text
stringlengths 0
1.67M
|
|---|
1. An device for heating a food product, the device including: an oven enclosure; at least one magnetron for emitting microwave energy; and a microwave energy focusing device associated with each magnetron and adapted to focus microwave energy towards the food product, wherein the magnetron(s) is/are disposed external the enclosure and the microwave energy focusing device(s) is/are disposed internal the enclosure. 2. The device as claimed in claim 1, wherein the microwave energy focusing device(s) are a horn with a first end adjacent the magnetron(s) and a second end directed towards the food product. 3. The device as claimed in claim 2, wherein the horn(s) has/have a rectangular cross-section or is/are substantially conical. 4. The device as claimed in claim 2, wherein the horn(s) taper from a smaller first end to a larger second end. 5. The device as claimed in claim 1, wherein the device includes a first (upper) magnetron. 6. The device as claimed in claim 5, wherein the device includes second and third (side) magnetrons. 7. The device as claimed in claim 1, wherein the oven enclosure includes a door, the door being associated with an interlock such that the magnetron(s) can not be energised whilst the door is open. 8. An device for heating a food product, the apparatus including: a microwave oven enclosure; a food product support device within the oven enclosure, the device being of a substantially truncated conical external shape with a first larger base surface adapted to be positioned adjacent the base of the oven enclosure and a second smaller supporting surface adapted to support a food product in a position vertically displaced from the base of the oven enclosure for heating and a sloping side surface extending between the base and support surfaces, whereby the food product is able to exit the oven enclosure by sliding down the side surface when pushed from the support surface towards an opening in the oven enclosure. 9. The device as claimed in claim 8, wherein the device includes: at least one magnetron for emitting microwave energy disposed external the enclosure; and a microwave energy focusing device disposed internal the enclosure and associated with each magnetron and adapted to focus microwave energy towards the support surface. 10. The device as claimed in claim 8, wherein the support device includes a hollow polyethylene base portion that includes the base and side surfaces and a Teflon support portion that includes the support surface. 11. The device as claimed in claim 10, wherein the Teflon support surface includes a dipole antenna adapted above which the food product is, in use, positioned, the antenna being adapted to focus the microwave energy towards the food product. 12. The device as claimed in claim 11, wherein the antenna is a metal screw which is screwed into the surface of the Teflon support plate that is, in use, remote the food product. 13. An device for heating a food product, the device including: an oven enclosure with an opening; a food product positioning and ejection device adapted for reciprocal movement towards and away from the opening between retracted and an extended positions; and a chute sloping downwardly into the enclosure through the opening, wherein when the device is adapted, when in the retracted position, to limit the movement of the food product into the enclosure by abutment with same further adapted to push the food product from the enclosure during movement towards the extended position. 14. The device as claimed in claim 13, wherein the positioning and ejection device includes a food product head having a leading edge substantially complimentary to the food product and a sliding mechanism adapted to extend and retract the head. 15. The device as claimed in claim 14, wherein the sliding mechanism includes a pair of guide rods and an expandable/retractable drive rod. 16. The device as claimed in claim 15, wherein the drive rod is attached to a pneumatic cylinder or electrical solenoid. 17. The device as claimed in claim 13, wherein the enclosure includes a door over the opening and the chute is adapted to pivot downwardly to present its lower edge towards the opening when the door is open and to pivot upwardly and away from the opening to allow the door to be opened and closed. 18. The device as claimed in claim 13, wherein the enclosure includes a slide therein that is adapted to convey the food product from the chute to the retracted food product positioning and ejection device. 19. The device as claimed in claim 13, wherein the device includes at least one internal magazine adapted to receive a substantially vertical stack of food products therein, the bottom of the magazine having an open end alignable with the chute. 20. The device as claimed in claim 19, wherein the device includes a carousel with a multiplicity of said magazines therein. 21. The device as claimed in claim 19, wherein the carousel is rotatable about a substantially vertical axis and adapted for indexed stopping in positions aligning the open end of each of said magazines with the chute. 22. An apparatus for heating a food product, the apparatus including: a device as claimed in claim 1. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Food product vending machines are common at many public venues such as public transport stations, sporting fields, shopping centres and the like. The vending machines can be broadly categorised into three man types, namely: Refrigerating for products such as cool drinks and ice creams; Ambient for products such as sweets and crisps; and Heating for food products such as hot chips and prepared meals. A disadvantage of existing heating food product vending machines is that they are slow in operation and produce a cooked product that is inferior to that cooked by conventional methods. For example, most heating food product vending machines rely on a conventional microwave type oven which results in soggy food and require the customer to purchase the food product from a vending machine and then place it in, and subsequently remove it from, a separate microwave oven. |
<SOH> SUMMARY OF THE INVENTION <EOH>In accordance with a first aspect of the invention there is provided a device for heating a food product, the device including: an oven enclosure; at least one magnetron for emitting microwave energy; and a microwave energy focusing device associated with each magnetron and adapted to focus microwave energy towards the food product, wherein the magnetron(s) is/are disposed external the enclosure and the microwave energy focusing-device(s) is/are disposed internal the enclosure. The microwave energy focusing device(s) are preferably a horn with a first end adjacent the magnetron(s) and a second end directed towards the food product. In a preferred embodiment, the horn(s) has/have a substantially rectangular cross-section. In another embodiment, the horn(s) is/are substantially conical. In one form, the horns taper from a smaller first end to a larger second end. In another form, the first and second ends are the same size, which results in the horn(s) having the form of a parallel rectangular tube. In one embodiment, the device includes a first (upper) magnetron and a second (lower) magnetron which are desirably substantially (vertically) aligned to face one another. The long axis of the horn of the first magnetron is preferably oriented with the short axis of the second magnetron. The device preferably includes a third (lower) magnetron which is desirably substantially (horizontally) aligned side-by-side with the second magnetron. The device preferably includes an infra red heater which is desirably substantially (vertically) aligned facing the third magnetron. The device preferably includes a fourth (upper) magnetron and a fifth (upper) magnetron either side of the infra red heater &hat are desirably disposed at an angle to facing the third magnetron. The device optionally includes a sixth (lower) magnetron which is desirably substantially (horizontally) aligned side-by-side with the third magnetron. The infra red heater is desirably a single or a pair of halogen lamps. The oven enclosure desirably includes an inlet door and, an outlet door, the doors being associated with interlocks such that the magnetrons/heater can not be energised whilst either door is open. In another embodiment, the device includes a first (upper) magnetron and, desirably, second and third (side) magnetrons. The oven enclosure desirably includes a door, the door being associated with an interlock such that the magnetron(s) can not be energised whilst the door is open. The device desirably includes a conveyor in the oven enclosure between the inlet door and the outlet door. The conveyor is preferably controllable to convey a food product from the inlet door to a first heating position between the first and second magnetrons and then to a second heating position between the third, fourth and fifth magnetrons, and the heater and the fifth magnetron and then to the outlet door. The conveyor is optionally controllable to convey a food product from the second heating position to a third heating position above the sixth magnetron and then to the outlet door. The conveyor is preferably also controllable to hold the food product stationary in the first heating position for a first predetermined period of time. The conveyor is preferably also controllable to oscillate the food product in the second heating position a predetermined distance for a second predetermined period of time. The conveyor is preferably optionally controllable to hold the food product stationary in the third heating position for a third predetermined period of time. In accordance with a second aspect of the invention there is provided a food product feed assembly for a device for heating the food product, the assembly including: an apparatus for storage of a plurality of food products, the apparatus having an outlet opening with a movable sealing device; and a transfer means with a first receptacle adapted to receive the sealing device therein and a second receptacle adapted to receive one of the food products therein, the second receptacle having an outlet door adapted, upon opening, to release any food product in the second receptacle towards the device for heating the food product, the first receptacle being adjacent the outlet open when the transfer means is in a first position for receiving the sealing device and the second outlet being adjacent the outlet opening when the transfer means is in a second position for receiving a food product, wherein the second receptacle outlet door is only openable when the transfer means is in the second position such that outlet opening is maintained substantially sealed by the first receptacle's sealing device when the transfer means is in the first position and is maintained substantially sealed by the second receptacle's outlet door when the transfer means is in the second position. The transfer means is preferably adapted to receive the sealing device into the first receptacle in the first position, move to the second position and receive a food product in the second receptacle, then return to the second position for replacing the sealing device in the outlet and opening the outlet door to release the food product from the second receptacle. The transfer means is preferably adapted to reciprocally slide between the first and second positions. In an embodiment, the storage apparatus preferably includes at least one internal magazine adapted to receive a substantially vertical stack of food products therein, the bottom of the magazine having an open end alignable with the apparatus' outlet opening. The storage apparatus preferably includes a carousel with a multiplicity of said magazines therein. The carousel is desirably rotatable about a substantially vertical axis and adapted for indexed stopping in positions aligning the open end of each of said magazines with the apparatus' outlet opening. In accordance with a third aspect of the invention, there is provided a device for heating a food product, the apparatus including: a microwave oven enclosure; a food product support device within the oven enclosure, the device being of a substantially truncated conical external shape with a first larger base surface adapted to be positioned adjacent the base of the oven enclosure and a second smaller supporting surface adapted to support a food product in a position vertically displaced from the base of the oven enclosure for heating and a sloping side surface extending between the base and support surfaces, whereby the food product is able to exit the oven enclosure by sliding down the side surface when pushed from the support surface towards an opening in the oven enclosure. The device preferably includes: at least one magnetron for emitting microwave energy disposed external the enclosure; and a microwave energy focusing device disposed the enclosure and associated with each magnetron and adapted to focus microwave energy towards the food product on the support surface. The device preferably includes a hollow polyethylene base portion that includes the base and side surfaces and a teflon support portion that includes the support surface. The teflon support surface desirably includes a dipole antenna above which the food product is, in use, positioned, the antenna being adapted to focus the microwave energy towards the food product. The antenna is preferably in the form of a metal screw which is screwed into the side of the teflon support plate that is, in use, remote the food product. In accordance with a fourth aspect of the invention, there is provided a device for heating a food product, the apparatus including: an oven enclosure with an opening; a food product positioning and ejection device adapted for reciprocal movement towards and away from the opening between retracted and an extended positions; and a chute sloping downwardly into the enclosure through the opening, wherein when the device is adapted, when in the retracted position, to limit the movement of the food product into the enclosure by abutment with same further adapted to push the food product from the enclosure during movement towards the extended position. The position and ejection device preferably also includes a food product head having a leading edge substantially complimentary to the food product and a sliding mechanism adapted to extend and retract the head. The sliding mechanism desirably includes a pair of guide rods and an expandable/retractable drive rod. The drive rod is preferably attached to a pneumatic cylinder or electrical solenoid. The enclosure preferably includes a door over the opening and the chute is adapted to pivot downwardly to present its lower edge towards the opening when the door is open and to pivot upwardly to and away from the opening to allow the door to be opened and closed. Further, the enclosure desirably also includes a slide therein that is adapted to convey the food product from the chute to the retracted food product positioning and ejection device. In an embodiment, the apparatus includes at least one internal magazine adapted to receive a substantially vertical stack of food products therein, the bottom of the magazine having an open end alignable with the chute. The apparatus preferably includes a carousel with a multiplicity of said magazines therein. The carousel is desirably rotatable about a substantially vertical axis and adapted for indexed shipping in positions aligning the open end of each of said magazines with the chute. In accordance with a fifth aspect of the invention there is provided an apparatus for heating a food product, the apparatus including a device for heating a food product in accordance with the first aspect of the invention; a device for heating a food product in accordance with the third aspect of the invention and a device for heating a food product in accordance with the fourth aspect of the invention. |
Methods and primers for evaluating hiv-1 mutations |
Primer sequences and a method of using such sequences for the genotyping of HIV-1-containing samples, particularly those which have failed genotyping analysis are provided using primer sequences designed for analysis of Group B subtype of the Group M type virus. For example, a combination of primers, including at least one species of forward primer and at least one species of reverse primer where the forward primer(s) can be represented by the degenerate sequence: RARRARGGGCTGYTGGARATGTS (Seq. ID No. 9) and the reverse primer(s) can be represented by the degenerate sequence: BCHTYACYTTRATCCCSGVRTARATYTGACT (Seq. ID No.: 10) or BCHTYACYTTRATCCCSGVRTARATYTGAC (Seq. ID No. 12) are suitably employed. The selected primers, one or more from each group, can be used as reverse transcription, amplification and sequencing primers and are suitably packaged in a genotyping kit. Such a kit may include reagents in addition to the primers, such as an RNase inhibitor, a reverse transcriptase, a polymerase, and/or dNTP and ddNTP feedstocks. |
1. A primer combination comprising, in a single solution, at least one forward HIV-1 primer selected from among primers comprising a sequence represented by the degenerate sequence RARRARGGGCTGYTGGARATGTS (Seq ID No. 9) and at least one reverse HIV-1 primer selected from among primers comprising a sequence represented by the degenerate sequence AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.: 10) or GTCARATYTAYBCWGGGATYAARGTRADGV. (Seq. ID No. 12) 2. The primer combination of claim 1, wherein at least one forward primer comprises a sequence selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ID No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No.: 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ID No.: 16) 3. The primer combination of claim 1, wherein at least one reverse primer comprises a sequence selected from the group consisting of: AGTCAGATTTACCCAGGGATTAAAGTAAGGV (Seq. ID No. 4) AGTCAGATTTACCCAGGGATTAAGGTAAGGV (Seq. ID No. 5) AGTCAGATTTACCCAGGGATCAAAGTAAGGV (Seq. ID No. 6) GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 7) AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 8) GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No.: 13) GCCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No.: 14) 4. The primer combination of claim 3, wherein at least one forward primer comprises a sequence selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ID No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No.: 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ID No.: 16) 5. The primer combination of claim 4, wherein the forward and reverse primers are members of a set of degenerate forward and reverse primers, and the primer combination includes at least two species of degenerate forward and at least two species of degenerate reverse primers. 6. The primer combination of claim 5, wherein the forward and reverse primers comprise sequences as set forth in Seq. ID Nos. 1 and 7, respectively. 7. The primer combination of claim 5, wherein the forward primers are members of the set of degenerate primers comprising the sequence: GGAAAAAGGGCTGTTGGAAATGYG. (Seq. ID No.: 1) 8. The primer combination of claim 7, wherein the forward primers have sequences as set forth in Seq. ID Nos. 15 and 16. 9. The primer combination of claim 7, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No. 7) 10. The primer combination of claim 9, wherein the reverse primers have the sequence as set forth in Seq. ID Nos. 13 and 14. 11. The primer combination of claim 5, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No. 7) 12. The primer combination of claim 11, wherein the reverse primers have the sequence as set forth in Seq. ID Nos. 13 and 14. 13. The primer combination of claim 1, wherein the forward primers or the reverse primers are labeled with a detectable label. 14. The primer combination of claim 13, wherein the detectable label is a fluorescent label. 15. A genotyping kit comprising at least one forward HIV-1 primer selected from among primers comprising a sequence represented by the degenerate sequence RARRARGGGCTGYTGGARATGTS (Seq ID No. 9) and at least one reverse HIV-1 primer selected from among primers comprising a sequence represented by the degenerate sequence AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.: 10) or GTCARATYTAYBCWGGGATYAARGTRADGV. (Seq. ID No. 12) 16. The kit of claim 15, wherein at least one forward primer is selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ID No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No.: 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ID No.: 16) 17. The kit of claim 15, wherein at least one reverse primer is selected from the group consisting of: AGTCAGATTTACCCAGGGATTAAAGTAAGGV (Seq. ID No. 4) AGTCAGATTTACCCAGGGATTAAGGTAAGGV (Seq. ID No. 5) AGTCAGATTTACCCAGGGATCAAAGTAAGGV (Seq. ID No. 6) GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 7) AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 8) GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No.: 13) GCCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No.: 14) 18. The kit of claim 17, wherein at least one forward primer is selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ID No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No.: 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ID No.: 16) 19. The kit of claim 15, wherein the forward and reverse primers are members of a set of degenerate forward and reverse primers, and the primer combination includes at least two species of degenerate forward and at least two species of degenerate reverse primers. 20. The kit of claim 19, wherein the forward primers are members of the set of degenerate primers comprising the sequence: GGAAAAAGGGCTGTTGGAAATGYG. (Seq. ID No.: 1) 21. The kit of claim 20, wherein the forward primers have the sequence as set forth in Seq. ID Nos. 15 and 16. 22. The kit of claim 20, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No. 7) 23. The kit of claim 22, wherein the forward primers have the sequence as set forth in Seq. ID Nos. 15 and 16. 24. The kit of claim 23, wherein the reverse primers have the sequence as set forth in Seq. ID Nos. 13 and 14. 25. The kit of claim 19, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC. (Seq. ID No. 7) 26. The kit of claim 25, wherein the reverse primers have the sequence as set forth in Seq. ID Nos. 13 and 14. 27. The kit of claim 15, wherein the forward primers or the reverse primers are labeled with a detectable label. 28. The kit of claim 27, wherein the detectable label is a fluorescent label. 29. The kit of claim 15, wherein the kit further comprises one or more reagents selected from the group consisting of an RNase inhibitor, a reverse transcriptase, a polymerase, and dNTP and ddNTP feedstocks. 30. The kit of claim 29, wherein the forward primers or the reverse primers are labeled with a detectable label. 31. The kit of claim 30, wherein the detectable label is a fluorescent label. 32. A method for evaluating a sample suspected of containing a non-B Group M HIV-1 virus or a Group O HIV-1 virus to assess the type of the virus, comprising the steps of: treating the sample to recover viral RNA; reverse transcribing the recovered viral RNA; sequencing the reverse transcription product; and using the results of the sequencing step to establish the genotype of the tested virus, wherein at least one of the reverse transcription step and the sequencing step is performed using a primer combination in accordance with claim 1. 33. The method of claim 32, further comprising the step of performing a parallel genotyping procedures that is designed to evaluate B-subtype virus. 34. The method of claim 32, wherein the sample is one that has previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype virus. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The present application relates to methods and primers for evaluating mutations in human immunodeficiency virus (HIV-1). Human immunodeficiency virus is the primary causative agent of Acquired Immune Deficiency Syndrome (AIDS), or AIDS-related complex (ARC). AIDS is an infectious disease characterized by generalized immune suppression, multiple opportunistic infections, and neurological disease. Although HIV is regarded to be the primary causative agent of AIDS, multiple co-infecting clinical viral and bacterial pathogens are responsible for the cluster of clinical syndromes seen in AIDS patients. The clinical course of HIV infection is remarkable for its great variability. The clinical effects include increased susceptibility to opportunistic infections and rare cancers, such as Kaposi's sarcoma, neurological dysfunctions, leading to AIDS related dementias, and generalized immune dysfunctions. The HIV-1 virus is a member of the lentivirus group of the retroviruses. Like all other retroviruses, it has an RNA genome which is replicated via the viral reverse transcriptase, into a DNA provirus which becomes integrated into the host cell genome. Various drugs are presently available to treat HIV. They fall into three different classes—nucleoside reverse transcriptase inhibitors, or NRTI's such as zidovudine, didanosine, zalcitabine, lamivudine, stavudine, abacavir, tenofovir, foscamet; non-nucleoside reverse transcriptase inhibitors or NNRTI's such as nevirapine, delavirdine, efavirenz; and protease inhibitors or PI's such as saquinavir, indinavir, ritonavir, nelfinavir, amprenavir, and lopinavir with ritonavir. Although some of these drugs may have similar modes of actions, resistance to one does not necessarily confer resistance to another. Each of the presently available anti-retroviral compounds used to treat AIDS suffers from some disadvantages, including transient CD4 cell count effects, incomplete inhibition of viral replication, toxicity at prescribing doses, and emergence of resistant forms of the virus. As a result, combination therapies are being used to treat patients. Several in vitro studies have suggested that the combination of two or more anti-HIV compounds will more effectively inhibit HIV replication than each drug alone. Over the last several years, the standard of patient care has evolved such that HIV patients are routinely treated with triple drug combination therapy. Combination therapy has significantly decreased HIV associated morbidity and mortality. However, a large number of patients are not able to achieve or maintain complete viral suppression even with combination therapy. Drug resistance is the consequence of this incomplete viral suppression. The very high mutagenicity rate of HIV virus (due to the error-prone nature of the viral reverse transcriptase) and the genetic variability of the virus have led to many HIV variants with decreased drug susceptibility. HIV-1 replication depends on a virally encoded enzyme, reverse transcriptase (RT) that copies the single-stranded viral RNA genome into a double-stranded DNA/RNA hybrid. The HIV-1 RT enzyme lacks a 3′ exonuclease activity which normally helps the “proof-reading” function of a polymerase enzyme to repair errors. HIV-1 has a 9200-base genome and, on average, RT makes at least one error during every transcription of 10,000 bases copied. Therefore, each progeny virus produced may be slightly different from its predecessor. The inaccuracy of RT results in an estimated in vivo forward mutation rate of 3×10 −5 per base incorporated. Mansky LM. Virology. 1996; 222:391-400. Many mutations introduced into the HIV-1 genome will compromise the infectivity of the virus; while some are compatible with virus infectivity. The frequency with which genetic variants of HIV-1 are detected in patients is a function of each variant's replicative vigor (fitness) and the nature of the selective pressures that may be acting on the population within the infected patient, Volberding PA, et al., Antiretroviral therapy for HIV infection: promises and problems. JAMA. 1998;279:1343-4. Selective pressures existing in HIV-1 infected persons include anti-HIV-1 immune responses, the availability of host cells that are susceptible to virus infection in different tissues, and the use of antiretroviral drug treatments. The mutagenicity of the virus represents a significant barrier to treatment of the disease. Moreover, the mutagenicity of the virus makes testing for genetic changes in the virus very difficult. Testing for changes in DNA sequence can proceed via complete sequencing of a target nucleic acid molecule, although many persons in the art believe that such testing is too expensive to ever be routine. Attention has been increasingly focused on failure to achieve or maintain viral suppression. Several factors may contribute to drug failure, including poor patient adherence to treatment regimen, drug potency, pharmacokinetic issues (related to antiretroviral drug absorption, metabolism, excretion, and drug-drug interactions) and drug resistance Vella S, et al.Aids. 1998; 12:S147-8.b. Although multiple combinations of antiretroviral drugs may suppress HIV-1 below the level of HIV-1 RNA detection, this does not mean that the virus is not replicating in “sanctuary” compartments. A therapy regimen may decrease HIV-1 RNA to below detectable levels, but within months the HIV-1 viral load may increase again. If HIV-1 is replicating, resistance to therapy can develop. Because HIV-1 replication occurs rapidly, large numbers of virus variants, including those that display diminished sensitivity to antiretroviral drugs, are generated. Mutations that confer resistance to antiretroviral drugs can be present in HIV-1 infected persons before antiretroviral therapy is initiated due to transmission from an individual having had prior therapy or due to spontaneously arising mutations. Once drug therapy is initiated, the pre-existing population of drug-resistant viruses can rapidly predominate because of a selective advantage. For drugs such as lamivudine or nevirapine (and other NNRTIs), a single nucleotide change in the HIV-1 RT gene can confer 100- to 1,000-fold reductions in drug susceptibility (Schinazi RF, et al Int Antiviral News. 1997;5:129-42). In vivo antiretroviral activity of these drugs, when used alone, is largely lost within 4 weeks of starting therapy due to the rapid outgrowth of drug-resistant variants, Richman DD, et al. Nevirapine resistance mutations of human immunodeficiency virus type 1 selected during therapy. J Virol. 1994; 68:1660-6. Some mutations selected by antiretroviral drugs directly affect viral enzymes and cause resistance via decreased drug binding, whereas others have indirect effects., Condra JH, et al. J Virol. 1996; 70:8270-6, and Harrigan PR, et al. J Virol. 1996; 70:5930-4. Treatment with different antiretroviral drugs may select for HIV-1 variants that harbor the same, or related, mutations. Treatments may even select for the outgrowth of HIV-1 variants that are resistant to drugs to which the patient has not yet been exposed (cross-resistance). Mutations can be detected by a technique called “single stranded conformational polymorphism” (SSCP) described by Orita et al., Genomics 5: 874-879 (1989), or by a modification thereof referred to as dideoxy-fingerprinting (“ddF”) described by Sarkar et al, Genomics 13: 441-443 (1992). SSCP and ddF both evaluate the pattern of bands created when DNA fragments are electrophoretically separated on a non-denaturing electrophoresis gel. This pattern depends on a combination of the size of the fragments and the three-dimensional conformation of the undenatured fragments. Thus, the pattern can not be used for sequencing, because the theoretical spacing of the fragment bands is not equal. Others have attempted to determine the genetic status of the virus by probe-based analyses, in which the presence or absence of a specific viral mutation is determined by whether or not an inquiry probe hybridizes to the viral nucleic acid under specific hybridization conditions. For example, Stuyver et al. (PCT International Publication No. WO 99/67428) describe the use of nucleic acid probe panels in a reverse hybridization assay, and Gingeras et al. describe the use of probes to detect pairs of mutations (PCT International Publication No. WO 92/16180). Such assays may suffer from several deficiencies, including being unable to detect new viral mutants, and may not be sensitive enough to cope with the complexity of many mutations within a region. Other methods include the use of resistance test vectors to culture host cells with virus derived from a patient. The vector may include an indicator gene, such that when a test amount of an anti-HIV drug is added to the cell culture, in an attempt to measure the resistance of the cloned virus to the drug in the cell culture system. (Parkin et al, U.S. Pat. No. 5,837,464). By far, the most direct information about the genetic composition of the virus in a patient is to directly determine the sequence of the virus (genotyping). The positive clinical benefit of genotyping has been demonstrated in controlled retrospective and prospective intervention based studies such as the Genotypic Antiretroviral Resistance Testing (GART)(Baxter JD, et al. A randomized study of antiretroviral management based on plasma genotypic antiretroviral resistance testing in patients failing therapy. AIDS; 2000;14;F83-F93 and VIRADAPT studies, Durant J, et al. Drug-resistance genotyping in HIV-1 therapy: the VIRADAPT randomised controlled trial, Lancet. 1999; 353:2195-9 and Lancet 1999 September 25;354(9184): 1128. The greater reduction in viral load when the identification of mutations associated with resistance to specific antiretroviral drugs is used as an adjunct to standard of care in treated patients has demonstrated the clinical benefit of the adjunctive use of genotyping to guide therapeutic decisions. One of the difficulties of genotyping is the inherent variability and heterogeneity of the virus. Viruses have been found to be serologically different on the basis of reactivity of the host immune system to the virus, and on the basis of ELISAs, antibody dependent cellular cytotoxicity assays (ADCC's), and CD4 inactivation procedures. The extensive serologic heterogeneity of the virus is also mirrored in the genetic sequences of the virus. As a result, the HIV-1 virus has been categorized into two genetic groups, based on phylogenetic reconstruction using the viral DNA sequences. Group O (outlier) represents a minority of the HIV-1, and is thought to originate in West Africa, perhaps in Cameroon. The vast majority of HIV-1 sequences that are associated with clinical AIDS are of the Group M (major) type. Within the M group, there are various subtypes (also referred to as clades), having different geographic distributions, as shown below. HIV-1 Group M Subtype Predominant geographical location A (including A1 and A2) Central Africa B Europe, North and South America, Australia, and Asia C East and South Africa, India D Central Africa E Southeast Asia (Thailand) F (including F1 and F2) South America (Brazil) and Eastern Europe (Romania) G Central Africa, Russia, and Portugal H Central Africa and Taiwan I Cyprus J Central Africa and Europe K N O Each subtype differs from the others in amino acid composition by at least 20% in the viral envelope region, and at least 15% in the viral gag region. Within each subtype, the differences in env can be up to 10%, while the differences in gag can be Up to 8%. The viral reverse transcriptase and protease genes, the sites known to be associated with drug resistance, are found on the viral pol transcript. It is estimated that there is only a 75% similarity in amino acids between subtypes for HIV-1 pol. The variability at the nucleic acid sequence level is even greater. Retroviruses have propensity to recombine with related retroviruses. If one cell is infected with multiple viruses, recombination events may occur, leading to recombinant subtypes that may then infect other individuals. In addition to the various subtypes known, circulating recombinant subtypes have been observed, such as A/E (Central Africa), A/G (West and Central Africa), A/B (Kalingrad), A/G/H/K (Cyprus/Greece) as well as D/F, and B/D recombinants. To date, the majority of clinical research in North America and Western Europe has been directed to the Group M subtype B, due to its relative prevalence over the other Group M subtypes. However, as the AIDS epidemic has spread, non-B subtypes are appearing with increasing frequency in North America and Europe. In some instances, for example, an initial infected person with a non-B infection may serve as the infection focal point for a local group, such that in some North American centers (which remain predominantly B subtype), there can be entire localized population groups infected with non-B subtypes. For example, Group O and Subtype G of Group M have recently been found in AIDS patients arriving in the United States from Africa. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides primer sequences, and a method of using such sequences for the genotyping of HIV-1-containing samples, particularly those which have failed genotyping analysis using primer sequences designed for analysis of Group B subtype of the Group M type virus. Thus, a first aspect of the present invention is a combination of primers, including at least one species of forward primer and at least one species of reverse primer. The forward primer(s) can be represented by the degenerate sequence: RARRARGGGCTGYTGGARATGTS (Seq ID No. 9) optionally with an additional G at either or both ends, where the non-standard letters (those others than A, C, G and T) reflect choices of bases in accordance with conventional nomenclature as outlined below. There are a total of 128 possible sequences represented by this sequence. Variations of these sequences may also be employed. For example, Seq. ID Nos. 11, 15 and6 show primers where one G is added. Similarly, the reverse primer(s) can be represented by the degenerate sequence: AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.: 10) or GTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No. 12) In the former case, there are a total of 3456 possible primer species within this definition. In the latter case, the degenerate sequence also represents 3456 possible sequences, differing only in the initial A. The selected primers, one or more from each group, can be used as reverse transcription, amplification and sequencing primers. The primers are suitably packaged in a genotyping kit. Such a kit may include reagents in addition to the primers, such as an RNase inhibitor, a reverse transcriptase, a polymerase, and/or dNTP and ddNTP feedstocks. The primers are suitably employed in the method of the invention. In accordance with this method, a sample suspected of containing a non-B Group M HIV-1 virus or a Group O HIV-1 virus is treated to recover viral RNA. The recovered viral RNA is reverse transcribed to DNA, which is sequenced using the primers of the invention. The resulting sequence information is used to establish the genotype of the tested virus, i.e., to determine to which subtype the virus in the sample belongs. The method of the invention may be practiced in parallel with genotyping procedures that are designed to evaluate B-subtype virus. Alternatively, the method of the invention is practiced on samples that have previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype virus. detailed-description description="Detailed Description" end="lead"? |
Process for the preparation of citalopram |
The present invention relates to an improved and industrially advantageous process for the preparation of citalopram represented by the following Formula I, and pharmaceutically acceptable acid addition salt thereof. |
1. A process for the preparation of citalopram of Formula I, comprising reacting 5-halophthalane compound of Formula III, wherein X is bromo or iodo with a cyanide source in a suitable solvent in the presence of an organic base and isolating citalopram of Formula I, as the free base or in the form of a pharmaceutically acceptable acid addition salt thereof. 2. The process according to claim 1 wherein the cyanide source is any cyanide ion donor. 3. The process according to claim 2 wherein the cyanide ion donor is selected from the group consisting of potassium cyanide, sodium cyanide, ammonium cyanide, cuprous cyanide, zinc cyanide, ammonium cynide, tetra alkylammonium cyanide, and mixtures thereof. 4. The process according to claim 1 wherein the suitable solvent is a polar aprotic solvent. 5. The process according to claim 4 wherein the polar aprotic solvent is selected from the group consisting of dimethylformamide, dimethylacetamide, N-methylpyrrolidone, N-methylpiperidinone, 1,3-dimethyl-3,4,5,6-tetrahydro (2H) pyrimidinone (DMPU), and mixtures thereof. 6. The process according to claim 5 wherein the polar aprotic solvent is dimethylformamide. 7. The process according to claim 1 wherein the organic base is selected from the group consisting of trimethylamine, triethylamine, dilsopropylamine, picolines, pyridine, pyridine derivatives (wherein pyridine derivatives are 2,6-lutidine or 4-methyl pyridine), quinoline, 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), piperidine, aryl substituted amines (e.g. aniline), dicyclohexylamine, and mixtures thereof. 8. The process according to claim 7 wherein the organic base is pyridine or quinoline. 9. The process according to claim 7 wherein the organic base is used in stoichiometric amount or in excess ranging from about 1-5 molar equivalents per equivalent of the compound of Formula III. 10. The process according to claim 1 wherein the reaction is carried out at a temperature ranging from about 120° C. to 170° C. 11. The process according to claim 10 wherein the reaction is carried out at a temperature ranging from about 135 to 145° C. 12. The process according to claim 1 wherein the citalopram is isolated as the hydrobromide salt. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Citalopram is a well known anti-depressant drug and is chemically known as 1-[3-(dimethylamino)propyl]-1-(4-fluorophenyl)-1,3-dihydro-5-isobenzofurancarbonitrile. It is a selective centrally acting serotonin (5-hydroxy-tryptamine; 5-HT) re-uptake inhibitor and was described for the first time in U.S. Pat. No. 4,136,193. Citalopram is further used in the treatment of dementia and cerebrovascular disorders as disclosed in European Patent No. 474,580. A method for preparing citalopram is described in U.S. Pat. No. 4,136,193. According to the invention, 4-halo-2-(hydroxymethyl)phenyl-(4′-fluorophenyl)-(3-dimethylaminopropyl)methanol represented by the following Formula II, wherein X represents halogen, is reacted with a dehydrating agent to effect ring closure for obtaining 5-halophthalane compound represented by the following Formula III, wherein X represents halogen. The compound of Formula III is reacted with cuprous cyanide in an inert organic solvent to give citalopram of Formula I. However, the process is unsuitable for accomplishment on an industrial scale since exchange reaction of the 5-halophthalane compound and cuprous cyanide does not go to completion even after refluxing them overnight in dimethylformamide thereby making it very difficult to separate the resulting citalopram from the corresponding 5-halo compound. WO 00/13648 discloses the preparation of citalopram by reacting the 5-halophthalane compound of Formula III wherein X is bromo or iodo or the corresponding triflate compound with a cyanide source in the presence of a palladium catalyst and a catalytic amount of Cu + or Zn 2+ or with zinc cyanide in the presence of a palladium catalyst, and isolation of the corresponding 5-cyano phthalane compound i.e. citalopram. The cyanide source is chosen from potassium cyanide, sodium cyanide, ammonium cyanide and tetra alkyl ammonium cyanide. A variant of this process is described in another PCT application, WO 00/11926, wherein the cyanide exchange is achieved with a cyanide source in the presence of a nickel catalyst. The processes described in the above PCT applications for the manufacture of citalopram suffer from the following limitations and for various reasons stated below are not suitable for commercial purposes. The reaction is carried out in the presence of palladium or nickel complexes which are very expensive, inconvenient to handle at commercial scale as they are air sensitive and light sensitive, highly flammable, cancer suspect agents and have limited commercial availability. The reaction conditions are unsafe and are burdened with the risk of explosion and fire as the processes make use of solvents like tetrahydrofuran and diethyl ether. Another process described in PCT application WO 01/02383 comprises the conversion of 5-halophthalane of Formula III to the corresponding Grignard reagent which is then converted to citalopram via reaction with compounds containing a cyano group bound to a leaving group. An alternative process involves obtaining an aldehyde from the Grignard reagent and its transformation to cyano group via an oxime or hydrazone intermediate. The process described in WO 01/02383 involves many steps and make use of raw materials which are not available commercially. Accordingly, none of the processes described heretofore are completely satisfactory at a commercial scale. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is an object of the present invention to solve the problems associated with the prior art and to provide an efficient and commercially viable process for producing citalopram via an improved cyano exchange process. The process is simple and provides obvious benefits with respect to economics and convenience to operate at a commercial scale. More particularly, the present invention relates to a process for the preparation of citalopram of Formula I comprising reacting 5-halophthalane compound of Formula III, wherein X is bromo or iodo with a cyanide source in a suitable solvent, in the presence of an organic base and isolating corresponding 5-cyano compound i.e. citalopram of Formula I as the free base or in the form of a pharmaceutically acceptable acid addition salt thereof. In a further aspect the invention relates to the above process which produces S-enantiomer of Formula I. The cyanide source may be any source which is a cyanide ion donor. Preferred sources are potassium cyanide, sodium cyanide, ammonium cyanide, cuprous cyanide, zinc cyanide, tetra-alkylammonium cyanide or mixtures thereof. More preferred sources are cuprous cyanide and zinc cyanide. The cyanide source may be used in stoichiometric amount or in excess. Preferably, 1 to 2 molar equivalents per equivalent of compound of Formula III is used. The term “suitable solvent” means any polar aprotic solvent. Preferably, the solvent may be selected from the group consisting of dimethylformamide, dimethylacetamide, N-methylpyrrolidone, N-methylpiperidinone, 1,3-dimethyl-3,4,5,6-tetrahydro(2H) pyrimidinone (DMPU), or mixtures thereof. Suitable organic base includes trimethylamine, triethylamine, diisopropylamine, picolines, pyridine, pyridine derivatives such as 2,6-lutidine, 4-methylpyridine morpholine, morpholine derivatives, quinoline, 1,8-diazabicyclo[5.4.0] undec-7-ene (DBU), piperidine, aryl substituted amines such as aniline and dicyclohexylamine, or mixtures thereof. Preferably, pyridine or quinoline is used. The organic base may be used in stoichiometric amount or in excess. Preferably, about 1 to 5 molar equivalents per equivalent of starting material of Formula III is used. We believe that nitrogen containing organic base plays a crucial role and facilitates the completion of reaction. The base is believed to form a complex of Formula IV in case of cuprous cyanide, with the cyanide source which facilitates the exchange of halogen with nitrile via a transient state which involves a coordination complex of formula V, The reaction is generally carried out at a temperature ranging from about 120° C. to 170° C., preferably, at 135° C. to 145° C. The reaction completion may take from about 3 hours to several hours. The intermediate of Formula III wherein X is bromo or iodo may be prepared from bromo or iodophthalide respectively, as described in U.S. Pat. No. 4,136,193, which is hereby incorporated herein by reference. Citalopram of Formula I may be obtained as the free base or converted into its pharmaceutically acceptable acid addition salts. Examples of such salts include those formed with organic acids such as maleic, fumaric, benzoic, ascorbic, succinic, oxalic, bismethylenesalicylic, methanesulfonic, ethanedisulfonic, acetic, propionic, tartaric, salicylic, citric, gluconic, lactic, malic, mandelic, cinnamic, aspartic, stearic, palmitic, itaconic, glycolic, glutamic and benzene sulfonic acids or with inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric and nitric acid. The acid addition salts of the compounds may be prepared by methods known in the art. The base is reacted with either the calculated amount of acid in a water miscible solvent such as ethanol or acetone and the salt is isolated after concentration and cooling or with an excess of the acid in a water immiscible solvent such as ether, dichloromethane or toluene with the salt separating out spontaneously. detailed-description description="Detailed Description" end="lead"? |
Nucleic acids coding for a protein interacting with a porin channel |
The invention relates to an isolated nucleic acid coding for at least a partial sequence of a protein kinase of the mitogenic signaling cascade, in particular c-raf, wherein the partial sequence interacts with VDAC or BAX channels in mitochondrial membranes, or with a nucleic acid hybridizing said nucleic acid or homologues or derivatives of said nucleic acid, to proteins or peptides coded for by such a nucleic acid and to a screening method. |
1. An isolated nucleic acid that encodes at least one partial sequence of a protein kinase of the mitogenic signaling cascade, wherein the partial sequence interacts with a porin channel or a nucleic acids capable of hybridizing with said nucleic acid or homologues or derivatives of said nucleic acid. 2. An isolated nucleic acid according to claim 1, wherein the interaction is a reduction in the permeability of porin channels comprising, VDAC, BAX or bacterial porin channels. 3. An isolated nucleic acid according to claim 1, wherein the nucleic acid codes for a protein or peptide containing the sequence c-raf-1 (338 to 627) or an active fragment thereof or a nucleic acid that hybridizes such a nucleic acid. 4. A cDNA prepared from a nucleic acid according to one of claims 1 to 3. 5. An isolated recombinant vector containing a nucleic acid according to one of claims 1 to 3. 6. A protein or peptide encoded by a nucleic acid according to one of claims 1 to 3. 7. A method for treating AIDS, neurodegenerative diseases, for protecting non-transformed cells in a tissue containing cancer cells, or treating bacterial infections comprising administering a pharmaceutical composition comprising a nucleic acid or a protein or peptide encoded by a nucleic acid according to one of claims 1 to 3. 8. A screening method for determining a substance causing the closure of VDAC or BAX or bacterial channels comprising administering a pharmaceutical composition comprising a nucleic acid according to one of claims 1 to 3 or of a protein or peptide coded for hereby. 9. A method for screening for substances capable of modulating porin channels comprising, VDAC, of BAX, or bacterial porin channels, comprising the following steps: a) providing a solution comprising a porin further comprising, VDAC, BAX, or a bacterial porin that is incubated with a partial sequence of raf, b) contacting the solution of step a) with a membrane positioned in an electrolyte, c) applying an electrical potential difference between different sides of the membrane, at time t=0 and beginning with t=0 or at a defined time after t=0, measuring an electrical current caused by the potential difference or a charge transport through the membrane as a function of time, d) comparing a value measured in step c) to a value which has been measured with an inactive form or an active form of raf. 10. A method for identifying raf activating substances for preparing a pharmaceutical composition for treating a disease according to claim 7, comprising the following steps: a) reacting target cells with a prospective active ingredient or a mixture of prospective active ingredients, and cultivating the target cells, b) measuring the expression and/or concentration of raf protein after a pre-defined time, and the obtained measured value is compared to a measured value which has been obtained without addition of a prospective active ingredient, and c) selecting a prospective active ingredient or a mixture of prospective active ingredients for which an increase of in the expression and/or concentration of raf protein was found in step b). 11. A method for identifying raf activating substances for preparing a pharmaceutical composition for treating a disease according claim 7, comprising the following steps: a) identifying raf inhibitors naturally occurring in target cells comprising substances that bind to the kinase domain of raf or substances that down-regulate the expression of raf, b) reacting a substance identified in step a) in a binding assay with a prospective active ingredient or a mixture of prospective active ingredients, and examining the binding capability of the substance with the prospective active ingredient, and c) selecting a prospective active ingredient or a mixture of prospective active ingredients for which a binding event has been detected in step b). 12. The method of claim 9, wherein the porin comprises a defined partial sequence of VDAC, BAX, or a bacterial porin. 13. The method of claim 10, wherein the raf comprises c-raf-1. 14. The method of claim 10, wherein in step c), a mixture of prospective active ingredients is selected and a deconvolution is performed comprising individual measurement of the active ingredients of the mixture. 15. The method of claim 11, wherein the substance identified in step a) is isolated or purified. 16. The method of claim 11, wherein in step c), a mixture of prospective active ingredients is selected and a deconvolution is performed comprising individual measurement of the active ingredients of the mixture. 17. The method of claim 11, wherein the method further comprises the steps according to claim 10. 18. An isolated nucleic acid according to claim 3, wherein the interaction is a reduction in the permeability of the porin channels comprising VDAC, BAX or bacterial porin channels. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The raf protein in its various isoforms c-raf, B-raf and A-raf plays an important role in the regulation of the proliferation and differentiation of cells. raf is an effector kinase of ras and an important member in the mitogenic cytoplasmic protein kinase (MAPK) signaling cascade (see e.g. Daum, O., et al., Trends Biochem. Sci. 19:474-479 (1994)). raf proto-oncogenes are highly conserved genes coding for serine/threonine specific kinases of the cytoplasm. These kinases have functions in the mitogenic signal transduction. This cascade transfers signals from receptor tyrosine kinases via ras, raf, MEK and ERK to targets in the cytoplasm and basically for the regulation of the proliferation and differentiation of the cells. The role of c-raf-1 in the classic mitogenic MAP kinase cascade is rather well researched. For details, reference is made here as an example only to U. R. Rapp in The Oncogene Handbook, T. Curran et al., Eds, Elsevier Science Publishers, The Netherlands, 1988, pages 115-154. c-raf-1 is practically ubiquitous in the human organism. With the transduction of an apoptosis signal into a cell, there are changes of the permeability of membranes of the mitochondria. An increase of the permeability of these membranes will lead to a translocation of the apoptotic protein cytochrome C into the cytoplasm, thereby finally proteolytic proteins called caspase being activated. These proteins lead to the apoptosis. The permeability of mitochondrial membranes is determined, among other factors, by the permeability of the mitochondrial porin channels VDAC (voltage-dependent anion channel). The permeability is in addition influenced by a protein family to which Bcl-2, Bcl-X L , BAX and BAK belong. Bcl-2 acts protectively and binds probably to VDAC. BAX is an integral membrane protein and promotes apoptosis. BAX and Bcl-2 can heterodimerize, and an overexpression of BAX overcompensates the protective effect of Bcl-2. For a deeper insight, reference is made as an example only to Zhou, M., et al. J. Biol. Chem. 273:11930-11936 (1998) and Shimizu, M., Nature (Asia) 399:483 (1999). It is common to the members of the Bcl-2 family that there are four regions with amino acid homology, BH1, BH2, BH3 and BH4. These domains are essential for the dimerization and/or the function of the different members. In particular the presence or absence of BH4 seem to play an important role for the antiapoptotic or proapoptotic effect (see e.g. Wang, H.-G. et al., Cell 87:629-638 (1996)). For instance Bcl-2 comprises BH4, whereas BAX does not comprise BH4. From the document Wang, H.-G. et al., Cell 87:629-638 (1996), it is known in the art that raf-1 interacts with Bcl-2. According to this document, BH4 is essential for this interaction. An association raf-1/BAX has not been found, rather has been negated. The results are subject to discussion. Various diseases are accompanied by a disturbance of the natural cell death programming. A lacking function of the natural cell death is for instance associated with cancer or autoimmune diseases. In contrast thereto, an excessive cell death comes with diseases such as AIDS and neurodegenerative diseases. But infections with pathogenic bacteria may also be accompanied by a disturbance of the natural cell death, bacterial porins being translocated into a cellular membrane and triggering apoptosis of the target cells there. For instance from the document The EMBO Journal 18:339-352 (1999) it is known in the art that the porin PorB in its different variants translocates from Neisseria gonorrhoeae into artificial membranes as well as into cellular target membranes, in particular the outer mitochondrial membrane. These considerations generally apply to Gram-negative bacteria. The relationship of natural mitochondrial porins to bacterial porins has by the way been described already for instance for Escherichia coli , Salmonella typhimurium and Pseudomonas aeruginosa in the document Biochimica et Biophysica Acta 686:204-214 (1982). Technical Object. The invention is based on the technical object to inhibit an undesired cell death and to provide suitable active ingredients for treating diseases accompanied by an undesired cell death, in particular AIDS, neurodegenerative diseases, or infections accompanied by an undesired cell death. Finding the Invention is Based On. Various experiments with regard to membrane permeability of VDAC or BAX channels were performed in synthetic membranes. Herein, it was found that with an incubation of VDAC or BAX with c-raf, the channels remain closed. In contrast thereto, the channels are open with an incubation of VDAC or BAX with an inactive form of the c-raf. The found interaction of raf with VDAC or BAX may be performed directly or indirectly by mediating substances, possibly Bcl-2. It can further be assumed that due to the similarity between on the one hand natural mitochondrial porins, VDAC and/or BAX, and on the other hand bacterial porins, the latter can also be inhibited or closed by interaction with raf. Basics of the Invention. The invention relates to a nucleic acid coding for at least a partial sequence of a protein kinase of the mitogenic signaling cascade, the partial sequence interacting with porins, in particular VDAC, BAX channels in mitochondrial membranes or with bacterial porin channels or a nucleic acid hybridizing such a nucleic acid or homologues or derivatives of said nucleic acids. The term nucleic acid in particular includes DNA, RNA and PNA. Further subsumed to the term are double-stranded nucleic acids as well as single-stranded nucleic acids and thus also nucleic acids being complementary to each other. Silent mutations are also nucleic acids according to the invention. Silent mutations are variants in the sequence which do not lead to a functional difference, referred to the interaction with VDAC or BAX, of the variant compared to the natural non-mutated sequence. Silent mutations may be alleles or artificial mutations. Derivatives are also covered by the invention. Derivatives are non-natural chemical modifications. Nucleic acids hybridizing nucleic acids according to the invention are such ones which hybridize under stringent conditions. Stringency typically occurs in a temperature range of 5° C. to 25° C. below the melting temperature at the hybridization. By stringent conditions is meant a hybridization at at least 95% sequence identity, preferably 98%. With regard to the hybridization method on which these definitions are based, reference is made to the document Sambrook, J. M. et al., A laboratory manual, Cold Spring Harbor Laboratory Press (1989) and Southern, E. M., J. Mol. Biol. 98:503 (1975). As protein kinases of the mitogenic signaling cascade, in particular A-raf, B-raf or c-raf may be used. The nucleic acid according to the invention may also be a raf partial sequence only, namely the kinase domain CR3 or active partial sequences therefrom as well as silent mutations and/or derivatives herefrom. CR3 is above the amino acid 302 in the range up to 648. Insofar the nucleic acid may for instance be a nucleic acid coding for Δraf(26-302). It seems to be important that the nucleic acid codes for an active form of the kinase or kinase-active part hereof or a homologous protein or peptide. By means of nucleic acids according to the invention, a search can be performed for substances interacting with VDAC, BAX or bacterial porin channels. On the one hand, in case of an indirect interaction, substances can be searched which bind to that part of raf having before been found as essential for the interaction. On the other hand, such nucleic acids may also serve as a model for substances of the same function having a higher efficiency. Therefore, the invention also relates to a screening method for determining substances modulating VDAC, BAX or bacterial porin channels, comprising the following steps: a) a VDAC, BAX or bacterial porin channel, as an option a defined partial sequence thereof only, is incubated with a sample substance, in particular a partial sequence of raf, b) the solution of step a) is brought into contact with a membrane positioned in an electrolyte, c) the membrane of step b) is subjected at a time t=0 to an electrical potential difference between different sides of the membrane, and beginning with t=0 or at a defined time after t=0, the current caused by the potential difference or the charge transport through the membrane is measured preferably in dependence of the time, d) the value measured in step c) is compared to a value which has been measured under identical conditions, however with an inactive or active form of raf. Hereby, it can be determined, for instance with regard to the inactive form, whether there is any inhibition at all, and for instance with regard to the active form, whether the inhibition is stronger than for active raf. Preferred is a nucleic acid according to the invention wherein the interaction is a reduction of the permeability of VDAC, BAX or bacterial porin channels. Preferably, the nucleic acid codes for an active protein or peptide comprising the sequence c-raf-1 (338 to 627) or an active fragment herefrom or is a nucleic acid hybridizing such a nucleic acid or codes for a protein or peptide consisting of the sequence c-raf-1 (338 to 627) or is a nucleic acid hybridizing such a nucleic acid. It may also be a cDNA. Preferably, for the purpose of this invention, it is human raf. For research purposes, it may however also be raf of non-human mammals. The invention further relates to an isolated recombinant vector comprising a nucleic acid according to the invention or an expression plasmid comprising this nucleic acid. For the purpose of a stable expression, a DNA fragment, for instance gag, coding for a suitable viral protein may also be used herein (fusion gag with for instance c-raf or c-raf fragments). By means of the expression plasmid, a transformant may be formed which in turn can be used for preparing the protein or peptide coded for by the nucleic acid. For this purpose, the transformant is cultivated in a suitable way following conventional methods. The invention further relates to a protein or peptide coded for by a nucleic acid according to the invention. Subject matter of the invention is finally in particular the use of a nucleic acid according to the invention or of a protein or peptide coded for thereby for preparing a pharmaceutical composition for treating AIDS or neurodegenerative diseases or for protecting non-transformed cells in a tissue containing cancer cells or bacterial infections. It is made use herein of that the nucleic acid according to the invention or the protein or peptide coded for thereby acts in an antiapoptotic manner and prevents a (premature) cell death with the consequence of a corresponding disease. In the case of AIDS, the T-lymphocytes are protected. In the case of neurodegenerative diseases, nerve cells are protected from a (irreparable) cell death. For a cancer therapy using cell poisons directed to cells proliferating in an uncontrolled manner, normal healthy cells can be protected from the undesired cell death by the action of the cell poison. The invention finally relates to a screening method for determining substances activating raf and thus being suitable for preparing pharmaceutical compositions for treating the above diseases, said substances preferably being low-molecular (<10,000 da, preferably <5,000 da). As a screening method is insofar also understood a method for verifying the raf activation by a prospective active ingredient. In principle, such a screening method can be directed to substances which directly or indirectly cause in a cell model an increase of the raf concentration. This may for instance be substances regulating the raf expression up. They may however also be substances which in turn inhibit the raf expression or raf itself. In detail, such screening methods may be configured as follows. A screening method for identifying raf activating substances may comprise the following steps: a) target cells are reacted with a prospective active ingredient or a mixture of prospective active ingredients, and the target cells are cultivated, b) after a defined time, the expression and/or concentration of raf protein is measured, and the obtained measured value is compared to a measured value which has been obtained under identical conditions, however without addition of a prospective active ingredient, c) a prospective active ingredient or a mixture of prospective active ingredients are selected such that an increase of the expression and/or concentration of raf protein was found in step b), d) as an option, in the case of the use of a mixture of prospective active ingredients, a deconvolution is performed, for instance by individual measurement of the active ingredients of the mixture. A screening method for identifying raf activating substances may however also comprise the following steps: a) raf inhibitors naturally occurring in target cells, in particular substances binding to the kinase domain of raf or substances regulating the raf expression down, are identified, b) a substance identified in step a) is as an option isolated and/or purified, reacted in a binding assay with a prospective active ingredient or a mixture of prospective active ingredients, and the binding capability of the substance with the prospective active ingredient is examined, c) a prospective active ingredient or a mixture of prospective active ingredients, for which a binding event has been detected in step b), is selected, d) as an option, in the case of the use of a mixture of prospective active ingredients, a deconvolution is performed, for instance by individual measurement of the active ingredients of the mixture, e) as an option, a selected prospective active ingredient or a selected mixture of prospective active ingredients is subjected to a method according to claim 10 for verifying the raf activity. In principle, all methods for determining a raf concentration and/or a binding assay known to the man skilled in the art can be used. In conjunction with the raf determination, it may be suitable if the used target cells are genetically altered such that expressed raf carries a reporter group, which can easily be detected by measurement and does naturally not exist in the target cells. Additionally, it is remarked that by an inhibition of raf, to which reference is made in the literature, on the other hand an inhibition of the natural cell death can be prevented for cancer cells, i.e. for lack of raf. VDAC and/or BAX channels are not closed, and apoptosis occurs. Insofar the invention also covers a pharmaceutical composition containing at least one inhibitor of raf for treating diseases, for which the natural apoptosis in cells does not take place, as for instance in cancer cells. The explanations for one claim category of the invention apply in a corresponding manner for other claim categories. The invention finally also relates to healing methods, for instance classically by administration of pharmaceutical preparations, but also gene therapeutically, by means of which one or several substances according to the invention are brought into a target cell or are produced in the target cell and the expression of which is excited or increased. In the following, the invention is explained in more detail, based on figures and experiments representing embodiments only. There are: FIG. 1 a, b : the permeability of VDAC (a) and BAXΔTM (b) channels after incubation with GST-c-rafL375W (a), FIG. 2 a, b : the permeability of VDAC (a) and BAXΔTM (b) channels after incubation with GST-c-rafYY340/341DD, and FIG. 3 : the permeability of BCL2ΔTM channels after incubation with GST-c-rafYY340/341DD. detailed-description description="Detailed Description" end="lead"? |
Method for the preparation of reagents for amplification and/or detection of nucleic acids that exhibit no significant contamination by nucleic acids |
The present invention decribes reagents free of detectable contaminating nucleic acids for performing highly sensitive and specific nucleic acids amplification and/or detection. It relates to an improvement in the technology of nucleic acid inactivation prior to nucleic acid testing (NAT) in order to prevent false-positive results. Specifically, this invention describes optimized and standardized reagents and ultra-violet treatment to achieve an effective and highly reproducible nucleic acid inactivation prior to NAT without substantially affecting the performance of the assay. More specifically, this nucleic acid inactivation process resulted in a reduction of up to four logs of the background signal associated with the PCR (polymerase chain reaction) amplification of DNA contaminating PCR reagents. This optimized and standardized method is also adaptable for use with NAT technologies other than PCR. |
1. A reagent to be put in contact with nucleic acids of interest, said reagent having a treatable surface, wherein the concentration of amplifiable contaminating nucleic acids is below a level that interferes with an amplification and/or detection reaction conducted with said nucleic acids of interest, said reagent comprising a furocoumarin compound and having been submitted to a UV light treatment capable of reducing contaminating nucleic acids below said level, with the standardization of the wavelength spectrum of the UV source and the total energy of the treatment per unit of surface, the combination of furocoumarin and UV light treatment inactivating the contaminating nucleic acids by rendering them unamplifiable; said treatment having no substantial detrimental effect on the performance of said amplification and/or detection reaction. 2. A reagent as defined in claim 1, which is obtainable by a UV light treatment equivalent to a treatment conducted in the presence of 8-MOP as the furocoumarin, with a Spectrolinker™XL-1000 apparatus, equipped with a UV sensor and a UV source of a wavelength spectrum of about 300 to 400 nm, and providing a total energy of about 750 to 4500 mJoules per square centimeter as measured by the UV sensor located at about 17.6 cm of the UV source while a reagent is disposed in 0.6 ml MaxyClear flip cap conical plastic tubes purchased from Axygen, located at about 10.8 cm from the UV source. 3. A reagent as defined in claim 1, which is obtainable by a UV light treatment equivalent to a treatment conducted in the presence of Trioxsalen as the furocoumarin, with a Spectrolinker™ XL-1000 apparatus, equipped with a UV sensor and a UV source of a wavelength spectrum of about 300 to 400 nm, and providing a total energy of about 500 to 1500 mJoules per square centimeter as measured by the UV sensor located at about 17.6 cm of the UV source while a reagent is disposed in 0.6 ml MaxyClear flip cap conical plastic tubes purchased from Axygen, located at about 10.8 cm from the UV source. 4. A reagent as defined in claim 1, which further comprises a level of contaminating nucleic acids (either spiked or naturally present in the reagent(s)), the presence of which can be detected if its concentration is not below said level; said contaminating nucleic acids being used as a standard to monitor and optimize the conditions for nucleic acids inactivation. 5. A reagent as defined in claim 1, which comprises a protein, the function of which is not substantially affected by said treatment. 6. The reagent of claim 1, wherein said reagent comprises a component selected from the group consisting of: a nucleotide and/or nucleotide analog; an oligonucleotide primer and/or probe; a buffer solution; a monovalent and/or divalent ion; an enzyme selected from the group consisting of DNA polymerase, RNA polymerase, reverse transcriptase, DNA ligase, restriction enzyme DNAase, RNAase, protease and an enzyme used for NAT or in test sample preparation for NAT; an amplification facilitator; a cryoprotector; a stabilizer; a solvent; and any suitable combination thereof. 7. The reagent of claim 6, wherein at least two components are mixed together in a common vial. 8. The reagent of claim 1, which is liquid, frozen or dehydrated. 9. A container comprising a reagent as defined in claim 1. 10. (cancelled) 11. A container as defined in claim 9, which is a closed vessel. 12. A reagent, as defined in claim 1, wherein said furocoumarin is 8-MOP or Trioxsalen. 13. A reagent or as defined in claim 12, wherein 8-MOP is used at a final concentration of about 0.015 μg/μL (or 0.07 mM) to about 0.12 μg/μL (or 0.56 mM). 14. A reagent as defined in claim 12, wherein Trioxsalen is used at a final concentration of about 0.001 μg/μL (0.0044 mM) to 0.0075 μg/μL (0.033 mM). 15. A reagent as defined in claim 1, which is for PCR. 16. A method for rendering contaminating nucleic acids in a reagent unamplifiable in an amplification reaction of nucleic acids of interest, without substantially affecting the performance of the amplification reaction which comprises: a) providing a reagent to be contacted with said nucleic acids of interest; b) providing a furocoumarin compound; c) obtaining a mixture of said reagent and the furocoumarin compound; and d) treating said mixture with light energy of a wavelength in the UV range. 17. A method as defined in claim 16, wherein the UV light treatment is equivalent to a treatment conducted in the presence of 8-MOP as the furocoumarin, with a Spectrolinker™XL-1000 apparatus, equipped with a UV sensor and a UV source of a wavelength spectrum of about 300 to 400 nm, and providing a total energy of about 750 to 4500 mJoules per square centimeter as measured by the UV sensor located at about 17.6 cm of the UV source while a reagent is disposed in 0.6 ml MaxyClear flip cap conical plastic tubes purchased from Axygen, located at about 10.8 cm from the UV source. 18. A method as defined in claim 16, wherein said UV light treatment is equivalent to a treatment conducted in the presence of Trioxsalen as the furocoumarin, with a Spectrolinker™ XL-1000 apparatus, equipped with a UV sensor and a UV source of a wavelength spectrum of about 300 to 400 nm, and providing a total energy of about 500 to 1500 mJoules per square centimeter as measured by the UV sensor located at about 17.6 cm of the UV source while a reagent is disposed in 0.6 ml MaxyClear flip cap conical plastic tubes purchased from Axygen, located at about 10.8 cm from the UV source. 19. A method as defined in claim 16, which further comprises a level of contaminating nucleic acids, the presence of which can be detected if its concentration is not below said level; said contaminating nucleic acids being used as a standard to monitor and optimize the conditions for nucleic acids inactivation. 20. The method of claim 16, wherein the reagent comprises a protein, the function of which is not substantially affected by said treatment. 21. The method of any one of claim 16, wherein the furocoumarin compound is a psoralen or an isopsoralen derivative. 22. The method of claim 21, wherein the furocoumarin compound is 8-MOP or Trioxsalen. 23. The method of claim 21, wherein the concentration of the furocoumarin compound is about 0.015 μg/μL (or 0.07 mM) to about 0.12 μg/μL (or 0.56 mM). 24. The method of claim 21, wherein the concentration of the furocoumarin compound is about 0.001 μg/μL (or 0.0044 mM) to 0.0075 μg/μL (or 0.033 mM). 25. The method of claim 16, wherein the reagent is involved in an amplification and/or detection reaction or in the test sample preparation. 26. The method of claim 25, wherein the reagent comprises a component selected from the group consisting of: a nucleotide and/or nucleotide analog; an oligonucleotide primer and/or probe; a buffer solution; a monovalent and/or divalent ion; an enzyme selected from the group consisting of DNA polymerase, RNA polymerase, reverse transcriptase, DNA ligase, restriction enzyme, DNAase, RNAase, protease and any enzyme used for NAT or in test sample preparation for NAT; an amplification facilitator; a cryoprotector; a stabilizer; a solvent; and any suitable combination thereof. 27. The method of claim 25, wherein the reagent is a PCR reagent. 28. The method of claim 25, wherein the reagent is a RT-PCR reagent. 29. The method of claim 16 wherein said mixture is treated with UV in a tubing. 30. The method of claim 16, wherein said mixture is enclosed in a plastic vessel. 31. The method of claim 30, wherein said mixture is treated with UV in immediate container into which a reaction with nucleic acids of interest is performed. 32. The method of claim 16, wherein said UV light dose is applied and monitored by measurements with a radiometer equipped with a UV sensor or with an appropriate spectrometer. 33. The method of claim 16, wherein said reaction mixture is treated using a suitable UV source including a laser, high intensity white light, an incandescent lamp and a diode. 34. The method of claim 16, wherein the light treatment is performed using an apparatus consisting of a chamber equipped with UV lights and allowing to measure the UV dose. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The practical application of recombinant DNA technology in the field of infectious diseases was initially reported in 1980 by Moseley et al. (Moseley et al., 1980, J. Infect. Dis. 142:892-898). Since those days, molecular biology technologies have undertaken a rapid evolution. Based on these technologies, a number of rapid and sensitive nucleic acid testing (NAT) methods have been developed for a variety of applications including diagnosis of infectious and genetic diseases in humans, animals and plants. Many of these NAT assays have been used in the field of microbiology to complement or replace the slower conventional culture-based identification systems (Picard and Bergeron, 2002, Drug Discovery Today 7:1092-1101; Boissinot and Bergeron, 2002, Curr. Opinion Microbiol. 5:478482; Tang and Persing, 1999, Molecular detection and identification of microorganisms, p. 215-244, In Manual of Clinical Microbiology, Murray et al., American Society for Microbiology, Washington, D.C.; Lee et al. 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques Books, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.). These assays have been designed for microbial detection and identification directly from clinical and/or environmental samples and are based on the use of a variety of NAT technologies including the widely used and powerful polymerase chain reaction (PCR). Other nucleic acid amplification technologies include among others the ligase chain reaction (LCR), the strand displacement amplification (SDA) as well as transcription-based amplifications such as the transcription mediated amplification (TMA) (Tang and Persing, 1999, Molecular detection and identification of microorganisms, p. 215-244, In Manual of Clinical Microbiology, Murray et al., American Society for Microbiology, Washington, D.C.; Lee et al., 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques Books, Eaton Publishing, Boston, Mass.). Sensitive NAT technologies also include signal amplification methods such as the branched DNA (bDNA) probe technique. NAT can be used to detect the presence of any microbe in clinical samples. A number of PCR-based assays targeting highly conserved nucleotide sequences in microbes have been used by us and others to develop universal amplification assays for bacteria or fungi (Martineau et al., 2001, J. Clin. Microbiol. 39:2541-2547; Schonhuber et al., 2001, BMC Microbiology 1:20; Ke et al., 1999, J. Clin. Microbiol. 37:3497-3503; Loeffler et al, J. Clin. Microbiol. 37:1200-1202; McCabe et al., 1999, Molecular Gen. Metabolism 66:205-211; Klausegger et al., 1999, J. Clin. Microbiol. 37:464-466; Tanner et al. 1998, Appl. Environ. Microbiol. 64:3110-3113; Goh et al., 1996, J. Clin. Microbiol. 34:818-823; Sandhu et al., 1995, J. Clin. Microbiol. 33:2913-2919; Greisen et al., 1994, J. Clin. Microbiol. 32:335-351; Schmidt et al., 1991, Biotechniques 11:176-177; Rand and Houck, 1990, Mol. Cell. Probes 4:445-450 and our co-pending patent application WO 01/23604 A2). However, because of the high sensitivity of NAT, the development of sensitive and broad-range (or universal) nucleic acid detection assays is hampered by the presence of microbial DNA and/or microbial cells that may be present in NAT reagents and which lead to false positive results. The most common source of false-positive results in NAT is associated with carry-over of previously amplified target nucleic acids. This type of contamination can be prevented by using proper laboratory procedures (Millar et al., 2002, J. Clin. Microbiol. 40:1575-1580; Kwok and Higuchi, 1989, Nature, 239:237-238), or alternatively, by using techniques to inactivate amplification products such as the method using the uracil-N-glycosylase (UNG) (Longo et al., 1990, Gene 93:125-128). DNA inactivation using the photoreactive compounds psoralen or isopsoralen, which is used in the object of the present invention, may prevent amplification of contaminating target nucleic acids (Persing and Cimino, 1993, Amplification products inactivation methods p. 105-212, In Persing et al., Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Isaacs et al., 1991, Nucleic Acids Res. 19:109-116; and U.S. Pat. No. 5,221,608). Psoralens and isopsoralens are furocoumarin compounds representing a class of planar tricyclic photoreactive reagents that are known to form covalent monoadducts and crosslinks with nucleic acids upon activation with ultra-violet (UV) light. Examples of furocoumarin compounds are given in U.S. Pat. No. 5,221,608, the contents of which are entirely incorporated by reference. These monoadducts can be formed between two adjacent pyrimidines on opposite strands of nucleic acids thereby creating interstrand crosslinks with both DNA and RNA. Such crosslinks prevent primer extension activities of polymerases. Psoralens and isopsoralens have the major advantage of allowing nucleic acid inactivation in closed vessels (such as PCR reaction vessels) thereby preventing carry-over contamination by nucleic acid aerosols. Another effective strategy to prevent carry-over contamination is to perform the nucleic acid amplification reactions in closed vessels such as in real-time PCR amplification and analysis (Foy and Parkes, 2001, Clin. Chem. 47:990-1000). Another important source of false-positive results in NAT is extraneous nucleic acids introduced in reagents during the manufacturing process. For example, the Taq polymerase used in PCR has been shown by many investigators to be contaminated with bacterial DNA (Gale et al., 2003, Clin. Chem. 49:415-424; Corless et al., 2000, J. Clin. Microbiol. 38:1747-1752; Maiwald et al., 1994, Mol. Cell. Probes 8:11-14; Meier et al., 1993, J. Clin. Microbiol. 31:646652; Schmidt et al., 1991, Biotechniques 11:176-177; Jinno et al., 1990, Nucleic Acids Res. 18:6739; Rand and Houck, 1990, Mol. Cell. Probes 4:445-450; and U.S. Pat. No. 5,532,145). Analysis of the conserved bacterial rRNA gene sequences contaminating different preparations of Taq DNA polymerase revealed that these nucleic acids were closely related to the genera Corynebacterium, Afthrobacter, Mycobacteiium, Pseudomonas, Alcaligenes and Azotobacter (Hughes et al., 1994, J. Clin. Microbiol., 32:2007-2008; Maiwald et al., 1994, Mol. Cell. Probes 8:11-14). Importantly, the contaminating DNA sequences did not match with that of the species Eschedchia coli and Thermus aquaticus which were the bacteria used to produce these ezymes. Because of the nature of this type of contamination, the use of UNG or of closed vessel assays as well as careful laboratory techniques cannot circumvent this important NAT reagents nucleic acid contamination problem. DNA inactivation using psoralens or isopsoralens combined with a UV treatment has been used to prevent amplification of microbial DNA contaminating PCR reagents (Corless et al., 2000, J. Clin. Microbiol. 38:1747-1752; Klausegger et al., 1999, J. Clin. Microbiol. 37:464-466; Hughes et al., 1994, J. Clin. Microbiol., 32:2007-2008; Meier et al., 1993, J. Clin. Microbiol. 31:646-652; Jinno et al., 1990, Nucleic Acids Res. 18:6739; and U.S. Pat. No. 5,532,145). However, there is no standardized method for nucleic acid inactivation using these photoreactive compounds allowing efficient and reproducible nucleic acid inactivation without substantial reduction in the performance of the nucleic acid amplification and/or detection assay. The words “without substantial” or “not have a substantial” are used throughout the present invention to mean “without or with minimal”. Several investigators have reported an important reduction in the analytical sensitivity of NAT assays attributable to the UV treatment in the presence of psoralen or isopsoralen (Corless et al., 2000, J. Clin. Microbiol. 38:1747-1752; Meier et al., 1993, J. Clin. Microbiol. 31:646-652 and U.S. Pat. No. 5,532,145). Corless et al. (2000, J. Clin. Microbiol. 38:1747-1752) compared several methods to eliminate nucleic acid contamination from PCR reagents. They concluded that it was not possible to eliminate contaminating nucleic acids from the PCR reagents without significantly decreasing the analytical sensitivity of their real-time PCR assays. When they tested a combination of 8-methoxypsoralen (8-MOP) and UV irradiation, complete DNA decontamination of the PCR reagents was achieved after 5 minutes of UV exposure. They have not specified the UV dose (in mJoule/cm 2 ) nor did they described the reagent container and its distance from the UV source. They observed a 5 to 7 logs reduction in the analytical sensitivity of the real-time PCR assays using this non-standardized 8-MOP-based DNA inactivation method. In fact, their experimental procedure does not include proper control of key parameters such as those disclosed in the present invention which ensure that an optimal UV energy dose is administered to the reagents containing an optimal 8-MOP concentration. The present invention allows for efficient nucleic acids inactivation while reducing the performance of the assay by only about 1 log or less. This is achieved by (i) monitoring the energy dose with a UV sensor by measuring the UV dose in mJoules per square centimeters, (ii) maintaining a constant distance between the reagents and the UV source, (iii) testing the reagent container for its permeability to UV treatment and (iv) optimising the 8-MOP concentration. U.S. Pat. No. 5,532,145 describes the use of degassing to remove oxygen from PCR reaction mixtures containing a furocoumarin prior to UV irradiation to preserve Taq DNA polymerase activity. However, the degassing process is not practical as it involves freezing the reaction mixture to be decontaminated in dry/ice ethanol, thawing and applying vacuum for 30 seconds three times. As revealed in the present invention it is simpler to control the parameters of the UV treatment. These parameters include the type of furocoumarin compound and its concentration, the UV exposure, the intensity of the UV source, the length of the UV treatment and the wavelengths spectrum of the UV source which are important factors in achieving an efficient and reproducible performance in DNA inactivation, and this, without substantial detrimental effect on the performance of NAT assays. Other methods to inactivate DNA contaminating NAT reagents have been used with very limited success. These methods include the use of UV irradiation alone, a treatment with DNAase and/or restriction endonucleases and a treatment with exonucleases (Corless et al., 2000, J. Clin. Microbiol. 38:1747-1752; Zhu et al., 1991, Nucleic Acids Res. 19:2511). Also, a pre-filtration step for the PCR mix prior to the addition of the test sample have been used to remove nucleic acids present in PCR reagents (Yang et al., 2002, J. Clin. Microbiol. 40:3449-3454). |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention relates to reagents submitted to an improved treatment using furocoumarin derivatives (e.g. psoralens and/or isopsoralens) and UV irradiation to inactivate contaminating nucleic acids from NAT reagents, without substantial hindering of the performance of the NAT methods, and this, without the need to remove oxygen in order to avoid the presence of damaging oxygen radical species (by degassing for example). This treatment includes careful control and monitoring of some experimental conditions including the quality of the vessel containing the reaction mixture to be treated as well as the UV dose and intensity of the light source in the UV wavelengths spectrum. The present method and resulting products (reagents and containers with reagents) ensure a reproducible and efficient nucleic acid inactivation. It is an object of the present invention to provide reagents useful in the obtention of samples which are to be submitted to amplification and/or detection of nucleic acids in which the concentration of amplifiable and/or detectable contaminating nucleic acids is low, if not totally absent, so as not to substantially interfere with the detection of the nucleic acids targeted in the reaction. These reagents may include a protein, the function of which should not be substantially affected by the treatment of this invention. Such a protein may be an enzyme. If a nucleic acid amplification reaction is to be performed, the enzyme may be a polymerase, a reverse transcriptase, a ligase or a restriction endonuclease. It may also be an enzyme useful in the test sample preparation steps for nucleic acid extraction preceding an amplification and/or detection reaction, for example a DNAase, a RNAase or a protease. These reagents include nucleotides and/or nucleotide analogs, oligonucleotides (primers and/or probes), buffer solutions, ions (monovalent and/or divalent), enzymes (DNA polymerase, RNA polymerase, reverse transcriptase, DNA ligase, restriction enzymes, DNAase, RNAase, protease or any other enzymes used for NAT or in test sample preparation for NAT), amplification facilitators (e.g. betaine, dimethyl sulfoxide, bovine serum albumin, tetramethylamonium chloride), cryoprotectors (e.g. glycerol), stabilizers (e.g. trehalose) and a solvent (usually water). In a particularly preferred embodiment, these reagents containing no or a low level of detectable contaminating DNA or RNA may be provided separately or as separate components of a kit, or mixed together, and may be liquid, frozen or dehydrated. Preferably, the reagents are any combination suitable for a nucleic acid amplification and/or detection reaction. It is another object of the present invention to provide for cleaner reagents and kits for the preparation of nucleic acids (sample preparation and nucleic acids extraction) for NAT assays as well as to provide an efficient method to inactivate nucleic acids contaminating said reagents and kits including purifying devices and columns. It is another object of this invention to provide a container, such as a closed vessel, which comprises the reagents treated in accordance with the present invention. The closed vessel could be submitted to the same treatment, simultaneously with the treatment of the reagents. Indeed, the reagents could be placed into the vessel and then submitted to the treatment of this invention. It is another object of this invention to provide an improved method using furocoumarin compounds and UV light for nucleic acid inactivation to treat reagents prior to NAT in order to prevent false-positive results, said improved method comprising: A. A reaction mixture which contains reagents and enzymes required for NAT per se or for one or more preparative steps prior to NAT, as well as one or more furocoumarin compound(s); and B. Said reaction mixture being treated with UV light under controlled conditions wherein the UV exposure as well as the intensity of the emission peaks of the light source in the UV spectrum are monitored to ensure a delivered UV dose sufficient to inactivate contaminating nucleic acids without substantial detrimental effect on the performance of the NAT assay; For NAT assay, the following steps would be added: C. Said UV treated reaction mixture being subsequently supplemented with the test sample and/or an internal control template; and D. Said reaction mixture supplemented with the test sample and/or internal control template being subjected to nucleic acid testing per se under appropriate conditions. The testing preferably involves nucleic acids amplification and/or detection. The furocoumarin compound is usually a psoralen or an isopsoralen derivative. In a preferred embodiment, the furocoumarin compound is 8-methoxypsoralen (8-MOP), trioxsalen, psoralen and/or FQ (1,4,6,8-tetramethyl-2H-furo[2,3-h]quinolin-2-one). In a particularly preferred embodiment, the furocoumarin compound is 8-MOP. In a preferred embodiment, NAT is performed by using target or probe amplification techniques or signal amplification techniques or any other NAT technologies performed in liquid phase or onto solid supports. In a particularly preferred embodiment, NAT is performed by using the PCR amplification technology performed in liquid phase or onto solid supports. In a preferred embodiment, the container wherein the NAT assay may take place is the immediate container in which the NAT is performed. It is usually a closed vessel. The closed vessel may also be a tubing or a tube. In a particularly preferred embodiment, the closed vessel is a plastic tube. The UV treatment is performed using an apparatus consisting of a chamber equipped with a UV source and a UV sensor to monitor the energy dose of the treatment. In a preferred embodiment, the intensity of the emission peaks of the light source in the UV spectrum is monitored using a UV sensor. In a particularly preferred embodiment, said UV sensor is used to monitor the intensity of the emission peaks of the light source in the UV spectrum inside the UV irradiation chamber of an apparatus. In a preferred embodiment, the intensity of the emission peaks of the light source in the UV spectrum generated is monitored using a suitable radiometer or spectrometer. In a particularly preferred embodiment, said radiometer or spectrometer is used to monitor the intensity of the emission peaks of the light source in the UV spectrum inside the UV irradiation chamber of an apparatus. The test sample may be of any origin, preferably of clinical or environmental source. In another preferred embodiment, an internal control is used to verify the efficiency of each NAT reaction. In another preferred embodiment, the detection method is based upon hybridization with a labelled probe. In a further preferred embodiment, the said probe is labelled with a fluorophore. |
Brain electrode |
The present invention relates to an electrode (1), in particular a deep brain stimulating (DBS) electrode or a deep brain lesioning electrode. The present invention also relates to a method for manufacturing the electrode (1) of the present invention and the use of the electrode. The present invention also relates to a directional electrode. |
1. An electrode comprising: (a) a core comprising one or more insulated wires having non-insulated ends; (b) an insulating sheath around the core, wherein the non-insulated ends of the one or more wires are exposed; and (c) one or more electrode areas formed by depositing electrically conducting material on the surface of the sheath, wherein the one or more electrode areas are in electrical contact with at least one of the non-insulated ends. 2. The electrode of claim 1 wherein the core comprises a plurality of insulated wires having non-insulated ends. 3. The electrode of claim 2, wherein each end of each insulated wire is in electrical contact with a separate electrode area. 4. The electrode of claim 1, wherein the electrically conducting material is deposited by jet printing, etching, photolithography, plasma deposition, evaporation and electroplating. 5. The electrode of claim 1, wherein the electrically conducting material is gold or platinum. 6. The electrode of claim 1, wherein the electrode is a deep brain stimulating (DBS) or deep brain lesioning electrode. 7. A method for constructing an electrode according to claim 1 comprising: (a) coating the core of one or more insulated wires with the electrically insulating sheath, wherein the non-insulated ends of the one or more wires are not coated by the sheath; and (b) depositing electrically conducting material on the surface of the sheath to form one or more electrode areas which are in electrical contact with at least one of the non-insulating ends. 8. The method of claim 7, wherein the one or more insultated wires are wound around a supporting member. 9. The method of claim 8, wherein the supporting member is a tungsten wire. 10. The method of claim 7, wherein the electrically conducting material is deposited by jet printing, etching, photolithography, plasma deposition, evaporation and electroplating. 11. A directional electrode comprising: (a) a core comprising one or more insulated wires having non-insulated ends; (b) an electrically insulating sheath around the core, wherein the non-insulating ends of the one or more wires are exposed; and (c) one or more electrode areas on the surface of the sheath in electrical contact with at least one of the non-insulated ends wherein each electrode area extends over less than half the circumference of the electrode. 12. The directional electrode of claim 11, wherein each of the one or more electrode areas extends over less than a quarter of the circumference of the electrode. 13. The directional electrode of claim 12, wherein each of the one or more electrode areas extends over about an eighth of the circumference of the electrode. 14. The directional electrode claim 11, wherein the longitudinal axis of the one or more electrode areas are parallel to or perpendicular to the longitudinal axis of the electrode. 15. The directional electrode of claim 11 wherein the core comprises a plurality of insulated wires having non-insulated ends. 16. The directional electrode of claim 15, wherein each end of each insulated wire is in electrical contact with a separate electrode area. 17. The directional electrode of claim 16, wherein the plurality of electrode areas are in a staggered arrangement. 18. The directional electrode of claim 11, wherein the electrically conducting material is gold or platinum. 19. The directional electrode of claim 11, wherein the electrode is a deep brain stimulating (DBS) or deep brain lesioning electrode. 20. The directional electrode of claim 11, comprising a line along the length of the electrode in alignment with the electrode areas for orientating the position of the electrode areas. 21. The directional electrode of claim 11, which produces a monopolar current. 22. The directional electrode of claim 11, which produces a bipolar current. 23. A method for constructing the directional electrode of claim 11, comprising: (a) coating the core of one or more insulated wires with the electrically insulating sheath, wherein the non-insulated ends of the one or more wires are not coated by the sheath; and (b) depositing electrically conducting material on the surface of the sheath to form the one or more electrode areas which are in electrical contact with at least one of the non-insulating ends. 24. The method of claim 23, wherein the one or more insulated wires are wound around a supporting member. 25. The method of claim 24, wherein the supporting member is a tungsten wire. 26. The method of claim 23, wherein the electrically conducting material is deposited by jet printing, etching, photolithography, plasma deposition, evaporation and electroplating. 27. Use of the directional electrode of claim 11 in therapy. 28. A brain electrode arranged to produce an effective field which is offset to one side of the electrode and which has a plane of symmetry through a plane through the longitudinal axis of the electrode. 29. A method of making a brain electrode comprising the steps of: arranging an elongate conductive electrode core in a mould cavity, arranging a conductor to contact the core and to extend outside the cavity of the mould, casting moulding material into the cavity of the mould to form a coating on the core so that the conductor creates a path to the core through the coating. |
Formulation and method for depositing a material on a substrate |
A formulation for depositing a material on a substrate, the formulation comprising the material to be deposited on the substrate dissolved in a solvent system comprising a first solvent component having a relatively high boiling point and which exhibits a relatively low solubility with respect to the material to be deposited, and a second solvent component having a relatively low boiling point and which exhibits a relatively high solubility with respect to the material to be deposited. |
1. A formulation for depositing a material on a substrate according to an ink-jet technique, the formulation comprising the material to be deposited on the substrate dissolved in a solvent system comprising a first solvent component having a relatively high boiling point and which exhibits a relatively low solubility with respect to the material to be deposited, and a second solvent component having a relatively low boiling point and which exhibits a relatively high solubility with respect to the material to be deposited. 2. A formulation according to claim 1 wherein the second solvent component has a boiling point in the range of 100 to 200° C. 3. A formulation according to claim 1 or claim 2 wherein the first solvent component has a boiling point in the range of 130 to 300° C. 4. A formulation according to claim 1 wherein the difference in boiling point between the first and second solvent components is in the range of 30 to 250° C. 5. A formulation according to claim 4 wherein the difference in boiling point between the first and second solvent components is in the range of 70 to 150° C. 6. A formulation according to any preceding claim wherein the solubility of the material to be deposited in the first solvent component is up to 0.5% weight per volume. 7. A formulation according to claim 6 wherein the solubility of the material to be deposited in the first solvent component is in the range of 0.03 to 0.3% weight per volume. 8. A formulation according to any preceding claim wherein the solubility of the material to be deposited in the second solvent component is greater than 0.5% weight per volume. 9. A formulation according to claim 8 wherein the wherein the solubility of the material to be deposited in the second solvent component is greater than 1.5% weight per volume. 10. A formulation according to any preceding claim wherein the amount of material in the formulation and the proportion of the first solvent component are selected such that upon removal of the second solvent component the remaining solution of the material in the first solvent component would be at or above saturation. 11. A formulation according to claim 1 wherein the first solvent component comprises α-tetralone and the second solvent component comprises 1,2-dimethylbenzene. 12. A formulation according to claim 1 wherein the first solvent component comprises cyclohexylbenzene and the second solvent component comprises 1,2-dimethylbenzene. 13. A formulation according to claim 1 wherein the first solvent component comprises xylene and 1,2,4-trimethylbenzene and the second solvent component comprises isopropylbiphenyl. 14. A method of depositing a material on a substrate comprising depositing one or more drops of a solution of the material onto the substrate through a nozzle according to an ink-jet technique and drying the drops, wherein the solution of the material comprises a formulation according to any preceding claim. 15. A method according to claim 14 wherein the variation in thickness of the dried drop is less than 30% of the maximum thickness. 16. A method of producing a light-emitting device comprising a layer of an electroluminescent material sandwiched between two electrodes such that charge carriers can move between the electrodes and the layer of electroluminescent material, wherein the layer of electroluminescent material is produced by a method according to claim 14 or claim 15. 17. A use of a formulation according to any of claims 1 to 13 for reducing or avoiding a ring deposition effect. 18. A formulation according to claim 1 excluding 1% w/v of a triblend containing approximately 14 wt. % of a ternary polymer containing fluorene (FB8) units, benzothiadiazole (BT) units and triarylene units, 56 wt. % of F8BT and 30 wt. % TFB in a solvent mixture containing 20 vol. % 1,2,4-trimethylbenzene and 80 vol. % xylene or a solvent mixture containing 50 vol. % 1,2,4-trimethylbenzene and 50 vol. % xylene. |
Thermally insulating structural components resistant to high temperature corrosive media |
The invention relates to a thermally insulating structural component (10) such as a cover of a container (5), in particular a molten salt electrolytic cell which component (10) is inert and resistant to corrosive media (1) at high temperature in the form of liquids, vapours and/or gases, in particular NaAlF4, AlF3, HF or O2, and which during use is exposed to such corrosive media (1). The component (10) comprises thermal insulating material (30) shielded from the corrosive media (1) by an openly porous or reticulated alumina structure (20) which is made impermeable by a compact filler material (15) resistant and inert to the corrosive media and comprising compacted particles of refractory material, in particular alumina cement. The structural component (10) can have a top metallic shell (40) which extends over the thermal insulating material (30) and downwards along lateral sides of the component (10). The insulating material (30) can be secured to the alumina structure (20) through nuts (50) and bolts (60). |
1. A thermally insulating cover of a cell for the electrowinning of aluminium from alumina dissolved in a fluoride-based molten electrolyte, which cover is inert and resistant to high temperature corrosive media in the form of liquids, vapours and/or gases that are contained in the cell and that comprise vapours from the electrolyte, and which cover during use is exposed to such corrosive media, said cover comprising thermal insulating material shielded from the corrosive media by an openly porous or reticulated alumina structure which is made impermeable by a compact filler made of material resistant and inert to said corrosive media, the filler material comprising compacted particles of refractory material. 2. The thermally insulating cover of claim 1, wherein said filler completely fills an outermost part of the structure, in particular a outermost bottom part. 3. The thermally insulating cover of claim 2, wherein the filler extends throughout the alumina structure. 4. The thermally insulating cover of claim 1 or 2, wherein the alumina structure is partly filled by the filler, leaving a filler-free part of the alumina structure, in particular a filler-free top part. 5. The thermally insulating cover of claim 4, wherein the filled part forms a layer in the alumina structure. 6. The thermally insulating cover of any preceding claim, wherein the alumina structure is a plate having a thickness in the range of 20 to 150 mm. 7. The thermally insulating cover of claim 6 when depending on claim 5, wherein the filler forms a layer in the plate, the layer having a thickness in the range of 10 to 100 mm. 8. The thermally insulating cover of any preceding claim, wherein the alumina structure is covered with a layer made of the filler material. 9. The thermally insulating cover of claim 8, wherein the layer covering the alumina structure has a thickness in the range of 2 to 10 mm. 10. The thermally insulating cover of any preceding claim, wherein the refractory material of the filler comprises at least one compound selected from metal oxides, carbides and nitrides. 11. The thermally insulating cover of claim 10, wherein the filler comprises a mixture of metal oxide particles with particles of at least one compound selected from carbides and nitrides. 12. The thermally insulating cover of any preceding claim, wherein the filler is a slurry-applied filler comprising dried colloidal and/or non-colloidal particles of at least one compound selected from metal oxides, carbides and nitrides and precursors thereof. 13. The thermally insulating cover of claim 12, wherein the filler comprises a cement that consists predominantly of at least one of alumina, silica and titania particles. 14. The thermally insulating cover of claims 13, wherein the cement comprises a mixture of silica an alumina, preferably containing at least 80 weight % alumina. 15. The thermally insulated cover of claim 12, wherein the filler comprises a mixture of alumina and titania. 16. The thermally insulating cover of claim 12, wherein the filler comprises particles of at least one compound selected from carbides and nitrides in a dried colloidal metal oxide carrier. 17. The thermally insulating cover of any preceding claim, which comprises one or more insulating layers and a protective layer that shields the insulating layer(s) from said corrosive media, the protective layer being made of said openly porous or reticulated filled alumina structure. 18. The thermally insulating cover of claim 17, wherein the insulating layer(s) and the protective layer are mechanically secured together. 19. The thermally insulating cover of claim 18, wherein the insulating layer(s) and the protective layer are mechanically secured together by means of one or more metallic attachment members extending through vertical holes of the protective layer and the insulating layer. 20. The thermally insulating cover of claim 19, wherein the or each vertical hole in the insulating layer(s) extends into a recess located in a bottom face of the alumina structure, said recess being arranged to embed a head of one or more of the attachment members, said recess being filled with said filler to protect the attachment member from said corrosive media. 21. The thermally insulating cover of claim 17, 18, 19 or 20, which comprises a top metallic shell which extends over the insulating layer(s) and downwards along lateral sides of the cover. 22. A cell for the electrowinning of aluminium from alumina dissolved in a fluoride-based molten electrolyte, comprising a thermally insulating cover as defined in any preceding claim. |
<SOH> BACKGROUND OF THE INVENTION <EOH>The technology for the production of aluminium by the electrolysis of alumina, dissolved in molten cryolite containing salts, at temperatures around 950° C. is more than one hundred years old. Conventional aluminium production cells are constructed so that in operation a crust of solidified molten electrolyte forms around the inside of the cell sidewalls. At the top of the cell sidewalls, this crust is extended by a ledge of solidified electrolyte which projects inwards over the top of the molten electrolyte. The solid crust in fact extends over the top of the molten electrolyte between the carbon anodes. To replenish the molten electrolyte with alumina in order to compensate for depletion during electrolysis, this crust is broken periodically at selected locations by means of a crust breaker, fresh alumina being fed through the hole in the crust. This crust/ledge of solidified electrolyte forms part of the cell's heat dissipation system in view of the need to keep the cell in operation at constant temperature despite changes in operating conditions, as when anodes are replaced, or due to damage/wear to the sidewalls, or due to over-heating or cooling as a result of great fluctuations in the operating conditions. In conventional cells, the crust is used as a means for automatically maintaining a satisfactory thermal balance, because the crust/ledge thickness self-adjusts to compensate for thermic unbalances. If the cell overheats, the crust dissolves partly thereby reducing the thermic insulation, so that more heat is dissipated through the sidewalls leading to cooling of the cell contents. On the other hand, if the cell cools the crust thickens which increases the thermic insulation, so that less heat is dissipated, leading to heating of the cell contents. The presence of a crust of solidified electrolyte is considered to be important to achieve satisfactory operation of commercial cells for the production of aluminium on a large scale. In fact, the heat balance is one of the major concerns of cell design and energy consumption, since only about 25% of such energy is used for the production of aluminium. Optimization of the heat balance is needed to keep the proper bath temperature and heat flow to maintain a frozen electrolyte layer (side ledge) with a proper thickness. In conventional cells, the major heat losses occur at the sidewalls, the current collector bars and the cathode bottom, which account for about 35%, 8% and 7% of the total heat losses respectively, and considerable attention is paid to providing a correct balance of these losses. Further losses of 33% occur via the carbon anodes, 10% via the crust and 7% via the deck on the cell sides. This high loss via the anodes is considered inherent in providing the required thermal gradient through the anodes. In the literature, there have been suggestions for cells operating without a crust of solidified electrolyte. U.S. Pat. No. 5,368,702 (de Nora) discloses a multimonopolar aluminium production cell operating with tubular anodes in a crustless molten electrolyte which is thermally insulated by a cover. The cover is lined underneath with a layer of thermally insulating material. U.S. Pat. No. 5,415,742 (La Camera/Tomaswick/Ray/Ziegler) disclose another aluminium production cell operating with a crustless molten electrolyte which is thermally insulated by a cover. Despite previous efforts to develop a cell design for operation with a crustless molten electrolyte, there is still a need to provide a thermic insulating material for cell covers which is resistant to electrolyte vapours and gases evolved during electrolysis and which is sufficiently lightweight but mechanically resistant to be used for removable covers. |
<SOH> SUMMARY OF THE INVENTION <EOH>The invention proposes a thermally insulating cover of a container, in particular a molten salt electrolytic cell, which cover is inert and resistant to corrosive media at high temperature in the form of liquids, vapours and/or gases contained in the container, in particular NaAlF 4 , AlF 3 , HF or O 2 , and which during use is exposed to such corrosive media. The cover comprises thermal insulating material shielded from the corrosive media by an openly porous or reticulated alumina structure which is made impermeable by a compact filler made of material resistant and inert to said corrosive media. The filler material comprises compacted particles of refractory material. The thermal insulating material may consist of or include a part of the openly porous or reticulated alumina structure that contains no filler. The thermal insulting material may also include or be formed of an entirely different body above the openly porous or reticulated filled alumina structure. The filler may extend throughout the alumina structure. Alternatively, the alumina structure may be only partly filled by the filler, leaving a filler-free part of the alumina structure, in particular a filler-free top part. For example, the filled part forms a layer which may form an outer surface of the cover, in particular an outer surface of a bottom part of the cover. In addition, the alumina structure may be covered with an outside layer made of the same filler material, the outside layer forming an outer surface of the cover. Usually, the alumina structure is a plate having a thickness in the range of 20 to 150 mm. A layer inside the alumina structure may have a thickness in the range of 10 to 100 mm. An outside layer covering the alumina structure can be 2 to 10 mm thick. Usually, the refractory material of the filler comprises at least one compound selected from metal oxides, carbides and nitrides. For instance, the filler comprises a mixture of metal oxide particles with particles of at least one compound selected from carbides and nitrides. These particles may be applied in a colloidal metal oxide carrier. Advantageously, the filler is a slurry-applied filler comprising dried colloidal and/or non-colloidal particles of at least one compound selected from metal oxides, carbides and nitrides, in particular selected from oxides, carbides and nitrides of titanium, zirconium, hafnium, vanadium, silicon, niobium, tantalum, nickel, molybdenum and iron. Suitable colloids may be selected from colloidal alumina, ceria, lithia, magnesia, silica, thoria, yttria, zirconia, tin oxide, zinc oxide and mixtures thereof. Colloidal precursors of such oxides, in particular hydroxides, may also be used. Further colloidal slurries which may be used as a filler material are disclosed in U.S. Pat. Nos. 5,310,476 and 5,364,513 (both in the name of Sekhar/de Nora). For instance, the filler comprises a cement that consists predominantly of at least one of alumina, silica and titania particles. The filler may be made of alumina and silica, in particular with an alumina content of at least 80 weight %, in particular at least 90 or even 95 weight %. The filler may comprise a mixture of alumina and titania. In one embodiment, the thermally insulating cover comprises an insulating layer and a protective layer that shields the insulating layer(s) from the corrosive media, the protective layer being made of the openly porous or reticulated filled alumina structure. Preferably, the insulating layer(s) and the protective layer are mechanically secured together, in particular by means of one or more metallic attachment members extending through vertical holes of the protective layer and the insulating layer. The hole(s) in the insulating layer(s) may extend into recess(es) located in a bottom face of the alumina structure. Each recess can be arranged to embed a head of one or more of the attachment members and can be filled with the filler to protect the attachment member from the corrosive media. Usually, a top metallic shell extends over the insulating layer(s) and downwards along lateral sides of the cover. The thermally insulating cover of the invention may be used on any container containing high temperature oxidising and/or corrosive media, in particular vapours and/or gases. In particular, the cover is used for aluminium electrowinning cells. The cover can also be used for other molten salt electrolytic cells, for example for the production of magnesium or other metals produced electrolytically. The cover may also be used in furnaces, such as arc furnaces for the production of steel or molten metal treatment apparatus, such as metal degassing apparatus. Further details of such apparatus may be found in WO00/63630 (Holz/Duruz), WO01/42168 (de Nora/Duruz) and WO01/42531 (Nguyen/Duruz/de Nora). More generally, the invention relates to a thermally insulating structural component which is inert and resistant to corrosive media at high temperature in the form of liquids, vapours and/or gases, in particular NaAlF 4 , AlF 3 , HF or O 2 , and which during use is exposed to such corrosive media. In accordance with the invention, the component is made an openly porous or reticulated alumina structure which is made impermeable by a compact filler made of material resistant and inert to said corrosive media. The component may comprise any of the above described features or combination thereof. The component may be a rigid, fire-resistant, lightweight panel, wall, door, lid, beam, balk or girder, housing or other structural component that can be utilised in the construction of containers, pressure vessels, reservoirs, ovens or furnaces etc. The invention will be further described in the following Example. |
Security system with an intelligent dma controller |
A security subsystem is provided with at least a first security engine, a first set of registers and a control portion to perform a first security operation for each of a first number of data blocks of each of a first number of data segments of a first data object. In one embodiment, the security subsystem is provided with two security engines and two sets of registers to respectively perform the first security operation and a second security operation for the first data object and a similarly constituted second data object. In one embodiment, the first and second security operations are DES and hashing operations. In one embodiment, the multi-method security subsystem is embodied in a multi-service system-on-chip. |
1. A security subsystem comprising: a first security engine to perform a first security operation on a block of data bits; a first plurality of registers to collectively store a first descriptor of a first data object having first one or more data segments, with each of said first one or more data segments having a plurality data bits; and a control portion coupled to said first registers and the first security engine to cause (a) said first descriptor of said first data object to be loaded into said first registers, first describing a first data segment of said first data object, and said first descriptor to be successively updated to correspondingly describe first additional data segments of said first data object, if any, one data segment at a time, and (b) data bits of each currently described one of said first data segments to be successively fetched, organized into blocks of data bits, and provided to said first security engine to have said first security operation to be successively performed on the provided blocks of data bits. 2. The security subsystem of claim 1, where said first descriptor of said first data object includes, at a first instance in time, first storage location descriptions that describe first storage locations of data bits of a first of said first data segments of said first data object. 3. The security subsystem of claim 2, where said first storage location descriptions comprise a starting storage location address and a size of the data bits of said first data segments of said first data object. 4. The security subsystem of claim 2, where said first descriptor of said first data object includes, at a second instance in time, second storage location descriptions that describe second storage locations of data bits of a second of said first data segments of said first data object. 5. The security subsystem of claim 4, where said first storage locations and said second storage locations are contiguous storage locations. 6. The security subsystem of claim 4, where said first storage locations and said second storage locations are discontiguous storage locations. 7. The security subsystem of claim 1, where said control portion further causes the results of said first security operations performed for the provided blocks of data bits to be successively returned. 8. The security subsystem of claim 7, where said first descriptor of said first data object includes, at a first instance in time, first storage location descriptions that describe first storage locations for returning first results of said first security operations performed on the provided data bits of a first of said first data segments of said first data object. 9. The security subsystem of claim 8, where said first storage location descriptions comprise a starting storage location address. 10. The security subsystem of claim 8, where said first descriptor of said first data object includes, at a second instance in time, second storage location descriptions that describe second storage locations for returning second results of said second security operations performed on the provided data bits of a second of said first data segments of said first data object. 11. The security subsystem of claim 10, where said first storage locations and said second storage locations are contiguous storage locations. 12. The security subsystem of claim 10, where said first storage locations and said second storage locations are discontiguous storage locations. 13. The security subsystem of claim 1, where said first descriptor of said first data object also describes operating parameters to be employed to perform said first security operation on each of said provided blocks of data bits of said first data object, and said control portion further causes said described operating parameters to be provided to said first security engine. 14. The security subsystem of claim 1, wherein said first security operation is a DES operation. 15. The security subsystem of claim 14, wherein said DES operation is a selected one of a DES cipher operation and a DES decipher operation. 16. The security subsystem of claim 14, wherein said DES operation is a selected one of a DES ECB operation, a DES CBC operation and a DES CFB operation. 17. The security subsystem of claim 14, wherein said first descriptor of said first data object also describes operating parameters including a first and a second key of to be employed to perform said DES operation on each of said provided blocks of data bits of said first data object, and said first control portion further causes said described operating parameters including said first and second keys of said DES operation to be provided to said first security engine. 18. The security subsystem of claim 17, wherein said operating parameters further include a third key of said DES operation. 19. The security subsystem of claim 14, wherein said DES operation is a selected one of a DES CBC operation and a DES CFB operation; said security subsystem further comprises a data router coupled to said security engine to selectively route a current block of data bits of said first data object and a result of the selected DES security operation for a prior block of data bits to said security engine; and said control portion is further coupled to said data router to control its operation. 20. The security subsystem of claim 19, wherein <additional details on the data router>. 21. The security subsystem of claim 1, wherein said security operation is a hashing operation. 22. The security subsystem of claim 21, wherein said hashing operation is a selected one of a MD5 operation and a SHA-1 operation. 23. The security subsystem of claim 21, wherein said first descriptor of said first data object also describes operating parameters including a plurality of chaining variables to be employed to perform said hashing operation on each of said blocks of data bits of said first data object, and said first control portion further causes said described operating parameters including said chaining variables to be provided to said first security engine. 24. The security subsystem of claim 1, wherein said security subsystem further comprises a control register to facilitate a subsystem external to said security subsystem in providing one more control instructions to said control portion of said security subsystem. 25. The security subsystem of claim 24, wherein at least one of said control instructions is a selected one of instructing said control portion to start said first security operation, to interrupt said external subsystem upon completing said first security operation for all blocks of data bits of said first data segments of said first data object, to interrupt said external subsystem upon completing said first security operation for all blocks of data bits of said first data object, and to stop said security subsystem upon completing said first security operation for all blocks of data bits of said first data segments of said first data object. 26. The security subsystem of claim 1, wherein said security subsystem further comprises a status register to facilitate said control portion of said security subsystem in providing one or more status to a subsystem external to said security subsystem. 27. The security subsystem of claim 26, wherein at least one of said status is a selected one of a pending interrupt issued on completion of said first security operation for all blocks of data bits of said first data segments of said first data object, a pending interrupt issued on completion of said first security operation for all blocks of data bits of said first data object, completion of said first security operation for all blocks of data bits of said first data segments of said first data object, completion of said first security operation for all blocks of data bits of said first data object and said security subsystem being in a busy state. 28. The security subsystem of claim 1, wherein said security subsystem further comprises a second security engine to perform a second security operation on a block of data bits; a second plurality of registers to collectively store a second descriptor of a second data object having second one or more data segments, with each of said second one or more data segments having a plurality of data bits; and said control portion is further coupled to said second registers and the second security engine to cause (a) said second descriptor of said second data object to be loaded into said second registers, first describing a second data segment of said second data object, and said second descriptor to be successively updated to correspondingly describe second additional data segments of said second data object, if any, one data segment at a time, and (b) data bits of each currently described one of said second data segments to be successively fetched, organized into blocks of data bits, and provided to said second security engine to have said second security operation to be successively performed on the provided blocks of data bits. 29. The security subsystem of claim 28, where said control portion further causes the results of said second security operations performed for the provided blocks of data bits to be successively returned. 30. The security subsystem of claim 28, where said second descriptor of said second data object also describes operating parameters to be employed to perform said second security operation for each of said blocks of data bits of said second data object, and said control portion further causes said described operating parameters to be provided to said second security engine. 31. The security subsystem of claim 28, wherein said first security operation is a DES operation and said second security operation is a hashing operation. 32. The security subsystem of claim 1, wherein said security subsystem further comprises a data transfer unit coupled to said first security engine and said control portion to retrieve and provide said data bits of said first data object for said first security engine, and return the results of said first security operations performed for said data bits of said first data object, under the control of said control portion. 33. In a security subsystem, a method of operation comprising: retrieving and storing a first descriptor describing a first data segment of a first data object; and causing first data bits of said described first data segment of the first data object to be successively retrieved, organized into blocks of data bits, provided to a first security engine of the security subsystem, have a first security operation performed by the first security engine on each of the provided blocks of data bits, and the results of the first security operations performed on the provided blocks of data bits to be returned. 34. The method of claim 33, wherein the method further comprises accepting and storing a plurality of control instructions instructing said security subsystem in its manner of operation; and stopping said security subsystem, if so instructed, upon causing said first security operation to be performed on each of said provided blocks of data bits of said first data segment of said first data object. 35. The method of claim 33, wherein the method further comprises accepting and storing a plurality of control instructions instructing said security subsystem in its manner of operation; and interrupting a subsystem external to said security subsystem, if so instructed, upon causing said first security operation to be performed on each of the provided blocks of data bits of said first data segment of said first data object. 36. The method of claim 33, wherein the method further comprises updating said first descriptor to describe a second segment of said first data object; and causing second data bits of said described second segment of the first data object to be successively retrieved, organized into blocks of data bits, provided to said first security engine of the security subsystem, have said first security operation performed by the first security engine on each of the provided blocks of data bits, and the results of the first security operations performed on the provided blocks of data bits to be returned. 37. The method of claim 36, wherein the method further comprises accepting and storing a plurality of control instructions instructing said security subsystem in its manner of operation; and interrupting a subsystem external to said security subsystem, if so instructed, upon causing said first security operation to be performed on all provided blocks of data bis of all data segments of said first data object. 38. The method of claim 36, wherein said first data blocks of said first data segment of said first data object and said second data blocks of said second data segment of said first data object are stored in contiguous storage locations. 39. The method of claim 36, wherein said first data blocks of said first data segment of said first data object and said second data blocks of said second data segment of said first data object are stored in discontiguous storage locations. 40. The method of claim 36, wherein the results of said first security operations performed on said data bits of said first data segment of said first data object and the results of said first security operations performed on said data bits of said second data segment of said first data object are returned to contiguous storage locations. 41. The method of claim 36, wherein the results of said first security operations performed on said data bits of said first data segment of said first data object and the results of said first security operations performed on said data bits of said second data segment of said first data object are stored in discontiguous storage locations. 42. The method of claim 33, wherein said first descriptor of said first data object also describes operating parameters to be employed to perform said first security operation on each of said organized blocks of data bits of said first data segment of said first data object, and the method further comprises providing the described operating parameters to said first security engine. 43. The method of claim 33, wherein said first security operation is a DES operation. 44. The method of claim 43, wherein said DES operation is a selected one of a DES cipher operation and a DES decipher operation. 45. The method of claim 43, wherein said DES operation is a selected one of a DES ECB operation, a DES CBC operation and a DES CFB operation. 46. The method of claim 43, wherein said first descriptor of said first data object also describes operating parameters including a first and a second key of to be employed to perform said DES operation on each of said first data blocks of said first data segment of said first data object, and the method further comprises providing said first and second keys of said DES operation to said first security engine. 47. The method of claim 46, wherein said operating parameters further include a third key of said DES operation. 48. The method of claim 43, wherein said DES operation is a selected one of a DES CBC operation and a DES CFB operation; and said method further comprises causing a selected one of a current block of data bits of said first data segment and a result of the selected DES security operation for a prior block of data bits to be provided to said security engine. 49. The method of claim 48, wherein <additional details on the data router>. 50. The method of claim 33, wherein said security operation is a hashing operation. 51. The method of claim 50, wherein said hashing operation is a selected one of a MD5 operation and a SHA-1 operation. 52. The method of claim 50, wherein said first descriptor of said first data object also describes operating parameters including a plurality of chaining variables to be employed to perform said hashing operation on each of said blocks of data bits of said first data segment of said first data object, and the method further comprises providing said chaining variables to said first security engine. 53. The method of claim 33, wherein the method further comprises providing one or more status to a subsystem external to said security subsystem. 54. The method of claim 53, wherein at least one of said status is a selected one of a pending interrupt issued on completion of said first security operation for all data bits of said first data segment of said first data object, a pending interrupt issued on completion of said first security operation for all data bits of said first data object, completion of said first security operation for all data bits of said first data segment of said first data object, completion of said security operation for all data bits of said first data object and said security subsystem being in a busy state. 55. The method of claim 33, wherein the method comprises retrieving and storing a second descriptor describing a second segment of a second data object; and causing second data bits of said described second segment of the second data object to be successively retrieved, organized into blocks of data bits, and provided to a second security engine of the security subsystem, have a second security operation performed by the second security engine on each of the provided blocks of data bits, and the results of the second security operations performed on the blocks of data bits to be returned. 56. The method of claim 55, wherein the method further comprises successively returning the results of said second security operations performed for the provided blocks of data bits. 57. The method of claim 55, wherein said second descriptor of said second data object also describes operating parameters to be employed to perform said second security operation for each of said provided blocks of data bits of said second data segment of said second data object, and the method further comprises providing said described operating parameters to said second security engine. 58. The method of claim 55, wherein said first security operation is a DES operation and said second security operation is a hashing operation. 59. An apparatus comprising: a memory to store data and descriptive information of said data; a processor coupled to said memory to set up in said memory a first descriptor having first one or more parts, describing a first data object having first one or more data segments, with each of said first one or more data segments having a plurality of data bits; and a security subsystem coupled to said memory and said processor to perform a first security operation on each of a plurality of blocks of data bits of said first one or more data segments of said first data object, responsive to a request of said processor, wherein the security subsystem is equipped to (a) first retrieve a first part of said first descriptor, and then successively updates said first descriptor with its additional parts, if applicable, (b) successively fetch the data bits of said first one or more data segments of said first data object in accordance with the successive current descriptions of the first descriptor, (c) successively organize the fetched data bits into blocks of data bits, (d) successively perform said first security operation on said organized data blocks, and (e) successively return the results of said successive first security operations. 60. The apparatus of claim 59, wherein the security subsystem comprises a first security engine to perform said first security operation for a block of data bits; a first plurality of registers to collectively store the currently retrieved part of a data object descriptor; and a control portion coupled to said first registers and the first security engine to cause (a) said first part of said first descriptor of said first data object to be loaded into said first registers, and then successively updated to successively describe said first one or more data segments of said first data object, (b) data bits of each currently described one of said first data segments to be successively fetched, organized into blocks of data bits, and provided to said first security engine to have said first security operation to be successively performed on the provided data blocks, and (c) the results of said successively performed first security operations to be returned. 61. The apparatus of claim 59, wherein each of said first one or more parts of said first descriptor describes storage locations of data bits of a corresponding one of said first one or more data segments of said first data object. 62. The apparatus of claim 61, wherein said first one or more data segments of said first data object comprise two or more data segments, and the storage locations of the data blocks of at least one of the data segments are discontiguous from the storage location of the data blocks of the other data segments of said first data object. 63. The apparatus of claim 59, wherein each of said first one or more parts of said first descriptor describes storage locations for returning the results of said first security operations for the data bits of a corresponding one of said first one or more data segments of said first data object. 64. The apparatus of claim 63, wherein said first one or more data segments of said first data object comprise two or more data segments, and the storage locations for returning the results of said first security operations performed for the data bits of at least one of the data segments are discontiguous from the storage location for returning the results of said first security operations performed for the data bits of the other data segments of said first data object. 65. The apparatus of claim 59, wherein at least a first part of said first descriptor of said first data object also describes operating parameters to be employed to perform said first security operation for each of said blocks of data bits of said first data object. 66. The apparatus of claim 59, wherein said first security operation is a DES operation. 67. The apparatus of claim 66, wherein said DES operation is a selected one of a DES cipher operation and a DES decipher operation. 68. The apparatus of claim 66, wherein said DES operation is a selected one of a DES ECB operation, a DES CBC operation and a DES CFB operation. 69. The apparatus of claim 66, wherein at least a first part of said first descriptor of said first data object also describes operating parameters including a first and a second key of to be employed to perform said DES operation on each of said blocks of data bits of said first data object. 70. The apparatus of claim 69, wherein said operating parameters further include a third key of said DES operation. 71. The apparatus of claim 66, wherein said DES operation is a selected one of a DES CBC operation and a DES CFB operation; and said security subsystem is further equipped to selectively employ a current block of data bits of said first data object and a result of the selected DES security operation for a prior block of data bits to perform the selected DES operation. 72. The apparatus of claim 59, wherein said security operation is a hashing operation. 73. The apparatus of claim 72, wherein said hashing operation is a selected one of a MD5 operation and a SHA-1 operation. 74. The apparatus of claim 72, wherein at least a first part of said first descriptor of said first data object also describes operating parameters including a plurality of chaining variables to be employed to perform said hashing operation for each of said blocks of data bits of said first data object. 75. The apparatus of claim 59 wherein said security subsystem further comprises a control register to facilitate said processor in providing one more control instructions to said security subsystem. 76. The apparatus of claim 75, wherein at least one of said control instructions is a selected one of instructing said security subsystem to start said first security operation, to interrupt said processor upon completing said first security operation for all blocks of data bits of said first data segments of said first data object, to interrupt said processor upon completing said first security operation for all blocks of data bits of said first data object, and to stop said security subsystem upon completing said first security operation for all blocks of data bits of said first data segments of said first data object. 77. The apparatus of claim 59, wherein said security subsystem further comprises a status register to facilitate said security subsystem in providing one or more status to said processor. 78. The apparatus of claim 77, wherein at least one of said status is a selected one of a pending interrupt issued on completion of said first security operation for all blocks of data bits of said first data segments of said first data object, a pending interrupt issued on completion of said first security operation for all blocks of data bits of said first data object, completion of said first security operation for all blocks of data bits of said first data segments of said first data object, completion of said first security operation for all blocks of data bits of said first data object and said security subsystem being in a busy state. 79. The apparatus of claim 59, wherein said processor is also to set up in said memory a second descriptor having second one or more parts, describing a second data object having second one or more data segments, with each of said second one or more data segments having a plurality of data bits; and said security subsystem is also to perform a second security operation for data bits of said second one or more data segments of said second data object, responsive to a request of said processor, wherein the security subsystem is also equipped to (a) first retrieve a first part of said second descriptor, and then successively updates said second descriptor with its additional parts, if applicable, (b) successively fetch the data bits of said second one or more data segments of said second data object in accordance with the successive current descriptions of the second descriptor, (c) successively organized the successively fetched data bits into blocks of data bits, (d) successively perform said second security operation on said successively organized blocks of data bits, and (d) successively return the results of said successive second security operations. 80. The apparatus of claim 79, wherein said first security operation is a DES operation and said second security operation is a hashing operation. 81. The apparatus of claim 59, wherein said apparatus is disposed on a single integrated circuit. 82. A method comprising: a processor setting up in a memory a first descriptor having first one or more parts, describing a first data object having first one or more data segments, with each of said first one or more data segments having a plurality of data bits; and a security subsystem performing a first security operation on the data bits of said first one or more data segments of said first data object, responsive to a request of said processor, by (a) first retrieving a first part of said first descriptor, and then successively updating said first descriptor with its additional parts, if applicable, (b) successively fetching the data bits of said first one or more data segments of said first data object in accordance with the successive current descriptions of the first descriptor, (c) successively organizing the fetched data bits into blocks of data bits, (d) successively performing said first security operation on said successively organized data blocks, and (d) successively returning the results of said successive first security operations. 83. The method of claim 82, wherein each of said first one or more parts of said first descriptor describes storage locations of data bits of a corresponding one of said first one or more data segments of said first data object. 84. The method of claim 83, wherein said first one or more data segments of said first data object comprise two or more data segments, and the storage locations of the data blocks of at least one of the data segments are discontiguous from the storage location of the data blocks of the other data segments of said first data object. 85. The method of claim 82, wherein each of said first one or more parts of said first descriptor describes storage locations for returning the results of said first security operations for data bits of a corresponding one of said first one or more data segments of said first data object. 86. The method of claim 85, wherein said first one or more data segments of said first data object comprise two or more data segments, and the storage locations for returning the results of said first security operations performed for the data bits of at least one of the data segments are discontiguous from the storage location for returning the results of said first security operations performed for the data bits of the other data segments of said first data object. 87. The method of claim 82, wherein at least a first part of said first descriptor of said first data object also describes operating parameters to be employed to perform said first security operation for data bits of said first data object. 88. The method of claim 82, wherein said first security operation is a DES operation. 89. The method of claim 88, wherein said DES operation is a selected one of a DES cipher operation and a DES decipher operation. 90. The method of claim 88, wherein said DES operation is a selected one of a DES ECB operation, a DES CBC operation and a DES CFB operation. 91. The method of claim 88, wherein at least a first part of said first descriptor of said first data object also describes operating parameters including a first and a second key of to be employed to perform said DES operation on each of said data blocks of said first data object. 92. The method of claim 91, wherein said operating parameters further include a third key of said DES operation. 93. The method of claim 88, wherein said DES operation is a selected one of a DES CBC operation and a DES CFB operation; and said method further comprises said security subsystem selectively employing a current block of data bits of said first data object and a result of the selected DES security operation for a prior block of data bits to perform the selected DES operation. 94. The method of claim 82, wherein said security operation is a hashing operation. 95. The method of claim 94, wherein said hashing operation is a selected one of a MD5 operation and a SHA-1 operation. 96. The method of claim 94, wherein at least a first part of said first descriptor of said first data object also describes operating parameters including a plurality of chaining variables to be employed to perform said hashing operation for each of said blocks of data bits of said first data object. 97. The method of claim 82 wherein said method further comprises said processor providing one more control instructions to said security subsystem. 98. The method of claim 97, wherein at least one of said control instructions is a selected one of instructing said security subsystem to start said first security operation, to interrupt said processor upon completing said first security operation for all data bits of one of said first data segments of said first data object, to interrupt said processor upon completing said first security operation for all data bits of said first data object, and to stop said security subsystem upon completing said first security operation for all data bits of one of said first data segments of said first data object. 99. The method of claim 82, wherein said method further comprises said security providing one or more status to said processor. 100. The method of claim 99, wherein at least one of said status is a selected one of a pending interrupt issued on completion of said first security operation for all data bits of one of said first data segments of said first data object, a pending interrupt issued on completion of said first security operation for all data bits of said first data object, completion of said first security operation for all data bits of one of said first data segments of said first data object, completion of said first security operation for all data bits of said first data object and said security subsystem being in a busy state. 101. The method of claim 82, wherein the method further comprises said processor setting up in said memory a second descriptor having second one or more parts, describing a second data object having second one or more data segments, with each of said second one or more data segments having a plurality of data bits; and said security subsystem performing a second security operation on data bits of said second one or more data segments of said second data object, responsive to a request of said processor, by (a) first retrieving a first part of said second descriptor, and then successively updating said second descriptor with its additional parts, if applicable, (b) successively fetching the data blocks of said second one or more data segments of said second data object in accordance with the successive current descriptions of the second descriptor, (c) successively organizing the fetched data bits into blocks of data bits, (d) successively performing said second security operation for said successively organized blocks of data bits, and (e) successively returning the results of said successive second security operations. 102. The method of claim 101, wherein said first security operation is a DES operation and said second security operation is a hashing operation. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The present invention relates to the field of security. More specifically, the present invention relates to the provision of a security subsystem having an intelligent direct memory access (DMA) controller in a multi-service system-on-chip to improve operational efficiency. 2. Background Information Advances in integrated circuit technology have led to the birth and proliferation of a wide variety of integrated circuits, including but not limited to application specific integrated circuits, micro-controllers, digital signal processors, general purpose microprocessors, and network processors. Recent advances have also led to the birth of what's known as “system on a chip” or SOC. In various SOC applications, such as telecommunications, networking and content handling, it is often necessary to perform security operations of one or more types of security methods. The terms “security operations” and “security methods” as used in the present application include all known security operations/methods, as well as to be discovered security operations/methods that are compatible with the present invention. Examples of known security operations/methods include but are not limited to Data Encryption Standard (DES) methods and operations of all types, Electronic Codebook (ECB), Cipher Block Chaining (CBC), Cipher Feedback (CFB), and so forth, and hashing operations of all types, Message Digest (MD5), Secure HASH Algorithm (SHA-1) and so forth. Further, the security methods or operations often have to be performed for data of various types, including audio, video and other data, and of various subsystems, such as the subsystem responsible for interfacing the SOC to a network, the subsystem responsible for interfacing the SOC to a telecommunication line and so forth. Thus, a need exists to provide or support security operations of multiple security methods or operations in an efficient manner. |
<SOH> BRIEF DESCRIPTION OF DRAWINGS <EOH>The present invention will be described by way of exemplary embodiments, but not limitations, illustrated in the accompanying drawings in which like references denote similar elements, and in which: FIG. 1 illustrates an overview of a system-on-chip including a security subsystem incorporated with the teachings of the present invention, in accordance with one embodiment; FIG. 2 illustrates the method of the present invention, in accordance with one embodiment; FIG. 3 illustrates the data descriptor of the present invention in further details, in accordance with one embodiment; FIGS. 4 a - 4 d illustrate the base and continuation portion of a data descriptor in further details, in accordance with one embodiment; FIG. 5 illustrates the security subsystem of the present invention in further details, in accordance with one embodiment; FIGS. 6 a - 6 b illustrate the control and status registers of the security subsystem of FIG. 5 in further details, in accordance with one embodiment; FIG. 7 illustrates the further provision of a data traffic router for a DES security engine to support multiple variants of DES operations, in accordance with one embodiment; FIG. 8 illustrates the data traffic router of FIG. 7 in further details, in accordance with one embodiment; and FIG. 9 illustrates the operational flow of the relevant aspects of the controller of the security subsystem of FIG. 5 in further details, in accordance with one embodiment. detailed-description description="Detailed Description" end="lead"? |
Animal trap |
An animal trap (1) comprising a containment body (2) with at least two entrances, each entrance having a door (3) operable to close and contain an animal within the containment body, the entrances to the containment body being aligned so as to provide an animal to be trapped with a view through the containment body. There is also disclosed an animal trap system incorporating an animal trap having a transmitter unit (10) operable to transmit a first signal indicative of the presence of the trap. |
1-14. (canceled) 15. An animal trap, comprising: a containment body having at least two entrances, each entrance having a door that closes to contain an animal within said containment body, said entrances aligned so as to provide an animal to be trapped with a view through said containment body; a release mechanism that initiates simultaneous closure of said doors; and a transmitter unit that transmits one or more signals. 16. The animal trap of claim 15, further comprising an indicator unit that receives said one or more signals and provides one or more alerts. 17. An animal containment system, comprising: a containment body having at least two entrances, each entrance having a door that closes to contain an animal within said containment body, said entrances aligned so as to provide an animal to be trapped with a view through said containment body; a release mechanism that initiates simultaneous closure of said doors; and a transmitter unit that transmits one or more signals. 18. The containment system of claim 17, further comprising an indicator unit that receives said one or more signals and provides one or more alerts. 19. A method that makes an animal trap, comprising: providing a containment body having at least two entrances, each entrance having a door that closes to contain an animal within said containment body, said entrances aligned so as to provide an animal to be trapped with a view through said containment body; coupling a release mechanism to said containment body, said release mechanism initiates simultaneous closure of said doors; and coupling a transmitter unit to said containment body, said transmitter unit transmits one or more signals. 20. The method of claim 19, further comprising providing an indicator unit that receives said one or more signals and provides one or more alerts. 21. A method that traps an animal, comprising: providing a containment body having at least two entrances, each entrance having a door that closes to contain an animal within said containment body, said entrances aligned so as to provide an animal to be trapped with a view through said containment body; closing said doors simultaneously using a release mechanism; and transmitting one or more signals using a transmitter unit. 22. The method of claim 21, further comprising receiving said one or more signals using an indicator unit that provides one or more alerts. 23. A dependent claim according to claim 15, 17, 19, or 21, wherein said transmitter transmits a first signal when said doors are open that indicates the presence of a set trap. 24. A dependent claim according to claim 23, wherein said transmitter unit transmits a second signal when said doors are closed that indicates that a trap has been activated. 25. A dependent claim according to claim 23, wherein said transmitter unit disables said first signal when said doors are closed. 26. A dependent claim according to claim 24, wherein said transmitter unit disables said first signal and enables said second signal when said doors are closed. 27. A dependent claim according to claim 15, 17, 19, or 21, wherein said transmitter unit transmits a unique identification code that identifies said transmitter unit in said one or more signals. 28. A dependent claim according to claim 15, 17, 19, or 21, wherein said transmitter unit transmits said one or more signals at least once during a pre-determined time period. 29. A dependent claim according to claim 16, 18, 20, or 22, wherein said indicator unit provides said one or more alerts under one or more of the following conditions: when said indicator unit does not receive a signal from said transmitter unit within a predetermined time period, or when said indicator unit receives a first signal from said transmitter unit indicative of the presence of a trap followed within a predetermined time period by a second signal indicative of the closure of said doors. 30. A dependent claim according to claim 29, wherein said transmitter unit transmits a unique identification code that identifies said transmitter unit in said one or more signals and said one or more alerts further indicates the identity of said transmitter unit. |
Cloning vectors and method for molecular cloning |
The invention discloses a family of cloning vectors capable of cloning nucleic acid inserts of interest of long sizes, with low or reduced background and high efficiency of excision and method for preparing these vectors and library thereof. As example, it is disclosed a cloning vector comprising a construction vector segment (CS) and a replaceable segment (RS), wherein the size of CS is: 36.5 kb≦CS<38 kb, preferably CS is 37.5 kb, comprising lox recombination sites for Cre-recombination and/or att recombination sites for Gateway-like recombination, preferably also a background-reducing system selected from the group of: the ccdB gene, a lox sequence, the lacZ gene, and asymmetric site sequences recognized by restriction endonucleases. |
1. A cloning bacteriophage vector comprising a construction segment (CS) and a replaceable segment (RS), wherein the size of CS is: X−1.2 kb≦CS<X; wherein X corresponding to the minimum size necessary to the vector for undergoing packaging. 2. The cloning vector of claim 1, wherein the size of CS is: X−0.2 kb. 3. A cloning bacteriophage vector comprising a construction segment (CS) and a replaceable segment (RS), wherein the size of CS is: 36.5 kb≦CS<38 kb. 4. The cloning vector of claim 3, wherein CS is 37.5 kb. 5. The cloning vector of claim 4, wherein CS is or comprises a foreign segment of 5.5 kb. 6. The cloning vector of claims 1-5, wherein said bacteriophage is λ. 7. The cloning vector of claim 1, wherein CS is a bacteriophage vector segment modified by comprising a plasmid segment at least comprising a ori. 8. The cloning vector of claim 7, wherein said plasmid segment comprising a ori is selected from the group of: pBluescript (+), pUC, pBR322, and pBAC. 9. The cloning vector of claim 1, wherein CS further comprises at least a selectable marker selected from the group consisting of: a DNA segment that encodes a product that provides resistance against otherwise toxic compounds; a DNA segment that encodes a product that suppresses the activity of a gene product; a DNA segment that encodes a product that is identifiable; a DNA segment that encodes a product that inhibits a cell function; a DNA segment that provides for the isolation of a desired molecule; a DNA segment that encodes a specific nucleotide recognition sequence which is recognized by an enzyme. 10. The cloning vector of claim 9, wherein said selectable marker comprises at least a marker selected from the group consisting of an antibiotic resistance gene, an auxotrophic marker, a toxic gene, a phenotypic marker, an enzyme cleavage site, a protein binding site; and a sequence complementary to a PCR primer sequence. 11. The cloning vector of claim 1, wherein said RS is flanked by two recombination sites, and said two recombination sites do not recombine with each other. 12. The cloning vector of claim 11, wherein said two recombination sites are selected from the group consisting of attB, attP, attL, attR and derivatives thereof. 13. The cloning vector of claim 11, wherein said two recombination sites flanking RS are lox recombination sites, which do not recombine with each other. 14. The cloning vector of claims claim 1, wherein CS further comprising two lox recombinant sites, said two lox recombination sites being capable of recombine with each other. 15. The cloning vector of claims 13-14, wherein the recombinant sites are loxP sites or derivatives thereof. 16. The cloning vector of claims claim 1, wherein RS further comprising at least a background-reducing sequence. 17. The cloning vector of claim 16, wherein said at least a background-reducing sequence is selected from the group consisting of: i) the ccdB gene, ii) the lacZ gene, iii) a lox sequence. 18. The cloning vector of claim 17, wherein said iii) lox sequence is loxP or a derivative thereof. 19. The cloning vector of claims claim 1, wherein RS is flanked by i) two homing endonuclease asymmetric recognition site sequences, which do not ligate with each other; or ii) two restriction asymmetric endonuclease cleavage sites sequences, which do not ligate with each other, recognizable by class IIS restriction enzymes. 20. The cloning vector of claim 19, wherein said homing endonuclease is selected from the group consisting of: I-CeuI, PI-SceI, PI-PspI, and I-SceI. 21. The cloning vector of claim 20, wherein said homing endonuclease asymmetric recognition site sequences are sequences from 18 to 39 bp. 22. The cloning vector of claims claim 1, which is linear. 23. The cloning vector of claim claim 1, wherein RS is replaced by a nucleic acid insert of interest. 24. The cloning vector of claim 23, wherein said insert is selected from the group consisting of DNA, cDNA and RNA/DNA hybrid. 25. The cloning vector of claim 23, wherein said insert is a long cDNA. 26. The cloning vector of claim 23, wherein said insert is a full-length cDNA. 27. The cloning vector of claim 26, wherein said full-length cDNA is a normalized and/or subtracted full-length cDNA. 28. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest, comprising the steps of: (a) preparing at least a cloning bacteriophage vector comprising a construction segment (CS) and a replaceable segment (RS), wherein the size of CS is: X−1.2 kb≦CS<X; wherein X corresponding to the minimum size necessary to the vector for undergoing packaging. (b) replacing RS with a nucleic acid insert of interest into the cloning vector obtaining the product according to claim 23; (c) allowing the in vivo or in vitro excision of the nucleic acid insert of interest or of the plasmid comprising the nucleic acid insert of interest; (d) recovering the (recombinant) plasmid carrying the nucleic acid insert of interest or a library of these plasmids. 29. The method of claim 28, wherein between step b) and c) a step of amplification of the cloning vector is carried out. 30. A bacteriophage cloning vector comprising a construction segment (CS) and a replaceable segment (RS), wherein said RS comprises at least the ccdB gene. 31. A bacteriophage or plasmid cloning vector comprising a construction segment (CS) and a replaceable segment (RS), wherein said RS comprises at least a recombination site or a derivative thereof; or RS is flanked by two asymmetric site sequences, which do not ligate with each other, and are recognized by restriction endonucleases. 32. The cloning vector of claims 30-31, wherein said bacteriophage is λ. 33. The cloning vector of claim 30, wherein the size of the bacteriophage vector CS is: 32 kb≦CS≦45 kb. 34. The cloning vector of claim 30, wherein CS is: 36.5 kb≦CS<38 kb. 35. The cloning vector of claim 34, wherein CS is 37.5 kb. 36. The cloning vector of claim 31, wherein said recombination site is lox recombination site or a derivative thereof. 37. The cloning vector of claim 36, wherein said lox site is a loxP site or derivatives thereof. 38. The cloning vector of claim 30, wherein the CS of said vector comprises a plasmid segment at least comprising an ori. 39. The cloning vector of claim 38, wherein said plasmid segment comprising an ori is selected from the group consisting of :pBluescript(+), pUC, pBR322 and pBAC. 40. The cloning vector of claim 30, wherein CS further comprises at least a selectable marker selected from the group consisting of: a DNA segment that encodes a product that provides resistance against otherwise toxic compounds; a DNA segment that encodes a product that suppresses the activity of a gene product; a DNA segment that encodes a product that is identifiable; a DNA segment that encodes a product that inhibits a cell function; a DNA segment that provides for the isolation of a desired molecule; a DNA segment that encodes a specific nucleotide recognition sequence which is recognized by an enzyme. 41. The cloning vector of claim 40, wherein said selectable marker comprises at least a marker selected from the group consisting of an antibiotic resistance gene, an auxotrophic marker, a toxic gene, a phenotypic marker, an enzyme cleavage site, a protein binding site; and a sequence complementary to a PCR primer sequence. 42. The cloning vector of claim 30, wherein said RS is flanked by two recombination sites, and said recombination sites do not recombine with each other. 43. The cloning vector of claim 42, wherein said recombination sites are selected from the group consisting of attB, attP, attL, attR, and derivatives thereof. 44. The cloning vector of claim 42, wherein said two recombination sites flanking RS are lox recombination sites or derivatives thereof and do not recombine with each other. 45. The cloning vector of claim 44, wherein the lox recombination site is loxP or a derivative thereof. 46. The cloning vector of claim 30, wherein CS further comprising two recombinant sites or derivatives thereof, these two recombination sites being capable of recombine with each other. 47. The cloning vector of claim 46, wherein said two recombination sites are lox recombination sites or derivatives thereof. 48. The cloning vector of claim 47, wherein said lox recombination site is loxP or a derivative thereof. 49. The cloning vector of claim 30, wherein said RS further comprises the lacZ gene. 50. The cloning vector of claim 30, wherein said asymmetric site sequences are i) two homing endonuclease asymmetric site sequences or ii) two restriction endonuclease cleavage sites sequences recognizable by class IIS restriction enzymes. 51. The cloning vector of claim 50, wherein said restriction homing endonuclease capable of cutting said asymmetric site sequences is selected from the group consisting of: I-CeuI, PI-SceI, PI-PspI and I-SceI. 52. The cloning vector of claims 50-51, wherein said homing endonuclease asymmetric recognition site sequences are sequences from 18 to 39 bp. 53. The cloning vector of claim 30, which is linear. 54. The cloning vector of claim 30, wherein RS is replaced by a nucleic acid insert of interest. 55. The cloning vector of claim 54, wherein said insert is selected from the group consisting of DNA, cDNA and RNA/DNA hybrid. 56. The cloning vector of claim 54, wherein said insert is a long cDNA. 57. The cloning vector of claim 54, wherein said insert is a full-length cDNA. 58. The cloning vector of claim 57, wherein said full-length cDNA is a normalized and/or subtracted full-length cDNA. 59. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest, comprising the steps of: (a) preparing at least a bacteriophage cloning vector comprising a construction segment (CS) and a replaceable segment (RS), said RS comprising the ccdB gene; (a) replacing RS with a nucleic acid insert of interest into the cloning vector; (c) allowing the in vivo or in vitro excision of the nucleic acid insert of interest or of the plasmid comprising the nucleic acid insert of interest; (d) recovering the (recombinant) plasmid carrying the nucleic acid insert of interest and lacking the ccdB gene or a library of these plasmids. 60. The method of claim 59, wherein between the steps b) and c) an amplification step of the at least a cloning vector is carried out. 61. A method for cloning a nucleic acid of interest or a bulk nucleic acid library of interest, comprising the step of: (a) preparing at least bacteriophage cloning vector comprising a construction segment (CS) and a replaceable segment (RS), wherein said RS comprises at least the ccdB gene; wherein RS is flanked by two recombination sites, and said two recombination sites do not recombine with each other; (b) replacing RS with a nucleic acid insert of interest into the cloning vector obtaining a product according to claims 54-58; (c) allowing the in vitro excision of the nucleic acid insert of interest by providing to the cloning vector of step b) at least a destination vector comprising a destination replaceable segment (RS) flanked by two recombination sites, said two recombination sites do not recombine with each other, and said destination RS comprises at least the ccdB gene; (d) recovering a recombinant plasmid carrying the nucleic acid insert of interest and lacking of the ccdB gene or a library of said plasmids. 62. (The method of claim 61, wherein between the steps b) and c) an amplification step of the at least a plasmid is carried out. 63. The method of claim 61, wherein said two recombination sites of both the cloning vector of step a) and the destination vector of step d) are derived from recombination site selected from the group consisting of attB, attP, attL, and attR or derivatives thereof. 64. The method of claim 61, wherein said recombination sites flanking RS are lox recombination sites or derivatives thereof, and do not recombine with each other. 65. The method of claim 64, wherein said lox recombination sites are loxP or derivatives thereof. 66. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest, comprising the steps of: (a) preparing at least a cloning vector comprising a construction segment (CS) and a replaceable segment (RS), said CS comprising two recombination sites which recombine with each other, and said RS comprising a recombination site capable of recombining with one of the two sites placed into CS; (b) replacing RS with a nucleic acid insert of interest into the cloning vector of step a); (c) allowing the in vivo or in vitro excision of the nucleic acid insert of interest or of the plasmid comprising the nucleic acid insert of interest; (d) recovering the (recombinant) plasmid carrying the nucleic acid insert of interest or a library of said plasmids. 67. The method of claim 66, wherein said RS and CS recombination sites are lox recombination site or derivatives thereof 68. The method of claim 67, wherein said lox site is a loxP site or derivatives thereof. 69. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest, comprising the steps of: (a) preparing at least a cloning vector comprising a construction segment (CS) and a replaceable segment (RS), said RS being flanked by two endonuclease asymmetric recognition site sequences, which do not ligate with each other; (b) replacing RS with a nucleic acid insert of interest comprising two endonuclease asymmetric recognition site sequences flanking said insert of interest, said sequences being capable of ligating with the two sequences placed into the vector of step a), and obtaining a vector comprising the nucleic acid insert of interest; (c) allowing the in vivo or in vitro excision of the nucleic acid insert of interest or of the plasmid comprising the nucleic acid insert of interest; (d) recovering the (recombinant) excised plasmid or destination plasmid carrying the nucleic acid insert of interest or a library of said plasmids. 70. The method of claim 69, wherein said endonuclease asymmetric recognition site sequences are: i) two homing endonuclease asymmetric recognition site sequences; or ii) two asymmetric restriction endonuclease cleavage site sequences recognizable by class IIS restriction enzymes. 71. The method of claim 70, wherein said restriction homing endonucleases capable of cutting said asymmetric site sequences are selected from the group consisting of: I-CeuI, PI-Scei, PI-PspI and I-SceI. 72. The method of claims 70, wherein said homing endonuclease asymmetric site sequences are from 18 to 39 bp. 73. A method for cloning a nucleic acid insert of interest or preparing a bulk nucleic acid library of interest comprising the steps of: (a) preparing at least a cloning vector, comprising a construction segment (CS) and a replaceable segment (RS), wherein said CS is a bacteriophage vector comprising two lox recombination sites or derivatives thereof; (b) replacing RS with a nucleic acid insert of interest into the cloning vector; (c) packaging of the vector; (d) in vivo in liquid-phase infection of at least a cell expressing Cre-recombinase; (e) allowing the in vivo in liquid-phase excision of at least a plasmid comprising the nucleic acid insert of interest under condition of short-time growth or no growth of the excised plasmid; (ii.)(f) carrying out cellular lysis and recovery of the plasmid carrying the insert or of a library of said plasmids. 74. The method of claim 63, further comprising the step of: (g) electroporating or transforming at least a cell, not expressing Cre-recombinase, making the plasmid(s) of step f) penetrating into said cell(s); (h) plating of cell(s) infected as at step g) and recovering the plasmid carrying the nucleic acid insert of interest or a library of said plasmids. 75. The method of claim 72, wherein said bacteriophage is λ. 76. The method of claim 73, wherein said lox recombination sites are loxP or derivatives thereof. 77. The method of claim 73, wherein between the steps c) and d) an amplification of the packaged vector(s) is carried out. 78. The method of claims 73-77, wherein the cloning vector of step a) is a cloning vector according to claims 1-22 or 30-53, and the product of step b) is a vector comprising the insert of interest according to claims 23-27 or 54-58. 79. The method of claim 73, wherein the step e) is carried out in 0-3 hours at the temperature 20-45° C. 80. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest comprising the step of: (a) preparing at least a cloning vector, comprising a construction segment (CS) and a replaceable segment (RS), wherein said CS is a bacteriophage vector segment comprising two lox recombination sites or derivatives thereof positioned at left and right side of said RS; (b) replacing RS with a nucleic acid insert of interest into the cloning vector; (c) in vitro packaging of the at least a bacteriophage cloning vector of step b) in presence of packaging extract; (d) extraction of bacteriophage cloning vector from the capside; (e) in vitro excision of the plasmid comprising the nucleic acid insert of interest from the vector in presence of Cre-recombinase; (f) recovery of said plasmid or library of plasmids. 81. The method of claim 80, further comprising the step: (g) electroporating or transforming at least a cell, not expressing Cre-recombinase, making said plasmid entering into said cell; (h) plating the cell of step g) and recovering plasmid carrying the nucleic acid insert of interest or a library of said plasmids. 82. The method of claims 80-81, wherein between the steps c) and d), an amplification step on plate of the bacteriophage is carried out. 83. The method of claim 80, wherein the lox recombination sites are loxP or derivatives thereof. 84. The method of claim 80, wherein said bacteriophage is λ. 85. The method of claims 80-84, wherein the cloning vector of step a) is a cloning vector according to claims 1-22 or 30-53 and the insert of interest of step b) is according to claims 23-27 or 54-58. 86. A bacteriophage cloning vector comprising a construction segment (CS) and a replaceable segment (RS), wherein said RS is flanked by two recombination sites, and said two recombinant sites do not recombine with each other. 87. The cloning bacteriophage vector of claim 86, wherein said bacteriophage is λ. 88. The cloning vector of claims 86-87, wherein said recombination sites are selected from the group consisting of attB, attP, attL, attR and derivatives thereof. 89. The cloning vector of claim 86, wherein CS further comprises two lox recombination sites or derivatives thereof, said lox sites being capable of recombining with each other. 90. The cloning vector of claim 89, wherein said lox recombination sites are loxP or derivatives thereof. 91. The cloning vector of claim 86, wherein the size of the bacteriophage λ vector segment (CS) is: 32 kb≦CS≦45 kb. 92. The cloning vector of claim 91, wherein CS is: 36.5 kb≦CS<38 kb. 93. The cloning vector of claim 91, wherein CS is 37.5 kb. 94. The cloning vector of claim 86, wherein the bacteriophage CS comprises a plasmid segment at least comprising an ori. 95. The cloning vector of claim 94, wherein said plasmid segment comprising an ori is selected from the group consisting of: pBluescript(+), pUC, pBR322 and pBAC. 96. The cloning vector of claim 86, wherein CS further comprises at least a selectable marker selected from the group consisting of: a DNA segment that encodes a product that provides resistance against otherwise toxic compounds; a DNA segment that encodes a product that suppresses the activity of a gene product; a DNA segment that encodes a product that is identifiable; a DNA segment that binds a product that modifies a substrate; a DNA segment that provides for the isolation of a desired molecule; a DNA segment that encodes a specific nucleotide recognition sequence which is recognized by an enzyme. 97. The cloning vector of claim 96, wherein said selectable marker comprises at least a marker selected from the group consisting of an antibiotic resistance gene, an auxotrophic marker, a toxic gene, a phenotypic marker, an enzyme cleavage site, a protein binding site; and a sequence complementary to a PCR primer sequence. 98. The cloning vector of claim 86, wherein RS further comprising at least a background-reducing sequence selected from the group consisting of: i) the ccdB gene, ii) the lacZ gene, iii) a lox sequence. 99. The cloning vector of claim 98, wherein said lox sequence is loxP. 100. The cloning vector of claim 86, wherein RS is flanked by i) two homing endonuclease asymmetric recognition site sequences, which do not ligate with each other; or ii) two asymmetric restriction endonuclease cleavage sites sequences recognizable by class IIS restriction enzymes. 101. The cloning vector of claim 100, wherein said homing endonucleases capable of cutting said asymmetric site sequences are selected from the group consisting of: I-CeuI, PI-SceI, PI-PspI and I-SceI. 102. The cloning vector of claims 100-101, wherein said homing endonuclease asymmetric site sequences are sequences from 18 to 39 bp. 103. The cloning vector of claim 86, which is linear. 104. The cloning vector of claim 86, wherein RS is replaced by a nucleic acid insert of interest. 105. The cloning vector of claim 10, wherein said insert is selected from the group consisting of DNA, cDNA, RNA/DNA hybrid. 106. The cloning vector of claim 104, wherein said insert is a long cDNA. 107. The cloning vector of claim 104, wherein said insert is a full-length cDNA. 108. The cloning vector of claim 107, wherein said full-length cDNA is a normalized and/or subtracted full-length cDNA. 109. A method for cloning a nucleic acid insert of interest or for preparing a bulk nucleic acid library of interest, comprising the steps of: (a) preparing at least a cloning vector comprising a construction segment (CS) and a replaceable segment (RS), wherein said CS is a bacteriophage vector segment and RS is flanked by two recombination sites, and said two recombinant sites do not recombine with each other; (b) replacing said RS with a nucleic acid insert and obtaining the product of claims 105-108; (c) in vitro packaging the at least a bacteriophage cloning vector of step b); (d) allowing the in vitro excision of the nucleic acid insert(s) of interest by providing to the at least a cloning vector of step c) an at least a destination vector comprising a destination replaceable segment (RS) flanked by two recombination sites, and said two recombination sites do not recombine with each other; (e) recovering a recombinant plasmid carrying the nucleic acid insert of interest or a library of said plasmids. 110. The method of claim 109, wherein said bacteriophage is λ. 111. The method of claims 109-110, wherein said two recombination sites of both the cloning vector of step a) and the destination vector of step d) are derived from recombination sites selected from the group consisting of attB, attP, attL, attR and derivatives thereof. 112. The method of claim 109, wherein said two recombinant sites of both step a) and step d) are lox recombination sites or derivatives thereof, which do not recombine each other. 113. The method of claim 112, wherein said lox recombination site is loxP or derivative thereof. 114. The method of claim 109, wherein said RS of the destination vector of step d) further comprises at least the ccdB gene 115. The method of claim 109, wherein the CS of the vector cloning further comprises a selectable marker. 116. The method of claim 109, further comprising the steps of: (f) providing an at least a second destination vector comprising a destination replaceable segment (RS) flanked by two recombination sites, and said two recombination sites do not recombine with each other, in contact with the plasmid(s) of step (e). 117. The method of claim 109, further comprising a step of 1) electroporating at least a cell making the plasmid obtained in step e) or f) entering said cell; and 2) plating the cell of step 1) and recovering of the plasmid or plasmids carrying the insert 118. A kit comprising at least a cloning vector or at least a library of vectors according to claim 1. 119. A method for preparing at least one normalized and/or subtracted library comprising the steps of: (f) providing at least an excised plasmid or a destination plasmid prepared according to claim 28; (g) providing the plasmid of step b) to a pool of nucleic acid targets; (h) removing the hybrids; (i) collected the normalized and/or subtracted nucleic acid targets. 120. The method of claim 119, wherein the plasmid of step b) is treating by 1) making at least a nick into only one strand of the double stranded plasmid(s); 2) removing the plasmid fragments which have been nicked; 3) collecting the single strand(s) which has not been nicked; 4) applying the steps (c)-(d). 121. The method of claim 120, wherein the nick is introduced by using the GeneII protein. 122. The method of claim 120, wherein the strand which has been nicked is removed by an esonuclease. 123. The method of claim 122, wherein the esonuclease is ExoIII. 124. A method for preparing at least a normalized and/or subtracted library comprising the steps of: (a) providing at least a cloning bacteriophage vector comprising a construction segment (CS) and a replaceable segment (RS), wherein the size of CS is: X−1.2 kb≦CS<X; wherein X corresponding to the minimum size necessary to the vector for undergoing packaging; wherein the CS of the vector comprises a F1 ori (b) replacing RS with a nucleic acid insert of interest according to claims 23-27; (c) adding an helper phage and producing a number of a single strand plasmid vector copies; (d) providing the copies of step c) to a pool of nucleic acids targets; (e) removing the hybrids; (f) collected the normalized and/or subtracted nucleic acid targets. 125. A bacteriophage vector comprising a bacterial artificial chromosome (pBAC) or a segment thereof comprising at least an origin of replication (ori). 126. The bacteriophage of claim 125, wherein the bacteriophage is □.bacteriophage. 127. The bacteriophage of claim 125-126, wherein the pBAC or segment thereof further comprises: a site into which an DNA fragment can be cloned; at least one pair of inducible excision-mediating sites flanking the site into which the DNA fragment can be cloned, the excision-mediating sites defining an excisable fragment that comprises the site into which the DNA fragment can be cloned. 128. The bacteriophage of claim 127, wherein the pair of excision-mediating sites are FRT sites. 129. The bacteriophage of claim 127, wherein the pair of excision-mediating sites comprise a sequence as shown in SEQ ID NO:45. 130. The bacteriophage of claim 125, wherein the ori is an ori capable of maintaining the plasmid at single copy. 131. The bacteriophage of claim 125, wherein the pBAC or segment thereof further comprises an inducible origin of replication. 132. The bacteriophage of claim 131, wherein the inducible origin of replication is oriV. 133. The bacteriophage of claims 125-126, comprising a bacterial artificial chromosome (pBAC) or a segment thereof comprising an inducible origin of replication. 134. The bacteriophage of claim 125, comprising at least two recombination sites selected from the following: (a) two recombination sites, wherein either site does not recombine with the other; (b) two lox recombination sites, wherein either site is capable of recombining with each other; (c) two homing endonuclease asymmetric recognition site sequences; (d) two restriction asymmetric endonuclease cleavage site sequences, wherein either site sequence does ligate with the other, recognizable by class IIS restriction enzymes. 135. The bacteriophage of claim 134, wherein the two recombination sites (a) are selected from the group consisting of attB, attP, attL, attR and derivatives thereof. 136. The bacteriophage of claim 134, wherein the two recombination sites (a) are lox recombination sites derivative, which do not recombine with each other. 137. The bacteriophage of claim 134, wherein the two recombination sites (b) are loxp sites. 138. The bacteriophage of claim 134, wherein the two homing endonuclease site sequences (c) are selected from the group consisting of: I-CeuI, PI-SceI, PI-PspI, and I-SceI. 139. The bacteriophage of claim 125, further comprising at least a background-reducing sequence. 140. The bacteriophage of claims 139, wherein the at least background-reducing sequence is selected from: a) the ccdB gene; b) the lacZ gene; c) a lox sequence. 141. A method for cloning a nucleic acid of interest or for preparing a bulk nucleic acid library of interest comprising the steps of: (a) preparing a bacteriophage cloning vector according to claim 125; (b) inserting a nucleic acid of interest into the bacteriophage cloning vector; (c) allowing the in vivo or in vitro excision of the BAC plasmid comprising the nucleic acid insert of interest; (d) recovering the BAC plasmid carrying the nucleic acid insert of interest or a library of these BAC plasmids. |
<SOH> BACKGROUND ART <EOH>Efficient genomic and cDNA cloning vectors are important tools in molecular genetic research, because high quality, representative libraries are rich sources for the analysis of many genes. Full-length cDNAs are the starting material for the construction of the full-length libraries (for example, the RIKEN mouse cDNA encyclopedia, RIKEN and Fantom Consortium, “Functional annotation of a full-length mouse cDNA collection”, Nature, Feb. 8, 2001, Vol.409:685-690). In contrast to standard cloning techniques, full-length cDNA cloning has the inherent risk of under representation or absence of long clones from the libraries, and cDNAs deriving from very long mRNAs are not cloned if the capacity of the vector is not sufficient. Available plasmid cloning vectors show bias for short cDNAs: shorter fragments are cloned more efficiently than longer ones when competing during ligation and library amplification steps. Although plasmid electroporation does not show relevant size bias, during circularization of plasmid molecules in the ligation step, in a mixed ligation reaction, short cDNAs are ligated more efficiently than longer cDNAs (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press, Molecular Cloning, NY, USA). Cloning vectors derived from bacteriophage have been disclosed as particularly useful for cloning, propagation of DNAs and for library construction. Ligated mixtures of insert and bacteriophage vector DNAs can be efficiently packaged in vitro and introduced into bacteria by infection. Bacteriophage vectors allow cloning of cDNAs sequences, however, the final product for large-scale sequencing should be a plasmid for large-scale colony picking, propagation, DNA preparation and sequencing reactions (Shibata et al., 2000, Genome Res. 10: 1757-1771). Cloning vectors for automatic plasmid excision should have a capacity for wide-range cDNA cloning, that is including cDNAs as short as 0.5 Kb and as long as 15 Kb, which are visible on agarose gel when using trehalose during the first strand cDNA synthesis (Carninci et al., 1998, Proc. Natl. Sci. USA, 95:520-524). There are a number of bacteriophage vectors allowing whole library bulk excision, but they are not optimal in terms of cloning size or bulk excision protocol. Examples of plasmid excision from bacteriophage vector having a cloned insert were obtained with the λ-Zap II (Short et al., 1988, Nucl. Acids Res., 16:7853-7600). However, the bulk excision from λ-Zap II shows size bias towards short inserts when using a mixed sample like a cDNA library, which contains both short and long clones. Using λ-Zap II, long and rare cDNAs are difficult to obtain. Other vectors designed for cDNA cloning and plasmid excision like the λ-Lox derivatives (Palazzolo M. et al., 1990, Gene, 88: 25-36), λ-YES (Elledge et al., 1991, Proc. Natl. Acad. Sci. USA., 88: 1731-5) and λ-Triplex™ (CLONTECHniques, January 1996), accept cDNAs that do not exceed 9˜10 Kb. Alternatively, vectors for genomic libraries construction and Cre-lox mediated plasmid excision accept inserts longer than 7 Kbp, such as λ PS (Nehls et al., 1994a, Biotechniques, 17: 770-775), λpAn (Holt et al., 1993, Gene, 133: 95-97), λGET (Nehls et al., 1994b, Oncogene, 9: 2169-2175), λ-MGU2 (Maruyama and Brenner, 1992, Gene, 120: 135-141) and a vector based on Tn1721 excision system, λRES (Altenbucher, J, 1993, Gene, 123: 63-68). However, these vectors do not allow the preparation of wide range size cDNA libraries. Only among the λSK series there were some vectors with calculated capacity between 0.2 to 15.4 Kb (Zabarovski et al., 1993, Gene, 127: 1-14), which would be suitable for wide-range size cDNA cloning purpose. Unfortunately, the rudimental excision system of λSK is based on simple restriction digestion, which causes internal cleavage of cDNA clones and probably this is the reason why these vectors are not commonly used for cDNA cloning. Japanese patent application having publication number P2000-325080A, discloses a modified λ PS vector. The new vector, indicated with the term λ-FLC-1, comprised a 6 kb nucleic acid sequence (stuffer II) in the left arm of the λ PS vector so that the size of the vector, without considering the cDNA of interest, was 38 kb. This modified λ PS vector was described as being able to insert broad range size of cDNAs. The λ-FLC-1, even if useful for generic (or “standard”) large size cDNA libraries, still shows a bias for short and not full-length cDNAs, so that very long, rare and important full-length cDNAs are difficult to obtain, in particular, in case of strongly normalized and/or subtracted cDNA libraries. A further problem in the art refers to the efficiency of bulk excision recombination mechanism. Bulk cDNAs (cDNA library), that is a library of cDNA comprising a wide range size of cDNAs, short, medium and long ones, are inserted in cloning vectors. These inserts are then transferred in other functional or specialized vectors that have desired characteristics, such as expression vectors. This transfer is called subcloning. The functional or specialized vectors used for subcloning DNA segments are functionally diverse. These include but are not limited to: vectors for expressing genes in various organisms; for regulating gene expression; for providing tags to aid in protein purification or to allow tracking of proteins in cells; for modifying the cloned DNA segment (e.g., generating deletions); for the synthesis of probes (e.g, riboprobes); for the preparation of templates for DNA sequencing; for the identification of protein coding regions; for the fusion of various protein-coding regions; to provide large amounts of the DNA of interest, etc. It is common that a particular investigation will involve subcloning the DNA segment of interest into several different specialized vectors. Traditional subcloning methods, using restriction enzymes and ligase, are time consuming and relatively unreliable. The use of recombinase recognition systems using specific recombinase recognition sequences have been proposed and they are known as Cre-lox (Palazzolo et al., 1990, Gene, 88: 25-36) and Gateway™ (Life Technologies Catalogue; Walhout A. J. M., et al., 2000, Methods in enzymology, Vol.328: 575-592; and U.S. Pat. No. 5,888,732). The Cre-recombinase solid-phase in vivo excision requires infection of the amplified cDNA library into a bacterial strain, which constitutively express the Cre-recombinase, for instance BNN132 (Elledge et al., 1991, Proc. Natl. Acad. Sci. USA., 88: 1731-5). However, this is not recommended because of low plasmid yield (Palazzolo et al., 1990, as above) and plasmid instability (Summers et al., 1984, Cell, 36: 1097-1103): in fact, Cre-recombinase is constitutively expressed causing formation of plasmid dimers/multimers leading to high proportion of plasmid-free cells (Summers et al., 1984, as above), impairing the sequencing efficiency. The Gateway excision is an alternative system to the Cre-lox excision. According to the general Gateway™ system, an insert donor vector carrying a DNA of interest (insert) and a pair of recombinant sites different from each other, recombines with a donor vector comprising a subcloning vector and a pair of recombinant sites different from each other, but able to recombine with the insert donor vector recombination sites. The final product is a subclone product carrying the DNA of interest (insert) and a byproduct. The recombinant sites are attB, attP, attL and attR. However, the Gateway™ system shows a bias for short cDNA; long cDNAs are obtained with low efficiency (Michael A. Brasch, slide “Gateway cloning of attB-PCR products”, GIBCOBRL® Technical Seminar, “Gateway Cloning Technology”, Life Technologies™, 1999). Another further problem in the cloning system consists in the presence of background, which is due to environmental DNA contamination and to subcloning process byproducts, that is a non recombinant plasmids (plasmids without the DNA of interest). It is instead highly desirable having a background-cutting cloning system, able to eliminate completely or having a little background. Some background-cutting strategies have been proposed in the art. Walhout et al. (as above), for example, reports that the Gateway™ vectors, attP1-attP and attR1-attR2, also contain between the att sites the ccdB gene (Bernard P. and Couturier M., 1992, J. Mol. Biol., 226:735-746), whose protein product interferes with DNA gyrase. After recombination, only the plasmids that have lost the ccdB gene (and which are recombinant) can grow in E.coli strains not mutated for gyrA, therefore providing a selective advantage. Plasmids carrying the gene ccdB can propagate only in specific E.coli strain, DB3.1, which carries a mutation in gyrA gene conferring resistance to ccdB (Walhout et al., as above). Therefore, this kind of recombination is limited to plasmids, since other vectors for instance λ substitution vectors used in cloning systems cannot grow and replicate in cells like DB3.1, which miss the recA protein (the recA product is required for the growth of substitution-type bacteriophage λ: Sambrook et al., 1989). In conclusion, there is the need in his field of the art of providing of vectors having the characteristics of: i) being size bias free and allowing the preparation of “size balanced” comprising very long, rare full-length cDNAs; ii) capable of improved recombination mechanism; and iii) able of background cutting. The cloning vectors available in the state of the art, fail to satisfy the above characteristics. The invention disclosed in the present application is addressed to solve the problems in the art. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present inventors provide a new family of vectors capable of cloning nucleic acids of wide range size and preferably very long ones, with high efficiency of excision and reduced background and contamination. Also provided are methods of cloning and for preparing bulk library using such vectors. According to a first embodiment, the invention provides a cloning vector comprising a construction vector segment (CS) and a replaceable segment (RS), wherein the size of CS is: 36.5 kb≦CS<38 kb, preferably CS is 37.5 kb. The construction vector segment preferably is made or comprise a bacteriophage λ vector fragment. The replaceable vector segment (RS) represents the segment, which is replaced by the nucleic acid insert of interest, which one intends to clone. It has been surprisingly found that a cloning vector with this size is capable of preferably inserting cDNA of very long sizes, and it is therefore particularly advantageous for cloning very full-length cDNAs. This vector overcomes the problem in the art of existing vector λ-FLC having a construction vector segment of 38 kb, which showed a strong bias for short size cDNAs (see Table1). The selection of a particular advantageous size of the vector for the preparation of full-length cDNAs libraries can also be applied to bacteriophage other than λ. Accordingly, the present invention also relates to a cloning bacteriophage vector comprising a construction segment (CS) and a replaceable segment (RS), wherein the size of CS is: X−1.2 kb≦CS<Xkb; X (expressed in kb) corresponding to the minimum size necessary to the bacteriophage vector for undergoing packaging. The size of CS is preferably: X−0.2 kb. The present invention also relates to a bacteriophage vector, preferably a λ, comprising a bacterial artificial chromosome (pBAC) or a segment thereof comprising at least an origin of replication (ori). This vector can also comprise: a site into which a DNA fragment can be cloned; and a pair of inducible excision-mediating sites defining an excisable fragment that comprises the site into which the DNA fragment can be cloned. The pair of excision-mediating sites are preferably FRT sites. This vector may further comprise an inducible origin of replication, preferably oriV. The cloning vectors according to the invention are capable of carrying out plasmid or nucleic acid insert excision using known recombination systems, for example the Cre-lox and/or Gateway™ system. The vectors of the invention can also comprise a background-reducing system, as ccdB gene, a lox sequence or the lacZ gene or asymmetric site sequences recognized by restriction endonuclease. The invention also relates to cloning method using the above vectors. According to another embodiment, the invention relates to a system for reducing background or contamination by providing a cloning vector comprising a background-reducing sequence like ccdB gene and/or a lox sequence comprised into RS segment of the vector of the invention, or in case of the Gateway™ system into the RS segment of a destination or receiving vector. RS of phage or plasmid vectors can also be flanked by two asymmetric site sequences recognized by restriction endonuclease. The invention also relates to a method for reducing background or contamination by using these vectors. The invention also relates to methods for efficient excision of plasmid or nucleic acid of interest providing improved Cre-recombinase or Gateway™ system using the vectors according to the invention. Preferably, the present invention relates to method for the preparation of bulk of long or full-length cDNA libraries, by using the vectors according to the invention. The present invention also relates to a kit comprising at least a cloning vector or at least a library of vectors according to the invention. The present invention further relates to a method for preparing at least a normalized and/or subtracted library comprising using a plasmid vector obtained with the excision method according to the invention or destination vector according to the invention, preferably reduced at single strand, as normalization and/or subtraction driver. |
Optical cross-connect system |
An optical cross-connect switch comprises a base (216), a flap (211) and one or more electrically conductive landing pads (222) connected to the flap (211). The flap (211) has a bottom portion that is movably coupled to the base (216) such that the flap (211) is movable with respect to a plane of the base (216) from a first orientation to a second orientation. The one or more landing pads (222) are electrically isolated from the flap (211) and electrically coupled to be equipotential with a landing surface. |
1. An optical cross-connect switch, comprising: a base; a flap having a bottom portion movably coupled to the base such that the flap is movable with respect to a plane of the base from a first orientation to a second orientation; and one or more electrically conductive landing pads connected to the flap, wherein the one or more landing pads are electrically isolated from the flap and electrically coupled to be equipotential with a landing surface. 2. The switch of claim 1, wherein at least one landing pad is substantially parallel to the flap. 3. The switch of claim 1 or 2, wherein the base further includes at least one cantilevered anti-stiction bar. 4. The switch of claim 1, 2 or 3, wherein a magnetic field is used to create a first actuation force to manipulate the flap. 5. The switch of claim 1,2 or 3, wherein an acoustic pulse is used to create a first actuation force to manipulate the flap. 6. The switch of claim 1,2 or 3, wherein a pneumatic pressure is used to create a first actuation force to manipulate the flap. 7. The switch of claim 1, 2, 3, 4, 5 or 6 further including a stop configured to contact a portion of the flap in a contact area sized so that, upon application of an electrostatic bias between the flap and the stop, a sufficient second force holds the flap against the stop. 8. The switch of claim 7 wherein stop is comprised of two vertical walls. 9. The switch of claim 7 or 8 wherein the stop includes a sidewall made of silicon and having crystalline orientation of <111>. 10. The switch of claim 1,2,3,4,5,6, 7, 8 or 9 further including a microcontroller electrically coupled to the flap to enable the flap to be grounded or held at a voltage potential. 11. The switch of claim 10, wherein the microcontroller also controls the first actuation force. 12. The switch of claim 10, further comprising a magnet assembly electrically coupled to the microcontroller and sized less than 0.5″ in width, said magnet assembly positioned to surround the switch and provide magnetic force along both a Z and an X axis, wherein the microcontroller also controls the magnet assembly and wherein the first actuation force is magnetic. 13. The switch of claim 10, 11 or 12 wherein the microcontroller stores the state of the flap and capacitive sensing is used to confirm that the flap is in the correct state. 14. The switch of claim 10, 11, 12 further including a magnetoresistive element coupled to the flap, wherein the microcontroller stores the state of the flap and magnetoresistive sensing is used to confirm that the flap is in the correct state. 15. The switch of claim 14 further including a magnetoresistive element coupled to the base, wherein the microcontroller stores the state of the flap and magnetoresistive sensing is used to confirm that the flap is in the correct state. 16. The switch of claim. 14 or 15 further including a magnetoresistive element coupled to the stop, wherein the microcontroller stores the state of the flap and magnetoresistive sensing is used to confirm that the flap is in the correct state. 17. The switch of claim 7, 8 or 9, further including a charge-storing circuit electrically coupled between the stop and an electrical ground, an isolator element electrically coupled between the clamping surface and a source of clamping voltage, wherein the isolator element is configured to electrically isolate the source of clamping voltage from the clamping surface in the event of a power failure. 18. The switch of claim 17 wherein the isolator element is an opto-isolator or a low leakage diode. 19. The switch of claim 17 or 18, wherein the charge-storing circuit includes a capacitor. 20. The switch of claims 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19, further including an enclosure for sealing the flap and having one or more sidewalls, an optical element coupled to at least one of the sidewalls, wherein at least one of the one or more sidewalls or the optical element includes a surface that is angled with respect to an optical plane. 21. The switch of claim 19, wherein the enclosure is evacuated. 22. The switch of claim 19, wherein the enclosure is filled with a gas. 23. The switch of claim 10, 11, 12, 13, 14, 15 or 16 wherein the microcontroller also monitors voltage levels and engage a signal transmission in the event of a power failure. 24. The switch of claim 17, 18, 19, 20 or 21 further including a microcontroller to monitor voltage levels, whereby the microcontroller may engage a signal transmission in the event of a power failure. 25. The switch of claim 10, 11, 12, 13, 14, 15 or 16, further including a stop configured to contact a portion of the cantilever in a contact area sized so that, upon application of an electrostatic bias between the flap and the stop, a sufficient second force holds the flap against the stop; and a charge-storing circuit electrically coupled between the stop and an electrical ground, an isolator element electrically coupled between the clamping surface and a source of clamping voltage, wherein the isolator element is configured to electrically isolate the source of clamping voltage from the clamping surface in the event of a power failure. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Microelectromechanical systems (MEMS) are miniature mechanical devices manufactured using the techniques developed by the semiconductor industry for integrated circuit fabrication. Such techniques generally involve depositing layers of material that form the device, selectively etching features in the layer to shape the device and removing certain layers (known as sacrificial layers, to release the device. Such techniques have been used, for example, to fabricate miniature electric motors as described in U.S. Pat. No. 5,043,043. Recently, MEMS devices have been developed for optical switching. Such systems typically include an array of mechanically actuatable mirrors that deflect light from on optical fiber to another. The mirrors are configured to translate and move into the path of the light from the fiber. Mirrors that move into the light path generally use torsion flexures to translate mirror position vertically while and changing its angular from a horizontal to a vertical orientation. MEMS mirrors of this type are usually actuated by magnetic interaction, electrostatic interaction, thermal, pneumatic actuation or some combination of these. The design, fabrication, and operation of magnetically actuated micromirrors with electrostatic clamping in dual positions for fiber-optic switching applications are described, e.g., by B. Behin, K. Lau, R. Muller in “Magnetically Actuated Micromirrors for Fiber-Optic Switching,” Solid-State and Actuator Workshop, Hilton Head Island, S.C., Jun. 8-11, 1998 (p. 273-276). When the mirror is in the horizontal position, it rests against a substrate that forms a base. Often, the mirror is subject to electromechanical forces, sometimes referred to as “stiction” that cause the mirror to stick to the substrate and prevent the mirror from moving. The same stiction forces can also prevent the mirror from being properly released from the substrate during manufacture. To overcome stiction problems, landing pads (also called dimples or bumps have been used in MEMS devices to minimize or otherwise control the contact area between the device and the underlying substrate. In the prior art, such landing pads are formed prior to deposition of a device layer either by etching pits in an underlying sacrificial layer or by depositing pads of another material prior to the deposition of the layer forming the device. The problem of stiction with respect to an example of a MEMs mirror device 100 is shown in FIG. 1 . The device 100 includes a mirror 111 formed from the device layer 112 of a substrate 110 . The mirror 111 may be movably attached to the device layer by a flexure 114 , actuated by an off-chip electromagnet, and individually addressed by electrostatic clamping either to a surface of the substrate 110 or to a vertical sidewall 114 of a top mounted chip 106 . A first actuation force may move the mirror 111 between a rest position parallel to the substrate 110 and a position nearly parallel to the vertical sidewall 104 of the top-mounted chip 106 , while the application of a second force (i.e electrostatic field) may clamp the mirror 111 in the horizontal or vertical position. The electrostatic field used to hold the mirror 111 in a position regardless of whether the first actuation force is on or off can increase the level of stiction between the mirror 111 and each landing surface. When clamped to either the substrate 110 or the vertical side-wall surface 104 , the mirror 111 may rest on a set of landing pads or dimples 122 , 124 , which may lie level with or protrude below or above the mirror surface, respectively. These landing pads 122 , 124 may minimize the physical area of contact between the mirror 111 and the clamping surface, thus reducing stiction effects. However, since the mirror 111 and clamping surface (either the side wall 104 or the substrate 110 ) may be at different potentials, the landing pads 122 , 124 may be made of an insulating material in order to prevent an electrical short between the mirror 111 and the clamping surface. While the insulating landing pad material does, indeed, prevent an electrical short, its inherent properties can lead to other problems. Firstly, most insulating materials have the capacity to trap electrical charge and can, in some cases, maintain that charge for long periods of time—sometimes indefinitely. As a result, the potential of the landing pads 122 , 124 can drift to an arbitrary value, resulting in either parasitic clamping potential between the mirror 111 and the clamping surface, even when both are externally driven to the same voltage, or a reduced clamping force by shielding the mirror potential. Second, since the insulating landing pads 122 , 124 will typically be at a potential close to the mirror potential when not in contact with the clamping surface, a rapid discharge can occur when the landing pads 122 , 124 first come into the contact with the clamping surface that is a kept at a potential different than the mirror 111 . This rapid discharge may be exhibited as arcing or short pulses of high current. Such surges can lead to physical damage to the landing pads 122 , 124 or the clamping surface, or may produce micro-welding, where the landing pad is welded to the clamping surface—resulting in the mirror 111 being stuck. There is a need, therefore, for a MEMS device having stiction resistant landing pads and a method of operating a MEMS device configured in a stiction reduced mode. Modern communications systems require a level of robustness that protects the state of the optical switches from being lost in the event of a power failure. MEMS optical switches typically include an array of mechanically actuatable mirrors that deflect light from one optical fiber to another. A mirror may be retained in a specific ON or OFF state by use of an electrostatic clamping voltage. In the event of a power failure, the clamping voltage may be lost and any MEMS mirrors that were clamped in a specific state may revert to the opposing state when under the influence mechanical restoring forces. In this manner, the state of the switch may be lost in the event of a power failure. Thus, there is a need in the art, for a method of maintaining the state of a MEMS device in the event of a power failure and an apparatus for implementing such a method. The increasing complexity of optical switching systems has lead to development of switching fabrics that are larger than say 8×8. When scaling to such larger optical switch fabrics (e.g., 16×16, 32×32), the yield of the optical MEMS die will decrease with the increasing die size. This places a feasible upper bound on such scaling. One proposed solution to this problem is to develop a new technology with a finer pitch and, therefore, a smaller die. Unfortunately this is a lengthy development process. Another alternative solution is to use redundant mirrors on the device die. Unfortunately, this complicates the overall design of the optical switch. It is known to tile two or more smaller dies together to form a larger device. For example, Minowa et al. uses four 4×4 arrays tiled together in a mosaic fashion to form an 8×8 array. However, for 16×16 arrays and larger, the size of the array still presents problems even if smaller devices are tiled together. For example, as the array size increases the distance between input and output fibers increases. The increased optical path between the fibers can lead to undesirable beam spreading. The beam spreading may be overcome by placing collimator lenses between the arrays. However, the alignment of the collimator lenses to the switching elements is difficult and even slight misalignment will result in optical loss that degrades switch performance. Another problem with tiling two or more dies is that the dies must be very accurately aligned with each other in order to ensure that the mirrors on one die will align with those on the other dies in the mosaic. Prior art alignment techniques include self-alignment and active-alignment. In self-alignment, metallized bonding pads are placed on two different pieces, e.g. a MEMS device die containing rotating mirrors and a corresponding top chip. Solder is applied to the bonding pads and the two pieces are brought together such that corresponding bonding pads roughly align with each other. When solder is heated through reflow, surface tension forces between the solder and the bonding pads pull the two pieces into alignment. In active-alignment, the pieces are placed, within micron tolerances, using a pick and place tool and held in place until the solder freezes. Active-alignment allows for the use of epoxies as well as solders for attachment of the top chip to the device die. However, even using these techniques, alignment can be particularly problematic with a tiled device having four 8×8 MEMS mirror arrays totaling 256 MEMS mirrors. Thus, there is a need in the art, for a self aligned or actively aligned optical MEMS device and a method for making it. |
<SOH> SUMMARY OF THE INVENTION <EOH>The disadvantages associated with the prior art are overcome by an inventive optical cross-connect switch and methods. The optical cross-connect switch comprises a base, a flap and one or more electrically conductive landing pads connected to the flap. The flap has a bottom portion that is movably coupled to the base such that the flap is movable with respect to a plane of the base from a first orientation to a second orientation. The one or more landing pads are electrically isolated from the flap and electrically coupled to be equipotential with a landing surface. |
Data processing apparatus and system and method for controlling memory access |
A data processor comprises a memory having storage elements arranged in columns and a number of column decoders, each having a memory access port. The data processor has a plurality of processing elements, and each of the memory ports is coupleable to at least a respective one of the processor elements, such that each processor element is capable of accessing at least one column of storage elements. |
1. A data processor apparatus comprising a plurality of processing elements, a memory having a plurality of storage elements arranged in a plurality of columns, a plurality of column decoders, a plurality of memory ports coupled to said decoders for at least one outputting data from said memory and receiving data for said memory, each of said plurality of memory ports being couplable to at least a respective one of said plurality of processor elements such that each processor element is capable of accessing at least one column of storage elements, a device for accessing said memory, switch means for switchably coupling each one of said plurality of memory ports to a respective processing element and for switchably coupling each one of said plurality of memory ports to said device, and a memory access controller arranged to control said switch means to selectively couple said plurality of memory ports to one of (i) said device and (ii) said plurality of processor elements. 2. A data processor apparatus as claimed in claim 1, further comprising a data bus for coupling said memory ports to said device and further comprising a bus decoder for coupling selected memory ports to said data bus. 3. A data processor apparatus as claimed in claim 2, wherein said data bus comprises a plurality of bus lines, and said bus decoder is arranged to selectively couple selected memory ports to selected bus lines. 4. A data processor apparatus as claimed in claim 3, wherein the number of memory ports is greater than the number of bus lines. 5. A data processor apparatus as claimed in claim 2, wherein said data bus comprises a plurality of bus lines, and said bus decoder is arranged to selectively couple selected bus lines to said plurality of memory ports. 6. A data processor apparatus as claimed in claim 5, wherein the number of bus lines is greater than the number of memory ports. 7. A data processor apparatus as claimed in claim 1, further comprising a data bus for coupling said memory ports to said device, said data bus having a plurality of bus lines wherein the number of bus lines is different to the number of memory ports, and decoding means between said memory ports and said data bus for one of coupling selected ones of said memory ports to said bus lines, if the number of memory ports exceeds the number of bus lines, and coupling selected ones of said bus lines to said memory ports, if the number of bus lines exceeds the number of memory ports. 8. A data processor apparatus as claimed in claim 1, wherein said processing elements are arranged to perform operations when said plurality of memory ports are coupled to said device. 9. A data processor apparatus as claimed in claim 8, wherein said processing elements are arranged to process data previously read from said memory when said plurality of memory ports are coupled to said device. 10. A data processor apparatus as claimed in claim 1, further comprising at least one storage element for storing data received from a memory port before being processed by a respective processor element. 11. A data processor apparatus as claimed in claim 10, comprising at least one respective storage element coupled to each of said plurality of memory ports for storing data received from said memory ports before being processed by said plurality of processor elements. 12. A data processor apparatus as claimed in claim 11, comprising two or more storage elements for storing data from each of said plurality of memory ports before being processed by said processor elements. 13. A data processor apparatus as claimed in claim 1 wherein said device comprises a processor, a direct memory access (DMA) device or an input/output (I/O) device. 14. A data processor apparatus as claimed in claim 2, further comprising another device coupled to said data bus. 15. A data processor apparatus as claimed in claim 1, wherein said memory ports each comprise an I/O port. 16. A data processor apparatus as claimed in claim 1, wherein said memory comprises a random access memory (RAM) and each of said memory ports comprises an input/output (I/O) port of said RAM. 17. A data processor apparatus as claimed in claim 1, wherein each of said memory ports comprises a one-bit memory port and further comprising a single bit line of a parallel data bus between each memory port and a respective processor element for one of read access and write access. 18. A data processor apparatus as claimed in claim 2, further comprising an array controller coupled to said data bus for controlling parallel operations of said processing elements. 19. A data processor apparatus as claimed in claim 1, further comprising a data bus for coupling said memory ports to said device and an array controller coupled to said data bus for controlling parallel operations of said processor elements. 20. A device comprising a memory having a plurality of memory ports for at least one of outputting data from said memory and receiving data for said memory, a data bus having a plurality of bus lines, wherein the number of bus lines is different to the number of memory ports, and decoding means between said memory ports and said data bus for one of coupling selected ones of said memory ports to said bus lines, if the number of memory ports exceeds the number of bus lines, and coupling selected ones of said bus lines to said memory ports, if the number of bus lines exceeds the number of memory ports. 21. A device as claimed in claim 20, further comprising a processor coupleable to said plurality of memory ports, independently of said data bus. 22. A device as claimed in claim 21, wherein said processor comprises a plurality of processing elements, each coupleable to a respective memory port. 23. A device as claimed in claim 21, further comprising memory access control means for selectively coupling one of said data bus and said processor to said memory ports. |
<SOH> BACKGROUND OF THE INVENTION <EOH>In a typical computer system having multiple computer processor units (CPUs) which require access to a common memory, the CPUs and memory are connected to a data communication bus for shared memory access. An example of a multi-CPU system is shown in FIG. 1 . The system 1 includes a number of microprocessors 3 , 5 and other devices such as a Direct Memory Access (DMA) device 7 and an input/output (I/O) device 9 connected to a data communication bus 11 , which is also connected to a number of shared memory blocks 13 , 15 by respective memory interface units (MIU) 17 , 19 . One problem with this implementation is that only one memory can be accessed by only one microprocessor or other device at any one time through the data communication bus, which often leads to a bottle neck or congestion in data transfer. For example, if microprocessors 3 , 5 both require access to a memory at the same time, and one of the microprocessors has priority over the other, the microprocessor having lower priority has to wait until memory access by the higher priority microprocessor is complete. This problem becomes greater as the number of devices connected to the data communication bus increases, so that, for example, access waiting times for other devices such as the DMA and input/output devices become significantly large. Another form of data processor is the single-instruction-multiple-data (SIMD) processor, which has multiple processor units each having its own associated memory space. The processor units are simple processors, unable to fetch or interpret instructions, and are controlled by a single control unit, so that the processor units act as slaves to the control unit, performing at its request, arithmatic-logic operations. A typical SIMD architecture is depicted in FIG. 2 . The data processor 21 has a number of processing units 23 , 25 each coupled to an associated memory 27 , 29 . The data processor has a control unit (not shown) for controlling the processing units in parallel via a data communication bus 33 and other devices such as a DMA 35 and an input/output device 37 , which are also connected to the data communication bus. One advantage of this system is that more memory and processor units can be easily added to the computer. However, a disadvantage of this system is that when a processor unit requires access to the memory space of another processor unit, the transfer of data is managed by the control unit, which therefore consumes control unit processing time or cycles, and during the time data is being moved around, the processor units remain idle. Another example of a SIMD processor is described in U.S. Pat. No. 5,956,274 issued on 21 Sep., 1999 to Duncan G. Elliot, et al, and is shown schematically in FIG. 3 . In this architecture, the processing units 33 are placed within the memory, there being one processor unit per column of storage elements, each processor unit being directly coupled to the sense amplifier of each column, and whose output is coupled to the memory column decoder. While this architecture provides a large number of processor units, each tightly coupled to its own memory space, when the microprocessor requires access to memory, the processor elements must remain idle. A further disadvantage of this architecture is that the memory must be designed specifically to incorporate the processing elements. |
<SOH> SUMMARY OF THE INVENTION <EOH>According to one aspect of the present invention, there is provided a data processor apparatus comprising a memory having a plurality of storage elements arranged in a plurality of columns, a plurality of column decoders, a plurality of memory ports coupled to the decoders for at least one of outputting data from the memory and receiving data for the memory, and a plurality of processing elements, wherein each of the plurality of memory ports is coupleable to at least a respective one of the plurality of processor elements, such that each processor element is capable of accessing at least one column of storage elements. In this arrangement, the processor elements are coupleable to the external interface ports of the memory, rather than being embedded in the memory between the sense amplifiers and column decoder. Advantageously, this architecture enables a parallel data processor to be realized having a plurality of processing elements each having access to its own portion of memory, but without the requirement for knowledge of the internal memory structure, thereby considerably simplifying design, reducing design time, and offering designers the flexibility of using any suitable memory for the intended application. In one embodiment, the data processor apparatus includes switch means between at least one, and preferably each of the memory ports, and at least one, and preferably each of the processor elements, for selectively coupling and decoupling the memory port(s) to and from the processor element(s). Advantageously, this arrangement enables the processor elements to be decoupled from the memory, so that the memory can be accessed by another device. At the same time, this allows the processor elements to continue to perform operations, for example processing data which was previously read from the memory. In one embodiment, at least one storage element is provided for at least one and preferably each processor element for storing data read from the memory before being processed by the processing elements. In one embodiment, the storage elements can be decoupled from the memory, again to enable the memory to be accessed by another device while allowing the processor elements to process data stored in the storage element(s). According to another aspect of the present invention, there is provided a data processor apparatus comprising a memory having a plurality of memory ports for at least one of outputting data from the memory and receiving data for the memory, a processor coupleable to the memory ports, and a data bus coupleable to the memory ports, and a memory access controller for selectively coupling and decoupling the data bus to and from the memory ports. Advantageously, this arrangement allows the data bus to be decoupled from the memory, so that the data bus can be used to transfer data, for example between different devices connected to the data bus, while the memory is being accessed by the processor. According to another aspect of the present invention, there is provided a memory device comprising a memory having a plurality of memory ports for at least one of outputting data from the memory and receiving data for the memory, first and second data buses, each being coupleable to the memory ports, and memory access control means for selectively coupling one of the first and second data buses to the memory ports. Advantageously, this arrangement enables each of the data buses to be decoupled from the memory so that the decoupled data bus can continue to be used by other devices, while the other data bus is coupled to the memory. According to another aspect of the present invention, there is provided a memory device comprising a memory having a plurality of memory ports for at least one of outputting data from the memory and receiving data for the memory, a data bus having a plurality of bus lines, wherein the number of bus lines is different to the number of memory ports, and decoding means between the memory ports and the data bus for one of coupling selected ones of the memory ports to the bus lines, if the number of memory ports exceeds the number of bus lines, and coupling selected ones of the bus lines to the memory ports, if the number of bus lines exceeds the number of memory ports. Advantageously, this arrangement provides a decoder coupled between the memory ports and a data bus having a different number of serial bit lines to the number of memory ports, and controls the selection of which memory ports are coupled to which serial bus lines to enable any size of data bus full access to any size of memory, and vice versa. |
Stabilized biocompatible supported lipid membrane |
A lipid membrane is self-assembled and stabilized at a solid surface by depositing a lipid monolayer or a lipid multilayer on a substrate, otaining a supported lipid monolayer or a supported lipid multilayer; and in situ polymerizing the supported lipid monolayer or the supported lipid multilayer, thereby obtaining a polymerized membrane. |
1. A method for the self-assembly and stabilization of a lipid membrane at a solid surface, comprising: depositing a lipid monolayer or a lipid multilayer on a substrate, thereby obtaining a supported lipid monolayer or a supported lipid multilayer; in situ polymerizing said supported lipid monolayer or said supported lipid multilayer, thereby obtaining a polymerized membrane. 2. The method according to claim 1, wherein said polymerized membrane is at least partly cross-linked. 3. The method according to claim 1, wherein said supported lipid monolayer or said supported lipid multilayer are formed by fusion of fluid, small unilamellar vesicles comprising a polymerizable lipid. 4. The method according to claim 3, wherein said polymerizable lipid contains at least one of the polymerizable group selected from the group consisting of a styryl group, a dienyl group, a dienoyl group, a sorbyl group, an acryloyl group, a methacryloyl group, a vinyl ester group and a mixture thereof. 5. The method according to claim 3, wherein said polymerizable lipid has a lipid tail having 14 to 22 carbon atoms. 6. The method according to claim 3, wherein said lipid tail is an unsaturated or saturated linear tail or an unsaturated or saturated branched tail. 7. The method according to claim 3, wherein a head group of said polymerizable lipid is selected from the group consisting of phosphatidylcholine, phosphatidic acid, phosphatidylethanolamine and phosphatidylserine. 8. The method according to claim 3, wherein said polymerizable lipid is terminated with a succinate group, a metal chelating group, a thioethanol group, a maleimido group, a pyridyldithio group, a biotinyl group, a succinimidyl ester group, a sulfo succinimidyl ester group, a alkyl halide group, a haloacetamide group, an ethylene glycol-based oligomer group or an ethylene glycol-based polymer group. 9. The method according to claim 1, wherein said solid surface is a silicon dioxide surface, a silicon oxide surface, a noble metal surface, a mica surface, a polymer surface, an indium-tin oxide surface, a tin oxide surface, an indium oxide surface, a steel surface or a silicon surface. 10. The method according to claim 1, wherein said in situ polymerizing is initiated by a redox initiator system. 11. The method according to claim 10, wherein said redox initiator system is K2S2O8/NaHSO3. 12. The method according to claim 1, wherein said in situ polymerizing occurs by irradiation with UV-rays, visible rays, near infrared rays or γ-rays. 13. The method according to claim 12, wherein said UV-rays have a wavelength of between 230 and 350 nm. 14. The method according to claim 12, wherein said VIS-rays have a wavelength of between 350 and 700 nm. 15. The method according to claim 12, wherein said near infrared rays have a wavelength of between 700 and 1000 nm. 16. The method according to claim 12, wherein said UV-rays, visible rays or near infrared rays are polarized or unpolarized. 17. The method according to claim 3, wherein said polymerizable lipid is mixed with a non-polymerizable amphiphile. 18. The method according to claim 17, wherein said non-polymerizable amphiphile is a lipid or a surfactant. 19. The method according to claim 3, wherein a mixture of at least two polymerizable lipids is used. 20. The method according to claim 1, wherein a membrane protein is incorporated into said polymerized membrane. 21. The method according to claim 1, wherein water soluble protein is bonded to or adsorbed to said polymerized membrane. 22. The method according to claim 1, wherein a structure of said polymerized membrane is preserved upon transfer into air and exposure to a surfactant solution or an organic solvent. 23. A polymerized membrane obtained by the method according to claim 1. 24. The polymerized membrane according to claim 23, wherein said polymerized membrane is at least partly cross-linked. 25. The polymerized membrane according to claim 23, wherein said membrane is obtained using a mixture of a polymerizable lipid and a non-polymerizable amphiphile. 26. The polymerized membrane according to claim 25, wherein said non-polymerizable amphiphile is a lipid or a surfactant. 27. The polymerized membrane according to claim 23, wherein said membrane is obtained using a mixture of at least two polymerizable lipids. 28. The polymerized membrane according to claim 23, wherein a membrane protein is incorporated into said polymerized membrane. 29. The polymerized membrane according to claim 23, wherein a water soluble protein is bonded to or adsorbed to said polymerized membrane. 30. The polymerized membrane according to claim 23, wherein a structure of said polymerized membrane is preserved upon transfer into air and exposure to a surfactant solution or an organic solvent. 31. A spatially addressable, planar array of molecules deposited on the membrane according to claim 23. 32. The array according to claim 31, wherein said membrane has a linearly polymerized portion and a cross-lined portion. 33. A surface coated with the membrane according to claim 23. 34. The surface according to claim 33, wherein said membrane comprises a protein. 35. The surface according to claim 33 which is a silicon dioxide surface, a silicon oxide surface, a noble metal surface, a mica surface, a polymer surface, an indium-tin oxide surface, a tin oxide surface, an indium oxide surface, a steel surface or a silicon surface. 36. The surface according to claim 33, wherein said polymerized membrane is at least partly cross-linked. 37. The surface according to claim 33, wherein said membrane is obtained using a mixture of a polymerizable lipid and a non-polymerizable amphiphile. 38. The surface according to claim 37, wherein said non-polymerizable amphiphile is a lipid or a surfactant. 39. The surface according to claim 33, wherein said membrane is obtained using a mixture of at least two polymerizable lipids. 40. The surface according to claim 33, wherein a membrane protein is incorporated into said polymerized membrane. 41. The surface according to claim 33, wherein a water soluble protein is bonded to or adsorbed to said polymerized membrane. 42. The surface according to claim 33, wherein a structure of said polymerized membrane is preserved upon transfer into air and exposure to a surfactant solution or an organic solvent. 44. The surface according to claim 33, which is included in a medical implant material, an analytical fluid handling instrument, a biomedical device or a personal care product. 45. A medical implant material, an analytical fluid handling instrument, a biomedical device or a personal care product, comprising: the membrane according to claim 23; and a solid surface. 46. The medical implant material, the analytical fluid handling instrument, the biomedical device or the personal care product according to claim 44, wherein said solid surface is selected from the group consisting of a silicon dioxide surface, a silicon oxide surface, a noble metal surface, a mica surface, a polymer surface, an indium-tin oxide surface, a tin oxide surface, an indium oxide surface, a steel surface, a silicon surface and a combination thereof. 47. The medical implant material, the analytical fluid handling instrument, the biomedical device or the personal care product according to claim 45, which contacts a biological sample or an organism. 48. The medical implant material, the analytical fluid handling instrument, the biomedical device or the personal care product according to claim 45, wherein said personal care product is a razor blade. |
<SOH> BACKGROUND OF THE INVENTION <EOH>1. Field of the Invention The present invention relates to a self-assembled lipid membrane, in the form of a monolayer, bilayer, or multilayer, that is stabilized on a solid support. 2. Discussion of the Background The development of durable, biomembrane-mimetic coatings for inorganic and polymeric surfaces that are resistant to nonspecific protein adsorption (protein resistant) is impacting numerous fields (Sackman, E., Science, 1996, 271, 43; Plant, A. L., Langmuir, 1999, 15, 5128; Marra, K. G.; Winger, T. M.; Hanson, S. R.; Chaikof, E. L., Macromolecules, 1997; 30, 6483; Wisniewski, N.; Reichert, M., Coll. Surf. B: Biointerfaces, 2000, 18, 197-219). One example is the design of a biosensor surface at which a ligand binding event must be detected in the presence of numerous other non-target proteins (Wisniewski, N.; Reichert, M., Coll. Surf. B: Biointerfaces 2000, 18, 197-219; Stelzle, M.; Weissmuller, G.; Sackman, E., J. Phys. Chem., 1993, 97, 2974; Duschl, C.; Liley, M.; Corradin, G.; Vogel, H., Biophys. J., 1994, 67, 1229; Song, X. D.; Swanson, B. I., Anal. Chem., 1999, 71, 2097; Parikh, A. N.; Beers, J. D.; Shreve, A. P.; Swanson, B. I., Langmuir, 1999, 15, 5369; Fischer, B.; Heyn, S. P.; Egger, M.; Gaub, H. E., Langmuir, 1993, 9, 136). In most optical and electrochemical sensors, the transducer is an oxide or noble metal surface to which dissolved proteins can irreversibly adsorb, “fouling” the sample/transducer interface. Planar lipid monolayer, bilayer, and multilayer structures have been used to coat such surfaces (Sackman, E., Science, 1996, 271, 43; Plant, A. L., Langmuir, 1999, 15, 5128; Song, X. D.; Swanson, B. I., Anal. Chem., 1999, 71, 2097; Parikh, A. N.; Beers, J. D.; Shreve, A. P.; Swanson, B. I., Langmuir, 1999, 15, 5369; Fischer, B.; Heyn, S. P.; Egger, M.; Gaub, H. E., Langmuir, 1993, 9, 136; Thompson, N. L.; Palmer, A. G., Comments Mol. Cell. Biophys., 1988, 5, 39; Watts, T. H.; Gaub, H. E.; McConnell, H. M., Nature, 1986, 320, 179; McConnell, H. M.; Watts, T. H.; Weis, R. M.; Brian, A. A., Biochim. Biophys. Acta., 1986, 864, 95; Meuse, C. W.; Krueger, S.; Majkrzak, C. F.; Dura, J. A.; Fu, J.; Connor, J. T.; Plant, A. L., Biophys. J., 1998, 74, 1388; Kalb, E.; Frey, S.; Tanun, L. K., Biochim. Biophys. Acta., 1992, 1103, 307; Edmiston, P. L.; Saavedra, S. S., Biophys. J., 1998, 74, 999; Majewski, J.; Wong, J. Y.; Park, C. K.; Seitz, M.; Israelachvili, J. N.; Smith, G. S., Biophys. J., 1998, 75, 2363; Hillebrandt, H.; Wiegrand, G.; Tanaka, M.; Sackmann, E., Langmuir, 1999, 15, 8451). Such lipid monolayers, bilayers, or multilayers offer the ability to minimize sensor “fouling”, i.e., the undesirable adsorption of non-target proteins and biomolecules invariably present in complex biological matrices, by exploiting the characteristic protein adsorption resistance associated with the phosphorylcholine (PC) lipid headgroup (Hayward, J.; Chapman, D., Biomaterials, 1984, 5, 135; Chapman, D., Langmuir, 1993, 9, 39; Malmsten, M. J., Colloid Interface Sci., 1995, 171, 106; Murphy, I. F.; Lu, J. R.; Lewis, L. L.; Brewer, J.; Russell, J.; Stratford, P., Macromolecules, 2000, 33, 4545). Additionally, their well-defined and controllable architecture may allow for favorable orientation and minimal denaturation of immobilized antigens or biomolecules such as fab antibody fragments, to maximize sensitivity of the device (Song, X. D.; Swanson, B. I., Anal. Chem., 1999, 71, 2097; Parikh, A. N.; Beers, J. D.; Shreve, A. P.; Swanson, B. I., Langmuir, 1999, 15, 5369; Fischer, B.; Heyn, S. P.; Egger, M.; Gaub, H. E., Langmuir, 1993, 9, 136; Viitala, T.; Vikholm, I.; Peltonen, J., Langmuir, 2000, 16, 4953-4961; Duschle, C.; Se(slash)vin-Landais, A. F.; Vogel, H., Biophys., 1996, 70, 1985-1995). Supported lipid membrane structures also provide the necessary environment for transmembrane receptor incorporation, which has been demonstrated by several authors through the fabrication of proteo-lipid structures with retained protein activity (Salafsky, J.; Groves, J. T.; Boxer, S. G., Biochem., 1996, 35, 14773-14781; Schmidt, E. X.; Liebermann, T.; Kreiter, M.; Jonczyk, A.; Naumann, R.; Offenhäusser, A.; Neumann, E.; Kukol, A.; Maelicke, A.; Knoll, W., Biosensors Bioelectronics, 1998, 13, 585-591; Naumann, R; Jonczyk, A.; Hampel, C.; Ringsdorf, H.; Knoll, W.; Bunjes, N., Gräber, P. Bioelectrochemistry and Bioenergetics, 1997, 42, 241-247; Fisher, M. L; Tjärnhage, T., Biosensors and Bioelectronics, 2000, 15, 463-471; Pun, G.; Gustafson, L; Artursson, E.; Ohlsson, P. A., Biosensors and Bioelectronics 1995, 10, 463-476; Puu, G.; Aartursson, E.; Gustafson, L; Lundsröm, M.; Jass, J., Biosensors and Bioelectronics, 2000, 15, 31-41; Graff, A.; Winterhalter, M.; Meier, W., Langmuir, 2001, 17, 919-923; Liley, M.; Bouvier, J.; Vogel, H. J., Coll. Inter. Sci., 1997, 194, 53-58; Naumann, R.; Schmidt, E. X.; Jonczyk, A.; Fendler, K.; Kadenback, B.; Liebermann, T.; Offenhäusser, A.; Knoll, W., Biosensors and Bioelectronics, 1999, 14, 651-662). Supported lipid monolayers, bilayers and multilayers can be self-assembled by fusion of fluid, unilamellar vesicles, an important issue for commercial application, onto a variety of optically or electrically active substrates. Furthermore, the recent development of micro-patterning techniques to modify planar, substrate supported thin films, including supported lipid bilayers, adds promise to the potential of biochips with parallel arrays of sensing elements for high throughput biological or pharmaceutical screening or sensing (Hovis, J. S.; Boxer, S. B., Langmuir, 2000, 16(3), 894-897; Hovis, J. S.; Boxer, S. B., Langmuir, 2001, 17(11), 3400-3405; Kam, L.; Boxer, S. G., J. Am. Chem. Soc., 2000, 122, 12901-12902; Toby, A.; Jenkins, A.; Boden, N.; Bushby, R. J.; Evans, S. D.; Knowles, P. F.; Miles, R. E.; Ogier, S. D.; Schönherr, H.; Vancso, J. G., J. Am. Chem. Soc., 1999, 121, 5271-5280; Groves, J. T.; Mahal, L. K.; Bertozzi, C. R., Langmuir, 2001; Srinivasan, M. P.; Ratto, T. V.; Stroeve, P.; Longo, M. L., Langmuir, 2001, 17, 7951-7954; Morigaki, K.; Baumgart, T.; Offenhäusser, A.; Knoll, W., Angew. Chem., Int. Ed., 2001, 40, 172). The key problem associated with implementing lipid structures in commercial molecular devise applications is the inherent lack of stability that arises from the exclusively non-covalent forces that are responsible for lipid lamellar assembly. As a result, partial or complete lamellar-structure loss is realized upon exposure to surfactants, organics, or removal of the film from aqueous environments. Finite aqueous lifetimes have also been observed, and lipid layer damage can occur upon fluid exchange, in the presence of soluble lipophilic proteins, or upon pH or temperature changes (Hui, S. W.; Viswanathan, R.; Zasadzinski, J. A.; Israelachvili, J. N., Biophys. J., 1995, 68, 171-178; Winger, T. M.; Ludovice, P. J.; Chaikof, E. L., Langmuir, 1999, 15, 3866-3874). These shortcomings prevent washing and reusing of a biosensor and seriously compromise the storage/shelf-life, reliability, and thus applicability of the device. Covalently bound self-assembled monolayers (SAMS) featuring oligo(ethylene glycol) (Yang, Z.; Galloway, J. A.; Yu, H., Langmuir, 1999, 15); or other protein adsorption resistant headgroups (Chapman, R. G.; Ostuni, E.; Takayama, S.; Holmlin, R. E.; Yan, L.; Whitesides, G. M., J. Am. Chem. Soc., 2000, 122, 8303-8304) address the stability issue of biosensor coatings but are not without shortcomings, including an increased difficulty in functionalizing these films with water-soluble proteins in a well-defined manner, and not providing a suitable environment for transmembrane receptor proteins. Therefore, interest in stabilizing lipid films on solid supports continues to receive scientific attention. An alternate method for incorporating phosphorylcholine groups into a substrate supported polymer film is copolymer synthesis followed by direct grafting to the substrate surface (Murphy, E. F.; Lu, J. R.; Lewis, A. L.; Brewer, J.; Russell, J.; Stratford, P., Macromolecules, 2000, 33, 4545). However, the molecular architecture of this assembly is more difficult to control than that of a lipid-based film, and is not amenable to functionalization with transmembrane proteins (Murphy, E. F.; Lu, J. R.; Lewis, A. L.; Brewer, J.; Russell. J.; Stratford, P., Macromolecules, 2000, 33, 4545; Sackman, E., Science, 1996, 271, 43; Watts, T. H.; Gaub, H. E.; McConnell, H. M., Nature, 1986, 320, 179; McConnell, H. M.; Watts, T. H.; Weis, R. M.; Brian, A. A., Biochim. Biophys. Acta, 1986, 864, 95; Salafsky, J.; Groves, J. T.; Boxer, S. G., Biochemistry, 1996, 35, 14773; Brian, A. A.; McConnell, H. M., Proc. Natl. Acad. Sci., 1984, 81, 6159). Although the results achieved using supported lipid membranes as sensor coatings have been encouraging with respect to protein resistance, these structures lack the chemical and thermal stability required for technological implementation (e.g. as a non-fouling coating for a reusable biosensor). This is because the low molecular mass lipids in the bilayer are self-organized by relatively weak, noncovalent forces that are insufficient to maintain the bilayer structure when the membrane is, for example, removed from water. Strategies employed to stabilize planar lipid structures under water include: i) incorporation of template molecules, covalently attached either directly to the substrate or to a thin hydrophilic polymer, around which free lipids self-organize to form a bilayer (Duschl, C.; Liley, M.; Corradin, G.; Vogel, H., Biophys. J., 1994, 67, 1229; Yang, Z.; Yu, H., Langmuir, 1999, 15, 1731; Bunjes, N.; Schmidt, E. K.; Jonczyk, A.; Rippmann, F.; Beyer, D.; Ringsdorf, H.; Graber, P.; Knoll, W.; Naumann, R., Langmuir, 1997, 13, 6188) and ii) derivatization of a metal or silica surface with an alkyl self-assembled monolayer, followed by deposition of a lipid monolayer, creating a hybrid bilayer (Plant, A. L., Langmuir, 1999, 15, 5128; Stelzle, M.; Weissmuller, G.; Sackman, E. J., Phys. Chem., 1993, 97, 2974; Song, X. D.; Swanson, B. I., Anal. Chem., 1999, 71, 2097; Parikh, A. N.; Beers, J. D.; Shreve, A. P.; Swanson, B. I., Langmuir, 1999, 15, 5369; Fischer, B.; Heyn, S. P.; Egger, M.; Gaub, H. E., Langmuir, 1993, 9, 136; Meuse, C. W.; Krueger, S.; Majkrzak, C. F.; Dura, J. A.; Fu, J.; Connor, J. T.; Plant, A. L., Biophys. J., 1998, 74, 1388). Both strategies increase the stability of the structure in water while maintaining some degree of lateral lipid mobility. However, the integrity of these structures is compromised by lipid loss upon exposure to harsher environments, such as organic solvents, surfactant solutions, or transfer across the water/air interface. A considerable body of work has shown that the stability and permeability of lipid bilayer vesicles (liposomes) can be significantly altered by polymerization of lipids containing reactive moieties (O'Brien, D. F.; Armitage, B.; Benedicto, A.; Bennett, D.; Lamparski, H. G.; Lee, Y. S.; Srisiri W.; Sisson, T. M., Acc. Chem. Res., 1998, 31, 861; Regen, S. L.; Singh, A.; Oehme, G.; Singh, M. J., Amer. Chem. Soc., 1982, 104; 791; Sisson, T. M.; Lamparski, H. G.; Kolchens, S.; Elyadi, A.; O'Brien, D. F., Macromolecules, 1996, 29, 8321). For example, unilamellar vesicles composed of bis-substituted lipids can be polymerized to form cross-linked vesicles that are insoluble in surfactant solutions and organic solvents (Sisson, T. M.; Lamparski, H. G.; Kolchens, S.; Elyadi, A.; O'Brien, D. F., Macromolecules, 1996, 29, 8321). Several groups have prepared polymerized, multilamellar supported lipid films composed of commonly used diacetylenic PC lipids which can be stabilized by UV photopolymerization (Hayward, J.; Chapman, D., Biomaterials, 1984, 5, 135; Chapman, D., Langmuir, 1993, 9, 39; 21). However, to be efficiently polymerized, these lipids must be in the solid analogous phase (L β ), which is incompatible with the self-assembly methods of the present invention and does not produce a high percentage of monomer to polymer conversion (Hayward, J.; Chapman, D., Biomaterials, 1984, 5, 135; Chapman, D., Langmuir, 1993, 9, 39; Albrecht, O.; Johnston, D. S.; Villayerde, C.; Chapman, D., Biochim. Biophys. Acta, 1982, 687, 165; Binder, H.; Anikin, A.; Kohlstrunk, B. J., Phys. Chem., 1999, 103, 450-460). At least two research groups have used the polymerization strategy to stabilize lipid mono- and bilayers on solid supports. Regen and coworkers adsorbed films of mono- and di-acrylate functionalized lipids on poly(ethylene), followed by UV-photo-polymerization to form a supported polymerized lipid film of near monolayer thickness (Regen, S. L.: Kirszensztejn, P.; Singh, A., Macromolecules, 1983, 16, 338; Foltynowicz, Z.; Yamaguchi, K.; Czajka, B,. Regen, S. L., Macromolecules, 1985, 18, 1394). Their water contact angle data were indicative of a surface more hydrophobic than expected for a uniform array of PC groups, suggesting incomplete coverage and/or significant film disorder. However, the analytical tools (e.g. atomic force microscopy) needed to characterize film morphology and uniformity were not available at that time. More recently, Chaikof and coworkers formed a hybrid bilayer by fusing vesicles (Marra, K. G.; Winger, T. M.; Hanson, S. R.; Chaikof, E. L., Macromolecules, 1997; 30, 6483; Orban, J. M.; Faucher, K. M.: Dluhy, R. A.; Chaikof, E. L., Macromolecules, 2000, 33, 4205) composed of mono-acrylate lipids onto a support coated with an alkylsilane monolayer; in situ polymerization produced linear polymers in the upper leaflet of this structure. Although enhanced stability during extended incubation in water was observed, significant lipid desorption occurred when the assembly was exposed to surfactant. |
<SOH> SUMMARY OF THE INVENTION <EOH>It is therefore an object of the present invention to provide a lipid membrane which is a monolayer, bilayer, or multilayer that is self-assembled and stabilized at a solid surface. It is another object of the present invention to provide a solid supported lipid film that is stable to transfer into air and exposure to surfactant solutions and organic solvents, yet retains the protein resistance characteristic of a fluid lipid bilayer. It is yet another object of the present invention to include non-polymerizable amphiphilic molecules into a stabilized lipid membrane. It is another object of the present invention to provide a stabilized lipid membrane that is an appropriate environment for reconstitution of a transmembrane protein and/or a water-soluble protein with retention of native protein structure and activity. This and other objects have been achieved by the present invention the first embodiment which includes a method for the self-assembly and stabilization of a lipid membrane at a solid surface, comprising: depositing a lipid monolayer or a lipid multilayer on a substrate, thereby obtaining a supported lipid monolayer or a supported lipid multilayer; in situ polymerizing said supported lipid monolayer or said supported lipid multilayer, thereby obtaining a polymerized membrane. |
Substituted 2-oxy-3,5-dicyano-4-aryl-6-aminopyridines and use thereof |
The use of compounds of formula (I) as medicaments, novel compounds of formula (I) and a method for production thereof are disclosed. Compounds of formula (I) are effective as adenosine receptor ligands. |
1. A compound of the formula (I) in which R1, R2 and R3 independently of one another represent (C1-C8)-alkyl which may be substituted up to three times, independently of one another, by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C2-C4)-alkenyl, (C2-C4)-alkynyl, halogen or (C6-C10)-aryloxy, (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, (C1-C8)-alkoxy which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C6)-cycloalkyl, (C2-C4)-alkenyl, (C6-C10)-aryl, 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, (C6-C10)-aryloxy, halogen, cyano, (C1-C4)-alkoxycarbonyl, amino or mono- or di-(C1-C4)-alkylamino, hydrogen, hydroxyl, halogen, nitro, cyano or —NH—C(O)—R7, in which R7 represents (C1-C8)-alkyl which may be substituted by hydroxyl or (C1-C4)-alkoxy, (C3-C7)-cycloalkyl or (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, or R1 and R2 are attached to adjacent phenyl ring atoms and, together with the two ring carbon atoms, form a 5- to 7-membered saturated or partially unsaturated heterocycle having one or two heteroatoms from the group consisting of N, O and/or S, which may be substituted by (C1-C4)-alkyl or oxo, R4 and R5 independently of one another represent hydrogen, (C1-C8)-alkyl which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C6-C10)-aryl or 5- to 6-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, or (C3-C8)-cycloalkyl which may be substituted by hydroxyl or (C1-C8)-alkyl, or R4 and R5 together with the nitrogen atom to which they are attached form a 5- to 7-membered saturated or partially unsaturated heterocycle which may contain one or two further heteroatoms from the group consisting of N, O and/or S in the ring and which may be mono- to trisubstituted, independently of one another, by oxo, fluorine, chlorine, hydroxyl, (C1-C6)-alkyl or (C1-C6)-alkoxy, and R6 represents (C3-C7)-cycloalkyl or (C1-C8)-alkyl, where alkyl may be substituted by (C3-C7)-cycloalkyl, hydroxyl, (C1-C4)-alkoxy, (C2-C4)-alkenyl, (C6-C10)-aryl or 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, where aryl and heteroaryl for their part may be substituted by halogen, (C1-C4)-alkyl, (C1-C4)-alkoxy, amino, mono- or di-(C1-C4)-alkylamino, nitro, cyano or hydroxyl, or a salt, a hydrate, a hydrate of a salt or a solvate thereof for the prophylaxis and/or treatment of disorders. 2. A compound of the formula (I) in which R1, R2 and R3 independently of one another represent (C1-C8)-alkyl which may be substituted up to three times, independently of one another, by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C2-C4)-alkenyl, (C2-C4)-alkynyl, halogen or (C6-C10)-aryloxy, (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, (C1-C8)-alkoxy which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C6)-cycloalkyl, (C2-C4)-alkenyl, (C6-C10)-aryl, 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, (C6-C10)-aryloxy, halogen, cyano, (C1-C4)-alkoxycarbonyl, amino or mono- or di-(C1-C4)-alkylamino, hydrogen, hydroxyl, halogen, nitro, cyano or —NH—C(O)—R7, in which R7 represents (C1-C8)-alkyl which may be substituted by hydroxyl or (C1-C4)-alkoxy, (C3-C7)-cycloalkyl or (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, or R1 and R2 are attached to adjacent phenyl ring atoms and, together with the two ring carbon atoms, form a 5- to 7-membered saturated or partially unsaturated heterocycle having one or two heteroatoms from the group consisting of N, O and/or S, which may be substituted by (C1-C4)-alkyl or oxo, R4 and R5 independently of one another represent hydrogen, (C1-C8)-alkyl which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C6-C10)-aryl or 5- to 6-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, or (C3-C8)-cycloalkyl which may be substituted by hydroxyl or (C1-C8)-alkyl, or R4 and R5 together with the nitrogen atom to which they are attached form a 5- to 7-membered saturated or partially unsaturated heterocycle which may contain one or two further heteroatoms from the group consisting of N, O and/or S in the ring and which may be mono- to trisubstituted, independently of one another, by oxo, fluorine, chlorine, hydroxyl, (C1-C6)-alkyl or (C1-C6)-alkoxy, and R6 represents (C3-C7)-cycloalkyl or (C1-C8)-alkyl, where alkyl may be substituted by (C3-C7)-cycloalkyl, hydroxyl, (C1-C4)-alkoxy, (C2-C4)-alkenyl, (C6-C10)-aryl or 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, where aryl and heteroaryl for their part may be substituted by halogen, (C1-C4)-alkyl, (C1-C4)-alkoxy, amino, mono- or di-(C1-C4)-alkylamino, nitro, cyano or hydroxyl, or a salt, a hydrate, a hydrate of a salt or a solvate thereof, but except for the following compounds of the formula (I) in which the radicals R1, R2, R3, R4, R5 and R6 are as defined below: R1=R2=R3=R4=R5=H; R6=ethyl R1=4-methyl; R2=R3=R4=R5=H; R6=ethyl R1=3-methyl; R2=R3=R4═R5=H; R6=ethyl R1=4-methoxy; R2=R3=R4=R5=H; R6=ethyl R1=4-methoxy; R2=3-methoxy; R3=5-methoxy; R4=R5=H; R6=ethyl R1=2-chlorine; R2=R3=R4=R5=H; R6=ethyl R1=4-chlorine; R2=R3=R4=R5=H; R6=ethyl R1=3-methyl; R2=R3=R4=R5=H; R6=ethyl R1=R2=R3=R4=R5=H; R6=methyl R1=R2=R3=R4=R5=H; R6=propyl R1=R2=R3=R4=R5=H; R6=isopropyl R1=2-hydroxy; R2=R3=R4=R5=H; R6=ethyl R1=4-fluorine; R2=R3=R4=R5=H; R6=methyl R1=4-methoxy; R2=R3=R4=R5=H; R6=methyl R1=R2=—O—CH2—O—; R3=R4=R5=H; R6=methyl. 3. A compound as claimed in claim 2 in which R1, R2 and R3 independently of one another represent hydrogen, hydroxyl, (C1-C6)-alkyl, trifluoromethyl, trifluoromethoxy, fluorine, chlorine, (C1-C4)-alkoxy, which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl or (C2-C4)-alkenyl, —NH—C(O)—CH3 or —NH—C(O)—C2H5, or R1 and R2 are attached to adjacent phenyl ring atoms and represent a group —O—CH2—O— or —O—CH2—CH2—O—, R4 and R5 independently of one another represent hydrogen, (C1-C6)-alkyl which may be substituted by hydroxyl, (C1-C4)-alkoxy or cyclopropyl, cyclopropyl, benzyl or pyridylmethyl, or R4 and R5 together with the nitrogen atom to which they are attached form a 5- to 7-membered saturated or partially unsaturated heterocycle which may contain a further heteroatom from the group consisting of N, O or S in the ring and which may be mono- to trisubstituted, independently of one another, by hydroxyl, (C1-C4)-alkyl or (C1-C4)-alkoxy, and R6 represents (C3-C7)-cycloalkyl or (C1-C6)-alkyl, which is substituted by (C3-C7)-cycloalkyl, hydroxyl, (C1-C4)-alkoxy, (C2-C4)-alkenyl, phenyl or 5- or 6-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, where phenyl and heteroaryl for their part may be substituted by fluorine, chlorine, (C1-C4)-alkyl, (C1-C4)-alkoxy, amino, mono- or di-(C1-C4)-alkylamino, nitro, cyano or hydroxyl, or unsubstituted (C4-C6)-alkyl or a salt, a hydrate, a hydrate of a salt or a solvate thereof. 4. A compound as claimed in claim 2, in which R1 and R2 independently of one another represent hydrogen, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy or —NH—C(O)—CH3, where the alkoxy radicals for their part may be substituted by hydroxyl, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy or cyclopropyl, or R1 and R2 are attached to adjacent phenyl ring atoms and represent a group —O—CH2—O—, R3 represents hydrogen, R4 represents hydrogen, methyl, ethyl, n-propyl, isopropyl, where the alkyl radicals for their part may be substituted by hydroxyl, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy or cyclopropyl, or cyclopropyl, R5 represents hydrogen or a methyl group, and R6 represents methyl or ethyl which are substituted by pyridyl, phenyl which for its part may be substituted by cyano, nitro, methyl, ethyl, propyl, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy or amino, hydroxyl or methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, or a salt, a hydrate, a hydrate of a salt or a solvate thereof. 5. A compound of the formula (I) in which R1, R2 and R3 independently of one another represent (C1-C8)-alkyl which may be substituted up to three times, independently of one another, by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C2-C4)-alkenyl, (C2-C4)-alkynyl, halogen or (C6-C10)-aryloxy, (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, (C1-C8)-alkoxy which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C6)-cycloalkyl, (C2-C4)-alkenyl, (C6-C10)-aryl, 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, (C6-C10)-aryloxy, halogen, cyano, (C1-C4)-alkoxycarbonyl, amino or mono- or di-(C1-C4)-alkylamino, hydrogen, hydroxyl, halogen, nitro, cyano or —NH—C(O)—R7, in which R7 represents (C1-C8)-alkyl which may be substituted by hydroxyl or (C1-C4)-alkoxy, (C3-C7)-cycloalkyl or (C6-C10)-aryl which may be substituted up to three times, independently of one another, by halogen, nitro, (C1-C4)-alkoxy, carboxyl, (C1-C4)-alkoxycarbonyl or mono- or di-(C1-C4)-alkylamino, or R1 and R2 are attached to adjacent phenyl ring atoms and, together with the two ring carbon atoms, form a 5- to 7-membered saturated or partially unsaturated heterocycle having one or two heteroatoms from the group consisting of N, O and/or S, which may be substituted by (C1-C4)-alkyl or oxo, R4 represents hydrogen, (C1-C8)-alkyl which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C6-C10)-aryl or 5- to 6-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, or (C3-C8)-cycloalkyl which may be substituted by hydroxyl or (C1-C8)-alkyl, and R5 represents (C1-C8)-alkyl which may be substituted by hydroxyl, (C1-C4)-alkoxy, (C3-C7)-cycloalkyl, (C6-C10)-aryl or 5- to 6-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, or (C3-C8)-cycloalkyl which may be substituted by hydroxyl or (C1-C8)-alkyl, or R4 and R5 together with the nitrogen atom to which they are attached form a 5- to 7-membered saturated or partially unsaturated heterocycle which may contain one or two further heteroatoms from the group consisting of N, O and/or S in the ring and which may be mono- to trisubstituted, independently of one another, by oxo, fluorine, chlorine, hydroxyl, (C1-C6)-alkyl or (C1-C6)-alkoxy, and R6 represents (C3-C7)-cycloalkyl or (C1-C8)-alkyl, where alkyl may be substituted by (C3-C7)-cycloalkyl, hydroxyl, (C1-C4)-alkoxy, (C2-C4)-alkenyl, (C6-C10)-aryl or 5- to 10-membered heteroaryl having up to three heteroatoms from the group consisting of N, O and/or S, where aryl and heteroaryl for their part may be substituted by halogen, (C1-C4)-alkyl, (C1-C4)-alkoxy, amino, mono- or di-(C1-C4)-alkylamino, nitro, cyano or hydroxyl, or a salt, a hydrate, a hydrate of a salt or a solvate thereof. 6. A process for preparing compounds of the formula (I) as defined in claim 2, characterized in that either [A] compounds of the formula (II) in which R1, R2, R3 and R6 are as defined in claim 2 and X represents a leaving group, are reacted with compounds of the formula (III) R4—NH—R5 (III) in which R4 and R5 are as defined in claim 2, or [B] compounds of the formula (IV) in which R1, R2 and R3 are as defined in claim 2 and X1 and X2 are identical or different and represent leaving groups, are initially converted with compounds of the formula (III) into compounds of the formula (V) in which R1, R2, R3, R4 and R5 are as defined in claim 2 and X2 represents a leaving group and these are then reacted with compounds of the formula (VI) R6—OH (VI) in which R6 is as defined in claim 2, or [C] if, in compounds of the formula (I), R4 and R5 each represent hydrogen, compounds of the formula (VII) in which R1, R2 and R3 are as defined in claim 2 are reacted in the presence of a base with malonitrile and compounds of the formula (VI). 7. A compound of the formula (I) as defined in claim 3 for the prophylaxis and/or treatment of disorders. 8. A compound of the formula (I) as defined in claim 4 for the prophylaxis and/or treatment of disorders. 9. A composition, comprising at least one compounds of the formula (I) as defined in claim 1 and at least one further auxiliary. 10. The use of compounds of the formula (I) as defined in claim 1 for preparing medicaments for the prophylaxis and/or treatment of disorders of the cardiovascular system (cardiovascular disorders). 11. The use of compounds of the formula (I) as defined in claim 1 for preparing medicaments for the prophylaxis and/or treatment of disorders of the urogenital system and cancer. 12. The use of compounds of the formula (I) as defined in claim 1 for preparing medicaments for the prophylaxis and/or treatment of inflammatory and neuroinflammatory disorders, neurodegenerative disorders and pain. 13. The use of compounds of the formula (I) as defined in claim 1 for preparing medicaments for the prophylaxis and/or treatment of disorders of the respiratory tract, of liver fibrosis and liver cirrosis and diabetes. |
Vaccine |
The present invention relates to an isolated polypeptide useful for immunisation against self-antigens. In particular the invention relates to a self-protein that is capable of raising auto-antibodies when administered in vivo. The invention particularly relates to rendering human cytokines immunogenic in humans. The invention further relates to pharmaceutical compositions comprising such compounds and their use in medicine and to methods for their production. |
1. An isolated protein which is at least 30% but less than 100% identical to a human protein wherein said isolated polypeptide (a) contains at least one mutation which is characteristic of an analogous non-human protein; (b) is capable of raising antibodies in a human, (c) is sufficiently structurally similar to the human protein that said antibodies bind to both the human protein and the isolated polypeptide and; wherein the isolated protein is not an antibody. 2. A protein having B-cell epitopes from a self-antigen of a first mammalian species and a mutation that gives rise to a sequence of an analogous protein of a second mammalian species such that the protein is able to raise in the first species from which the B-cell epitopes derived, an immune response that recognises the natural protein from which the B-cell epitopes are derived. 3. A protein having B-cell epitopes of a self-protein from a first mammalian species which are grafted, by substitution, into a frame work of an analogous protein from a second mammalian species such that the protein is able to raise in the species in which the B-cell epitopes are derived, an immune response that recognises the natural protein from which the B-cell epitopes are derived. 4. A protein as claimed in claim 3, wherin said mutation comprises a conserved surface region introduced into the non-surface exposed region, said mutation giving rise to a sequence of an analogous protein such that the protein is able to raise an immune response to the self protein in the species from which the self-protein is derived. 5. A protein as claimed in claim 2 wherein the immune response is a neutralising antibody response. 6. A protein as claimed in claim 2 wherein the human protein, or B-cell epitope is derived from a cytokine. 7. A cytokine as claimed in claim 6, which is a 4-helical cytokine. 8. A cytokine as claimed in claim 7 which is IL-4 or IL-13. 9. A mutated human—IL-13 having one or more of the following substitutions or a substitution involving a conservative substitution thereof: R → K at position 30 V → S at position 37 Y → F at position 63 A → V at position 65 E → D at position 68 E → Y at position 80 K → R at position 81 M → I at position 85 G → H at position 87 Q → H at position 113 V → I at position 115 D → K at position 117 10. A mutated human IL-13 as claimed in claim 9 having a plurality of substitutions as set forth in claim 9. 11. A mutated human IL-13 as claimed in claim 9 having one or more of the following sequences LKELIEELSN FCVALDSL AIYRTQRILHG KIEVAHFITKLL or a variant of said sequence comprising one or more conservative substitutions. 12. A mutated human IL-13 as shown in FIG. 9. 13. A polynucleotide encoding a protein of claim 2. 14. A polynucleotide of claim 13 which is a DNA and is operably linked to a promoter. 15. A vector comprising a polynucleotide of claim 13. 16. A host transformed with a polynucleotide of claim 13. 17. A pharmaceutical composition comprising the protein of claim 2 with a pharmaceutically acceptable carrier or excipient. 18. A pharmaceutical composition as claimed in claim 17 additionally comprising an adjuvant. 19. A pharmaceutical composition as claimed in claim 18 further comprising a protein as set forth in claim 2 and an immunostimulatory oligonucleotide. 20. A pharmaceutical composition as claimed in claim 19 wherein the immunostimulatory oligonucleotide is selected from the group: OLIGO 1: TCC ATG ACG TTC CTG ACG TT (CpG 1826) (SEQ ID NO:1) OLIGO 2: TCT CCC AGC GTG CGC CAT (CpG 1758 (SEQ ID NO:2) OLIGO 3: ACC GAT GAC GTC GCC GGT GAC GGC (SEQ ID NO:3) ACC ACG OLIGO 4: TCG TCG TTT TGT CGT TTT GTC GTT (SEQ ID NO:4) (CpG 2006) OLIGO 5: TCC ATG ACG TTC CTG ATG CT (CpG 1668) (SEQ ID NO:5) 21. A protein as claimed in claim 2 for use in medicine. 22. Use of a protein as claimed in claim 2 in the manufacture of a medicament for the treatment of IL-13 mediated diseases. 23. Use as claimed in claim 22 for the treatment of asthma. 24. A method for the treatment of prophylaxis of IL-13 mediated disease comprising the administration of a safe and effective amount of composition according to claim 17 to a patient in need thereof. 25. A method for the preparation of a protein according to claim 2 which method comprises: (a) identification of one or more regions of a self, typically human, protein against which an antibody response is desired, (b) identification of the amino-acid sequence of the self protein, and (c) identification of the amino-acid sequence of an analogous protein construction by recombinant DNA techniques of a chimaeric molecule containing at least one target region identified in step (a), whose amino-acid sequence is taken from the sequence identified in step (b), and sufficient amino-acids from the sequence(s) identified in step (c) to enable the resulting protein to fold into a shape similar to that of the self protein such that the mutated protein can raise an immune response that recognises the self protein. |
<SOH> BACKGROUND OF THE INVENTION <EOH>Asthma is a chronic lung disease, caused by inflammation of the lower airways and is characterised by recurrent breathing problems. Airways of patients are sensitive and swollen or inflamed to some degree all the time, even when there are no symptoms. Inflammation results in narrowing of the airways and reduces the flow of air in and out of the lungs, making breathing difficult and leading to wheezing, chest tightness and coughing. Asthma is triggered by super-sensitivity towards allergens (e.g. dust mites, pollens, moulds), irritants (e.g. smoke, fumes, strong odours), respiratory infections, exercise and dry weather. The triggers irritate the airways and the lining of the airways swell to become even more inflamed, mucus then clogs up the airways and the muscles around the airways tighten up until breathing becomes difficult and stressful and asthma symptoms appear. COPD is an umbrella term to describe diseases of the respiratory tract, which shows similar symptoms to asthma and is treated with the same drugs. COPD is characterised by a chronic, progressive and largely irreversible airflow obstruction. The contribution of the individual to the course of the disease is unknown, but smoking cigarettes is thought to cause 90% of the cases. Symptoms include coughing, chronic bronchitis, breathlessness and respiratory injections. Ultimately the disease will lead to severe disability and death. As a result of the various problems associated with the production, administration and tolerance of monoclonal antibodies there is an increased focus on methods of instructing the patient's own immune system to generate endogenous antibodies of the appropriate specificity by means of vaccination. However, mammals do not generally have high-titre antibodies against self-proteins present in serum, as the immune system contains homeostatic mechanisms to prevent their formation. The importance of these tolerance mechanisms is illustrated by diseases like myasthenia gravis, in which auto-antibodies directed to the nicotinic acetylcholine receptor of skeletal muscle cause weakness and fatigue (Drachman, 1994, N Engl J Med 330:1797-1810). There is therefore a need for a vaccine approach which is able to circumvent antibody tolerance mechanisms without inducing auto-antibody-mediated pathology. A number of techniques have been designed with the aim of breaking B cell tolerance without necessarily inducing unacceptable autoimmune toxicity. However, all have significant drawbacks. One technique involves chemically cross-linking either the self-protein (or peptides derived from it) to a highly immunogenic carrier protein, such as keyhole limpet haemocyanin (Antibodies: A laboratory manual” Harlow, E and Lane D. 1988. Cold Spring Harbor Press). This approach is a variant of the widely used hapten-carrier system for raising antibodies to poorly immunogenic targets, such as low-molecular weight chemical compounds. However, the process of chemical conjugation can destroy potentially valuable epitopes, and much of the evoked antibody response is directed at the carrier protein. Furthermore this approach is only applicable to protein vaccination, and is not compatible with nucleic acid immunogens. A variant on the carrier protein technique involves the construction of a gene encoding a fusion protein comprising both carrier protein (for example hepatitis B core protein) and self-protein (The core antigen of hepatitis B virus as a carrier for immunogenic peptides”, Biological Chemistry. 380(3):277-83, 1999). The fusion gene may be administered directly as part of a nucleic acid vaccine. Alternatively, it may be expressed in a suitable host cell in vitro, the gene product purified and then delivered as a conventional vaccine, with or without an adjuvant. However, fusing a large carrier protein to the self-protein can constrain or distort the self-protein's conformation, reducing its efficiency in evoking antibodies cross-reactive with the native molecule. Also, like the traditional cross-linked carrier systems, much of the antibody response is directed to the carrier part of the fusion. Anti-carrier responses may limit the effectiveness of subsequent booster administrations of vaccine or increase the chance of allergic or anaphylactic reactions. A more refined approach has been described by Dalum and colleagues wherein a single class II MHC-restricted epitope is inserted into the target molecule. They demonstrated the use of this method to induce antibodies to ubiquitin (Dalum et al, 1996, J Immunol 157:4796-4804; Dalum et al, 1997, Mol Immunol 34:1113-1120) and the cytokine TNF (Dalum et al, 1999, Nature Biotech 17:666-669). As a result, all T cell help must arise either from this single epitope or from junctional sequences. While this approach may work well in subjects possessing the appropriate MHC class II haplotype for which the vaccine was designed, or indeed those fortunate enough to have class II molecules capable of binding junctional epitopes, in any normal outbred population, such as those typical of humans, there will be a significant portion of the population for whom the vaccine will not work. Additionally, since the inserted epitope is typically from a quite unrelated protein, such as ovalbumin or lysozyme, it is likely that the additional sequence will to some degree interfere with the folding of the target protein, preventing the adoption of a fully native conformation of the target protein. In contrast to all of the above, the present invention provides a multiplicity of potential T cell epitopes, yet retains the target molecule in a conformation close to the native form. These properties allow the vaccines of the present invention to be effective immunogens in complex outbred populations, such as those composed of human patients. These properties are achieved by rendering a mutation in a self-protein to produce a sequence at that point which can be found in an analogous protein. A number of recent papers have defined a critical role for the Th2 cytokine IL-13 in driving pathology in the ovalbumin model of allergenic asthma (Wills-Karp et al, 1998; Grunig et al, 1998). In this work, mice previously sensitised to ovalbumin were injected with a soluble IL-13 receptor which binds and neutralises IL-13. Airway hyper-responsiveness to acetylcholine challenge was completely ablated in the treated group. Histological analysis revealed that treated mice had reversed the goblet-cell metaplasia seen in controls. In complementary experiments, lung IL-13 levels were raised by over-expression in a transgenic mouse or by installation of protein into the trachea in wild-type mice. In both settings, airway hyper-responsiveness, eosinophil invasion and increased mucus production were seen (Zhu et al, 1999). These data show that IL-13 activity is both necessary and sufficient to produce several of the major clinical and pathological features of allergic asthma in a well-validated model. A vaccine capable of directing a neutralising response to IL-13 would therefore constitute a useful therapeutic for the treatment of allergic asthma in humans. It would also have application in the treatment of certain helminth infection-related disorders (Brombacher, 2000) and diseases where IL-13 production is implicated in fibrosis (Chiaramonte et al, 1999), such as chronic obstructive pulmonary disease. The present invention addresses this need. The concepts and principles of the invention are thus set forth with respect to IL-13, but can be applied to any mammalian self-protein having an analogous protein in a second species. |
<SOH> SUMMARY OF THE INVENTION <EOH>The present invention provides an isolated polypeptide which is at least 30% but less than 100% identical to a human protein which polypeptide (a) contains at least one mutation which is characteristic of an analogous non human protein; and b) is capable of raising antibodies in humans and (c) is sufficiently structurally similar to the human protein that the antibodies bind to both the human protein and the polypeptide; and (d) wherein the polypeptide is not an antibody. Thus the invention provides in one embodiment; a protein having B cell epitopes from a mammalian self-antigen and a mutation that gives rise to a sequence of an analogous protein from a second mammalian species, such that the protein is able to raise in the species from which the B-cell epitopes are derived, an immune response that recognises the native protein from which the B-cell epitopes are derived. Preferably the sequence of the analogous protein is more than 5, more preferably greater than 8 contiguous amino acids. Thus the protein of the present invention contains a sequence that is identical to the analogous sequence for at least 5, preferably at least 8 consecutive amino acids. In an alternative embodiment a protein is provided having B cell epitopes of a self protein which are grafted by substitution, into a framework of an analogous protein from a second mammalian species such that the protein is able to raise in the species in which the B cell epitopes are derived an immune response that recognises the natural protein from which the B-cell epitopes are derived. It will be appreciated that the protein of the present invention are not an antibody. The immune response raised is preferably an antibody response, most preferably a neutralising antibody response. In general the mutation is introduced preferably into the non-surface exposed region of the molecule, such that surface exposed regions are conserved. Surface exposed regions are accessible to the immune-system and consequently often contain B-cell epitopes. Accordingly the present invention provides a protein comprising conserved surface exposed regions of a self protein, and a mutation introduced into the non-surface exposed region, said mutation giving rise to a sequence of an analogous protein such that the protein is able to raise an immune response to the self-protein arises in the species from which the self-protein is derived. The self protein is preferably a human protein, but can be a protein from any mammal in which it is desired to raise an auto immune response to. The immune response is preferably specific to the native protein and immunogen of the invention. That is having minimal cross-reactivity or neutralising capacity with respect to other self proteins. The self antigen is preferably a cytokine, more preferably a 4 helical cytokine, more preferably IL-4 or IL-13, most preferably IL-13. Thus in a preferred embodiment of the present invention there is provided a chimaeric protein comprising B cell epitopes from Human IL-13 presented in a murine IL-13 back bone. Such a construct is capable of raising a specific anti IL-13 antibody response in humans. Such a construct is shown in FIG. 9 (seq: ID No 21 and 22). Similarly an IL-4 construct comprising human IL-surface regions and murine framework is presented in FIG. 13 (Seq ID: No 25). The invention also provides: an expression vector which comprises a polynucleotide of the invention and which is capable of expressing a polypeptide of the invention; a host cell comprising an expression vector of the invention; a method of producing a polypeptide of the invention which method comprises maintaining a host cell of the invention under conditions suitable for obtaining expression of the polypeptide and isolating the said polypeptide: a vaccine composition comprising a polypeptide or polynucleotide of the invention and a pharmaceutically acceptable carrier. In another aspect, the invention provides a method for the design and preparation of a polypeptide according to the invention which method comprises: 1. identification of one or more regions of a self, typically human, protein against which an antibody response is desired. 2. identification of the amino-acid sequence of the self protein. 3. identification of the amino-acid sequence of an analogous protein construction by recombinant DNA techniques of a chimaeric molecule containing at least one target region identified in step 1, whose amino-acid sequence is taken from the sequence identified in step 2, and sufficient amino-acids from the sequence(s) identified in step 3 to enable the resulting protein to fold into a shape similar to that the self protein such that the mutated protein can raise an immune response that recognises the self protein. |
Sprue apparatus |
A sprue apparatus for use in a molding apparatus for connecting the melt duct of a molding machine nozzle with a runner system of a molding apparatus. The sprue apparatus includes a plurality of thermal regulators that regulate a plurality of thermal zones that segment the length of the sprue apparatus for the purpose of localized temperature control in support of a molding process. The plurality of zones may be thermally regulated such as to enable a substantially leak-free junction between the machine nozzle and the molding apparatus. The sprue apparatus may include an isolating coupler that substantially isolates a heated sprue bushing from carriage force. The invention has been found particularly useful when injecting metal alloys such as magnesium based alloys when in the thixotropic state. |
1) A sprue apparatus (51) configured to be received in a molding apparatus (26) for connecting a melt duct (89) of a molding machine nozzle (48) with a runner system of the molding apparatus (26), the sprue apparatus (51) comprising: a sprue bushing (52) that is configured to cooperate with an isolating coupler (53); the sprue bushing (52) comprising: a tubular body having a first and a second end; a nozzle connection interface (94) configured on an inner surface of the tubular body, at the first end thereof, for connecting with a complementary connection interface on the machine nozzle (48); an outer surface of the tubular body being configured to receive a plurality of thermal regulators; a first isolating coupler connection interface (72) configured on the outer surface of the tubular body, at the first end thereof, substantially adjacent the nozzle connection interface (94); a second isolating coupler connection interface (74) configured on the outer surface of the tubular body, at the second end thereof; and a melt duct (89) configured through the tubular body, on the inner surface thereof, from the first to the second end; and the isolating coupler (53) comprising: a tubular body having a first and a second end; a first sprue bushing connection interface (76) configured on an inner surface of the tubular body, at the first end thereof, for receiving the first isolating coupler connection interface (72) on the sprue bushing (52); a second sprue bushing connection interface (78) configured on an inner surface of the tubular body, in proximity to the second end thereof, for receiving the second isolating coupler connection interface (74) on the sprue bushing (52); a mold connection interface (93) configured at the second end of the tubular body for connecting with a complementary connection interface on the molding apparatus (26); the first isolating coupler connection interface (72) and the first sprue bushing connection interface (76) are configured to cooperate to substantially isolate the sprue bushing (52) from an applied carriage force from the machine nozzle (48). 2) The sprue apparatus (51) according to claim 1 wherein the nozzle connection interface (94) is configured as a cylindrical spigot interface. 3) The sprue apparatus (51) according to claim 2 wherein at least one of the plurality of zones is a thermally regulated sealing zone that maintains a temperature at the nozzle connection interface (94) below a liquidus temperature of a molding material that provides a substantially leak-free connection with the machine nozzle (48). 4) The sprue apparatus (51) according to claims 1 or 2 wherein the mold connection interface (93) is configured as a cylindrical spigot interface. 5) The sprue apparatus (51),according to claim 4 wherein at least one of the plurality of zones is a thermally regulated sealing zone that maintains a temperature at the mold connection interface (93) below a liquidus temperature of a molding material that provides a substantially leak-free connection with the molding apparatus (26). 6) The sprue apparatus (51) according to claim 4 wherein the isolating coupler (53) includes a melt duct extension configured along the inner surface of the tubular member at the second end thereof that interconnects the melt duct (89) of the sprue bushing (52) with the runner system of the molding apparatus (26). 7) The sprue apparatus (51) according to claim 6 wherein the connection between the second isolating coupler connection interface (74) of sprue bushing (52) and the second sprue bushing connection interface (78) of isolating coupler (53) is a spigot junction. 8) The sprue apparatus (51) according to claim 7 wherein at least one of the plurality of zones is a thermally regulated sealing zone that maintains a temperature at the mold connection interface (93) below a liquidus temperature of a molding material that provides a substantially leak-free connection with the molding apparatus (26). 9) The sprue apparatus (51) according to claim 7 wherein the isolating coupler (53) further comprises a front housing (54) connected with a cooling insert (56), the cooling insert (56) providing the function of a thermal regulator adjacent the nozzle connection interface (94). 10) The sprue apparatus (51) according to claim 9 wherein the cooling insert (56) includes a cooling channel (142) for circulating cooling fluid. 11) The sprue apparatus (51) according to claim 10 wherein the cooling insert (56) includes a thermocouple in mount (128) located adjacent an interface area between the cooling insert (56) and sprue bushing (52). 12) The sprue apparatus (51) according to claim 9 wherein the front housing (54) provides a thermal conduit for heat conduction between the cooled molding apparatus (26) and the second end of sprue bushing (52) within a second sealing zone, the thermal conduit providing the function of a thermal regulator adjacent the connection between the second isolating coupler connection interface (74) of sprue bushing (52) and the second sprue bushing connection interface (78) of isolating coupler (53). 13) The sprue apparatus (51) according to claim 12 wherein the front housing (54) includes an bore (90) that extends through the front housing (54) from a first end to a second end thereof and provides a pocket surrounding the sprue bushing along a substantial portion of its length. 14) The sprue apparatus (51) according to claim 13 wherein the bore (90) further includes a cylindrical surface in proximity to the second end of the front housing (54) that provides the second sprue bushing connection interface 78, and an outward taper immediate the second end that provides the melt duct extension (89). 15) The sprue apparatus (51) according to claim 14 wherein the front housing (54) includes an outer surface that is configured to provide the mold connection interface (93). 16) The sprue apparatus (51) according to claim 1 wherein the nozzle connection interface (94) is provided by an inner surface of a recessed cylindrical bore (87) at a first end of the sprue bushing (52). 17) The sprue apparatus (51) according to claim 16 wherein the first isolating coupler connecting interface (74) is provided by a surface on the outer diameter of a cylindrical flange (86) located at the first end of sprue bushing (52). 18) The sprue apparatus (51) according to claim 17 further including a heat choke (124) formed as a groove on an inside face of flange (86). 19) The sprue apparatus (51) according to claim 18 wherein melt duct (89) further includes an inwardly contracting tapered portion adjacent the bore (87), a stepped transition (170) between a main melt portion and an outwardly expanding tapered portion immediate the second end of the sprue bushing (52). 20) The sprue apparatus (51) according to claim 19 wherein sprue bushing (52) further includes an extended circular spigot ring portion (88) at its second end with an outer surface that provides the second isolating coupler connection interface (74.) 21) The sprue apparatus (51) according to claim 20 wherein sprue bushing (52) includes heaters (96a, 96b, 96c and 96d) located along the longitudinal axis of sprue bushing (52) and may be selectively controlled, the heaters providing the function of a thermal regulator for selective heating of at least one conditioning zone between sealing zones. 22) The sprue apparatus (51) according to claim 21 wherein the sprue bushing (52) further includes thermocouples in mounts (122a, 122b and 122c) located along its length for housing thermocouples that provide, in use, temperature feedback of the thermal conditions along the length of the sprue bushing (52) to at least one controller that controls thermal settings of the thermal regulators. 23) The sprue apparatus (51) according to claim 22 wherein the sprue bushing (52) includes a narrowed portion in proximity to its second end to enable rapid temperature changes in the molding material. 24) The sprue apparatus (51) according to claim 1 further including the isolating coupler. 25) A method of controlling the temperature along a sprue apparatus 51 in accordance with claim 1 that connects the melt duct of a machine nozzle (48) with the runner system of a molding apparatus (26), the method including the steps of: configuring a plurality of thermal zones (z1, Z2, Z3, Z4) that segment the sprue apparatus (51) along its length; the plurality of zones including a nozzle sealing zone (Z1) that encompasses a nozzle connection interface (94) and a melt duct portion (89a) at a first end of the sprue apparatus (51); configuring one or more thermal regulators (54, 56, 96) for regulating the temperature in the plurality of thermal zones; operating a controller for driving at least a subset of the thermal regulators, based upon temperature feedback from their respective thermal zones and a desired temperature setting; said controller driving said thermal regulator in said nozzle sealing zone (Z1) to maintain a temperature at the mold connection interface (94) below a liquidus temperature of a molding material that provides a substantially leak-free connection with a machine nozzle (48). 26) The method of controlling the temperature along a sprue apparatus (51) according to claim 25, further including the step of configuring at least one of the plurality of thermal zones as a conditioning zone (Z2 and Z3) located adjacent the nozzle sealing zone (Z1) wherein the molding material within the encompassed melt duct portion (89b and 89c) is maintained at any desired processing temperature. 27) The method of controlling the temperature along a sprue apparatus (51) according to claim 26, further including the step of configuring one of the plurality of thermal zones as a cycling zone (Z4) located at the second end of the sprue apparatus (51) for the controlled formation of a localized plug of solidified molding material in an encompassed melt duct portion (89d). 28) The method of controlling the temperature along a sprue apparatus (51) according to claim 27, wherein the sprue apparatus (51) comprises a sprue bushing (52) housed within 40 an isolating coupler (53) that itself includes a front housing (54) connected with a cooling insert (56), the cooling insert (56Y providing the function of a thermal regulator for selective cooling of the nozzle sealing zone (Z1). 29) The method of controlling the temperature along a sprue apparatus (51) according to claim 28, wherein sprue bushing (52) includes heaters (96a, 96b, 96c and 96d) located along the longitudinal axis of sprue bushing (52) and may be selectively controlled, the heaters providing the function of a thermal regulator for selective heating of the least one conditioning zone (Z2 and Z3). 30) The method of controlling the temperature along a sprue apparatus (51) according to claim 29, wherein the isolating coupler (53) provides a thermal conduit for heat conduction between the cooled molding apparatus (26) and the second end of sprue bushing (52) within a second sealing zone contained in the cycling zone (Z4), the thermal conduit providing the function of a thermal regulator. |
<SOH> BACKGROUND OF TEE INVENTION <EOH>Sprue bushings for molding apparatus are well known in the art. For example, the book entitled “Understanding Injection Molding Technology” by Herbert Rees, copyright 1994, ISBN 1-56990-130-9, describes Hot Sprues on page 61. Essentially, sprue bushings provide a connection between the machine nozzle and the runner system of a mold for injecting at least partially molten molding material into the cavity of a mold. The at least partially molten material, sometimes called the melt, travels from the machine nozzle into a duct located within the sprue bushing and into a cavity of a mold. A carriage force is typically directed longitudinally through the sprue bushing for sealing the connection between the machine nozzle and the sprue bushing during the molding process. Generally, there are two. categories of sprues, cold and hot. Cold sprues are not heated. Any arrested flow of molten material in a cold sprue will solidify within a portion of the duct in the sprue bushing. The solidified material must be removed from the sprue bushing before a subsequent injection cycle. The solidified material is wasteful and increases the cost of the part as a result of the scrap material. Hot sprues, generally, are electrically heated. The heat may be applied either internally or externally to the sprue. Generally, the hot sprue keeps the material molten within the duct of the sprue bushing through a single heat zone. U.S. Pat. No. 5,884,687 issued on Mar. 23, 1999 to Hotset teaches a hot sprue with a heated chamber for a die casting machine. A feed sleeve includes a central passage for receiving a melt of material. A heater providing a single heat zone surrounds the feed sleeve. One end of the feed sleeve engages a supply of liquid metal and a carriage force is directed through a portion of the sprue bushing. A plug of solid material forms near a gate and is pushed out during the molding process through the application of injection pressure. U.S. Pat. No. 6,095,789 issued on Aug. 1, 2000 to Polyshot Corporation teaches an adjustable hot sprue bushing. Resistive heaters are shown surrounding the body of the bushing. The number of turns of wire is increased at the distant ends of the bushing to provide more heat energy at the distant ends to compensate for the high heat transfer, or heating losses, at the distant ends. This is an attempt to provide a constant temperature along the entire length of the bushing in a single uniform thermal zone. PCT application WO 01/19552 to Hotflo Die Casting teaches a sprue tip insert in combination with a separate transition channel. The temperature along the entire length of the sprue appears to be controlled as a single uniform thermal zone. The material in the entire length of the sprue is at a temperature high enough to ensure flow. A separate mating die includes the transition channel downstream from the sprue. The transition channel is controlled independently of the sprue to freeze the material in the transition channel. U.S. Pat. No. 6,357,511 issued on Mar. 19, 2002 to the assignee of the present invention teaches a spigot junction that provides an improved connection interface between melt channel components of an injection molding machine, and in particular between a machine nozzle and an otherwise typical sprue bushing for thixotropic molding of a metallic material. The spigot junction includes an annular cylindrical portion of a first component received in a cylindrical bore of a second component. The fit of a spigot junction is characterized as having a close diametric fit between an outer surface of the annular cylindrical portion and a corresponding inner surface of the cylindrical bore, the close fit may include a small annular gap to support an initial melt seepage, and a longitudinal engagement of sufficient length to permit limited relative axial movement without a loss of sealing. The spigot junction provides a seal against melt leakage by virtue of the fit, that may be augmented by a seal of solidified molding material seepage that forms in the small gap. European patent publication 0 444 748 to Boekel et al., published on Sep. 4, 1991, describes a mold sprue bushing that includes a number of thermal control zones configured therealong. Japanese patent publication 2002-059456 to Atsuki et al. describes a machine nozzle for use with a metal molding system that includes a structure for controlling the formation of a cold plug therein. There are a number of problems with known sprue apparatus that result from poor thermal regulation along the length of the sprue bushing, with only a single thermal zone dedicated to maintaining the conditions of the molding material flowing through the sprue bushing. For example, with the single thermal control zone dedicated to the thermal regulation of molding material in support of the molding process, it is not possible to independently thermally regulate the junction between mating melt channel components; as is required with a spigot junction, to ensure a reliable seal against molding material leakage. The leakage of molding material is of particular concern when processing light-alloys, such as magnesium in a thixomolding process, due to the possibility of rapid and uncontrolled oxidation at elevated processing temperatures. Further, it would be desirable to provide localized temperature control along the length of the sprue apparatus to counter problems such as undesirable molding temperature variances, control sprue plug formation, or provide general processing flexibility. Another problem relates to the susceptibility of known sprue apparatus to permanent deformation due to longitudinally applied carriage force, required for the purpose of maintaining a seal between the machine nozzle and the sprue apparatus, especially when the sprue apparatus is weakened at the high operating temperatures required for thixomolding magnesium. In particular, the sprue apparatus, in use, is constrained along its length between the machine nozzle and the molding apparatus and is therefore compressed under the applied carriage force directed though the machine nozzle. The sprue apparatus is susceptible to permanent deformation from the compression due to its slender construction; the slender construction of the sprue apparatus provides a short heat conduction path, and therefore a fast thermal response, between heaters provided along the length of the sprue apparatus and the molding material within its melt duct. Yet another problem relates to undesirable process fluctuations that result from the formation and ejection of sprue plugs of inconsistent length, the variations in sprue plugs may be attributed to inadequate thermal regulation and melt channel configuration. |
<SOH> SUMMARY OF THE INVENTION <EOH>In a first aspect of the present invention there is provided a sprue apparatus that connects a melt duct of a molding machine nozzle with a runner system of a molding apparatus. The sprue apparatus is configured to be received in the molding apparatus and includes a nozzle connection interface at a first end configured to form a junction with a complementary connection interface on the machine nozzle, a melt duct that extends through the sprue apparatus from the first end to a second end, and a mold connection interface at the second end configured to form a junction with a complementary connection interface on the molding apparatus for connection of the melt duct with the mold runner system. The sprue apparatus further includes a plurality of thermal regulators, disposed along the sprue apparatus, that thermally regulate a plurality of thermal zones that segment the length of the sprue apparatus for the purpose of localized temperature control of molding material within encompassed melt duct portions. The sprue apparatus may be an assembly of components with a junction between mating components. Further, any junction may be thermally regulated such as to enable a substantially leak-free connection between the machine nozzle and the runner system of the molding apparatus. The connection interface of the sprue apparatus may be configured to complete a spigot junction as described in U.S. Pat. No. 6,357,511. In another aspect of the present invention there is provided a method of controlling the temperature along a sprue apparatus that connects the melt duct of a machine nozzle with the runner system of a molding apparatus, including the steps of: i) configuring a plurality of thermal zones that segment the sprue apparatus along its length; and ii) configuring one or more thermal regulators for regulating the temperature in at least a subset of the plurality of thermal zones; and iii) operating one or more controllers for driving at least a subset of the thermal regulators based upon temperature feedback from their respective thermal zones in accordance with a molding process. Preferably, the method of controlling the temperature along a sprue apparatus further includes the step of configuring one of the plurality of thermal zones as a nozzle sealing zone that encompasses a machine nozzle connection interface and a melt duct portion at a first end of the sprue apparatus, wherein the temperature at the nozzle connection interface is maintained below the melting point of the molding material while simultaneously maintaining the molding material within the melt duct portion at any desired processing temperature. The method may further include the step of configuring one of the plurality of thermal zones as a conditioning zone, located adjacent the nozzle sealing zone, wherein the molding material within an encompassed melt duct portion is maintained at any desired processing temperature. The method may further include the step of configuring one of the plurality of thermal zones as a cycling zone, located at the second end of the sprue apparatus, for the controlled formation of a localized plug of solidified molding material in an encompassed melt duct portion. An advantage of embodiments of the sprue apparatus of the present invention is the thermal regulation and control of a plurality of distinct thermal zones along a sprue apparatus for maintaining the molding material in the melt duct at a desired temperature and physical state to support a molding process. The plurality of thermal zones may also provide thermal regulation of spigot junctions for ensuring a reliable sealing connection between the machine nozzle and the molding apparatus. Another advantage of embodiments of the sprue apparatus of the present invention is a durable configuration, even at the high operating temperatures required for the thixotropic molding of magnesium. In particular, vulnerable components of the sprue apparatus may be substantially isolated from applied carriage force. Another advantage of embodiments of the sprue apparatus of the present invention is the provision of a cycling zone that controls the formation of a molding material plug used for flow control. The cycling zone is configured and controlled such that the size of the injected plug is of a consistent and minimal size and hence there is less process variation from shot to shot. The invention has been found particularly useful when molding with metal alloys such as with magnesium-based alloys in a thixotropic state in an injection molding system, although it will be understood that the concept is widely applicable in any molding system in which a molding material is plastecized or at least partially melted prior to delivery to a mold. |
Subsets and Splits