 1 3 2 1 2 1 709 1 1 1 3 2 2 2 1 3 2 1 3 1 3 2 3 2 1 2 3 2 1 1 1 710 1 2 1 2 1 2 3 1 2 1 3 2 1 3 1 3 2 1 3 1 2 2 1 3 711 2 3 1 3 1 1 3 2 2 1 1 2 2 3 2 1 2 1 3 1 2 2 3 1 712 2 1 2 1 3 1 3 1 2 3 2 2 1 2 1 2 3 1 1 3 2 2 3 2 713 1 1 1 2 2 2 3 2 2 1 1 3 2 2 3 2 2 3 2 2 3 2 2 3 714 2 2 3 2 2 3 1 1 3 1 2 3 1 1 1 3 2 1 3 1 1 2 2 1 715 1 1 3 1 3 1 2 1 1 3 2 1 3 2 3 2 2 2 1 2 3 2 2 2 716 1 1 2 1 1 3 1 1 3 1 1 3 2 3 1 1 1 3 1 2 2 3 1 2 717 2 1 1 3 2 2 1 1 1 3 2 2 3 1 2 3 1 2 2 3 1 2 1 3 718 1 2 1 2 1 1 3 1 2 1 1 3 1 3 2 3 2 1 1 3 2 3 1 2 719 3 2 2 1 1 1 2 3 2 2 3 2 2 3 2 2 2 1 1 3 2 3 1 2 720 3 1 3 2 2 1 1 3 2 2 1 2 2 1 3 2 2 1 1 3 1 1 3 2 721 2 1 2 2 1 3 1 3 2 2 2 3 1 3 1 1 2 1 1 3 2 1 3 2 722 2 1 1 2 3 2 2 3 2 2 1 2 3 2 3 2 2 1 3 1 1 3 2 2 723 3 1 1 1 3 2 2 3 1 2 1 3 1 1 2 3 2 1 1 2 3 2 2 2 724 2 3 1 2 1 3 1 2 3 1 1 2 2 3 1 2 2 3 1 2 2 1 3 2 725 1 2 3 1 2 1 3 1 3 2 1 1 1 3 1 1 2 1 1 3 2 2 3 2 726 1 3 2 1 1 3 2 3 2 2 1 3 1 2 1 3 2 1 2 2 3 1 1 2 727 1 2 3 2 1 3 1 2 2 1 1 1 3 2 1 3 2 3 2 1 2 3 2 2 728 2 2 1 2 2 3 1 2 1 1 2 3 1 3 1 3 1 3 2 2 1 1 1 3 729 1 2 2 2 3 2 2 1 2 3 1 2 1 1 1 2 3 2 3 2 1 3 2 3 730 2 2 3 1 1 3 1 1 1 2 1 1 3 1 3 2 1 1 2 1 1 3 1 3 731 2 3 2 3 2 1 1 2 1 1 3 2 1 3 2 1 1 3 1 2 2 1 3 1 732 1 2 3 1 1 1 3 2 2 1 3 1 3 2 2 2 1 2 3 1 2 1 1 3 733 1 2 2 1 3 2 2 1 1 3 1 3 1 3 2 2 2 3 2 1 3 1 2 2 734 2 3 2 1 3 2 1 2 2 3 2 1 2 3 1 2 2 1 1 1 3 2 3 2 735 1 3 2 2 3 1 2 1 1 1 3 1 1 3 1 1 3 1 3 2 1 2 1 2 736 3 2 1 1 2 3 1 3 1 2 1 1 1 3 1 3 1 3 1 2 1 1 2 2 737 2 3 2 3 2 2 3 1 1 3 1 2 1 1 1 3 2 2 2 1 2 3 1 2 738 1 1 3 1 1 3 1 3 2 1 3 2 2 1 3 1 1 2 2 3 1 2 2 1 739 3 1 1 2 3 1 1 3 1 2 3 1 1 3 2 2 2 3 2 2 1 1 2 1 740 1 1 1 2 2 3 2 2 3 1 3 1 2 1 1 3 1 2 1 3 2 3 1 2 741 2 3 1 2 2 3 2 2 2 1 1 2 3 1 2 3 2 3 2 3 1 2 2 1 742 1 2 3 1 1 3 2 1 2 2 3 2 2 3 1 3 2 3 1 2 2 2 1 1 743 3 2 3 2 1 1 1 2 3 2 2 2 3 1 3 1 2 3 2 1 2 1 2 2 744 1 1 2 2 3 1 2 3 1 3 2 2 2 1 1 1 3 1 3 2 2 3 1 2 745 2 2 2 3 2 3 2 1 1 2 1 2 3 1 2 2 3 1 3 1 3 2 2 2 746 3 2 1 3 2 1 3 1 2 3 1 2 2 1 1 3 1 1 3 1 2 1 1 1 747 2 2 2 1 1 2 3 2 3 1 1 1 2 2 2 3 2 2 3 2 3 1 3 2 748 3 2 1 1 1 3 1 1 2 2 1 3 1 2 1 1 1 3 1 3 2 3 1 2 749 1 1 2 1 3 2 2 1 1 3 2 2 2 1 1 3 1 3 2 2 3 2 3 2 750 3 2 3 2 3 1 2 3 2 2 2 1 2 1 3 1 2 2 2 3 2 2 1 2 751 3 2 1 2 1 3 2 3 2 3 1 2 2 1 3 1 2 2 2 3 2 1 1 1 752 3 2 2 3 2 1 1 3 1 1 1 3 1 2 1 2 3 2 1 1 3 1 1 1 753 1 2 1 2 2 1 3 1 2 2 3 2 1 1 1 3 1 3 1 3 2 3 1 1 754 3 1 3 2 3 1 2 1 2 2 3 1 1 1 2 2 1 3 1 2 2 3 2 1 755 2 1 1 3 1 1 3 2 2 1 1 1 3 1 1 3 1 3 1 3 2 2 2 1 756 3 1 2 3 2 2 1 3 1 2 1 1 1 3 2 2 2 1 1 3 2 1 3 2 757 3 2 3 1 2 2 3 2 1 2 3 1 3 1 1 1 2 3 2 2 1 1 1 2 758 2 3 1 2 2 1 2 2 3 2 1 1 3 1 1 1 3 1 2 2 3 1 3 1 759 1 1 3 1 1 2 2 3 2 3 2 1 1 3 2 2 2 1 2 3 1 3 2 1 760 2 2 3 2 1 2 2 2 1 3 1 1 3 1 2 2 2 3 2 1 3 1 2 3 761 2 1 2 1 2 3 2 2 2 3 2 3 2 1 1 3 1 1 3 1 1 1 2 3 762 3 1 2 1 1 2 3 2 3 2 3 1 1 2 2 2 3 2 3 1 1 2 1 1 763 2 2 1 3 1 1 1 2 3 2 3 1 3 1 2 2 2 1 1 3 1 3 2 2 764 1 3 2 3 2 1 3 1 1 2 2 2 3 2 1 2 2 2 1 3 2 2 3 2 765 2 1 3 2 2 1 1 3 1 2 1 3 1 3 2 1 1 1 2 3 1 2 1 3 766 3 1 1 3 2 3 1 2 1 2 2 3 2 1 1 1 2 2 3 1 2 1 1 3 767 3 2 1 1 2 2 3 2 3 2 2 1 3 1 2 2 2 1 1 3 1 1 3 2 768 2 3 1 2 1 2 2 2 3 2 3 1 1 2 2 3 1 2 1 3 2 1 2 3 769 1 1 3 2 1 1 1 3 1 3 1 2 1 2 1 3 2 2 1 1 3 2 2 3 770 1 2 2 1 3 2 2 1 1 3 2 2 1 2 2 2 3 2 3 1 3 2 3 1 771 1 3 1 2 3 1 1 3 2 1 3 2 2 2 1 2 3 1 1 2 2 1 3 1 772 2 3 1 3 2 2 1 3 2 2 1 1 3 2 3 1 2 1 3 2 2 1 1 1 773 2 2 1 2 2 3 2 1 3 1 2 2 2 1 3 1 3 1 1 3 1 2 3 1 774 2 1 2 2 2 3 2 3 2 2 2 3 2 2 3 1 2 2 1 3 1 2 1 3 775 3 2 1 2 1 1 2 3 2 3 2 3 2 3 1 1 1 3 2 2 1 2 1 1 776 2 1 2 1 2 3 2 2 3 1 3 2 1 2 1 1 1 3 1 3 1 3 1 1 777 2 2 1 3 2 2 1 3 2 2 2 1 1 1 3 1 2 2 3 2 3 1 3 2 778 2 2 2 1 3 1 1 2 1 1 3 2 3 1 2 3 2 3 1 2 3 1 1 1 779 1 3 1 3 2 1 1 2 3 2 3 2 1 1 1 2 1 3 2 2 1 3 1 2 780 2 3 2 3 1 2 1 1 1 3 1 3 1 1 1 2 2 1 3 2 2 3 2 2 781 3 1 1 2 2 2 1 3 2 3 1 1 2 3 2 2 2 3 1 3 1 2 2 1 782 2 3 2 3 1 2 3 2 3 2 1 1 3 2 1 2 1 2 3 1 1 1 2 2 783 2 2 3 2 3 1 1 2 3 1 2 2 1 1 2 3 1 1 2 1 3 1 1 3 784 1 1 2 3 2 2 3 2 2 2 1 3 1 2 2 3 1 3 1 1 1 3 2 2 785 1 3 1 2 2 3 2 3 2 2 1 3 2 1 2 2 1 3 2 1 2 1 1 3 786 2 2 3 1 2 3 2 1 2 2 1 3 1 1 1 3 2 2 2 1 2 3 2 3 787 2 1 2 3 1 2 2 3 2 3 2 3 2 2 1 3 1 3 1 1 2 2 2 1 788 2 1 3 2 3 2 1 3 1 2 1 2 2 2 3 1 2 1 3 2 2 1 2 3 789 1 3 2 2 2 1 1 2 3 2 3 2 2 2 1 3 2 2 3 2 2 1 2 3 790 2 3 2 3 2 1 1 1 3 2 1 3 1 1 1 3 2 1 1 1 3 1 2 2 791 3 2 2 1 2 3 1 2 1 2 1 3 2 3 1 3 2 2 3 2 2 1 2 2 792 2 2 2 3 1 2 2 3 1 1 2 3 2 2 1 1 2 1 3 2 3 2 3 2 793 1 3 1 3 2 1 2 2 1 3 2 1 3 2 2 1 2 2 3 2 1 1 3 2 794 2 1 1 3 2 1 3 1 1 1 3 1 1 3 1 1 3 1 2 1 2 2 2 3 795 1 3 1 1 1 3 1 3 1 1 2 2 1 2 3 2 1 1 2 3 1 1 1 3 796 2 2 1 3 1 2 2 2 3 2 2 1 3 2 3 2 3 1 2 2 2 1 1 3 797 3 1 2 3 1 2 2 1 1 3 1 2 1 2 1 3 1 3 1 2 1 3 2 2 798 1 2 1 2 2 2 3 1 3 2 3 1 2 2 1 1 3 1 3 2 1 1 2 3 799 2 3 2 1 2 2 3 2 3 1 3 2 2 1 1 3 2 1 2 1 1 3 2 2 800 1 1 2 2 2 1 3 2 1 3 1 1 1 3 2 3 2 2 3 2 3 2 2 2 801 3 2 2 1 3 1 1 3 1 2 2 1 1 3 2 2 3 1 1 2 1 1 2 3 802 2 1 1 1 3 2 1 2 3 2 3 1 3 1 2 3 1 2 2 2 1 2 3 2 803 2 3 1 1 1 2 3 1 2 2 1 1 1 3 1 2 3 1 1 3 1 2 3 1 804 2 2 1 2 2 1 3 1 2 3 2 2 3 1 3 2 3 2 2 2 3 2 2 2 805 2 1 3 2 3 2 2 2 1 1 1 3 1 3 2 1 3 2 1 2 1 2 3 1 806 1 3 2 2 1 2 1 1 3 2 1 1 1 2 3 1 2 3 2 2 3 1 2 3 807 2 2 1 1 3 1 3 1 3 1 1 1 2 1 1 3 2 3 2 1 2 2 3 2 808 3 1 2 1 2 2 3 1 1 1 2 3 2 3 2 1 1 1 2 3 1 2 3 1 809 1 2 3 1 2 3 1 1 2 2 1 1 3 1 1 1 3 1 1 1 3 1 3 1 810 3 1 1 2 1 3 2 2 2 3 1 2 2 2 3 2 3 2 2 2 3 2 2 1 811 1 3 2 2 3 2 2 2 1 3 1 2 2 2 3 1 2 2 2 3 2 1 1 3 812 3 2 1 2 3 1 3 1 2 2 2 3 1 2 1 2 1 1 3 1 2 2 1 3 813 2 2 2 1 2 1 3 2 3 1 3 2 1 2 1 3 2 3 1 2 3 1 2 2 814 2 1 2 1 2 3 2 3 1 1 3 1 2 1 2 1 1 3 2 3 2 2 2 3 815 1 2 2 3 1 2 1 3 1 2 3 1 2 1 3 2 1 1 2 2 3 1 3 2 816 2 3 1 2 1 3 1 2 3 2 3 1 1 3 1 1 2 2 2 3 1 2 2 2 817 3 1 1 3 1 2 1 2 2 3 1 1 1 3 1 1 2 2 2 3 1 2 3 2 818 3 1 2 3 2 2 2 1 3 2 3 2 1 3 1 2 1 2 1 3 1 2 2 2 819 3 1 1 2 1 2 2 3 1 3 2 2 1 2 1 1 3 2 1 3 2 1 3 2 820 1 3 2 3 1 3 2 1 1 3 2 1 1 2 1 3 1 1 1 3 1 2 2 2 821 3 2 1 3 1 1 2 1 1 3 2 1 1 2 2 2 3 2 3 1 3 1 2 1 822 3 1 3 2 2 1 2 2 2 3 1 3 1 2 2 2 1 3 1 2 3 2 2 2 823 3 1 1 1 2 3 1 2 3 1 2 2 3 1 1 2 2 2 1 3 1 3 1 2 824 1 1 1 2 1 3 2 3 2 3 1 3 1 1 2 1 3 2 2 1 1 3 2 1 825 1 2 3 2 3 2 2 1 1 3 2 2 3 2 1 3 1 1 3 1 1 2 1 1 826 1 2 1 1 2 3 1 3 2 2 1 1 2 1 3 2 3 2 1 1 3 1 1 3 827 1 2 1 1 3 1 3 1 2 3 2 2 2 1 1 3 2 2 1 3 1 1 1 3 828 2 3 2 2 1 3 2 3 2 2 1 3 1 1 1 2 1 2 3 1 1 1 3 1 829 2 2 2 1 3 1 1 3 1 2 2 3 2 2 1 3 1 2 1 1 3 2 2 3 830 3 2 3 2 1 1 2 3 2 1 2 1 1 3 1 2 1 3 2 2 1 1 3 2 831 2 1 2 2 1 3 1 3 1 3 1 1 1 2 2 3 2 1 3 1 3 1 2 2 832 2 1 3 2 3 1 3 1 2 1 1 1 3 2 1 1 1 3 2 2 2 1 2 3 833 2 2 3 2 3 1 1 1 3 2 2 1 1 3 2 1 1 3 2 2 1 3 2 2 834 1 1 1 3 2 3 2 1 1 3 2 2 3 1 1 3 1 1 2 1 2 2 3 1 835 3 1 1 2 1 3 1 3 2 3 2 2 1 2 2 2 3 1 1 1 2 1 3 1 836 2 1 2 1 1 3 1 3 1 3 1 3 1 2 1 1 3 2 1 1 2 1 1 3 837 2 3 1 3 2 3 1 1 1 2 2 3 1 2 1 3 1 3 2 1 1 1 2 2 838 3 1 2 3 1 1 2 1 1 3 2 2 2 1 1 3 2 3 1 3 1 1 1 2 839 3 2 3 2 3 1 2 1 2 3 2 2 2 1 2 2 3 1 2 2 1 1 3 2 840 2 1 1 1 3 2 3 1 3 2 3 2 1 1 1 2 3 1 2 1 1 2 3 1 841 3 2 1 3 1 3 2 2 2 3 1 2 2 2 3 1 1 1 3 1 1 2 1 2 842 3 1 1 2 1 2 2 3 2 2 1 2 3 2 2 2 3 2 2 1 2 3 1 3 843 3 2 3 2 1 1 2 1 1 3 1 2 3 2 1 2 2 3 2 2 3 2 2 2 844 2 1 1 1 2 2 3 1 2 2 3 2 3 1 3 2 2 3 1 1 3 1 1 2 845 2 3 1 3 1 2 1 3 2 2 1 2 1 3 2 2 1 1 3 2 2 2 1 3 846 1 3 2 2 2 3 2 2 1 1 3 1 2 2 1 2 3 2 1 3 1 1 1 3 847 3 1 1 2 3 2 3 2 1 3 1 1 2 1 1 3 1 3 1 2 2 1 1 1 848 3 2 1 2 2 1 2 3 1 1 1 3 1 1 3 2 2 3 2 2 3 2 2 2 849 3 2 3 2 2 1 2 1 3 1 1 3 2 2 1 1 1 2 3 2 2 1 1 3 850 2 2 1 1 3 1 3 2 1 3 2 3 1 1 2 1 2 3 1 2 1 3 2 1 851 1 1 2 3 2 2 1 2 1 1 3 1 2 3 1 3 1 3 2 2 2 1 3 2 852 1 2 1 2 1 1 3 1 2 2 2 3 1 2 3 2 1 3 2 3 2 1 3 2 853 2 1 2 3 2 2 2 3 2 2 3 2 2 3 2 2 1 1 3 2 2 2 3 1 854 3 1 2 1 3 2 2 2 1 3 2 1 2 1 3 1 1 3 1 2 1 1 1 3 855 3 2 2 3 1 1 2 1 2 1 3 1 3 1 2 1 3 2 1 1 1 2 1 3 856 1 3 1 3 1 1 3 1 2 2 2 1 3 2 1 1 3 1 1 2 3 1 2 1 857 2 3 1 1 2 3 1 3 1 1 1 3 1 2 1 2 2 3 1 3 2 1 2 2 858 2 3 1 1 3 1 2 2 1 2 1 3 2 1 3 2 2 3 2 1 2 1 3 1 859 3 1 2 2 1 3 2 1 3 2 1 2 2 3 1 1 3 1 2 2 1 2 3 2 860 2 3 1 1 1 2 3 2 3 2 1 2 2 2 3 2 1 2 3 2 2 2 1 3 861 1 2 2 1 1 1 3 2 2 3 1 2 1 2 3 1 1 1 3 1 1 3 2 3 862 1 1 2 3 2 1 3 1 3 1 2 2 3 2 1 3 2 3 1 1 2 1 2 2 863 2 2 1 2 2 2 3 2 2 3 1 3 2 3 2 1 1 1 2 3 2 3 1 2 864 1 2 3 2 1 1 2 2 3 2 3 1 1 2 1 1 2 3 2 1 2 3 2 3 865 3 1 2 2 2 3 2 1 2 1 3 1 3 1 2 2 1 3 2 1 1 3 2 1 866 1 1 2 1 2 2 3 2 2 3 2 2 2 1 3 1 3 1 1 1 3 1 1 3 867 1 2 3 1 2 3 1 2 3 2 1 2 2 2 3 2 1 1 1 3 1 3 2 1 868 1 1 2 3 2 1 2 2 2 3 2 3 2 3 1 2 2 3 2 3 2 1 1 1 869 1 3 2 3 2 2 1 2 3 1 1 3 1 1 2 1 3 2 1 1 3 1 1 2 870 3 2 2 1 2 3 2 1 3 1 3 1 2 3 1 1 1 3 1 1 1 2 2 1 871 3 2 2 2 3 2 1 2 2 1 3 1 2 1 1 1 2 3 1 3 2 2 3 2 872 2 3 1 2 2 2 1 2 3 1 3 1 2 2 1 1 3 1 3 1 1 1 3 1 873 2 2 2 3 2 3 2 3 2 2 1 2 2 3 2 1 1 2 2 3 1 3 1 2 874 3 1 2 3 2 3 2 3 1 2 1 2 3 1 2 2 1 1 1 3 1 1 1 2 875 1 3 1 2 2 1 2 1 3 1 2 2 2 3 2 1 3 1 3 1 1 1 3 2 876 3 1 1 3 1 3 2 1 2 3 2 1 1 2 1 3 2 1 2 2 3 2 1 2 877 2 2 2 3 2 1 1 2 3 2 2 3 2 2 3 1 3 2 2 2 1 1 3 1 878 1 3 2 1 1 1 2 1 3 2 1 3 2 1 2 3 1 1 2 1 1 3 1 3 879 3 1 1 2 3 2 2 3 1 1 2 2 3 1 1 1 2 1 2 3 1 3 2 2 880 1 3 2 1 3 2 2 1 1 2 2 3 1 2 1 3 2 1 1 3 2 2 2 3 881 1 3 2 3 2 1 1 1 3 1 1 1 2 3 1 1 2 3 1 1 2 1 1 3 882 2 3 2 2 1 3 1 2 1 2 2 2 3 2 3 1 1 1 2 3 2 3 1 1 883 2 3 2 1 2 3 2 2 3 1 3 2 2 2 3 1 1 2 2 3 2 2 1 2 884 2 3 1 3 2 3 1 1 2 2 1 3 2 2 1 2 3 2 2 3 2 2 1 2 885 3 1 1 3 1 1 1 3 1 1 1 2 3 1 3 1 1 1 3 1 2 2 1 2 886 2 2 1 1 3 2 1 1 3 2 2 3 2 3 2 2 3 1 2 1 2 2 1 3 887 1 2 3 1 2 3 2 3 2 2 2 3 1 2 2 2 3 1 1 2 2 3 1 1 888 1 1 3 2 1 1 3 2 3 1 1 1 2 2 3 2 2 3 2 2 2 3 1 1 889 1 2 3 1 1 3 2 3 2 1 1 1 3 2 2 2 3 1 1 1 3 1 1 1 890 1 3 1 3 1 3 2 1 1 3 1 2 1 1 2 2 3 2 1 2 1 3 2 1 891 2 2 2 1 2 3 1 3 1 2 1 3 1 2 3 1 1 1 2 1 1 3 2 3 892 1 3 1 1 1 2 2 1 3 2 1 3 2 1 1 2 3 1 2 2 2 3 2 3 893 3 1 2 2 2 3 1 3 1 2 2 3 1 1 2 3 1 3 1 1 2 1 2 1 894 3 1 2 2 1 3 1 1 1 3 1 2 3 1 1 2 1 1 1 3 1 2 3 1 895 2 1 3 1 2 1 3 1 1 1 3 2 1 2 1 2 3 2 2 3 2 1 3 2 896 3 1 1 3 1 2 1 3 2 1 1 1 3 2 1 1 1 3 2 1 1 3 2 2 897 1 1 1 2 3 2 3 2 3 2 2 2 1 3 2 1 3 2 2 3 2 1 1 1 898 2 2 3 2 2 3 1 1 3 2 1 1 3 1 3 1 2 3 1 1 2 1 1 1 899 2 1 2 2 2 3 1 3 1 3 1 1 1 3 1 1 1 3 1 3 2 2 2 1 900 2 1 2 2 2 1 3 2 3 1 2 3 1 1 2 2 2 3 2 3 1 2 3 2 901 2 2 1 2 1 3 2 3 1 2 3 1 2 3 1 2 1 1 3 2 2 3 1 2 902 2 1 1 1 3 1 2 1 1 2 2 3 2 1 3 1 1 1 3 2 1 3 2 3 903 3 2 2 2 1 3 2 1 2 2 3 1 2 1 2 2 3 2 3 2 3 2 1 1 904 3 2 3 2 2 3 2 3 1 1 2 1 1 3 1 2 2 3 1 1 1 2 1 2 905 1 1 1 3 1 1 1 3 2 1 2 1 1 1 3 2 3 1 3 1 2 1 3 1 906 2 1 2 2 2 3 2 1 1 3 1 1 3 2 3 2 1 3 1 2 1 2 2 3 907 2 1 3 1 1 3 1 2 3 1 1 1 2 2 3 2 3 1 2 2 2 3 2 2 908 1 2 1 1 2 1 3 2 1 1 3 2 3 1 1 2 3 1 2 3 1 3 1 2 909 1 1 2 3 2 3 1 1 2 1 1 3 1 2 1 1 1 3 2 3 2 3 2 1 910 1 2 2 3 1 1 3 1 2 1 1 1 3 1 2 3 2 2 3 2 2 2 1 3 911 2 3 1 1 1 2 1 3 1 1 3 2 3 1 3 1 2 2 1 2 1 3 2 1 912 1 3 2 2 1 2 2 3 2 3 1 1 1 3 1 3 2 2 2 1 2 3 1 2 913 1 1 1 2 1 3 2 1 3 2 3 1 2 1 3 1 3 1 1 3 1 2 2 2 914 1 3 2 3 2 1 2 3 1 1 3 2 3 2 1 1 2 1 1 3 1 2 2 1 915 2 3 1 2 2 1 1 3 1 2 2 3 2 3 2 1 3 2 3 2 2 1 2 1 916 1 3 2 2 2 1 2 3 1 2 1 2 2 2 3 2 1 3 1 2 3 1 3 2 917 2 1 2 3 2 3 2 1 2 3 1 1 3 1 2 2 1 2 1 3 2 2 1 3 918 3 1 1 1 2 2 3 2 2 3 2 1 2 1 3 1 3 2 3 1 2 1 2 1 919 2 1 3 1 1 1 2 1 3 2 2 2 1 1 3 2 1 2 1 3 2 3 2 3 920 2 3 1 2 2 2 1 3 1 2 3 2 2 2 1 2 2 3 2 3 1 3 1 1 921 1 1 3 2 2 3 1 2 1 2 2 2 3 2 2 3 2 2 1 3 1 2 3 1 922 2 3 1 2 3 2 3 1 2 1 1 2 3 1 3 1 1 2 1 1 1 3 1 1 923 1 1 1 3 2 2 2 1 3 2 2 2 3 2 1 2 2 1 3 2 1 3 1 3 924 1 3 2 2 2 3 1 2 3 2 3 1 2 1 3 2 1 1 1 2 1 3 1 1 925 1 1 3 2 3 2 2 1 2 2 3 1 1 2 3 2 3 1 2 3 2 2 1 2 926 1 1 1 2 2 3 1 1 3 2 3 2 3 1 2 1 1 2 3 2 2 2 3 2 927 3 2 2 2 1 3 2 3 1 2 2 1 1 1 3 1 2 1 3 1 2 2 1 3 928 1 2 1 1 3 2 3 2 1 2 1 1 3 1 3 1 1 3 2 3 2 2 1 1 929 1 2 3 1 1 2 2 2 3 2 2 2 3 2 3 1 2 3 1 1 3 2 2 1 930 1 1 1 3 1 1 2 2 3 1 3 1 1 1 2 3 1 1 1 3 2 2 1 3 931 1 3 2 3 2 1 1 3 1 3 2 1 2 1 1 1 3 2 1 2 2 2 3 1 932 3 1 1 2 2 1 1 3 1 2 2 3 2 2 1 2 1 2 3 2 3 1 3 2 933 2 1 2 3 1 1 1 3 2 3 2 2 3 2 2 2 1 1 3 2 1 1 3 1 934 2 1 1 1 3 2 1 1 1 2 3 2 2 1 2 3 2 3 1 3 1 3 1 1 935 1 1 1 3 1 2 1 2 2 3 1 2 2 3 1 3 1 2 1 3 1 3 2 2 936 1 1 3 2 3 1 2 1 2 3 1 1 2 1 2 3 2 3 1 3 1 1 1 2 937 1 1 1 2 1 3 1 3 2 2 2 3 2 2 1 1 2 3 2 1 1 3 2 3 938 3 1 2 2 2 1 3 1 2 3 1 3 2 2 1 1 3 1 1 2 2 2 1 3 939 2 2 3 2 1 1 1 2 3 1 3 2 3 2 3 1 1 2 1 2 2 3 2 1 940 1 3 2 1 3 2 3 2 1 2 2 2 3 1 3 1 2 1 1 2 1 3 1 1 941 2 3 1 3 2 2 1 1 1 3 1 3 2 2 3 2 2 3 1 2 1 2 2 2 942 1 1 1 3 1 3 2 3 2 1 2 2 1 3 1 1 1 2 1 3 2 2 2 3 943 3 2 2 2 1 3 2 2 1 2 2 2 3 1 2 3 1 3 1 2 1 1 2 3 944 1 1 3 2 3 2 1 1 1 2 3 1 1 2 1 1 1 3 1 3 2 2 3 2 945 1 1 2 1 1 1 3 2 3 1 3 2 1 3 1 1 3 2 3 2 1 1 2 2 946 2 1 2 2 3 1 3 2 2 2 3 2 3 2 1 1 1 3 1 1 3 1 2 1 947 2 2 2 1 2 1 3 2 2 3 2 2 3 2 3 2 2 3 1 1 1 3 2 2 948 1 2 3 1 1 1 2 1 2 3 1 2 2 3 2 3 2 2 2 3 2 2 3 2 949 1 1 1 3 1 3 1 2 3 2 1 1 1 3 2 3 1 3 2 2 1 2 2 1 950 2 2 3 1 1 3 1 1 1 3 2 2 1 3 1 2 3 1 2 3 1 1 2 2 951 1 2 3 2 2 1 2 2 2 3 2 2 2 1 3 2 2 2 3 2 3 2 3 1 952 1 1 1 2 1 2 3 1 1 2 2 2 3 1 1 3 1 3 1 1 3 2 3 1 953 3 1 2 2 1 3 1 2 1 2 1 3 1 1 2 1 2 2 3 1 1 3 1 3 954 2 2 1 3 1 1 2 1 1 3 1 3 1 1 1 2 3 2 1 2 3 2 3 2 955 2 2 2 1 2 3 1 1 1 3 1 3 1 1 3 2 3 2 1 2 2 1 2 3 956 3 2 1 1 3 2 1 2 2 1 1 3 2 3 2 3 1 2 2 2 1 3 2 1 957 1 2 1 1 1 3 1 3 1 1 3 2 1 1 1 3 1 3 2 1 1 1 3 2 958 1 2 2 3 2 2 1 1 2 2 3 1 1 3 2 3 2 1 2 3 1 1 1 3 959 2 1 2 1 2 1 3 2 2 3 1 3 2 2 3 1 3 2 1 1 3 1 2 2 960 2 1 3 1 2 3 1 3 1 2 1 2 1 2 3 1 1 1 3 1 2 1 3 2 961 1 2 1 1 3 1 1 3 1 2 3 1 2 2 2 3 2 3 2 1 1 1 2 3 962 2 2 1 3 2 1 1 2 1 1 3 1 1 1 3 1 2 3 1 1 3 1 3 1 963 3 1 2 2 2 3 2 3 1 3 2 1 1 1 3 2 1 1 1 2 1 3 1 1 964 1 1 1 2 1 3 1 2 3 2 1 3 1 1 2 2 2 3 2 3 2 3 2 2 965 3 1 1 1 2 2 1 3 2 3 2 2 2 3 2 3 2 3 2 1 2 2 1 2 966 1 2 2 2 3 1 3 2 1 2 3 1 2 1 3 1 1 3 1 2 2 3 2 2 967 1 2 1 3 1 3 2 2 3 1 1 3 2 1 2 3 2 1 1 1 3 2 2 2 968 2 1 1 2 2 2 3 2 3 1 1 2 3 2 2 3 2 2 1 2 2 3 2 3 969 2 2 1 3 2 2 2 1 2 3 1 3 1 3 2 3 1 3 1 2 2 2 1 1 970 3 2 2 3 2 2 1 3 1 3 2 3 2 2 2 1 2 3 1 1 1 2 2 2 971 2 2 2 1 2 2 3 2 3 1 2 3 2 3 1 1 1 2 1 1 3 1 3 1 972 3 2 1 1 3 2 1 1 2 1 2 3 1 2 1 3 2 3 1 2 2 1 1 3 973 2 3 1 3 1 2 3 1 2 3 2 1 2 1 2 3 2 1 3 2 1 1 2 1 974 1 1 2 2 3 1 3 1 1 1 3 1 3 1 2 1 1 1 2 3 1 2 1 3 975 2 2 2 3 1 1 3 2 3 1 2 3 2 2 1 3 1 1 2 3 2 2 2 1 976 1 3 2 2 3 2 2 3 2 3 2 1 1 2 2 3 2 2 1 3 2 1 1 1 977 1 2 1 3 2 3 1 3 1 1 3 2 3 1 2 1 1 3 1 2 1 2 2 2 978 3 2 3 2 3 1 2 1 1 3 2 1 1 2 2 3 1 3 2 2 1 1 1 2 979 2 1 3 2 2 1 2 2 3 2 2 2 3 2 3 1 1 2 2 2 3 1 3 1 980 1 2 1 3 2 2 3 1 1 2 1 3 2 1 1 2 2 2 3 1 1 3 1 3 981 1 2 3 2 2 2 3 2 3 2 2 2 3 1 1 2 1 3 1 3 1 1 2 1 982 2 3 1 2 1 1 1 3 1 2 1 2 3 1 3 1 3 1 2 2 3 2 1 1 983 2 1 1 1 3 1 2 3 1 3 1 2 3 2 2 3 2 2 1 1 1 3 2 2 984 1 1 3 2 3 1 1 1 2 2 2 3 2 1 1 3 1 1 2 2 1 3 2 3 985 3 1 1 1 2 3 1 3 1 3 2 2 1 2 2 3 1 2 1 3 2 2 2 1 986 2 2 2 3 2 1 1 1 2 3 1 3 1 2 1 2 1 3 2 3 2 2 1 3 987 3 2 2 1 1 2 2 3 2 3 1 2 1 2 2 2 3 1 2 2 1 3 2 3 988 1 3 1 3 2 3 2 2 3 1 2 1 1 1 3 1 2 3 2 2 2 1 2 1 989 1 1 2 2 3 2 3 1 3 1 1 1 2 2 3 1 2 1 1 3 1 1 3 1 990 2 2 1 1 1 3 1 3 1 1 2 2 3 1 3 1 1 3 1 3 1 1 1 2 991 2 2 3 2 2 1 3 1 1 3 1 1 2 2 3 1 1 2 3 2 1 2 3 2 992 1 3 2 2 1 1 3 1 2 1 2 3 2 3 2 3 1 2 3 2 2 2 1 1 993 2 3 1 3 2 2 1 2 3 2 2 3 2 1 1 2 1 3 1 1 1 2 2 3 994 2 2 1 3 1 2 1 1 3 2 2 2 1 3 1 3 1 2 2 3 1 3 1 1 995 1 2 3 1 3 2 1 1 2 1 1 3 1 3 2 1 2 2 2 3 1 1 3 2 996 2 3 2 2 2 1 1 3 2 3 2 1 1 2 3 1 2 2 2 3 2 2 1 3 997 2 2 3 1 1 3 1 1 3 1 2 2 3 2 2 1 2 2 3 2 2 3 1 1 998 2 1 2 1 3 1 1 1 3 1 2 2 1 1 1 3 1 3 2 3 1 1 2 3 999 2 1 1 1 2 2 3 2 2 1 3 1 1 1 2 2 2 3 1 3 2 3 2 3 1000 1 2 2 3 2 2 1 3 2 3 2 3 2 2 1 2 2 3 1 2 2 1 2 3 1001 3 1 3 1 1 2 2 1 2 3 2 3 2 3 1 1 2 1 2 1 3 1 1 1 1002 2 2 3 1 2 2 3 1 2 1 1 1 3 2 1 1 1 3 1 3 2 3 2 1 1003 3 2 3 2 3 2 1 1 1 2 2 3 1 1 2 1 2 3 2 2 1 1 2 3 1004 1 1 1 3 2 1 1 1 3 1 1 1 3 1 1 3 2 2 2 3 1 1 1 3 1005 2 2 2 1 3 2 2 3 1 1 3 1 1 2 1 3 1 1 1 3 1 1 1 3 1006 3 2 3 2 1 1 2 1 1 3 1 3 2 3 1 1 2 1 3 2 1 1 2 2 1007 2 1 2 2 3 1 1 1 2 1 1 3 1 3 1 3 1 2 2 2 3 2 3 1 1008 1 2 3 1 3 1 1 1 3 1 1 3 1 1 3 2 2 1 1 3 1 2 2 2 1009 1 1 3 1 3 2 3 1 3 2 1 2 1 2 2 3 2 2 1 1 1 3 1 1 1010 2 2 2 3 2 1 1 1 3 2 3 1 2 3 1 2 3 2 1 1 3 1 2 1 1011 3 1 2 3 2 2 1 2 3 2 3 1 2 3 1 1 1 2 1 2 3 2 1 2 1012 3 2 1 3 1 1 2 1 1 1 3 2 3 2 2 1 1 1 3 2 3 2 2 1 1013 1 1 1 3 1 3 2 1 2 3 2 3 2 3 2 1 2 3 1 2 1 2 2 2 1014 1 1 1 3 1 2 1 1 3 1 3 2 2 1 3 2 1 1 1 2 2 3 2 3 1015 1 1 3 1 1 2 2 1 3 1 3 1 1 2 1 1 3 2 3 2 3 1 2 1 1016 3 1 2 1 1 3 1 1 1 3 2 3 1 1 1 2 3 2 1 1 2 2 2 3 1017 3 2 3 1 1 1 3 1 2 3 2 2 2 1 2 1 1 3 2 2 2 3 2 2 1018 1 3 2 3 2 1 1 3 2 1 1 2 1 1 3 2 2 2 3 1 3 1 1 1 1019 3 2 2 3 1 3 1 1 2 2 1 3 1 1 2 2 2 3 1 2 1 1 1 3 1020 2 2 1 1 3 1 1 1 2 2 2 3 2 1 2 3 2 3 2 2 3 2 2 3 1021 1 3 1 1 3 1 2 2 2 1 3 1 2 3 1 1 1 2 3 1 3 2 2 2 1022 2 1 1 3 2 2 2 3 1 3 1 2 1 1 1 3 1 2 3 1 2 1 2 3 1023 2 3 1 3 1 2 1 3 2 2 2 3 2 1 1 2 1 2 3 2 2 2 3 2 1024 1 3 2 2 2 3 1 1 1 2 2 3 2 1 1 3 2 2 2 3 1 2 3 1 1025 2 1 3 1 1 2 2 3 1 2 2 1 1 2 3 1 2 3 1 3 2 1 3 2 1026 1 3 1 3 1 2 2 2 3 2 1 1 2 1 1 3 2 1 2 2 3 1 1 3 1027 1 2 1 1 2 3 1 2 3 2 1 1 2 3 2 1 1 3 2 1 3 2 3 2 1028 2 3 1 1 1 2 2 2 3 1 2 3 1 3 1 3 1 2 1 2 3 2 2 1 1029 2 3 2 3 2 1 1 1 3 2 1 2 1 3 2 2 2 1 2 3 2 2 1 3 1030 2 3 1 1 2 1 1 3 2 3 1 1 1 2 1 3 1 1 2 3 1 1 2 3 1031 1 1 1 3 1 1 1 3 1 2 2 3 2 1 1 2 1 1 3 2 1 3 1 3 1032 1 1 2 3 1 1 1 2 1 3 2 3 2 2 1 1 1 2 3 1 3 2 3 2 1033 3 2 1 3 1 2 1 1 1 3 1 2 3 2 3 1 1 2 2 1 2 3 1 2 1034 3 1 2 1 3 2 1 2 1 2 3 2 3 2 3 2 1 2 2 2 3 2 2 2 1035 1 2 3 2 2 2 3 2 1 3 1 1 1 2 3 2 2 2 3 1 1 3 1 2 1036 1 1 1 2 2 2 3 2 1 3 1 3 1 3 1 1 1 2 2 2 3 2 2 3 1037 2 1 3 1 1 2 1 1 3 1 2 2 1 3 2 1 1 3 2 3 2 1 3 1 1038 2 3 1 2 2 2 1 3 1 3 1 1 1 2 1 2 3 1 3 2 1 3 1 1 1039 1 1 2 1 3 1 3 2 1 2 3 2 2 3 2 2 2 1 2 3 1 3 1 1 1040 3 1 2 3 1 2 3 1 1 3 1 3 2 2 2 1 2 2 3 2 1 1 1 2 1041 1 1 3 2 1 1 1 3 1 1 3 1 1 3 1 1 1 2 3 2 3 2 2 1 1042 2 2 3 1 1 3 1 1 2 2 1 1 3 2 3 2 2 2 1 3 2 3 2 1 1043 1 3 1 1 1 3 1 1 2 3 2 2 3 1 2 2 2 1 2 3 1 2 3 2 1044 3 1 2 2 1 1 1 3 1 3 1 2 3 2 2 3 1 2 2 3 1 1 1 2 1045 1 1 2 3 1 2 1 1 2 2 3 2 2 3 1 3 1 3 1 3 2 1 1 2 1046 3 2 2 2 3 2 2 3 1 1 1 3 2 3 2 1 1 1 3 2 1 2 1 2 1047 2 3 1 3 2 2 1 2 1 2 3 1 3 1 1 1 3 2 3 2 1 1 2 2 1048 2 2 3 2 3 1 3 1 1 1 3 1 1 3 2 1 2 1 2 1 3 1 1 2 1049 3 2 1 1 3 2 2 2 1 3 1 3 2 2 1 2 1 3 1 3 2 2 2 1 1050 3 1 2 1 3 1 2 1 3 1 2 1 1 3 2 2 1 1 2 2 3 1 1 3 1051 1 3 1 3 1 2 3 1 2 2 3 2 2 2 1 2 3 2 1 2 2 1 2 3 1052 1 1 1 3 2 2 1 1 3 1 1 1 2 2 3 2 1 3 2 3 1 2 1 3 1053 2 2 2 3 1 2 1 2 2 3 2 2 2 3 2 3 1 3 2 3 2 1 2 1 1054 1 2 2 2 3 2 1 3 1 1 1 3 2 2 3 2 2 1 2 3 1 3 2 2 1055 3 1 2 2 2 3 1 3 2 1 1 3 2 2 2 1 2 1 3 1 2 3 1 1 1056 1 1 3 1 2 1 1 1 3 2 3 1 3 2 2 3 1 2 2 2 1 3 1 2 1057 3 1 2 1 2 2 3 2 1 1 3 1 2 1 2 3 2 2 3 2 1 1 1 3 1058 3 2 1 1 3 1 3 2 3 2 1 2 2 3 2 1 1 3 2 2 1 1 2 2 1059 3 2 3 2 3 1 2 2 1 3 2 1 1 2 3 1 1 3 2 1 2 2 2 1 1060 3 2 1 1 3 1 1 1 3 1 2 2 1 1 3 2 3 2 2 1 3 2 1 1 1061 1 3 2 1 3 1 1 1 3 2 2 3 1 1 1 2 2 3 1 2 2 1 2 3 1062 2 1 1 3 1 3 1 1 3 2 2 3 1 3 2 1 1 2 3 2 1 2 2 2 1063 3 2 2 1 1 3 1 1 1 2 1 3 2 1 3 1 2 1 1 3 2 3 1 1 1064 2 1 1 3 2 1 1 1 2 2 3 1 1 1 3 2 3 2 1 2 1 3 2 3 1065 1 1 3 1 2 3 2 1 2 3 2 2 2 1 2 2 3 2 2 3 2 3 2 1 1066 1 2 2 2 1 3 1 1 2 1 2 1 3 2 3 1 1 3 1 3 1 2 1 3 1067 3 2 2 1 2 3 1 1 1 3 1 3 2 1 2 3 2 3 2 2 1 1 1 2 1068 2 1 2 2 1 2 3 2 3 1 1 3 1 1 3 1 1 2 3 1 2 2 1 3 1069 2 1 1 2 1 1 3 2 2 3 1 1 3 1 3 1 1 2 2 3 2 2 3 2 1070 2 3 1 2 3 2 2 2 3 1 2 3 2 1 1 2 2 3 2 2 1 1 1 3 1071 3 2 3 1 1 1 3 1 2 2 2 3 1 3 2 2 2 3 2 1 2 1 1 2 1072 1 3 1 3 1 1 2 1 2 1 3 1 2 2 3 1 3 1 2 2 2 3 2 2 1073 2 2 2 3 1 3 1 2 3 2 3 1 2 3 1 2 1 1 1 3 2 2 1 1 1074 3 2 2 3 2 1 1 1 2 2 3 2 1 3 2 1 1 1 3 1 1 3 2 1 1075 3 2 3 2 2 1 2 3 1 2 3 2 2 3 2 2 2 3 2 1 2 2 1 2 1076 1 2 2 1 2 2 3 2 3 2 1 3 1 2 3 2 1 2 2 1 1 3 1 3 1077 3 2 2 1 3 1 1 1 3 1 2 2 2 1 3 1 1 3 2 2 1 3 2 2 1078 2 2 3 2 3 2 1 2 2 1 1 3 1 3 1 3 2 3 1 1 1 2 1 2 1079 3 2 2 2 1 1 3 1 2 1 3 1 1 1 3 1 3 2 3 1 2 2 2 1 1080 1 1 2 3 1 3 1 1 1 2 1 3 1 2 1 3 2 2 1 2 2 3 2 3 1081 2 3 1 1 2 2 3 1 1 2 1 1 3 1 1 2 2 2 3 2 2 3 2 3 1082 1 1 2 1 1 3 1 2 2 3 1 1 2 2 1 3 2 3 1 3 2 1 1 3 1083 1 1 2 3 2 2 2 3 1 3 1 3 1 2 2 2 1 3 2 1 1 1 3 1 1084 1 3 2 2 2 1 3 1 1 2 1 3 1 1 1 2 3 2 3 2 2 2 3 1 1085 2 1 2 1 1 3 2 1 1 3 2 3 2 2 1 1 3 1 2 2 2 3 1 3 1086 3 2 1 3 2 3 1 1 2 1 1 3 2 2 1 3 2 3 2 2 1 1 2 1 1087 1 1 3 2 3 2 3 2 2 1 1 1 3 2 1 1 1 2 3 2 1 3 1 2 1088 1 3 1 3 1 2 3 2 2 2 1 2 3 2 2 3 2 3 1 1 2 2 1 1 1089 1 3 2 2 3 1 1 2 1 2 2 3 1 2 3 1 2 1 1 3 1 1 3 1 1090 2 3 1 1 2 3 2 3 1 3 1 2 3 2 2 2 1 3 1 1 2 1 1 2 1091 1 1 2 1 1 2 3 1 2 3 2 1 1 3 2 2 2 3 1 3 2 2 2 3 1092 1 1 1 3 1 3 2 3 1 1 2 1 3 1 1 1 2 1 1 3 1 3 1 1 1093 1 1 2 1 1 1 3 2 2 1 2 2 3 1 3 1 3 1 3 2 2 2 1 3 1094 1 3 2 1 3 2 3 2 2 3 2 1 3 2 2 2 1 3 2 1 2 1 2 1 1095 3 2 1 1 3 1 1 2 3 2 1 2 2 1 3 1 2 1 2 2 2 3 2 3 1096 3 1 2 1 1 1 2 3 2 2 2 3 1 2 1 1 1 3 2 1 3 2 2 3 1097 1 2 1 3 2 1 2 3 2 1 2 3 2 3 2 3 1 1 3 1 2 2 2 1 1098 1 2 3 1 1 2 3 2 1 3 1 3 2 3 1 2 2 1 3 2 2 2 1 1 1099 3 2 1 3 2 1 2 2 2 1 3 2 3 1 2 3 2 1 1 3 1 1 2 1 1100 1 3 1 1 2 2 3 2 1 2 2 3 1 1 3 1 1 3 1 1 2 1 2 3 1101 2 2 2 1 2 1 3 1 1 2 2 3 1 3 1 3 1 1 3 2 2 1 1 3 1102 1 1 1 3 2 1 3 2 1 3 1 3 1 2 2 2 3 1 3 1 1 2 2 1 1103 2 2 2 1 1 1 3 1 1 1 3 2 1 2 2 3 2 1 1 3 1 3 2 3 1104 1 1 1 2 2 3 1 3 1 1 1 3 2 3 1 1 2 3 1 1 3 2 2 2 1105 1 1 3 1 1 1 2 1 1 3 2 1 2 3 1 2 1 3 2 1 3 2 1 3 1106 1 2 2 2 3 1 1 2 2 3 2 1 2 2 3 2 1 3 2 2 2 3 2 3 1107 1 1 3 1 3 1 1 2 1 1 2 3 2 1 3 1 3 1 2 1 2 1 1 3 1108 2 3 2 3 2 1 1 2 1 3 2 2 3 2 2 1 1 2 3 1 3 2 1 1 1109 2 1 2 1 3 2 2 3 2 1 3 2 2 2 1 3 1 2 3 1 1 2 3 2 1110 1 2 2 3 2 3 2 2 1 3 1 1 2 3 1 2 3 2 2 1 1 2 1 3 1111 3 2 2 2 3 2 1 2 1 3 2 1 2 2 2 3 1 2 2 3 1 2 3 2 1112 1 3 1 3 2 1 1 1 3 2 1 2 3 1 3 2 2 1 2 3 1 1 2 1 1113 3 1 1 1 3 2 2 2 1 1 3 2 3 1 2 3 2 1 2 1 2 2 3 2 1114 2 2 1 1 1 2 3 1 2 1 1 1 3 1 3 2 1 3 2 3 1 1 3 2 1115 2 2 1 1 1 2 3 2 3 2 3 1 3 1 1 3 1 2 3 1 1 2 1 1 1116 1 2 2 2 3 2 1 2 1 1 1 3 2 3 1 1 3 1 1 3 1 3 1 1 1117 2 3 1 2 2 1 3 2 1 2 2 2 3 2 3 1 1 3 1 3 1 2 2 2 1118 2 2 2 3 1 1 2 3 1 1 1 2 2 3 1 2 3 1 2 1 3 1 2 3 1119 1 3 1 3 2 1 1 3 1 2 2 1 1 3 1 1 2 1 1 3 1 1 1 3 1120 1 2 2 3 1 1 2 2 3 1 3 1 1 3 2 3 1 1 3 2 1 1 1 2 1121 2 2 2 1 3 1 3 1 1 3 2 1 2 2 3 2 2 2 3 1 1 1 3 1 1122 2 1 1 1 3 2 3 1 1 1 3 1 2 2 2 3 1 1 1 2 3 1 2 3 1123 3 1 1 1 3 2 2 1 3 1 3 1 1 1 2 3 2 1 3 1 1 1 2 2 1124 3 2 3 1 1 2 1 1 2 3 1 1 3 1 1 3 2 2 1 2 3 2 2 1 1125 2 2 3 2 3 1 1 2 1 1 1 3 2 1 3 1 2 3 2 3 2 2 1 2 1126 2 2 1 2 1 2 3 1 2 1 2 3 1 3 2 2 2 3 2 3 2 2 3 1 1127 2 2 3 1 2 2 2 3 2 3 2 3 1 3 2 1 2 2 1 3 2 2 1 2 1128 1 1 1 3 2 3 1 2 2 1 1 3 2 2 1 3 2 2 2 3 1 3 1 2 1129 2 2 3 2 1 2 2 2 3 2 1 2 1 1 2 3 2 2 1 1 3 1 1 3 1130 3 2 2 2 3 1 1 1 2 2 1 3 2 3 2 3 1 3 1 1 1 2 1 2 1131 1 1 2 3 2 2 3 1 3 1 2 2 3 1 2 1 1 2 3 2 2 3 1 1 1132 2 1 3 2 1 3 2 1 3 2 1 2 2 3 2 2 3 2 1 1 2 1 1 3 1133 3 2 2 3 2 1 1 2 2 2 3 1 3 2 3 2 2 1 3 2 2 1 2 2 1134 2 3 1 1 2 1 2 3 1 2 1 3 2 2 1 3 2 1 1 2 2 3 2 3 1135 2 3 1 2 1 3 2 1 2 3 2 2 2 3 2 3 1 2 2 1 1 1 3 1 1136 3 1 2 3 2 1 2 1 1 1 3 1 3 2 1 2 3 2 2 1 2 1 1 3 1137 1 3 2 3 1 3 1 2 2 2 1 3 1 1 3 1 2 3 2 2 1 2 2 1 1138 1 2 3 1 3 1 1 2 2 2 3 2 2 1 1 1 3 1 3 1 1 1 3 2 1139 1 1 1 3 1 1 2 2 1 3 2 1 2 3 1 2 1 3 1 2 3 1 3 1 1140 2 1 3 1 3 2 2 3 2 1 2 1 3 2 2 2 1 2 1 3 2 2 3 1 1141 3 2 1 3 1 1 2 3 1 2 2 3 2 2 2 1 3 1 1 3 1 2 2 2 1142 3 2 2 2 1 2 3 2 2 2 3 1 3 1 1 3 1 3 2 2 1 2 2 2 1143 2 1 3 1 1 3 2 2 2 3 1 1 1 3 2 2 1 2 2 3 1 2 2 3 1144 3 1 2 3 1 1 3 1 3 2 1 2 2 2 3 2 2 1 2 1 2 3 2 1 1145 3 1 2 3 1 1 2 1 2 1 3 2 1 1 3 2 1 2 2 3 1 3 2 1 1146 2 1 3 2 3 1 2 3 1 1 1 2 2 2 3 1 3 1 2 1 3 1 2 1 1147 3 1 1 1 3 1 1 1 2 2 3 1 1 3 1 3 2 2 2 3 1 2 1 2 1148 1 2 2 2 3 1 3 2 1 2 2 2 3 2 3 2 1 2 2 3 1 1 2 3 1149 1 2 3 1 3 2 2 3 1 1 1 2 2 2 3 1 1 3 2 1 2 2 3 2 1150 2 2 1 1 2 1 3 2 3 1 3 1 3 1 3 2 1 2 1 2 3 2 1 1 1151 1 2 2 1 1 3 1 3 1 3 2 3 1 3 2 1 1 1 2 3 2 1 1 1 1152 1 1 3 1 1 2 1 3 1 2 3 1 3 1 2 2 1 3 1 1 1 2 1 3 1153 1 3 2 2 2 1 1 1 3 1 3 2 2 1 3 1 1 2 2 3 1 1 1 3 1154 3 2 1 1 3 1 2 2 2 3 2 2 3 1 1 3 1 3 1 1 1 3 1 1 1155 3 2 2 1 1 1 3 2 3 1 2 1 2 2 3 1 1 2 1 1 1 3 1 1 1156 2 1 1 2 1 3 1 3 1 1 3 1 3 1 2 3 2 1 2 3 1 1 2 1 1157 2 2 1 2 2 1 3 2 3 1 2 1 1 3 1 2 1 1 2 3 2 1 1 1 1158 3 1 2 3 1 3 2 2 2 1 2 3 1 3 1 2 3 2 2 1 2 3 1 2 1159 2 2 3 1 2 2 2 3 1 3 1 3 2 2 3 1 2 1 1 3 1 2 2 2 1160 1 2 3 1 2 2 1 2 2 3 2 3 2 3 2 1 3 1 1 2 2 1 3 1 1161 2 1 2 1 1 1 3 1 2 1 2 1 3 2 1 3 1 2 3 1 2 3 2 3 1162 2 2 2 1 3 2 2 3 1 3 1 2 3 1 1 3 2 2 1 2 2 1 1 2 1163 2 3 1 2 2 3 1 2 1 2 1 3 2 3 2 1 1 1 3 2 3 2 1 2 1164 3 1 1 3 1 1 1 3 1 2 2 1 2 2 3 2 1 2 2 3 1 3 1 2 1165 2 3 1 3 2 3 2 1 3 2 3 1 2 2 2 1 3 1 1 1 2 1 1 1 1166 1 1 2 1 1 1 3 2 3 2 2 2 1 1 3 1 3 2 1 3 1 3 2 1 1167 3 2 1 3 1 3 1 2 1 1 2 2 3 1 2 3 2 3 2 1 1 2 2 2 1168 In Table IA, each of the numerals 1 to 3 (numeric identifiers) represents a nucleotide base and the pattern of numerals 1 to 3 of the sequences in the above list corresponds to the pattern of nucleotide bases present in the oligonucleotides of Table I, which oligonucleotides have been found to be non-cross-hybridizing, as described further in the detailed examples. Each nucleotide base is selected from the group of nucleotide bases consisting of A, C, G, and T/U. A particularly preferred embodiment of the invention, in which a specific base is assigned to each numeric identifier is shown in Table I, below. In one broad aspect, the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as specified by numeric identifiers set out in Table IA. In the sequences, each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦15, M2≦12, M3≦19, M4≦15, and M5≦18, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; wherein: the score of an alignment is determined according to the equation (A ×m)−(B×mm)−(C×(og+eg))−(D×eq)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eq=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii) , (iii) and (iv). An explanation of the meaning of the parameters set out above is given in the section describing detailed embodiments. In another broad aspect, the invention is a composition containing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences as set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score; wherein the score of an alignment is determined according to the equation (A×m)−(B×mm)−(C×(og +eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). In another broad aspect, the invention is a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences set out in Table IA wherein each of 1 to 3 is a nucleotide base selected to be different from the others of 1 to 3 with the proviso that up to three nucleotide bases of each sequence can be substituted with any nucleotide base provided that: for any pair of sequences of the set: M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: M1 is the maximum number of matches for any alignment in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment; M3 is the maximum number of matches for any alignment having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of maximum score, wherein: the score of an alignment is determined according to the equation 3A−B−3C−D, wherein: A is the total number of matched paris of bases in teh alighnment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and In preferred aspects, the invention provides a composition in which, for the group of 24mer sequences in which 1=A, 2=T and 3=G, under a definde set of condition s in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybiridization between said sequence and its complement, for all said oligonucleotide of the composition, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of teh composition does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. More preferabley, the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 10, more preferably between 1 and up to 9, more preferably between 1 and up to 8, more preferably between 1 and up to 7, more preferably between 1 and up to 6, and more preferably between 1 and up to 5. It is also preferred that the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 25%, more preferably does not exceed 20%, more preferably does not exceed 15%, more preferably does not exceed 10%, more preferably does not exceed 5%. Even more preferably, the above-referenced defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. In the composition, the defined set of conditions can include the group of 24mer sequences being covalently linked to beads. In a particular preferred aspect, for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and up to 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement. It is possible that each 1 is one of A, T/U, G and C; each 2 is one of A, T/U, G and C; and each 3 is one of A, T/U, G and C; and each of 1, 2 and 3 is selected so as to be different from all of the others of 1, 2 and 3. More preferably, 1 is A or T/U, 2 is A or T/U and 3 is G or C. Even more preferably, 1 is A, 2 is T/U, and 3 is G. In certain preferred composition, each of the oligonucleotides is from twenty-two to twenty-six bases in length, or from twenty-three to twenty-five, and preferably, each oligonucleotide is of the same length as every other said oligonucleotide. In a particularly preferred embodiment, each oligonucleotide is twenty-four bases in length. It is preferred that no oligonucleotide contains more than four contiguous bases that are identical to each other. It is also preferred that the number of G's in each oligonucleotide does not exceed L/4 where L is the number of bases in said sequence. For reasons described below, the number of G's in each said oligonuclebtide is preferred not to vary from the average number of G's in all of the oligonucleotides by more than one Even more preferably, the number of G's in each said oligonucleotide is the same as every other said oligonucleotide. In the embodiment disclosed below in which oligonucleotides were tested, the sequence of each was twenty-four bases in length and each oligonucleotide contained 6 G's. It is also preferred that, for each nucleotide, there is at most six bases other than G between every pair of neighboring pairs of G's. Also, it is preferred that, at the 5′-end of each oligonucleotide at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonculeotide is a G. Similarly, it is preferred, at the 3′-end of each oligonucleotide that at least one of the first, second, third, fourth, fifth, sixth and seventh bases of the sequence of the oligonucleotide is a G. It is possible to have sequence compositions that include one hundred and sixty said molecules, or that include one hundred and seventy said molecules, or that include one hundred and eighty said molecules, or that include one hundred and ninety said molecules, or that include two hundred said molecules, or that include two hundred and twenty said molecules, or that include two hundred and forty said molecules, or that include two hundred and sixty said molecules, or that include two hundred and eighty said molecules, or that include three hundred said molecules, or that include four hundred said molecules, or that include five hundred said molecules, or that include six hundred said molecules, or that include seven hundred said molecules, or that include eight hundred said molecules, or that include nine hundred said molecules, or that include one thousand said molecules. It is possible, in certain applications, for each molecule to be linked to a solid phase support so as to be distinguishable from a mixture containing other of the molecules by hybridization to its complement. Such a molecule can be linked to a defined location on a solid phase support such that the defined location for each molecule is different than the defined location for different others of the molecules. In certain embodiments, each solid phase support is a microparticle and each said molecule is covalently linked to a different microparticle than each other different said molecule. In another broad aspect, the invention is a composition comprising a set of 150 molecules for use as tags or tag complements wherein each molecule includes an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1>19/24×L 1 , M2>17/24×L 1 , M3>21/24×L 1 , M4>18/24×L 1 , M5>20/24×L 1 , where L 1 is the length of the shortest sequence of the pair, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of an alignment is determined according to the equation (A×m)−(B×mm)−(C×(og+eg))−(D×eg)), wherein: for each of (i) to (iv): (i) m=6, mm=6, og=0 and eg=6, (ii) m=6, mm=6, og=5 and eg=1, (iii) m=6, mm=2, og=5 and eg=1, and (iv) m=6, mm=6, og=6 and eg=0, A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment; and wherein the maximum score is determined separately for each of (i), (ii), (iii) and (iv). In yet another broad aspect, the invention is a composition that includes a set of 150 molecules for use as tags or tag complements wherein each molecule has an oligonucleotide having a sequence of at least sixteen nucleotide bases wherein for any pair of sequences of the set: M1≦18, M2≦16, M3≦20, M4≦17, and M5≦19, where: M1 is the maximum number of matches for any alignment of the pair of sequences in which there are no internal indels; M2 is the maximum length of a block of matches for any alignment of the pair of sequences; M3 is the maximum number of matches for any alignment of the pair of sequences having a maximum score; M4 is the maximum sum of the lengths of the longest two blocks of matches for any alignment of the pair of sequences of maximum score; and M5 is the maximum sum of the lengths of all the blocks of matches having a length of at least 3, for any alignment of the pair of sequences of maximum score, wherein: the score of a said alignment is determined according to the equation 3A−B−3C−D, wherein: A is the total number of matched pairs of bases in the alignment; B is the total number of internal mismatched pairs in the alignment; C is the total number of internal gaps in the alignment; and D is the total number of internal indels in the alignment minus the total number of internal gaps in the alignment. In certain embodiments of the invention, each sequence of a composition has up to fifty bases. More preferably, however, each sequence is between sixteen and forty bases in length, or between sixteen and thirty-five bases in length, or between eighteen and thirty bases in length, or between twenty and twenty-eight bases in length, or between twenty-one and twenty-seven bases in length, or between twenty-two and twenty-six bases in length. Often, each sequence is of the same length as every other said sequence. In particular embodiments disclosed herein, each sequence is twenty-four bases in length. Again, it can be preferred that no sequence contains more than four contiguous bases that are identical to each other, etc., as described above. In certain preferred embodiments, the composition is such that, under a defined set of conditions, the maximum degree of hybridization between an oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 30% of the degree of hybridization between said oligonucleotide and its complement, more preferably 20%, more preferably 15%, more preferably 10%, more preferably 6%. Preferably, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles. Of course it is possible that these specific conditions be used for determining the level of hybridization. It is also preferred that under such a defined set of conditions, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. In a particular disclosed embodiment, the observed variance in the degree of hybridization was a factor of only 5.3, i.e., the degree of hybridization between each oligonucleotide and its complement varied by a factor of between 1 and 5.6. In certain preferred embodiments, under the defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide of the composition does not exceed about 15%, more preferably 10%, more preferably 6%. In one preferred embodiment, the set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the oligonucleotides are covalently linked to microparticles. Also, under the defined set of conditions, it is preferred that the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and up to 8, more preferably up to 7, more preferably up to 6, more preferably up to 5. Any composition of the invention can include one hundred and sixty of the oligonucleotide molecules, or one hundred and seventy of the oligonucleotide molecules, or one hundred and eighty of the oligonucleotide molecules, or one hundred and ninety of the oligonucleotide molecules, or two hundred of the oligonucleotide molecules, or two hundred and twenty of the oligonucleotide molecules, or two hundred and forty of the oligonucleotide molecules, or two hundred and sixty of the oligonucleotide molecules, or two hundred and eighty of the oligonucleotide molecules, or three hundred of the oligonucleotide molecules, or four hundred of the oligonucleotide molecules, or five hundred of the oligonucleotide molecules, or six hundred of the oligonucleotide molecules, or seven hundred of the oligonucleotide molecules, or eight hundred of the oligonucleotide molecules, or nine hundred of the oligonucleotide molecules, or one thousand or more of the oligonucleotide molecules. A composition of the invention can be a family of tags, or it can be a family of tag complements. An oligonucleotide molecule belonging to a family of molecules of the invention can have incorporated thereinto one more analogues of nucleotide bases, preference being given those that undergo normal Watson-Crick base pairing. The invention includes kits for sorting and identifying polynucleotides. Such a kit can include one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached. The tag complements are made up of a set of oligonucleotides of the invention. The one or more solid phase supports can be a planar substrate in which the one or more spatially discrete regions is a plurality of spatially addressable regions. The tag complements can also be coupled to microparticles. Microparticles preferably each have a diameter in the range of from 5 to 40 μm. Such a kit preferably includes microparticles that are spectrophotometrically unique, and therefore distinguisable from each other according to conventional laboratory techniques. Of course for such kits to work, each type of microparticle would generally have only one tag complement associated with it, and usually there would be a different oligonucleotide tag complement associated with (attached to) each type of microparticle. The invention includes methods of using families of oligonucleotides of the invention. One such method is of analyzing a biological sample containing a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid. The method includes: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, with the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid. In another method of the invention, a biological sample containing a plurality of nucleic acid molecules is analyzed for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. This method includes steps of: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid; wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. Another method includes analyzing a biological sample that contains a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. The method includes steps of: (A) amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form amplified molecules with 5′-ends with a sequence complementary to the sequence of the tag; (B) extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5′-end complementary a 3′-end of the amplified sequence, the 3′-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other; (C) specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus; wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. In yet another aspect, the invention is a method of analyzing a biological sample containing a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method including steps of: (a) hybridizing the molecule and a primer, the primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention and a 3′-end extending to immediately adjacent the locus; (b) enzymatically extending the 3′-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3′-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus; (c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and (d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule; wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other. The derivative can be a dideoxy nucleoside triphosphate. Each respective complement can be attached as a uniform population of substantially identical complements in spacially discrete regions on one or more solid phase support(s). Each tag complement can include a label, each such label being different for respective complements, and step (d) can include detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements. Another aspect of the invention includes a method of determining the presence of a target suspected of being contained in a mixture. The method includes the steps of: (i) labelling the target with a first label; (ii) providing a first detection moiety capable of specific binding to the target and including a first tag; (iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target; (iv) providing a family of suitable tag complements of the invention wherein the family contains a first tag complement having a sequence complementary to that of the first tag; (v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement; (vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence of said target in the mixture. Preferably , the first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first label at said specified location. Also, the first tag complement can include a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement. Further, the target can be selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. The target can be an antigen and the first molecule can be an antibody specific for that antigen. The antigen is usually a polypeptide or protein and the labelling step can include conjugation of fluorescent molecules, digoxigenin, biotinylation and the like. The target can be a nucleic acid and the labelling step can include incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like. |
Binary mixtures of biodegradable aliphatic polyesters and products obtained from these |
A biodegradable mixture obtained by melt mixing polyesters comprising (A) an aliphatic polyester obtained from aliphatic diacids selected from the group consisting of azelaic acid, sebacic acid, brassilic acid, mixtures thereof and mixtures of said acids with aliphatic dicarbossilic acids and/or aliphatic hydroxyacids containing more than 50 mole % of azelaic acid, sebacic acid and brassilic acid, and from aliphatic diols; (B) a polymer of lactic acid in which the concentration by weight of A with respect to (A+B) is in the range of 30 to 60 % and in which the sum of the fusion entalpy ΔHA and ΔHB of the two polyesters in the mixture is greater than the sum of the fusion entalpies ΔH1 and ΔH2 of the polyesters prior to melt mixing. |
1-20. (canceled) 21. A biodegradable mixure obtained by melt mixing polyesters comprising: (A) An aliphatic polyester obtained from aliphatic diacids selected from the group consisting of azelaic acid, sebacic acid, brassilic acid, mixtures thereof and mixtures of said acids with aliphatic dicarbossilic acids and/or aliphatic hydroxyacids containing more than 50 mole % of azelaic acid, sebacic acid and brassilic acid, and from aliphatic diols said polyester having modulus of elasticity lying between 400 and 900 MPa and breaking elongation greater than 200% on blown film of about 25-30 μm, average ponderal molecular weight greater than 55,000 and a melting point from 40 to 95° C.; (B) A polymer of lactic acid chosen among L or D polylactic acid, L,D-polylactic, meso polylactic or lactic acid copolymer with hydroxyacids or lactones thereof containing at least 75% of L-lactic or D-lactic acid having average ponderal molecular weight greater than 70,000 and with modulus of elasticity greater than 1500 MPa; in which the mixture contains plasticizers in quantities less than 5% by weight with respect to the quantity of aliphatic polyester and polyweer of the lastic acid the concentration by weight of A with respect to (A+B) is in the range of 30 to 60% and blown films of thickness between 25-30 μm have modulus of elasticity greater than 1400 MPa, permeability to water from 170 to 40 g30 μm/m224 h a transmittance at the entrance port lying between 90 and 95% and in which the sum of the fusion enthalpy ΔHA and ΔHB of the two polyesters in the mixture is greater than the sum of the fusion enthalpies ΔH1 and ΔH2 of the polyesters prior to melt mixing. 22. A mixture according to, claim 21 in which the aliphatic polyester is obtained from mixtures of azelaic acid and/or sebacic acid and/or brassylic acid with aliphatic dicarboxilic acids and, optionally, aliphatic hydroxyacids containing more than 70 mole % of azelaic acid and/or sebacic acid and/or brassylic acid. 23. A mixture according to claim 22, in which the hydroxy acid is selected from the group containing glycolic acid, lactic acid, 3-hydroxybutyric, 4-hydroxybutric, 3-hydroxyvaleric, 4-hydroxyvaleric, 6-hydroxycaproic, and cyclic esters of hydroxycarboxylic acids, glycolidies, dimmers of glycolic acid, ε-caprolactone and 6-hydroxycaproic acid. 24. A mixture according to claim 21 in which the aliphatic diol is selected from the group comprising ethylene glycol, diethylene glycol, triethylene glycol, polyethylene glycol, diethylene glycol, 1-2 and 1-3 propylene glycol, 1,3-butandiol, 1,4-butandiol, 3-methyl-1,5-pentandiol, 1,6-hexandiol, 1-9 nonandiol, dipropylene glycol, 1,11-undecandiol, 1,13-tridecandiol, neopentyl glycol, polytetramethylene glycol and 1,4-cyclohexane dimethanol, cyclohexane diol or mixtures thereof. 25. A film produced by blowing or flat head extrusion from mixtures according to claim 21. 26. A film according to claim 25, in which the mixture contains one or more inorganic additives such as silica, calcium carbonate, talc, kaolin, kaolinite, oxide of zinc, wollastonite, hydrotalcite, lamellar inorganic substances functionalized or not with organic molecules capable of delamellating in the mixing phase with the polymeric mixture or with one of the individual polymers of the mixture to give nanocomposites. 27. A film according to claim 26 in which the content by weight of inorganic additives in the mixture lies between 0.05 and 3.0. 28. Packets for food or industrial products and clothing, adhesive tapes, tapes for napples, coloured ornamental tapes, adhesive tapes of different form, film for packaging flowers, plants and gift items, produced from film according to claim 27. 29. Bags and films for dry products such as bread, biscuits, crackers, crisps, chipsters, chocolate, cheese, meat, vegetables, welding and tear tape, and film for sealing containers, produced from film according to claim 27. 30. Film according to claim 27 surface treated with aluminum or silica or laminated. 31. Multi-layer film comprising at least one film according to claim 27 and one layer of polylactic acid or other polyester or destructured or non-destructured starch and its blends with synthetic and natural polymers said multi-layer film possibly comprising a layer of aluminium and other materials or a vaccum-metalized layer with aluminum, silica and other inorganic materials. 32. Fibres for woven and non-woven textiles of for fishing nets produced from mixtures according to claim 21. 33. Sheets for thermoforming, extruded or coextruded with other layers of polymers then thermoformed into trays for food, and agricultural products obtained from mixtures according to claim 21. 34. Containers for yoghurt, cheese, meat, biscuits, crisps, snacks, trays for industrial use, containers for fragile objects, produced from sheet according to claim 33. 35. Containers, cutlery, disposable objects, injection moulded from biodegradable polymeric mixtures according claim 21. 36. Foam sheet produced with mixtures according to claim 21 and formed into containers for food such as meat, cheese, vegetables, drinks, containers for fast food. 37. Agglomerable expanded particles produced from biodegradable polymeric mixtures according to claim 21 for packages for use in the industrial sector. 38. Use of the biodegradable mixture according to claim 21 for applications requiring low water permeability values. |
Polynucleotides for use as tags and tag complements, manufacture and use thereof |
A family of minimally cross-hybridizing nucleotide sequences, methods of use, etc. A specific family of 210 24mers is described. |
1. A composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a following group of sequences: 1 4 6 6 1 3 2 4 5 5 2 3 1 8 1 2 3 4 1 7 1 9 8 4 1 1 9 2 6 9 1 2 4 3 9 6 9 8 9 8 10 9 9 1 2 3 8 10 8 8 7 4 3 1 1 1 1 1 1 2 2 1 3 3 2 2 3 1 2 2 3 2 4 1 4 4 4 2 1 2 3 3 1 1 1 3 2 2 1 4 3 3 3 3 3 4 4 3 1 1 4 4 3 4 1 1 3 3 3 6 6 6 3 5 6 6 1 1 6 5 7 6 7 7 7 5 8 7 5 5 8 8 2 1 7 7 1 1 2 3 2 3 1 3 2 6 5 6 1 6 4 8 1 1 3 8 5 3 1 1 6 3 5 6 8 8 6 6 8 3 6 5 7 3 1 2 3 1 4 6 1 5 7 5 4 3 2 1 6 7 3 6 2 6 1 3 3 1 2 7 6 8 3 1 3 4 3 1 2 5 3 5 6 1 2 7 3 6 1 7 2 7 4 6 3 5 1 7 5 4 6 3 8 6 6 8 2 3 7 1 7 1 7 8 6 3 7 3 4 1 6 8 4 7 7 1 2 4 3 6 5 2 6 3 1 4 1 4 6 1 3 3 1 4 8 1 8 3 3 5 3 8 1 3 6 6 3 7 7 3 8 6 4 7 3 1 3 7 8 6 10 9 5 5 10 10 7 10 10 10 7 9 9 9 7 7 10 9 9 3 10 3 10 3 9 6 3 4 10 6 10 4 10 3 9 4 3 9 3 10 4 9 9 10 5 9 4 8 3 9 4 9 10 7 3 5 9 4 10 8 4 10 5 4 9 3 5 3 3 9 8 10 6 8 6 9 7 10 4 6 10 9 6 4 4 9 8 10 8 3 7 7 9 10 5 3 8 8 9 3 9 10 8 10 2 9 5 9 9 6 2 2 7 10 9 7 5 3 10 6 10 3 6 8 9 2 10 9 3 2 7 3 8 9 10 3 6 2 3 2 5 10 8 9 8 2 3 10 2 9 6 3 9 8 2 10 3 7 3 9 9 10 9 10 1 1 9 4 10 1 9 1 4 1 7 1 10 9 8 1 9 1 10 1 10 6 9 6 9 1 3 10 3 10 8 8 9 1 3 8 1 9 10 3 9 10 1 3 6 9 1 9 1 10 3 1 1 4 9 6 8 10 3 3 9 6 1 10 5 3 1 6 9 10 6 1 8 10 9 6 5 9 9 4 10 3 2 10 9 1 9 5 10 10 7 2 1 9 10 9 9 1 8 2 1 8 6 8 9 10 1 9 1 3 8 10 9 6 9 10 1 2 1 10 8 9 9 2 1 9 6 7 2 9 4 3 9 3 5 1 5 11 10 14 12 1 7 12 4 13 3 2 5 5 4 4 12 9 2 13 13 11 13 13 10 2 5 4 12 7 11 7 4 11 6 4 12 12 1 9 11 11 12 9 4 14 12 6 12 7 13 2 9 11 9 11 3 4 1 3 10 5 12 11 4 4 4 13 7 12 1 5 9 13 10 11 11 6 10 14 14 10 1 3 2 14 1 10 4 5 10 12 12 7 11 10 9 11 2 12 8 11 2 8 5 2 12 14 1 8 13 3 7 8 9 4 7 5 4 2 13 2 12 7 1 12 11 10 9 7 5 11 8 12 2 2 12 7 5 2 14 3 4 13 1 8 8 1 5 9 14 5 11 10 13 3 14 1 4 13 2 4 4 4 5 11 3 10 10 9 2 3 3 11 11 4 8 14 3 4 5 1 14 8 11 2 14 3 11 6 12 5 13 4 4 1 10 1 6 10 11 6 5 1 5 8 12 5 1 7 4 5 9 6 9 2 13 2 4 4 2 3 11 2 2 5 9 3 8 1 10 12 2 8 12 7 9 11 4 1 12 1 4 14 3 13 11 2 7 10 4 1 3 4 12 11 11 11 3 3 4 2 12 11 1 5 9 4 2 1 6 1 12 2 10 5 10 5 1 12 2 14 2 11 7 9 4 11 7 4 4 5 14 12 12 5 2 1 10 12 5 9 2 11 6 1 12 14 3 6 1 14 5 9 11 10 1 4 2 5 12 14 10 10 4 5 8 4 5 6 10 12 4 6 12 5 4 2 1 13 6 8 9 10 10 14 5 3 6 14 10 11 3 3 2 9 10 12 5 7 13 3 7 10 5 12 6 4 1 2 5 13 6 1 13 4 14 13 2 12 1 14 1 9 4 11 13 2 6 10 1 10 7 4 5 8 7 2 2 10 13 4 8 2 11 4 6 14 4 8 2 6 2 3 7 1 12 11 2 9 5 6 10 4 13 4 5 10 4 11 9 3 3 11 9 3 2 3 8 15 6 20 17 19 21 10 15 3 7 11 11 7 17 20 14 9 16 6 17 13 21 21 10 15 22 6 17 21 15 7 17 10 22 22 3 20 8 15 20 16 17 21 10 16 6 22 6 21 14 14 14 16 7 17 3 20 10 7 16 19 14 17 7 21 20 16 7 15 22 10 20 10 18 11 22 18 18 7 19 15 7 22 21 18 7 21 16 3 14 13 7 22 17 13 19 7 8 12 10 17 15 3 21 14 9 7 19 6 15 7 14 14 4 17 10 15 20 19 21 6 18 4 20 16 2 19 8 17 6 13 12 12 6 17 4 20 16 21 12 10 19 16 14 14 15 2 7 21 8 16 21 6 22 16 14 17 22 14 17 20 10 21 7 15 21 18 16 13 20 18 21 12 15 7 4 22 14 13 7 19 14 8 15 4 4 5 3 20 7 16 22 18 6 18 13 20 19 6 16 3 13 3 18 6 22 7 20 18 10 17 11 21 8 13 7 10 17 19 10 14 wherein: (A) each of 1 to 22 is a 4mer selected from the group of 4mers consisting of WWWW, WWWX, WWWY, WWXW, WWXX, WWXY, WWYW, WWYX, WWYY, WXWW, WXWX, WXWY, WXXW, WXXX, WXXY, WXYW, WXYX, WXYY, WYWW, WYWX, WYWY, WYXW, WYXX, WYXY, WYYW, WYYX, WYYY, XWWW, XWWX, XWWY, XWXW, XWXX, XWXY, XWYW, XWYX, XWYY, XXWW, XXWX, XXWY, XXXW, XXXX, XXXY, XXYW, XXYX, XXYY, XYWW, XYWX, XYWY, XYXW, XYXX, XYXY, XYYW, XYYX, XYYY, YWWW, YWWX, YWWY, YWXW, YWXX, YWXY, YWYW, YWYX, YWYY, YXWW, YXWX, YXWY, YXXW, YXXX, YXXY, YXYW, YXYX, YXYY, YYWW, YYWX, YYWY, YYXW, YYXX, YYXY, YYYW, YYYX, and YYYY, and (B) each of 1 to 22 is selected so as to be different from all of the others of 1 to 22; (C) each of W, X and Y is a base in which: (i) (a) W=one of A, T/U, G, and C, X=one of A, T/U, G, and C, Y=one of A, T/U, G, and C, and each of W, X and Y is selected so as to be different from all of the others of W, X and Y, (b) an unselected said base of (i)(a) can be substituted any number of times for any one of W, X and Y, or (ii) (a) W=G or C, X=A or T/U, Y=A or T/U, and X≠Y, and (b) a base not selected in (ii)(a) can be inserted into each sequence at one or more locations, the location of each insertion being the same in all the sequences; (D) up to three bases can be inserted at any location of any of the sequences or up to three bases can be deleted from any of the sequences; (E) all of the sequences of a said group of oligonucleotides are read 5′ to 3′ or are read 3′ to 5′; and wherein each oligonucleotide of a said set has a sequence of at least ten contiguous bases of the sequence on which it is based, provided that: (F) (I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.1 and 0.40 and said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.2; and (II) for any phantom sequence generated from any pair of first and second sequences of the set L1 and L2 in length, respectively, by selection from the first and second sequences of identical bases in identical sequence with each other: (i) any consecutive sequence of bases in the phantom sequence which is identical to a consecutive sequence of bases in each of the first and second sequences from which it is generated is less than ((¾×L)−1) bases in length; (ii) the phantom sequence, if greater than or equal to (⅚×L) in length, contains at least three insertions/deletions or mismatches when compared to the first and second sequences from which it is generated; and (iii) the phantom sequence is not greater than or equal to ({fraction (11/12)}×L) in length; where L=L1, or if L1≠L2, where L is the greater of L1 and L2; and wherein any base present may be substituted by an analogue thereof. 2. The composition of claim 1, wherein the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules, or at least one hundred and ten said molecules, or at least one hundred and twenty said molecules, or at least one hundred and thirty said molecules, or at least one hundred and forty said molecules, or at least one hundred and fifty said molecules, or at least one hundred and sixty said molecules, or at least one hundred and seventy said molecules, or at least one hundred and eighty said molecules, or at least one hundred and ninety said molecules, or at least two hundred said molecules. 3. The composition of claim 1, wherein said set of oligonucleotides is based on the sequences tested in Example 2, as set out in Table I. 4. The composition of claim 3, wherein the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules. 5. The composition of claim 1, wherein: (G) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. 6. The composition of claim 3, wherein: (G) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. 7. The composition of claim 5 wherein, in (G) under said defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. 8. The composition of claim 6 wherein, in (G) under said defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. 9. The composition of claim 7 wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 25%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 20%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 15%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 11%. 10. The composition of claim 8 wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 25%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 20%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 15%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 11%. 11. The composition of claim 7 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 12. The composition of claim 8 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 13. The composition of claim 9 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 14. The composition of claim 10 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 15. The composition of claim 5, wherein said defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. 16. The composition of claim 6, wherein said defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. 17. The composition of claim 15 wherein, in (G) said defined set of conditions includes the group of 24mer sequences of (G) being covalently linked to beads. 18. The composition of claim 16 wherein, in (G) said defined set of conditions includes the group of 24mer sequences of (G) being covalently linked to beads. 19. The composition of claim 17 or 18 wherein, in (G) for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement. 20. The composition of claim 1 or claim 3, wherein each of the 4mers represented by numerals 1 to 22 is selected from the group of 4mers consisting of WXXX, WXXY, WXYX, WXYY, WYXX, WYXY, WYYX, WYYY, XWXX, XWXY, XWYX, XWYY, XXWX, XXWY, XXXW, XXYW, XYWX, XYWY, XYXW, XYYW, YWXX, YWXY, YWYX, YWYY, YXWX, YXWY, YXXW, YXYW, YYWX, YYWY, YYXW, and YYYW. 21. The composition of claim 20, wherein each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, each of the 4mers represented by numeral 10 are identical to each other, each of the 4mers represented by numeral 11 are identical to each other, each of the 4mers represented by numeral 12 are identical to each other, each of the 4mers represented by numeral 13 are identical to each other, each of the 4mers represented by numeral 14 are identical to each other, each of the 4mers represented by numeral 15 are identical to each other, each of the 4mers represented by numeral 16 are identical to each other, each of the 4mers represented by numeral 17 are identical to each other, each of the 4mers represented by numeral 18 are identical to each other, each of the 4mers represented by numeral 19 are identical to each other, each of the 4mers represented by numeral 20 are identical to each other, each of the 4mers represented by numeral 21 are identical to each other, and each of the 4mers represented by numeral 22 are identical to each other. 22. The composition of claim 20, wherein at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, at least one of the 4mers represented by the numeral 10 has the sequence XYWX, at least one of the 4mers represented by the numeral 11 has the sequence YYXW, at least one of the 4mers represented by the numeral 12 has the sequence WYYX, at least one of the 4mers represented by the numeral 13 has the sequence XYXW, at least one of the 4mers represented by the numeral 14 has the sequence WYYY, at least one of the 4mers represented by the numeral 15 has the sequence WXYW, at least one of the 4mers represented by the numeral 16 has the sequence WYXW, at least one of the 4mers represented by the numeral 17 has the sequence WXXW, at least one of the 4mers represented by the numeral 18 has the sequence WYYW, at least one of the 4mers represented by the numeral 19 has the sequence XYYX, at least one of the 4mers represented by the numeral 20 has the sequence YXYX, at least one of the 4mers represented by the numeral 21 has the sequence YXXY, and at least one of the 4mers represented by the numeral 22 has the sequence XYXY. 23. The composition of claim 22, wherein in each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, each 14=WYYY, each 15=WXYW, each 16=WYXW, each 17=WXXW, each 18=WYYW, each 19=XYYX, each 20=YXYX, each 21=YXXY and each 22=XYXY. 24. The composition of claim 1, wherein a said group of sequences is based on the sequences having sequence identifiers 1 to 173 as set out in Table IA, and wherein each of the 4mers represented by numerals 1 to 14 in (A) is selected from the group of 4mers consisting of WXYY, YWXY, XXXW, YWYX, WYXY, YYWX, YWXX, WYXX, XYYW, XYWX, YYXW, WYYX, XYXW, and WYYY. 25. The composition of claim 24, wherein the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules, or at least one hundred and ten said molecules, or at least one hundred and twenty said molecules, or at least one hundred and thirty said molecules, or at least one hundred and forty said molecules, or at least one hundred and fifty said molecules, or at least one hundred and sixty said molecules, or at least one hundred and seventy said molecules, or at least one hundred and eighty said molecules, or at least one hundred and ninety said molecules, or at least two hundred said molecules. 26. The composition of claim 24, wherein: (G) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. 27. The composition of claim 26 wherein, in (G) under said defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. 28. The composition of claim 27 wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 25%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 20%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 15%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 11%. 29. The composition of claim 27 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 30. The composition of claim 26, wherein said defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. 31. The composition of claim 30 wherein, in (G) said defined set of conditions includes the group of 24mer sequences of (G) being covalently linked to beads. 32. The composition of claim 24, wherein each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, each of the 4mers represented by numeral 10 are identical to each other, each of the 4mers represented by numeral 11 are identical to each other, each of the 4mers represented by numeral 12 are identical to each other, each of the 4mers represented by numeral 13 are identical to each other, and each of the 4mers represented by numeral 14 are identical to each other. 33. The composition of claim 24, wherein at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, at least one of the 4mers represented by the numeral 10 has the sequence XYWX, at least one of the 4mers represented by the numeral 11 has the sequence YYXW, at least one of the 4mers represented by the numeral 12 has the sequence WYYX, at least one of the 4mers represented by the numeral 13 has the sequence XYXW, and at least one of the 4mers represented by the numeral 14 has the sequence WYYY. 34. The composition of claim 33, wherein each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, and each 14=WYYY. 35. The composition of claim 1, wherein a said group of sequences is based on those sequences having sequence identifiers 1 to 100 as set out in Table IA and wherein each of the 4mers represented by numerals 1 to 10 in (A) is selected from the group of 4mers consisting of WXYY, YWXY, XXXW, YWYX, WYXY, YYWX, YWXX, WYXX, XYYW, and XYWX. 36. The composition of claim 35, wherein the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules. 37. The composition of claim 35, wherein: (G) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. 38. The composition of claim 37 wherein, in (G) under said defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. 39. The composition of claim 38 wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 25%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 20%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 15%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence does not exceed 11%. 40. The composition of claim 38 or claim 39 wherein under said defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. 41. The composition of claim 37, wherein said defined set of conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. 42. The composition of claim 41 wherein, in (G) said defined set of conditions includes the group of 24mer sequences of (G) being covalently linked to beads. 43. The composition of claim 35, wherein each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, and each of the 4mers represented by numeral 10 are identical to each other. 44. The composition of claim 43, wherein at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, and at least one of the 4mers represented by the numeral 10 has the sequence XYWX. 45. The composition of claim 44, wherein each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8 WYXX, each 9=XYYW, and each 10=XYWX. 46. The composition of any of claims 1 or 3 wherein in (C)(i)(a): W=one of G and C; X=one of A and T/U; and Y=one of A and T/U. 47. The composition of claim 46, wherein in (C)(i)(a): W=G; X=one of A, and T/U; and Y=one of A and T/U. 48. The composition of claim 47, wherein W=G; X=A; and Y=T/U. 49. The composition of claims 1 or 3, wherein in (F)(I), said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.1. 50. The composition of claim 49, wherein in (F)(I), said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.05. 51. The composition of claim 50, wherein in (F)(I), said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.01. 52. The composition of claims 1 or 3, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.15 and 0.35. 53. The composition of claim 52, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.2 and 0.3. 54. The composition of claim 53, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.21 and 0.29. 55. The composition of claim 54, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.22 and 0.28. 56. The composition of claim 55, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.23 and 0.27. 57. The composition of claim 56, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.24 and 0.26. 58. The composition of claim 57, wherein in (F)(I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is 0.25. 59. The composition of claims 1 or 3, wherein in (D) up to two bases can be inserted at any location of any of the sequences or up to two bases can be deleted from any of the sequences. 60. The composition of claim 59, wherein in (D) one base can be inserted at any location of any of the sequences or one base can be deleted from any of the sequences. 61. The composition of claim 60, wherein in (D) no base can be inserted at any location of any of the sequences. 62. The composition of claim 60, wherein in (D) no base can be deleted from any of the sequences. 63. The composition of claim 60, wherein in (D) no base can be inserted at or deleted from any location of any of the sequences. 64. The composition of claims 1 or 3, wherein each of the oligonucleotides of a said set has a sequence at least eleven contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twelve contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least thirteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least fourteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least fifteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least sixteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least seventeen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least eighteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least nineteen contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twenty contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twenty-one contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twenty-two contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twenty-three contiguous bases of the sequence on which it is based; or wherein each of the oligonucleotides of a said set has a sequence at least twenty-four contiguous bases of the sequence on which it is based. 65. The composition of claims 1 or 3, wherein in each oligonucleotide of the set, there is a maximum of six bases other than G between every neighboring pair of G's. 66. The composition according to claim 65, wherein each initial G of an oligonucleotide of the set sequence occupies a position in the terminal selected from a first, second, third, fourth, fifth, sixth or seventh position thereof. 67. The composition of claims 1 or 3, wherein the contiguous bases of each oligonucleotide of a said set are selected such that the position of the first base of each said oligonucleotide within the sequence on which it is based is the same for all nucleotides of the set. 68. The composition of claims 1 or 3, wherein each of the oligonucleotides of a said set is up to thirty bases in length; or each of the oligonucleotides of a said set is up to twenty-nine bases in length; or each of the oligonucleotides of a said set is up to twenty-eight bases in length; or each of the oligonucleotides of a said set is up to twenty-seven bases in length; or each of the oligonucleotides of a said set is up to twenty-six bases in length; or each of the oligonucleotides of a said set is up to twenty-five bases in length; or each of the oligonucleotides of a said set is up to twenty-four bases in length. 69. The composition of claims 1 or 3, wherein each of the oligonucleotides of a said set has a length of within five bases of the average length of all of the oligonucleotides in the set; or each of the oligonucleotides of a said set has a length of within four bases of the average length of all of the oligonucleotides in the set; or each of the oligonucleotides of a said set has a length of within three bases of the average length of all of the oligonucleotides in the set; or each of the oligonucleotides of a said set has a length of within two bases of the average length of all of the oligonucleotides in the set; or each of the oligonucleotides of a said set has a length of within one base of the average length of all of the oligonucleotides in the set. 70. The composition of claims 1 or 3, wherein in (II)(i), any consecutive sequence of bases in the phantom sequence which is identical to a consecutive sequence of bases in each of the first and second sequences from which it is generated is no more ((⅔×L)−1) bases in length. 71. The composition of claims 1 or 3, wherein in (II)(ii), the phantom sequence, if greater than or equal to (¾×L) in length, contains at least 3 insertions/deletions or mismatches when compared to the first and second sequences from which it is generated. 72. The composition of claim 71, wherein in (II)(ii), the phantom sequence, if greater than or equal to (⅔×L) in length, contains at least 3 insertions/deletions or mismatches when compared to the first and second sequences from which it is generated. 73. The composition of claims 1 or 3, wherein in (II)(iii), the phantom sequence is not greater than or equal to (⅚×L) in length. 74. The composition of claim 73, wherein in (II)(iii), the phantom sequence is not greater than or equal to (¾×L) in length. 75. A composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a following group of sequences having the one hundred sequence identifiers of the sequences tested in Example 2 as set out in Table I, wherein: (A) wherein 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, each 14=WYYY, each 15=WXYW, each 16=WYXW, each 17=WXXW, each 18=WYYW, each 19=XYYX, each 20=YXYX, each 21=YXXY and each 22=XYXY; (B) each of W, X and Y is a base in which either: (i) (a) W=one of A, T/U, G, and C, X=one of A, T/U, G, and C, Y=one of A, T/U, G, and C, and each of W, X and Y is selected so as to be different from all of the others of W, X and Y, (b) an unselected said base of (i)(a) can be substituted any number of times for any one of W, X and Y, or (ii) (a) W=G or C, X=A or T/U, Y=A or T/U, and X # Y, and (b) a base not selected in (ii)(a) can be inserted into each sequence at one or more locations, the location of each insertion being the same in all the sequences; (C) up to three bases can be inserted at any location of any of the sequences or up to three bases can be deleted from any of the sequences; (D) all of the sequences of a said group of oligonucleotides are read 5′ to 3′ or are read 3′ to 5′; and wherein each oligonucleotide of a said set has a sequence of at least ten contiguous bases of the sequence on which it is based, provided that: (E) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.1 and 0.40 and said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.2; and (F) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement; wherein any base present may be substituted by an analogue thereof. 76. The composition of claim 75 wherein the contiguous bases of each oligonucleotide of a said set are selected such that the position of the first base of each said oligonucleotide within the sequence on which it is based is the same for all nucleotides of the set. 77. The composition of claim 75 wherein, subject to the provisos of (E) and (F), each oligonucleotide of a said set comprises a said sequence of twenty-four contiguous bases of the sequence on which it is based. 78. The composition of claim 75 wherein, subject to the proviso of (F) each oligonucleotide of a said set comprises a said sequence of twenty-four contiguous bases of the sequence on which it is based. 79. The composition of claim 75, wherein in (B): W=one of G and C; X=one of A and T/U; and Y=one of A and T/U. 80. The composition of claim 79, wherein in (B): W=G; X=one of A, and T/U; and Y=one of A and T/U. 81. The composition of claim 75, wherein the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules. 82. A composition of claims 1, 3, or 75, wherein each molecule is linked to a solid phase support so as to be distinguishable from a mixture of said molecules by hybridization to its complement. 83. The composition of claim 82, wherein each molecule is linked to a defined location on a said solid phase support, the defined location for each said molecule being different than the defined location for different other said molecules. 84. The composition of claim 82, wherein each said solid phase support is a microparticle and each said molecule is covalently to a different microparticle than each other different said molecule. 85. A composition according to any of claims 1, 3, or 75, wherein each said molecule comprises a tag complement. 86. A kit for sorting and identifying polynucleotides, the kit comprising one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached, and the tag complements each being selected from the set of oligonucleotides as defined in any of claims 1 to 85. 87. A kit according to claim 86, wherein there is a tag complement for each said oligonucleotide of a said composition. 88. A kit according to claim 86 wherein said one or more solid phase supports is a planar substrate and wherein said one or more spatially discrete regions is a plurality of spatially addressable regions. 89. A kit according to claim 86 wherein said one or more solid phase supports is a plurality of microparticles. 90. A kit according to claim 89 wherein said microparticles each have a diameter in the range of from 5 to 40 μm. 91. A kit according to claim 89 or 90, wherein each microparticle is spectrophotometrically unique from each other microparticle having a different oligonucleotide attached thereto. 92. A method of analyzing a biological sample comprising a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid, the method comprising: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 85 to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, with the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid. 93. A method of analyzing a biological sample comprising a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 85 to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid; wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. 94. A method of analyzing a biological sample comprising a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (A) Amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 85 to form amplified molecules with 5′-ends with a sequence complementary to the sequence of the tag; (B) Extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5′-end complementary a 3′-end of the amplified sequence, the 3′-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other; (C) Specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and (D) Detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus; wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. 95. A method of analyzing a biological sample comprising a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method comprising: (a) hybridizing the molecule and a primer, the primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements as defined in claim 85 and a 3′-end extending to immediately adjacent the locus; (b) enzymatically extending the 3′-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3′-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus; (c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and (d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule; wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other. 96. The method of claim 93 wherein each said derivative is a dideoxy nucleoside triphosphate. 97. The method of claim 95, wherein each respective complement is attached as a uniform population of substantially identical complements in a spacially discrete region on one or more said solid phase supports. 98. The method of claim 97, each said tag complement comprises a label, each such label being different for respective complements, and step (d) includes detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements. 99. The hybridized molecule and primer of step (A) of claim 95. 100. A method of determining the presence of a target suspected of being contained in a mixture, the method comprising the steps of: (i) labelling the target with a first label; (ii) providing a first detection moiety capable of specific binding to the target and including a first tag; (iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target; (iv) providing a family of tag complements as defined in claim 85 wherein the family contains a first tag complement having a sequence complementary to that of the first tag; (v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement; (vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence said target in the mixture. 101. The method of claim 100 wherein said first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence the first label at said specified location. 102. The method of claim 100 wherein said first tag complement comprises a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement. 103. The method of claim 100 wherein said target is selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. 104. The method of claim 103, wherein said target is an antigen and said first molecule is an antibody specific for said antigen. 105. The method of claim 104, wherein the antigen is a polypeptide or protein and the labelling step includes conjugation of fluorescent molecules, digoxigenin, biotinylation and the like. 106. The method of claim 105, wherein said target is a nucleic acid and the labelling step includes incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like. 107. A set of molecules consisting essentially of two or more of the following-listed sequences for use as tags or tag complements: GATTTGTATTGATTGAGATTAAAG (SEQ ID NO: 1) TGATTGTAGTATGTATTGATAAAG (SEQ ID NO: 2) GATTGTAAGATTTGATAAAGTGTA (SEQ ID NO: 3) GATTTGAAGATTATTGGTAATGTA (SEQ ID NO: 4) GATTGATTATTGTGATTTGAATTG (SEQ ID NO: 5) GATTTGATTGTAAAAGATTGTTGA (SEQ ID NO: 6) ATTGGTAAATTGGTAAATGAATTG (SEQ ID NO: 7) ATTGGATTTGATAAAGGTAAATGA (SEQ ID NO: 8) GTAAGTAATGAATGTAAAAGGATT (SEQ ID NO: 9) GATTGATTGATTGATTGATTTGAT (SEQ ID NO: 10) TGATGATTAAAGAAAGTGATTGAT (SEQ ID NO: 11) AAAGGATTTGATTGATAAAGTGAT (SEQ ID NO: 12) TGTAGATTTGTATGTATGTATGAT (SEQ ID NO: 13) GATTTGATAAAGAAAGGATTGATT (SEQ ID NO: 14) GATTAAAGTGATTGATGATTTGTA (SEQ ID NO: 15) AAAGAAAGAAAGAAAGAAAGTGTA (SEQ ID NO: 16) TGTAAAAGGATTGATTTGTATGTA (SEQ ID NO: 17) AAAGTGTAGATTGATTAAAGAAAG (SEQ ID NO: 18) AAAGTTGATTGATTGAAAAGGTAT (SEQ ID NO: 19) TTGATTGAGATTGATTTTGAGTAT (SEQ ID NO: 20) TGAATTGATGAATGAATGAAGTAT (SEQ ID NO: 21) GTAATGAAGTATGTATGTAAGTAA (SEQ ID NO: 22) TGATGATTTGAATGAAGATTGATT (SEQ ID NO: 23) TGATAAAGTGATAAAGGATTAAAG (SEQ ID NO: 24) TGATTTGAGTATTTGAGATTTTGA (SEQ ID NO: 25) TGTAGTAAGATTGATTAAAGGTAA (SEQ ID NO: 26) GTATAAAGGATTGATTTTGAAAAG (SEQ ID NO: 27) GTATTTGAGTAAGTAATTGATTGA (SEQ ID NO: 28) GTAAAAAGTTGAGTATTGAAAAAG (SEQ ID NO: 29) GATTTGATAAAGGATTTGTATTGA (SEQ ID NO: 30) GATTGTATTGAAGTATTGTAAAAG (SEQ ID NO: 31) TGATGATTTTGATGAAAAAGTTGA (SEQ ID NO: 32) TGATTTGAGATTAAAGAAAGGATT (SEQ ID NO: 33) TGATTGAATTGAGTAAAAAGGATT (SEQ ID NO: 34) AAAGTGTAAAAGGATTTGATGTAT (SEQ ID NO: 35) AAAGGTATTTGAGATTTGATTGAA (SEQ ID NO: 36) AAAGTTGAGATTTGAATGATTGAA (SEQ ID NO: 37) TGTATTGAAAAGGTATGATTTGAA (SEQ ID NO: 38) GTATTGTATTGAAAAGGTAATTGA (SEQ ID NO: 39) TTGAGTAATGATAAAGTGAAGATT (SEQ ID NO: 40) TGAAGATTTGAAGTAATTGAAAAG (SEQ ID NO: 41) TGAAAAAGTGTAGATTTTGAGTAA (SEQ ID NO: 42) TGTATGAATGAAGATTTGATTGTA (SEQ ID NO: 43) AAAGTTGAGTATTGATTTGAAAAG (SEQ ID NO: 44) GATTTGTAGATTTGTATTGAGATT (SEQ ID NO: 45) AAAGAAAGGATTTGTAGTAAGATT (SEQ ID NO: 46) GTAAAAAGAAAGGTATAAAGGTAA (SEQ ID NO: 47) GATTAAAGTTGATTGAAAAGTGAA (SEQ ID NO: 48) TGAAAAAGGTAATTGATGTATGAA (SEQ ID NO: 49) AAAGGATTAAAGTGAAGTAATTGA (SEQ ID NO: 50) ATGAATTGGTATGTATATGAATGA (SEQ ID NO: 51) TGAAATGAATGAATGATGAAATTG (SEQ ID NO: 52) ATTGATTGTGAATGAAATGAATTG (SEQ ID NO: 53) ATTGAAAGATGAAAAGATGAAAAG (SEQ ID NO: 54) ATTGTTGAAAAGTGTAATGATTGA (SEQ ID NO: 55) ATGATGTAATGAAAAGATTGTGTA (SEQ ID NO: 56) AAAGATTGAAAGATGATGTAATTG (SEQ ID NO: 57) ATTGATGAGTATATTGTGTAGTAA (SEQ ID NO: 58) AAAGATFFGTGTAATTGATGATGAA (SEQ ID NO: 59) AAAGGTATATTGTGTAATGAGTAA (SEQ ID NO: 60) TGTAATGAGTATTGTAATTGAAAG (SEQ ID NO: 61) GTATAAAGAAAGATTGGTAAATGA (SEQ ID NO: 62) TTGAGTAATTGAATTGTGAAATGA (SEQ ID NO: 63) TGTATTGAATGAATTGTTGATGTA (SEQ ID NO: 64) TGTAATTGGTAAATGAGTAAAAAG (SEQ ID NO: 65) TGAATGAAATTGATGAGTATAAAG (SEQ ID NO: 66) GTAAGTAAATTGAAAGATTGATGA (SEQ ID NO: 67) GTAAATGATGATATTGGTATATTG (SEQ ID NO: 68) ATTGTTGATGATTGATTGAAATGA (SEQ ID NO: 69) ATTGTGAAGTATAAAGATGATTGA (SEQ ID NO: 70) ATGAAAAGTTGAGTAAATTGTGAT (SEQ ID NO: 71) ATGAATTGAAAGTGATTGAAAAAG (SEQ ID NO: 72) GTAAATTGATGAAAAGTTGATGAT (SEQ ID NO: 73) AAAGTGATGTATATGAGTAAATTG (SEQ ID NO: 74) GTAATGATAAAGATGATGATATTG (SEQ ID NO: 75) TTGAAAAGATTGGTAATGATATGA (SEQ ID NO: 76) AAAGTGAAAAAGATTGATTGATGA (SEQ ID NO: 77) ATTGATGAGATTGATTATTGTGTA (SEQ ID NO: 78) ATGAGATTATTGGATTTGTAGATT (SEQ ID NO: 79) TGAAGATTATGAATTGGTAAGATT (SEQ ID NO: 80) ATTGGATTATGAGATTATGATTGA (SEQ ID NO: 81) ATTGTTGAATTGGATTAAAGATGA (SEQ ID NO: 82) AAAGATGAGTAAGTAAATTGGATT (SEQ ID NO: 83) AAAGGTAAGATTATTGATGAAAAG (SEQ ID NO: 84) ATTGATGAGATTAAAGTTGAATTG (SEQ ID NO: 85) GATTATTGGATTATGAAAAGGATT (SEQ ID NO: 86) GATTTGTAATTGTTGAGTAAATGA (SEQ ID NO: 87) AAAGAAAGATTGTTGAGATTATGA (SEQ ID NO: 88) GTATAAAGGATTTTGAATTGATGA (SEQ ID NO: 89) TTGAGATTGTAAATGAATTGTTGA (SEQ ID NO: 90) GTATATTGATTGTGTAATGAAAAG (SEQ ID NO: 91) TGATATGAATTGGATTATTGGTAT (SEQ ID NO: 92) ATGAATGATGAATGATGATTATTG (SEQ ID NO: 93) ATGAATTGATTGGATTGTAATGAT (SEQ ID NO: 94) GATTGTAATTGAGTAAATTGATGA (SEQ ID NO: 95) GATTATTGGATTAAAGGTAAATGA (SEQ ID NO: 96) ATTGTTGAATTGATGAGATTTGAT (SEQ ID NO: 97) GATTATGAGTAAATTGATTGTGAT (SEQ ID NO: 98) GATTATTGTTGATGAATGATATTG (SEQ ID NO: 99) TGTAAAAGATTGAAAGGTATGATT (SEQ ID NO: 100) 108. The set of molecules of claim 107, wherein the set includes at least ten said sequences, or at least eleven said sequences, or at least twelve said sequences, or at least thirteen said sequences, or at least fourteen said sequences, or at least fifteen said sequences, or at least sixteen said sequences, or at least seventeen said sequences, or at least eighteen said sequences, or at least nineteen said sequences, or at least twenty said sequences, or at least twenty-one said sequences, or at least twenty-two said sequences, or at least twenty-three said sequences, or at least twenty-four said sequences, or at least twenty-five said sequences, or at least twenty-six said sequences, or at least twenty-seven said sequences, or at least twenty-eight said sequences, or at least twenty-nine said sequences, or at least thirty said sequences, or at least thirty-one said sequences, or at least thirty-two said sequences, or at least thirty-three said sequences, or at least thirty-four said sequences, or at least thirty-five said sequences, or at least thirty-six said sequences, or at least thirty-seven said sequences, or at least thirty-eight said sequences, or at least thirty-nine said sequences, or at least forty said sequences, or at least forty-one said sequences, or at least forty-two said sequences, or at least forty-three said sequences, or at least forty-four said sequences, or at least forty-five said sequences, or at least forty-six said sequences, or at least forty-seven said sequences, or at least forty-eight said sequences, or at least forty-nine said sequences, or at least fifty said sequences, or at least sixty said sequences, or at least seventy said sequences, or at least eighty said sequences, or at least ninety said sequences, or the one hundred said sequences. 109. The set of claim 107 wherein, under a defined set of conditions in which the maximum degree of hybridization between a molecule having a first said sequence and a molecule having any complement of a different second said sequence does not exceed 30% of the degree of hybridization between a molecule having the first sequence and a molecule having its complement, for all molecules of the set, the maximum degree of hybridization between a molecule and a complement of any other molecule of the set does not exceed 50% of the degree of hybridization of the molecule and its complement. 110. The set of claim 109 wherein, under said defined set of conditions, the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. 111. The set of claim 110 wherein said maximum degree of hybridization between a said molecule having a first said sequence and a said molecule having any complement of a different second said sequence does not exceed 25%, more preferably 20%, more preferably 15%, more preferably 11%. 112. The composition of claim 110 wherein under said defined set of conditions, the maximum degree of hybridization between a molecule and a complement of any other molecule of the set is no more than 15% greater than the maximum degree of hybridization between a molecule and any complement of a molecule of the set, more preferably no more than 10% greater, more preferably no more than 5% greater. 113. The composition of claim 109, wherein said defined set of conditions results in a degree of hybridization that is the same as the degree of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Specific hybridization of oligonucleotides and their analogs is a fundamental process that is employed in a wide variety of research, medical, and industrial applications, including the identification of disease-related polynucleotides in diagnostic assays, screening for clones of novel target polynucleotides, identification of specific polynucleotides in blots of mixtures of polynucleotides, therapeutic blocking of inappropriately expressed genes and DNA sequencing. Sequence specific hybridization is critical in the development of high throughput multiplexed nucleic acid assays. As formats for these assays expand to encompass larger amounts of sequence information acquired through projects such as the Human Genome project, the challenge of sequence specific hybridization with high fidelity is becoming increasingly difficult to achieve. In large part, the success of hybridization using oligonucleotides depends on minimizing the number of false positives and false negatives. Such problems have made the simultaneous use of multiple hybridization probes in a single experiment i.e. multiplexing, particularly in the analysis of multiple gene sequences on a gene microarray, very difficult. For example, in certain binding assays, a number of nucleic acid molecules are bound to a chip with the desire that a given “target” sequence will bind selectively to its complement attached to the chip. Approaches have been developed that involve the use of oligonucleotide tags attached to a solid support that can be used to specifically hybridize to the tag complements that are coupled to probe sequences. Chetverin et al. (WO 93/17126) uses sectioned, binary oligonucleotide arrays to sort and survey nucleic acids. These arrays have a constant nucleotide sequence attached to an adjacent variable nucleotide sequence, both bound to a solid support by a covalent linking moiety. These binary arrays have advantages compared with ordinary arrays in that they can be used to sort strands according to their terminal sequences so that each strand binds to a fixed location on an array. The design of the terminal sequences in this approach comprises the use of constant and variable sequences. U.S. Pat. Nos. 6,103,463 and 6,322,971 issued to Chetverin et al. on Aug. 15, 2000 and Nov. 27, 2001, respectively. This concept of using molecular tags to sort a mixture of molecules is analogous to molecular tags developed for bacterial and yeast genetics (Hensel et al., Science; 269, 400-403: 1995 and Schoemaker et al., Nature Genetics; 14, 450-456: 1996). Here, a method termed “signature tagged” mutagenesis in which each mutant is tagged with a different DNA sequence is used to recover mutant genes from a complex mixture of approximately 10,000 bacterial colonies. In the tagging approach of Barany et al. (WO 9731256), known as the “zip chip”, a family of nucleic acid molecules, the “zip-code addresses”, each different from each other, are set out on a grid. Target molecules are attached to oligonucleotide sequences complementary to the “zipcode addresses,” referred to as “zipcodes,” which are used to specifically hybridize to the address locations on the grid. While the selection of these families of polynucleotide sequences used as addresses is critical for correct performance of the assay, the performance has not been described. Working in a highly parallel hybridization environment requiring specific hybridization imposes very rigorous selection criteria for the design of families of oligonucleotides that are to be used. The success of these approaches is dependent on the specific hybridization of a probe and its complement. Problems arise as the family of nucleic acid molecules cross-hybridize or hybridize incorrectly to the target sequences. While it is common to obtain incorrect hybridization resulting in false positives or an inability to form hybrids resulting in false negatives, the frequency of such results must be minimized. In order to achieve this goal certain thermodynamic properties of forming nucleic acid hybrids must be considered. The temperature at which oligonucleotides form duplexes with their complementary sequences known as the T m (the temperature at which 50% of the nucleic acid duplex is dissociated) varies according to a number of sequence dependent properties including the hydrogen bonding energies of the canonical pairs A-T and G-C (reflected in GC or base composition), stacking free energy and, to a lesser extent, nearest neighbour interactions. These energies vary widely among oligonucleotides that are typically used in hybridization assays. For example, hybridization of two probe sequences composed of 24 nucleotides, one with a 40% GC content and the other with a 60% GC content, with its complementary target under standard conditions theoretically may have a 10° C. difference in melting temperature (Mueller et al., Current Protocols in Mol. Biol.; 15, 5:1993). Problems in hybridization occur when the hybrids are allowed to form under hybridization conditions that include a single hybridization temperature that is not optimal for correct hybridization of all oligonucleotide sequences of a set. Mismatch hybridization of non-complementary probes can occur forming duplexes with measurable mismatch stability (Santalucia et al., Biochemistry; 38: 3468-77, 1999). Mismatching of duplexes in a particular set of oligonucleotides can occur under hybridization conditions where the mismatch results in a decrease in duplex stability that results in a higher T m than the least stable correct duplex of that particular set. For example, if hybridization is carried out under conditions that favor the AT-rich perfect match duplex sequence, the possibility exists for hybridizing a GC-rich duplex sequence that contains a mismatched base having a melting temperature that is still above the correctly formed AT-rich duplex. Therefore design of families of oligonucleotide sequences that can be used in multiplexed hybridization reactions must include consideration for the thermodynamic properties of oligonucleotides and duplex formation that will reduce or eliminate cross hybridization behavior within the designed oligonucleotide set. A multiplex sequencing method has been described in U.S. Pat. No. 4,942,124, which issued to Church on Jul. 17, 1990. The method requires at least two vectors which differ from each other at a tag sequence. It is stated in the specification that a tag sequence in one vector will not hybridize under stringent hybridization conditions to a tag sequence in another vector, i.e. a complementary probe of a tag in one vector does not cross-hybridize with a tag sequence in another vector. Exemplary stringent hybridization conditions are given as 42° C. in 500-1000 mM sodium phosphate buffer. A set of 42 20-mer tag sequences, all of which lack G residues, is given in FIG. 3 of Church's specification. Details of how the sequences were obtained are not provided, although Church states that initially 92 were chosen on the basis of their having sufficient sequence diversity to insure uniqueness. There have been other attempts at the development of families of tags. There are a number of different approaches for selecting sequences for use in multiplexed hybridization assays. The selection of sequences that can be used as zipcodes or tags in an addressable array has been described in the patent literature in an approach taken by Brenner and co-workers. U.S. Pat. No. 5,654,413 describes a population of oligonucleotide tags (and corresponding tag complements) in which each oligonucleotide tag includes a plurality of subunits, each subunit consisting of an oligonucleotide having a length of from three to six nucleotides and each subunit being selected from a minimally cross hybridizing set, wherein a subunit of the set would have at least two mismatches with any other sequence of the set. Table II of the Brenner patent specification describes exemplary groups of 4mer subunits that are minimally cross hybridizing according to the aforementioned criteria. In the approach taken by Brenner, constructing non cross-hybridizing oligonucleotides, relies on the use of subunits that form a duplex having at least two mismatches with the complement of any other subunit of the same set. The ordering of subunits in the construction of oligonucleotide tags is not specifically defined. Parameters used in the design of tags based on subunits are discussed in Barany et al. (WO 9731256). For example, in the design of polynucleotide sequences that are for example 24 nucleotides in length (24mer) derived from a set of four possible tetramers in which each 24mer “address” differs from its nearest 24mer neighbour by 3 tetramers. They discuss further that, if each tetramer differs from each other by at least two nucleotides, then each 24mer will differ from the next by at least six nucleotides. This is determined without consideration for insertions or deletions when forming the alignment between any two sequences of the set. In this way a unique “zip code” sequence is generated. The zip code is ligated to a label in a target dependent manner, resulting in a unique “zip code” which is then allowed to hybridize to its address on the chip. To minimize cross-hybridization of a “zip code” to other “addresses”, the hybridization reaction is carried out at temperatures of 75-80° C. Due to the high temperature conditions for hybridization, 24mers that have partial homology hybridize to a lesser extent than sequences with perfect complementarity and represent ‘dead zones’. This approach of implementing stringent hybridization conditions for example, involving high temperature hybridization, is also practiced by Brenner et. al. The current state of technology for designing non-cross hybridizing tags based on subunits does not provide sufficient guidance to construct a family of sequences with practical value in assays that require stringent non-cross hybridizing behavior. Thus, while it is desirable with such arrays to have, at once, a large number of address molecules, the address molecules should each be highly selective for its own complement sequence. While such an array provides the advantage that the family of molecules making up the grid is entirely of design, and does not rely on sequences as they occur in nature, the provision of a family of molecules, which is sufficiently large and where each individual member is sufficiently selective for its complement over all the other zipcode molecules (i.e., where there is sufficiently low cross-hybridization, or cross-talk) continues to elude researchers. |
<SOH> SUMMARY OF INVENTION <EOH>Using the method of Benight et al. (described in commonly-owned international patent application No. PCT/CA 01/00141 published under WO 01/59151 on Aug. 16, 2001) a family of 100 nucleotide sequences was obtained using a computer algorithm to have optimal hybridization properties for use in nucleic acid detection assays. The sequence set of 100 oligonucleotides was characterized in hybridization assays, demonstrating the ability of family members to correctly hybridize to their complementary sequences with an absence of cross hybridization. These are the sequences having SEQ ID NOs:1 to 100 of Table I. This set of sequences has been expanded to include an additional 110 sequences that can be grouped with the original 100 sequences as having non-cross hybridizing properties, based on the characteristics of the original set of 100 sequences. These additional sequences are identified as SEQ ID NOs:101 to 210 of the sequences in Table I. How these sequences were obtained is described below. Variant families of sequences (seen as tags or tag complements) of a family of sequences taken from Table I are also part of the invention. For the purposes of discussion, families of tag complements will be described. A family of complements is obtained from a set of oligonucleotides based on a family of oligonucleotides such as those of Table I. For illustrative purposes, providing a family of complements based on the oligonucleotides of Table I will be described. Firstly, sequences based on the oligonucleotides of Table I can be represented as follows: TABLE IA Numeric sequences corresponding to word patterns of a set of oligonucleotides Sequence Identifier Numeric Pattern 1 1 4 6 6 1 3 2 2 4 5 5 2 3 3 1 8 1 2 3 4 4 1 7 1 9 8 4 5 1 1 9 2 6 9 6 1 2 4 3 9 6 7 9 8 9 8 10 9 8 9 1 2 3 8 10 9 8 8 7 4 3 1 10 1 1 1 1 1 2 11 2 1 3 3 2 2 12 3 1 2 2 3 2 13 4 1 4 4 4 2 14 1 2 3 3 1 1 15 1 3 2 2 1 4 16 3 3 3 3 3 4 17 4 3 1 1 4 4 18 3 4 1 1 3 3 19 3 6 6 6 3 5 20 6 6 1 1 6 5 21 7 6 7 7 7 5 22 8 7 5 5 8 8 23 2 1 7 7 1 1 24 2 3 2 3 1 3 25 2 6 5 6 1 6 26 4 8 1 1 3 8 27 5 3 1 1 6 3 28 5 6 8 8 6 6 29 8 3 6 5 7 3 30 1 2 3 1 4 6 31 1 5 7 5 4 3 32 2 1 6 7 3 6 33 2 6 1 3 3 1 34 2 7 6 8 3 1 35 3 4 3 1 2 5 36 3 5 6 1 2 7 37 3 6 1 7 2 7 38 4 6 3 5 1 7 39 5 4 6 3 8 6 40 6 8 2 3 7 1 41 7 1 7 8 6 3 42 7 3 4 1 6 8 43 4 7 7 1 2 4 44 3 6 5 2 6 3 45 1 4 1 4 6 1 46 3 3 1 4 8 1 47 8 3 3 5 3 8 48 1 3 6 6 3 7 49 7 3 8 6 4 7 50 3 1 3 7 8 6 51 10 9 5 5 10 10 52 7 10 10 10 7 9 53 9 9 7 7 10 9 54 9 3 10 3 10 3 55 9 6 3 4 10 6 56 10 4 10 3 9 4 57 3 9 3 10 4 9 58 9 10 5 9 4 8 59 3 9 4 9 10 7 60 3 5 9 4 10 8 61 4 10 5 4 9 3 62 5 3 3 9 8 10 63 6 8 6 9 7 10 64 4 6 10 9 6 4 65 4 9 8 10 8 3 66 7 7 9 10 5 3 67 8 8 9 3 9 10 68 8 10 2 9 5 9 69 9 6 2 2 7 10 70 9 7 5 3 10 6 71 10 3 6 8 9 2 72 10 9 3 2 7 3 73 8 9 10 3 6 2 74 3 2 5 10 8 9 75 8 2 3 10 2 9 76 6 3 9 8 2 10 77 3 7 3 9 9 10 78 9 10 1 1 9 4 79 10 1 9 1 4 1 80 7 1 10 9 8 1 81 9 1 10 1 10 6 82 9 6 9 1 3 10 83 3 10 8 8 9 1 84 3 8 1 9 10 3 85 9 10 1 3 6 9 86 1 9 1 10 3 1 87 1 4 9 6 8 10 88 3 3 9 6 1 10 89 5 3 1 6 9 10 90 6 1 8 10 9 6 91 5 9 9 4 10 3 92 2 10 9 1 9 5 93 10 10 7 2 1 9 94 10 9 9 1 8 2 95 1 8 6 8 9 10 96 1 9 1 3 8 10 97 9 6 9 10 1 2 98 1 10 8 9 9 2 99 1 9 6 7 2 9 100 4 3 9 3 5 1 101 5 11 10 14 12 1 102 7 12 4 13 3 2 103 5 5 4 4 12 9 104 2 13 13 11 13 13 105 10 2 5 4 12 7 106 11 7 4 11 6 4 107 12 12 1 9 11 11 108 12 9 4 14 12 6 109 12 7 13 2 9 11 110 9 11 3 4 1 3 111 10 5 12 11 4 4 112 4 13 7 12 1 5 113 9 13 10 11 11 6 114 10 14 14 10 1 3 115 2 14 1 10 4 5 116 10 12 12 7 11 10 117 9 11 2 12 8 11 118 2 8 5 2 12 14 119 1 8 13 3 7 8 120 9 4 7 5 4 2 121 13 2 12 7 1 12 122 11 10 9 7 5 11 123 8 12 2 2 12 7 124 5 2 14 3 4 13 125 1 8 8 1 5 9 126 14 5 11 10 13 3 127 14 1 4 13 2 4 128 4 4 5 11 3 10 129 10 9 2 3 3 11 130 11 4 8 14 3 4 131 5 1 14 8 11 2 132 14 3 11 6 12 5 133 13 4 4 1 10 1 134 6 10 11 6 5 1 135 5 8 12 5 1 7 136 4 5 9 6 9 2 137 13 2 4 4 2 3 138 11 2 2 5 9 3 139 8 1 10 12 2 8 140 12 7 9 11 4 1 141 12 1 4 14 3 13 142 11 2 7 10 4 1 143 3 4 12 11 11 11 144 3 3 4 2 12 11 145 1 5 9 4 2 1 146 6 1 12 2 10 5 147 10 5 1 12 2 14 148 2 11 7 9 4 11 149 7 4 4 5 14 12 150 12 5 2 1 10 12 151 5 9 2 11 6 1 152 12 14 3 6 1 14 153 5 9 11 10 1 4 154 2 5 12 14 10 10 155 4 5 8 4 5 6 156 10 12 4 6 12 5 157 4 2 1 13 6 8 158 9 10 10 14 5 3 159 6 14 10 11 3 3 160 2 9 10 12 5 7 161 13 3 7 10 5 12 162 6 4 1 2 5 13 163 6 1 13 4 14 13 164 2 12 1 14 1 9 165 4 11 13 2 6 10 166 1 10 7 4 5 8 167 7 2 2 10 13 4 168 8 2 11 4 6 14 169 4 8 2 6 2 3 170 7 1 12 11 2 9 171 5 6 10 4 13 4 172 5 10 4 11 9 3 173 3 11 9 3 2 3 174 8 15 6 20 17 19 175 21 10 15 3 7 11 176 11 7 17 20 14 9 177 16 6 17 13 21 21 178 10 15 22 6 17 21 179 15 7 17 10 22 22 180 3 20 8 15 20 16 181 17 21 10 16 6 22 182 6 21 14 14 14 16 183 7 17 3 20 10 7 184 16 19 14 17 7 21 185 20 16 7 15 22 10 186 20 10 18 11 22 18 187 18 7 19 15 7 22 188 21 18 7 21 16 3 189 14 13 7 22 17 13 190 19 7 8 12 10 17 191 15 3 21 14 9 7 192 19 6 15 7 14 14 193 4 17 10 15 20 19 194 21 6 18 4 20 16 195 2 19 8 17 6 13 196 12 12 6 17 4 20 197 16 21 12 10 19 16 198 14 14 15 2 7 21 199 8 16 21 6 22 16 200 14 17 22 14 17 20 201 10 21 7 15 21 18 202 16 13 20 18 21 12 203 15 7 4 22 14 13 204 7 19 14 8 15 4 205 4 5 3 20 7 16 206 22 18 6 18 13 20 207 19 6 16 3 13 3 208 18 6 22 7 20 18 209 10 17 11 21 8 13 210 7 10 17 19 10 14 Here, each of the numerals 1 to 22 (numeric identifiers) represent a 4mer and the pattern of numerals 1 to 22 of the sequences in the above list corresponds to the pattern of tetrameric oligonucleotide segments present in the oligonucleotides of Table I, which oligonucleotides have been found to be non-cross-hybridizing, as described further in the detailed examples. Each 4mer is selected from the group of 4mers consisting of WWWW, WWWX, WWWY, WWXW, WWXX, WWXY, WWYW, WWYX, WWYY, WXWW, WXWX, WXWY, WXXW, WXXX, WXXY, WXYW, WXYX, WXYY, WYWW, WYWX, WYWY, WYXW, WYXX, WYXY, WYYW, WYYX, WYYY, XWWW, XWWX, XWWY, XWXW, XWXX, XWXY, XWYW, XWYX, XWYY, XXWW, XXWX, XXWY, XXXW, XXXX, XXXY, XXYW, XXYX, XXYY, XYWW, XYWX, XYWY, XYXW, XYXX, XYXY, XYYW, XYYX, XYYY, YWWW, YWWX, YWWY, YWXW, YWXX, YWXY, YWYW, YWYX, YWYY, YXWW, YXWX, YXWY, YXXW, YXXX, YXXY, YXYW, YXYX, YXYY, YYWW, YYWX, YYWY, YYXW, YYXX, YYXY, YYYW, YYYX, and YYYY. Here W, X and Y represent nucleotide bases, A, G, C, etc., the assignment of bases being made according to rules described below. Given this numeric pattern, a 4mer is assigned to a numeral. For example, 1=WXYY, 2=YWXY, etc. Once a given 4mer has been assigned to a given numeral, it is not assigned for use in the position of a different numeral. It is possible, however, to assign a different 4mer to the same numeral. That is, for example, the numeral 1 in one position could be assigned WXYY and another numeral 1, in a different position, could be assigned XXXW, but none of the other numerals 2 to 10 can then be assigned WXYY or XXXW. A different way of saying this is that each of 1 to 22 is assigned a 4mer from the list of eighty-one 4mers indicated so as to be different from all of the others of 1 to 22. In the case of the specific oligonucleotides given in Table I, 1=WXYY, 2=YWXY, 3=XXXW, 4=YWYX, 5=WYXY, 6=YYWX, 7=YWXX, 8=WYXX, 9=XYYW, 10=XYWX, 11=YYXW, 12=WYYX, 13=XYXW, 14=WYYY, 15=WXYW, 16=WYXW, 17=WXXW, 18=WYYW, 19=XYYX, 20=YXYX, 21=YXXY and 22=XYXY. Once the 4mers are assigned to positions according to the above pattern, a particular set of oligonucleotides can be created by appropriate assignment of bases, A, T/U, G, C to W, X, Y. These assignments are made according to one of the following two sets of rules: (i) Each of W, X and Y is a base in which: (a) W=one of A, T/U, G, and C, X=one of A, T/U, G, and C, Y=one of A, T/U, G, and C, and each of W, X and Y is selected so as to be different from all of the others of W, X and Y, and (b) an unselected said base of (i)(a) can be substituted any number of times for any one of W, X and Y. or (ii) Each of W, X and Y is a base in which: (a) W=G or C, X=A or T/U, Y=A or T/U, and X≠Y, and (b) a base not selected in (ii)(a) can be inserted into each sequence at one or more locations, the location of each insertion being the same in each sequence as that of every other sequence of the set. In the case of the specific oligonucleotides given in Table I, W=G, X=A and Y=T. In any case, given a set of oligonucleotides generated according to one of these sets of rules, it is possible to modify the members of a given set in relatively minor ways and thereby obtain a different set of sequences while more or less maintaining the cross-hybridization properties of the set subject to such modification. In particular, it is possible to insert up to 3 of A, T/U, G and C at any location of any sequence of the set of sequences. Alternatively, or additionally, up to 3 bases can be deleted from any sequence of the set of sequences. A person skilled in the art would understand that given a set of oligonucleotides having a set of properties making it suitable for use as a family of tags (or tag complements) one can obtain another family with the same property by reversing the order of all of the members of the set. In other words, all the members can be taken to be read 5′ to 3′ or to be read 3′ to 5′. A family of complements of the present invention is based on a given set of oligonucleotides defined as described above. Each complement of the family is based on a different oligonucleotide of the set and each complement contains at least 10 consecutive (i.e., contiguous) bases of the oligonucleotide on which it is based. When selecting a sequence of contiguous bases, preference is given to those sets in which the contiguous bases of each oligonucleotide of a set are selected such that the position of the first base of each said oligonucleotide within the sequence on which it is based is the same for all nucleotides of the set. Thus, for example, if a nucleotide sequence of twenty contiguous bases corresponds to bases 3 to 22 of the sequence on which the nucleotide sequence is based, then preferably, the twenty contiguous bases for all nucleotide sequences corresponds to bases 3 to 22 of the sequences on which the nucleotides sequences are based. For a given family of complements where one is seeking to reduce or minimize inter-sequence similarity that would result in cross-hybridization, each and every pair of complements meets particular homology requirements. Particularly, subject to limited exceptions, described below, any two complements within a set of complements are generally required to have a defined amount of dissimilarity. In order to notionally understand these requirements for dissimilarity as they exist for a given pair of complements of a family, a phantom sequence is generated from the pair of complements. A “phantom” sequence is a single sequence that is generated from a pair of complements by selection, from each complement of the pair, of a string of bases wherein the bases of the string occur in the same order in both complements. An object of creating such a phantom sequence is to create a convenient and objective means of comparing the sequence identity of the two parent sequences from which the phantom sequence is created. A phantom sequence can be considered to be similar in concept to a consensus sequence which a person skilled in the art would be familiar with, except that a consensus sequence typically is comprised of all bases from both parent sequences with each position reflecting the most common choice of base at each position (the union of both sequences), whereas the “phantom” sequence is comprised of only bases which occur in the same order in both parent sequences (the intersection of both sequences). Also, a consensus sequence usually is indicative of a common phylogenetic ancestry for the two sequences (or more than 2 sequences depending on how many sequences are used to generate the consensus sequence), whereas the “phantom” sequence definition has been created to specifically address the sequence similarity between 2 complementary sequences which have no ancestral history but may have a propensity to cross-hybridize under certain conditions. A phantom sequence may thus be generated from exemplary Sequence 1 and Sequence 2 as follows: Sequence 1: ATGTTTAGTGAAAAGTTAGTATTG * • Sequence 2: ATGTTAGTGAATAGTATAGTATTG • ♦ Phantom Sequence: ATGTTAGTGAAAGTTAGTATTG The phantom sequence generated from these two sequences is thus 22 bases in length. That is, one can see that there are 22 identical bases with identical sequence (the same order) in Sequence Nos. 1 and 2. There is a total of three insertions/deletions and mismatches present in the phantom sequence when compared with the sequences from which it was generated: ATGT-TAGTGAA-AGT-TAGTATTG The dashed lines in this latter representation of the phantom sequence indicate the locations of the insertions/deletions and mismatches in the phantom sequence relative to the parent sequences from which it was derived. Thus, the “T” marked with an asterisk in Sequence 1, the “A” marked with a diamond in Sequence 2 and the “A-T” mismatch of Sequences 1 and 2 marked with two dots were deleted in generating the phantom sequence. A person skilled in the art will appreciate that the term “insertion/deletion” is intended to cover the situations indicated by the asterisk and diamond. Whether the change is considered, strictly speaking, an insertion or deletion is merely one of vantage point. That is, one can see that the fourth base of Sequence 1 can be deleted therefrom to obtain the phantom sequence, or a “T” can be inserted after the third base of the phantom sequence to obtain Sequence 1. One can thus see that if it were possible to create a phantom sequence by elimination of a single insertion/deletion from one of the parent sequences, that the two parent sequences would have identical homology over the length of the phantom sequence except for the presence of a single base in one of the two sequences being compared. Likewise, one can see that if it were possible to create a phantom sequence through deletion of a mismatched pair of bases, one base in each parent, that the two parent sequences would have identical homology over the length of the phantom sequence except for the presence of a single base in each of the sequences being compared. For this reason, the effect of an insertion/deletion is considered equivalent to the effect of a mismatched pair of bases when comparing the homology of two sequences. Once a phantom sequence is generated, the compatibility of the pair of complements from which it was generated within a family of complements can be systematically evaluated. According to one embodiment of the invention, a pair of complements is compatible for inclusion within a family of complements if any phantom sequence generated from the pair of complements has the following properties: (1) Any consecutive sequence of bases in the phantom sequence which is identical to a consecutive sequence of bases in each of the first and second complements from which it is generated is no more than ((¾×L)−1) bases in length; (2) The phantom sequence, if greater than or equal to (⅚×L) in length, contains at least 3 insertions/deletions or mismatches when compared to the first and second complements from which it is generated; and (3) The phantom sequence is not greater than or equal to ({fraction (11/12)}×L) in length. Here, L 1 is the length of the first complement, L 2 is the length of the second complement, and L=L 1 , or if L 1 ≠L 2 , L is the greater of L 1 and L 2 . In particular preferred embodiments of the invention, all pairs of complements of a given set have the properties set out above. Under particular circumstances, it may be advantageous to have a limited number of complements that do not meet all of these-requirements when compared to every other complement in a family. In one case, for any first complement there are at most two second complements in the family which do not meet all of the three listed requirements. For two such complements, there would thus be a greater chance of cross-hybridization between their tag counterparts and the first complement. In another case, for any first complement there is at most one second complement which does not meet all of three listed requirements. It is also possible, given this invention, to design a family of complements where a specific number or specific portion of the complements do not meet the three listed requirements. For example, a set could be designed where only one pair of complements within the set do not meet the requirements when compared to each other. There could be two pairs, three pairs, and any number of pairs up to and including all possible pairs. Alternatively, it may be advantageous to have a given proportion of pairs of complements that do not meet the requirements, say 10% of pairs, when compared with other sequences that do not meet one or more of the three requirements listed. This number could instead be 5%, 15%, 20%, 25%, 30%, 35%, or 40%. The foregoing comparisons would generally be largely carried out using appropriate computer software. Although notionally described in terms of a phantom sequence for the sake of clarity and understanding, it will be understood that a competent computer programmer can carry out pairwise comparisons of complements in any number of ways using logical steps that obtain equivalent results. The symbols A, G, T/U, C take on their usual meaning in the art here. In the case of T and U, a person skilled in the art would understand that these are equivalent to each other with respect to the inter-strand hydrogen-bond (Watson-Crick) binding properties at work in the context of this invention. The two bases are thus interchangeable and hence the designation of T/U. Analogues of the naturally occurring bases can be inserted in their respective places where desired. An Analogue is any non-natural base, such as peptide nucleic acids and the like that undergoes normal Watson-Crick pairing in the same way as the naturally occurring nucleotide base to which it corresponds. In one broad aspect, the present invention is thus a composition comprising molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences having numeric patters as set out in Table IA wherein: (A) each of 1 to 22 is a 4mer selected from the group of 4mers consisting of WWWW, WWWX, WWWY, WWXW, WWXX, WWXY, WWYW, WWYX, WWYY, WXWW, WXWX, WXWY, WXXW, WXXX, WXXY, WXYW, WXYX, WXYY, WYWW, WYWX, WYWY, WYXW, WYXX, WYXY, WYYW, WYYX, WYYY, XWWW, XWWX, XWWY, XWXW, XWXX, XWXY, XWYW, XWYX, XWYY, XXWW, XXWX, XXWY, XXXW, XXXX, XXXY, XXYW, XXYX, XXYY, XYWW, XYWX, XYWY, XYXW, XYXX, XYXY, XYYW, XYYX, XYYY, YWWW, YWWX, YWWY, YWXW, YWXX, YWXY, YWYW, YWYX, YWYY, YXWW, YXWX, YXWY, YXXW, YXXX, YXXY, YXYW, YXYX, YXYY, YYWW, YYWX, YYWY, YYXW, YYXX, YYXY, YYYW, YYYX, and YYYY, and (B) each of 1 to 22 is selected so as to be different from all of the others of 1 to 22; (C) each of W, X and Y is a base in which either (i) or (ii) is true: (i) (a) W=one of A, T/U, G, and C, X=one of A, T/U, G, and C, Y=one of A, T/U, G, and C, and each of W, X and Y is selected so as to be different from all of the others of W, X and Y, and (b) an unselected said base of (i)(a) can be substituted any number of times for any one of W, X and Y, (ii) (a) W=G or C, X=A or T/U, Y=A or T/U, and X≠Y, and (b) a base not selected in (ii)(a) can be inserted into each sequence at one or more locations, the location of each insertion being the same in all the sequences; (D) up to three bases can be inserted at any location of any of the sequences or up to three bases can be deleted from any of the sequences; (E) all of the sequences of a said group of oligonucleotides are read 5′ to 3′ or are read 3′ to 5′; and wherein each oligonucleotide of a said set has a sequence of at least ten contiguous bases of the sequence on which it is based, provided that: (F) (I) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.1 and 0.40 and said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.2; and (II) for any phantom sequence generated from any pair of first and second sequences of the set L 1 and L 2 in length, respectively, by selection from the first and second sequences of identical bases in identical sequence with each other: (i) any consecutive sequence of bases in the phantom sequence which is identical to a consecutive sequence of bases in each of the first and second sequence from which it is generated is less than ((¾×L)−1) bases in length; (ii) the phantom sequence, if greater than or equal to (⅚×L) in length, contains at least three insertions/deletions or mismatches when compared to the first and second sequences from which it is generated; and (iii) the phantom sequence is not greater than or equal to ({fraction (11/12)}×L) in length; where L=L 1 , or if L 1 ≠L 2 , where L is the greater of L 1 and L 2 ; and wherein any base present may be substituted by an analogue thereof. In a preferred embodiment, a set of oligonucleotides of the invention is based on the numeric patters of sequences tested in Example 2. Preferably, (G) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, for the group of sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4 TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement. It can thus be seen that it is possible to routinely determine whether all oligonucleotides of a selected set are all minimally cross-hybridizing. Preferably in (G), under said defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 30% of the degree of hybridization between said sequence and its complement, it is also true that the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 10, more preferably between 1 and 9, and more preferably between 1 and 8. It is demonstrated in Example 2, below, for a preferred set of oligonucleotides, that the degree of hybridization between each sequence and its specific complement varies by a factor of between 1 and 8.25 and the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 10.2% of the degree of hybridization between the sequence and its specific complement. Preferably, the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 25%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 20%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 15%, more preferably wherein the maximum degree of hybridization in (G) between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 11%. Preferably, under the defined set of conditions of (G), the maximum degree of hybridization between a sequence and a complement of any other sequence of the set is no more than 15% greater than the maximum degree of hybridization between a sequence and any complement of a different sequence of the said group of 24mer sequences, more preferably no more than 10% greater, more preferably no more than 5% greater. According to Example 2, described below, under conditions of 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 10.2% when 24mer nucleotide sequences are covalently linked to a solid support, in this case microparticles or beads. In another preferred aspect of the composition, in (G) for the group of 24mers the maximum degree of hybridization between a sequence and any complement of a different sequence does not exceed 15% of the degree of hybridization between said sequence and its complement and the degree of hybridization between each sequence and its complement varies by a factor of between 1 and 9, and for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 20% of the degree of hybridization of the oligonucleotide and its complement. In a preferred aspect, each of the 4mers represented by numerals 1 to 22 is selected from the group of 4mers consisting of WXXX, WXXY, WXYX, WXYY, WYXX, WYXY, WYYX, WYYY, XWXX, XWXY, XWYX, XWYY, XXWX, XXWY, XXXW, XXYW, XYWX, XYWY, XYXW, XYYW, YWXX, YWXY, YWYX, YWYY, YXWX, YXWY, YXXW, YXYW, YYWX, YYWY, YYXW, and YYYW. In another aspect, each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, each of the 4mers represented by numeral 10 are identical to each other, each of the 4mers represented by numeral 11 are identical to each other, each of the 4mers represented by numeral 12 are identical to each other, each of the 4mers represented by numeral 13 are identical to each other, each of the 4mers represented by numeral 14 are identical to each other, each of the 4mers represented by numeral 15 are identical to each other, each of the 4mers represented by numeral 16 are identical to each other, each of the 4mers represented by numeral 17 are identical to each other, each of the 4mers represented by numeral 18 are identical to each other, each of the 4mers represented by numeral 19 are identical to each other, each of the 4mers represented by numeral 20 are identical to each other, each of the 4mers represented by numeral 21 are identical to each other, and each of the 4mers represented by numeral 22 are identical to each other. In another aspect, at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, at least one of the 4mers represented by the numeral 10 has the sequence XYWX, at least one of the 4mers represented by the numeral 11 has the sequence YYXW, at least one of the 4mers represented by the numeral 12 has the sequence WYYX, at least one of the 4mers represented by the numeral 13 has the sequence XYXW, at least one of the 4mers represented by the numeral 14 has the sequence WYYY, at least one of the 4mers represented by the numeral 15 has the sequence WXYW, at least one of the 4mers represented by the numeral 16 has the sequence WYXW, at least one of the 4mers represented by the numeral 17 has the sequence WXXW, at least one of the 4mers represented by the numeral 18 has the sequence WYYW, at least one of the 4mers represented by the numeral 19 has the sequence XYYX, at least one of the 4mers represented by the numeral 20 has the sequence YXYX, at least one of the 4mers represented by the numeral 21 has the sequence YXXY, and/or at least one of the 4mers represented by the numeral 22 has the sequence XYXY. In one preferred aspect, the invention is a composition in which each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, each 14=WYYY, each 15=WXYW, each 16=WYXW, each 17=WXXW, each 18=WYYW, each 19=XYYX, each 20=YXYX, each 21=YXXY and each 22=XYXY. In one broad aspect, the invention is a composition wherein a group of sequences is based on those having numeric patterns of those with numeric identifiers 1 to 173 of Table IA and wherein each of the 4mers represented by numerals 1 to 14 in (A) is selected from the group of 4mers consisting of WXYY, YWXY, XXXW, YWYX, WYXY, YYWX, YWXX, WYXX, XYYW, XYWX, YYXW, WYYX, XYXW, and WYYY. In such a composition it is preferred that each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, each of the 4mers represented by numeral 10 are identical to each other, each of the 4mers represented by numeral 11 are identical to each other, each of the 4mers represented by numeral 12 are identical to each other, each of the 4mers represented by numeral 13 are identical to each other, and/or each of the 4mers represented by numeral 14 are identical to each other. It is also preferred that at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, at least one of the 4mers represented by the numeral 10 has the sequence XYWX, at least one of the 4mers represented by the numeral 11 has the sequence YYXW, at least one of the 4mers represented by the numeral 12 has the sequence WYYX, at least one of the 4mers represented by the numeral 13 has the sequence XYXW, and/or at least one of the 4mers represented by the numeral 14 has the sequence WYYY. More preferably, each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, and each 14=WYYY. In another broad aspect, the invention is a composition in which a group of sequences is based on those sequences having the numeric patters of those with sequence identifiers 1 to 100 set out in Table IA and wherein each of the 4mers represented by numerals 1 to 10 in (A) is selected from the group of 4mers consisting of WXYY, YWXY, XXXW, YWYX, WYXY, YYWX, YWXX, WYXX, XYYW, and XYWX. In such a composition it is preferred that each of the 4mers represented by numeral 1 are identical to each other, each of the 4mers represented by numeral 2 are identical to each other, each of the 4mers represented by numeral 3 are identical to each other, each of the 4mers represented by numeral 4 are identical to each other, each of the 4mers represented by numeral 5 are identical to each other, each of the 4mers represented by numeral 6 are identical to each other, each of the 4mers represented by numeral 7 are identical to each other, each of the 4mers represented by numeral 8 are identical to each other, each of the 4mers represented by numeral 9 are identical to each other, and/or each of the 4mers represented by numeral 10 are identical to each other. It also preferred that at least one of the 4mers represented by the numeral 1 has the sequence WXYY, at least one of the 4mers represented by the numeral 2 has the sequence YWXY, at least one of the 4mers represented by the numeral 3 has the sequence XXXW, at least one of the 4mers represented by the numeral 4 has the sequence YWYX, at least one of the 4mers represented by the numeral 5 has the sequence WYXY, at least one of the 4mers represented by the numeral 6 has the sequence YYWX, at least one of the 4mers represented by the numeral 7 has the sequence YWXX, at least one of the 4mers represented by the numeral 8 has the sequence WYXX, at least one of the 4mers represented by the numeral 9 has the sequence XYYW, and/or at least one of the 4mers represented by the numeral 10 has the sequence XYWX. More preferably, each 1=WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, and each 10=XYWX. In the most preferred compositions, in (C)(i)(a): W=one of G and C; X=one of A and T/U; and Y=one of A and T/U, maintaining the provisos of (F). More preferably, (C)(i)(a): W=G; X=one of A, and T/U; and Y=one of A and T/U. Even more preferably, wherein W=G; X=A; and Y=T/U. A person skilled in the art will appreciate that the closer a given oligonucleotide sequence variant is to one of the most preferred sequences (Table I), the more closely it will resemble the preferred sequence as a member of a minimally cross-hybridizing set of oligonucleotides. It will be understood that when it is stated herein that a group of sequences (oligonucleotides) is minimally cross-hybridizing, it is meant that any given member of the group of sequences (oligonucleotides) only minimally hybridizes with the complement of any other sequence (oligonucleotide) of that group. Preferably, in (F)(I), the quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.1, more preferably, the quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.05, more preferably the quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.01. Also, it is preferred in (F)(I) that the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.15 and 0.35, more preferably between about 0.2 and 0.3, more preferably between about 0.21 and 0.29, more preferably between about 0.22 and 0.28, more preferably between about 0.23 and 0.27, even more preferably between about 0.24 and 0.26, and most preferably the quotient is 0.25. Preferably, in (D) up to two bases can be inserted at any location of any of the sequences or up to two bases can be deleted from any of the sequences, more preferably only one base can be inserted at any location of any of the sequences or one base can be deleted from any of the sequences, and most preferably no base is inserted at any location of any of the sequences. Also, it is preferred that in (D), no base can be deleted from any of the sequences, and most preferably, in (D) no base can be inserted at or deleted from any location of any of the sequences. In preferred compositions, each of the oligonucleotides of a set has a sequence at least eleven contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twelve contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least thirteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least fourteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least fifteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least sixteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least seventeen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least eighteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least nineteen contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twenty contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twenty-one contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twenty-two contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twenty-three contiguous bases of the sequence on which it is based; or more preferably each of the oligonucleotides of a set has a sequence at least twenty-four contiguous bases of the sequence on which it is based. Preferably, each of the oligonucleotides of a set is up to thirty bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-nine bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-eight bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-seven bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-six bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-five bases in length; or more preferably each of the oligonucleotides of a set is up to twenty-four bases in length. In certain preferred embodiments, each of the oligonucleotides of a set has a length of within five bases of the average length of all of the oligonucleotides in the set; or more preferably each of the oligonucleotides of a set has a length of within four bases of the average length of all of the oligonucleotides in the set; or more preferably each of the oligonucleotides of a set has a length of within three bases of the average length of all of the oligonucleotides in the set; or more preferably each of the oligonucleotides of a set has a length of within two bases of the average length of all of the oligonucleotides in the set; or more preferably each of the oligonucleotides of a set has a length of within one base of the average length of all of the oligonucleotides in the set. Preferably, the string of contiguous bases of each oligonucleotide of a said set are selected such that the position of the first base of each string within the sequence on which it is based is the same for all nucleotides of the set. In preferred embodiments, the composition includes at least ten said molecules, or at least eleven said molecules, or at least twelve said molecules, or at least thirteen said molecules, or at least fourteen said molecules, or at least fifteen said molecules, or at least sixteen said molecules, or at least seventeen said molecules, or at least eighteen said molecules, or at least nineteen said molecules, or at least twenty said molecules, or at least twenty-one said molecules, or at least twenty-two said molecules, or at least twenty-three said molecules, or at least twenty-four said molecules, or at least twenty-five said molecules, or at least twenty-six said molecules, or at least twenty-seven said molecules, or at least twenty-eight said molecules, or at least twenty-nine said molecules, or at least thirty said molecules, or at least thirty-one said molecules, or at least thirty-two said molecules, or at least thirty-three said molecules, or at least thirty-four said molecules, or at least thirty-five said molecules, or at least thirty-six said molecules, or at least thirty-seven said molecules, or at least thirty-eight said molecules, or at least thirty-nine said molecules, or at least forty said molecules, or at least forty-one said molecules, or at least forty-two said molecules, or at least forty-three said molecules, or at least forty-four said molecules, or at least forty-five said molecules, or at least forty-six said molecules, or at least forty-seven said molecules, or at least forty-eight said molecules, or at least forty-nine said molecules, or at least fifty said molecules, or at least sixty said molecules, or at least seventy said molecules, or at least eighty said molecules, or at least ninety said molecules, or at least one hundred said molecules, or at least, depending upon the size of the group of sequences on which the oligonucleotides are based, one hundred and ten said molecules, or at least one hundred and twenty said molecules, or at least one hundred and thirty said molecules, or at least one hundred and forty said molecules, or at least one hundred and fifty said molecules, or at least one hundred and sixty said molecules, or at least one hundred and seventy said molecules, or at least one hundred and eighty said molecules, or at least one hundred and ninety said molecules, or at least two hundred said molecules. A person skilled in the art will appreciate that, depending upon the use to which a family of oligonucleotides of the invention are to be put, it may or may not be desirable to include with sequences that can be distinguished one from the other (i.e., are minimally cross-hybridizing) a number of sequences that do cross hybridize with each other. In a preferred aspect, the invention is a composition wherein in (II)(i), any consecutive sequence of bases in the phantom sequence which is identical to a consecutive sequence of bases in each of the first and second sequences from which it is generated is no more than ((⅔×L)−1) bases in length. More preferably, the phantom sequence, if greater than or equal to (¾×L) in length, contains at least 3 insertions/deletions or mismatches when compared to the first and second sequences from which it is generated, and even more preferably, the phantom sequence, if greater than or equal to (⅔×L) in length, contains at least 3 insertions/deletions or mismatches when compared to the first and second sequences from which it is generated. In another preferred aspect, in (II)(iii), the phantom sequence is not greater than or equal to (⅚×L) in length, more preferably, the phantom sequence is not greater than or equal to (¾×L) in length. In another broad aspect, the invention is a composition containing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide selected from a set of oligonucleotides based on a group of sequences having the numeric patterns of the sequences tested in Example 2, as set out in Table IA, wherein: (A) wherein 1 WXYY, each 2=YWXY, each 3=XXXW, each 4=YWYX, each 5=WYXY, each 6=YYWX, each 7=YWXX, each 8=WYXX, each 9=XYYW, each 10=XYWX, each 11=YYXW, each 12=WYYX, each 13=XYXW, each 14=WYYY, each 15=WXYW, each 16=WYXW, each 17=WXXW, each 18=WYYW, each 19=XYYX, each 20=YXYX, each 21=YXXY and each 22=XYXY; (B) each of W, X and Y is a base in which either: (i) (a) W=one of A, T/U, G, and C, X=one of A, T/U, G, and C, Y=one of A, T/U, G, and C, and each of W, X and Y is selected so as to be different from all of the others of W, X and Y, (b) an unselected said base of (i)(a) can be substituted any number of times for any one of W, X and Y, or (ii) (a) W=G or C, X=A or T/U, Y=A or T/U, and X≠Y, and (b) a base not selected in (ii)(a) can be inserted into each sequence at one or more locations, the location of each insertion being the same in all the sequences; (C) up to three bases can be inserted at any location of any of the sequences or up to three bases can be deleted from any of the sequences; (D) all of the sequences of a said group of oligonucleotides are read 5′ to 3′ or are read 3′ to 5′; and wherein each oligonucleotide of a said set has a sequence of at least ten contiguous bases of the sequence on which it is based, provided that: (E) the quotient of the sum of G and C divided by the sum of A, T/U, G and C for all combined sequences of the set is between about 0.1 and 0.40 and said quotient for each sequence of the set does not vary from the quotient for the combined sequences by more than 0.2; and (F) for the group of 24mer sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, for the group of sequences in which each 1=GATT, each 2=TGAT, each 3=AAAG, each 4=TGTA, each 5=GTAT, each 6=TTGA, each 7=TGAA, each 8=GTAA, each 9=ATTG, each 10=ATGA, each 11=TTAG, each 12=GTTA, each 13=ATAG, each 14=GTTT, each 15=GATG, each 16=GTAG, each 17=GAAG, each 18=GTTG, each 19=ATTA, each 20=TATA, each 21=TAAT and each 22=ATAT, under a defined set of conditions in which the maximum degree of hybridization between a sequence and any complement of a different sequence of the group of 24mer sequences does not exceed 30% of the degree of hybridization between said sequence and its complement, for all oligonucleotides of the set, the maximum degree of hybridization between an oligonucleotide and a complement of any other oligonucleotide of the set does not exceed 50% of the degree of hybridization of the oligonucleotide and its complement; wherein any base present may be substituted by an analogue thereof. Again, preferably, the contiguous bases of each oligonucleotide of a set are selected such that the position of the first base of each oligonucleotide within the sequence on which it is based is the same for all nucleotides of the set. In a preferred aspect, subject to the provisos of (E) and (F) above, each oligonucleotide of a said set comprises a said sequence of twenty-four contiguous bases of the sequence on which it is based. More preferably, subject to the proviso of (F) each oligonucleotide of a said set comprises a said sequence of twenty-four contiguous bases of the sequence on which it is based. In particularly preferred aspects, in (B), W=one of G and C; X=one of A and T/U; and Y=one of A and T/U. Even more preferred, in (B): =G; X=one of A, and T/U; and Y=one of A and T/U. In another broad aspect, the invention is a composition that includes fifty minimally cross-hybridizing molecules for use as tags or tag complements wherein each molecule comprises an oligonucleotide comprising a sequence of nucleotide bases for which, under a defined set of conditions, the maximum degree of hybridization between a said oligonucleotide and any complement of a different oligonucleotide does not exceed about 10% of the degree of hybridization between said oligonucleotide and its complement. A preferred set of such defined conditions results in a level of hybridization that is the same as the level of hybridization obtained when hybridization conditions include 0.2 M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0 at 37° C., and the sequences are covalently linked to microparticles. Of course, these conditions are preferably used directly. Preferably, under the defined set of conditions, whatever the conditions are, the degree of hybridization between each oligonucleotide and its complement varies by a factor of between 1 and 8. Preferably, each oligonucleotide is the same length and is at least twenty nucleotide bases in length. More preferably, each oligonucleotide is twenty-four nucleotide bases in length. In certain embodiments, each molecule of a composition is linked to a solid phase support so as to be distinguishable from a mixture of said molecules by hybridization to its complement. Each such molecule can be linked to a defined location on such a solid phase support, the defined location for each molecule being different than the defined location for other, different, molecules. In one preferred embodiment, the solid phase support is a microparticle and each said molecule is covalently attached to a different microparticle than each other different said molecule. The invention includes kits for sorting and identifying polynucleotides. Such a kit can include one or more solid phase supports each having one or more spatially discrete regions, each such region having a uniform population of substantially identical tag complements covalently attached. The tag complements are made up of a set of oligonucleotides of the invention. The one or more solid phase supports can be a planar substrate in which the one or more spatially discrete regions is a plurality of spatially addressable regions. The tag complements can also be coupled to microparticles. Microparticles preferably each have a diameter in the range of from 5 to 40 μm. Such a kit preferably includes microparticles that are spectrophotometrically unique, and therefore distinguishable from each other according to conventional laboratory techniques. Of course for such kits to work, each type of microparticle would generally have only one tag complement associated with it, and usually there would be a different oligonucleotide tag complement associated with (attached to) each type of microparticle. The invention includes methods of using families of oligonucleotides of the invention. One such method is of analyzing a biological sample containing a biological sequence for the presence of a mutation or polymorphism at a locus of the nucleic acid. The method includes: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, with the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified sequence; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid. In another method of the invention, a biological sample containing a plurality of nucleic acid molecules is analyzed for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. This method includes steps of: (A) amplifying the nucleic acid molecule in the presence of a first primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form an amplified molecule with a 5′-end with a sequence complementary to the sequence of the tag; (B) extending the amplified molecule in the presence of a polymerase and a second primer having 5′-end complementary the 3′-end of the amplified sequence, the 3′-end of the second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus of the amplified molecule; (C) specifically hybridizing the second primer to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primer in (B) so as to identify the base located at the locus of the nucleic acid; wherein each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. Another method includes analyzing a biological sample that contains a plurality of double stranded complementary nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule. The method includes steps of: (A) amplifying the double stranded molecule in the presence of a pair of first primers, each primer having an identical 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention to form amplified molecules with 5′-ends with a sequence complementary to the sequence of the tag; (B) extending the amplified molecules in the presence of a polymerase and a pair of second primers each second primer having a 5′-end complementary a 3′-end of the amplified sequence, the 3′-end of each said second primer extending to immediately adjacent said locus, in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of incorporation during transciption by the polymerase onto the 3′-end of a growing nucleotide strand; (ii) causes termination of polymerization; and (iii) capable of differential detection, one from the other; (C) specifically hybridizing each of the second primers to a tag complement having the tag complement sequence of (A); and (D) detecting the nucleotide derivative incorporated into the second primers in (B) so as to identify the base located at said locus; wherein the sequence of each tag of (A) is unique for each nucleic acid molecule and steps (A) and (B) are carried out with said nucleic molecules in the presence of each other. In yet another aspect, the invention is a method of analyzing a biological sample containing a plurality of nucleic acid molecules for the presence of a mutation or polymorphism at a locus of each nucleic acid molecule, for each nucleic acid molecule, the method including steps of: (a) hybridizing the molecule and a primer, the primer having a 5′-sequence having the sequence of a tag complementary to the sequence of a tag complement belonging to a family of tag complements of the invention and a 3′-end extending to immediately adjacent the locus; (b) enzymatically extending the 3′-end of the primer in the presence of a plurality of nucleoside triphosphate derivatives each of which is: (i) capable of enzymatic incorporation onto the 3′-end of a growing nucleotide strand; (ii) causes termination of said extension; and (iii) capable of differential detection, one from the other, wherein there is a said derivative complementary to each possible nucleotide present at said locus; (c) specifically hybridizing the extended primer formed in step (b) to a tag complement having the tag complement sequence of (a); and (d) detecting the nucleotide derivative incorporated into the primer in step (b) so as to identify the base located at the locus of the nucleic acid molecule; wherein each tag of (a) is unique for each nucleic acid molecule and steps (a) and (b) are carried out with said nucleic molecules in the presence of each other. The derivative can be a dideoxy nucleoside triphosphate. Each respective complement can be attached as a uniform population of substantially identical complements in spacially discrete regions on one or more solid phase support(s). Each tag complement can include a label, each such label being different for respective complements, and step (d) can include detecting the presence of the different labels for respective hybridization complexes of bound tags and tag complements. Another aspect of the invention includes a method of determining the presence of a target suspected of being contained in a mixture. The method includes the steps of: (i) labelling the target with a first label; (ii) providing a first detection moiety capable of specific binding to the target and including a first tag; (iii) exposing a sample of the mixture to the detection moiety under conditions suitable to permit (or cause) said specific binding of the molecule and target; (iv) providing a family of suitable tag complements of the invention wherein the family contains a first tag complement having a sequence complementary to that of the first tag; (v) exposing the sample to the family of tag complements under conditions suitable to permit (or cause) specific hybridization of the first tag and its tag complement; (vi) determining whether a said first detection moiety hybridized to a first said tag complement is bound to a said labelled target in order to determine the presence or absence of said target in the mixture. Preferably, the first tag complement is linked to a solid support at a specific location of the support and step (vi) includes detecting the presence of the first label at said specified location. Also, the first tag complement can include a second label and step (vi) includes detecting the presence of the first and second labels in a hybridized complex of the moiety and the first tag complement. Further, the target can be selected from the group consisting of organic molecules, antigens, proteins, polypeptides, antibodies and nucleic acids. The target can be an antigen and the first molecule can be an antibody specific for that antigen. The antigen is usually a polypeptide or protein and the labelling step can include conjugation of fluorescent molecules, digoxigenin, biotinylation and the like. The target can be a nucleic acid and the labelling step can include incorporation of fluorescent molecules, radiolabelled nucleotide, digoxigenin, biotinylation and the like. |
Communication device and method |
The present invention relates to a communication apparatus and method that allow setting for forming a wireless link to be automatically executed without requiring a special setting operation. A personal computer 1 forms a wireless link with an access-point device 3 using a wireless communication unit, and exchanges data with, for example, a server (not shown) connected to a network 4, via the access-point device 3. The personal computer 1 requires an SSID and a WEP KEY defined in IEEE 802.11b to be set before forming a wireless link with the access-point device 3. The setting is executed only by placing an IC card 2 within a predetermined distance of (or momentarily in contact with) an IC-card contactless communication unit 19 of the personal computer 1. The present invention can be applied to a wireless LAN system including personal computers, PDAs, access-points, etc. |
1. A communication apparatus for carrying out wireless communication with another electronic apparatus based on a predetermined wireless communication standard, the communication apparatus comprising: wireless communication means for carrying out wireless communication with the another electronic apparatus based on the predetermined wireless communication standard; detection means for detecting presence of an information recording medium having recorded thereon setting information that is required for forming a wireless link with the another electronic apparatus; reading means for reading the setting information, by contactless communication, from the information recording medium detected by the detection means; and setting means for adjusting setting of the wireless communication means according to the setting information read by the reading means. 2. A communication apparatus according to claim 1, wherein the predetermined wireless communication standard is IEEE 802.11b. 3. A communication apparatus according to claim 1, wherein the predetermined wireless communication standard is bluetooth. 4. A communication apparatus according to claim 1, wherein the contactless communication is carried out using a FeliCA FeliCa system. 5. A communication apparatus according to claim, 1, wherein the information recording medium is an IC card. 6. A communication apparatus according to claim 1, wherein the setting information includes at least one of ID information, a password associated with the ID information, a user name, and a password associated with the user name. 7. A communication apparatus according to claim 1, further comprising recording means for recording, by the contactless communication, setting information that is required for forming a wireless link with the communication apparatus on the information recording medium detected by the detection means. 8. A communication method for a communication apparatus for carrying out wireless communication with another electronic apparatus based on a predetermined wireless communication standard, the communication method comprising: a wireless communication step of carrying out wireless communication with the another electronic apparatus based on the predetermined wireless communication standard; a detection step of detecting presence of an information recording medium having recorded thereon setting information that is required for forming a wireless link with the another electronic apparatus; a reading step of reading the setting information, by contactless communication, from the information recording medium detected by processing in the detection step; and a setting step of adjusting setting of processing in the wireless communication step based on the setting information read by processing in the reading step. 9. A recording medium having recorded thereon a computer-readable program for a communication apparatus for carrying out wireless communication with another electronic apparatus based on a predetermined wireless communication standard, the program comprising: a wireless communication step of carrying out wireless communication with the another electronic apparatus based on the predetermined wireless communication standard; a detection step of detecting presence of an information recording medium having recorded thereon setting information that is required for forming a wireless link with the another electronic apparatus; a reading step of reading the setting information, by contactless communication, from the information recording medium detected by processing in the detection step; and a setting step of adjusting setting of processing in the wireless communication step based on the setting information read by processing in the reading step. 10. A program for allowing a computer that controls a communication apparatus for carrying out wireless communication with another electronic apparatus based on a predetermined wireless communication standard to execute processing comprising: a wireless communication step of carrying out wireless communication with the another electronic apparatus based on the predetermined wireless communication standard; a detection step of detecting presence of an information recording medium having recorded thereon setting information that is required for forming a wireless link with the another electronic apparatus; a reading step of reading the setting information, by contactless communication, from the information recording medium detected by processing in the detection step; and a setting step of adjusting setting of processing in the wireless communication step based on the setting information read by processing in the reading step. |
<SOH> BACKGROUND ART <EOH>IEEE (Institute of Electrical and Electronics Engineers) 802.11b and Bluetooth™ are known as techniques for forming wireless links among a plurality of apparatuses. In this specification, a wireless link and a wireless communication refer to those that use radio waves. IEEE 802.11b is used to form a wireless LAN (local area network) by forming wireless links among, for example, a plurality of personal computers, access-point devices, etc. Bluetooth is used, for example, to exchange specified data (control-command data, text data, still-picture data, moving-picture data, audio data, etc.) between personal computers, PDAs (personal digital assistants), cellular phones, digital video cameras, etc. When a wireless LAN is to be formed using the wireless link techniques described above, in which only desired ones of a plurality of nearby electronic apparatuses capable of forming wireless links are to be linked, in order to inhibit an unintended electronic apparatus from getting linked with the wireless LAN, according to one method, ID information, passwords, etc. are set in advance to electronic apparatuses that are to be linked to the wireless LAN. However, it has been laborious for a user to set network configuration by entering ID information and a password to an electronic apparatus for which a wireless link is to be formed. Furthermore, setting network configuration is difficult for a user not familiar with operating the electronic apparatus for which a wireless link is to be formed, and is not considered to be an operation that can be readily performed by anyone. Furthermore, since the ID information and password themselves are usually meaningless sequences of characters and digits, errors could occur when the user manually enters the ID information and password. |
<SOH> BRIEF DESCRIPTION OF THE DRAWINGS <EOH>FIG. 1 is a diagram showing a scheme of executing setting of a wireless link between a personal computer 1 and an access-point device 3 using an IC card. FIG. 2 is a block diagram showing an example configuration of the personal computer 1 shown in FIG. 1 . FIG. 3 is a diagram showing an example of access-point information pre-recorded in the IC card shown in FIG. 2 . FIG. 4 is a flowchart showing processing for setting an access point, executed by the personal computer 1 . FIG. 5 is a diagram showing a scheme of executing setting of a wireless link between the personal computer 1 and an access-point device 31 using an IC card. FIG. 6 is a diagram showing an example where user information is added to the access-point information shown in FIG. 3 . FIG. 7 is a diagram showing a scheme of forming a wireless LAN between a personal computer 1 - 1 and a personal computer 1 - 2 in ad-hoc mode. FIG. 8 is a flowchart showing processing for forming a wireless LAN in ad-hoc mode, executed by the personal computer 1 - 1 . FIG. 9 is a diagram showing an example of local-network information recorded in an IC card 2 . FIG. 10 is a flowchart showing processing for forming a wireless LAN in ad-hoc mode, executed by the personal computer 1 - 2 . FIG. 11 is a diagram showing a scheme of forming a wireless LAN between the personal computer 1 and a PDA 41 in ad-hoc mode by contactless communication without using the IC card 2 . FIG. 12 is a block diagram showing an example configuration of the PDA 41 shown in FIG. 11 . FIG. 13 is a flowchart showing processing for forming a wireless LAN between the personal computer 1 and the PDA 41 in ad-hoc mode by contactless communication without using the IC card 2 . FIG. 14 is a diagram showing a scheme of forming a wireless LAN between the personal computer 1 and a PDA 71 by infrared communication without using the IC card 2 . FIG. 15 is a block diagram showing an example configuration of the PDA 71 shown in FIG. 14 . FIG. 16 is a flowchart showing processing for forming a wireless LAN between the personal computer 1 and the PDA 71 in ad-hoc mode by infrared communication without using the IC card 2 . detailed-description description="Detailed Description" end="lead"? |
Method and device for the subjective determination of abberations of higher order |
The invention relates to a device for the subjective determination of aberrations of higher orders Xi in an optical system, in particular in an eye (5), comprising at least one observation channel (15) into which defined plates (20) can be introduced, the individual plates (20) having optically active structures (21) which correspond to a defined Zernike polynomial and to a defined amplitude, at least one order Xi of the Zernike polynomial being greater than two. |
1-10. (canceled) 11. A device for a subjective determination of aberrations of higher orders in an optical system, the device comprising: an observation channel; and a plurality of individual plates configured to be introduced into the observation channel, each plate having optically active structures corresponding to a defined Zernike polynomial and to a defined amplitude of the defined Zernike polynomial, the defined Zernike polynomial having an order greater than two. 12. The device as recited in claim 11, wherein the optical system includes an eye. 13. The device as recited in claim 11, wherein a set of the plurality of individual plates define a plate set, the plate set configured compensate aberrations corresponding to the defined Zernike polynomial. 14. The device as recited in claim 13, wherein the plate set includes a subset of the set of individual plates, each of the individual plates in the subset corresponding to a different defined amplitude for the defined Zernike polynomial. 15. The device as recited in claim 13, wherein the plate set is disposed on a circular disc. 16. The device as recited in claim 11, wherein the device is a phoropter. 17. The device as recited in claim 11, further comprising a target apparatus for the optical system. 18. The device as recited in claim 11, wherein the plates are made of glass or plastic. 19. The device as recited in claim 11, wherein the device is configured to determine a visual acuity. 20. The device as recited in claim 11, wherein the device is configured to optimize a resolution of an optical instrument. 21. The device as recited in claim 11, wherein the device is configured to correct a beam profile of a beam source. 22. The device as recited in claim 21, wherein the beam source is a laser diode. 23. The device as recited in claim 11, wherein the device is configured to individually correct a vision defect when using optical instruments. 24. A method for the subjective determination of an aberration of a special higher order X in an optical system, comprising: in a first step, introducing a first plate into an observation channel of the optical system, the plate having optically active structures corresponding to a defined Zernike polynomial having an order X and to a defined amplitude of the defined Zernike polynomial, the order X being greater than 2; in a second step, subjectively assessing a current wave deformation of the order X; and in a third step repeating the first step with a second plate of different amplitude correction of the defined Zernike polynomial and repeating the second step of the subjective determination so as to select one of the first and second plates that subjectively best compensates the aberration of the special higher order X. 25. The method as recited in claim 24, wherein the optical system includes an eye. 26. A method for the subjective determination of aberrations of special higher orders X1 to Xn in an optical system, comprising: in a first step, introducing a first plate into an observation channel of the optical system, the plate having optically active structures corresponding to a defined Zernike polynomial having an order X1 and to a defined amplitude of the defined Zernike polynomial, the order X1 being greater than 2; in a second step, subjectively assessing a current wave deformation of the order X1; and in a third step repeating the first step with a second plate of different amplitude correction of the defined Zernike polynomial and repeating the second step of the subjective determination so as to select one of the first and second plates that subjectively best compensates the aberration of the special higher order X1 in a fourth step, successively repeating the first and second steps for each defined Zernike polynomial having an order Xn, wherein Xn is greater than X1. 27. The method as recited in claim 26, wherein the optical system includes an eye. |
ARRANGEMENT FOR DEMAGNETIZING A TRANSFORMER |
To demagnetize a transformer (TR) in a single-ended forward DC/DC converter with self-driven synchronized rectifiers (V1, V2) connected across the secondary winding (N2) of the transformer (TR), a diode (D1) is connected in series with a capacitor (C1) across the primary winding (N1) of the transformer. The diode (D1) transfers magnetization energy transformer to the capacitor (C1) every time a primary switch (V3) of the converter is turned off. To ensure optimum efficiency of the synchronized rectifiers, a discharging circuit is connected to the capacitor (C1) for discharging the magnetization energy stored therein by drawing a DC current (I) from the capacitor (C1) in response to varying input DC voltage such that complete demagnetization of the transformer (TR) always is attained just before turn-on of the primary switch (V3). |
1. An arrangement for demagnetization of a transformer (TR) in a single-ended forward DC/DC converter, a primary winding (N1) of the transformer being connected in series with a primary switch (V3) to a source (U1) of varying input DC voltage, a diode (D1) being connected in series with a capacitor (C1) across the primary winding (N1) for transferring magnetization energy from the transformer (TR) to the capacitor (C1) during the off period of the primary switch (V3), and a discharging circuit being connected across the capacitor (C1) in order to dissipate magnetization energy stored therein, characterized in that the discharging circuit comprises means for discharging the capacitor (C1) with such a DC current (I) in response to the varying input DC voltage that complete demagnetization of the transformer (TR) always is attained just before turn-on of the primary switch (V3). 2. The arrangement according to claim 1, characterized in that the discharging circuit comprises a first transistor (T1) connected with its emitter to the cathode of the diode (D1) via a first resistor (R1), with its collector to one terminal (1) of said source (U1), and with its base to the cathode of the diode (D1) via a second resistor (R2), and to the collector of a second transistor (T2) connected with its base to said one terminal (1) of said source (U1), and with its emitter to the other terminal (2) of said source (U1) via a third resistor (R3) and a zener-diode (D2). |
<SOH> BACKGROUND OF THE INVENTION <EOH>FIG. 1 shows an embodiment of a known pulse width modulated single-ended forward DC/DC converter with self-driven synchronized rectifiers V 1 , V 2 , illustrated as field effect transistors (FETs), connected across a secondary winding N 2 of a transformer TR in the converter. An output filter comprising an inductor L and a capacitor C is connected across V 2 to provide an output voltage U 2 across the capacitor C in a manner known per se. A primary winding N 1 of the transformer TR is connected with one of its terminals to a (+) terminal 1 of a source of varying input DC voltage Ul, and with its other terminal to the drain of a primary switch in the form of a FET V 3 . The source of V 3 is connected to a (−) terminal 2 of the voltage source U 1 . The gate of V 3 is pulse width modulated such that its duty cycle is varied in response to the varying input voltage U 1 to keep the output voltage U 2 at a desired value. To accomplish this, the actual value of the output voltage U 2 is sensed by a voltage regulator 3 and compared to the desired value of the output voltage, that is set in the voltage regulator 3 . In response to differences between the actual value and the desired value, the voltage regulator 3 outputs a control signal to a control circuit 4 . In response to the control signal, the control circuit 4 in its turn outputs a pulse width modulated control signal to the gate of V 3 to vary the duty cycle of V 3 such that the actual value of U 2 equals the desired value. During the off period of the primary switch V 3 , the core of the transformer TR has to be reset to discharge the leakage inductance of the transformer TR. To reset or demagnetize the transformer TR, a so-called snubber circuit is provided in a manner known per se to absorb energy during the off period of V 3 . The snubber circuit comprises a series circuit of a diode D 1 and a capacitor C 1 that is connected in parallel with the primary winding N 1 and a resistor R 1 which is connected to the terminals of the capacitor C 1 . When V 3 is turned off, energy which has been accumulated in the primary winding N 1 of the transformer TR is transferred to the capacitor C 1 and dissipated by the resistor R 1 . The FETs V 1 and V 2 are both controlled by the transformer TR in such a manner that V 1 is on when V 3 is on, while V 2 is on when V 3 is off. Thus, V 2 is on when the transformer TR is being reset. At higher input voltages U 1 , the on periods of V 3 will be shorter. Hereby, the transformer TR will be reset more quickly. This will result in a longer so-called dead time, i.e. the time when there is no voltage across the transformer TR. As a consequence, V 2 will not have any gate drive during such times. Instead, its body diode that generates more losses, will conduct. Hereby, the efficiency of the converter will be lower. Also, the presence of dead time means that the primary switch V 3 is exposed to higher voltage than necessary. FIG. 2 is a diagram illustrating the voltage UN 1 across the primary winding N 1 of the transformer TR versus the time t. The primary switch V 3 is turned off at time t 1 and is turned on again at time t 3 . The transformer TR is supposed to have been demagnetized at time t 2 . Thus, the dead time lasts from time t 2 to time t 3 in FIG. 2 . The dead time depends on the on-time of V 3 such that a shorter on-time gives a longer dead time. To improve the efficiency that is associated with good timing of the secondary switches, it is possible to control the gate drive of V 2 from the primary side of the transformer TR. The disadvantages of such a solution are increased complexity and increased costs. |
<SOH> SUMMARY OF THE INVENTION <EOH>The object of the invention is to bring about an arrangement for demagnetizing the transformer in a single-ended forward DC/DC converter with self-driven synchronized rectifiers to ensure optimal operation of the synchronized rectifiers and optimal efficiency of the converter. This is attained by providing the converter with an arrangement for demagnetizing/resetting the transformer such that complete demagnetization of the transformer always is attained just before turn-on of the primary switch. Hereby optimal operation of the synchronous rectifiers is achieved as well as minimum voltage stress of the primary switch. |
Combined pen and knife implement |
A combined writing instrument and knife comprises a tubular body, a mount disposed within the body, an elongate writing element (e.g., pen or pencil) projecting in one direction from the mount, and a knife projecting in the opposite direction from the mount. The mount is displaceable in one direction to extend the writing element from one end of the body, or in the opposite direction to extend the knife from the opposite end of the body. |
Subsets and Splits